Proc. Natl. Acad. Sci.
USA
Vol. 89, pp. 8180-8184, September 1992
Biochemistry
Thermodynamics of Cro protein-DNA interactions
(enthalpy/entropy/heat capacity chang/calormtry/DNA sequence reco
YOSHINORI TAKEDA*, PHILIP D. Rosst, AND COURTNEY P. MUDDt
*Laboratory of Molecular Biology, National Cancer Institute-Frederick Cancer Research Facility, Program Resources Inc., Frederick, MD 21701; tLaboratory
of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases; and tBiomedical Engineering and Instnrmentation Program, National
Center for Research Resources, National Institutes of Health, Bethesda, MD 20892
Communicated by William A. Hagins, May 5, 1992 (received for review February 15, 1991)
ABSTRACT Using a highly sensitive pulsed-flow microcal-
orimeter, we have measured the changes In enthalpy and
determined the thermodynamic parameters AH, AS°, AG°,
and ACp for Cro protein-DNA asoation reactions. The reac-
tions studied include sequeno ific DNA asiation and
sequence-specific DNA asciations involving single- and multi-
ple-base alterations and/or single-amino acid alt i mu-
tants. (i) The a i of Cro protein with nonspecific DNA
at 150C is characterized by AH = +4.4 kcal-not' (1 cal =
4.18J), ASO = 49 cal'mol-l K'1, AGO = -9.7 kcalomd-l, and
ACp 0; the atin with specific high-affnity operator
OR3 DNA is characterized by AH = +0.8 kcalimol-1, ASO =
59 cal mol-l'K'1, AGO = -16.1 kcal mol-1, and AC, = -360
cal moll K-', respectively,. Both nonspecific and specific Cro-
DNA asoiations are entropy-driven. (ii) Plots of AH vs. ACp
and AS vs. ACp for the 20 sin reactions studied fag into
two correlation groups with linear slopes of +9.4 K and -20.5
K and of -0.03 and -0.14, respectively. These r n lines
have common intercepts, at the AH and ASO values of nonspe-
cific assocation (where ACp 0). The results suggest that there
= association and understand the forces stabilizing the com-
are, at least, two distinct conformational subclasses in specific
Cro-DNA complexes, stbized by different combinations of
enthalpic and entropic contributions. The AGO and AC, values
form an approximately single linear correlation group as a
consequence of compensatory contributions from AH and AS"
to AGO and to ACp. Cro protein-DNA asiatis share some
similar thermodynamic properties with protein folding, but
their overall energetics are quite different. Although the non-
specific complex is stabli predominantiy by electrostatic
forces, it appears that H bonds, van der Waals contacts,
hydrophobic effects, and charge interactions all contribute to the
stability (AGO and ACp) of the specific complex. (Mi) The
variations in the values of the thermodynamic parameters are in
general accord with our knowledge of the structLre of the
Cro-DNA complex.
Cro protein represents a prototype of DNA-binding proteins
with a helix-turn-helix structure as a specific DNA-
recognition motif (1-4). Recent determination of the three-
dimensional structure of a Cro protein-DNA complex (5)
shows that the pertinent helix-turn-helix. structure is, in fact,
used for DNA binding, as has been demonstrated for other
DNA-binding proteins, such as 434 repressor (6), 434 Cro (7),
A repressor (8), trp repressor (9), and CAP protein (10).
Analyses of these structures (1-12) suggest that the important
features in DNA-sequence recognition are a snug fit between
protein and DNA structures, resulting H bonds and van der
Waals contacts between amino acids and edges of DNA
bases, and phosphate interactions. To understand how pro-
tein recognizes specific DNA sequences, however, we must
understand the energetics of DNA binding along with the
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
8180
n)
structure because the specificity of DNA association is
ultimately determined by the free energy.
Takeda et al. (13) have reported the effects of systematic
base substitutions upon the free energy of Cro-DNA asso-
ciations. Examination of these data in relation to the struc-
ture of the Cro-DNA complex revealed that the locations of
the changes in the free energy of binding coincided with the
locations of the specific amino acid-nucleic acid base con-
tacts. This result suggested that the sequence recognition by
Cro repressor is mediated primarily by these direct amino
acid-base contacts-e.g., specific H bonds and van der
Waals contacts. However, when base substitution was
clearly breaking a H bond or van der Waals contact between
protein and DNA, the amount ofobserved free energy change
attributable to that perturbation was unclear because signif-
icant contributions to AG0 might come from other sources-
e.g., changes in phosphate interactions and local or global
hydrophobic effects.
Thus, to gain insight into the origins of AG' in Cro-DNA
plex, we have measured AH values and determined the
thermodynamic parameters, AG', AH, A S0, and ACp, for the
associations of Cro protein with nonspecific DNA, associa-
tions with specific operator DNA, and the associations
involving a variety of defined single-base and/or single-
amino acid alteration mutants. These studies suggest, al-
though it is not obvious from AG', at least two thermody-
namically distinct types of specific Cro-DNA associations:
one proceeding with a more favorable AH, and the other
proceeding with a less favorable AH than that accompanying
nonspecific-DNA association. We discuss the significance of
these findings in terms of protein-DNA recognition.
MATERIALS AND METHODS
DNAs and Proteins. All DNAs used were 21-base-pair (bp)
synthetic DNAs (13). Cro protein binds to 17-bp DNA,
located in the middle of the following sequences: OR3,
TTTATCCCTTGCGGTGATAAA; OR1, TTTACCTCTG-
GCGGTGATAAA; #4, TAAAACACCTCACGAGTTAAT;
#5, TAAATCACTCCCGGGTATATT; #10, TGGAAC-
CCACCGAGTGAAAGT; and #11, TCCGTCACCGC-
CAGTTAATCT. Operator DNAs OR3 and OR1 have the
highest- and the third-highest-affinity for Cro, respectively.
DNAs #4 and #5 are nonoperator DNA with intermediate
affinity. DNAs #10 and #11 are nonspecific DNA. Single-
base substitution mutant DNAs are all derivatives of OR3 and
are listed in Table 1 below. These DNAs were 70-100%6
active in DNA binding (the purification procedure will be
published elsewhere). Purified Cro protein was 100% active.
Measurement of Enthalpy Change. The pulsed-flow micro-
calorimeter described by Mudd and Berger (14) was used
with better than 1-pJ resolution. In each experiment, 80 pI of
Cro protein (7 x 10-10 mol) in 0.1 M KCl plus 0.01 M KPO4
buffer at pH 7 was mixed with an equal volume of the same
solution containing a 30%o molar excess of DNA. Twenty
such runs were averaged, and the thermal-mixing artifact was
 Biochemistry: Takeda et al. Proc. Natl. Acad. Sci. USA 89 (1992) 8181
Table 1. Thermodynamic parameters of Cro-DNA association + 1L
reactions at 15'C
Protein DNA -AG'5* AH15t A S1st -ACp,15§
0
CrogIn27
(wild type)
Exp. 1 #11 9.7 4400 49 10 0

Exp. 2 #10 9.8 4300 49 10 E -10 #11

Exp. 3 #5 13.0 2800 55 150
Exp. 4 #4 13.5 3000 57 210
Exp. 5 OR1 15.4 1200 58 330 -20
~1
Exp. 6 OR3 16.1 800 59 360 #5
Exp. 7 OR3.2AU 16.0 1200 60 350
Exp. 8 OR3.2TA 12.3 7900 70 150 -30 OR3
Exp. 9 OR3.2UA 10.3 5700 55 40
Exp. 10 OR3.2GC 10.5 4200 51 120
Exp. 11 OR3.2CG 10.2 4300 51 10 ltv
Exp. 12 OR3.4GC 13.1 3100 56 260 10 20 30
Exp. 13 OR3.4AT 12.2 5800 63 120 T (OC)
Exp. 14 OR3.SAU 14.5 2100 58 260
FIG. 1. AH values of Cro-DNA association reactions
Croval27 function of temperature. Solvent was 0.1 M KCl/0.01 M KPO4
Exp. 15 OR3 11.7 5700 60 130 buffer, pH 7. Nonspecific DNA #11; A, specific
n, nonoperator
Exp. 16 OR3.2AU 11.6 4700 57 60 #5;o, specific operator DNAOR3.
Exp. 17 OR3.2TA 14.0 8900 79 190
Exp. 18 OR3.2UA 12.2 7300 68 90
Exp. 19 OR3.2GC 10.3 5000 53 50 denaturation is completely reversible (Fig. 2). The Cro-0R3

Exp. 20 OR3.2CG 10.3 4900 53 0 DNA complex melts above 70TC (Fig. 2). Thus, if partially

denatured Cro is mixed with DNA, it would probably rena-

Solvent was 0.1 M KCI/0.01 M KPO4 buffer, pH 7. AH15 and ture exothermically to form a heat-stable Cro-DNA
A Cp,15 were determined from repeated measurements of AH (± 300 complex.

cal-1-mol-1) at two to four temperatures between 40 and 200C. AG'1s (ii) The amino acid substitution mutant of Cro protein,

was calculated by Eq. 1 from AGo (± 0.1 kcal mol-1) determined by Crova27, has 10TC greater thermo-stability than wild-type

the fiter-binding assay (13), which defines the standard-state con- Cro protein. The increasingly exothermicAH
°).A
ditions (superscript A Sl was obtained form AGl5 and AH15. The
operatorOR3 sequence is pseudo palindromic, to which the Cro
associations of Cro,.127 with DNAs are accordingly
changes in

shifted
the

to

dimer binds by fitting the 2-fold symmetry element of the protein o10TC higher temperatures (data not shown). Because

(refs. 1-5, 13). To study effects of essentially identical interactions impossible to account quantitatively for contributions to the

occurring at two 2-fold related positions simultaneously, all base- observed AH from partial unfolding, we use AH and ACp

substitution mutants carry two alterations at 2-fold related positions, determinations only in the region below 20TC to measure the

exceptOR3.5AU. Because the 17-bp operator sequence is located in intrinsic association reaction between Cro protein and DNA.

the middle of the 21-bp DNA used, base-pair positions are numbered Comparison of AG', AH, and TAS' for Nonspecific and
from the third base. Thus, mutantOR3.2TA,OR3.4AT, and Specific Association. AlthoughACp varies with temperature,
OR3.5AU, respectively, have the sequences TTTTTCCCTTGCG- below 20TC the temperature-dependent variation
GTGAAAAA, TTTATACCTTGCGGTTATAAA, and TTTATC- in ACp

CCTTGCGGUGATAAA (base alterations fromOR3 are under- very small (Fig. 1), and the thermodynamic parameters at

lined). Nomenclature and base alterations for the other DNAs follow temperature T(s20TC) can be expressed by
the samerule.
*Units for AG' are kcal mol-1. AHT AHO + A Cp(T-
=
)
tUnits for AH are cal mol-1.
*Units forAS° are cal mol-l K-1.
§Units for ACp are cal mol-l K-1.
AST = AS + ACpln(T/0)
subtracted. The enthalpies of dilution of both Cro and DNA AG; = AGO + ACp[(T 6) T ln(T/0)],
were zero within experimental error. The molar enthalpy
change, AH, of the Cro-DNA association was calculated on
the basis of added protein and had an estimated uncertainty 0.2
of ±300 cal mol-1. 0.0
0

RESULTS -.2 -

(0

Calorimetric Determination of Enthalpy and Heat Capacity

Changes. Fig. 1 shows measured A H values as a function of nn
n
0
I)
-.4-
temperature for the association of Cro protein with nonspe- -.6-
cific DNA #11, specific high-affinity operator DNAOR3, x
w
and specific nonoperator DNA #5 with an intermediate
60 80 100
affinity. Another set of DNAs of similar respective affinities *0 20 0

(13) gave nearly identical values of AH from 40C to37°C- T (CO)

i.e., #10 #11, #4 = #5, and OR1 OR3 (data not shown,
=

but all thermodynamic parameters at 15°C for these DNAs
are reported in Table 1). Several lines of evidence suggest
that the curvature and increasingly exothermicAH values
observed with all the DNAs above 250C (Fig. 1) arise pri-
marily from the renaturation of partially unfolded Cro pro-
tein. (i) Wild-type Cro protein starts melting at -250C, and its
FIG. 2. Thermal denaturation of Cro protein and the Cro-0R3
DNA complex monitored by differential scanning calorimetry. Top
and middle curves represent first and fourth heating, respectively, of
Cro protein (2.2 mg/mi in 0.1 M KCI/0.01 M KPO4 buffer, pH 7).
Bottom curve represents Cro-0R3 DNA complex at 10-fold lower
concentration. Data were obtained with a Microcal (Amherst, MA)
MC-2 calorimeter at a scan rate of 60 K/hr.
 ~+
8182 Biochemistry: Takeda et al. Proc. Nadl. Acad. Sci. USA 89 (1992)
where 0 denotes a reference temperature. The standard free 5' 3'
A
energy change, AG', is calculated from the equilibrium -9 G C *9
association constant Ka by AG0 = -RT In Ka. Ni 06 N4
With the AH and A Cp values of Fig. 1 and the Ka values of
1.4 x 107 M-1 and 1.0 x 1012 M-1 determined previously by -8 C - I- I- G +8
filter-binding assay at 00C for association of Cro with #11 and *
OR3 DNA (13), respectively, values of thermodynamic pa- -7 G-A-C *7
rameters at 50 intervals were calculated. These values were
used to illustrate the temperature-dependent changes in A G, N.2 fyH2Arg 38
AH, and TA 50 for the nonspecific and specific DNA asso- -6 G I I A- C +6
ciation (Fig. 3). For binding of Cro to nonspecific DNA #11 *
between 40C and 200C, AH +4 kcalmol-1 and ACp 0
cal-mol-lK-1. In contrast, AH for the specific Cro-0R3 -5 T Q j A 4 -A .5
DNA association decreases with increased temperature with -4 G rCH2 Lys 32
4NH3 c
ACp = -360 cal-mol'lK-1. AG0 is nearly temperature-
invariant in both cases. Both the nonspecific and specific
DNA associations are entropy-driven., C Lys 32
Effects of Single Base and/or Single Amino Acid Alteration -3 A AI+-I--6 T +3
Mutants on the Thermodynamic Parameters of Specific Asso- HO Ser 28 c Asn 31
ciations. Although these results provide a general picture of
the overall thermodynamic behavior of Cro-DNA associa- -2 T {3 I A I A +2
tions, the DNAs used contain too many base alterations for O NH Gin 27
detailed analysis. To gain insight into the energetics of
specific Cro-DNA association, we studied the effects of -I A - la la T 'I
Ni N6 04 ,
various single-base and/or single-amino acid alteration mu- Thr 17 -CH3
tants on AG0, AH, TAS0, and ACp. Mutant DNAs are all
derivatives of OR3 (Table 1). A mutant protein, Cro*,U7, is a FIG. 4. Illustration of the sequence-specific H bonds ( ) and van
product of a specificity mutant that changes base-recognition der Waals contacts (III) between amino acid side chains of Cro and
specificity (Y.T., unpublished work). These DNA and pro- functional groups exposed within the DNA major groove of the
tein mutants disrupt a few H bonds or a van der Waals contact consensus half-operator of OR3 (refs. 2, 3, 5, 13). I, H-bond
at specific locations in the binding region within the complex, acceptor; h, H-bond donor; o, thymine methyl group. Only one-half
thereby reducing binding affinity (see Fig. 4). Values of the site is presented because the other half-site interacts similarly.
thermodynamic parameters at 150C are reported in Table 1.
Examination of Table 1 reveals that AH, A S', and AG0 all AH1= 4600 + 9.4 K X ACp
correlate with ACp (Fig. 5). Plots of AH and AS0 vs. ACp
(Fig. 5 a and b) show that the 20 Cro-DNA associations AHII=4300-20.5 K X ACP
studied fall into two correlation groups: the associations of [2]
wild-type Cro with OR3, OR3.2AU, OR1, OR3.5AU, ASo= 49.4-0.03 x ACE
OR3.4GC, #4, #5, 0R3.2GC, and OR3.2CG make up one
group (group I), whereas the associations of Crovl27 with all ASO =49.0-0.14xACP,
the DNAs tested (OR3, OR3.2AU, 0R3.2TA, OR3.2UA,
OR3.2GC, and OR3.2CG) and the associations of wild-type where AH is expressed in callmol-, and A 50 and ACp are
Cro with OR3.2TA, OR3.2UA, and OR3.4AT make up expressed by cal mol-l-K-1, respectively. The lines intercept
another group (group II). The linear correlations between AH close to the values characteristic of the Cro-nonspecific
and A Cp (Fig. 5a) or between A S0 and ACp (Fig. Sb) for the DNA association; AH = +4.4 kcal-mol-1 and ASo = 49
two groups are given by: cal mol-l K-l, where ACp 0O. All AG' and ACp values form
a more or less single correlation group with a slope of 17.1 K
(Fig. 5c); this relationship is as follows:
+20 -20
AG0 = -9700 + 17.1 K x ACp, [3]
TAS
0 + 10l
TAS where AG0 is expressed by cal-moli1. This relationship exists
because the slopes of correlation in the AG0 - ACp plots are
very close, 17.6 K and 19.7 K for groups I and II, respec-
J9 AH tively, due to compensatory contributions from AH and A S5
0
AH
-o to AG0 and to ACp.
Pairwise comparisons show that the variations in the
U
10o
values of the thermodynamic parameters are in general
z _
wU AG accord with our knowledge of the structure of the Cro-DNA
complex (Table 1 and Fig. 4). For instance, (i) The removal
-20 AG _ of the methyl group of -2 T (2 AT (OR3) -*2 AU) has very
little effect on all thermodynamic parameters (Table 1, ex-
0 10 20 0 10 20 periments 6 and 7; experiments 15 and 16), being consistent
with the structural studies (2, 5), which suggest that this
T (OC) methyl group is not involved in any contact.
FIG. 3. Comparison of calculated AG', AH, and TA S0 between (ii) Substitution of 2 TA for 2 AT (OR3) (Table 1, exper-
associations of Cro with nonspecific DNA #11 (Left) and with iments 6 and 8) results in the changes: AAH = +7.1
specific operator DNA OR3 (Right). Thermodynamic parameters are kcal mol', -TAAS = -3.3 kcal mol-1, AAG' = +3.8
calculated from AG' and measured AH by Eq. 1. kcal mol-1, and AACp = +210 cal mol-l-K-1. Substitution of
 Biochemistry: Takeda et A Proc. Natl. Acad. Sci. USA 89 (1992) 8183
= +5.0 kcal mohl1 (TAA So0 0). Binding of Cro,.m7 to DNA
101 -a is improved when thymine is placed at the +2 position
because this change creates a van der Waals contact. This
8F association proceeds with an even more unfavorable en-
0 thalpy change, AAH = +3.2 kcal mol1, which is overcome
E by a large entropy change -TAAS' = -5.7 kcal-mol-1,
6 resulting in AAG0 = -2.3 kcal'mol-1 and AACp = -60
0
co cal mohl K-1 (experiments 15 and 17). The removal of this
Jv methyl group (experiments 17 and 18) reverses these effects,
%foI 4 weakening the interaction by AAG0 = +1.8 kcal mol1 with
A AAH = -1.6 kcal mol-1 and -TAAS5 = +3.3 kcal mol1.
2 (iv) Substitution of 4 GC for 4 CG (OR3) (experiments 6 and
12) breaks H bonds between -4 G and Lys-32, resulting in
AAH = +2.3 kcal-mol-1, -TAA S = +0.9 kcal-mol-1, AAG'
= +3.0 kcal mol-1, and AACp = +100 cal mol-lhK-1. The 4
AT substitution, while breaking H bonds, probably creates a
van der Waals contact between the thymine methyl and the
hydrophobic part of Lys-32, resulting in the changes of AAH
= +5.0 kcal molh, -TAA S = -1.1 kcal mol1, and AAG'
0
.-M = +3.9 kcal-mol-1.
(v) Removal of the single -5 thymine methyl group (ex-
0 periments 6 and 14) eliminates a van der Waals contact,
v which results in AAGO = +1.6 kcal-mol-1, AAH = +1.3
kcal mol1, and TAAS'0 0.
0
CD DISCUSSION
I
The results of Fig. 3 Left show that the nonspecific Cro-DNA
E association is entropy-driven. This result confirms previous
conclusions (15-22), drawn from measurements of the van't
c #11
Hoff AH, that many protein-DNA associations are entropy-
-10 2UA #1C driven. In protein-DNA association long-range electrostatic
V27-2GC0
0 2G forces bring protein and DNA into proximity, and charged
2GC V27-2CG groups of the protein displace cations and water molecules
0 V27
V27-2AU
from DNA. This process is accompanied by a large positive
-12 2TA *02-2UA entropy change (15-17, 21, 22). Analysis of the ionic-strength
4AT dependence of nonspecific Cro-DNA association (23) by an
* #4 electrostatic model (21, 22) suggests the release of about nine
0 4GC #5 univalent cations, and chemical protection studies (24) indi-
14p 0 cate 10 lysine residues interacting with DNA, 8 of them with
V27-2TA
I /5AU the phosphate backbone. Because of marked ionic strength
OR1
0 dependency, it has been postulated that nonspecific DNA
161 0R3 association is primarily electrostatic in nature (15-17, 21-27).
A This view is supported because we have found that the ratio
A S0/A G' = 0.005 for nonspecific Cro-DNA association at
-400 -300 -200 -100 0 150C is very close to the value of (d In D/dT) = 0.0046 (where
D is the dielectric constant of water) predicted for A S0/AG'
ACp (cal/mol deg) by the simple electrostatic theories of ion hydration (Born)
FIG. 5. Correlations between AHand ACp (a), between AS0 and
and Bjerrum's theory of ion association (28). The observed
A Cp 0 for the nonspecific association indicates very little
=
ACp (b), and between AG' and ACp (c) seen for Cro-DNA associ- perturbation of the enthalpic states of the system (29) and is
ation reactions. Data are from Table 1. Closed symbols denote
associations with wild-type Cro, and open symbols denote associa- consonant with a very "loose" complex held together by
tions with mutant Cro,.j27. long-range electrostatic forces.
The specific Cro-DNA complex is formed with the further
2 UA for 2 AT (OR3) (experiments 6 and 9) results in AAH displacement of water molecules from the protein-DNA
= +4.9 kcal moli1, -TAAS0 = +1.1 kcal mol-1, AAlG' = interface and the formation of the specific amino acid-nucleic
+5.8 kcal'mol-1, and AACp = +320 cal-molhlK-1. All of acid base contacts. This process is accompanied by further
these changes in the thermodynamic values are consistent positive changes in entropy and negative values of A Cp (Fig.
with the picture that the 2 TA substitution, while removing H 3 Right). The negative ACp indicates a narrowing of the
bonds between Gln-27 and + 2 adenine, creates van der Waals enthalpic states of the system (29). In common with many
contacts between the +2 thymine methyl group and Asn-31 ligand binding and association processes of proteins (29-32),
and/or Gln-27. Removal of this methyl group decreases the a part of the observed negative A Cp would be contributed by
stability by 2 kcal mol-1. Associations of Cro with OR3.2GC the "tightening" of the structure as a result of constraints in
and OR3.2CG are weak (experiments 10 and 11) because, like the motion of DNA and protein in the specific complex.
the Cro-0R3.2UA association, they lack the H bonds and Changes in A Cp are characteristic of hydrophobic effects
van der Waals contacts. (29-37). We asked whether the negative A Cp values seen for
(iii) The specificity mutant protein, CrovW27, cannot form H the specific Cro-DNA associations originate mainly from
bonds to the + 2 adenine and binds poorly to OR3. The hydrophobic effects. Before examining this hypothesis, we
reduction of A A G° = +4.4 kcal mol-' (experiments 6 and 15) recall a few key observations concerning ACp and hydro-
is due primarily to the more positive enthalpy change AAH phobic effects. For dissolution of a variety of hydrophobic
8184 Biochemistry: Takeda et al.
compounds in water, Sturtevant (30) observed that ACp
values are accompanied by commensurate AS' values, and
the ratio A S/ACp has a constant value of -0.26 at 250C.
More recently, Murphy et al. (35) showed that the ratio
A S0/ACp for denaturation of proteins has a similar constant
value. Then, Spolar et al. (36) showed that the ratio between
ACp and the change in water-accessible nonpolar surface area
(AAnp) is identical for the transfer of nonpolar solutes from
water to the pure liquid phase and for the folding of small
globular proteins. Our current results (Fig. Sb) show that the
thermodynamic behavior of Cro-DNA associations is some-
what similar to these well-studied cases in that the ratio
A S/A Cp is constant but quite different in that there are two
values of this ratio in Cro-DNA associations and that the
values are much smaller and more positive-i.e., -0.03 and
-0.14 at 150C (estimates at 250C are +0.02 and -0.08,
respectively). These results suggest that Cro protein-DNA
associations share some similar thermodynamic properties
with protein folding, but their overall energetics are quite
different. This conclusion is further supported by the fact
that, whereas AG0 correlates to ACp with a coefficient of 80
K in protein folding (36), AG' correlates to ACp with a
coefficient of 17 K in the specific Cro-DNA association (see
above and Fig. Sc). A likely reason for these differences is
that the protein-DNA interface is more polar and more
hydrated than the interior of a folded protein. By analogy
with hydrocarbon transfer and protein folding, Ha et al. (20)
recently proposed that protein-DNA associations are stabi-
lized by the large hydrophobic free energy. Thermodynamic
data on Cro-DNA associations do not support this proposal.
As described above, only limited similarity exists between
protein-DNA association and protein folding, and their over-
all energetics are quite different. In Cro-DNA association
ACp is tightly coupled with AG' of specific binding (see Fig.
Sc), and H bonds, van der Waals contacts, and hydrophobic
effects appear to all contribute directly to ACp, such that
breakage of any of these interactions markedly affects both
ACp and AG0 (see Results and Table 1).
The AH-ACp and A S°-ACp plots revealed two types of
thermodynamic behavior for the specific Cro-DNA associ-
ations that were not evident from the values of AG0 and A Cp
(Fig. 5). One group of association, which includes most
wild-type Cro associations, is characterized by more favor-
able AH and A S0 than for nonspecific DNA association. The
second group of association, which includes three wild-type
Cro associations and all CrowJ27 associations examined, is
characterized by less favorable AH than in the nonspecific
association that is offset by a positive A S°. Thus group I and
group II associations are stabilized by different enthalpic and
entropic contributions, and our results indicate that specific
complexes with given affinity can be created by two different
combinations ofHand S contributions. We suggest that these
thermodynamically distinct binding modes reflect two dis-
tinct conformational subclasses in the structures of specific
Cro-DNA complexes. It is noted that a single-base-pair or a
single-amino acid change can switch the thermodynamic
behavior from one group to the other. Takeda et al. (13)
reported that the AG0 values are mostly additive for specific
Cro-DNA association. Additivity of AG depends on unifor-
mity of conformation. In retrospect, the experiments that led
to this conclusion included only mutants that give rise to
group I associations and none that give rise to group II
associations. It will be interesting to test whether AG values
are additive or not when the mutations that give rise to group
I and II associations are combined. Comparison of the
three-dimensional structures of group I and II associations
will also be very interesting.
Proc. Nail. Acad. Sci. USA 89 (1992)
We are deeply indebted to Dr. Robert L. Berger for use of the
calorimeter (now available from Commonwealth Technology, Alex-
andria, VA). We thank Miss Nancy Seaton for technical assistance.
This research has been supported, at least in part, by the National
Cancer Institute, Department of Health and Human Services, under
Contract NO1-CO-74102 with Program Resources, Inc.
1. Anderson, W. F., Ohlendorf, D. H., Takeda, Y. & Matthews,
B. W. (1981) Nature (London) 290, 754-758.
2. Ohlendorf, D. H., Anderson, W. F., Fisher, R. G., Takeda, Y.
& Matthews, B. W. (1982) Nature (London) 298, 718-723.
3. Takeda, Y., Ohlendorf, D. H., Anderson, W. F. & Matthews,
B. W. (1983) Science 221, 1020-1026.
4. Brennan, R. G. & Matthews, B. W. (1989) J. Biol. Chem. 264,
1903-1906.
5. Brennan, R. G., Roderick, S. L., Takeda, Y. & Matthews,
B. W. (1990) Proc. Natl. Acad. Sci. USA 87, 8165-8169.
6. Aggarwal, A. K., Rodgers, D., Drottar, M., Ptashne, M. &
Harrison, S. C. (1988) Science 242, 899-907.
7. Mondragon, A. & Harrison, S. C. (1991) J. Mol. Biol. 219,
321-334.
8. Jordan, S. R. & Pabo, C. 0. (1988) Science 242, 893-899.
9. Otwinowski, R. W., Schevitz, R. W., Zhang, R.-G., Joach-
nk, A., Marmorstein, R. Q., Luisi, B. F. & Sigler, P. B.
(1988) Nature (London) 335, 321-329.
10. Steitz, T. A. (1990) Q. Rev. Biophys. 23, 205-280.
11. Pabo, C. 0. & Sauer, R. T. (1984) Annu. Rev. Biochem. 53,
293-321.
12. Harrison, S. C. & Aggarwal, A. K. (1990) Annu. Rev. Bio-
chem. 59, 933-969.
13. Takeda, Y., Sarai, A. & Rivera, V. M. (1989) Proc. Natl. Acad.
Sci. USA 86, 439-443.
14. Mudd, C. P. & Berger, R. L. (1988) J. Biochem. Biophys.
Methods 17, 171-192.
15. Riggs, A. D., Bourgeois, S. & Cohn, M. (1970) J. Mol. Biol. 53,
401-417.
16. Revzin, A. & von Hippel, P. H. (1977) Biochemistry 16, 4769-
4776.
17. deHaseth, P. L., Lohman, T. M. & Record, M. T., Jr. (1977)
Biochemistry 16, 4783-4790.
18. Whitson, P. A., Olson, J. S. & Matthews, K. S. (1986) Bio-
chemistry 25, 3852-3858.
19. Vershon, A. K., Liao, S.-M., McClure, W. R. & Sauer, R. T.
(1987) J. Mol. Biol. 195, 311-322.
20. Ha, J.-H., Spolar, R. S. & Record, M. T., Jr. (1989) J. Mol.
Biol. 209, 801-816.
21. Manning, G. S. (1978) Q. Rev. Biophys. 11, 179-246.
22. Record, M. T., Jr., Anderson, C. F. & Lohman, T. M. (1978)
Q. Rev. Biophys. 11, 103-178.
23. Boschelli, F. (1982) J. Mol. Biol. 162, 267-287.
24. Takeda, Y., Kim, J. G., Caday, C. G., Steers, E., Jr., Ohlen-
dorf, D. H., Anderson, W. F. & Matthews, B. W. (1986) J.
Biol. Chem. 261, 8608-8616.
25. Lin, S. Y. & Riggs, A. D. (1975) Cell 4, 107-111.
26. von Hippel, P. H. (1979) in Biological Regulation and Devel-
opment, ed. Goldberger, R. F. (Plenum, New York), pp. 279-
347.
27. Matthews, J. B. & Ohlendorf, D. H. (1985) J. Biol. Chem. 260,
5860-5862.
28. King, E. J. (1965) Acid-Base Equilibria (Macmillan, New
York), pp. 137-217.
29. Eftink, M. & Biltonen, R. L. (1980) in Biological Microcalo-
rimetry, ed. Beezer, A. E. (Academic, London), pp. 343-412.
30. Sturtevant, J. M. (1977) Proc. Natl. Acad. Sci. USA 74,
2236-2240.
31. Ross, P. D. & Subramanian, S. (1981) Biochemistry 20, 3096-
3102.
32. Hinz, H.-J. (1983) Annu. Rev. Biophys. Bioeng. 12, 285-317.
33. Edsall, J. T. (1935) J. Am. Chem. Soc. 57, 1506-1507.
34. Kauzmann, W. (1959) Adv. Protein Chem. 14, 1-63.
35. Murphy, K. P., Privalov, P. L. & Gill, S. J. (1990) Science 247,
559-561.
36. Spolar, R. S., Ha, J.-H. & Record, M. T., Jr. (1989) Proc. Natl.
Acad. Sci. USA 86, 8382-8385.
37. Privalov, P. L. & Gill, S. J. (1988) Adv. Protein Chem. 39,
191-234.