Welcome to Scribd. Sign in or start your free trial to enjoy unlimited e-books, audiobooks & documents.Find out more
Download
Standard view
Full view
of .
Look up keyword
Like this
1Activity
0 of .
Results for:
No results containing your search query
P. 1
Analysis of Sequence-Based COpy Number Variation Detection Tools for Cancer Studies

Analysis of Sequence-Based COpy Number Variation Detection Tools for Cancer Studies

Ratings:
(0)
|Views: 18|Likes:
Published by AMIA
2013 Summit on Translational Bioinformatics
2013 Summit on Translational Bioinformatics

More info:

Categories:Types, Research
Published by: AMIA on Apr 09, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/07/2013

pdf

text

original

 
1
Analysisofsequence-basedcopynumbervaria7ondetec7ontoolsforcancerstudies
SheidaNabaviZhengqiuCaiPeterJTonellato
LaboratoryforPersonalizedMedicineCenterForBiomedicalInforma7csHarvardMedicalSchool
WhyfocusonCNV?

CNVshavebeenassociatedwithvariousdiseasesincludingcancers.
 –
 
Amplifica7onofoncogenesandlossoftumorsuppressorgenes
CNVs(amplifica7onsanddele7onsofchromosomalsegments)aremajorstructuralvaria7ons.
amplifica7on
 
2
NGSisemergingasthebestplaormforCNVdetec7on
ArraybasedtechnologieshavebeenusedtostudyCNVsSequencebasedtechnologies(usingnextgenera7onsequencing(NGS))areemerging
AdvantagesDisadvantages
AordableNoisy,Hybridiza7onEstablishedLimitedresolu7onHighresolu7onarraysPredenedprobes
AdvantagesDisadvantages
Higherresolu7onandaccuracyCurrentlyexpensiveSingleplaormNostandardanalysisRapidcostreduc7onComputa7onallydemanding
Objec7vesofthiswork
 
Indicatetheperformancecharacteris7csoftherecentsequence-basedCNVdetec7ontoolstofacilitatetoolselec7on.
 
Iden7fystrengthsandweaknessesofcurrentCNVtools.
 –
 
Addresslimita7ons
 –
 
Iden7fymodifica7onstoimproveperformance
 –
 
Developnewmethod
 
3
Typicalpipelineforreaddepth-basedCNVdetec7on
Thenumberofreadsthataligntoaposi7oninagenomeispropor7onaltothecopynumberatthatposi7on
AlignmentNGSdataCNVlistCoun7ngreadsNormaliza7onCNVdetec7onSegmenta7onReferencegenomeShortreadCoun7ngwindow
@SRR03420.326591length=36ATTATTTTATGTTATTTATTTTGTATGTTTTTTTTT+88888888888888888888885888%888888/8)@SRR03420.326592length=36TCGGGAACGTCTCGACCGAAATTATTTTGTATGTCT+88888888888888888-18828888188"888
...
NGSdataReadcount
 
Normaliza7onreducesbiases
Soma7camplifica7onSoma7cdele7on
ControlAlignedshortreadsSample
MainsourcesofbiasesareGC-content,mapability,andsampleprepara7on

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->