Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Look up keyword
Like this
1Activity
0 of .
Results for:
No results containing your search query
P. 1
(Chapter 7) Construction and Use of a Bottom-Up HAC Vector for Transgene Expression

(Chapter 7) Construction and Use of a Bottom-Up HAC Vector for Transgene Expression

Ratings: (0)|Views: 36|Likes:
Published by Conscience Science
...
...

More info:

Published by: Conscience Science on Jul 26, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/09/2013

pdf

text

original

 
101
Gyula Hadlaczky (ed.),
Mammalian Chromosome Engineering: Methods and Protocols
, Methods in Molecular Biology, vol. 738,DOI 10.1007/978-1-61779-099-7_7, © Springer Science+Business Media, LLC 2011
Chapter 7
Construction and Use of a Bottom-Up HAC Vector for Transgene Expression
Masashi Ikeno and Nobutaka Suzuki
Abstract
Recent technological advances have enabled visualization o the organization and dynamics o localchromatin structures; however, the global mechanisms by which chromatin organization modulates generegulation are poorly understood. We designed and constructed a human articial chromosome (HAC) vector that allows regulation o transgene expression and delivery o a gene expression platorm intomany vertebrate cell lines. This technology or manipulating a transgene using a HAC vector could beused in applied biology.
Key words:
Alphoid DNA, BAC, HAC, MMCT, Cre/lox recombination, Transgene
 A human articial chromosome (HAC) is a mini-chromosomethat is constructed articially in human cells (1, 2). Using its ownsel-replicating and segregating systems, a HAC can behave as astable chromosome that is independent rom the chromosomeso host cells. HACs were constructed using a bottom-up strategy based on the transection o cloned or synthetic centromericalphoid DNA precursors with CENP-B boxes into a culturedhuman cell line, HT1080 (3–5). The HACs were built up tomegabase size (1–10 Mb) by multimerization o alphoid precur-sors. This “bottom-up construction” strategy involves the de novoconstruction o HACs by introducing DNA elements necessary or the maintenance o chromosome unction into cells. By con-trast, “top-down construction” reers to the truncation o naturalchromosomes into smaller sizes by using targeting vectors con-taining telomeric sequences (6, 7).
1. Introduction
 
102Ikeno and Suzuki
 We produced a HAC that carries a site-directed insertionsystem (HAC vector) (8). The expression o transgenes (cDNA or genomic DNA) integrated into chromosomes in cultured cellsand in transgenic mice is oten subject to position eects.However, transgenes can be inserted at a certain position in theHAC vector, and the transgene in the HAC can be expressed inmammalian cells in a promoter-dependent manner under thedesired stable control (8). This HAC vector provides severalpotential advantages over viral and integrating vectors or evaluat-ing gene expression, including long-term stability, low toxicity,and accommodation o a huge size o inducible DNA.Microcell-mediated chromosome transer (MMCT) has beenused to deliver large-sized chromosomal material (9). At present,HACs have been transerred successully into many vertebrate celllines by MMCT and are stably transerred during mitosis (8, 10).HACs can be transerred into mouse embryonic stem cells by MMCT or straightorward development o a transgenic mousecontaining exogenous genes (10). The establishment o a reliablemethod to create a transgenic animal will enable use o the HAC vector or gene therapy and regenerative medicine.1. HT1080 (ATCC: CCL-121): Dulbecco’s Modied Eagle’sMedium (DMEM) (Sigma) supplemented with 10% etalbovine serum (FBS).2. A9 (ATCC: CCL-1.4): DMEM (Sigma) supplemented with10% FBS.3. CHO-K1 (ATCC: CCL-61): Ham’s F-12 nutrient mixture(Sigma) supplemented with 10% FBS.4. HeLa (ATCC: CCL-2): DMEM (Sigma) supplemented with10% FBS.5. Indian Muntjac (ATCC: CCL-157): Ham’s F-10 nutrientmixture (Sigma) supplemented with 10% FBS.1. BAC vector: pBelo-BAC11 (New England BioLabs).2. Alphoid DNA: Human chromosome 21 alphoid DNA (GenBank D29750.1).3. Insulator (11–13): Human
b
-globin 5
¢
HS5 (3.4-kb
Eco 
RIragment; 4,818–8,173 in GenBank NG 000007) and 3
¢
-HS1 (5.6-kb
Sph 
I
–Sac 
I ragment; 8,255–13,891 in GenBank  AC104389) cloned rom the YAC clone A201F4.3.4. CAG promoter: The sequence derived rom pCAGGS (14).
2. Materials
2.1. Cell Lines and Culture 2.2. Precursors of the HAC Vector 
 
103Construction and Use of a Bottom-Up HAC Vector for Transgene Expression
5. Lox71 sequence (14): 5
¢
TACCGTTCGTATAGCATACATTA TACGAAGTTAT3
¢
.6. Neo: The coding sequence derived rom pSV-neo.7. QIAGEN Large Construct Kit (QIAGEN).1. Puro: The coding sequence derived rom pGK-puro.2. Lox66 sequence (14): 5
¢
 ATAACTTCGTATAGCATACATTATACGAACGGTA3
¢
.3. Cre expression plasmid: CAG-Cre (14).1. Lipoectamine™ 2000 (Invitrogen).2. FuGENE
®
HD (Roche).3. G418 (Sigma).4. Puromycin dihydrochloride (Sigma).1. Quick and easy BAC modication kit (Gene Bridges).2. The target sequences or homologous recombination set inposition (6,915–7,114) and position (51–2,509) in Belo-BAC11.1. PEG (1:1.4) (5 g autoclaved PEG1000, 1 ml DMSO, and6 ml serum-ree DMEM).2. PEG (1:3) (3 g autoclaved PEG1000, and 9 ml serum-reeDMEM).3. 6-Thioguanine (Sigma-Aldrich).4. Ouabain octahydrate (Sigma-Aldrich).5. Colcemid (1 mg/ml).6. Cytochalasin B (Sigma-Aldrich) (10 mg/ml in DMSO).7. Percoll (GE Healthcare).8. 50% PEG1500 (Roche).9. HAT Media Supplement (50×) Hybri-Max™ (Sigma-Aldrich).1. 11-4 alphoid DNA (15).2. Digoxigenin-11-dUTP (Roche).3. Anti-digoxigenin rhodamine Fab ragment (Roche).4. Biotin-16-dUTP (Roche).5. Alexa Fluor
®
488-conjugated streptavidin (Invitrogen).1. Primer or CAG promoter: 5
¢
CTCTGCTAACCATGTTC ATG3
¢
.2. Primer or Puro: 5
¢
CTTGTACTCGGTCATGGTAAGC3
¢
.
2.3. Cre–Lox Recombination 2.4. DNA Transfection 2.5. Red-ET Recombination 2.6. Cell Fusion and Microcell-Mediated Chromosome Transfer 2.7. Fluorescence In Situ Hybridization 2.8. PCR 

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->