United States Patent USOOT3SIS78B2 «2 (00) Patent Nox US 7,351,578 B2 Cheo et al. is) Date of Patent: Apr. 1, 2008 (51) USE OF MULTIPLE RECOMBINATION 111995 sich a SITES WITH UNIQUE SPECTEICITY IN A "oto He RECOMBINATIONAL CLONING 4 Tisor ‘eeech Saas © bioor Sommer (75) Invemors: David Chev, Kensington, MD (US) Seite & S97 Auech Michiel. Branch, Gaither MD SeaS3e1 © Glory ta (US) Gary Temple, Washington Seat 871997 Baum Grove, MD (US) James Ts Hae, Seco? Ploy Haman t a Fra, MD (US) Devon Rs Ne Seskine A RIT Wale Byrd, Frodetsbors, VA US) Sestiss A Plow? Pan S677 A 81907 Oller a (73) Asians: Invrogen Corp Cara CA (US) Serio & olor Devin ot . SOTI77 A 01997 Wake a (+) Note: Subjectoany dcainertetemofthis Sioa A son eine patel exter afjned une 35 Songs A S1S88 Olena USC. 154(b) by 792 days. S728SS1 A —-/1998_Devine et al. oye SIRNA V1998 Avtnch (22) ted: Am 14, 2008 (Cconinaed) © ror Publication Data FOREIGN PATENT DOCUMENTS Us 20080225729 AI Now 18,2008 ca aisle 21984 Related US. Applicaton Data (63) Coniason-i-pr of application No, 08752914 (Consawes) filed on Dee. 11, 2000. OTHER PUBLICATIONS. (60) Provisional plication No, 60402920, fed 0808. hyn, K. aly “Ratsaphage PI Cre? Sipe 14, 2002, provisional pplication No. 6188,020, pacman Sipe DA fooomaac Avo th fk on Mar, 2000, provisional aplication No Gre teaion Pin Bi Chom 1991296 ern Gar, De 10,199. Sty or whey 2 esa oy 386) ‘Abu Ae a Howe, Ry “ascopage PY Stospe (st) tect ‘ccmbaoa fusion ni rape th Cre Recben C29 1658 (200601) Frc Bot chen psisisia, Anca Solo (2) Us. 435/201; 43816 Bishi an Mole Bilas C988) (58) Fil of Clasiiation Search None vam al. Stile nthe Pps of Pt Se Seis Se application fie fr camplete Sach siory Sis Caan 3) 0) References Cited U.S. PATENT DOCUMENTS. 4626505 121986 Falen Ae7N6I0 A GIDST Bockman 6S195 A T19R7. Mali ta os202 8 T1987 Mull A}BS45 A SIB86_ Backman & 808537 21989. Stroman e SS5S231 KIDS. Stoman eal 4990217 & 91990 Sander ea 4980317 A 91900 Sauer A 101990. Malls et. A 31992 Gay 797 A 41002 Tucker et al 51891062 A 101902 Kaapp otal Som28s A 7/1993 Blatter 5258201 A * 11/1993 Boyle et a ABS9141 5286652 A 21904 Jones SBB378 A 81904 Nabi et SB3457S A 81994 Noonan ta A 911904 ‘A 101904 A Los A T1995 A wi995 ‘A 911995. Mali eta (Continved) Primary Bvaminer—lames Keto (74) Attorney, Agent, or Firm-—Peter G. Feiles on ABSTRACT ‘The present invention provides compositions and methods {for recombinational cloning. The compositions include vec- tors having multiple recombination sites with unique spe ficity. The methods permit the simultancous cloning of two ‘oF more diferent nvceie acid molecules. In some embed rents the molecules are fised together while in other ‘embodiments the molecules ae inserted into distinct sites in ‘vector. The invention uso generally provides for linking or jining through recombination 4 number of molecules and ‘orcomponads (eg, chemical eompounds, drugs, proteins oF peptides lipids, nucleic ack, carbohydrates, ete.) which nay be the same or different, Such molecules andlor com= pounds or combinations of such molecules andlor com- pounds can also be bound through recombination to various Structures or supports according to the invention. 18 Claims, 78 Drawing SheetsUS 7,351,578 B2 Page 2 U.S. PATENT DOCUMENTS, 20020098582 AL 72002 Golda aon200106707 AL $2002 Miles ea. 8738743 A 311998. Johnson etl. Jonioltosd AL S200 Chios ata $744305 A 41908 Fedor eal 20020162125 Al 102002 Bench eta S744396 A 1998 Hoes 20020172997 AL Hanley ca 566801. 61998 Shuman aon2018731 AL Seta S776 A 71998 Baum eal aon20100819 At Haney eta SROLO}O A 9/1908. Mevey ea. amn20igrsat At 12 Mine-Golomb SALAS A 911998 Palsson matzo TAL a S807822 A 9/1998 Brown et a Sonsmoz337 AL Brome tal SSIL2%4 A 911998 Palson Sorapnsae8 AL Saco eral SR14300 A 911998 Soot a a anns0siss2 AL arly etal SRMD7OT A 11/1908 Bushman aonsiostsss AL ome ca S837242 A 11/1998 Holliger eta Sonsmmer68 AL Rawk SRYAS6 A 11/1998 Mins ea aonsi0soe0 AL farmer SRALT72 A 121998 Devine eta. 200s 0064s18 AL Hartley ta 5851808 A 121998 Elledge el onson6s799 AL ane ea SRSK6S7 A 1/1099 Winter eta Sonsoorraot AL Byala SR7L9O7 A 21999 Winer et a aoosvor7s27 Al Cite 587429 A 21999 Seytas 2o030100110 1 Maney eta Sss8732 4 31999 Hany eta aoiso12asss AL Brasch ea S916804 A 1909 Bushman 20030135888 AL Zh ta Spi96%6 A 71999 Grabam ot Sonssa0ss AL Mie oa SO28914 A 7/1999 Tebouh ta aoosios76e2 Al Gerd 529307 A 71999. Hodges eal. am0sosT7i6 Al any eta $962.255 & 101999 Grits eal peso wee S817 A 11/1999. Demian eal 20030175070 AL arly tal 3599.835 A 11/1999 Duna et Jonsorreeet AL Byala Soa9872 A 11/1999 Luo ea 2n0sL86259 AL Chesnut ea 6010864 A "1/2000. Grits wt a aera aes 040.138 A 32000 Lockhart a Sonsuzio809 At Bele eal fian.s% A $2000 Sew Soranaieoe AL ea 063627 A S2000. Mo¥ey ta 2004004005) AL Noma ea. (6066778 A 3:2000 Ginsburg a amnamnsssi2 Al Mantes eta S.90576 A 62000. Zambos et aonainoss207 AL any eta 6.11046 A 82000, Shalon eal SaaorTitse AL Haley etal 61143.557 1/2000, Haley tl 204171157 At Haney ta ATLL BL 12001. Hanley el aman2iesis At Beat ea 228101 BL $2001. Savake et a. eetern yal aoe 6258536 BI 72001 lnc a aona0229229 At Ghco eta 261.7% BL 72001 Ping ta so0a02s3ea1 AL fay ca 66262341 BI 72001. ‘Basecyosi et a. soaunssee) AL Ca. 6265546 BI 72001 Cohen eta esos f a eal 627969 BI $2001 ‘Haney wa 6271436 BI 82001. Pichia a POREIGN PATENT DOCUMENTS. 6277608 BI 82001 629118 BL 92001, ee O60 st 1taes 6303301 Bi 102001 ep 020009 4987 6309802 BI 102001 B® 0300822 Tipe 6608 BI 1/2001. Reynosa P oarors Sige 6322973 BL 112001 Bosian etal. iP Osi2456 S94 33.155 BI 122001 Lockhart a iP 0x8 20% 9/2000 6346419 BI 22002 Fodor et a rR 26002 G92 6361972 BI 32002 Harington ea Wo WOSOIITS 101950 6365377 BI 42002 Paten eat WO WOsTODT —“HIB8L 61810266 BI 62002 Harnglon ea WO WOSLOST T1981 6410317 Bi 62002 Famer WO WOsTI6R7 191951 66436707 BI_82002 Zambrowice eta wo wos210877 —6i892 6481536 BI 92002 Fodor a a, Wo Wos2S64 1992 6476209 BI 112002 Glen ea Wo Wo922071 1992 6506.89 BI 12003 Fie et WO WOs222650 IB I982 6544790 BI 42003 Sabai WO WooMisit ——-R1993, 65730" B2 62003 Graham Wo Wosy0172 91893, 576404 B2 62003 Fodor ea Wo Wosemas 1904 6576.78? BI 62003, Manohran «a WO Woston1a7 i954 Sit0as2 BI $2003 Favor a WO WOSHITITE R994 (6.652878 B2 11/2003 Webb eal. WO WOSUIKKS R994 {670.29 B2 122003 Webb etal. WO WOd420604 91904 6720.40 BI 42004 Hanley ett WO WODSODSSS. Lions 2on2ioo06664 AL 1/2002 Sahat WO Wo 360493 20020007051 AL 1/2002 Choo ca wo Woseinw7 20020068290 AL 62002 Yarovinsky WO WOser008 20020084574 AL 7/2002. Haley eta Wo Wo 960722US 7,351,578 B2 Page 3 wo Woss4uT2 121996 Wo Wosr6.s “21907 Wo woormmas 41997 Wo WosTas4 = 71997 WO WosTauEL 9897 Wo Woossto0ss 31098 WO WO9est0s6 111998 WO WORST LT 1998 WO WosoIss “31999 Wo Woo21s7” 51999 Wo WooasKst S199 Wo Wossr19 7199 WO Wo9949029 91999 WO Wooossssl 11 1999 WO WOsmssKK LT 1999 Wo Woonnes? "32000 Wo WO 0029000 52000 wo Woon 72000 Wo Woon4903s 2000 Wo Wo00s2027 9 2000 WO Wooosrist 912000 WO Woon 10-2000 wo Woone397 10.2000 Wo WoOoUuses “12001 Wo WooUu7sT2 22001 WO WOOL TOE 22001 Wo WooU20o1s 32001 Wo Woorrss 42001 Wo WOOIsI0 — S001 Wo WOOL 6 2001 Wo WoOoUe2 $2001 Wo woovesss = 92001 Wo Woods — 12002 Wo Woods 12002 wo WooroK — 12002 Wo Woortesad —— 22002 Wo WoordaaT $2002 WO WooreIT? §——_—6 2002 WO WoODdsioH $2002 wo wo0D9657 $2002 wo woudoTrst 102002 wo wouDdKI4 10-2002 Wo WoODds0s5 11-2002 WO Woosorsi6L — 32003 Wo Woosonn07 52003 WO — Woos0ss600 10.2003 Wo woos 122003 Wo woosooTe: 12004 Wo wo 2008013290 2.2004 (OTHER PUBLICATIONS Abremeki,K. and Gottesman, S “Purification of the Baseroph- gg hls Gene Product Required for Fxeisive Resombizatio.” J ‘Biol. Chem. 25796589662, American Society for Biochemisiy ‘and Molecuiar Biology (1982) ‘Alans, DI, etal, "Crea Recombination in Escherichia col (Cals MechanitieDileences rom the in iro Retstion,” ‘Biol, 226661-673,Acaenic Press (1992), ‘Akagi Ket a, “Cremediated somatic st-specfc recombination in nia” Nuc. dei Res 25:1 766-1773, Oxford University Prat (ay 1997) Aladjm, MI. etal, “Posive Selection of FLP-Mited Unequal Sister Chaomsid Fuchange Products in Mansnalian Calls” Mol Call. Biol 178ST-NB1, American Socisty for Microbiology (Fb, oon, Aller 1 ot a, *Sitespeii Integration of DNA into wildsype tua man fx sites pace inthe plant genome,” Pant J. 7:689- 1659 Blackwell Scien Lt. (1995) Andis, BL. tal, "The FLP Recombinase ofthe 2 Ciscle DNA, ‘of Yeast Ineraction with ls Taypl Sequences.” Cell 40798-8053, Call Press (1985), Andis, BJ, eal, “Ifriction ofthe FLP Resombinns ofthe Saccharomyces ceréisiae 2 jum Pasi with Mud Target Sequences” MoL Cell, Biol. 624822489, American Soxity or Microbiology (1986) Angsan, 1M. tal, “entiation of diverse nerve growth ‘ctr relatod genes by sori analysis of zen expresion (SAGE) polling” Pree, Natl. ead. So. USE 971612410020, Nail ‘cudemy of Sciences (Sep, 2000). Angrand, P.O, et al. “Inducible expression based on regulted recombination’ a single vestortategy for stale expression in aed ells" Nucl ids Res. 2632683269, Oxford University Press Gal. 1998). Anton. Mand Ghar, FI. "Ste Spesific Recombination Met ated by at Adenovins Vector Expressing the Cre Revombinase Protein a Molecular Switch for Contol of Gene Expression” rt 64600-1606, American Society’ for Micrbilogy’ (1995) Araki Ht a, “Sitespeiie Recombinas,R, Encoded by Yest Plaid SR,” J Mot Pll, 25:25-37, Academic Press Inc, New York, N¥ (1902) Asumian, 1H, a, “Sitespciie recombination between lone KP and a8 ses from the Haemophitur nluaca baclenophe [HPL propagate in recombinaton deficient Escherichia col” J Bacteriol, ITLATA7A1780, American Sosiey for Microbiology (1089 Aung, eal, “A versatile msthod for integration of genes ant gene Hsions into the } tachment ste of Escherichia col." Gene TOT 1-17, Elsevier Science (1991). ‘Ausubel, FM. et al, "Maps of Plasmids pBRS2 and pUC19" in Short Proiocolsin Molecar Biology, Tind Edin, tha Wiley Son, Ine, Boston, MA, pp. 112-11 (1995), Ayes EK, et al, “Preise Deletions in Large Bacterial Gnomes by Vecorsmoited Excision (VEX) The 0/1 Gane of Promiscuous ‘Plasmid RK2 is Essential for Replication in Several Grarnopative Host” J Mol Biol 290-17185, Academic Press (1993). Babineau, D. et al, “The FLP Protein of the 2-nicron Plasmid of Yeu”. Bish Cem. 260:12.%12391, American Sooty for Bioehemisy and Molecalar Biology Inc (1988). Backman, Ket al, “Use of Synchronous Site-Specific Recombi- tation In Vivo to" Regulate Gone’ Expresio,” BioTeobnolog 21048-1049 (1988), Thu, Co al, “SKPY Conneuts Call Cycle Regulatory to the Ubiquitin Proteolysis Machinery through a Novel Mot, the F-Bon” Col 86:263-274, Call Press (1996), Balakishaan, Reta, "A gene ease fr alaping Escherichia call tains as hosts for afloat rearnageneat aad, fexpresion vectors” Gone 138101104, Fbeier Science (at 1959), Ball, C.A. and Johnson, R.C, “Eien Excision of Phage trom the Fschevichia coli Chromosome Regutes the Fis Poti,” Bacteriol 17%: 4027-400, American Society for Microbiology (a 1991). ‘Bames, Gand Rine, J. “Replat expression of endonuclease cot in Saccharompces cereisae. Nuclear oty and bislogicl omsaquence,” Pre Natl. Acad, So, USA 82: 13841358, Nain ‘cae’ of Sciences (1985). Baier, CE, otal, “Extent of Soquence Homology Reguite. for ‘Bateiophage Lamba Site-spocfc Recombination” J. Mo. Bil 181-187-197, Acad Prost lnc. (1985). Bayley, CC. etal, "Exchange of gene activity in transgenic plants ‘aay by the Crear site spite recombination system.” Plant ‘Mot Biol, 18:383-361, Dodsecht Kluwer Aca (1992). ‘Beard, P and Coutuies M. "Cell Killing bythe F plasmid Cedb ‘roein involves Poisoning of DNAtopoisomerase I Complexes” Mol Bol. 226:735-745, Academic Pres Ins (1992), ‘Bemand,P, “Positive Slestion of Recombinant DNA. ty Cod.” Biofecinigues 21320323, Eaton Publishing Company (199). ‘Berard Petal, “The F Plasmid Ce Protein Indices cient ATPalependent DNA Cleavage by Gymse.” J Mol, Biol, 24534 S41, Academic Press, Ine. (1993) ‘Benard, Pet a. "Positive selection of vectors using the F plasmid ‘al iller gene" Gane 148: 714, Elsevier Science (1999) Bthie, B ani Sauer B. "Sepmvatal genomic replacement by Crema combination: genotoxic ser activation of the pSUS 7,351,578 B2 Page 4 promoter in single-copy transformants” Nucl Acids Res. 25:2828- BS, Oxford University Pros (1997). eu. UAK. otal, "Bypass of lthaly with mosic mice ener ‘aed by Crelo?-medited recombination” Curr Biol. 6 1307 16, Curent Biology Lid. (Ost, 1990), ‘Bhandari, P, and Gowrishaka "An Erherchia col host stain useful Tor efien!overproducion of cloaed gone products Wi [NaCl asthe inden”. Bacteriol 17944038806, Amerison Soc ‘ey for Mirobiology Gul 197) Black, LW "In vito packaging info phage particles and peste recinclarization of phage lanisks DNAs." Gone 4697-101 Elsevier Science (1986, Bloch, CA. etal, “Purifation of Escherichia coli Chromosomal Segments without Cloning” Biochem. Blopiys. Res. Comm. 225:104-1, Academie Pros, Ine. (1996). Bochner BIL, etal. "Posie Selostion for Loss of Tetacyline Resistance J. Bacteriol. 43926933, American Society for Microbitogy (1980) Bosart, Moe al" Very Stomg Enhancers Located Upstream ‘of an Immediate Easly Gene of Human Cytomezalovis” Cell 1521-530, MIT 1985), Bouhasia FF eal, “Tansriptional Behavior of LCR Enhancer laments Integiaed atthe Same Chromosomal Locus by Recombinse-Mdiated Caste Exchange,” Blood 9033823344, The American Society of Hematology (Nov: 1997) Boyd, AC. "Turbo cloning a fas ficient metho for cloning PCR polite and. other Buntendod DNA fragments into lami.” Nut, Acids Res. 2U:817-821, Oxford University Press 11999), Brent, R. an Puashne, M.A fecterial ropresorprotcin oa yeast transcriptional terminator can block upstveam actation of Yeast pene Nature $12: 612-615, NeenillanTourals Lid (1983) Broach, JR, ea, "Recombination withing the Yess Plasmid 2 Circle fs St-Speife,” Coll 2227-234, Cal Pres (1982), Bruckner, RC, and Cas, MM. “The Hisioneie H Prtcin of| Escherichia clita somal rosin "Nac tds Res, L73145- S161 (1959). Brunel JP, and Pall, M.,"Lambda’Plsmni Vector Contution by. In Vivo. eedox Mediated. Recombination.” BioTechniques 11061-1064, Eton Publishing Company (lun. 194). Brunel, 1P and Pall, MIL. "A Soe of Yeast Escherichia coll Expression Vectors Designed for Dietional Cloning of DNAsand ‘relorMedited Phsinit Excision.” Teost 21309-1318, John Wiley 1993), Bubock, P. ea, “Rapid cloning by homologous recombination in vivo Nuch Acids Res. 2E3601-362, Oxford University Press 1999), Buchholz, Fc aA simple asay to determine the functionality of Cre of FLP recombisation tages in genomic manipulation onset” Nuch civ Res. 263118311, Oxford University Press (1956), achhol, Fetal, “Dillrentthermostablties of FLP and Cre recombinase: implications for applied. site-specific recombing- Mion” Nucl lds Res. 2442864262, Oxford Univesity Press 11996), shan, W, etal, “Cootiol of Ditstionaty in Lamba Site Specific Recombination” Science 230906:911, Amesican Assoc: tion fr the Advancement of Science (1985) Barioni, Re a, “Am improved phge dip veto for antibody repertoze cloning by consction of combinatorial libraries.” Res. Trot. 148 161-164, Elsevier (1997, Campbell, A.M. “Chromosomal Insertion Sites for Phages and Plasmids” J. Bacterol 174:7498-1499, American Society For Micrbioogy (1992) (Capone, LP, et al. “atoduction of UAG, UAA, and UGA Nom tense Mutations at a. Specie Site in the Escherichia col CChlorampbenicol Acesltansferase Gene: Use in Measurement of Amb, Ochre, and Opal Suppression ir Mammalian Cell,” Wot Call Bol. 63059-3067, American Society for Microbiology 380), ‘Chanock, RM, etal, “Human Monoclonal Aaibody Fab Fra rents Cloned from Combinatorial Libraries: Potential Useless in Prevention andor Treatment of Major Human Vital Diseases.” Inject. gon Dis 2118-131, Raven Pres (1993) (Chaps, Se al, “Difronial expression of aeratively spliced forms of MAD a repertoire of sacral diferent mcrotaale: binding domning”” Hockem. 342289-2301, American Chemie Society (1995) ‘Casteyjoe, PK and Coren, 1S, “Isolating lage nesta deletions in bacteria and PI artifical chromosomes by in vivo Pl packaging of products of Cr-catayzed recombination between the endogeneus fn atansposel ow?” Nucl. eds Res. 2522052212, Oxford University Press (1097) CChorepanos, PP, and Wackerngel, W, “Gene divption in EErohrchia coli Te™ and Km esettes wth the option of Fp ‘atalyzed excision of the antbioteesistance determinant.” Gene 1389-14, Elsevier Science (195). Chong, S. etal “Singl-columm parifetion of fee recombinaat proteins wing» selfclevable ant ag derived tom a protein Splicing clement." Gene 192 271-281, Hlsevier Science BY. (1997), CChoulka, A. et al, “Transfer of single pone-contining long terminal repeats inthe genome of mamma cells by aero ‘Sector canying the ere gene andthe loxP ste” J. Viol. 701792- 98, Amerian Society For Microbiology (1996), Chuang. C-F, etal, "Spovfc and heritable genetic incerforence by shubleseranded RNA in Arabidopsis thaliana,” Proc. Nal. cad. ‘Sei USA 97-4985990, Notional Academy of Sciences ofthe USA, (Cpr 2000), (Cgan, AM, ct, “Mutational Analysis ofthe JS¢ Translational Initiator Region ia Saccharomyces cerevisiae,” Mol Cell. Biol :2968.2975. American Society fr Microbiology (1988). CLONTECH, "Creator™ Gene Cloning & Expression System.” (CLONTECHniques 157-11, CLONTECH (Ape. 2000), CLONTECH, ""New Addons to the Creator™ Poem,” CLONTECHniques 16° pages, CLONTECH (an. 2001) CLONTECH, “New Creator Compatible Expression Stems” (CLOWTECHIniques 15.2 poges, CLONTECH (Oct. 2000), CLONTECH, "Creatr™ Accepior Vector Constuction Kits" CLONTECHniques 16:2 popes, CLONTECH (Oxt. 2001 CLONTECH, “Crestor Sant Library Contraction Ki” CLONTECHniques 16-2 popes, CLONTECH, (Ot. 2001, (CLONTECH, “Creator The Universal Plafonm for Analysis of ‘Gove Function” Powerpoiat Presestation, pp. 1-2, CLONTECH, (dst 24, 2001), aiahle a hp seewclonech com products amills creator popups sipagl hin CLONTECH, “Creaor™ pDNR-Dral Cloning Ki CLONTECHniques 16° pages, CLONTECH, (Ost. 2001, Collis, CM, and Hall, RM, “Expression of Antibiot Resistance (Gener in the Iterated Carter of integrons,” Aric gots Ghemother 321556162, American Socity For Microbislogy (4998), ‘Cormack, B., “Directed Mutagensis Using the Polymerase Chain Reaction in Carrot Protocole Molecular Bolas, Supplement 37, Ausubel FM etal, els John Wiley & Sons, Inc, Boston, MA, pp. 85.1-8.510 1997), Cormack, B. "Mutagenesis by the Polymerase Chain Reston. in Garsnt Protocole Molecular Biology, wl. 1, Sopplement 15, Ausbel, FM etal, eds, John Wiley & Sons, Inc, Boston, MA, Pp 851-859 (199). (Cox, MM. “The FLP protein ofthe yeast 2- yn plasmid Expres sion of» stare genetic recombination sytem in Encherihia al” Proc Natl ead. So USAND4225-4227, National Aendemy of Sciences (1983) Craig, NL and Nash, HA. “The Mechanism of Phage 2 Site Specie Recombination: Sko-Spocific Breakage of DNA by Int “Topoisomerase” Cel 35:798805, Cell Press (1983) Cuivio, MJ. and Garfinkel, DS. “Singlestep selection for TW element ettiransposition,” Poe Nau Aral Se. USA 8936-940, National Acidemy of Sciences (1991) Dale, EC, and Ow, D.W,“Ina- ant intenmoeslarsite-spesific recombination in plant ‘ecls-mediatat by baccriophage. PL ‘ecombings,” Gone 91.79°88, HsovarSsience (1990) Dale, EC. and Ow, DW, “Gene transfer with subsequent removal ofthe selection gen fiom the host genome," Proe. Na ead. Sl {USA 81085810862, National Academy of Sciences (1991),US 7,351,578 B2 Page S Dale, .C, and Ow, D.W., Mutations inthe Cre Recombination Site Enhance the Sabi of Recombination Products: Applications {or Gene Taping in Plats" Cell. Biochem, (Sup. F206 bro No. VIO, Wiley-Liss, Inc. (192) Dang. DT, and Peron, N. “Use of a Yeast Site-Spesific Recombinaie to Generate Esbeyonie Mosaics i Drosopie," Des Genet 1.367.975, Wiley-Liss (1992) Datsoa, NA. ct al, "MictoSAGE: a modified procedure for sil aaalyss of gene expression in Lmital amounts of tssue.” Nucl ‘Heide Res. 71300-1307, Oxford University Pres (Mar 1989) Davies J and Reichman, 1. “An Anibedy VH Domain with a lox-Cre Sie Integrated Ino ts Coding Region: Bacterial Reson ination within a Single Polypeptide Chain,” FEBS Les. 37792- 96, Eavier Scenes (1999) Davis, CR, et al, “Analysis of the Mechanisms of Action ofthe Saccharomyces cervisige Dominant Lethal ede 2°" and Dori rant Negative cde42""""* Mutations" J Biol. Chem. 278 849.838, The American Society for Buochemisty and Molecular Biology 1998) Dest, ‘ol appication plasmid constions.” Elsevier Science (1998), Deng. M-D, and Coleman, 1, “Ethanol Syathesis by Genetic Engineering in Cynnobactria” App. Eivon. Mlrobil 65:523- 528, American Society for Microbiology (Feb. 1999), Derbyshire, Vand Belfon. M. “Lighting stkes twice: Inon- intin coincidence” Proc. Nat Acad. Sei USH 95135641357, National Academy of Sciences ofthe USA (1998) Devin, SE and Boeke, 1D. “Elicia! intepation of atid lransposons ito plasmid agg in Vito: ubetultol for DNA rapping. sequeneing and gencic analysis” Niel. Aids Res 22:3768-3772, Oxford University Pres (Sep, 1998), Diodorich, Lt al, "Now Cloning Vectors for Ineptation into the I Atachinent Sie’ aid’ of the Escherichia coll Chomoson,” Plavmid 2814-24, Aendmic Press (1992). Diikema, Re ab, “Cloning and Expression of the Chromosomal Immune Inrferon Gene of the Rit” EMBO J.-4:761-767, IRL Press Limited (1985), Dymecki,SM.“A molar stof Fp, FRTand lacZ fusion vectors for manipulating genes by sitespacile recombination” Gene 7197-20, Esesee Northttolland in. 199), ledge, SJ) a, “YES: A muliinctional CDNA expression ‘vector fr the soliton of genes by complementation of yeast and ‘Excherihia coll mutations Pro. Nat. dead. So USA°881731~ 1338, National Academy of Siences (1991) Engst, LW, and Weisberg, R.A “The Ret Plague Test: A Rapid Method! for Mentifcation of Excision Defective. Varian of Bacteriophage Lambda,” Vology 72 147-183, Academic Pres, Ine. (1915). Esposito, Det al “The integrase family of tyrosine reconbinsses: ‘exoltion of & onsen ative site domain.” Nucl teke Res 35:3605-3614, Oxford University Pres (1997) Feil, Reta, “Regulation of Cre Revombinase Activity by Mutated Esuopen Receptor Lisand-Biadiag Damas.” Biochem. Blops ‘ex. Comm 287°752-95, Academic Pres (1997) Feinbaum, R. ~“Wetors Derived fom Plasmids” in Caron Pro- tocol in Moleular Biolog). Ausubel, FM, als John Wiley ‘© Sons, Ine, Boson, MA, pp. E1S.1-15.17 (1908) Ferguson, J, al. “Consnuction and characterization of thee yeast-Eschrichie cl stl vectors designed fr rp subcloning OF yeast genes on small DNA fragments” Gone 16191197, Elsevier Seence (1981, Firing. S. calAnin-oursuatepy using gnc targeting and FLP recombinase for dhe function dsoction of complex DNA tepi- Islory elements: Analysis of the Pralabin locus contol sepia” Proc. Natl Acod. So. USK 9OSA69847, National Academy of Sciences (1993), Fluowiz, M. eal, "Purication of the Escherichia coll integra tion hot fictor (HE in one chaonatopeaphic sep” Gone 147149. 150, Elsevier Science (Sep. 1994), , “In vivo intermolecular recombination in Escherichia Gene 7045-50, Flanagan, PM. and Feanald, M.A, “Analysis of Inibtors of the Sitespeciie Recombination Reaction Mited by” TN3 Resolvase” J. Mot lol 206298-304, Academic Pets Linited (198), Flores, A. etal, "A protinpotein interaction map of yeast RNA, polymere" Prt Nah. Acad Se, USA 96:7815-7820, National Reaemy of Seienes ul 199). Francia, MY. et al, “Gene lntepaton in the Escherichia colt Chromosome Media by Ta2? Iotegrase(l2)." J. Bacterial 178 894-898, Amrican Society For Microbiology (Feb. 1996). Fraacia, MLV. et al. “The Int Inegron Proerentally Binds Single-Suandcd DNA of the auC Site" J. Bacio. ISL68H. (6849, American Society for Microbiology (19%). Fukushige. 8, and Saves, B, “Genomic tagsting witha posiive- selection far integration vector allows highly reproducible gene espresion in mammalian cally” Proc, Natl stead. Sel USA '59 7008-7000, National Academy of Sciences (1992). Gage, PA, eal, “A Call-ree Recotnbinaton System for Sit Specie Ineration of Mltgenic Shale lass nto Herpes Simplex Type | Genome". ro 66°S809-5815, Arian S00 fy fr Mcrbiology (1993), Gateway™ Cloning Techoology. Version 1- GIBCO BRL, Life ‘Technologies Inston Manual, pp. 1-60 (Nov. 1999), available at hap: rowwlifetech com gateway. Gay, Petal, “Positive Selection Procadue for Entrapment of Inston Sequence Hlements in. GramNegative aetna” Bacteriol. 164918921, American Society for Microbiology (1985) (Gay, P, tal, “Cloning Stuctral Gono se, which Codey or Exoencime Lovansirace of Bacillus Subai: Expression of the Gene in Exchorichia coll” J. Bacteria. LSB 1424-1431, American Society for Microbiology (983) Geofoy, Fy otal, "A new phage display system to const ‘mlticombinatoril libraries of very large antibody repeties,” Gone 151-109-113, Eevee Science Dee. 1998), Giasgowm AC. eal, "DNAcbinding Properties of the Hin Recombinse?” Bol Chem, 2641007210082, American Sovity {or Biochemisty and Molecular Biology (1989). oie, KG, and Lindquist, S, “The FLP Recombimse of Yeast Caine Site-Specific Recombination inthe Drosophila Geno,” (Call $9499-509, Cell Prev (1989. Gorman, CM. etal. “The Rous Satcom Vins Long Tenis Repent is » Sirng Promoter when Iniouced ito» Vatiety of Eukayotc Cells by DNAcmedisted Transfection.” Pree Net Acad. Set USA 7967776781, National Acadamy of Sciences (1982), Git, Ft a, “Esoerihis colt 50S mans lacking protein S20 ae dfisive in ansaion inition” Biochim, Biophys. acta 103093497, Flsevier Publiahing Co (1990) ‘Gren, Rand Noll, HLF. "Ribosomes and Translation”. Re ‘Biochem. 6679-716, Anau Reviews, ls. (1997). Grindley, ND-F, and Kelley, WS, “Pies of Different Alleles of| the Ecol KI2 polt Gene on the Replication of Non-ransfering Plasmid,” Mole, Gon Genet. ISS311-318, Springer, Velag 4976), Gronostajski, RM, and Sadowski, PD. “The FLP Protein ofthe 2-ncton Plasmid of Yeast Inter and Inamoecular Reactions.” J Biol Chem, 260123282335, The American Society of Biological (Chemist Ino (1588) Gu, H, etal, “Deletion oa DNA polymerase beta gene sepment ‘ils sg ell ipe-sperifc seme lavgeting”Slence 268 10% 16, American Assocation forthe Advancement of Seience (1994). Guo, F, otal, "Anjnmetic DNA bending inthe Crean? sit Speide’ yecombinaion synapse." Proc. Natl. Acad. Se USA 96-7143.0148, National Acalemy of Sciences (1999) ae, and Bickle. "Enhancerindgpendent mats of the Cin Recombinasehave a Relaxe Topological Spiel" EMBO 13001-3996 IRL. Pres Lint (1088) Hall, RM, and Coll, CM, “Mobile Gene Casstes and Intesroas: Capture and Spread of Genes by Site-specific Reco sation” Moiee. Microbiol. 15893-600, Blackwell Science Li, (Feb 1995).US 7,351,578 B2 Page 6 lacock, RLEW.. and Seat, MG. “The ole of antimicrobial ides in animal defenses” Poe. Natl Acad. Sc. USA 978886- S61, National Acalemy of Sefences (Ap. 2000) Hay. S. et al. “Consintion of Adenovirus Vectors dvough (Cred Recombination” J Po T1-1S82-1849, American Socily for Microbiology (1997), Hartley. Je aL, “DNA Cloning Using In Vito Site-Specific Recombination.” Genome Rex, 10178-1795, Cold Spring Harbor Laboratry Press (Nov. 2000), isan, Net al. “Escherichia col genome trzting, 1. Crean rete! in vio generation of orfplasnis and their in vivo ‘huomosomalingrtion at octal” Gane 1805186, Flsvier Science (Dee. 19, Hasan, N., and Szybalski, W,"Contol of cloned gene expression ty promoter inversion in vivo: cousnction of inprved vectors witha multiple cloning site and the p. promoter" Gee $6:195- IS, Eleesier Science (1987) Hashimoto-Gotoh, ctl, “Tmgroved vector, pHSGGG4, fr dtet streptomeinsressiance selection: cDNA cloning with G-C-iing procedie and seloning of double-digesed DNA. fragments” (Gone 411254128, Elsevier Science (1985) oh, Reta Structural analysis of Ta, a ramposable cement fiom Amirrhinum maj, reveals homologies 1o the Ae element fiom maize,” Plant Mot Bol. 16:69-371, Kluwer Academie Press ~Uniirestionl digestion with exonicens I erent targeted bcakponts for DNA sequencing” Gone 2831399, Elsevier Science Publishers (198) Heyman, ILA. eal, "Genome-Scale Cloning and Expression of| Indiv Open Realing Frames Using Topoisomerase -Meiated Ligation,” Genome Rex 9.383392, Cll Spring labor Laboratory Press (Apr 1999), lochul Ee al “Genctic Approach to Facilitate Pufcation of Recombinaat Protas with 1 Novel Metal Chelate Adsobva.” Biolecinology 6: 1321-1325, Nature Pb Co, (1988). Hoekstra MF, eta, "Shute Mutagenesis: Bacterial Tansposons for Gencie Maniplitions in Yes.” Me, Enzymol. 194 329342. Academic Pres (1991), Hoes, Rf, etal, "Mechanism of Strand Cenvage and Exchange inthe Credne Ste-specite Revombination Sytem” Mot ol {81351-362, Acafenie Press (1985). Hoes, Ro al, “Formation of small erular DNA molecules via nin vitro sitespociic recombination system” Gane 403252329, Elsevier Science (1985), loess, RH, al, “PL site-specific recombination: Nucleotide sequence of the recombining stes" Pro. Net. cad. Se USA 7983983402, Naional Academy of Sieces (1082) Hoes, RH, eal, “The role ofthe loxP spacer region in PL sitespesife" recombination.” Niel. teks Rex 142287-230, (Oxford University Press (1986, ins, Ro HL, and Abremski, K. “The Credo Resombination System” in Nucleic cide and Molecular Biology, vl 4, ed. by Fekstin F, and Fille. DMJ, Springer-Verlag, Blin, 99109 990), ies, RIL, and Abremski,K., “teraction of the Bacteriophage PI Recombinase Cre withthe Recombvning Site lax?" Proc. Na Acad, Sek USA 81:1026-1029, National Academy of Sciences ss0, Holt, C1, an May, GS, “A novel phage b replacement Crelas ‘vector ha hss automatic subcloning epablities” Gene 133.9897, Flsevier Seence (1993) ioogenboom, H.R, ta, "Muli-subuni protcins on the surface of Slamentous phage” methodologies for displaying antibody (Fab) Dea and Hght chains” Mae lds Res 19ALS3-4137, Oxford University Press (199 Tid, 5. eal, "A site specifi, conservative recombination stern ‘arid by tateioptage Pl, Mapping ofthe econbinate gene ca land the crossover ies ci forthe Inversion of the ¢ segment” EMBO J. 1-1485-1483, Oxford University Press (1982) "T and Kusukake, K, “Tran-acting Genes of Bacteriophages land Mu Mediate Inversion of «Spite DNA Seganent involved in Flagellar Phase Variation of Salmonella" Cold Spring Harbor Shmpasia on Quantarve Biology 4511-16, Cold Sping Hasbor Taboratry Press (1981). Inst Pasteur Website, Intron hipster frecher shetntespmiglintg ino hil (cseseat fun 19, 2003) Institut Pasteur Webi, Figure hp ww pasture rocherche unites pte fig hint (accessed Tun 19, 2003) Inst Paster Website Figure 2 pw pasteurfrecherche nites pnts fg? uml (acess Tun. 19, 2003. Institut Pasteur Webi Figure pw pater recherche! uns pn ne fig hl (accessed Tan 1, 2003) Institut Pasteur Website, Main Page: itp wor: pasteurtecher chetunitespmi (ceesod hin 1, 2003) Invitrogen Online Catalog, “The Echo™ Cloning Systom: The Future of Cloning is Here svailable at ips webachiveang ‘vey 2001011213 1100 wa imirogen comveatalog projet at_echo hm (acceso ul 7, 2008), Tlf, ta, "Efets ofthe ced Function ofthe F Plasmid Bacterial Grow,” J. Bacteriol. 163841-849, American Sovity For Microbiology (1988) Sayaram, M, "The Ft Family of Site-specific Recombinases: Somme thoughs on’ General Reaction Mechanism.” J. Genet. 67.2936, Indian Academy of Seienes (1988), ‘Jeong, etal "Cloning and melt sequencing of the genes, ‘pill and rpm, fr ribosomal proteins 121 and 127 of Escherihia fal". DNA Sequencing and Mapping 439-67, Harwood. Acs ‘fmic Publishers Gant (1999, ohnson, RC, et al, “Ioltion of the gene encoding the Hin ‘secombinaionl enhancer binding protsin.” Pre. Na. cad. Se. {USA 5:3484- 3488, Natoma Academy’ of Seances (1988). Kania, R. etal, “Gin-Meited Recombination of Catered and ‘Knot DNA Suita: Implications forthe Mechanism of Inter ation Between CiseAeting Sites” Cell S8147H159, Cell Press (108), ‘Kania. K. ct al, "A wide-hostrange suicide vector for improving sevetse gents in Gra-pegatve bacteria: inastvaton of the sa gene of lersnia enteral,” Gone 109-1374, Elsevier See fence (1991), Katz, L, e a, “Sitegpeci—icrecombinsion in Escherichia colt between the a sites of plas pSEPIL from Saccharopospora there," Mol, Gen, Gane. 227155139, Springer-Verlag (1991) Kealey, 7, tal, “Production of Polyktide Nara Poet in ‘onpolykstide producing Polayotic and Eukaryode Hosts” Pr. [Na teod, Se. US4 95:505509, National Academy of Scenes (an. 1958, Kholodenko, BAN, et al, “Metabolic Design: How to Engineer a Living Cell 10 Desired Metabolite Concentrations and xe” Blorohol. Bloenginer.59239-247, John Wiley & Son (1998). Kilby, NJ. etal. “Sitespeciie recombinase: tals for genome engineering.” Toids Gener 9413-421, Flsevier Treads Journals (1293), Kim, S. and Landy. A, “Lamina tat Prossin Bridges Berwen Higher Onder Completes at Two Distant Chmosomal Lost ai. and oR Science 256:198.203, American Association forthe ‘Advancement of Science (1992), Kim, D.W "Use ofthe Human Elongation Factor La Promoter as a Veraie and Efficient Expression System.” Gene 91217223, isevier Science (1990) its, PA. and Nash, HLA, “Bacteriophage Lamba Site-Speific Recombination Proceeds ‘with a. Defined “Onder of Stand Exchanges” J Mol. Biol 2049-107, Aeademie Press Ie (1988) Klippe A etal, “Isolation and characterization of unusual gn tani” Dh EMBO Journal 7 3839989, IRL Press ine. (1988) Koch, €. etal, “Escherichia cli bot facto for siterspeciic DNA, Inversion: Cloning and characterization of the fs pene” Proc. Nat oad Set USA 8542574241, National Academy of Seienes (985), Kolb, AF, and Sel §.G “Genomic Tagsting with an MBP Cre Fusion Protein” Gone 15333-60, Hacer Science (Doe. 196). ‘Kouprina, N, tal. “Rescue of Targted Regions of Mammalian CChromosoms by in Vivo Recombination in Yeast” Genome Res 856661672, Co Spring Harbor Research Laboratory Pres (1998),US 7,351,578 B2 Page 7 Kozak, M, “Comparison of inition of protein symhesis in Procarjotes, euarores and organelle,” Microb. Rev. 47-145, ‘American Society For Microbiology (1983) Krak, M, "An analysie of S-noncoding sequences from 699 vertebrate messenger RNAK” Nuc, eae Res. 1581258132, (Oxford University Press (1987), Kozak. M. "Structural features eukaryotic mRNA that modulate the ination of tanltion” J. Biol” Chem, 266-1986? 9870 ‘American Society for Biochemistry and Molecular Biology (1991) Krafle, DS. etal. “Suble Expression and Functional Character ization of «Homan Cardiae Na" Channel Gene in Mammalian Cal” Mol Call Caniol 27823580, Academic Press Lid 4999), Krautald, Sand Baccarini, M, “Bacterial expressed marine (CSF-1 possesses agonistic activity ints monomeric fom.” ‘Bochem, Bloplys Rex. Comma, 192: 720-127, Hsevier Scenes 999), Kuempel, Petal, “Use ofa transposon (Tait bean apyres- ing and nonsuppessing insertions of the if rewlase site of Eschericia col," Genes & Development 1011621171, Cold Spring iaybor Laboratory Pres (May 1, 1996) Kn, R. etal "Inducible Gene Targeting in Mice." Sclence 269:L427-1429. American Assocation for the Advancement of Science ep. 1995), Tafontaine, D, and Tollevey, D, “Onestep PCR Mite State cy forthe Consiition of Conditionally Expressed and Epitope “Tagged Yous Proteins” Nucl vids Res, 03409-3472, Oxford University Press (199) Lake, TA. “Evolving Ribosome Stneture: Domains in Achicbicctia, Fut, Focytes and Fukanotes” nn Rev. Biochem. $4:S67-530, Anal Reviews, Ine (1985) also. MC otal, “Tapetad oncogene activation by site-specific recombination in wanspenie mice" Proc. Nat. Acad. Sc, USA '59.6252-6286, National Acalemy of Sciences (1992) Lander, F'S.-"The ne genomics global views of biology.” Science 274536539, American Assocation forthe Advancement of Sei ‘ence (Ot. 1996), Landy, A. “Mechanistic and stustral complexity inthe sit specif recombination pathvays of Int and FLD." Cur: Opin Gone, Dev. 4699-707, Curent Biology (193). Landy, A, “Dynamic, Stuctural, and Regulatory Aspects of i Specie Recombination” nme. Res Biochem. S8913:989, ‘Annual Reviews (1989), LLangevel SA. etal, “Expression ofan Escherichia cal pr gene in the yeast Saccharomyces cerevisiae,” Mol. Gen. Genet. 193 396-400, Springs-Verag (1985), Lebreton, B, eal, "Mutations Tht improve the Binding of Yeast FLPRecombinac ols Sutra” Gane 18 393-00, Genetics Society of American (1588) Tee. FC. al. "Genetic Analysis of Eschorihle col Integration Host Facor Infractions with Ks Bacteriophage > HW” Recognition te" J Bacteriol 17603.617, American Society for Mirai. ‘ogy (1990. {ee Gan Sito, 1, "Role of Nusleatde Suenees af lax? Spacee Region in Cresedted Recombination,” Gene 216°55-5,Elacnet Selnce (1998), Toe, MIL, tal, “Sitesepeii integration of mycobacteriophage LS: Imegraionproficieat vectors for Mjcobacteriun smegma, Mycobacterium ibercoss, and ball Calmete-Goétin” Proc [Natl oad Set OSH NOSITI-SIIS, National Academy of Ssienees sop, Lensl, RE eal. "Genet Analysis ofa Plasmid-Encode, Host ‘Genotype-Spufie Enhancement of Bacterial Fitness." Bate HI6S3140<3149, American Society For Microbiology (1094). Leong, IM, ef al, “Geneon of single basepair deletions, ineetions, and substations bya tite-pocic recombination 93° tem.” Pr. Natl cod Se, USA 826990-6998, National Academy ‘of Sciences (1985). Leslie, and Short HL, “Site-specific Recombination in the Replication Terminus Region of Escherichia coll Functional Replacement of dif" EMBO J. 14:1861-1870, Oxoud University Pres (Apr 1995) ‘Leung, LK. "Application of Combinatorial Libis and Protein Engncorng o the Discovery of Novel Ant-Thrombotc Drugs.” Thromb. Haemost. 74373376, EK, Schatauer Velagsueslschat mbit (1995). Ti Z.W,etal, Generation of mice witha 200 anya precursor protcin gene deletion by Cre rcombinase-medieated site-specific combination in embryonic stem cells, Pro. No. ead. St. USA ‘DREUSR1E2, National Acaemy of Sciences (1956). Liu, Q. tal. "The nivectr plasmid-fusion system, a method for rapid) constiction of secombinant’ DNA without sesietion zymes" Carr Bll. 1900-1309, Cell Pes (1998). Tosbach, E, tal, “Sitespeciic Recombination i Hunan Cells Catalyzed by Phage 7. Itegzase Mutants." J) Mol. Bil, 296 1178. I, Aeatemic Pres (Mar 200) 1, and Churchward, G. “Conjugative transposition: n916 Inlerabe contains two iniependeat DNA binding domains tht secogaize diferent DNA. sequences.” EMBO J. 13 18411548, Oxtord University Press (Ape 1994). luchow; VA, ot al, “Eieie Gencraton of Iafestious Recomhi ‘ant Baculviruses by Site Specie Transposon- Minted Insertion fof Foreign Genes into a Baevloviss Genome Proagated. in Exoherichia col,” J. Vik, 674566-4579, American oy For Micrbiology (1903) ‘Mackie, G.A.*Nuclooide Sequence of the Ge for Ribosomal Proein $20 aa Its Flanking Regions.” J. Bil, Chem. 256:8177~ SIS2, American Society for Biochomisry and Molecule Biolog, Ine. (1981. Maditon, LL, and Huisman, GW, “Metabolic Enginecing of Poly(-Hyuioxjalkanoates). From DNA to Plsti™ Microbiol Mol Biol Reviews 6321-53, Ameriean Soci for Micrbiology (Mise 1999), ‘Maciura. K. cal. “Generation ofa Dominaat-ogaive Mutant of| Endothelial PAS Domain Potin 1 by Deletion ofa Potent Cr inal Transactivation Dorin” J. Ho Chem. 2743156531570, ‘The Amenscan Society fr Biochemistry and Moleclar Biolog. Ine. (199). ‘Macser, Sand Kshmana, “The Gin recombinase of phage Mo ‘am ealalyte ste-speciesocobination in plant protoplast” Mal ‘Gon. Genet, 230 170-176, Singer Verlag (1991), ‘Mahilon, J. tal, “18251 and other Baca thringlensl eas poste laments a review" Govetea 93:13:26, Kluwer Aerie {Xow 1984) ‘Mahitlon, 1, ct al “Subivision of the Escheichi colt Ke12 genome for Sequencing: manipulation and DNA sequence of rans posable cloments intoducing uaique tesuction sites” Gene BBs, Haevier Science BV (1998) Malyaa, B.A. et al. "The seid fact Acts the Final Step ofthe Inoglobulin VDJ Recombinase Mechanisn,” Coll 54:453-160, (Cet Press (1988), ‘Maniatis, otal, “Regulation of Inducible and Tiswespesifc Gene Expression,” Scone 236:1297-1245, Amerson Axsoenion forthe Advanccment of Science (197). ‘Manning. PA eal, “Gene Captre in Frio cholerae,” Trends in Mlerobtolgy 793-95, Eaovot Science (19). ‘Matsuzaki Het al, "Chromosome Enginceing in Socoharomyces corvinia by Using a Ste-Specie Recombination System of 2 ‘Yeast Plasmid” J Bacerol 172:610-618, American Sosity for Microbiology (1990), ‘McCanhy. 1. and Brimacombs, R.“Prokayotie translation: the Interactive pathway leading to inition.” Trends Gener. 10402 407. Elsevier Tres Journals (No 19). Mesbery. Set al, “Tntz-chromosomal reurangements gener tod by Creda stespocife combination” Nucl acids Res $:4nse400, Oxford University Prese (1999) ‘Mendiola MW, etal. and dels Cr, F, “Speci of Insertion ‘of 9/, am Insertion Soquence Preset in chcolysis Pass of Escherichia col,” Mol Microbiol. 3979984, BlackvellScemifc Publications 1989). Mercer, J. eal, "Stitral and Functional Charccriztion of| mph, 4 Resowbinase Lois in Ta2/ and Related Lacamase “iansposons" J. Bacteriol, 1723748-3787, American Society for Microbiology (1990),US 7,351,578 B2 Page 8 Metcalf, WW. eta. "Condtonslly Repicaive and Conjugative Plasmids Canying facZa for Cloning. Mutagenesis and Allle Replacmont in Baca,” Plasmid 8-113, Acadame Pres, Ine dan, 1996), Matis, MF, ot al, “Transcriptional silencing and_prometer methylation “uiggered by daublestandal RNA” EMBO. J TD.SI94-8201, Ewopean Molecular Biology Organization (Oct 2000) MeyerLeon, I. ¢t aly “Purification of the FLP Sitespesific Recombinae by Alii” Chromatography and Rewxamination of Basie Propetes ofthe Sytem” Nucl els Res. 15 6460-6488, IRL Press Limited (1987) Miki, T. al, “Cont of segregation of chromosomal DNA by ‘x fcr in Exoherichla cll Mutants of DNA gyaaesbunt A Suppress liD (ce) product growth inition” J. Mol. Biol 22853952, Academic Pres (1992) Mile, etal "nr an dr Mutation of Phage Tha Enkamees Site-Specific Recombination." Cell 20; 721-729. Cell Pres (1980), Miasshima, ad Naga, S. "pEF-BOS, a Poweril Mammalian Expression Vestn” Nucl cide Rex, 15322, Oxford University Press (1990), Miawchi K. and Mizwchi, M. “Integrative Recombination of| Bacteriophage 2! In Vino Stay of the lntemolcular Reston,” Cold Spring Hor. Symp. Quant, Biol. 48111-1014, Cold Spring innbor Laboratory Pres (1979), Minch, M., and Micatch, K. “The extent of DNA sequence roqired fora fictional serial atachment ite of phage lamb, ‘Muck deids Res. 13 1193-1208, Oxford Univesity ress (1985). Mazo, T, and Hooykaas, PI, “Design of a novel system forthe ‘constuction of vectors for Agrobacterturmedave plant transfor Inition” Mol. Gen. Genet 2361-7, Springer Verlag (1992) Mullins. LJ. et al. “Eficiont Croox linearisation of BACS: applications to physical mapping. ant generation of transgenic faim” Nucl Ace Re. 257539.2840, Onto Univer Pres 1997) Murayama, otal, “Evidence for Involvement of Eherichia ‘oll Genes pmb, eat A ant a Previously unrvognized Gene dD, in the Control of DNA Gage by le (ee) of Sox Factor F." J Mol. Bio. 286:48:S02, Academie Press Limite (Mas. 1 196). Nagaraja, Ry and Weisberg, R.A. “Specfcty Determinant nthe ‘Altachment Sits of Bacteriophages HKO22 and)" J. Bacteriol 172654016550, American Soviet for Microbiology (199). [Nagy A "Cre Recombunas’ The Universal Reagent for Genome “allring:" Genesis 2699-109, Wiley-Liss (2000) Nash HA. “Integrative Resombination of Bacteriophage Lamba DNA In Wir.” Pr, Nol stead, Sl, USA 7210721076, Naina Academy of Sciences (1975) Nash I-A. “Bending and supercoiling of DNA atthe attachment site of facterophage lamba” Trends Biochem. Set 15:222227, Elsevier Trends Journals (1990. Nash, HLA. “Purification and Properties of the Bacteriophage Lamba Int Protein” Meth Enzymol 100:210-216, eaemic Press 1983), Nash, HLA. and Roberton, C.A, “Heteroduplex sister for Dactsiophage lamba site-specific recombination: cleavage and and tuner products” EMBO J. AS24383, Oxforl Lnivesty Press (1989), Nash HA set al, “Rol of homology site-specife recombination of bacteriophage J: Evidence against joining of cobeive ends” Proc. Natl dcod. So. USE 84-4049-4053, National Academy of Sciences (1987), Nash HA.,and Roberson, CA. "Purification and properties of the ‘Escherichia coll peu factor reguted for lama ialepe tive recombination” Biot Ohon, 2569246253, America Society for Biochemistry and Molecular Bilogy (1981). ‘Nomura, Met al, "Regulation ofthe Synthesis of Ribosomes and Ribosomal Components" ine. Rev Blochem. $3:75-117, Amal Reviews, Ine (1988), meh, TE A LL @xny we Ea @n| 2 4. 3xn} Qs! Za ‘van QS! ‘LL xn} as! a axn| as 4 on 3s a 3} as 4 yeni as dL oxn) as AKON SNINOTOUS 7,351,578 B2 Sheet 19 of 78 Apr. 1, 2008 U.S. Patent a2} “Old uo dup Bae “LL gxn| as ‘LL Wan cm wm Ba oxnt Qs a uo dw HO uDy uO UD of on ny os | TL 3x0) 0S OTe Lam BZ uo juoy Yo uDy yo yuDy 1HON 9NINOTOUS 7,351,578 B2 Sheet 20 of 78 Apr. 1, 2008 U.S. Patent Ra Tle ASWNOTO YT + Bala ESV Sa] Taal 81°94US 7,351,578 B2 Sheet 21 of 78 Apr. 1, 2008 U.S. Patent ASWNOTD U1 + Gene * Epo ca ‘a 3SYNOTO dd ‘3SNOTO U1 meet Soe aaa Ge eee duo Kedearsstse"7 @ SangUS 7,351,578 B2 Sheet 22 of 78 Apr. 1, 2008 U.S. Patent — ryU.S. Patent Apr. 1, 2008 Sheet 23 of 78 US 7,351,578 B2 3 ——_>—_ © B2 CODING Oe B3_ kan? amp? 1 ——* FIG.21B SH i HOMOLOG TES eo 3_ SHOWOLOGY 821 pya-a_B FIG.21CUS 7,351,578 B2 Sheet 24 of 78 Apr. 1, 2008 U.S. Patent V0? Old duo Zz EE r Ze MONONOH=C4- ON ca ADOTONOH-S “5 TSW Bi | : Tey AQOIONOH- AOOTOROH-S 10D} 003, SYOLOSA ONLGDYVL INFO ONILONYLSNODU.S. Patent Apr. 1, 2008 Sheet 25 of 78 US 7,351,578 B2 CONSTRUCTING GENE TARGETING VECTORS kant kant ZG PT e_pps EZ, Vw Lt 5'-HOMOLOGY i 3'-HOMOLOGY, 5] BI B21 B2 |BP_CLONASE. kant kant 5'-HOMOLOGY LI: GR ccdB Rl NEO CRT ccdB ampr LR _CLONASE B21 a» B2 13'—-HOMOLOGY, Cy Za a 5'-HOMOLOGY FIG. 22BU.S. Patent Apr. 1, 2008 Sheet 26 of 78 US 7,351,578 B2 mRNA AMMA RANDOM-PRIMED 1ST STRAND ‘SYNTHESIS | RANDOM-PRIMED PCR { SPLIT INTO n REACTIONS PCR WITH PRIMERS WITH RANDOM 3° ENDS, attB SITES ON 5’ ENDS a I~ Bit p= Bis Biit2) = Bit3 Bon) SIZE FRACTIONATE, e.g., BY GEL PURIFICATION, TO 50-60 bp | clone iio ENTRY vEcTORs | Poot ENTRY cLoNes | CLONE CONCATAMERS SEQ. "Ce Big = Big2—= Bis3 = Bing: Ba—= eS ____ vector Soe SEQUENCE CONCATAMER FIG. 23U.S. Patent Apr. 1, 2008 Sheet 27 of 78 US 7,351,578 B2 att80 — AGCCTGCTTTIITATACTAACTTGAGC (SEQ ID NO:1) TCGGACGMAAAAATATGATTGAACTCG attPO — GTTCAGCTTTITTATACTAAGTTGGCA (SEQ ID NO:2) CAAGTCGAAAAAATATGATTCAACCGT attL0 — AGCCTGCTTTICTATACTAAGTTGGCA (SEQ ID NO:3) TCGGACGMAAAAATATGATTCAACCGT attRO — GTTCAGCTTTTTTATACTAACTTGAGC (SEQ ID NO:4) CAAGTCGAAAAAATATGATTGAACTC attB1 — AGCCTGCTTTITTGTACAAACTTGT (SEQ ID NO:5) TCGGACGAAAAAATATGTTTGAACA attPl — GTTCAGCTTTIITGTACAAAGTTGGCA (SEQ ID NO:6) CAAGTCGAAAAAACATGTTTCAACCGT attLl — AGCCTGCTTTTTTGTACAAAGTTGGCA (SEQ ID NO:7) TCGGACGMAAAAACATGTTTCAACCGT attRl — GTTCAGCTTTIITGTACAAACTTGT (SEQ ID NO:8) CAAGTCGMMAAAACATGTTTGAACA attB2 — ACCCAGCTTTCTIGTACAAAGTGGT (SEQ ID NO:9) ‘TGGGTCGAAAGAATATGTTTCACCA attP2 — GTTCAGCTTTCTIGTACAAAGTTGGCA (SEQ ID NO:10) CAAGTCGAAAGAACATGTTTCAACCGT attL2 — ACCCAGCTTTCTTGTACAAAGTTGGCA (SEQ ID NO:11) ‘TGEGTCGAAAGAACATGTTTCAACCGT attR2 — GTTCAGCTTTCTIGTACAAAGTGGT (SEQ ID NO:12) CAAGTCGAAAGAACATETTTGACCA, attBS CAACTTTATTATACAAAGTTGT © (SEQ ID NO:13) GTTGAAATAATATGTTTCAACA, attP5 —GTTCAACTTTATTATACAAAGTTGGCA (SEQ ID NO:14) CAAGTTGAAATAATATGTTTCAACCGT FIG.24AU.S. Patent Apr. 1, 2008 Sheet 28 of 78 US 7,351,578 B2 atts CAACTTTATTATACAAAGTTGGCA (SEQ ID NO:15) GTTGAMATAATATGTTTCAACCGT attR5 GT TCAACTTTALTATACAMAGTTGT ~— (SEQ. ID NO: 16) CAAGTTGARATAATATGTTTCAACA att8ll CAACTTTICTATACAAAGTTGT (SEQ 1D NO:17) GTTGAAAAGATATGTTTCAACA attPl1 GTTCAACTTTICTATACAAAGTTGGCA (SEQ ID NO:18) CAAGTTGAAAAGATATGTTTCAACCGT attlil CAACTTTICTATACAAAGTTGGCA (SEQ ID NO:19) GTTGAAAAGATATGTTTCAACCGT attR1l GTTCAACTTTICTATACAAAGTTGT (SEQ. ID NO:20) CAAGTTGAAAAGATATGTTTCAACA attB17 CAC SAAAGTTGT (SEQ 1D NO:21) GTTGAAAACATATGTTTCAACA attP17 GTTCAACTTTIGTATACAMAGTTGGCA (SEQ ID NO:22) CAAGTTGAAAACATATGTTTCAACCGT attLi7 CAACTTTIGTATACAAAGTTGGCA (SEQ ID NO:23) GTTGAAAACATATGTTTCAACCGT attR17 GTTCAACTTTIGTATACAMAGTTGT (SEQ. ID NO:24) CAAGTTGAMAACATATGTTTCAACA attB19 CAACTTTITCGTACAAAGTTGT — (SEQ ID NO:25) GTTGAAAAAGCATGTTTCAACA attP19 © GTTCAACT ICGTACAAAGTTGGCA (SEQ ID NO:26) CAAGTTGAAAAAGCATGTTTCAACCGT attll9 CAACTTTIICGTACAAAGTTGGCA (SEQ ID NO:27) GTTGAMAAAGCATGTTTCAACCGT attR19 GTTCAACTTTIICGTACAAAGTTGT (SEQ. ID NO:28) CAAGTTGAAAAAGCATGTTTCAACA FIG.24BU.S. Patent Apr. 1, 2008 Sheet 29 of 78 US 7,351,578 B2 attB20 CAAC GGTACAAAGTTGT © (SEQ ID NO:29) GTTGAAAAACCATGTTTCAACA attP20 —GTTCAAC GGTACAAAGTTGGCA (SEQ ID NO:30) CAAGTTGAAAAACCATGTTTCAACCGT attl20 CAACTTTITGGTACAAAGTTGGCA (SEQ ID NO:31) GTTGAAAAACCATGTTTCAACCGT attR20 GTTCAAC GGTACAAAGTTGT © (SEQ ID NO:32) CAAGTTGAAAAACCATGTTTCAACA attB21 CAAC [AATACAAAGTTGT = (SEQ ID NO:33) GTTGAAAAATTATGTTTCAACA attP21 — GTTCAACTTTITAATACAAAGTTGGCA (SEQ ID NO:34) CAAGTTGAAAAATTATGTTTCAACCGT attl2l CAACTTITITAATACAAAGTTGGCA (SEQ ID NO:35) GTTGAAAAATTATGTTTCAACCGT attR21 — GTTCAAC [AATACAAAGTTGT © (SEQ ID NO:36) CAAGTTGAAAAATTATGT TTCAACA FIG.24CU.S. Patent Apr. 1, 2008 Sheet 30 of 78 US 7,351,578 B2 VECTOR ASSEMBLY USING MODULAR VECTOR ELEMENT ENTRY CLONES ZA BAYA kan? ori FIG. 25A VECTOR ASSEMBLY USING MODULAR VECTOR ELEMENT ENTRY CLONES ORF ts N-Tag C+Tag loxP FIG. 25BU.S. Patent Apr. 1, 2008 Sheet 31 of 78 US 7,351,578 B2 CONSTRUCTION OF attP PLASMIDS kant ori ccdB cat _, kan? ori ccdB cat FIG.26AU.S. Patent Apr. 1, 2008 Sheet 32 of 78 US 7,351,578 B2 CONSTRUCTION OF attP PLASMIDS FIG.26BU.S. Patent Apr. 1, 2008 Sheet 33 of 78 US 7,351,578 B2 u A 2 R2 B RS. SOESSSSSQ oriB m2)": [loxP tsm4_§ Int za? LxR | IHF Xis u A B2 B R3 ori sm2 loxP +sm3_ smi P2 loxP +sm4 oriB RESOLVE | Cre FIG.27AU.S. Patent Apr. 1, 2008 Sheet 34 of 78 US 7,351,578 B2 A A B2 BRS c 620 R4 eA, B2 B Bone Cle Bde, R4 ZS t SSS O +sm. FIG.27BU.S. Patent Apr. 1, 2008 Sheet 35 of 78 US 7,351,578 B2 GTAAAACGACGGCCAGTGAATTATCAACTTTGTATAGAAAAGTTGAACGAGAAA CGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGAC TACATAATACTGTAAAACACAACATATCCAGTCACTATGGCGGCCGCTAAGTTGG CAGCATCACCCGACGCACTTTGCGCCGAATAAATACCTGTGACGGAAGATCACTT CGCAGAATAAATAAATCCTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAA. CTTTTGGCGAAAATGAGACGTTGATCGGCACGTAAGAGGTTCCAACTTTCACCAT AATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAG CTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATAT CCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTAC CTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAA AATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGC TCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAG TGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCT GGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGG CGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTT TTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCA ATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGG CGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGC TTCCATGTCGGCAGAATGCTTAATGAAT TACAACAGTACTGCGATGAGTGGCAGG GCGGGGCGTAATCTAGAGGATCCGGCTTACTAAAAGCCAGATAACAGTATGCGT ATTTGCGCGCTGA’ ‘GCGGTATAAGAATATATACTGATATGTATACCCGAAG TATGTCAAAAAGAGGTGTGCTATGAAGCAGCGTATTACAGTGACAGTTGACAGC GACAGCTATCAGTTGCTCAAGGCATATATGATGTCAATATCTCCGGTCTGGTAAG CACAACCATGCAGAATGAAGCCCGTCGTCTGCGTGCCGAACGCTGGAAAGCGGA AAATCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGAAATGAACGGCTCTTTT GCTGACGAGAACAGGGACTGGTGAAATGCAGTTTAAGGTTTACACCTATAAAAG AGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCC GGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCT CCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGAC CACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTC AGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATA TAAATGTCAGGCTCCGTTATACACAGCCAGTCTGCAGGTCGACCATAGTGACTGG ATATGTTGTGTTTTACAGTATTATGTAGTCTGI [ATGCAAAATCTAATTTAA TATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTATTATACAAAGTTGA TAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGIGTGAAATTGTTATCCGCTCG GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAAC GCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA GGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTAC. CGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCAC GCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACG AACCCCCCGTTCAGCCCGACCECTGCGCCTTATCCGGTAACTATCGTCTTGAGTC CAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGAT TAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA CTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTT FIG.28AU.S. Patent Apr. 1, 2008 Sheet 36 of 78 US 7,351,578 B2 CCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTA GCGGTGG GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCA AGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA CGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTT TAAATTAAAAATGAAGT TT TAAATCAATCTAAAGTATATATGAGTAAACTTGGTC TGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTT CGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGG GCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGC TCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGECCGAGCGCAGAAGTGG TCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGT TGCCGGGAAGCTAGAGTA AGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCG TGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTC CTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTITTCTGTGACTG GTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTC TTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGT GCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTG TTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT TACTTTCACCAGCGTTTCTGGGTGAGCAMAAACAGGAAGGCAAAATGCCGCAAA AAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCC CAA TATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATG TATTTAGAAAAATAAACAAATAGGGGT TCCGCGCACATTTCCCCGAAAAGTGCC ACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGT ATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGAC ACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCA GACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGEGTGTCGGGGCTGGCTTA ACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAA TACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCA GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCA GCTGGCGAAAGGGGGATGTGCTGCAAGGCGAT TAAGTTGGGTAACGCCAGGGTT TTCCCAGTCACGACGTT SEQ ID NO: 156 FIG.28BU.S. Patent Apr. 1, 2008 Sheet 37 of 78 US 7,351,578 B2 CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGG AAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCETTGGCCGATTC ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCA ACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAG GCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGECGGG CGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCG GCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAA AGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTIGATGCCTGGCAGTTCCCTAC TCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACG GCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCT GTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAAGTTTGTACAA AAAAGCAGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGAT TTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTA TGAATCAACTACTTAGATGGTATTAGTGACCTGTAGTCGACCGACAGCCTTCCAA ATGTTCTTCGGGTGATGCTGCCAACTTAGTCGACCGACAGCCTTCCAAATGTTCTT. CTCAAACGGAATCGTCGTATCCAGCCTACTCGCTATTGTCCTCAATGCCGTATTA AATCATAAAAAGAAATAAGAAAAAGAGGTGCGAGCCTCTTTTTTGTGTGACAAA ATAAAAACATCTACCTATTCATATACGCTAGTGTCATAGTCCTGAAAATCATCTG CATCAAGAACAATTTCACAACTCTTATACTTTTCTCTTACAAGTCGTTCGGCTTCA TCTGGATTTTCAGCCTCTATACTTACTAAACGTGATAAAGTTTCTGTAATTTCTAC TGTATCGACCTGCAGACTGGCTGTGTATAAGGGAGCCTGACATTTATATTCCCCA GAACATCAGGTTAATGGCG' GATGTCATTTTCGCGGTGGCTGAGATCAGCC ACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGC GCCAGCTTTCATCCCCGATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATC ‘TGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCGTCGCCCGGGCGTGTC AATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAG GTGTAAACCTTAAACTGCATTTCACCAGTCCCTGTTCTCGTCAGCAAAAGAGCCG TICATTTCAATAAACCGGGCGACCTCAGCCATCCCTTCCTGATTTTCCGCTTTCCA. GCGTTCGGCACGCAGACGACGGGCTTCATTCTGCATGGTTGTGCTTACCAGACCG GAGATATTGACATCATATATGCCTTGAGCAACTGATAGCTGTCGCTGTCAACTGT CACTGTAATACGCTGCTTCATAGCACACCTCTTTTTGACATACTTCGGGTATACAT ATCAGTATATATTCTTATACCGCAAAAAT CAGCGCGCAAATACGCATACTGTTAT CTGGCTTTTAGTAAGCCGGATCCACGCGATTACGCCCCGCCCTGCCACTCATCGC AGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGC ATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATAT TTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAAT CAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAA TAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGA ATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAA AACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATA TCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATOAGCATTCATCAG GCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTA CTTTACG GTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAG CAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCAT TGGGATATATCAAC GGTGGTATATCCAGTGA’ CTCCATTTTAGCTTCCTTAGCTCCTGAAAATC FIG.29AU.S. Patent Apr. 1, 2008 Sheet 38 of 78 US 7,351,578 B2 TCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTT GGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGC TTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCG TCACAGGTATTTATTCGGCGCAAAGTGCGTCGGGTGATGCTGCCAACTTAGTCGA. CTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTGGATATGTTGT GTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGAT. ATTTATATCATTTTACGTTTCTCGTTCAGCTTTCTTGTACAAAGTGGGCATTATAA GAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAA AATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCA TAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCA CAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTA ATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAA ATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGG GCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTG TTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCA GACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCG TACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTC CAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAG TGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGAT CGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATG CGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAG AAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTC TCACTTGATAACCTTA GACGAGGGGAAATTAATAGGTTGTATTGATGTTG GACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCT CGGTGAGTTTTCTCCTTCATTACAGAAACGGC CAAAAATATGGTATTGATA. ATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAG’ CTAATCA, GAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACG GCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGC GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTIGAGATCCTTTTTTTCTGCGC GTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGC CGGATCAAGAGCTACCAACTC ‘CCGAAGGTAACTGGCTTCAGCAGAGCGCA. GATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAAC TCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGC CAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGAT AAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAG CGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCC ACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGA. ACAGGAGAGCGCACGAGGGAGCTT CCAGGGGGAAACGCCTGGTATCTTTATAGT CCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGA GTGATGCTCGTCAGG GGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC1T FTTACGGTTCCTGGC CTTTTGCTGGCCTTTTGCTCACATGTT SEQ ID NO: 157 FIG.29BU.S. Patent Apr. 1, 2008 Sheet 39 of 78 US 7,351,578 B2 CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGG AAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCA ACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAG GCCATCCGTCAGGATGGCCTICTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGG CGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCG GCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAA AGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTAC TCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGT TGTAAAACGACG GCCAGTCTTAAGCTCGGGCCCTGCAGCTCTAGAGCTCGAATTCTACAGGTCACTA ATACCATCTAAGTAGTTGATTCATAGTGACTGCATATGTTGTGTTTTACAGTATTA TGTAGTCTG |ATGCAAAATCTAATTTAATATATTGATATITATATCATTTTA CGTTTCTCGTTCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTAT CAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGAG CTCTAGAGCGTCGACTAAGTTGGCAGCATCACCCGACGCACTTTGCGCCGAATAA ATACCTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTG ATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGACGTTGATCGGCACG TAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTIT TGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAAT CAC TGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACA’ GAGGCA TTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGG cc |AAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCA CATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGAC GGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGC AAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTT TCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTC. CCTAAAGGGTTTATTGAGAATATG' CGTCTCAGCCAATCCCTGGGTGAGTTT CACCAG GATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCA CCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTC AGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATT ACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATCGCGTGGATCCGGCTT ACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTGA GCGGTATAAGA ATATATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTATGAAGCA. GCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATG: ATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTCT GCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCGCCCG GTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAATGCA, GTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTA. CAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGT GCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCG GGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCG TTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACG CCATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCTCCCTTATACACAGCCA, GTCTGCAGGTCGATACAGTAGAAATTACAGAAACT FIG.30AU.S. Patent Apr. 1, 2008 Sheet 40 of 78 US 7,351,578 B2 TTATCACGTTTAGTAAGTATAGAGGCTGAAAATCCAGATGAAGCCGAACGACTTG TAAGAGAAAAGTATAAGAGTTGTGAAATTGTTCTTGATGCAGATGATTTTCAGGA CTATGACACTAGCGTATATGAATAGGTAGATGTTTTTATTTTGTCACACAAAAAA GAGGCTCGCACCTCTTTTICTTATTTC: [ATGATTTAATACGGCATTGAGGAC. AATAGCGAGTAGGCTGGATACGACGATTCCGTTTGAGAAGAACATTTGGAAGGC TGTCGGTCGAGCTCGAATTCTACAGGTCACTAATACCATCTAAGTAGTTGATTCA TAGTGACTGCATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAA TCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTATTAT. ACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGT CACTATCAGTCAAAATAAAATCATTATTTGGAGCTCCATGGTAGCGTTAACGCGG CCGCGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAG CTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATAT. CATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTAT GAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGC. TGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACA. ATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCA. AAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGA CGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCA TGGTTACTCACCACTGCGATCCCCGGAAMAACAGCATTCCAGGTATTAGAAGAAT ATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTT GCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCG CTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGA CGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTITG CCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTAT TTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCA GACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTC ATTACAGAAACGGC CAAAAATATGGTATTGATAATCCTGATATGAATAAA TTGCAGTTTCATTTGATGCTCGATGAG CTAATCAGAATTGGTTAATTGGTT GTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACC. AAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAA AAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCA AACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACC AACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTC CTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTA CATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTC GTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTC GGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACAC. CGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGG GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCA CGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCG CCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTA TGGAAAAACGCCAGCAACGCGGCC |ACGGTTCCTGGCCTTTTGCTGGCCTT TTGCTCACATGTT SEQ ID NO: 158 FIG.30BU.S. Patent Apr. 1, 2008 Sheet 41 of 78 US 7,351,578 B2 CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTT TGAGTGAG CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGG ‘AAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCA ACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAG GCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGG CGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCG GCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAA AGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTAC. TCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACG GCCAGTCTTAAGCTCGGGCCCGCGTTAACGCTACCATGGAGCTCCAAATAATGAT TTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTT TTATAATGCCAACTTTGTATAGAAAAGT TGAACGAGAAACGTAAAATGATATAA ATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAA AACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTG TAGAATTCGAGCTCGACCGACAGCCTTCCAAATGTTCTTCTCAAACGGAATCGTC GTATCCAGCCTACTCGCTATTGTCCTCAATGCCGTATTAAATCATAAAAAGAAAT AAGAAAAAGAGGTGCGAGCCTCTTTTTTGTGTGACAAAATAAAAACATCTACCTA TTCATATACGCTAGTGTCATAGTCCTGAAAATCATCTGCATCAAGAACAATTTCA CAACTCTTATACTTTICTCTTACAAGTCGTICGGCTICATCTGGATTTTCAGCCTCT ATACTTACTAAACGTGATAAAGTTTCTGTAATTTCTACTGTATCGACCTGCAGACT GGCTGTGTATAAGGGAGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGC Gi GATGTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCCCGATAACGG AGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCGAT ATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACGTGCACT GGCCAGGGEGATCACCATCCGTCGCCCGGGCGTGTCAATAATATCACTCTGTACA TCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCA TTTCACCAGTCCCTGTTCTCGTCAGCAAAAGAGCCGTTCATTTCAATAAACCGGG CGACCTCAGCCATCCCTTCCTGATTTTCCGCTT TCCAGCGTTCGGCACGCAGACG ACGGGCTTCATTCTGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATAT ATGCCTTGAGCAACTGATAGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTT CATAGCACACCTCTTTTTGACATACTICGGGTATACATATCAGTATATATTCTTAT AGCGCAAAAATCAGCGCGCAAATACGCATACTGTTATCTGGCTTTTAGTAAGCCG GATCCACGCGATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATICAT TAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGATGAACCTGAATCG CCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAAC GGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACT CACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAA ATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAAC TGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCT CATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGT CTTTCATTGCCATACGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTG AATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCC GTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATG CCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT FIG.31AU.S. Patent Apr. 1, 2008 Sheet 42 of 78 US 7,351,578 B2 GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAA ATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTG CCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACA GGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATIC GGCGCAAAGTGCGTCGGGTGATGCTGCCAACTTAGTCGACGCTCTAGAGCTCCA AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAG CAATGC |ATAATGCCAACTTTGTACAAAAAAGTTGAACGAGAAACGTAAA ATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATA, ATACTGTAAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATT. AGTGACCTGTAGAATTCGAGCTCTAGAGCTGCAGGGCGGCCGCGATATCCCCTAT AGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTC AAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAA ACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGG GAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATA. AATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGG. GAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAA TGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTT CCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTG CGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTG AAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTT ‘TGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACG AATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGG CCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATT CAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTA GACGAGGGGAA ATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGAT CTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCT TITTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGA TGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAG CATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTG AGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTT CTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTT TCCGAAG GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGT AGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCT AATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGT TCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTA. CAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAG GTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGG GGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTT TCGCCACCTCTGACTTGAG CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGC AACGCGGCC ‘ACGGTTCCTGGCCTITTGCTGGCCTTTTGCTCACATGTT SEQ ID NO: 159 FIG.31BU.S. Patent Apr. 1, 2008 Sheet 43 of 78 US 7,351,578 B2 GTAAAACGACGGCCAGTGAATTATCAACTTTGTATAGAAAAGT TGTTATGACAAC TTGACGGCTACATCATTCACTTITTCTTCACAACCGGCACGGAACTCGCTCGGGC TGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACC AACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTT CGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGC TGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACG CTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCT CGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCG CCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCT TCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGT GCGCTTCATCCGEGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAA GCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATT CGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCA AAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTG ACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATA AMAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGG GCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTT TCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTG CCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTA TTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACA AAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCAC ACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCT TTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGA ATTAACCATGCCAAGTTTGTACAAAAAAGCAGGCTCATTTAACTTTAAGAAGGAG ATATATACCATGGTCCGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCG ACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTG: GTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAGTTTTAA CGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAG CGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCG ATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGC ATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGG GAAAAGTGTACGTATCACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATC CCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAAAGCAGTCTTACTTC CATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGC CGAACACCTGGGTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTA ACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCAGCGTTGAACT GCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTT GCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTG ‘TGCGTCACAGCCAAAAGCCAGACAGAGTGTGATATCTACCCGCTTCGCGTCGGC ATCCGGTCAGTGGCAGTGAAGGGCGAACAGTTCCTGATTAACCACAAACCGTTCT ACTTTACTGGCTTTGGTCGTCATGAAGATGCGGACTTACGTGGCAAAGGATTCGA TAACGTGCTGATGGTGCACGACCACGCATTAATGGACTGGATTGGGGCCAACTCC TACCGTACCTCGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAAC ATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTITAGGC FIG.32AU.S. Patent Apr. 1, 2008 Sheet 44 of 78 US 7,351,578 B2 ATTGGTTTCGAAGCGGGCAACAAGCCGAAAGAACTGTACAGCGAAGAGGCAGTC AACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAGCGCGTG ACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCC GTCCGCAAGGTGCACGGGAATATTTCGCGCCACTGGCGGAAGCAACGCGTAAAC TCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGCTCACAC CGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGG TATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTT CTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAATACGGCGTG GATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTAT CAGTGTGCATGGCTGGATATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCG TCGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGCAAGGCATATTGCG CGTTGGCGGTAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGC GGCTTTTCTGCTGCAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAG CAGGGAGGCAAACAATGATACCCAGCTTTCTTGTACAAAGTGGAGGAAACAGCT ATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC GGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAA CCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTG AATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATITC ACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGCAACTT TATTATACAAAGTTGATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGA AATTGTTATCCGCTCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACA GAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGEC CAGGAACCGTAAAAAGGCCGCGTTGCTGGCG ‘CCATAGGCTCCGCCCCCCT GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGA. CTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCC GACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCG CTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGT AACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAG CCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGC TCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCA GAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTICTACGGGGTCTGACGCTCA GTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGAT CTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATAT ATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTC. AGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACT ACGATACGGGAGGGCTTACCATCTGGCCCCAGTECTGCAATGATACCGCGAGAC CCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCC GAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGC CATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCT CCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGC FIG.32BU.S. Patent Apr. 1, 2008 Sheet 45 of 78 US 7,351,578 B2 GGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTA TCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAG ATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATG CGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATA GCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAAC TGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAA GGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTC ATACTCTTCC CAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAG CGGATACATATTTGAATGTATT TAGAAAAATAAACAAATAGGGGTTCCGCGCAC ATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTA ACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATG ACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTA AGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGG GTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCAC CATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGG CGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCT CTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTG GGTAACGCCAGGGTTTTCCCAGTCACGACGTT SEQ ID NO: 160 FIG.32CUS 7,351,578 B2 Sheet 46 of 78 Apr. 1, 2008 U.S. Patent eels 109—yuausaja—yyad aspuoy) yy] Zura 1s304 quaulaje—G X quawaje—CuINad a FE) 1 upy Huo 109 uuNad auog uoissaidxq 40}99A, uonouyseg souo|) AnuzUS 7,351,578 B2 Sheet 47 of 78 Apr. 1, 2008 U.S. Patent ve dla 109 —yuawiaja—Gdx3d {duo} —“v0 a ca 1a +a aspuoy) Y1 | cupy—1s3ad {dwio} 0 Asa yoo gpoo ve 109 YINad le upy {uo quawiaja—cyINad quawia|a—GyINad auolg uolssaudx3 40}0a, uonounseg sauo|) AquqU.S. Patent Apr. 1, 2008 Sheet 48 of 78 US 7,351,578 B2 BA BI B2 ZN promoter Yj] ssGus__ Lo Fam] FIG.35U.S. Patent Apr. 1, 2008 Sheet 49 of 78 US 7,351,578 B2 4000 bp 3000 bp 2000 bp 1650 bp 1000 bp 500 bp FIG.36U.S. Patent Apr. 1, 2008 Sheet 50 of 78 US 7,351,578 B2 B4 BI B2 B3 Y Al promoter ss GUS Z ss alacZi9U.S. Patent Apr. 1, 2008 Sheet 51 of 78 US 7,351,578 B2 4000 bp 3000 bp 2000 bp 1650 bp 1000 bp 500 bp FIG.38U.S. Patent Apr. 1, 2008 Sheet 52 of 78 US 7,351,578 B2 20 N Final spermidine concentration FIG.39 sg2eeege¢sgRgee2e° aor oH aA = ayojd sad # Auojoo 100U.S. Patent Apr. 1, 2008 Sheet 53 of 78 US 7,351,578 B2 10.5 FIG.40 Final spermidine concentration (mM) a) | 2 ~ T —+—+ ~ om» Mm PP © PM © WwW 2 £& 8 BS 8 ae ayojd sad ff AuojooU.S. Patent Apr. 1, 2008 Sheet 54 of 78 US 7,351,578 B2 FIG.41AU.S. Patent Apr. 1, 2008 Sheet 55 of 78 US 7,351,578 B2 M13 Rev primer = M13 fwd primer FIG.41BU.S. Patent Apr. 1, 2008 Sheet 56 of 78 US 7,351,578 B2 M13F (-20) M13F (-40) P(BLA) APr M13R (-24) M13R (-48) FIG.41CU.S. Patent Apr. 1, 2008 Sheet 57 of 78 US 7,351,578 B2 M13F (-20) M13R (-48) FIG.41DU.S. Patent Apr. 1, 2008 Sheet 58 of 78 US 7,351,578 B2 M13 (~20) att B4 AmpR —, po % Al promoter +rbs+ A att Bt M13R (-24) att B3 ss alpha lacZ19 att B2 FIG.41EUS 7,351,578 B2 Sheet 59 of 78 Apr. 1, 2008 U.S. Patent Vev Old auojo uolssaidxa go Jo yonpod auo}d J0}9@A yonpoud—Aq Agua JoUOp Yd pexudy — Gyo AL 8 Za WAT aub WZ] », 280U0Nd8 (“YAP ) + (Aw Za apo ayo Te THe dy ayo go aoUS 7,351,578 B2 Sheet 60 of 78 Apr. 1, 2008 U.S. Patent dev Old auojo 40yaA auojo yonposd—Aq uoissaudxa uo}ounsap Ayue YALE |Z YA ab ZZ) y, Sul (YA Za YA aueb Za dye ayo ayo ayo ayo uno Two TeUS 7,351,578 B2 Sheet 61 of 78 Apr. 1, 2008 U.S. Patent €v' dls auoj9 uoissaidxa Jno) yo }~f duo) me jquaulaja—¢ | ZaHO auab [ano] yuawaje—G] yan SM yy 280K). YT | a 0 {duo Suey ylszad Cao [apo] __[ yo rane [uoy}{ Ho C3 auab—yinad 710] auab | 1140) X X CTO] WHURS=T an 1y770 | Weusa|a—S ty 190) yuawiaje—cy Nad uD} 0 C wou s-aue {uy} 0 > auo|g uoissaudxy 40), uonDunsag sauoj) AjuqUS 7,351,578 B2 Sheet 62 of 78 Apr. 1, 2008 U.S. Patent SOSSYOOWOLLILLIOLVOWWWELLD-$4 Y9T FON GL 03S yyy sna SILLS yonpoud-£g ——le ue 4ojoan---36ly-oyWOLLI SIWIYOWYOLIS-S4N---40}984 ——auo|> voq2an---9¢ty-91 19 MOVSE ww9-S4N---yojen Aug €9T *ON GI 03S ude _ a7. (uo. ly Ty-wvOLUlLouvivavwvOL19-S4N---JoI294 YT d-pd : WOWWOLIS Fe aN : 291 *0N QI D3S 2ETy-SLLOMERIVISLLOWYI-SAI-——vornan ANDO quawe[3,¢ -g4eUS 7,351,578 B2 Sheet 63 of 78 Apr. 1, 2008 U.S. Patent ‘891 ‘ON GI 03S £91 ‘ON GI Das oyen---Sly-yo ovo 15 4oy2an---Sty- 95, 9¥eVOVLOLL 7m WOWWOILLD9009 apnpoud-£g aua6-g27eUS 7,351,578 B2 Sheet 64 of 78 Apr. 1, 2008 U.S. Patent OLT *ON GI 03S 2524019 a eq7e t woqoan”"“S4y-syyLupiviwnywOLL-2ey-—. 4oy20n---Shy-91 1S WVVIVLLYLLIIWO-22t 69T °ON GI bas ‘SOOSWOWVO.LLL SIM ‘O0LSLLSWYOWLY LL aonpoud-fg ---yoI99N—auo|9 |---40}98A Aaqu3 J --JOA d-¥ed -aonoeh | uNOGd usu 3, “eeUS 7,351,578 B2 Sheet 65 of 78 Apr. 1, 2008 U.S. Patent ban auojo Ayua ¢ yy VZV Old 40}09A Uld-rd yonpod yQq pexudy wiynoad = Layo puo ano ZA WZZL », Sud ZAZA + (AZ) aldo ydy0 ayo yaoUS 7,351,578 B2 Sheet 66 of 78 Apr. 1, 2008 U.S. Patent aZv'Sls yonposd Yod Paxudy = ggHO pu Zano + (ZZ J0}99A auojo Gd-Y2d Aqua ¢ wm yNoad GY [ava BZ, wy 28001) dd GF 9p | smo ZdnO cao (zd gay canUS 7,351,578 B2 Sheet 67 of 78 Apr. 1, 2008 U.S. Patent 8y'Dls auoj Anuy | 40}92A » OdO1-UINId J0}99A y, YINAd 40,984 |ZZ yy YNOGd Oyu! au0}) oyu! auo|) WIM auiquiooay | A auojo YNG2~ auojd uolssaudxe—gyj yuewibosy awézue = payunyy 7g 70 Jo yonpoid YOd yonpod Yod uojoused pud gyO — pexUdy. 7q}D pUud gD | (quawBo1y yNG 4ayjo JO ‘AiDqiIYNG? ‘YNG o1woUab ‘yNGo) yulod AquZUS 7,351,578 B2 Sheet 68 of 78 Apr. 1, 2008 U.S. Patent SLT :ON GI 03S LT *ON GI 03S €ZT ‘ON GI 03S .£--(aouanbas 914 ,9ads-a9e | dwa9)--NNT- & C ( 6y'Dls yrze ‘@ouanbas D1419ads-33e [dule}) --NNJ=LI9-WWW- WOV-LVI-SLL- Lov-VoV-9999- .G 2a778 aouanbas 31 419ads-a3e | due) --NNO-919- WW OVL-OLL-d1L-199-Wov-9999- .S tae WWW SvI-S11- 15¥-WV-9999- .$ vee zan7e 19792US 7,351,578 B2 Sheet 69 of 78 Apr. 1, 2008 U.S. Patent Lit BLT *ON GI 03S 20N GI 03S QLT ON GI DaS if og'Dld eqge .€--(aouanbas 914 L9ads-33e | due) --N5T-LOV-WL- WW -WLo-LL1-oW- -9999-.S 2gi7e (aguanbas 14 L9ads-3e | duwa9) - -NIQ-951-JOV-W9-WI-V19- LII-J¥I~J¥-9999- .S 19742 .€--(aouanbas 9141938ds-33e | dad) --N5T-LW-Wo- Wid LLL. Car7e 29772 Te77eUS 7,351,578 B2 Sheet 70 of 78 Apr. 1, 2008 U.S. Patent 6ZT :ON GI bas VLGOld OVOOLIOLL LOLIOVLVIL JOLWIVLIWL SOLOVOLOvL WLIIIIIWLW 9999999999 £00E aus Bulwlid asuaney CIN ee ALDIWIVS9L DWOLWWIWSD WIOIWWOLVO LIV LV LW DVIOLIOVIY LILIOVOOLL WOVISLIDV SLSVLLVI99 LVOVLIDVLI WWOLWOLWL £762 QUOVILSOWL VLOLIOLOLL LIVOVOLVLL VISLVOLII9 LULLWI59 WLUW QWOLSVIDLY LVIWWOVOVY WLOLOWLWY LVOVLOVOYD WWW WWLWO9 LLLIVOVLLY £882 Tae LIVWLVIVLL SVIVLLIWIV LOVLLLIWI9 LULD199L19 Ww WLIVIVIW OIVLVWLVL VOLWWWL9D WWWOVOIWS LID WY WwW VL S282 isr4 ML VIV IW VOL L9S9VLIVL VwYWWWOOVL LOW WODDLWWLW LILILLO9LW TS9 I LSOLIVIOVY LLISLL9OVY I9VVOVODLD VOLWLIVOL WYWIWWWWL OWLLVLLL99 VOOWLVOLL WVOWWIDLL SOLISLIIVD ADVIVOLIVD LLLIVILLIY SLvWIWw9D T6S L9OV99LVIO VLIBIWLLD 9900099901 IOVVLLD. ays SulwLsd (02) PIEMIOS ETHUS 7,351,578 B2 Sheet 71 of 78 Apr. 1, 2008 U.S. Patent alo°Dld OST °ON GI 03S = DOLLWIVLID IWOLOLOLWY WOLDL9190 II99LILI9¥ I9DLIDLLID LOOV.LWD. €20€ ays Burllud asieney ETH ee SOLIOVLISD WWWLWWLOVL LLIWLLLIOW AVOVLIVIDD LOVOLOVIVL DIDDLWLVOL IOVIOLVIID LLLWLIVOLW WWWLYWYWOL £962 cHIe DLDWAVOLOV JOLOLIIOLL SOWOWWLL SVLWOOWL SDLILILIWL WL 999 Jvd SVILVLIVIL SOVIVVOIWY JOLIOLUIWY SIVLLISLIY ISVWWOWLW LIV 999 S19 7062 i E82 rae 1s9 VOL 199 OWL LWIVWWWWW9 QWLLSOLIVL OWILLLSILS IvWISWOVS SLOvILWLOW 19V VOD SLV WIVLLILLID SIVWOSVOLVY SLIVWWOVWD DLLODLIOLD IWOLOWLVOL 16S EEE SLOW WLW WILOVLIVLL 199999999" WWOLLLIWIL LIWOLVWLWY ¥999999991 ISWLLI. ayLs BuLwLs (02-) PueMO4 ETWUS 7,351,578 B2 Sheet 72 of 78 Apr. 1, 2008 U.S. Patent T8T ‘ON GI 03S OLG'Dld 49099199 LLISLOOVIY DLQO.VOVLL VI9OLOVDLD WIvLII9OL¥ 4v99990990 Too 11S Bulultsd as4anay ETH —EEE LOOWWIVWWL SVLLLIVILL LOVOLSVLV9 L9VODIDLLO SOWLIO0OV LODLVIDLI9 VOOLLIVLLY LWVLYWY VOLSVOLVL9 VOLSSVIWS 1h6z g199e DLIQOWOW WILOVLYvOD WWLOOLLUL JWLWL999 WO LLL QWVODLLOLL LWWOLVLLOD LIVOOWWWWY VLVLLVO59 LO Ww OWL VL vez 6882 a] Le SIV JW SW VOL LSvv9aV) VwvoOIWY Ov WOLLSOLD LLLOOWLLLL ITZ JSVIVLVWL VIOWLVLVL LWVLLVOVL LLLOOVIWWY WWOVOVOLV JVLVWIVOLD VOLWWLLLY JVOLIWIWIY VLUWULOLY WWWOSIWLLL LILSLOLSVL SLWLIWISVD TS9 zyage AWWWWOVOVY OVLVLOOVDL QVOLVLOVVL IWVOLVOLIY SVISDIVIIY SLSVOOLOLY WILLISLOLL SLWIVISLIV SLOVIVILLY SLIOWLOWWL DLVIVIWWL JvILOOVOWL 16S DLLW9D199 VOVIOLIOVI 9190099991 IOVVLIDLDY I99VOOWW WH 21s Bulwiad (2-) PIEMIOY CTHUS 7,351,578 B2 Sheet 73 of 78 Apr. 1, 2008 U.S. Patent 281 :ON GI Das cg Old DOLLLVDLS VIDLVLVID SVIDIOWLWY JWWLLLIWIV IVODVWWIVD ILVLOVIIVL DOVWILIWI LIDVILWLID ILIDIIWLL SLIVWWOLSL DLIDILLSLI SvVIVOLODLV S88T a4LS BULWLId aSJONOY ETH €8772 SVLLVIOIOV VIOLVLOWWD LL) SURAT) BENE) 3 1) a) eee 2H 72 ey ey a eee ono) LOWOILVLL W9LDVIIND IVIL T aqLs Butwiud (Qz-) Puemso4 ETHUS 7,351,578 B2 Sheet 74 of 78 Apr. 1, 2008 U.S. Patent e€g°Old esianay CIN EIERZ yao] ape paDMJO4 pupys Aunjuawa|dwoo = (9) pLLy-l0Ly S9soq OB6E-1Z1¢ s8s0q :eueb aoun;sisay BS0f-ZrOe sesoq (9) 6L67-BPLZ SeSDq :9yS UOnDUIqUIOIAD YLq}D (0) 282-8281 sesoq :auab sounjsisas jooluaydupuojy9 (2) 981-1811 sasoq :aua6 gpoo (©) $28-26G ses0g :ays uonoUiquiovas $4770 Zeg—Leg $980q :2ys Bud (9Z-) puOMIOS C1 Guo ond (2) O£¢-Z2p sesoq :2ouanbas yonDujUe, UORduOsUD || gu (2) $62-992 sesoq :eouenbas uonDuluey uoRduosuDA 7] gu sepyoajonu {2c Uld-td yYNOGd 40} suewwogUS 7,351,578 B2 Sheet 75 of 78 Apr. 1, 2008 U.S. Patent vals uo ond asronay [Cdn yy cin PuDMUOy fi ] punsys Aipyuawejdwoo = (9) 9SL>-E80r s0s0q Z296E-€G1¢ SesDq rauab QOUD}SISAJ UIDAWDUDY () ov0e-p20E sas0q :oys Bud osieney C1 (2) Ze6z-1s2z $9809 :24}90 (9) $067—-rrBL sesdq :eueb aounjsises jooluayduinsojy9 0) 5 cd (2) Zosi-Z611 sasoq :auab gpoo 408-079 $9809 +1470 ZgG-Z¢G sesoq :ays Bud (9¢—) puomioy CLW (°) O2%-ZZp sesdq :eouenbes uoDUIWe} UoRdUOsUD.) |) Qua (2) ¢6z-g92 sasoq :eouanbes uonpulue} uonduosunyy 7] guy Sapnoajonu EG/y 122 jyYNOGd 40} spwauw0)US 7,351,578 B2 Sheet 76 of 78 Apr. 1, 2008 U.S. Patent gg°Old asioney [£42 Elza cin paM1o4 cin ySOP-BEOE sasoq says Bt LLEZ—9¥L2 SAS0q :2418 UO} ZPLI-E801 Sesoq :euab eounjsise, 228-165 sasoq puns Aipyuawajdwoo = (9) OLL¥-L60r $9509 :uibuo ond 9L6¢-L91¢ s9s0q ‘ouab dounysisa1 ulowoUDy wud asian C1W iquiosal ¢4}}0 68-802 $9809 :eueb gp20 iuayduos0}y) uonDuiquiodas YZ }70 ZGG-LEG sesoq :oys Burund (QZ—) puomuol CIN £d (9) O£¥-ZZ¥ sesoq :eouanbes uonou! (2) s6z—-g9z sesoq :eouanbas uonot 9} uoNdudsuDN, |) Quay sapyoajonu EZLy ‘UZd_ yy YNOAd 10) syuaww0gUS 7,351,578 B2 Sheet 77 of 78 Apr. 1, 2008 U.S. Patent 9g°Dl4 asianay cin Sao ytd 7H? | pipMI04 cin puns Ainjuawajdwoos = (0) (®) 69ze-1z9¢ (2) o29¢-018% ses0q :eua6 eounys! sasog uajowoud 0/9 isa1 (019) unjtordusy 992-265} sesoq :uibuo ond ¥061-7881 Sas0q :oys buwud asioney C1W, (2) B981—rrZ) sesoq says 401-660! LSO01-86¢ sesdq :auab adun}s! Br1—SZ_Sas0q :2ys 9I-| sasoq :oys bud eure al UORDUIGUIOIA! $y yD |, sasoq :euab gp99 1801 jooluaydUiDsojy UonDUIquiod=! 44770 (02-) pupmo EL Sapyosjonu ByZy INOGd 40) syuauiW07US 7,351,578 B2 Sheet 78 of 78 Apr. 1, 2008 U.S. Patent £9°Dld puoys Ainyuewe|dwos = (9) 9S~G esDq OZ! (2) 61¥G-12eg sasoq siajowod 019 (2) ozes-0g9y sesoq :ueb ounjsises (07) umpordury Sler-Zrge s9s0q :uibuo ond ySGe—-Bege sesoq ‘os Buiwud esianey C1 BISC-BEPE SeSDq ‘YS UO! quioval $9 77D LGPE-C91E Sasoq :auab 0720/ Z9LE-ZhHIE S9sDq :9ys UOHDUIqUIODE! 7g }HO L6ZI-CLZL Se8Dq :2YS uo} 9221-8611 $8s0q ssejoWoud | LE\e—-v6Z1 Sasoq :auab snb 8SZI-Ssz1_sas0q :oys buy JOZI-£914 ses0q :uosGer Z} puo |) asourgo.y Q9L1-ES11 sasoq :ays Supuiq ayo ZELI-LELL $880q :uoibes soyo1edo | q asoulqnsy 696-756 sesDq (2) 926-99 sasoq :3u0 omy Gr-SZ SasDq :a}!S uoNDUIquODas 4g 70 | sasog cays Buywud (9Z-) puomioy ¢LW Sapnoajonu g6BS gl- asreney ayo [pzoor zano| sn6] reno] a] Quo |vano pubmio4 cin clW | 9/SWd 40) sjuauii0)US 7,351,578 B2 1 USE OF MULTIPLE RECOMBINATION SITES WITH UNIQUE SPECIFICITY IN RECOMBINATIONAL CLONING CROSS-REFERENCE TO RELATED "APPLICATIONS, ‘The present application claims the benefit of the fling date of US. Provisional Application No. 60/402,920, fled Aug. 14, 2002. The prosent application also is a contin tion-in-part of, and elaims the benefit under 95 USC. § 120 ‘of, U.S. application Ser. No.09/732.914, filed Dec. 11,2000, Which claims the benefit ofthe filing dates of U.S. Provi sional Application No. 60/169.083, filed Dec. 10, 1999, and 60/188,020, filed Mar, 9, 2000, The disclosures of all of these referenced applications are incorporated herein by reference in thei entieeies, BACKGROUND OF THE INVENTION 1, Field of the Invention ‘The preseat invention relates to the felds of bioteehnol- ‘ogy and molecular biology. In particular, the present inven- tion relates to joining multiple nucleic acd molecules con- ining recombination sites, preferably using recombination * sites having a unique specificity. The present invention also relates to cloning such joined nucleic acid molecules using recombination cloning methods. The invention also relates ‘o joining multiple peptides, and combinations of peptides ‘and nucleic acid molecules through the use of recombination sites. Other molecules and compounds or combinations of molecules and compounds may also be joined tough recombination sites according to the invention. Sech pep- tides, nveleie acids and other molecules andor eompotnds (or combinations thereof) may also be joined or bound through recombination To oe oF a number of supports oF structures in accordance with the invention, 2. Related Ant Site Specie Recombinases Sitespecitc recombinases ae proteins that are present in ‘many organisms (eg, Viruses and bacteria) and have been ‘characterized as having both endonuclease and ligase prop- ‘erties. These recombinases (along with associated proteins Jn some cases) recognize specific sequences of bases in 2 nucleic acid molecule and exchange the nucleic acid seg- ments flanking those sequences, The recombinases and ‘associated proteins are collectively relered to a8 “recombi nation proteins” (see, eg. Landy. A. Current Opinion in Biotechnology 3:699-707 (1993), Numerous recombination systems from various organ- isms have been described. See, eg. Hoess, etal, Nucleic Acids Research 14(6):2287 (1986); Abremsi, eal J. Biol Chem 26111391 (1986); Campbell, J. Bacteriol. 17423) 7495 (1992): Qian, et al, J. Biol, Chem. 267(11):7794 (1992); Araki tal, Jc Mol. Biol 225(1):25 (1992); Maser ‘and Kahnmann, Mol. Gen. Genet. 230:170-176) (1991) Esposito, eta, Nucl. Acids Res, 25(18):3605 (1997), Many ‘of these belong to the integrase family of recombinases (Aruos et al, EMBO J 5:433-440 (1986); Vozivanov, etal. ‘Nuc. cid Res, 27930 (1999) Pethaps the best studied of these are the Integraslatt system from bacteriophage (Landy, A. Current Opinions in Geneties and Devel. 689- 707 (1993), the CrelloxP system from bacteriophage PI (Hess and Abremski (1990) In Nucleic eds and Molecu- Jar Biolog vo. 4, Pds: Pekstein an Lilley, Bedin-Heidel- bem: Springer-Verlag: pp. 90-108), and the FLP/FRT system 0 o 2 from the Saccharomyces. cerevisiae 24 circle plasmid (broach, etal. Cell 29:227-234 (1982) ‘Transposons Transposons are mobile genetic elements, Transposons are structurally variable, being deseribed as simple or com- pound, but typically encode a transposition catalyzing fenzyie, termed a trnsposase, Manked by DNA sequences ‘ganized in inverted orientations. For more thorough ‘cussion of the chantcteristics of transposons, one may ‘consult Mobile Genetic Elements, D.J. Sheratt, Fd, Oxford University Press (1995) and Mobile DN, DF. Beng and M. 'M. Howe, Fs, American Society for Microbiology (1989), ‘Washington, D.C. both of which are specifically incorpo: ‘ted herein by relerenee. ‘Transposons have been used to insert DNA into target DNA. As a general rule, the insertion of transposons into target DNA is a mndom event. One exception to this re is the insertion of transposon Tu. Transposon Th? can inte- arate itsl! into a specific site in the Z coli enome os one part of is life eyele (Stellwagen, A. B., and Crag, N. L. Tronds in Biochemical Sciences 28, 486-490, 1998 speci cally incorporated herein by reference). This site specific insertion has been used in vivo to manipulate the bactlovi- ris genome (Lacklow et al, J. Fro. 67:4566-4579 (1993) specifically incomporated herein by reference). The site Steciiy of Ta? alypial of transposable elements whose hallmark s movement to random positions in acceptor DNA ‘molecules. For the purposes of this application, transposition will be used to reer to random or quasi-undom movement, unless otherwise specifiod, whereas recombination will be ‘used to refer to site specie recombination evens, Thus, the site specific insertion of Ta7 into the atTa 7 site would be referred to as a recombination event while the random insertion of Ta7 would be referred to as 2 tansposition event, York, et al. (Nucleic Acids Research, 26(8): 1927-1933, (1998) disclose an in vitro method fo the generation of ‘ested deletions based! upon an intramolecular transposition within a plasmid using TaS, A vector containing a Kana cin resistance gene flanked by two 19 base pair Tn trans- posuse recognition sequences and a target DNA sequence ‘was incubated in vitro inthe presence of purified transposase protein, Under the conditions of low DNA coneeatration employed, the intramolecular transposition reaction was favored and was successfully used to generate a set of nested deletions in the target DNA. The authors suggested that this system might be used to generate C-temninal truncations in protein encoded by the target DNA by the inchision of stop ‘ignals in all thre reading frames adjacent to the recognition sequences. In addition, the authors suggested thatthe ineli- sion ofa is tag and kinase region might be used lo generate N-terminal deletion proteins for further analysis, Devine, etal, (Nucleic Acids Research, 2237653772 (1994) and US Pat, Nos, 5,677,170 and 5,843,772, all of ‘which are specifially incorporated herein by” reference) disclose the construction of artificial trinsposons for the insertion of DNA segments into recipient DNA molecules ia vitro, The system makes use of the insertion-catalyzing cenzyime of yeast TYI virus-like particles as a source of ‘ransposase activity, The DNA sezment of interest is cloned, using standard methods, between the ends ofthe transposon Iike element TY1. In the presence of the TY1 inserion- catalyzing enzyme, the resulting element integrates ran- domly into a second target DNA molecule. ‘Another class of mobile genetic elements are integrons Integrons generally consist of 4 5'- and a 3-conservedUS 7,351,578 B2 3 sequence flanking a variable sequence. Typically, the S00 erved sequence contains the coding information for an integrase protein, The integrase protein may catalyze si recombination at a variety of recombination sites Including at, atC as well as other types of sites (see Francia s tal, J, Bacteriology 18121): 6844-6849, 1999, and refer. fences cited therein). Recombination Sites ‘Whether the reactions discussed above are termed reco bination, transposition or integration and are catalyzed by & recombinase or integrase, they share the Key feature of recognition saquences, often temed “recombination sites" on the nucleic acid molecules participating in the reactions, These recombination sites ate sections or seg- ments of nucleic acid on the participating nucleic acid ‘molecules that are ecognized and bound by the recombi nation proteins during the initial stages of integration or recombination, For example, the revombination site For Cre recombinase is 1oxP which is a 34 base pair sequence ‘comprised of two 13 base pair inverted repeats (serving a5 the recombinase binding sites) Banking an 8 base pair core sequence. (See FIG. 1 of Sauer, B. Cuvx Opin. Biotech 5:521-527(1994).) Other examples of recognition sequences include the attB, at. att, and atfR sequences ‘which are recognized by the recombination protein > Int (Bis an approximately 25 base pair sequence containing ‘v0 9 base pair coe-type Int binding sites and a 7 base pair ‘overlap region, while a isan approximately 240 base pai Sequence containing core-type Int binding sites and arm- type Int binding sites as well a sites Tor auxiliary proteins Inegration host factor (IHF), FIS and excisionase (X is). (See Landy, Curr. Opin. Biotech, 3699-707 (1993)) Stop Codons and Suppressor (RNAS Tree codons are used by both eukaryotes and prokary~ ‘testo signa the end of gene. When transcribe into MRNA, the codons have the following sequences: UAG (amber) UGA (opal) and UAA (ochre). Under most circumstances, the cel daes not contain any 1RNA molecules that recognize these eodans. Thus, when a ribosome translating an miNA reaches one ofthese codons, the ibosome stalls and falls of the RNA, temninating translation ofthe mRNA. The release ‘of the riboscme from the mRNA is mediated by specific Factors (See S. Mottaui-Tabar, NAR 26(11), 2789, 1998). ene with an in-frame stop codon (TAA, TAG, or TGA) will ‘ondinariy encode a protein with a native eaboxy terminus, However, suppressor 1RNAS, can result inthe insertion of ‘amino acids and continuation of translation past stop codons ‘Motant RNA molecules that recognize what are ordi nary stop codons suppress the termination of translation of an mRNA molecule and are termed suppressor (RNAS. A umber of such suppressor IRNAS have been found. Examples inchide, but are not limited to, the supP, sup? supD, supF and supZ suppressors which suppress the ter mination of translation ofthe amber stop codon, supB, aT, supL, sup, sopC and supM suppressors which suppres the Junetion of the ochre stop codon and gly, tepT and Su-9 Which suppress the Function of the opal ‘stop coded. a general, suppressor tRNAs contain one or more mutations in the ant-cadon loop of the RNA that allows the tRNA base pair with a codon that ordinarily functions as © stop ‘odin, The mutant RNA is charged with its cognate amino jd residue and the cognate amino acid resid is inserted ‘nto the translating polypeptide when the stop eodon is ‘encountered. For a more detailed discussion of suppressor RNAS, the reader may consult Epgertsson, et a. (1988) 0 o 4 Microbiological Review 52(3)354-374, and Engleerg- Koka, et al. (1996) in Escherichia colt and Salmonelta Cellular and Molecular Biology, Chapter 60, pps 909-921 Neidharat, etal. eds. ASM Press, Washington, D.C. ‘Motations which enhance the efficiency of tennination suppressors, ie, inerease the rsd through ofthe stop codon, have boen identfiod. These include, but are not lined 10, ulations in the uar gene (also known as the prfA. gene). ‘mutations in the ups gene, mutations inthe sveA, sue and stieC genes, mutations inthe mpsD (ram) and ps (spe) sdenes and mutations in the rplt- gene. ‘Under ordinary circumstances, host cells would not be expected to be healthy i suppression of stop codons is 100 ficient. This is because of the thousands or tens of thou- sands of genes in a genome, a significant frveton will naturally have one of the three stop codons; complete read-through of these would result in ¢ large number of aberrant proteins containing additional amino acid at their carboxy termini. If some level of suppressing (RNA. is present, there is @ race between the incorporation of the ‘aminoacid and the release of the ribosone. Higher levels of RNA may lead w more read-through although other factors, sch as the codon context, ean ivluence the eficeney of suppression. ‘Organisms ordinarily have multiple genes for RNAS ‘Combines with the redundaney of the genetic code (auliple codons for many ofthe amino acids), mutation of one tRNA ‘Bene (oa supprestor RNA status doesnot lead to high levels fof suppression, The TAA stop codon is the strongest, and post dificult fo suppress. The TGA is the weakest, and raturaly (in E.coli) leaks to the extent of 3%. The TAG (amber) codon is relatively tht, with 4 read-through of 1% without suppression. In addition, the amber codon ca be suppressed with eficencies on the order of 50% with naturally occuring suppressor mutans ‘Suppression has boen studied for decades in bacteria snd bacteriophages. In addition, suppression is known in yeas flies, plants and other eukaryote cells inching mammalian calls. For example, Capone, etal. (Molecular and Cellular Biology {9)3059-3067, 1986) demonstrated thet suppres- sor IRNAS derived from mammalian 1RNAS could be used fo suppress a stop codon in mammalian cells copy of the E, col chloramphenicol acetyltansiease (cat) gene having 4 stop codon in place of the codon for serine 27 was ‘ransfocted into mammalian cols along with @ gene encod- ing a human serine RNA which had been mutated t0 form an amber, ochre, or apal suppressor derivative of the gene Shocessfil expression of the eat gene was observed. Aa indveible mammalian amber suppressor has heen used 10 suppress mutation inthe replicase gene of polio vis and cell lines expressing the suppressor were successfully used to propagate the mutated virus (Sedivy, etal, (1987) Cell 50: 379-389). The context effects on the eficiency of sup- prestion of stop codons By suppressor TRNAS fas boca Shown tobe different in mammalian cells as compared oF. coli (Phillips-Jones, etal, (1995) Molecular and Cellular Biology 15(12): 6593-6600, Matin, eta. (1993) Biochemi- cal Society Transactions 21°846851) Since some human diseases are caused by nonsense motations in essential genes he potential of suppression for gene therapy bas Tong ‘been recognized (soe Temple, ct al. (1982) Nanure 296 (6857):537-40). The suppression of single and double non- sense mutations initodaced ito the diphtheria toxin A-gene Ina been used as the basis ofa binary system for toxin gene therapy (Robinson, ct al, (1995) Human Gene Theraps 6:137-143),US 7,351,578 B2 5 ‘Conventional Nucleic Acid Cloning “The cloning of nucleic acid segments curently oeeurs as daly routine in many research Inbs and a a prerequisite step in many genetic analyses. The purpose of these clonings js various, however. two general purposes can be consid- ‘ered: (1) the intial cloning of nucleic acid from larye DNA, for RNA segments (chromosomes, YACs, PCR fragments, MIRNA, ete.) done in a eelative handful of known vectors such as pUC, pGem, pBlueSeript, and (2) the subcloning of these nucleic acid segments into specialized vectors for funetional analysis. A great deal of time and effor is ‘expended both in the tansfer of nucleic acid segments fom, the intial cloning vectors to the more specialized vectors. This tansfer is called subcloning ‘The basie methods for cloning have been known for many ‘years and have changed little daring that time. typical ‘loning protocol is as follows: (1) digest the nucleic acid of interest with one oF two restriction enzymes: (2) gol puri the nucleic acid segment of interest when. known (G) prepare the vector by cutting with appropriate restric tion enzymes, teating with alkaline phosphatase, gel purify ‘ete, 28 appropriate: (G) ligate the nucleie acid segment to the vector, with “appropriate controls to eliminate background of nett and scle-ligated vector, (6) introduce the suing vector into an Ecol host ell (6) pick selected colonies and grow small cultures over- night (7) make nucleic acid minipreps; and (8) analyze the isolated plasmid on agarose gels (oft aller diggnostic restriction enzyme digestion) or by PCR. ‘The specialized veetors used for subcloning. nuclei acid segments are functionally diverse. These include but are not ted (0: vectors for expressing nucleic acid molecules i arious organisms; for regulating nucleic acid molecule ‘expression; for providing tags to aid in protein purification ‘or t allow tracking of proteins in cells: for modifying the ‘cloned nucleic acid segment (ex, penerating deletions): for the synthesis af probes (cg. iboprobes); forthe preparation ‘of templates for neleie acid sequencing; forthe identifica tion of protein coding regions; for the fision of various protein-coding regions; (© provide large amounts of the rueleic acd of intrest, et. It is common that @ particular ‘investigation will involve subeloning the nucleic acid seg- iment of interest into several diferent specialized veetors. ‘As known in the art, simple subclonings can be done in ‘one day (et, the nucleic acid segment isnot large and the restriction sites are compatible wth those ofthe subcloning vector). However, many other subelonings ean take several weeks, especially those involving unknown sequences, long fragments, toxie genes, unsuitable placement of restriction sites, high backgrounds, impure enzymes, ete. One of the most tedious and time consuming type of subcloning involves the sequential addition of several nucleic acid Segments 10 a vector in onder to construct a desired clone. ‘One example ofthis type of cloning isi the constuction of gene targeting vectors. Gene targeting vectors typically Include two nucleic acid segments, each identical 10 2 portion ofthe target gene, Ranking a selectable marker. In ‘onde o construct such a vector, it may be necessary o clone ‘each segment sequentially, ic. first one gene fragment is inserted into the vector, then the selectable marker and thea the sccond fragment of the target gene. This may require & number of digestion, purification, Figation and isolti 0 o 6 steps for each frggment cloned. Subcloning nucleic acid {rapments is thus olen viewed asa chore to be done as few times as possible, Several methods for facilitating the cloning of muck acid segments have heen described, gs in the following references. Ferguson, J, eta, Gene 16:191 (1981) disclose a family of vectors for subcloning fragments of yeast nucleic acids. ‘The vectors encode kanamycin resistance. Clones of longer yeast nucleic acid segments can be partially digested and ligated into the subcloning vector. Ifthe original cloning vector conveys resistance to ampicillin, no purification is necessary prior to transformation, since the seletion willbe {or kanamycin. Hashimoto-Gotoh, et a, Gene 41:12 (1986), disclose f subcloning vector with unigue cloning sites within @ streptomycin sensitivity gene; in a streptomycin-resistant host, only plasmids with inserts or deletions in the dominant sensitivity gene will survive streptomycin selection, ‘Notwithstanding the improvements provided by these methods, traditional subelonings using restriction nd ligase tenzymes are tmte consuming and relatively unreliable. Cor siderable lbor is expended, and if two or more day’ later the sired subelone can not be found among the candidate plasmids, the entire process must then be repeated with fltemative conkitions attempted. ecombinational Cloning Cloning systems that uilize recombination at defined recombination sites have been previously described in the ‘elated applications listed above, and in U.S. application Ser. No. 09/177.387, filed Oct. 23, 1998; US. application Ser. No. 05/517.466, fled Mar. 2, 200 and US. Pat, Nos. ‘5,888,732 and 6,143,557, all of which are specifically incor porated herein by reference In bre, the Garewav™ Cloning System, described in this application and the applications referred to in the related applications section, uilizes vectors ‘that contain atleast one recombination site wo clone desired clic acid molecules in vivo o in vitro. More specially, the system utilizes vectors that contain at last two different site-specific recombination sites based on the bacteriophage Jamba system (eg, atl and att2) that are mutated from the wildtype (at) sites. Fach mutate site has a unique spe ficity for is cognate pariner att site (.e. its binding partner recombination site) ofthe same type (for example at with an, or atL1 with attR1) and will not exoss-eaet with recombination sites of the other mutant type or with the wildtype att site. Different site specificities allow dirce- ‘ional cloning or linkage of desired molecules thus providing desired orientation of the cloned molecules. Nucleie ackt ‘ragments flanked by recombination sites are cloned and subcloned using the Garrway"™ system hy replacing a scl able marker (for example, eedB) tanked by at sites on the recipient plasmid molecule, sometimes termed the Destina- tion Vector Desired clones ae then selected by transforma tion ofa ccdB sensitive host stain and positive selection for marker on the recipient molecule. Similar strategies for negative selection (e.. use of toxie genes) can be used in other organisms such as thymidine kinase (TK) in mammals and insects, ‘Motating specific residues in the core region of the ats can generate lange numberof different at sites. As with the al andl att2 sites utilized in Gartway™%, each additional ‘mutation potentially erestes a novel aft site with unique specificity that will recombine only with its cognate partner at site bearing the same mutation and will not emstreact ‘with any’ other mutant or wild-type at site, Novel mutatedUS 7,351,578 B2 1 at sites (¢,f81-10, aNP1-10,atRI-10 andl tt 1-10) ae ‘describes i. previous patent application Ser. No. 09/517, 4466, filed Mar, 2, 2000, which is specifically incorporated herein by reference. Other recombination sites having unique specificity (i.e. a frst site will rooombine with its ‘corresponding site and will nat recombine or nat substan tally recombine with a second site having a different speci ficty) may be used 10 practice the present invention, Examples of suitable recombination sites inchode, but are not limited to, loxP sites; loxP site mutans, variants or derivatives such as loxPS11 (see USS. Pat No. 5.851,808); fn ies; site mutans, variants or derivatives: disites dit site mutants, variants of derivatives; psi sites: psi site riuians, Variants or derivatives, eer sites; and cer site Intants, variants derivatives. The present invention pro- vides novel methods using such recombination sites t oi ‘oF link muiple nucleic acid molecules or segments and ‘more specifically to clone such multiple segments (e210. three, four, five, seven, ten, twelve, fiteen, twenty, thy. ‘ity, seventy-five, one hundred, Wo hundred, ee.) into one for more vectors (e.g, two, three, four, five, seven, ton, twelve, ete.) containing one or more recombination sites (eg, two, three, four, five, seven, ten, twelve, fifteen twenty, thy, ily, seventy-five, one hundred, two hundred atc), such as any Garewav™ Vector inchuding Destination > Vectors, BRIEF SUMMARY OF THE INVENTION “The present invention generally provides materials and methods for joining or combining two or more (¢., 0, three, four, five, soven, ten, twelve, fifteen, twenty, thy, fit, Seventy-five, one hundred, two hundred, et.) segments ‘or molecules of nucleic acid by the recombination reaction between recombination sits, at least one of which is present ‘on each molecule or segment. Such recombination reactions to join multiple nucleic acid molocules according w the wention may be conducted in vivo (eg, within a cell, tissue, organ or organism) or in vito (eg., cell-free sys- tems), Acconlingly, the invention relates to methods for ‘creating novel or unique combinations of nuceie acid mot- ‘ecules and to the nucleic acid molecules ereated by such methods. The invention also relates to host and host clls ‘comprising the nuclei ac molecules ofthe invention. The invention also relates to kits for earying out the methoxls of the invention, and to compositions for carying out the methods of the invention as well as compositions made While carying out the methods of the inveation “The nvcleie acid molecules ereated by the methods ofthe invention may be used for any purpose known to those skilled inthe art. For example, the nucleic acid molecules of the invention may be used to express proteins or peptides ‘encoded by the nucleic acid molecules and may be used 10 ‘reste novel fusion proteins by expressing different Sequences Tinked by the methods of the invention. Such ‘expression can be accomplished in a cell or by wsing well, Known in vitro expresion/irinseription systems. In. one aspect, at feast one (and preferably fo or more) of the rueleie acid molecules of segments to be joined by the methods of the invention comprise at least eso recombi tion sites, although each molecule may comprise multiple recombination sites (eg, two, thre, four, five, seven, ten, twelve, teen twenty thin, ity, ete). Sueh recombination sites (which may be the same or differant) may be located at Various positions in each nucleic ocd molecule or segment tnd the nucleic acid used in the invention may have various Sizes and be in differet forms including circular super o 8 coiled, linear, and the like, The nuclei acid molecules wsed in the inveation may also comprise one or more vectors or ‘one or more sequences allowing the molevule to function as a vector in a host cell (such as an origin of replication). The ‘nucleic acid molecules of the invention may alsa comprise ‘non-coding segments (¢., intronic, untranslated, or other segments) that serve a structural o other non-expressive Functions In a prefered aspect, the nucleic acid molecules or souments for use ia the invention are linear molecules ‘having atleast one recombination site al or near at least one ‘emnini of the molecule and preferably comprise at least one recombination site at oF near both termini of the molecule In another prefered aspect, when multiple recombination sites are located ona nucleic acid molecule of intrest, such Sites do not substantially recombine or do. not recombine ‘with each other on that molecule. In this embodiment, the corresponding binding partner recombination sites prefer ably are located on one or more other nucleic acid molecules to be linked or joined by the methods of the invention. For instane, a fst nucleic acid molecule used inthe invention ‘may comprise atleast a first and second recombination site fnd a second nucleic acid molecule may comprise atleast a third and fourth recombination site, wherein the first and second sites do not recombine with each other and the third ‘and fourth sites do not recombine with each other, although the fist and thd andlor the second and fourth sites may recombine "The nleic acid molecules to be joined by the methods of the invention (ie, the “staring molecules”) are used 10 produce one or more (eg. 1wo, three, four, five, seven, ten twelve, fifeen, twenty, thiny, fifty, seventy-five, one hun- dred, two hundred, etc) hybrid molecules (eg, the “product raueleic acid molecules") containing all of a portion of the starting molecules. The staring molecules can be any fuclic acid molecule derived from any’ source o produced by-any method. Such molecules may be derived from natural sources (such as eels (eg, prokaryotie cells such as bac- terial cells, eukaryotic cells such as fungal cells (eg. yeast cals), plant cells, animals ells (¢.g., mammalian cells sueh as human cells) etc), viruses, tissues, ompans from any ‘animal oF non-animal source, and organisms) or may be non-natural (eg. derivative nucleic acids) or synbetically erived, Such molecules may also include prokaryotic and cekaryotie vectors, plasmids, ialegration sequences (@. transposons), phage oF viral vectors, phagemid, cos tnd the Tike. The segments or molecules for use in the invention may be produced by any means known to those stalled in the art inclding, but not Fimited to, amplification such as by PCR, isolation from natural sources, chemical synthesis, shearing o restriction digest of larger nucleic acid ‘molecules (such as genomic or eDNA), transcription, reverse transcription and the like, and recombination sites may be added to such molecules by any means known t0 those skilled in the art including ligation of adapters eon- taining recombination sites, attachment with topoisomerases of adapters containing recombination sites, attachment with topoisomerases of adapter primers containing recombinstion sites, amplification or nucleic acid synthesis using primers containing recombination sites, insertion o¢ integration of rueleie acid molecules (eg. tramsponsons of integration soquonces) containing recombination sites et. Ina preferred aspect, the nucleic acid molecnles used in the invention are populations of molecules such as nuclei acid libraries or DNA libraries, ‘Recombination sites for we inthe invention may be say recognition sequence on a nucleic acid molecule whichUS 7,351,578 B2 9 participates in a recombination reaction mediated or eata- lyzed by one or more recombination proteins. In those ‘embodiments of the present invention utilizing more than fone (©, 60, three, four, ive, soven, ten, twelve, fiftsn, twenty, thiny, ity, ete.) recombination sites, such recom bination sites may he the same or different and may rocom- bine with each other or may not recombine or not substan- tially recombine with cach other. Recombination sites ‘contemplated by the invention also include mutants, derivae tives or variants of wildtype or matually occurring recom- bination sites. Preferred recombination site modifications include those that enbiuace recombination, such eahance- ments being selected from the group consisting of substan- tially (2) favoring integrative recombination; (i) favoring ‘excisive recombination; (ji) relieving the requirement for host factor; (iv) increasing the efliciency of eo-inteprate or product formation; and (v) increasing the specificity of ‘co-integrate or procict formation, referred modifications tothe recombination sites include those that enhance recombination specifiy, remove one oF ‘more stop eodons, andor avoid hai-pin formation. Desied ‘modifications ean also be mode tothe recombination sites 0 jnchide desired amino acid changes to the transcription oF translation produet (ez, mRNA or proein) when translation for transeription occurs across the modified recombination > site, Preferred recombination sites used in accordance With the invention include at sites, ft sits, dif sites, psi sites, cor sites, and Tox sites or mutans, derivatives aad variants thereof (or combinations there). Recombination sites con- templated by the invention also inelnde portions of sich recombination sites, Depending on the recombination site Specificity used, the invention allows directional linking of clic acid molecules to provide desired orientations of the Tinked molecules or noa-drectional linking to produce ra ‘dom orientations of the linked molecules. In specific embodiments, the recombination sites which recombine with each other in compositions and used in methods ofthe invention comprise at sites having identical seven basepair overlap regions. In specific embodiments of the invention, the first three nucleotides af these seven base pair overlap regions comprise nucleotide sequences selected trom the group consisting of AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, AGA, AGC, AGG.” AGT, ATA! ATC. ATG: ATT, CAA. CAC, CAG, CAT, CCA,'CCC, CCG, CCT, CGA, CGC, COG, COT CTA, CTC, CTG CTT, GAA, GAC, GAG, GAT, GCA, GCC, GCG, GCT, GGA, GGC, GGG, GGT, GTA, GTC, GTG, GTT, TAA, TAC. TAG, TAT, TCA, TCC, TCG, TCT, TGA, TGC, TGG, TGT, TTA, TTC, TTG, and TTT. ach stating mucleie acid molecule may compris, in addition tone or more recombination sites (est, tree, four, five, seven, ten, twelve, fifteen, twenty, thy, fit. 1 Variety of sequences (or combinations thereo!) ‘nchiding, but not limited to sequences suitable for use as primer sites (eg. sequences which a primer such as Sequencing primer or amplification primer may hybridize t0 initiate nucleic acid synthesis, amplification or sequencing) teanscription or translation signals or regulatory sequences such as promoters oe enhancers, ribosomal binding sites, Kozak sequences, start codons, transcription andor transla ‘ion termination signals such as sop codons (which may be ‘optimally suppressed by one or more suppressor tRNA, molecules), origins of replication, selectable markers, and ‘genes or portions of genes which may be used to create protein fusion (ez, N-terminal or carboxy temninal) sch as alutathione S-iransterase (GST), f-glucuronidase (GUS), histidine tags (HISG), green fluorescent protein (GFP), yel o 10 Jow fuoreseeat protein (YFP), eyan Muorescent prot (CFP), open reading frame (ORF) sequences, and any other sequence of interest which may be desired or used in various molecular biology techniques including sequences for use ia homologous recombination (ee, for use in gene targeting). In one aspect, the invention provides methods for pro- {ducing populations of hybrid nucleic acid molecules com- prising (a) mixing at last fist population of aucleic acid ‘molecules comprising one or more recombination sites With at least ane target nucleic acid molecule comprising one oF ‘more recombination sites and (b) causing some or all ofthe nucleic acid molecules of the at least fist population to recombine with all or some of the target nucleic acid molecules, thereby forming the populations of hybrid nucleic acid molecules. In certain spevifie embodiments of the above methods, the recombination is caused by mixing the frst population of nucleic acid molecules and the target acl acid molecule with one oF more recombination proteins tinder conditions which favor the recombination to praduce hybrid noeleie acid molecules. In other specific embodiments, methods of the invention further comprise ing the hybrid nucleic acid molecules with at least a second population of nucleic acid molecules comprising one ‘or more recombination sites to produce a second popula of product nucleic acid molecules. Altematively the first population, second population and target nucleic acid mol- fctles may be mixed together to foem a hybrid population ‘through recombination In additional specific emboxtiments, ‘mcthods of the invention further comprise selecting for the populations of hybrid nucleic acid molecules generated by the methods described above. In yet additional specific embodiments, methods of the invention further comprise Sleting for the population of hybrid nucleic acid mol- ecules aginst te fist population of nuceie acid molecules, against the target nucleic acid molecules, andor against the second population of nucleic acid molecules In related embodiments, the invention provides methods for rocombining a first nucleic acid segment containing a first recombination site, a second nucleic acid segment containing a second and third recombination site, anda third ‘nucleic cid segment containing a fourth recombination si ‘wherein the fist, second, or third auclec acid segments may be identical nucleic seid segments or populations of ncleie ‘cid molecules, such that recombination generates incur oF closed, ciecle product comprising the fist, second and third rnuelei¢ acid seyments. Further, members of the recombina- ‘ion products may be amplified using oligonucleotides \whiel either contain or do not eoatain recombination sites And ate homologous or degenerate tothe fist o third noeloic acid segments. Thus, for example, by perioming ampli cation with primers specific for the first and third necleie ‘cid segments, « product comprising the first-second-thind hhybrid molecules can be amplified, where other undesired molecules (e., products comprising the first-second hybrid molecules) are not amplified. In this way, amplification can be used to select for desired products and against undesired products. Such amplification ean be designed to select for ‘any desired products or intermediates of a recombination reaction. For example, four diferent molecules (eg, A, B, Cyd D) can be joined and various intermestiate products can be selected for (eg, A-BC, oF A-B) using primers designed to amplify the desir?’ products (e.2., primers corresponding to molecules A and C, when A-B-C is ampl Tied and A and B when A-B is amplified), The resulting amplified products may then be cloned. In related embodi- the process described above ean be performed usingUS 7,351,578 B2 un two oF more (e.g Wo, three, four, five, six, seven, eight nine, ten, eleven, twelve, thirteen, lfleen, ete) ucleic acid segments, In another aspect, the invention provides methods of producing populations of hybrid nueleie acid molecules ‘comprising (a) mixing at least a frst poplation of nucleic acid molecules comprising one or more recombination sites ‘with at least a second population of nucleic acid molecules ‘comprising one or more recombination sites: and (b) causing ome orall ofthe nucleic acid molecules ofthe at least frst population to recombine with all or some nucleic acid ‘molecules ofthe at least second population, thereby forming ‘one or more populations of hybrid nucleic acid molecules. In ‘certain specific embodiments of the above methods, recom- bination is eaused by mixing the fist population of nucleic ‘acid molecules and the second population of nucleic acid ‘molecules with one or mote recombination proteins under ‘conditions which favor their recombination. In ther specific ‘embodiments, methods of the invention further comprise mixing the fir and second populations of veleic acid molecules with at least a thin! popnlation of nucleic acd ‘molecules comprising one or more recombination sites. In ditional other specific embodiments, methods of the ‘invention further comprise selecting forthe population of hybrid nucleic acid molecules. In yt other specific embod mens, nethods of the inveation fther comprise selecting for the population of hybrid nucleic acid molecules and ‘against the first, second, andor third populations of nueleic id molocules. In further specific embodiments, methods of the invention further comprise selecting for or against coin- tegrate molecules andlor byproduct molecules. The invention further includes populations of hybrid rceie acid molecules produced by the above methods and populitions of recombinant host eels the above populations of hybrid nucleic acd molecules Tn certain embodiments, the recombination proteins wed jin the practice of the invention comprise one or more proteins selected from the group consisting of Cre, Int, IHF, X is, Fp, Fis, Hin, Gin, Cin, Ta3 resolvase, TndX, XerC XerD, and C31. in specific embodiments, the recombina- tion sites comprise ane or more recombination sites selected from the group consisting of lx sitet psi sites; dif sites; cer sites; [it sites at sites; and mutants, variants, and deriva- tives of these recombination sites which retain the ability t0 undergo recombination Ina specific aspoct, the invention allows controlled ‘expression of fusion proteins by suppression of one or more sop codons, According 10 the invention, one or more faring molecules (eg. one, Wo, three, Tour, five, seven, ten, twelve, et.) joined by the invention may’ comprise one ‘or more stop cadons which may be suppressed to allow ‘expression from a first starting molecule through the next Joined staring molecule, For example, frst-second-third Starting molecule joined by the invention (when each of sich first and second molecles contains & stop codon) can ‘express a tripatite fusion protein encoded by the joined molecules by suppressing each of the stop codons. More- ‘over, the invention allows selective of coattolled fasion protein expression by varying the suppression of selected stop codons. Thus, by suppressing the sip codon between the first and sevond molecules but not between the second and third molecules of the fist-second-third molecule, 2 {sion protein encoded by the first and second molecule may be produced rather than the tripartite fasion. Thus, use of Jifferent stop codons and variable contol of suppression allows production of varius fusion proteins oF portions thereat encoded by all of different portions of the joined o 12 starting nucleic acid molecules of interest In one aspect, the stop codons may be included anywhere within the starting fuclic acid molecule or within a recombination site con: tained by the staring molecule Preferably, such stop codons are located at or near the termini ofthe starting molecule of interes, although such stop codons may be included inter nally within the molecule. In another aspect, one or more of the starting nucleic acid moleciles may comprise the coding sequence of all of a portion of the target gene or open reading finme of interest wherein the coding sequence is {allowed by a stop codon. The stop codon may then be followed by a recombination site allowing joining of a socond starting molecule. Ia some embodiments ofthis type, the stop codon may be optionally suppressed by a suppressor {RNA molecule. The genes coding forthe suppressor tRNA. polecule may be provided on the same vector comprising the target gene of interest, on a different weetor, or in the chromosome of the host cel into which the vector compet Jing the eoding sequence is inserted. In some embodiments, more than one copy (€., 1W0, thee, four, five, seven, ten, twelve, fileen, twenty, thin, filly, ete. copies) of the sup. pressor (RNA may be provided. In some embodiments, the {ranseription of the suppressor {RNA may he under the control ofa repulatable (eg. inducible or repressible) pro- moter Ths, in one aspect, the invention relates to-a method of | ‘expressing one or more fusion proteins (e324 one, two thee, Tour, five, seven ten, twelve iltee, twenty they fy te) ‘comprising: (@) obiaining at least a first nuclei acid molecule com> prising at last one recombination ite and atleast one stop codon (preferably the recombination site andior stop codon fare located at or near # terminus of termini of said first rueleic acid molecule), and a second nucleic acd molecule comprising t least one recombination site (which is pref erably located ator near a terminus or termini of said sevond else acid molecule); (b) causing said first and second nucteie acd molecules to recombine through recombination of said recombination sites, thereby producing a third nuceie acid molecule com- prising said atleast one stop codon and all or @ portion of Sid frst and second molecules; and (©) expressing ene or more peptides or proteins (eg. wo. three, four, ive, seven, ten, twelve, fileen, Twenty, thiny. filly et.) encoded by said third molecule while suppressing said atleast one stop codon, Punter, recombination sites deserbed herein (ea. ‘eeombination sites having various recombination specific ties) may contain stop codons in one, (wo or all three orward or reverse reading, frames. Such termination codons may be suppressed as described above, Further, in appro- priate instances, such recombination sites may be designed 0 as wo eliminate stop codons in one, wo andor all three forward andior reverse reading frames. Tn another aspect, the invention provides methods of synthesizing proteins comprising (a) providing atleast frst rueleic acid molecule comprising « coding sequence fol- lowed by a stop codon; (b) providing at least a second weleic acid molecule ‘comprising a coding sequence, ‘optionally, followed by a stop codon; (c) causing recom! ‘ation such thatthe nueleie acid molecules are joined; (@) ‘inserting said joined nucleie acid molecules into a vector to produce modifiod vectors with the ‘wo coding soquences connected in frame; (e) transforming host cells which ‘express suppressor IRNAS with the modified weston; and () ‘atsing expression of the two coding sequences such that {usion proteins encoded by atleast a portion of bath of theUS 7,351,578 B2 13 ‘coving sequences are produced, wherein the nveleie acid molecules of (a) and (b) are cach flanked by at least one recombination site, Further, the fised nucleic acid molecules fr the veetor may comprise at least one suppressible stop ‘oxion (eg, amber, opal andor ochre codons). In addition, titer the first or second nveleie acid molecule may already be present in the veetor prior to application of the methods described above. ln specific embodiments ofthe invention, the vectors andor host cells comprise genes which encode at least one suppressor (RNA molecule. In other specific ‘embodiments, methods of the invention further comprise transforming the host cell with a muclee acid molecule ‘comprising genes which encode at Teast one suppressor IRNA molecule. In yet other specific embodiments, the fusion proteins may comprise N- or C-terminal tags (eg. phuathione Sctransferase, glucuronidase, green fluores- ‘ent protein, yellow flvorescent protein, red fluorescent protein, cyan fluorescent protein, maltose binding protein, 2 ‘ix histidine tag, an epitope tag, ete.) encoded by atleast & portion of the vecter. “The invention also relates to a method of expressing one ‘or more fusion proteins (eg.. one, two, three, four, five, seven, ten, welt fillen, twenty. thi, fly, ete.) come prising: (@) obtaining at least a fist nucleic acid molecule com- > prising at least one recombination site (preferably the recombination site is located ator near a temninus of termini ‘of sid first nucleic acid molecule) anda second nucleic acid ‘molecule comprising a least one recombination ste (which Js preferably located at or near a terminus or termini of said second nuceie acid molecule), (b) causing ssid at least first and seoond nucleic avid molecules to recombine through recombination of ‘said recombination sites, thereby producing a third nucleic acid ‘molecule comprising all Fa portion of said atleast fist and second molecules: and (expressing one of more peptides or proteins (eg. 0ne, two, three, four, five, seven, ten, wwelve, fifteen, Bwenty, thin, fifly, etc.) encoded by said third mucleie acid mole ‘cule, In certain such embodiments, atleast part of the ‘express fusion protein will be encoded by the third nucleic acid molecule and atleast another part will be encoded by Teast part of the first andor sevond nuclei ail molecules Such a fusion protein may be produced by translation of nucleic acid Which corresponds 1o recombination Jocated between the frst and second nucleic acid molecules. Thus, fusion proteins may be expressed by “reading through” mRNA corresponding to recombination sites used to connect two or more nveleie acid segments, The invention further includes fusion protein produced by methods ofthe jnvention and mRNA which encodes such fusion proteins. ‘As discussed below in more detail, the methods discussed ‘above can be used to prepare fusion proteins which are ‘encoded by different nucleic acid segments, as well as rncleic aed molecules which encode such fusion proteins. “Vis, in one general aspect, the invention provides methods {or producing fusion proteins prepared by the expression of nucleic acid molecules generated by connecting two oF more nucleic acid segments. In related embodiments, the inven tion provides methods for pricing fasion RNAs prepared by the expression of nucleic acid molecules generated by ‘conneting two of more nucle acid segments. These RNAS may be MRNA or may be untranslated RNAS whieh have sctivities other than protein coding funetions. Fxamples of such RNAS inelude ribozymes and (RNAS. The invention further provides nueleie acid moleciles prodiced by meth- ‘ds of the invention, expression products of these nucleic 14 acid molecules, methods for producing these expression products, recombinant host cells which contsi these nvelcic ‘aid molecules, and methods For making these hos ells. As tiscussed below in more detail, the invention Further pro- Vides combinatorial ibearies which may be sereened 10 identify nucleic acid moleevles and expression products having particular functions of activities. Ta one specific aspect, the present invention provides ‘materials and methods for joining two mucleie acid mol- ecules oF portions thereol, cach of which contains at least ‘one recombination sit, into one or more product noeleie cid molecules by incubating the molecules under condi- ‘ions eausing the recombination of a recombination site present on ane nucleic acid molecule witha recombination Site present on the other nucleic ace molecule. The recom bination sites are preferably located ator near the ends ofthe starting nucleic acid molecules. Depending on the location of the recombination sites within the starting molecules, the product molecule thus created will contain al ora portion of the firt and second starting molecules joined by a recom- bination site (which is profeably a new recombination sit). FFor example, recombination between an attB1 recombina- tion siteandan atPI recombination site results in generation fof an a1 and/or att recombination sites. In another specific aspect, the present invention provides paterials and methods for joining two or more nucleic aeid ‘molecules (eg, two, three, four, five seven, ten, owelve, fifeen, twenty, thin, filly, et.) into one or more product nucleic acid molecules (e-2, one, two, three, four, five seven, ten, twelve, ete;) wherein each stating nucle acid ‘molecule has atleast one recombination ste and at least one of the starting nucleic avid molecules has at least Wo ‘recombination sites, The recombination sites preferably are located at or near one or both termini ofthe starting n0el acid molecules. Thus, the invention provides a method of joining at least two aueleie acid molecules wherein at least 4 first nucleic acid molecule contains atleast one recom! ration site and at Teast a second nucleic acid molecule ccntins to or more recombination sites. The molecules are incubated in the presence of at least one recombination protein under conditions suflcient to combine all of portion of the stating molecules to create one or more product molecules. The product molecules thus crested will contain all or a portion of each of the starting. molecules joined by a recombination site (which is preferably a new recombination site) ‘In another specific aspect, the present invention provides ‘method to join at least thre nucleic acid molecules (eg. two, three, Tour, ive seven, ten, twelve, filteen, twenty thin, fifty, ete.) wherein the molecules have at least one recombination site and at least one of the starting nucleic acid molecules contains at least two recombination sites Tncubating such molecules in the presence of at least one recombination protein provides one or mare product mol- ecules (eg, one, two, three, four, five seven, ten, twelve fifteen, twenty; thin, fifty, et.) containing all or a portion of the starting molecules, wherein each molecule is joined by a recombination site (which is preferably a new Fecom- bination site). In another specific embodiment, the present invention sravides compositions and methods for joining two or more nucleic acid molecules (eg. wo, thee, four, fiveseven, ton, twelve, fifteen, twenty, thiny, fy, ete), at least wo of ‘which (and preferably all of which) have two or more recombination sites, The recombination sites located on tach molecule are preferably located ator near the ends of the starting nucleic acid molecules, According othe methodUS 7,351,578 B2 15, ‘of the invention, the two oF more muclee acid molecules oF portions thereof are joined by a recombination naetion (ez. Incubate the molecules in the presence of at least one recombination protein) to form one or more product mol- ‘ecules comprising all or portion of eae starting molecule joined by a recombination site (whichis preferably a new recombination ste. In another specific aspect, the present invention provides ‘compositions and methods for joining atleast three nucleic id molecules comprising providing atleast fst, asccond and 2 thied nucleic acid molecule, wherein the First nueloic id molecule comprises at least fist recombination site, the second nucleic acid molecule comprises at leat a second tnd a third recombination site and the third nucleic acid molecule comprises at least a fourth recombination site, ‘wherein the frst recombination site is capable of recombi- Jing withthe second recombination ste and the third recom ination site is capable of recombining with the four recombination site and conducting at least one recombina- tion rection such that the fist and the second recombination sites recombine and the third and the fourth recombination sites recombine, theeby combining all or a portion of the molecules to make one or more product molecules. Ts, the present invention generally relates to a method. ‘of combining a nucleic acid molecules or segments, where nis an integer greater than 1 (eg, 2,3,4, 5, 6,7. 8, 9,10, 12, 15, 18, 20, 30, 40, 50, ete), comprising the steps of providing a1” through an n” nucleie acid molecule or Segment, each molecnie from 2 theough n= baving atleast two recombination sites and molecules 1 and n having at Jeast one recombination site (and preferably having atleast two recombination sites), and contacting the molecules or segments with one of more recombination proteins (8. ‘v0, three, four, ete.) under conditions sulicent wo cause all ‘ora portion of the segments or molecules to recombine (0 orm one of more product nucleic acid molecules eompris- ing all or a portion of each I" through ni” molecule oF segment, Joining of molecules through recombination sites (eg, interacting a first recombination site on first molecule ‘with a second recombination ste of a second molecule) preferably creates a new recombination site atthe junction Df the two molecules and may ereste 3 new recombination site at each junetion where each molecule is joined to the next, For example, when joining a number of molecules (ea, first or “X" molecule, a second or “y" molecule, and ‘third or“2” molecule) when each molecule has atleast Wo recombination sites, the first recombination site on the x ‘molecule interacts witha second recombination site on the 'y molecule and the second recombination site on the x. molecule interacts with a fist recombination site om the 2 molecule to create a hybrid nucleie acid molecule compris- ing yixiz joined by recombination sites. OF course, other recombination events may produce hybrid molectles com prising, for example, 322, x:2:9, 9:72, 22¢y, andlor 29°X oF Jagmentstheroo, joined by recombination sites. Additional molecules can be added t9 product molecules by recombi- nation between at least one recombination site located ‘another molecules with one or more recombination sites Jocated on the product molecule (eg. interacting @ second recombination site on the 7 molecule with & fist recombi nation site on an e molecule, ete. andor interacting a fist recombination site on the y molecule with a second recom- bination site on an f molecule, et.) Furher, the hybrid nucleic acid molecule comprising y°x:7 (or other sequences as noted above) can be eiularized by the interaction of recombinuation sites on the free ends ofy and 2. Addition of 0 o 16 all or a portion of the starting sequentially or simultaneously Tn instances where nclee acid segments joined by meth- ‘ds ofthe invention contain a terminus, oF temtni, which do ‘ot contain recombination sites, this terminus OF termini ‘may be connected 10 the same micleie acid segment oF ‘another mueleie acid molecule using a ligase oF a topoi- somerase (ea Vaceina virus topoisomerase; see US. Pat No. $,766,801, the entre disclosure of which i incorporated herein by reference), In addition to joining multiple molecules, the invention also provides a means to replace one oF more molecules (oF ‘combinations thereat) contained in product molecule, For instance, any one or more n molecules comprising the product molecule may be replaced or substitted by recom- bination with all or portion of a different molecule (m) ‘which comprises one of mote recombination sites. Thus, ia fone example, m may replace x in the yx molecule eseribod above by recombining a first recombination site ‘on m with the first recombination site flanking x (eg, the recombination site between y and x) and recombining @ second recombination site on m with the seond recombi- ration site flanking x (e.2. the recombination site between 2x and 2) to produce y:m:z. Multiple substitutions or eplace- ‘ments may be made within oron any nuclei acid molecule of the invention by recombining one or more recombination Sites on such molecule with one or more recombination sites ‘within or on the molecule © be substituted. Moreover, one for more deletions (eg. two, three, four, five seven. ten twelve, et.) of various sizes on the produet molecules of the invention may be aecomplished by recombining two or more recombination sites within the molecule of interest Tor creating the deletion. For example, to ereste deletion ‘within the y:x:z (or other arrangement thereat) molecule escribed above, recombination of the recombination sites Nanking the x molecule will teste a new molecule from whieh x is deleted that i, the new molecule will comprise yz. Thus, multiple deletions, multiple replacements and ‘combinations of deletions and replacements of various por ‘ions of molecule of iaterest may be accomplished by ected recombination within the molecule of interest ‘Punter, te invention also provides & means to insert one ‘or more molecules (or combinations thereo)inta a product ‘molecule. For instance, using the molecule yix:z deseribed above for illustration, molecule w, which comprises one or ‘more recombination sites may be inserted hetween y and x fo form a new molecule: yow:x:z In one specific embodi- ‘meat, molecule w is anked by lox? sites and insertion of molecule w is mediated by Cre recombinase between the loxP sites on thew molecule and corresponding loxP sites on the y and x molecules, As one skilled in the art woul! recognize, numerous Variations of the above are possible and are included within the scope of the invention. For ‘example, molecule 0, which comprises one or more recom- bination sites may be inserted between y and xto fom 8 nese either ysoxxz or yro-w:x7, depending ‘on the starting molecule. The methods described herein ean be used to insert virtually any number of molecules into other molecules. Futher, these methods can be usod sequen- tially, for example, to prepare molecules having diverse ‘The product molecules produced by the methods of the invention may comprise any combination of starting mol- cules (or portions thereof) and can be any size and bein any orm (eg, circular, linea, superviled, et.) depending on ecules may be doneUS 7,351,578 B2 the recombination sites on the molecule, and the order of recombination ofthe sites, “Importantly, the present invention provides a means by’ ‘which populations of nucleic acid molecules (known oF unknown) can be combined with one or more known oF "unknown target sequences of intorest (e.g, Wo, theee, four, five seven, ten, twelve fileen, twenty, tiny, fly, ‘with other populations of nucleic acid molecules (known oF unknown), thereby creating populations of combinatorial molecules (eg, combinatorial libraries) from which unigue ‘and/or novel molecules (eg. hybrid molecules) and proteins ‘or peptides encoded by these molecules may be obtained and Trher analyzed. In a prefered aspect, the population of nucleic acid molecules use to create combinatorial libraries according 0 the invention may comprise @ population of segments or molecules having at least one (and preferably two or more) recombination sites (ex, two, three, four, five seven, ten, ‘velve, et). Such populations of molevules are preferably ‘obtained from genomic or cDNA libraries (oF por thereo?) oF mndom nucleic acids, amplification product (eg, PCR products genemted with various primers) and domias (eg, nucleic acids encoding difleweat protein ‘domains from the same or different proteins) constricted to ‘contain such recombination sites. Thus, in accondanee with the invention, fist population of molecules comprising recombination sites ean be randomly joined of combined through recombination (by directed andlor random orienta- tion) with at least one target soquence of intrest oF with @ second population of molecsles comprising recombination sites to produce a thiel population of molecules or hybrid molecules, Tn accordance with the invention, multiple populations of molecules from various sources may be combined multiple times to create a new population which eomprises molecles having multiple combinations of sequences. For instance, @ fist population, a second population and a third population ‘ean he recombined to create fourth popdlation comprising a rancdom population of tripartite molecules (eg, some or all, fof the molecules ofthe fourth population contain all or 3 portion of the segments fom the first, second and third population). Tn a prefered aspect, the newly created population of molecules (eg. the third population) created by the com- binatoral methods may be preferentially selected and thus separated or isolated from the original molecules (ez. target molecules, and first and second population mofecules) and from undesired prodict molecules (eg. cointegrates andor byproduct molecules) Such selection may be accomplished by assaying or selecting forthe presence of «desired nucleic i fusion (PCR with disgnoste primers) and/or the pres- ‘ence ofa desied activity ofa protein encoded by the desired elec acid fusion, Sich selective may also be accom- plished by positive and/or negative selection, One or more toxie genes (e., 160, thre, four, five seven, ten, ete.) are preferably used deconding t the invention in such negative selection scheme. Combinations of selection ofthe desired fusion product (nucleic acid and/or prowin) and positive and/or negative selection may also be used in the invention, Thus, the invention provides means for selecting a population of Prodivet_motocules (or even a specific class of product ‘molecules or specific product molecule) created by recom- binational cloning and selecting against a population of Insert Donors, Veetor Donors and Cointegrates of in similar fashion, selecting for a population of Insert Donors, Veetor 0 o 18 Donors, Byproducts and/or Cointegrates and selecting ‘against a population of Product moloctls (see FIG. 1), Referring to FIG. 2, inthe racombinatoral library meth- ‘ods of the invention, a first population of molecules of the fvention, represented by segment A, may he provided as ‘one population of Insert Donor molecules while a second population of molecules, represented by segment B, may be provided as a second population of Insert Donor molecules. While these segments are depicted as incar fragments, they may be provided as segments within a Taree molecule, for example, as segments in a plasmid “Those skilled in the art will spprecisted that in this integrate molecules, other than the one son iy be prediced. For example, cointegrates prising «segment A and a sepment B Insert Donor molecule may be formed. In addition, cointegrates comprising seg- ‘meat A and/or segment B insert Donor molecules and ‘Vector Donor molecsle may be fored. The selection meth- fds of the prevent invention permit selection against the Insert Donor molectles and against the varios eointegrate ‘molecules and for the newly ereated population of hybrid molecules which may be refered to a5 a population of Product molecules. Conversely, the selection methods may permit selection against Products and for InserVVector Donors, Byproduets, and/or Cointezrates ‘Thus, the invention relates 10 a method w ereate a popillation of hybrid nucleic acid molecules comprising: (a) mixing at Teast a first population of nucleic acid molecules comprising one or more recombination sites (ez. two, thre, four, five seven, ton, twelve, ct.) with at least ‘one target nveleie acid molecule of intrest compesing one for more recombination sites (e.g. two, three, four, five seven, ten, twelve, et) (6) causing (preferably randomly) some or all of the molecules of said atleast fist population o recombine wilh all or some molecules of said target molecule of interest, thereby forming a third population of hybrid molecules; and () optionally selecting pecilcally for said third popula sion of hybrid molecules. In aeeordance with the invention, the hybrid molecules contained by the third population preferably comprise all or 4 portion of a molecule obtained from the fist population and all or a portion ofthe tayet molecule. The orientation in whch the molecules are joined may be one ina directed for random manner depending on the need, In one aspect, the target molecule used to produce said third popolation described above can be a DNA binding domain or a transcription activation domain, such tht the third population o hybrid molecules ean be used in 2-hybrid screening methods well knowa in the art The invention more specifically relates to 4 method of ‘resting 2 population of combinatorial molecules eompris- ing: () obtaining at Teast a frst population of nucleic acid molecules comprising one or more recombination sites (ep to, thee, four, five seven, ten, twelve, etc.) and atleast @ second population of nucleic aid molecules comprising one ‘or more recombination sites (e.g, two, three, four, five seven, ten, twelve, ete) (6) causing (preferably randomly) some or all of the molecules of st last sad fist population to recombine with some or all of the molecules of at least said second popu Tation, thereby creating a third population of hybrid mol- ecules; and (©) optionally selcting specifically for said third pop sion of hybrid moleculesUS 7,351,578 B2 19 In aocordance with the invention, each or many of the hybrid molecules contained by the third population prefer ably comprises all or a portion of a molecule obtained from the first population and all or @ portion of a molecule ‘obtained from the second population. The orientation whieh, the molecules are joined may be done in a directed or random manner, depending on the need. Populations of nucleic acid molectles used in aecondance ‘with the combinatorial methods of the invention ean com= prise synthetic, genomic, or cDNA libraries (or portions ‘hereo), random synthetic sequences or degenerate oligo- ruclotides, domains and the ike. Preferably, the population ‘of miceic acid molecules used comprises @ random popu Tation of molecules, each having at lest ovo recombination sites which preferably do not recombine with each other and Which are preferably located ator near both termini oF each molecule. Random recombination of populations of mol- ‘ecules by the methods ofthe invention provides a powerful, technique for generating populations of molecules having significant sequence diversity. For example, recombination ‘ofa fit library having about 10° sequences with a second population having about 10° sequences results in a third population having about 105? sequences The invention further provides methods for preparing and screening combinatorial libraries in which segments of the nucleic acid molecules of the library members have bee altered. Such alterations include mutation, shuling, inser- tion, andor deletion of mueleie acid segments. In particular, the invention provides methods for preparing nvcleie acd Iibraries whieh contain members having such alterations and mcthods for introducing such alterations in existing ibrar- ies. Ina related aspect, the inveation ineludes combinatorial libraries produced by methods ofthe invention, methods for screening such libraries to identify members which encode ‘expression products having particular functions or activites, and expression products of these libraries (e.g, RNA, pro- ins, etc). Further, in aspects related 10 those described above, the invention provides methods for generating poptlations of uclee aeid molecule containing one or more (e.., one, two, three, four, five, ten, fieen) mucleic acid segments ‘which ae the same and one or more nucleic acid segments ‘which are derived liom members of ane or more poptiations ‘of nucleic acid molecules. One method for producing such nucleic acid molecules involves the use of a vector which ‘contains two recombination sites, A frst nucle acid seg ‘ment, which encodes a protein having a particular Function ‘or activity (signal peptide activity, DNA binding activ ity, ainity fora particular ligand, ct.) is inserted inthe frst recombination site and a second nucleic acid segment, ‘which is derived ftom a population of nucleic acid mole ‘ecules, is inserted into the second recombination site. Fur- ther, these nucleic acid segments are operably Tinked 10 @ sequence which regulates transcription, thereby producing 2 aston peptide aad an RNA moleete produced by the fusion sequence. The resulting combinatorial library may then be sereened to identify miclec acid molecules which encode ‘expression products having particular functions or aetivites| (eae, transcriptional activation aetivity: DNA binding ative ity; the ability to form multimers; localization t a sub- cellule compariments svch as the endoplasmic reticulom, the nucteus, mitochondria, chloroplasts, the cell membrane, ‘ete; ete). When three or more (eg. three, four, five, six, ‘ight, tn, ete.) nucleic acid segments are usod in methods sueh as those deseribed above, one or more of the nucleic id segiients may be kept constant and ane or more of the rucleie atid segments may be derived from members of one 0 o 20 clei acd molecules. For example, in constructing a four part molecule, represented by A! C.D, A-and D may be known molecules having known functions (eg. tags such as HIS6, promoters, transcription fr translation signals, selectable markers, ee.) while mol- cules Hand C may be derived from ane or more pope tions of nucleic acid molecules. ‘Any of the product molecules of the invention may be further manipulated, analyzed or used in any number of standard molecular biology techniques or combinations of such technigues (in vitro oF in vivo), These techniques include sequencing, amplification, nucleic acid synthesis, ‘making RNA transeripts (eg, through trnserption of prod ‘uct molecules using RNA promoters such as TT oF SPS promoters), protein or peptide expression (for example, sion profein expression, antibody expression, homnone expression etc), protein-protein interactions (2-hybrid or reverse hybrid analysis), homologous recombination or gene targeting, and combinatorial library” analysis and ‘manipulation, The invention also relates to cloning the nucleic acid molecules of the invention (preferably by recombination) into one oF more Vectors (e180, three, four five seven, ten, twelve, fileen, twenty, thirty: fy ete.) or converting the nucleic acid molecules of the invention into a vector by the addition of certain functional vector sequences (2. origins of replication). Ina prefered ape recombination is accomplished in vitro (eg, in cell-free systems) and further manipulation or analysis is performed Giretly in vitro. Thus, further analysis and. manipulation will not be consiained by the ability to introduce the ‘molecules ofthe invention into host cell andor maintained ina hos cell. Thus, less time and higher throughput may be ‘accomplished by further manipulating or analyzing the polectes of the iaventon directly in vito, Altematvely in vitro analysis or manipulation can be done after passage ‘through host cells orean be done directly ia vivo (eg, Whi in the host cells, tissues, organs, or organisms). [Nucleic acid synthesis steps, according to the invention, say comprise: i (@) mixing a nucleic acd molecule of interest or template with one or more primers eg. one, two, three, four, five seven, te, twelve, fifteen, twenty, tiny, filly, ee.) and one for more nucleotides (eg ane, two, three, oF four) to form ‘mixture and () incubating said mixture under conditions suliciat to symesize a nueeic acid molecule complementary to all oF ‘8 portion of said molecule or template ‘The synthesized molecule may then be used asa template {or further synthesis of a nucleic acid molecule complemen- tary to all or a portion of the fist synthesized molecule Accordingly a double stranded nucleic acid molecule (e. DNA) may be prepared. Preferably, such socond synthesis sep is preformed inthe presence of one or more primers and ‘one or more nucleotides under conditions sufficient to syn- thesize the scoond nneleie seid molecule complementary to allora portion of the fist nucleic acid molecule. Typically. synthesis of one or more nucleic acid molecules (e.. one fo, three, four, five seven, ten, twelve, fifteen, twenty, thie iy, ete) is performed in the presence of one oF more polymerases (preferably DNA polymerases hich may be thermostable or mesophilic) although reverse transeriptases may also be used in such synthesis reactions. Accordingly, the nucleic acid molecules used as templates for the syn: thosis of additional nucleic acid molecules may be RNA, mRNA, DNA or non-natural or derivative micleic acid ‘molecules, Nucleic acid synthesis, according to the inven- ‘ion, may be failitated by incorporating one or more primerUS 7,351,578 B2 2 sites (ex, Wo, three, four, five, seven, ten, twelve fifleen, ‘oven, thirty, fifty, et.) ino the product molecules through the use of starting nucleic acid molecules containing sueh primer sites. Thus, by the methods of the invention, primer sites may be added at one or a numberof desired locations Jn the product molecules, depending on the location of the primer site within the stating molecule and the onder of dition of the stating molecule inthe prodict molecule Sequencing steps, according tothe invention, may come prise: (@) mixing a nucleic acid molecule to be sequenced with ‘one or more primers (e., one, tWo, tree, four, five seven, ten, twelve, fifteen, twenty, thin, ty, ete), one or more nueleotides (e.. one, to, three, oF four) and one or more termination agents (@., one, tWo, three, four, oF five) 10 orm a mixtures (©) incubating sad mixture under conditions suficient to synthesize a population of molecules complementary to all ‘ora portion of said molecules to be sequenced; and (c) separating sud population to detennine the nucleotide sequence of all or a portion of said molecule t0 be sexquenced, ‘Such sequencing steps are preferably performed in the presence of one or more polymerases (e.g, DNA poly- erases and/or reverse transcriptases) and one or more primers. Preferred temninating agents for sequencing include ‘derivative nucleotides such as dideoxynucleotides (dAATP, ATP, ddGTP, dCTP and derivatives thereo!). Nucleic id sequencing, according to the invention, may’ be fai tated by incosporating one or more sequencing primer sites (eg, one, two, three, four, five, seven, ten, twelve, fees, twenty thy ily, et.) into the prodet molecules through the use of staring nucleic acid molecules containing sich primer sites. Thus by the methods of the invention, sequen- tng primer sites may be added at one ora number of desired Jocations inthe product molecules, depending on the loea- tion of the primer site within the stating molecule and the ‘onder of addition of the staring molecule in the product molecule Protein expression steps, according o the invention, may ‘comprise: (@) obtaining ® nucleic acid molecule to be expressed Which comprises one of more expression signals (ex, one two, thee, four) and (expressing all ora portion of the nucleic acid molecule under contol of said expression signal thereby producing & peptide or protein encoded by said molecule or portion thereof In this context, the expression signal may be said t0 Be ‘operably’ lnked 16 the sequence to be expressed, The protein ‘or peptide expressed ean be expressed ina host ell (in vivo), although expression may be conducted in vit (eq. in since expression systems) using techniques well knowa, jn the ar. Upon expression of the protein or peptide, the protein or peptide product may optionally be isolated or Purified. Moreover, the expressed protein or peptide may be ‘sed in various protein analysis techniques including 2-hy- bri interaction, protein functional analysis, and agonist tagonis(-protein interactions (er, simulation or inhibi tion of protein function through drugs, compounds or other Further, expressed proteins or peptides may be those which have particular biological ‘aetvities. Examples of such activities inelude binding ain= ity for nucleic acid molecules (eg, DNA or RNA) oF proteins or peptides. In particular, expressed proteins oF Peptides may be screened to identify those with binding llnity for other proteins or themselves, Proteins or peptides 0 o have bi elves will generally be capable of forming multimers or aggregates, Proteins oF peptides which ave binding affinities for themselves andor ther proteins will often be eapable of forming or part ating in the formation of multiprotein complexes such as Antibodies, spicesomes, muli-subunit enzymes, muli-sub- nit enzymes, ribosomes, et. Further included within the scape the invention ae the expressed proteins or peptides described above, micleie acid molecules which encodes there proteins, methods for making these nucleic acid mol- ecules, methods for producing recombinant host cells whieh ‘onlin these nucleic acd molecules, recombinant host cells radiced by these methods, and methods for producing the expressed proeins or peptides Te novel and unique hybrid proteins or peptides (e., ‘usion proteins) produced by the invention and particularly from expression of the combinatorial molecules of the invention may generally be useful for any numberof appli- cations. More specifically, 3s one skilled in the art woud recognize, hybrid proeins or peptides of the invention may be designed and selected to identify those which to perform Virwally any Function. Examples of applications for which those proteins may he used inclade terapentis, indsteial ‘manufacturing (eg, microbial synthesis of amino acids or carbohydates), small molecule identification and puritca- tion (e, by ality chromatography), et. Protein expression, according t0 the invention, may be ‘iltated by incorporating one or more tranexiption or translation signals (¢@., one, two, three, four, five, sewen, ten, twelve, fileen, ee.) oF regulatory sequences, start codons, termination signals, splice" donoe/scceptor sequences (eg. intronie sequences) and the like into the praduct molecules throvigh the use of starting nucleic acid ‘molecules containing such sequences. Thus, by the methods of the invention, expression sequences may be added at one ‘ora number of desired locations in the product molecules, ‘epending on the locaton of such sequences within d saning molecule and the order of addition of the staring ‘molecule in the product molecule. Ta another aspeet, the invention provides methods for performing hamologous recombination between nvclcic acid molecules comprising (a) mixing at least first nvcleie ‘cid molecule which comprises one or more recombination sites with a least one target nuclei acl molecule, wherein the frst and target aucleie acid molecules have one or more Fhomofogous sequences; and (b) causing the frst and target ueleic cid molecules to recombine by hiomologons recom bination. In specific embodiments of the invention, the ‘homologous recombination methods ofthe invention result in transfer of all of # portion of the first nceie acid molecule into the tanget nucleic acid molecule. ln certain specific embodiments of the invention, the first nuclei acid molecule comprises two or more sequences Which are homologous to sequences of the target nucleic acid mol- cule. In other specific embodiments, the homologous Sequences ofthe first nucle acid molecule lank atleast one ‘Selectable marker andior one or more recombination sits, In yet other specific embodiments, the homologous soquences ‘ofthe first aueleie acid molecule lank at least one selectable ‘marker Nlanked by recombination sites. In additional specific ‘embodiments, dhe homologous sequences of the frst nucleic ‘cid molecule Rank a clic aid segment which regulates transcription. Further, homologous recombination, according to the invention, may comprise: (2) mixing at lest first nucleic acid molecule of the invention (whieh is preferably a product molecule) compelUS 7,351,578 B2 four, five, seven tea, twelve filleen, twenty, thirty fy ete.) with atleast one target nucleic seid molecule (eg, ane, 0, three, four, five, seven, ton, twelve, ete), wherein said fst ‘and target molecules have one’ or more homologous sequences (eg, one two, three, four, five, seven, etc); and () causing said first and target mucleie acid molecules to recombine by homologous recombination. ‘Such homologous recombination may occur in vitro (et in cell-free systems), but preferably is accomplished in vivo (ex, ina host eel) Preferably, homologous recombination ‘cases transfer ofall ora portion of a nuclei woid molecule ‘of the invention containing recombination sites (the fist ruclic aeid molecule) into one or more positions of the target nucleic acid molecule containing homologous sequences (eg., one, tWo, three, four, five, seven, et.) Selection of such homologous recombination may be fat tated by postive or negative selection (eg. using selectable markers) to select fora desired product andor against an undesired product. In @ prefered aspect, the nucleic acid ‘molecule of the invention comprises a least one selectable ‘marker and at least two sequences which are homologous 10 the tanget molecule. Preferably, the first molecile comprises at east 0 homologous sequences Manking at least one selectable marker The present invention thus facilitates construction of pene targeting nucleic acid molecules or vectors which may’ be used to knock-out ar mutate a sequence or gene of interest (oralter existing sequences, for example to converts mutant Sequence to a wild-ype sequence), particularly genes or sequences within a host or host cells such as animals Cneluding animals, such as humans), plans, insets, bacte- Fin, yeast, and the like oF sequences of adventitions agents such af viruses withia such host oe host cells. Sueh gene targeting may preferably comprise tameling a sequence on the genome of such host cells. Such gene targeting may be ‘conducted in vitro (eg, in a cell-free system) oF in vivo (eg, ina host cell). Thus, na preferred aspect, the invention relates to a method of targeting o mutating a nucleotide Sequence or a gene comprising: (@) obisining at least one nucleic acid molecule of the ‘invention comprising one or more recombination site (and preferably one or more selectable markers) wherein sd molecule comprises one or more nucleotide sequences homologous to the target gene oF nucleotide sequence of meres (said one or more homologous sequences preferably Flank one oF more selectable markers e.g, one, Wo, three, our, five, seven, ten, et.) on the molecule of the invention): and () contacting ssid molecule with one or more target genes or micleotide sequences of interest (63. of, 10, three, four, five, seven, ten, twelve, fifeen, twenty, thy, ‘lly, ete.) under conditions sulliient to cause homologous recombination at onc or moresites ©, 6, three, four five, seven, ten, efe:) between said target" nucleotide sequence or gene of interest and said molecule of the invention, thereby causing insertion of all ora portion ofthe molecule of the invention within the target nucleotide sequence or pene Such targeting method may cause deletion, activation, inactivation, partial inactivation, or partial aetivation of the target nucleic acid or gene such that an expression product (iypically a protein oF peptide) normally expressed by the target nucleic acid or gene is not produced or produced at 2 higher of lower level orto the extent produced is has aa fered protcin sequence which may result in more of less activity or in an inactive or pastially inactive expresso 0 o 2 product, The selectable marker preferably present on the molecule of the invention facilitates selection of candidates (for example host cells) in whieh the homologous recom- bination event was successful. Thus, the present invention provides a method o produce host cells, issues, organs, and animals (e., transgenic animals) containing the modified nucleic acd or gene produced by the tangeting methods of the invention, The modlied nucleic acid or gene preferably ‘comprises at least one recombination site and/or a least one slecable marker provided by the nucleic acid molecule of the invention, "Thus, the present invention more specifically relates 103 method of targeting oF mutating a nucleic acid oF a gene comprising (@) obtaining at least one nucleic acid molecule of the ‘one oF more recombination sites (e.. ‘one, tw three, fou, five, seven, ten, twelve, fifeen, twenty, thirty filly ete) anda least one selectable marker (¢.,one, ‘wo, three, four, five, seven, ten, et} Nanked by one or more sequences homologous tothe iarget nucleic acid or gene of interest (eg. one, two, three, four, five, seven, ten, etc); () contacting ‘said'molecule with one or more tanet rucleic acids or genes of interest (eg. one, two, three, four, five, seven, ten, twelve, fifteen, Wealy, hiny, fly, ete) inder conditions sufficient 1 eause homologous recombi pation atone oF more sites between the target cele acid fF gene of interest and the nucleic acid molecule, thereby ‘causing insertion of all or a portion of the nucleic acid molecule of the invention (and preferably causing insertion ‘of at least one selectable marker anor at Teast one recom- bination site) within the target nucleic acid or gene of interest ad (6) optionally selecting for the target acc acid or gene of interest comprising all or a portion of the nucleic acid ‘molecule ofthe invention or for a host cell containing the target nucleic acid oF gene containing all ora portion ofthe nucle acid molecule ofthe invention. Preferably, selectable markers used in the methods described above are positive selection markers (eg. anti fotie resistance markers sich as ampicillin, tetracycline, kanamycin, neomycin, and G-418 resistance markers) Tn one general aspect, he invention provides methods for tangeling or mutating target gene or nucletide sequence comprising, (@) obtaining at least one first nucleic acid ‘molecule comprising one of more recombination sites and fone oF more selectable markers, wherein the first noloie acid molecule comprises one or more nucleotide sequences Fhomofogous to the target gene or nucleotide sequence; and () contieting the rst ncleic acid molecule with one or ‘more target genes or nucleotide sequences under conditions sillicent to caine homologous recombination al one oF ‘more sites between the target gene or nucleotide sequence ‘andthe frst aueleie acid molectle, thereby causing insertion ‘ofall of a portion ofthe fist nucleic acid molecule within the tamet gene or nucleotide sequence. In certain specific embodiments of the invention, the frst nueloic acid mol- ‘cule comprises at Teast one selectable marker flaked by the homologous sequences. In other specific embodiments, the selectable marker is flanked by the homologous sequesees. Inadditional specific embodiments, the target gene or mucle- ‘tide sequence is inactivated as a result of the homologous recombination. In yet additional specific embodiments, ‘methods of the invention further comprise selecting for @ host cell containing the target gene or micleoide sequence. In some specific embodiments. one or mor’ of the one or sore micletide sequences ofthe frst nucleic acid molecule are homologous (© the target gene or nucleotideUS 7,351,578 B2 25 sequence will not be 100% identical to the target gene oF nucleotide sequence. In other words, the nucleic acid sey- ments which Liltate homologous recombination need not necessarily share 100% sequence identity. However, in general, these neleie seid segments will share at least 70% dont (eg atleast 706, at least 75%, a least 80% atleast 5%, atleast 90%, a least 952%, atleast 97%, atleast 98%, ‘or a least 99%) in their regions of homology: Te use of nucleic acid segments to facilitate homologous recombination which do fot share 100% sequence identity to the nuclei acd with which they are recombine (ie, the larget gene or nucleotide sequence) can be advantageous under number of instances. One example of such an instance is where the homologous nucleie acids correspond to part of a target cleotide sequence which isa gene and homologous recombination results in the introduction one or ‘more sequence alterations inthe target mcleotde sequence In a related example, the homologous nucleic acids may ‘correspond to target nucleotide sequence which represents ‘an ealire gene. Thus, homologous recombination results ia replacement ofthe target gene. Another example of such an instance is where one seeks to perform homologous recom- bination on an onganism which has different cleotide sexquences tthe site where homologous recombination is t0 ‘occur a8 compared to the one or more homologous nvcle= lide Sequences of the fist nucleic acid molecule. The differences in these sequences may result, for example, ‘when an organism ia which homologous recombination is ‘intended to occur is of different strain or species than the ‘organism from whieh the homologous nucteotide sequences fof the frst niclee acid molecule are obtained or where the ‘organism has a different genotype at the recombination focus. Further, the length of the homologous regions whieh ‘acilitate ecombination can vary in size, but, will generally be at least 15 nucleotides in length (eg, at least 20 nucle- ‘ofides, atleast 50 nucleotides, at lest 100 nucleotides, at Teast 200 nucleotides, atleast 400 nueeotides, at Least 600 rueleotides, at least 800 nucleotides, atleast 1000 nucle- ‘tides, at least 1500 nucleotides, atleast 2000 nucleotides, at least 2500 nucleotides, atleast 3000 nuclides, at last 3500 nucleotides, at least 4000 nucleotides at least 4500 rucleotides, at leat $000 nucleotides, at least $500 mucle- ‘tides, at least 6000 nucleotides, atleast 6000 nucleotides, ete), ‘The invention further provides recombinant host cells produced by the methods described herein, which may be prokaryotic (eg, bacteria, or enkaryoti (eg, fungal (eg. ‘yeasts, plant, or animal (eg. insect, mammalian including Hnuman, et.) host). In another aspect of the invention, recombination sites introduced into targoted nucleic acids or genes according 10 the invention may be used to excise, replace, or remove all ‘ora portion of the miclee acid molectle inserted into the target nucleic acid or pene of interest. Thus, the invention allows for in vitro or in vivo removal of such nuceie acd molecules and thus may allow for reactivation of the tanyet nucleic acid or gene. Tn some embodiment, after identifi ‘cation and isolaion of 8 nucleic acid or gene contining the alterations introduced as above, a selectable marker present ‘on the molecule of the present invention may’ be removed, “The present invention also provides methods for cloning the starting or product nucleic aeid molecules of the inven- tion info one oF more vectors or converting the product molecules ofthe invention into one or more vectors. In one aspect, the stating molecules are recombined to make one ‘or mere product molecules and such product molecules ae 0 o 26 cloned (preferably by recombination) into one or more vectors. In another aspect, the stating molecules are clo Gireelly into one or more vectors such that @ number of starting molocules are joined within the vector, thas creating a vector containing the product molecules of te invention. In another aspect, the starting molecules are cloned directly {nto one of more vectors such thatthe tating molecules are sot joined within the vector (i.e. the starting molecules are separated by vector sequences). In yet another aspect, a combination of product molecules and starting, molecules ‘may be cloned in any order into one oF more vectors, ths ‘creating a Vector comprising anew product molecule res ing from a combination ofthe original stating and product molecules Thus, the invention relates to # method of eloning com- rising: (@) obtaining at least one mucleic acid molecule of the invention e-., one, two three, four, five, seven ten, twelve, et.) comprising recombination sites: and (b) ansferring all ora portion of said molecule into one or more vectors (6, one two, throe, Four, five, seven, ten, twelve, fifteen, et). Preferably, such vectors comprise ane oF more recom nation sites (eg., one, two, three, four, five, seven, ten twelve, fifteen, twenty, thirty, fly ete.) and the transfer of the molecules into such vectors is preferably accomplished by recombination between one or more sites onthe vectors (ext, one, tvo, three, fou, lve, seven, ten, ete.) and one oF ‘more sites on the molecules of the invention (eg, one, 19, three, four, five, seven, ten, ete). In anather aspect, the product molecules of the invention may be converted to ‘molecules which function as vectors by including the nec- essary vector sequences (e.2. origins of replication). Thus, aecording to the invention, such vectors sequences may be incorporated into the product molecules trough the use of starting molecules containing such sequences. Sueh vector sequences may he added at one or a number of desired Tocatons in the product molecules, depending onthe loc tion of the soquence within the starting molecule and the order of addition of the starting. molecules in the product ‘molec, Thus, the invention allows custom construction of a desired vector by combining (preferably through recom bination) any aumber of functional elements that may be desired into the vector, The produet molecule containing the vector sequences maybe in linear form or may be converted oa ofr Tigation techniques well known inthe a, Preferably, cire- larization of such product molecule is accomplished by recombining recombination sites at oF near both termini of the product molecule or by ligating the termini of the product molecule to citculaize the molecule. As will be recognized, linear or circular product molecules can be ‘ntrocieed into one or more hosts or host eels for further ‘manipulation ‘Vector sequences usefil in the invention, when employed, may comprise one ora number of elements and/or functional sequences andior sites (or combinations thereof) including rs sites (eB, fone, to, three, four, five, seven, ten, et.) one or more sequences which confer translation termination suppressor activities (eg, one, two, three, four, five, seven, ten, et.) ‘uch as sequences which encode suppressor tRNA’ mol- ecules, one or more selectable markers (eg. one, to thee, four, five, seven, or ten toxic genes, antibiotic resistance ‘genes, tc), one or more transcription or translation sites or Signals (2, one, two, three, four, five, seven ten, et.) oneUS 7,351,578 B2 27 ‘or more transcription or translation termination sites @.8. ‘one, 0, thre, four, five, seven, ten, Weve, ee.) one OF more spice sites (ex, one, two, thre, four, ive, seven, ten etc.) which allows for the excision, for example, of RNA. ‘corresponding to recombination sites or protein ianslated from such sites, one or more tag sequences (¢., HIS6, GST, GUS, GFP, YEP, CEP, epitope tags, et.) one or more restriction enzyme sites (eg. muple cloning sites), one or more origins of replication (¢.., one, two, thre, four, five, Seven, ten, ct.) one oF more recombination sites (oF por tions thereof) (e, one, 10, three, four, five, seven, ten, twelve, fifieen, wventy, thy, filly, ee.) ete. The vector Sequences used in the invention may ako comprise stop cexions Which may be suppressed 10 allow expression of ‘desired fusion proteins as described herein, Thus, according to the invention, vector sequences may be used to introduce ‘one or more of such elements, functional sequences andor sites into any of the nucleic acid molecule of the invention, and such sequences may he used to further manipolate of ‘analyze such micleic acid molecule, For example, primer sites provided by a vector (preferably located on both sides ‘of the insert cloned in such veetor) allow sequencing or amplification ofall ora portion ofa prodact molecule cloned into the vector. Additionally, transcriptional or regulatory Sequences con- tained by the vector allows expression of peptides, polypep- tides or proteins encoded by all ora portion ofthe product molecules cloned t the vector. Likewise, genes, postions of enes or sequence tags (such as GUS, GST, GFP, YFP, CFP, His tags, epitope taps and the like) provided by the vectors allow creation of populations of gene Tusions with the product molecules cloned in the vector or allows production ‘of a number of peptide, polypeptide or protein fusions ‘encoded by the sequence tags provided by the vector in ‘combination with the produet sequences cloned in such vector. Sich genes, portions of genes oF sequence tags may be used in combination with optionally suppressed stop ‘eodons to allow controlled expression of fusion proteins ‘encoded by the sequence of interest being cloned into the vector and the vector supplied gene or tay sequence, In a construct, the vector may comprise one oF more recombination sites, one of more stop godoas and one oF more lag sequences, In some embodiments, the tg sequences may be adjacent 0 a eeombination site. Option- ally, a suppressible stop codon may be incorporated into the Sequence ofthe tag o in the sequence of the recombination site inorder to allow controlled addition ofthe tg sequence 'o the gene of intrest. In embodiments of this type, the gene of interest may be inserted into the vector by recombina- tional cloning such thatthe tag and the coding sequence of the gene of interest are in the same reading frame, “The gene of interest may be provided with tramsation intition signals (e., Shine-Delgamo sequences, Kozak sequences andior IRES sequences) in order to permit the ‘expression of the gene with a native N-terminal when the stop codon is not suppressed. Further, recombination sites ‘which reside hetween nucleic acid segments which encode ‘components of fsion proteins may be designed ether © n0t ‘encode stop codons or 10 not encode stop codons in the fusion protein reading lrame, The gene of interest may also be provided with a stop codon (ea suppressiblo stop ‘cocina the 3-end of the coding sequence, Similarly, when, 8 fusion protein is produced from multiple micieie acid Segments (eg, three, Tour, fie, si, eight, fen, ele. seg- ments), nucleic acid which encodes stop codons can be ‘omitted between each nuclei acid segment and, if desired, o 28 ueleie avid which encodes a stop codon can be positioned atthe ¥ end of the fusion protein coding region, Insome embodiments, stag sequence may be provided at both the N- and C-teminals ofthe gene of interest. Option- ally, the tag sequence at the N-ieminal may be provided ‘witha stop codon and the gene of interest may be provided with a stop codon and the tag at the C-terminal may be provided with # stop codon. The stop codons may be the same or diferent. Tn some embodiments, the stop codon of the N-terminal ‘ag is different from the stop codon of the gene of interes. In embodiments of this type, suppressor RNAs correspond. ‘ng © one orboth ofthe stop eodons may be provided. When both are provided, each of the suppressor {RNAS may’ be independently provided on the same veetor, on a different vector, or inthe host cell genome. The suppressor 1RNAS ‘eed not both be provided in the same way, for example, one ‘may be provided on the vector contain the gene of interest ‘while the other may be provided in the host cell genome. ‘Depending on the location ofthe expression signals (e.. promoters), suppression ofthe stop codon(s) during expres sion allows produetion of a fasion peptide having the tag sequence at the N- andior C-ternings of the expressed protein. By not suppressing the stop codon(s), expression of the sequence of interest without the N-andioe C-terminal tg sequence may be accomplished. Thus, the invention allows ‘through recombination eficient construction of vectors con- ‘aining a gene or sequence of interest (eg. one, to, thee, four, five, sx, tn, or more ORFs) for controlled expression of fision proteins depending on the need Preferably, the starting nucleic acid molecules or pret molecules of the invention whieh are cloned or constricted fccording to the invention comprise at least one open reading frame (ORF) (eg. one, 10, three, four, five, seven, ten, twelve, or fifleen ORFs). Such staring or product ‘molecules may also comprise functional sequences (ez. primer sites, transcriptional or translation sites or signals, termination sites (eg, stop codons which may’ be optionally suppressed), origins of replication, and the like, and prefer ably comprises soquenees that regulate gene expression including transcriptional regulatory sequences and sequences that function as intemal ribosome entry sites (RES), Preferably, at least one of the starting or product molecules andor vectors comprise sequences that function fas promoter, Suck staring or product molecules andlor vectors may. also comprise transcription temination sequences, selectable markers, restriction enzyme recopni- tion sites, and the tke, Tn some embodiments, the starting or prodvet andor vectors comprise two copies ofthe same selectable marker, cach copy Manked by (wo recombination sites. In other embodiments, the staring or product andor vectors com- prise wo different selectable markers each Manked by wo recombination sites. In some embodiments, one oF more of the selectable markers may be a negative selectable marker (eg, ccdB, kicB, Herpes simplex thymidine kinase, cytosine deaminase, et.) In one aspect, the invention provides methods of cloning ucleic acid molecules comprising (a) providing. a first nucleic aid seamen flanked by a fist and a sevond recom bination site: (b) providing a second aveleic acid segment Fanked by a third and a fourth recombination site, wherein either the frst or the second recombination site is capable of recombining with either the third or the fourth recombina- tion site (¢) conducting a recombination reaction such that the two nucleic acid segments are recombined into single ueleie acid molecule; and (@) cloning the single nucleicUS 7,351,578 B2 29 ‘acid molecule, In certain specific embodiments of these methods, the first recombigation site is not capable of recombining with the second and fourth recombination sites tnd the second recombination site is not capable of recom- Dining with the first and third recombination ste, In-a specific aspect, the invention provides a method of ‘cloning comprising providing at least a first nucleic acid molecule comprising at lest a first and a socond recombi nation site and at least a sevond nucleie acid molecule ‘comprising at east a third and a fourth recombination sit, ‘wherein either the first oF the second recombination site is ‘capable of recombining with either the third or the fourth recombination site and eondictng a recombination reaction such thatthe two nucleic acid molecules are recombined into ‘one or more product nucleic acid molecules and cloning the product nucleic acid molecules into one or more vectors. Preferably, the recombination sites flank the frst and/or second nucleic aid molecules. Moreover, the cloning step is preferably accomplished by the recombination reaction of the prodiict molecule into 4 veetor comprising one or more recombination sites, although such cloning steps may be secomplished by standard ligation reactions well known in the art. In one aspect, the cloning step comprises conducting recombination reaction between the sites in the product rucleic acid molecule that didnot reat in the first reco bination reaction with a vector having recombination sites ‘capable of recombining with the unreacted site. In another aspect, the invention provides methods of cloning nucleic acid molecules comprising (a) providing 3 first nueleie acid sepment flanked by at least a frst and a second recombination sites and a second nucleic acid sq ment flanked by at least a third and a fourth recombinatir sites, wherein none of the recombination sites anking the fist and second nueleieaeid segments are capable of recom- bining with any of the other sites flanking the first and second nucleic acid segments; (b) providing a veetor com prising at least a fi, sixth, seventh and eighth reeombina tion sites, wherein each of the atleast fifth, sixth, seventh ighth recombination sites is capable of recombining ‘with one of the at lest fist, second, third andor fourth recombination sites: and (c) conducting a recombination reaction such thatthe two nucleic cid segments are recom- bined into the vector thereby cloning the fist andthe second incleie aeid segments In another specific aspect, the invention provides 9 method of cloning comprising providing at Teast a fst nucleic acid molecule eomprising atleast fist anda second recombination site and atleast a sgoond nucleic acid mol- ‘cule comprising a least a third and a fourth recombination site, wherein none of the firs, second, third or fourth recombination sites is capable of recombining with any of the other sites, providing one or more vectors (e160. throe, four, five, seven, fen, twelve ee), comprising at least ‘fifth, sixth, seventh and eighth recombination site, wherein ‘each of the fifth, sixth, seventh and eighth recombination sites are capable of recombining with one of the first, second, third oF fourth recombination site, and conducting & ecombiiation reaetion such that atleast said frst and second molecules are recombined into said vectors. In & Jurther aspect, the method may allow cloning of at least one asitional nucleic acid molecule (eat leas a third nueloic ‘cid molecule), wherein said molecule is Hanked by a ninth fnd a tenth recombination site and wherein the vector ‘comprises sn eleventh and a twelfth recombination site each ‘of which is capable of recombining with ether the ninth oF the tenth recon o 30 The invention also specifically relates to a method of cloning comprising providing a fist, a second and a third ueleic acid molecule, wherein the first nucleic acid mol- cule i flanked by at least ist anda second recombination sites, the second mveleie cid molecule i Hanked by atleast ‘third and a fourth recombination ste and the third meleie acid molecule is Manked by at Feast fith and a sixth recombination sites, wherein the second recombination site is capable of recombining with the thin} recombination site ‘and the fourth recombination site is capable of recombining ‘with the fifth recombination ste, providing a vector having atleosta seventh and an eighth recombination sites, wherein the seventh recombination site is capable of reacting with the fist recombination site and the eighth recombination site is capable of reacting with the sixth recombination site, and conducting at least one recombination reaction such thatthe sevond and the third recombination sites recombine, the ‘ourth and the fith recombination sites recombine, the frst ‘and the seventh recombination sites recombine and the sixth and the eighth recombination sites recombine thereby clon- ing the fis, second and thd nueleie acid segments in said In another specific aspect, the invention provides 3 vetiod of cloning comprising providing at least a fist, a sovond and a third nucle seid molecule, wherein the first nucle acid molecule is Hanked by a frst and & second recombination sit, the second nucleic acid molecule is flanked by a thind and a fourth recombination site and the third nucleic acid molecule is Ranke by a ith aod a sixth recombination site, wherein the second recombination site is capable of recombining with the thin! recombination site ‘and none of the first, four, fithorsxth recombination sites is capable of recombining with any of the first through sixth recombination sites, providing one or more veviors com- prising a seventh and an eighth recombination site fanking Atleast a frst selectable marker and comprising a ninth and ‘tenth recombination site Hanking at least a second scl able marker wherein none of the seventh through tenth ‘recombination sites ean recombine with any of the seventh throvgh tenth recombination sites, conducting at Teast one recombination reaction such thatthe second and the third recombination sites recombine, the fist and the fourth recombination sites recombine with the seventh and the eighth recombination sites and the fith andthe sixth recom- bination sites recombine withthe ninth andthe tenth recom- bination sites thereby cloning the first, second and thind clic acid segments, In some embodiments, te selectable ‘markers may be the same or may be diferent, Moreover, the fone oF more selectable markers (eo, three four, five, seven, et.) may be negative selectable markers ‘The invention also provides metho of cloning a nveeie acid segments, wherein n is an integer greater than 1 ‘comprising (a) providing n nucleic acid segments, each segment flanked by two recombination sites which do not recombine with each other; (b) providing a vector compris ing 2n recombination sites, wherein each ofthe 2n recom- bination sites is capable of recombining with one of the recombination sites flanking one of the nucleic acid seg- ‘ments; and (c) conducting a recombination resetion such that the n nucleic acid sepments are recombined into the vector thereby cloning the n ncleic acid segments. in specific embaxtiments, the recombination reaetion between the n nucleic acid segments and the vector is conducted in the presence of one oF more recombination proteins under conditions which favor the recombination. In other specific embodiments, a i8 2,3, 4,08 5US 7,351,578 B2 3 Thus, the vention generally provides method of ing miclee oid molecules, wherein nis an integer greater than 1, comprisiag the steps of providing a nuclei aed moles, each molecule comprising st last one and pre ‘ably two recombination sts (he two recombination sess Preferably flank the a alot acid molecule), providing st Feast one vector comprising one or more recombination sites (nd preterbly 2a recombination sites) wherein the vector containing recombination sites is capable of recombining ‘with the rocombination sites of the m molesles, and cone ‘deting a recombination reaton such that thew nuclei aid roles are inserted into said veto thereby’ cloning the nnuelee eid seuments. The n molecules may be inserted next oor adjining eachother inthe vector andor may be inserted at diferent positions within the vetor. The vectors used for cloning according to the invention preferably ‘comprise copies ofthe same oe dllerent selectable marker, ‘cock copy of which shanks by atleast wo recombination sites. Preferably, one o¢ more ofthe selectable markers ate negative selectable markers. "The invention alo generally relates to a method of loning @ mcleic acid moleules, wherein n i an integer feat than 1, comprising the steps of providing 1" through ann ‘nuctic acid molecules, cach molecule flanked by at least to recombination sites, wherein the recombination sites are selected sch that one of the to recombination sites flanking the segment nest wih ‘ne of the recombination sites Nanking the my" segment fn the other recombination ste flanking thei segment, reacis with ane ofthe recombination sites Nanking then, 50 Segment, providing a vector comprising atleast 0 Feemse bination sites wherein one ofthe two recombination sites oa the vector reat wih ane ofthe sites onthe nucleic acid seamet and anotber ste onthe vector ues witha reo bination site on the nucleic aid segment “The nucleic acid moleulesisepments cloned bythe meth- ‘ods of the invention can be different types and can have ‘fret fanetions depending onthe need and depending on the finetona cements preseat. In one axpet at east one of the mic aid segments cloned according to the invention 3s opembly linked to sequcace which is capable of reps Jang transcription (eg. promote, an enhancer, a repes- sor, cic). For example. af least onc of the elec acid Segments may be operably Tinked to @ promoter which is ihe an inducible promoter or a consttuve promote. Ia yet otber specific embodiments, tanslation of an RNA Produced from the cloned nuelei aid segments resus ia the production of either a fsion protein or all or part of @ single protein. In addional specie embodiments atleast ‘one ofthe nucleic acid segments encodes all of pat of an ‘open reading frame and atleast one of the nelle acid ‘euments contains a sequence which is eapable of regulting transcription (eg, a promoter, an enhancer, a repressor ‘te In furer specific embodiment, st fest one ofthe nucleic acd Sepments produces a sense RNA sand upon transeription an ot lest one ofthe mlsie ack! segments proves an antisense RNA stand Upon transcription, La Felted embodiments, the sense RNA and antisense NA have atleast one complementary repion and are capable of hybridizing to each oe. In her specific embodiments, teanseription of at Jest two of the miele aid seuments results inthe production of a single RNA of bvo seperste RNAs. Ih various specific embodiment, those ncleie acid segments may bs connect to each eter or may be spstially separated within the sme nuclei aid molecule. Ia specific Ctbodiments, the niclie cid segments comprise molcic ‘cid molecules of one oF more libraries. Further, these 0 o 32 libraries may comprise eDNA, synthetie DNA, or gem DNA. In addition, the mucleic acid molecules of these libraries may encode vasiable domains of antibody mol- ecules (eg., variable domains of antibody light and beavy chains), In specific embodiments, the invention provides screening methods for identifying nucleic acid molecules ‘hich encode proteins having binding specificity for one or ‘more antigens andlor proteins having one or more activities (ex, secretion from a cell, sub-celular localization (eg, Jocalizaton to the endoplasmic reticulum, the nucleus, mito chondria, chloroplasts, the cell membrane, ete), ligand binding activity (eg. small molecules, binding activities for ueleie acids, cel surface receptors, soluble proteins, metal fons, strctural elements, protein interaction domains, et.) enzymatic activity, ete). Further, mucleie acid molecules) segments cloned using methods of the invention may have ‘one of more ofthe activities referred to above. Tn another aspect, the invention provider methods of cloning at least one nucleic acid molecule comprising (a) providing at least a fis, a second and a third nucleic acid Segments, wherein te frst nacleie acid segment is Anke by at least a first and a second recombination sites, the second noeleic acid segment x Hanke by at least a thi a 4 fourth recombination sites and the thinl nveleic acid segment is flanked by at Teast a fifth and a sixth recom! pation sites, wherein the second recombination site is capable of recombining with the thind recombination site ‘and none of the first, foun, fithorsixth recombination sites js eapable of recombining with any of the first through sixth recombination sites; (b) providing. a vector comprising at least a seventh and an eighth recombination sites flanking at least first negative selectable marker and comprising at least ninth andl tenth recombination sites flanking at least ‘second aeyative selectable marker, wherein sone of the Seventh thrgh tenth recombination sites can recombine ‘with any of the seventh through tenth recombination si (6) conducting a first recombination reaction such that ¢ second and te third recombination sites recombine; and (4) condicting @ second recombination reaction sch that the fist and the fourth recombination sites recombine with the seventh and the cighth recombination sites and the fil and the sixth recombination sites recombine with the ninth and the tenth recombination sites thereby cloning the first, sec- fond and third nucleic acid seaments, In relate! emboli sents, the fst and second recombination reactions are conducted in the presence of one or more recombination proteins under conditions which favor the recombination Such first-and second recombination reaetions may” be carried out simultanconsly or sequentially Tn another aspect, the invention provides methods of cloning at least one aucleic acid molecule comprising (a) providing first, a second and a third nucleie acid segment, ‘wherein the first micleic acid segmeat is anked by a frst and a second recombination sito, the second nucleic acid segment is lanked by third anda fourth recombination site And the third nucleic seid segment is flanked by a fifth and ‘sixth recombination site, wherein the second recombina- ‘ion site is capable of recombining with the third recom! sation site aad the Four recombination site is capable of recombining with the fifth recombination sit; (b) providing ‘vector comprising a seventh and an eighth recombintion site; and (e) conducting atleast one recombination reaction ‘such that the second and the third recombination sites recombine and the fourth and the fifth recombination sites recombine aad the frst and the sixth recombination sites recombine with the seventh and the eighth recombination sites respectively, thereby cloning the fist, second and thirdUS 7,351,578 B2 33 ace aid segments, In related embodiments, the reo bination reaction i condicted inthe presence of ane or more recombination proteins under conditions which for the recombination. In specific embodiment, the recombination Sites which recombine with each ther comprise at sites having identical seven base pair overlap reais. Tn another aspect, the invention provides methods of cloning suclie acid fragments, wherein is an integer neater than 2, comypesing (a providing a1 trough an ath fucleic aid scyment, each scent fnked by two recone bination sites, wherein the combination sites are selected such that ne ofthe Ovo rscombination sites aking te Seament, 1, reas With one of the recombination sites Aanking then sepment andthe oer recombination ste flanking thei segment reacts with one ofthe recombination sites lnking the "segment, (b) providing a vector ‘comprising at lest two recombination sites, wherein one of the two recombination ies on the vector escts with one of the sites onthe I" nocleic acid segment and soothe sit on the vector revels witha recombination site onthe 2” auclie id segment and (6) eondting at least one recombination reaction such that all of the nucleic acid fragments are recombined into the vector In specie embodiments, the recombination reaction i conducted in the presence of ne ‘oF more recombination proteins under conditions which Favor the revombination In specific embodiments ofthe methods describe! above, rutile nuetele acid segments are inserted. into another rele acid molecules. While memerows variations of sh methods are possible, in specific embodiments, nlc acid ‘Scaments which conain combination sites having diferent Species (2 a1 and at 2) ae insert into a vetor ‘which contains more than oe sto cognate recombination Sites (eq. ttRl and at), eae set of wih aks negative sclection markers. Ths, recombination at cognate sites results can be used to select Tor melee acd molectles ‘which have endergone recombination st one or mone of the recombination sites. The nvelei acid seuments which aee Jnserted into the vector may be the same or diferent Fur, these nucleic acid segments may encode expression pots ‘or may he transenptional contol. sequences. When the nuclei aed seuments encode expression prods, vectors ‘ofthe invention may be used to amply the copy number or inewase expression of encode produ. Further, when nlec eid segments are inserted io both direct and jnverted orientations, vectors ofthe invention may be Used, for example, to express RNA, os desedbed elsewhere herein. When the miclie acid sepments encode sequence which regulate transcription (eg. promotes, enhances, ‘6), vector of the invention may be sed to place multiple regulatory elements in operable linkage with avcleic acid that encodes expression prodets Vector of this nature may be seo increased expression of expression products, for ‘example, by providing mlple binding sites for proteins whit atvatetranserption. Similarly vectors of this nature nay he sod to deersate expression of expression prods, forexanple, by providing mullple binding sites for proteins ‘which inhibit transcription. Vectors of this nate may be Used fo increased or decrease the expression of expression produc, for example, bythe expression of multiple copies ‘f nile acid moeciles which encode factor involved ia the regulation of transcription. Other embodiments related to the above would be apparent to one skied in the at Tn another aspect, the invention provides methods of loin atleast one nucleic acid molecule comprising (a) Providing a fist population of siclic acid. molecules ‘wherein all ora pon of such molecules are Manked by at 0 o 34 least a fist anda second recombination sites; (b) providing atleast one nucleic acid segment flanked by at last third ‘and fourth recombination sites, wherein ether the first oF the second recombination site is capable of recombining ‘with either the third oF the Foust recombination site; (€) condecting a recombination reaction such that all of a portion ofthe nucleic acid molecules in the population are ‘recombined with the segment to form a second population of ‘nucleic aeid molecules: and (4) cloning the second popla- tion of nueleie acid molecules. In related embodiments, the recombination reaction is conducted in the presence of one for more recombination proteins under conditions which favor the recombination. In specific embodiments, the see~ ‘ond population of nucleic acid molecules encodes a fusion protein. In related embodiments, the nucleic acid segment ences 2 polypeptide which comprises a sequence (prefer ably an N-terminal andor a C-terminal tag sequence) encod- ing all oF a portion of the following: the Fe portion of aa ‘mmunoglobin, an antibody, 2 f-glucuronidase a fluorescent protein (eg., green fluorescent protein, yellow fluorescent protein, red fluorescent protein, eyan fluorescent protcin, te.) # transcription aetvation domain, a protein or domain involved in translation, protein localization tag, a protein stabilization or destabalzation sequence, a protein inerae- ‘ion domains, a binding domain for DNA, a protein sub- strate, a purification tag (e., an epitope tap, maltose bind- ing protein, six histidine fag, glutathione S-transferase, ee), and an epitope tag, Tn another aspect, the invention provides methods of cloning at least one nucleic acid molecule comprising (8) providing a first population of nucleic acid molecules ‘wherein al or a portion of such molecules are flanked by at i second population of nuclei aed 1 4 portion of such molecules are flanked by a thi Tourth recombination site, wherein either he fest or the second recombination site is capable of recombining with cither the thd or the fourth recombination site; (¢) con- ‘ducting a recombination reaction such tha all ora portion of the molecules inthe fist population is recombined with one fr more molecules from the second population ta foem a ‘hied population of nucleic acid molecules: and (@) cloning the thin! population of nucleic acid molecules. In related embodiments, the recombination reaction is conducted ia the presence of one oF more recombination proteins under conditions which favor the recombination. ‘Thus, the invention generally provides methods of joining at least two segments of nucleic acid (including joining populations of nucleic acid molecules), comprising (a) pro- viding a least two segments of nucleic acid (one or both of which may be derived fom a population or library of molecules), exch segment comprising a least one rom nation ste capable of recombining With a recombination site present on another (or second) segment; and (b) contacting the segments with one or more recombination proteins under conditions causing recombination between the rscombina- tion sites, thereby joining the segments. The invention further provides composition comprising the joined nvcleic acid segments (or population of segments) prepared by sch ethos, hosts or host eels comprising such joined nvcleic avid seuinents (vhich may be populations of host cells or recombinant host cals), and methods of making such hosts ‘or host cells (sch as by transforming oF transfecting such cells with product molecules of the invention). In specific embodiments, methods of the invention further comprise Inserting the joined nucleic acid segments into one or more vectors, The invention also relates to hosts of host cellsUS 7,351,578 B2 35 containing such vectors, In additional specific embodients, Teast ont ofthe two segments of nucleic acid encodes ‘expression produet (eg, a selectable marker, an enzyme, 2 rihovyme, ec) having one or more identifiable activities. In {yet other specific embodiments, at least one of the two egments of nucleic acid contains all oF part of an open reading frame (ORF). In another aspect, at Teast one of the too segments of nucleic acid contains a sequence which is ‘capable of regulating transcription (eg, & promoter, an ‘enhancer, a repressor, et). Ina specific aspect, ne segment ‘encodes an ORF and the other encodes sequence capable ‘of regulating transcription andor translation and the rom bination reaction allows such sequences to be operably Tinked. In yet other additional specific embodiments, one oF more of the nucleic acid segments encode a selectable marker or contains an origin of replication. In further specific embodiments, some or all of the nucleic acid segments comprise nucleic acid molecules of one oF more libraries. In certain specific embodiments, the one or more braries comprise polynucleotides which encode variable domains of antibody molecules. In related embodiment, at least one ofthe nucleic acid segments encodes a polypeptide linker for connecting variable domains of antibody mol- ‘ecules andior one oF more libraries comprise polynvcle- ‘tides which encode variable domains of antibody Hight and heavy chains. In specific embodiments, methods of the invention further comprises at least one sereening step 10 ‘dentify nucleic acid molecules which encode proteins hav- ing one or more identifiable activities (e.g, binding spec fieites for one oF more antigens, enzymatie activities, at ties associated with selectable markers, et.). This, the Jnvention can be used to produce modified expression prod- ucts (by variably linking diferent seaments andor replacing ‘and/or deleting Seements) and analyzing. the expression products for desired activities, According tothe invention, Portions of genes andior numberof genes ca be Finke 0 ‘express novel proteins oF novel compounds and to select for ‘activities of interest. As described herein, substitution andor deletions of such linked molectles ean also be uscd 10 produce altered or modified proteins or compounds for testing. In one aspect, biological pathways ean be modified by the methods ofthe invention to, for example, use diferent ‘enzymes or mutant enzymes in a particular pathway (©. Tink different enaymes or mutaat enzyines which participate jn reactions in the same biological pathway). Sueh mo ‘ation to biological pathways accoring to the invention Jeads to (1) the production of potentially novel compounds such as antibiotics or carbohydrates oF (2) unique post- translational modification of proteins (e-g., glycosylation. Slalation, et.) The invention also allows for production of novel enzymes by manipulating or changing subunits of multimeric enzyme complexes. In other specific embod ments, the invention also provides methods of altering properties of a cell comprising introducing into the cell ruleic acid segments produced by the methods described herein. In certain specific embodiments, cells altered or pradiced by methods ofthe invention are either fing cells or bacterial cells (eg, Escherichia coli. The invention further provides methods for altering bio Jogical pathways and generating new biological pathways For eximple, genes encoding. products involved in. the production ofa particular pathway (e-., a pathway which Jeads to the production ofan antibitie) may be altered using methods of the invention. These alterations inchide the deletion, replacement, and/or mutation ofane or more genes ‘which encode products that prtcipate in the pathway. In addition, regions of genes may be deleted or exchanged 0 o 36 following by sereening to ideals, for example, pathway products having particular features (eg. particular meth Jation pater). Further, genes of diferent oganisms whieh perfoem similar but diferent fanetions may be combined t0 produce novel products. Further, these products may be ‘entfied hy screening for specific functional properties (ext, the ability to inhibit an enzymatic esetion, binding allinity fora particular ligand, antimicrobial activity Viral activity, ete). Thus, the invention provides, in one aspect, sroening methods for identifying compounds which ‘are produced by expression products of nucleic acid mol- ecules of the invention, Funber, when the nucleic acid segments which encode fone or more expression produes involved in a particular biological pathway or process have heen assembled into one for more nucleic atid molecules, regions ofthese molecules (eg, regions which encode expression products) may be Geleted oF replaced to generate nucleic acid molecules ‘whieh, for example, express additonal expression product, alleed expression produets, or which do not express one oF ‘more expression product involved inthe biological pathway orprocess. Further, nicleic acid segments which encode one fr more expression products involved in # particular bio- Togical pathway or process may be deleted or inserted as a single unit. These methods fine application in the production and sereening of novel products. In particular, the invention also includes novel products produced by the expression products of nucleic acid molecules described herein. Tn another aspect, the invention provides methods for preparing and identifying nucleic acd molecules containing fo of more nucleic acid segments which encode gene raducts involved in the same biological processor biologi- al pathway, as well as unrelated biological processes oF biological pathways, compesing (a) providing frst popu lation of aucleic acid molecules comprising at least one recombination site capable of recombining with other ‘elie aid molectles in the fist popalation; (b) contacting the nucleic aeid molecules ofthe ist population with one ar ‘more recombination proteins under conditions wich enuse the nucleic aid molecules to reeombine and create a second popillation af nucleic acid molecules: and (c)sereening the second population of micleie acid molocules to identify @ nucleic acid molecule which encodes two oF more products involved in the same processor pathway: In specific embod ‘ments of the invention, the aucleie acid molecules which ‘encodes wo or more preluets involved in the same process or pathway encode two different domains of a protein or protein complex. In other specific embodiments, the protein ‘sa single-chain antigen-binding protein, In yet other spe- cific embodiments, the protein complex comprises an ant body molecule or multivalent antigen-binding protein com prising at least two single-chain antigen-binding protein ‘The invention further provides methods similar © those scribed above for preparing and identifying nucleic ack molecules containing to oF more mucleic acid segments ‘whieh encode gene prodicts involved in different of unre lated biological processes or biologial pathways. ‘Methods of the invention may also be employed to determine the expression profile of genes in eells andor tissues. In one embodiment, RNA may be obtained from cells andlor tissues and used to generate eDNA molecules ‘These DNA molecules may then be linked to each other and sequenced to identily genes which are expressed in cells ndir tise, as wl as the prevalence of RNA species in these cells anor tssies, Thus, in one aspect, the invention provides methods for identifying genes expressed in par ticular cells andor tissues aad the relative quantity ofUS 7,351,578 B2 37 particular RNA species present in these cells andor tissues fs compared to the quantity of other RNA spocies, As ‘discussed below, such methods may be used fora variety of applications including disgnosties, gene discovery, the iden- lation of genes expressed in specific cell and/or tissue types. the identification of genes which are over-or under ‘expressed in particular cells (eg, cells associated with 2 ), the sercening af agents ta identify agents (e therapeutic agents) which alter gene expression, ‘etc. Funtber, it will often be possible to identify the gene fom which a particular RNA species or segment is ran- scribed by comparison of the sequence data obtained by methods of the invention to nucleic acid sequences cata Joged in public databases. Generally, about 10 nueleotides oF 0 of sequence data will be required to identify the gene from which RNA has been transcribed. Ths, ina specific aspect, the invention provides methods Jor determining gene expression profiles in cells or tissues ‘comprising (a) generating at least one population of cDNA, molecules from RNA obuained from the cells or Ussues, ‘wherein the individual cDNA molecules of the population ‘comprise atleast two recombination sites capable of recom bining with at least one recombination site present on the individual members ofthe same ora diferent population of ‘eDNA molecules; (b) contacting the nveleie acid molecules, ‘of (a) With one oF more recombination proteins under ‘conditions which cause the aueleic acid molacules to join: ‘and (¢) determining the sequence of the joined nucleic acid molecules. In specific embodiments of the invention, the Joined cDNA molecules are inserted into vectors which ‘contain sequencing primer binding sites Ranking the inser- tion sites. In yet other specific embodiments, the joined ‘DNA molecules are scpaated by atP recombination sites In adklitional specific embodiments, the joined DNA mol- ‘ecules contain between about 10 and about 30 nucleotides which corresponds to the RNA obtained from the cell oF ‘Once the sequences of cDNA corresponding. 10 RNA, ‘expression products have been determined, these sequences ‘ean be compared to databases which contain the sequences ‘of known genes to determine which genes are expressed in the particular cells andor tissues and the expression levels of individual genes. Further, the expression levels of genes ‘ean be determined using methods of the invention under particular conditions to determine if tkese conditions result Jn the alteration of the expression of one or more genes. Examples of sich conditions include decreased setivity of cellular gene expression products, nutient imitation andor ‘deprivation, eat shock, low temperatures, contact with solutions having low ot high ionic strengths, exposure 10 ‘chemical agents (eg. antibiotics, chemotherapeutic agents, tal jons, mutagens, ee), ionizing radston, et. Thus the ‘invention provides methods for identifying genes which ‘exhibit alterations in expression as a result of specific stim “The invention further provides methods for identifying genes involved in cellular metabolism (eg. pathological ‘conditions). For example, methods of the invention ean be used to detemnine the expression profile of cells of @ particular strain or cells which exhibit an aberrant phono- ‘ype. The expression profile of cells of the particular strain ‘or cells which exhibit the aberrant phenotype is compared to the expression profile of cells of another strain or cells whieh «do not exhibit the aborrant phenotype, refered to herein as “reference cell.” By comparison of expression profiles of| _genes of cells ofthe particular stain or cells which exhibit, the aberrant phenotype t appropriate reference cells 0 o 38 expression characteristics of associated with the strain or herrant phenotype can be determined, Thus, in one specific ‘aspect, the inveation provides diagnostic methods, wherein the gene expression profiles of cells of a patient which exhibit an aberrant phenotype (eg, caneerous) is compared to the gene expression profiles of cells which do not exhibit the aberrant phenotype (ie, reference cells). Tn another specific aspect, the invention provides methods for sereening therapeutic agents (eg, immunostimlatory agent) comprising (a) exposing cells (e.g, human cells) © a candidate therapeutic agent, (b) determining the pene expression profile of the exposed cells, (¢) comparing the gene expression profile t the gene expression profile of cells which have not been exposed fo the candidate thers- peutic agent (ie, reference cells). The invention further includes. therapeutic agents identified by the methods described above. In another aspect, the invention provides a means for attaching or binding through recombination molecules and! for compounds of population of molecules andor com- pounds to other molecules, compounds and/or supports (preferably solid or semisolid). Suitable molecules and com- pounds for ase in the present invention include, but are not limited to, proteins. polypeptides, or peptides, chemical ‘compounds, deugs, lipids, lipoproteins, eatbohysdrates, hor none, steroids, antibodies (or portions thereof, antigens, enzymes (e, nucleases, polymerases, ete), polysaccha. Fides, nucleosides and derivatives thereof, nucleotides and erivatives thereof, amino acids and derivatives thereof, fatty acids, receptors, Higands, haptens, small molecules (eg, activation groups such as COOH), binding’ mol- ecules (eg. biotin, avidin, stepavidin, Protein A, Protein B, te), growih factors, metal ions, cytokines, ribozymes, oF weleic acid molecules (eg, RNA, DNA, DNA/RNA hhybrids, CDNA or cDNA libraries, double stranded nocleic vids, single stranded nucleic acid, linear nucleic acids, circular nee acids, supercoiled nucle acids and the ike) ‘and combinations of to oF more of the foregoing. In specific embodiments, molecules may be linked to supports either directly or indirectly. Funher, molecules may be linked to supports by either covalently o non-covalently. For purposes of istration, one example of the indirect non-covalent linkage ofa clic eid molecule to support is where «protein which exhibits high binding allinity’ Tor rucleic acid molecules is diecily liked to a support. The support containing this protein is then contacted with the ueleic acid molecules under appropriate conditions res ‘ng. in the non-covalent attachment of the nucleic acid molecules to the support through the protein. This associa- ‘ion between nucleic ace! molecule/protein interaction ean be cher sequence specific or non-sequence specific. In another aspect, the invention provides supports com> prising (iduer ound oF unbound to tke support) at least one first nucleic acid molecule, wherein the first nucleic acid molecule comprises one oF more recombination sites or portions thereof. In specifie embodiments, supports of the invention further comprise at least one second nucleic acid molecule ora least one peptide or protein molecule or other ‘compound bound to the suppor trough the recombination site onthe first nucleic acid molecule ‘The invention also relates to supports of the invention ‘which comprise (ether bound or unbound to the support) ‘one of more components selected from the group eonsisting ‘of one oF more nucleie acid molecules comprising at last ‘ne recombination site one or more recombination proteins, fd ane or more peptides or compounds comprising atleast ‘one recombination ste,US 7,351,578 B2 39 In another aspect, the invention provides methods for taching or binding one or more aucleic acid molecules, protein oF peptide molecules, or ether compounds to sup- ors comprising (a) oblaining at least one micleie acid molecule, protein or peptide molecule, other compounds, oF population of such molecules or compounds comprising st Feast one recombination site and obtaining supports com Prising atleast one recombination site: and (b) exosing some ‘or all of the recombination sites on the atleast ane nucleic id molecule, protein or peptide molecule, other com- pounds, o population of such molecules or compounds 10 Fecombine Wilh all or a portion of the recombination sites ‘comprising. the supports. In specific embodiments of the ‘invention, the methods futher comprise attaching or binding ‘one of more mucleie acid molecules to the support. In other specific embodiments, only one nucleic acid’ molecule is the methods described above. In specific embodiments, the support of the invention are either solid or semisolid. Fur- ther, as discussed above, nucleic acid molecules may be Finked to supports either direlly or indirectly. AS also discussed above, nucleic acid molecules may be linked t0 supports either covalently or non-covalently. In addition nucleic acid molecules may be linked to supports through Tinkage to a protein or small molecule (eg, molecule having an activation group such as —COOH). Further, nucleic acid! molecules may be linked to supports through linkages which are either labile or non-labile Tn another aspect, the invention provides methods for linking or connecting twa or more moleciles or eomponnds of interest, comprising (a) providing at least a frst and a second molecule or compouind of interest each ofthe frst ‘and second molecules or compounds of interest comprising least one recombination site; (b) causing some orall ofthe recombination sites on the frst molecule oF compound of inerest to recombine with some or all of the recombination sites on the second molecule or compound of interest Ia specific embodiments ofthe invention, the methods further ‘comprise attaching nucleic acids comprising recombination sites t the first and the second molecules or compounds of inerest. In other specilic embodiments, a least one of the molecules or compounds of interest comprises a protein oF Peptide, a miclec acd, a carbohydrate, a steoid, oF a lipid. In some embodiments, one or more of the compounds and/or molecules of the invention (e160, three, fu five, even, Ten, twelve, fieen, tWealy, thy, filly, ee.) may ‘comprise one or more recombination sites (et thre, four, five, seven tea, twelve illeen, twenty, they filly ete.) ‘or portions thereof. Such molecules and/or compounds may’ be unlabeled or detectably labeled by methods well known in the art, Detectable labels include, but are not limited to, radioactive labels, mass labels, Muorescent labels, chemilue ‘inescent labels, bioluminescent labels, and enzyme labels. Use of such labels may allow for the detection of the presence or absence of labeled molecules andor compounds ‘on a suppor. Thus, te invention generally relates to atach- ing toa support any number of molzeules and/or eompounds ‘oF populations of molecules andlor compounds by recom: bination and the supports made by this method. Such eom- pounds and/or molecules can thus be attaches! ta support fr stricture via a nucleic acid linker containing a recombi nation site or portion thereof. Such linkers are preferably small (eg. $20, 30, $0, 100, 200, 300, 400, or $00 base pairs in length) 0 o 40 _Accondingly, the present invention encompasses 9 support comprising one or a number of recombination sites (oF portions thereo!) which ean be used aeconding to this aspect fof the invention. Thus, one or a number of nucleic acid molecules, or proteins, peptides and/or other molecules andar compounds having ane or more recombination sites ‘oF portions thereat which ate to be added or attached or bound to the support are recombined by a recombination reaction with the recombination-site-containing, suppor, thereby creating a support containing one or more nvclcic ‘acid molecules, or protein, peptides and/or other molecules ‘andor compounds oF interest, The recombination rection ia binding the molecule andior compound of interest to the suppor is preferably accomplished in vitro by contacting the support and the molecule andor compound of interest with at least one recombination protein under conditions sul tient to cause recombination of at least one recombination site on the molecule andor compound of interest with at Jeast one recombination site present on the support. This aspect of the invention is particularly useful in creating nays of nucleic acids, or proins andlor other molecules ‘andlor compounds on one oF more supports (eo, tree, four, five, seven, ten, twelve, etc.) in that it facilitates binding of a number ofthe same or different nucleic acids fF proteins andlor other molecules andor compounds of terest through recombination to the support OF various part ofthe support. Thus, the invention relates to a method ‘of ataching of binding one oF more (e4. Wo, three, FOUR, five, seven, ten, twelve, fitsen, twenty, thiny, fifty, etc) ucieie aeid, or protein molecules andor other molecules andar compotunds to 8 support comprising: (@) obtaining atleast a first molecule andor compound or population of molectles andlor compounds comprising st Jeast one recombination site (exe, the starting nucleic acid ‘molecules of the invention) and obtaining a support com- frising atleast one recombination site (which may’ also be fhe starting molecules of the invention}: and (b) causing some or all of the recombination sites on said at least first molecule and/or compound oF poptlation of ‘molecules andar compounds to recombine with all or a portion ofthe recombination sites on the support ‘Once the molecules andior compounds ate added to the support, the presence or absence or position of sueh mol- ecules andior compounds on the support can be determined (for example by using detectable labels). Additionally, the ‘molecules and/or compounds bound to the suppor may be ‘urther manipulated by well known techniques. In addition to joining one or multiple molecules andor ‘compounds to 2 Support in accordance withthe inveation, the invention aso allows replacement, insertion, or deletion ‘of one or more molecules andor compounds contained by the suppot. As discussed herein, causing combination of specific ites withina molecule andlor compound of interest, all of a portion of molecule and/or compound may be ‘removed or replaced with another molecule or compound of interest. This process may also be applied to molecules ‘and/or compounds having recombination site which are attached tothe suppor. Thus, recombination may be used 10 remove ot replace all of a portion of the molecule and/or ceompound of the intrest from the suppor, in addition + adding all or part of molecules to suppor. “The molecules andor compounds added tothe support or removed from the support may be further manipulated or Analyzed in accordance with the invention and as desribed herein. For example, firher analysis or manipulation of molecules andor compounds botnd to or removed from the support include sequencing, hybridization (DNA, RNA.US 7,351,578 B2 ‘expression, protein-DNA interactions (2-hybrid or reverse 2-hybrid analysis), interaction of binding sindies with other ‘molecules andor compounds, homologous recombination ‘or gene largeting, and combinatorial library analysis and manipulation, Such manipulation may be accomplished ‘while the molecules and/or compounds are bound to the support of alter the molecules andor compounds are Femoved fromthe support. In accordance withthe invention, any solid or semi-solid supports may be used and sequences containing recombi nation sites (or portions thereof) may be added by well known wehniques for attaching nucleic acids to suppor. Furthermore, recombination sites may be added to nucleic acid, rosin molecules andor other molecules andor com pounds of interest by techniques well known in the art. Moreover, any wild-type or mutant recombination sites oF ‘combinations of the same or different recombination sites may be used for adding and removing molecules andor ‘compousads of interest to or fom a support The invention also relates to any support comprising one ‘or more recombination sites (eg 10, three four, five, seven, ten, twelve, fifteen, twenty, thiny, filly ete.) oF Portions thersof and to suppors comprising nucleic acid, protein molecules andor other molecules and/or compounds having one or more recombination sites (or portions thereo!) bound to said support, ‘The invention also relates 10 compositions comprising such supports of the invention, Such compositions may Jurter comprise one or more recombination proteins (pel- ‘erably site specific recombination proteins), suitable bulfers (ex, for eausing recombination) nucleic zeid, protein mol- ‘ecules andlor other molecules andior compounds, preferably ‘comprising recombination sites which may be unbound 10 the support, and any other reagents used for recombining recombination sites acconing to the invention (and combi nations thereof) The invention also relates to compositions or use in farther manipulating or analyzing the supports of the invention or the ucleic acid or protein molecules or ‘other molecules andor compounds attached thereto, Further ‘manipulation and analysis may be preformed on the aucleic ‘acids, proteins, and/or other molecules andor compounds While bouad to the support or aller removal fom the support, Such compositions may comprise suitable butlers ‘and enzymes sich 2s restriction enzymes, polymerases Tigases, recombination proteins, and the like, Tn another aspect, the peesent invention provides a means {or attching or binding one or more (eg. Wo, three, four, five, seven, ten, twelve, fen, twenty, tht, filly, ete) molecules andlor compounds or populations of molecules and/or compounds 10 One oF more of the same or diferent molecules andior compounds or populations of molecules andr eompounds. Ths, the invention generally relates to ‘connecting ny number of molecules andlor compounds oF population of molecules andlor compounds by recombi ion, As descrihed herein, such liaked molecules andlor ‘componrals may be unlabeled or detectably labeled. Further, such linked molecules and/or compounds may be linked 10 «iter covalently or non-covalently. Suitable molecules and! for compounds include, but are not limited to, those ‘described hercin such as nucleic acids, proteins o peptides, ‘chemical compounds, drugs, lpi, lipoproteins, hormones, ‘etc In one aspect, the same molceules and/or compounds, oF the same type oF molecules andor compounds (-, protein- protein, nucleic acki-nucleic acid, ete.) may be. linked ‘hough recombination. Thus, in one aspect, small molecules 0 o a andor proteins may be Tinked to recombination sites and then linked to each other in various combinations In another aspect, different molecules and/or compounds or different types of molceules andlor compounds (eg. proteinsnucleie acid, nucleic aeid-ligand, pvotein-ligand, te.) may be linked trough recombination. Additionally, the ‘molecules andr compounds linked through recombination (ea, protein-protein, proein-ligand, ec.) may be altached {oa support ot structue through recombination as desribed herein. Thus, the molecules and/or compounds (optionally Tinked t0 a support) produced are linked by one oF more recombination sites (or portions thereof), Such recombin- tion sites (or ponions thereof) may be attached to molecules such as proteins, peptides, carbohydrates, steroids andlor Iipids or combinations thereof using conventional technol gies and the resulting recombination-site-containing mol- ecules andlor compounds may be liked using the methods fof the present invention. Further, the resultant linked mol- ecules andlor compounds may be attached via one or more fof the recombination sites to other molecules andr com- pounds comprising recombination sites. For example, & rucleic acid comprising a recombination site may be tached to a molecule of interest and a sccond nuclei acid ‘comprising a compatible recombination site may be attached toa second molechle of interest. Recombination between the sites resus in the attachment of the two molecules via a ‘small nucleic acd Tinker. The nuclei acid linker may be any Tength depending on the nee but preferably is small (eg. from about 5 t about S00 bps in length). Using this methodology, proteins, peptides, nucleic acids, carbohy~ trates, steroids andlor lipids or combinations thereof may be attached to proteins, peptides, nucleic acids, carbohydrates, steroids andlor lipids or combinations thereof, Thus, the present invention provides a method of connecting two or ‘more molecules andr compounds, comprising the steps of: (@) obtaining atleast a frst and a second molecule andor ‘compound, each of sad molecules and/or compotnds com- prising atleast one recombination site (or portion thereof); and () easing some or all of the recombination sites (or portions thereo!) on said fist molecule and/or compound! 10 recombine with all ora portion ofthe recombination sites (or portions thereof) on sad second molecule andor compound. In some preferred embodiments, recombination site may be attached to a molecule of interest using conventional conjugation technology. For example, oligonucleotides ‘comprising the recombination site can be syasized 80 as to itchide one or more reactive funetional moieties (€., ‘0, three our, five, seven, ten, et.) Which may be the same ‘or diferent. Suitable esctive functional moieties include, but are not limited to, amine groups, epoxy groups, vinyl soups, thiol groups and the like. The synthosis of olige- ‘one or more reactive functional ‘is routine in the an, Onee synthesized, oligontcle- ‘tides comprising one oF more reative Functional moieties may be attached to one or more reactive groups (eg. 0, three, four five, seven, ten, et.) present on the molectle or ‘compound of interest. The oligonucleotides may be attached relly by reacting one oF more of the reactive Functional ‘moieties with one or more ofthe reactive functional groups. Insoae embodiments, the atachinent may be elects using Aastitable linking group capable of reacting with one or more ofthe reactive fintional moieties present on the aligomucle- ‘tide and with one or more of the reactive groups present on the molecule of interest. In other embodiments, both direct attachment and attachment through a linking growp may be ‘used. Those skilled inthe at will appreciate that the reactiveUS 7,351,578 B2 43 ‘unetional moieties on the oligonucleotide may be the same ‘or diferent as the reactive fnetional moieties on the mole ‘ecules andor compounds of interes, Suitable reagents and techniques for conjugation of the oligonucleotide to the molecule of interest may be found in Hermanson, Biocon Jugate Techniques, Academic Press Ine., San Diego, Calif 1996. The present invention also relates to kts for earying out the methods of the invention, and particularly for use in ‘creating the product nucleic acid molecules of the invention, ‘or other Tinked molecules and/or compounds of the inven- tion (eg, protein-protein, nucleic ucid-proten, ete), oF supports comprising such product muclei aciel molecules or Tinked molecules and/or compounds. The invention also relates to kits for adding andior removing and/or replacing nucleic acids, proteins andor other molecules andor eo pounds 1o oF from one or more supports, for cresting and using combinatorial libraries of the invention, and for ea ying out homologous recombination (particularly gene tar teting) according wo the methods of the invention, The kts ‘of the invention may also comprise further components for Tarher asnipolating the recombination site-cntaining mol- cctles andlor compounds produced by the methods of the ‘vention. The kits ofthe invention may comprise one oF more micieie acid molecules of the invention (particularly starting molecules comprising one or more recombinatir sites and optionally comprising one or more reactive fune- ional moieties), one oF more molecules and/or compounds ‘of the invention, one or more supports of the invention ‘and/or one oF more vectors ofthe invention, Such kits may ‘optionally comprise one of more additional components selected from the group consisting of one or more host cells (eg, to, three, four, five etc), one oF more reagents for Intodueing (eg, by transfection or transformation) mol- ‘ecules or compounds into one or more host cells, one oF more nucleotides, one or more polymerases andor reverse transcripases (eg. two, three, four, five, et.) one or mare suitable butfers (@., 16, threo, Four, ive, ee.) one oF more primers (eg. two, three, four, five, seven, ten, twelve, ‘keen, sventy, they, fly, ete), one oF more terminating agents (eg. two, three, four ive, seven, ten, ec), one oF more populations of molecules for creating combinatorial libraries (eg. two, three, four, five, seven, ten, twelve, flteen, went. diy, fy ete.) and one or more combine torial libraries (ex, tWo, three four, five, seven, tea, twelve fifteen, twenty, tiny, ity, ee.) The kits of the invention may also contain directions or protocols for carrying out the methods of the invention. In another aspect the invention provides kits for joining deleting, oF replacing nucleic acid segments, these kits ‘comprising atleast one component selected from the group, ‘consisting of (1) one of more recombination proteins oF compositions comprising one or more recombination pro- teins, and (2) at least one nucleic acid molecule comprising ‘one br more recombination sites (preferably a vector having at least wo different recombination specificities). The kits of the invention may also comprise one or more components selected from the group consisting of (a) addtional nucleic {id molecules comprising adklitional recombination sites: (b) one or more enzymes having ligase activity: (€) one oF more enzymes having polymerase activity; (d) one or more ‘enzymes having reverse transcriptase activity; (e) one oF ‘more enzymes having resirition endonuclease aetivity: (1) ‘one or more primers; (2) ane oF more nucleic acid libraries: (h) one or more supports: (7) one or more buffers; (0) one oF ‘ore detergents of solutions containing detergent (k) one ‘or more nucleotides; (1) one or more terminating agent; (m) 0 o 44 ‘neo mote transfection reagents: (a) one oF more host ells; and (O) instructions for using the kit components. Punber, kits of the invention may contain one or more recombination proteins selected from) the goup consisting of Cre, Int IHF, X is Fp, Fis, Elin, Gin, Cin, Ta3 resolvase, C31, TnaX, XerC. and XerD. In addition, recombination sites of kits of the invention will generally have diferent recombination specificities cach comprising att sites with different seven base pair ‘overlap rexions. In specific embodiments of the invention, the first three nucleotides of these seven base pair overlap regions comprise nucleotide sequences selected from the group consisting of AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, AGA, AGC, AGG, AGT, ATA, ATC, ATG: ATT, CAA CAC, CAG, CAT, CCA, CCC, CCG, CCT, CO: CGC, CGG, CGT, ETA, CTC, CTS GAG, GAT. GCA, GCC; GCG. GCT. 3c, GGT, GTA, GTC, GIG, GTT, TAA, TAC, TAG, TAT, TC) TCC TCG, TCT. TGA, TGC, TGG,TGT, TTA, TIC, TT and PTE In specific embodiments, kts of the invention contain ‘compositions comprising one or more recombination pro- {eins capable of catalyzing recombination between alt sits. Inrelated embodiments these compositions comprise one or sore recombination proteins capable of catalyzing at2att? (BP) reactions, at. xatiR (LR) reactions, or both BP and LR [Nucleic acid libraries supplied with kits of the invention ‘may comprise cDNA or genomic DNA. Further, these Iibraries may comprise polynucleotides which encode vari- able domains of antibody light and heavy’ chains. 1 ‘The invention also relates t© compositions for carrying ‘out the methods ofthe invention and to compositions created while carrying out the methods of the invention. In paricu- Jar, the invention includes nucleic acid molecules prepared bby methods of the invention, methods for preparing host calls which contain those nucieie acid molecules, host cells prepared by these methods, and methods employing these host cells for producing products (eg... RNA, protein, etc.) encoded by’ these lee seid moloctles, procs encoded by these nucleic acid molecules (e-2, RNA, protein, et). ‘The compositions, methods and kis ofthe invention ae preferably prepared and carried out using a phage-lambda site-specific recombination system and more preferably with the Garswav™ Recombinational Cloning System available from Invitrogen Corp. (Carlsbod, Cali). The Garewas™ Cloning Technology Tnsieuction Manual (lavitrogen Corp.) eseribes in more detail the systems and is incorporated hoerein by reference in its entirety. Other preferred embodiments of the iavention-will be apparent fo one or ordinary skill in the art in ligt of what is knowa in the art, in light of the following drawings and ‘eseripton of the invention, and in light of the elsins 2 3 8 a BRIEF DESCRIPTION OF THE FIGURES. FIG. 1 is a schematic representation ofthe basic recom binationa cloning reaction FIG. 2 is a schematic representation of the use of the present invention to clone two nuclele acid segments by performing an LR recombination reaction. FIG. 3 is a schematic representation of the use of the present invention to clone two nucleic acid segments by joining the segments using an LR reaction and then inserting the joined fragments into a Destination Vector using ® BP recombination reaction,US 7,351,578 B2 45 FIG. 4 is a schematic representation of the use of the present invention to clone two aucleic acid segments by Performing BP resetion followed by an LR reaction, TG. § is a schematic representation of two nucleic acid ssumens having at sis tng cloned by peroming 8 first BP reaction to generate ana site on one segment and an att on the other followed by an LR reaction to combine the segments. In variations of this process, Pl, P2, andlor P3 ‘ean be oligonucleotides or linear stretches of nucleotides. TG, 6s. schematic representation of tae cloning of two rucei¢ acid seuments into two separate sites in a Destina- tion Vector using an LR reaction, FIG, Tia schematic representation ofthe cloning of two nucleic acid segments info tWo separate sites in @ Vector using @ BP reaction FIG. 8 is a schematic representation of the eloning of three nucleic acid segments into three vectors using. BP. reactions, cloning the three segments into a single vector using an LR reaction, and generating segments separated by sites. FIG. 9 is a schematic representation of the cloning of tree nucleic acid segments into a single vector using & BP. reaction and generating segments separated by at sites. FIG. 10 is a schematic representation of adding one oF more of the same or different molecules (nveloie acid, protein/peptide, carbohydrate, andor other compounds) 0 & support (shaded box) by recombination. The open boxes represent recombination sites. TIG. 11 isa schematic representation of joining multiple ‘molec and/or compounds (A and B), Labels used in this figure correspond to those in FIG. 10, The addition of A and can be simultancous or sequential TIG. 12 isa schematic representation of deleting a portion ‘ofa molecule or compound (A) from a support. Labels used inthis figure correspond to those in FIG. 10, FIG. 13 is a schematic representation of replacing 2 portion of « molecule or compound (A) with a second molecule or compound (C), Labels used in this figure ‘correspond to those in FIG. 10. FIG. 144 is a plasmid map showing a construct for providing a C-terminal fusion to a gene of interest. Sup fencodes a suppressor function. Thus, when supF is ‘expressed, a GUS-GST fusion protein is produced. n vari tions of his molecules, GUS ean be any gene. TIG, 14B is a schematic representation of method for ‘controlling both gene suppression and expression. The T7 RNA polymerase gene contains one or more (two are shown} amber stop codons (labeled “am”) in place of tyrosine codons. Leaky (uninduced) transcription from the inducible promoter makes insuflcient supF to result in the production of active TT RNA polymerase. Upon induction, Sulficent supE is produced to make active 17 RNA poly erie, which resus in inereased expression of sup. Which results in further increased expression of 17 RNA poly- merase. The T7 RNA polymerase further induces expression ‘of Gene. Further, expression of supF results in the addition ‘of a C-terminal tag to the Gene expression product by suppression of the intervening amber stop codon. TIG. 18 is a plasmid map showing a construct for the production of N- and/or C-temninal fusions of a gene of interest. Cireled numbers represent amber, ochre, or opal stop codons. Suppression of these stop codons result in ‘expression of fusion tags on the N-terminus, the C-terminus, ‘or both termini In the absence of suppression naive protein is produced TIG. 16 is schematic representation of the singe step insertion of four separate DNA segments into a Destination 0 o 46 ‘Vector using LR reactions. In particular, a first DNA seg- sent hiving an aL site atthe ' end and an at site at the 3° end is linked to a second DNA seyment having an AHR’ site ot the 5° end and an atL4 site atthe 3 end. The second DNA segment is then inked to thinl DNA segment having an aR site a the Send and an al 5 site atthe ¥ end. The third DNA segment is then linked toa fourth DNA. ‘segment having an attRS site atthe 5" end and an atl 2 site atthe ¥ end, Thus, upon resetion with LR Cuosase™, the fist second, third, and fourth DNA segments are inserted into a Destination Veetor which coatsins a cedB gene ‘Manked by atR1 and attR2 sites. The inserted DNA seg- ‘ments are separated from each other and vector soquences by a1, a3, 4, attB5, and att? sits. FIGS. I7A and 17B show schematic representations of the construction of a Tux operon prepared according to the ‘methods set out below in Example 18. In accordance with the invention, one or more genes of the operon can be replaced or deleted through recombination to construct one ‘or more modified operons und then tested for activity andlor effect on host cell Alternatively, other genes (including variants and mutants) canbe used in the inital construction fof the operon to replace one or more genes of intrest, thereby producing one oF more modified operons. FIG. 18 isa schematic representation ofthe insertion of six separate DNA segments into a vector using a 180 step, ‘one vecior process. In particular, a first DNA segment (DNA.A) having an at site atthe S end and an a3 site atthe end is linked to a second DNA segment (DNA-B) Fhaving an atR3 sito a the $end and an al 4 site atthe 3 tend, The second [INA segment is then linked to third DNA. segment (DNA-C) having an at site a the $end and an ALS site atthe ¥ end, A fourth DNA segment (DNA-D) Dhaving an atRl site a the S' end and an allL3 site atthe 3 ‘end is linked to a filth DNA segment (DNA-E) having aa AaMR3 site atthe 5° end and an alt site atthe 3 end. The fifth DNA segment is then linked to a sixth DNA segment (DNA-F) having an attR4 ste at the $end andl an att 2 site atthe 3 end. The two resulting molecules (ie, DNA-A- DNA-B-DNA-C and DNA:D-DNA-E-DNA-E) are. thea inserted into the insertion vector. Each of the above reactions is catalyzed by LR Ciosast™. An LR reaction is also used to insert the joined DNA segments into a Destination Vector whieh contains a eedB pene flanked by aR and attR2 sites ‘The inserted DNA segments are separated from each other ‘andthe vector by at, tt, at, at5, and at? sites As described in FIG. 6, for example, the assembled sex- ‘ments may be inserted into contiguous oF non-contiguous sites. FIG. 19 isa schematic representation ofthe insertion of six separate DNA segments into a vector using a two sep, ‘wo vector process. In paniculay a first DNA segment (DNA.A) hoving an auBI site at the $ end and an a3 site atthe 3 end is linked to @ second DNA segment (DNA-B) ‘having an atR3 site a the Send and an all 4 ste atthe ¥ ted, The second DNA segment is then linked toa third DNA segment (DNA-C) having an at site a the $end and an NBS site atthe ¥ end. The linked DNA segments are thea inserted into a vector which contains atPL and atDS sites, Funlier a fourth DNA segment (DNA-D) having an attBS site atthe 5 ead and an ait.3 site atthe 3 end is linked 10 ‘fi DNA segment (DNA-E) having an at site atthe S fend ancl an att site at the 3° end. The fifth DNA segment js then linked to @ sixth DNA segment (DNA-F) having an ‘aR site atthe 5° end and an a2 site atthe ¥ end. The linked DNA segments are then inserted into a vector which contains at? 1 and anP2 sites,US 7,351,578 B2 47 After construction ofthe two plasmids as described, exh ‘of which contains three inserted DNA segments, these plasmids are reacted with LR Cioxasi™ wo generate nother plasmid which contains the six DNA segments flanked by ‘AWD sites (i0,, BI-DNA-A-B3-DNAB-B4-DNA-C-BS- DNA-D-83-B1-DNA-E-B4-DNA-P-12), IG. 20A is a schematic representation of an exemplary vector of the invention which contains two different DNA inserts, the transcription of which is criven in different directions by T7 promoters. Depending on the type of transcripts which are to be produced, either of DNA-A ‘and/or DNA-B may be in an orientation which results inthe production of ether sense or anti-sense RNA, FIG, 208 is a schematic representation of an exemplary vector of the invention which contains one DNA inset, the transcription of which is driven in two different directions by T7 promotes. Thus, RNA produced by transcription driven by one promoter will be sense RNA and RNA produced by teanscription deven by the other promoter will be anti-sense RNA. FIG. 200 is a schematic representation of an exemplary vector of the invention which contains two different DNA inserts having the same nucleotide soquence (ic., DNA-A), the transcription of which are driven in differet direotions by two separate T7 promoters. In this example, RNA pro- ‘duced by transcription driven by one promoter will be Sense RNAand RNA produced by ransription drivenby the other promoter will be anti-sense RNA. TFIG. 20D is schematic representation of an exemplary vector of the invention which contains two DNA insers having the same nucleotide sequence (ic, DNA-A) in ‘opposite orientations, the transcription of which is driven by fone T7 promoter. A transcription termination signal i not present between the two copies of DNA-A and the DNA-A fnserts, Transription of one segment produces a sense RNA ‘and of the other produces an anti-sense RNA. The RNA, produced. from this vector will undergo. intramolectl hybridization and, ths, will form a double-stranded mol- ‘cule witha fairy turn FIGS, 208 and 20F are schematic representations of ‘exemplary vectors of the invention, each of which contains 8 DNA insert having the same nucleotide sequence (i.e, DNA.A), Transcription ofthese inserts results in the pro- ‘duetion of sense and anti-sense RNA which may then hybridize to form double stranded RNA molecules. FIG. 21A is a schematic representation of an exemplary vector of the invention which contains three inserts, labeled “promoter” “coding sequence,” and “Kan’.” ‘In this ‘example, the inserted promoter drives expression of the ‘osing sequence. Further, an inserted DNA segment confers resistance to kanamycin upon host cells which contain the vector. As discussed below in more dewil, a considerable ‘umber of veetor components (ea selectable marker (Tor ‘example a kanamycin resistance gene) cassette, an of cas Sette, a promoter cassette, a tap sequence cassette, and the like) ean be inserted into or used to construct vectors of the FIG. 218 is a schematic representation of an exemplary vector of the invention which contains four inserts, labeled “promoter 1,” “eoding sequence 1.” “promoter 2.” and “ooding sequence 2." In this example, promoter 1 drives ‘expression of coding sequence 1 and promoter 2 drives ‘expression of coding sequence 2. IG. 21C is a schematic representation of an exemplary vector of the invention for homologous recombination. This vector wich contains four inserts, labeled "S* homology.” “NEO;"*DNA-A," and"! homology." The Sand 3 homol- 0 o 48 ‘ogy regions, in this example, are homologous to a chromo- ‘somal region selected for insertion of a neomycin resistance ‘marker (*NEO")and a DNA segment (*DNA-A"), Targeting vectors of this type ean be designed to inset, delete andlor replace nucleic acid present in targeted nueleie acid mol- cules. FIGS. 22A and 2B show a schematic representation of processes for preparing langeting vectors af the invention, FIG. 23 shows mRNA amplified with random-primed first strand reverse transcription, then random-primed with PCR. ‘These amplification prodvets are split into a pools, and each pool is amplified with rundom primers with a dillerent pair ‘of att sites, The “R™ sufi shows that some of the at sites fan be i inverted orientation, atl sites with either the standard or reverse orientations ae used in separate pools to generate amplification products where the attB sites are linked in either standard or inverted orientation. When these sites react with inverted atP sites, at sites are formed in the Entry Clones instead of at sites. Hence, reacting pools with standard or inverted atiRS will generate mixtures of ‘molecules flanked by atiR and atl sites. The amplification products are sized by gel purification, then cloned with the Garew™" AP reaction 9 make Entry Clones, each con- ‘aining small inserts planked by at sites, att sites, or atl and aitR, depending on th orientation of the at sites and ANP sites used. When Entry Clones are mixed together, the inserts clone form a concatamer that can be cloned into a suitable Destination Vector, to give m inserts, each separated by an attB site, Sequencing a number of conemtamers agenerites a profile of mRNA molecules present in the original sample. FIGS. 24A-24C show the sequences of a numberof att sites (SEQ ID NOs:1-36) suitable for use in methods and ‘compositions of the invention FIGS, 254-258 show a collection of Entry Clones which contain insets including, N-terminal tps or sequences (N-tog), open reading frames (ORF), C-terminal tags or sequences (C-tag), selectable markers (amp), origins of plasmid replication (ori) and other vector elements (lor ‘example a Tox? site) Fach Entry Clone vector element inset is flaaked by ator att sites such thatthe vector elements ‘ean be linked together and form a new vector construct in an ER Clonase reaction (shown in FIG. 28B). FIG. 264-268 show a process for constructing atP DONOR plasinids containing att sites of any orientation and specifiy. FIG, 26A shows four arrangements of att? sites in atP DONOR plasmids consisting of two orientations ‘of dirwet repeat and two orientations of inverted repeat att? sites. The four attP DONOR plasmids shown in FIG. 264, fan be used as templates for PCR reactions with PCR Primers that would snes! specifically tothe eore of aa att? Site and thus create an atl. or attR site of any desired specificity atthe ends of the PCR products. For each new atP DONOR vector to be consicted, two such PCR radhcts are generated, one consisting ofthe plasmid back- bone (oi-kan) and a second consisting of the cedB and eat genes. The PCR products ae reacted together in LR Clonase eactons fo generate new plasmids with atP sites of any ‘orientation with any att site specificity. FIG. 274 shows a process for Tinking two nucle acid segments, Aand B, The segments are cloned in wo similarly ‘configured plasmid. Pach segment is lanked by two recom bination sites. One of the recombination sitet on each plasmid is capable of reacting with ts cognate partner on the other plasmid, whereas the other two recombination sites do fot ret with any other site present. Each plasmid carries a ‘unique origin of replication which may" or may not beUS 7,351,578 B2 49 ‘conditional. Each plasmid also carries both positive and negative selectable markers (45mX and sm, respectively) ‘o enable selection against, and for elements linked to 3 particular marker Lastly, each plasmid carries a third recom bination site (loxP in this example), suitably positioned to enable deletion of undesired elements andl retention of ‘dsited elements. In this example, the #Wo plasmids ate initially fused ot L2 and RQ via a Gateway ExR reaction. This results in the juxtaposition of segments A and B via 2 182 recombination site, and the justaposton of sma and ori via @ P2 recombination site. The two loxP sites in the backbone that lank a series of plasmid elements are ‘depicted in the second panel. Addition of the Cre protein will, resolve the single large plasmid ito two smaller ones. One ‘of these willbe the desired plasmid which caries the linked ‘Aad B segments with ori now inked to sm2 and smd, The other carries a set of dispensable and/or undesirable ‘elements. Transformation of am appropriate host and subse ‘quent imposition of appropriate genetic selections will result in loss of the undesired plasmid, while the desired plasmid is maintained FIG. 27B shows a process for linking two chimeric rucleic acid segments, A-B and CD, constructed a shown above in FIG. 27A. The segments are cloned in two similarly ‘configured plasmids. Fach segment bination sites. One of these on each plastid is capable of reacting with its cognate partner on the other plasmid, ‘whereas the other two recombination sites do not react with ny other site present. In this example, the two plasmids are inivlly fused at 12 and R2 via a Gateway EXR reaction. ‘This results in the juxtaposition of segments A and B via 3 'B2 recombination site, and the juxtapostion of smal and ori via a D2 recombination site. The two loxP sites in the backbone that flank a series of plasmid elements are ‘depicted in the second panel. Addition ofthe Cre protein wil, resolve the single large plasmid into to smaller ones. One ‘of thse willbe the desired plasmid which ears the linked AcB and C-D segments with oriA now Tinked to sm2 and ‘tsmd, The other caries a sct of dispensable andlor unde- sirable elements. Transformation of an appropriate host and subsequent imposition af appropriate genetic selections will result in loss of the undesired plasmid, whilst the desired plasmid is maintained. FIGS, 284-3 show the sequence of pDEST™R4-R3 (SEQ ID No:156), FIGS, 29A:B show the sequence of pPDONR™221 (SEQ ID NO:i57), FIGS, 30A-B show the sequence of pDONR™P2R-P3 (SEQ ID NO: 158), FIGS. M1A.B show the sequence of PDONR™P4-PIR (SEQ ID No:159), FIGS. 324: show the sequence of pMS/GW (SEQ 1D) NO-160), FIG, 3 shows vectors ofa Two Fragment Modular Vector ‘Construction Kit ofthe invention, as well asa recombination process using these vectors. Tis kit may be used to link DNA elements to the 5° end of nuckic acid molecules ‘comprising. recombination site (eg, Gateway-adapied ‘ORF's). The Enty clones of 5' elements and ORFs ar inked and assembled on the destination vector pDEST-RAR? in 2 single LR reaction. The unique specificities ofthe different fit sites allow for directional assembly of the Fntry frag- ments FIG. 34 shows vectors of a Three Fragment Modular Vector Construction Kit of the invention, 2s well as recombination process using these vectors, This kit allows DNA elements to be Hiaked tothe Sand 3' ends of aueleie fManked by two recom o ‘acid molecules compr sites (ex, Gate- ‘way-adapted ORFs). Sand 3° elements are linked and assembled on the destinaion vector pDEST-RAR3 in a single LR reection, The Sand 3 elements are supplied to the TER reaetion as Entry clones. PIG. 38 pEXP-AlssGUS was constructed sing the entry clones pENTR. AI and pENTR.ssGUS in an LR Clonase reaction with the destination vector pDEST R&R2. Bacterial colonies transformed with either Entry clones alone or the Destination vector used in the assembly of pEXD-AL-s3GUS alone were determined to be negative for Gus activity within the assay parameters. (AI promoter: arabinose inducible promoter; SsGUS: Glucoronidase gene with a Shine-Del- ‘zamo sequence and a translation stop codon). FIG. 36 Bsr GI digestion of six pExp-ATssGUS Expres sion clones. The predicted fragments from this digestion are '3670 bp, 1167 bp, 426 bp and 279 bp. Lanes 2 and 9 are 1 b-plusDNA markers. Lanes 3 10 8 are Bsr Gl digestod rmini-prep DNA. A 1.2% E-Gel was used for the separation of the digested fragments FIG. 37 pExp-Al-ssGUS-ss alac719, a polycistronic expression clone, was assembled with the Entry clones PENTR AL, pENTR ssGUS and pENTR ss actlacZ19 in a Single LR reaetion with the Destination vector pDES ARS. $$ eaeZ19: alpha eZ fragment from puC19 with a Shine Delgamo and a translation stop codon, FIG. 38 Bor Gl digestion of six pExp-Al-ssGUSss ‘@lacZ19 Expression clones. The predicted fgments Irom this digestion are 4026 bp. 1167 bp, 426 bp and 279 bp. Lanes 2 and 9 are 1 kb-plvs-DNA markers, Lanes 3108 are [sr Gl digested miniprep plasmid DNA. All samples showed the desired profile. The extra fragment in lane 8 Was later proven to be # partial digest figment FIG, 39 Pffects of spermidine eoncencation on the linking of thrce Entry clones in aa LR reaction. Transformants rom {his reaction were seored against the final spermidine con- centration. Several tiation experiments were conducted however only one is depicted in the graph. All the experi ments suggested a peak activity of betwcen 7 to 10 mM spermidine but di to the variability of the colony eonnt assay compiling all results onto one graph was not feasible The final concentration of spermidine in many Gateway LR. seactions may be about 4.5 mM. FIG, 40 The effects of spermidine concentration between 7S aad 10 mM in MuliSite LR reactions. Results from 60 separate experiments are depicted in the graph, TFIG. 41 isa schematic diagram of vector pDONRS: FIG. 4IB is a schematic diagram of vector PDONR®’, In particular embodiments, a spectinomyein resistance marker ‘may be present instad or in addition tothe chloramphenicol resistance marker shown in this figure (abbrevisted "em" FIG. 41€ is schematic diagram of vector pDESTRAR2 FIG. 41D is. schematic diagram of vector PDESTRARA. FIG. 4IP isa schematic diagram of vector pMVC Con- wo, FIG. 42A depiets « BP reaction, where recombination of an att subsrate (ep alt PCR product or expression clone) ‘with an attP substrate (donor Vector) creates an attL-con- entry clon. FIG. 428 depicts an LR reaction, where recombination of ‘an atl-contaning entry clone with an attR-containing des- J veclorereates an attB-containing expression clone FIG, 48 diagram showing three entry clones in single ‘MaltSite Gateway [R recombination reaction with a spe- cially designed desination vector, PDESTMRA-RS, TFIG. 44 depicts the recombination reaction between an a4 and atiBL-lanked PCR product and pDONR™PS.US 7,351,578 B2 51 PIR to ereate an entry clone and a by-produet (SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ 1D NouI6s) FIG. 48 depicts the recombination reaction between an BI and attB2-flanked PCR product and pPDONR™221 t0 ‘reate an entry clone and a by-prodvct (SEQ ID NO: 165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168). FIG. 46 depicts the recombination reaction between a stB2 and atB3-lanked PCR product and pPOONR™P2R- 3 to create and entry clone and a by-product (SEQ:ID NO:169, SEQ ID NO:170, SEQ ID NO:I71, SEQ ID NO:172), FIG. 47A depicts the generation of an att and att ‘anked entry lone containing a 5 element of interest FIG. 47B depicts the generation of an a2 and a3 flanked entyr clone containing a 3 element of interest FIG, 48 depicts various methods of generating an entry clone, FIG. 49 depiets attB forwaed primers (SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175) FIG, 50 depicts at reverse primers (SEQ ID NO:176, SEQ ID NO:177, SEQ ID NO:178). IG, SLA depicts the recombination reagion of the entry ‘lone resulting from pDONR™PS-PIRsattB4-5 element atB1(SEQ ID NO:179), FIG. S1B dapicts the recombination region of the entry ‘lone resulling from pPDONR™221 at 1-genea of ilerest- attB2 (SEQ ID NO:180). FIG. SC depicts the recombination region of the entry ‘lone resulting from PDONR™P2R-PSyatH2-¥ clement sttB3 (SEQ ID NO:181). FIG, 82 depiets the recombination region of the expres sion clone resulting from pDEST™RS-R3xatL 4-5" entry cloneatiR batt Lentry eloneat2¥ entry: clone-atL 3 (SEQ ID No:182) IG, 83 is a vector map of pPDONR™*PS-PIR. FIG. 84 i a vector map of pPDONR™N22 | FIG. $5 is a vector map of pPDONR™P2R-P3 FIG. $6 isa vector map of pPDESTI"RS-RS. FIG, §7 is a vector map of pMSIGW, DETAILED DESCRIPTION OF THE INVENTION Definitions Inthe description that follows a numberof terms used in recombinant nucleic acid technology are utilized exten- sively. In onder to provide a clear and more consistent understanding ofthe specification and claims, including the scope to be given such terms, the following definitions are provided, ‘Gene: As used herein, the term “gone” refers to a nucleic ‘acid which contains information necessary for expression of 1 polypeptide, protein, or untranslated RNA (eg, FRNA, (RNA, anti-sense RNA), When the gene encodes 2 proven, it ineludes the promoter andthe structural gene open reading Jame sequence (ORF), as wel as other sequences involved in expression of the protein. Of course, as would be clearly ‘apparent to one skilled in the art, the transcriptional and ttanslational machinery required for production ofthe gene products not included within the definition afa gene. Whea the gene encodes an untranslated RNA, it includes the prontoter ani the nucleic acid which encodes the unteans- fated RNA, Structural Gene: As used herein, the phrase “structural rene” refers to refers to a aucleie acid which is transcribed 0 o 52 wo messenger RNA that i then translated into a sequence of amino acids characteristic of a specific polypeptide Host) AS used herein, the term “host” refers to auy prokaryotic or evkaryotic organism that is a recipient of @ replicable expression vector. cloning vector of any’ nveloie ‘cid molecule, The nveleie acid molecule may contain, but isnot limited to, a srvetural gene, a transcriptional regu tory soquence (such as a promoter. enhancer, repressor, and ‘an ocgin of replication. As used herein, the ‘host cell” “recombinant host” and “recom- binant host cell” may be used interchangeably. For examples of such hosts, see Maniatis et al., Molecular Cloning: Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N-Y. (1982), Transcriptional Regulatory Sequence: As used herein, the phrase “transcriptional mgulatory sequence” refers to a Tunetional stretch of nucleotides contained on a nuclei acid molecule, in any configuration or geometry, that act t0 regulate the transcription of (1) one or more structural genes (ez, wo, thre, four, live, seven, ten, etc.) into messenger RNA or @) one or more genes into uniranslated. RNA. Examples of transcriptional regulatory sequences include ‘but are not limited to, promoters, enhancers, repressors, and the like, Promoter: As used herein, a promoter isan example ofa ‘ranscriptonal regulatory sequence, and is specifically a nucleic acid generally described as the SVropion of a gone Jocated proximal to the start codon or nucleic aeid whieh encodes untranslated RNA. The transcription ofan adjacent fcc acid segment is initiated at the promoter region. A. repressible promoters rate of transcription decreases in response fo a repressing agent. An inducible promoters ate fof transcription increases in response to an indacing agent. A constitutive promoters rate of transription is not spe cifically regulated, though it can vary under te influence of general metabolic conditions Insert: As used herein, the term “inser refers toa desired nucleic acid segment that isa part ofa Targer nucle acid ‘molecule. In many instances, the insert willbe introduced ‘nto the larger nicleic acid molecule. For example, the fnucleic acid segments labeled cedb and DNA-A in FIG. 2 Aare mice aed inserts with respect to the larger nvcleic acid ‘molecule shown therein In most instances, the inseet will be dTanked by recombination sites (eg, at least one recom nation site at each end). In certain embodiments, however, the insert will only contain a recombination site on one en "Target Nucleic Acid Molecule: As used herein, the phrase “target nucleic acid molecule” refers to a nucleic acid segment of interest, preferably nucleic acid which is to be acted upon using the compounds and methods ofthe present jvention, Sock target aucleic acid molecules preferably ‘contin one or more genes (ez. Wo, three, fou, five, seven, ten, twelve, fille, twenty, thay, filly, et.) oF portions of genes Insert Donor: As used herein, the phrase “Insert Donor” rwfersto one ofthe wo parental nuclei acid molecules (ez. RNA or DNA) of the present invention which carries the Insert (See FIG. 1), The Insert Donor molecule comprises the Insert flanked on both sides with recombination sites. The Insert Donor can be linear or circular. In one embodiment of the invention, the Insert Donor is a circular nucleic acid molecule, optionally supercoiled, and further comprises a cloning vector sequence outside of the recombination sig- nals. When a population of Inserts or population of nvcleie acid segments are used to make the Insert Donor, a popu lation of Insert Donors result and may he used in accordance with the invention,US 7,351,578 B2 53 Product: As used herein the term “Produet” refers to one the desired daughter molecules comprising the A and D sequences whichis produced after the second recombination ‘event during the rocombinational cloning process (sce FIG. 4), The Product contains the nucleic acid which was 10 be <’loned or subcloned, In eordance withthe inveation, when, ' population of Insert Donors are used, the resulting popt- Jation of Prodvet molecules will contain all or a portion of the popslation of Inserts ofthe Insert Donors and preferably ‘will contain a representative population of the original molecules of the Insert Donors ‘Byproduct: As used herein, the term “Byproduct” refers to daughter molecule (a new clone produced after the second recombination event during the recombinational cloning process) lacking the segment which is desired to be cloned ‘or subeloned Cointegrite: As used herein, the term “Cointegrate” refers to at least one recombination intermediate nucleic acid ‘molecule ofthe present invention that contains both parental (starting) molecules. Cointegrates may be linea or eieulae. RNA and polypeptides may be expressed fom coiategrates using an appropriate host eell stain for example B. coll DB3.1 (particularly E.coli LIBRARY EFFICIENCY DB3.17™ Competent Ces), and selecting for both selection smarkers found on the eointegmte molecule, Recognition Sequence: As used herein, the phrase “ree ‘ogniton sequence” refers to a particular sequence to which ‘2 protein, chemical compound, DNA, or RNA molecule (eg restriction endonuclease, a modification methylase, oF ‘a recombinase) recognizes and binds. In the present inven tion, a recognition sequence will usually refer toa recom bination site. For example, the recognition sequence for Cre recombinase is loxP which is a M4 base pair sequence ‘comprising two 13 base pair inverted repeats (serving athe recombinase binding sites) flanking an & base pair core sequence. (See FIG. I of Saver, B., Current Opinion in Biotechnology §:521-527 (1994)) Other examples of rec- ‘ognition sequences are the attB, at, att, and atk sequences which are recognized by the recombinase enzyme 2. Inteprase. at isan approximately 25 base pair sequence ‘containing two 9 hase pair coretype Int binding sites and 3 7 base pair overlap repion, alt? i an approximately 240 base pair sequence conisining core-ype Int binding sites and farmetype Int binding sites as well as sites for auxiliary proteins integration host factor (1H), FIS and excisionase (is) (See Landy, Current Opinion in Biotechnology 3:639- 707 (1993), Such sites may also be engineered according to the present invention t enhance production of products in the methods of the invention, For example, when sich ‘enginoered sites luck the Pl or Hi domains to make the recombination reactions ireversible eat or all), such sites may be designated atiR) or att” to show that the dons of these sites have heen mealfed i some Way. Recombination Proteins: AS used herein, the phmse “recombination proteins” includes excisive or integrative proteins, enzymes, co-factors or associated proteins that are Involved in recombination reactions involving one or more recombination sites (eq, Wo, thre, four, five, seven, ten twelve, fifteen, twenty, thins, fifty. ete), which may be wiklype proteins (see Landy, Current Opinion in Biotech- hnologs 3699-707 (1993), or mutans, derivatives (©. fusion proteins containing the recombination protein sequences or fragments thereo!), fragments, and variants thereof, Examples of recombination proteins include Cro, In, IHF, Nis, Flp, Fis, Hin, Gin, C31, Cin, Ta3 resolvase TudX, XerC, XerD, TupX, Hie, Gin, SpCCEI, and Par, 34 Recombination Site: used herein, the phrase “recom ration ste” refers to recognition sequence on # nucleic acid molecule which participates in an integraon/ecombi- ration reaction by recombination proteins. Recombination sites are diserete sections of segments of nucleic acid on the participating nucleic acid molecules tht are recognized and bound by a site-specific recombination protein during the inital stages of integration or recombination. For example, the recombination site for Cre recombinase is loxP which is a 34 base pair soquence comprised of two 13 hase pair inverted repeats (serving as the recombinase binding sites) Tanking an 8 base par core sequence, (See FIG. 1 of Saver, 1B, Cun: Opin Biotech. 5°521-527 (1994), Other examples fof recognition sequences include the at, at, at and at sequences described herein, and mutants, fragments, vati- fants and derivatives there, which are recognized by the recombination protein % Int and by the auxiliary proteins integration host factor (IHE), FIS and excisionase (is). (Gee Landy, Cure Opin, Biotech. 3:699-707 (1993)) ‘Recombination sites may be added 10 molevules by any ‘number of known methods. For example, recombination sites ean be added fo nueleie aeid molecules by blunt end ligation, PCR performed with fully or partially random primers, or inserting the nucleic acid molecules into an vector using a restriction site which Mlanked by recombina- sion sites, ‘Recombinational Cloning: As used herein, the phrase “recombinational cloning” refers to a method, such as that eseribod in US. Pat. Nos. 5,888,732 and 6,143,557 (the contents of which are fully incorporated herein by refer fence), wherchy segments of nucleic acid molecules oF populations of such molecules are exchanged, inserted ‘placed, substituted or modified, in vitro or in vivo. Pref erably, stch cloning method is an in vitro method ‘Repression Cassette: As used herein, the phrase “repres- sion cassette refers to 4 meleie seid segment that contains ‘repressor ora selectable marker present inthe subcloning vector ‘Selectable Marker: As used herein, the phrase “selectable marker” refers to a nuclei acid segment that allows one t0 selot for oragainst a molecule (eg. a replicoa}ara cell hat contains it often under particular conditions. These markers fan encode an activity, such as, but not limited to, produc- tion of RNA, peptide, or protein, or ean provide a binding site for RNA, peptides, proteins, inorganic and organic compounds of compositions and’ the Tike, Examples of selectable markers include bu are not mite to: (1) nel ‘acid segments that encode products which provide resistance ‘against otherwise toxie compounds (ez, antibiotics): 2) ‘nucleic acid segments that encade products which are oth- fnvise lacking in the recipient cell (eg~ (RNA genes, auxotrophie markers; (3) nuclei acid seyments that encode products whieh suppress the activity of @ gene product: 4) fuclse acid segments that encode products which ean be readily identified (e-¢, phenotypic markers such as (Bg. Jactosidase, green fluorescent protein (GFP), yellow floures cent provein (YFP), red fluorescent protein (REP), eyan AMuorescent protein (CFP), and cell surface proteins); (5) ueleie acid seyments that bind products which are otber- ‘wise detrimental to cell survival andor funtion; (6) neleic ‘acid segments that otherwise inhibit the aetivity of any ofthe nucleic acid segments described in Nos. 1-5 above (eg. antisense oligonucleotides); (7) muclele acid segments that bine products that modify a substrate (eg, restriction endo- ueleases); (8) nucleic aeid segments that can be used 10 isolate or identify a desired molecule e.g. specific protein binding sites); (9) nueleie acid seyments that encode aUS 7,351,578 B2 55 cleotide sequence whieh can be otherwise » Junetional (eg. for PCR amplification of subpopulations of molecules}; (10) nucle aeid segments, which when absent, directly or indirectly confer resistance of sensitivity t0 particular compounds; and/or (11) nucleic acid segments that encode products which either are toxic (-g., Diphtheria ‘oxin) or conver a relatively non-foxie compound a toxic ‘compound (eg. Herpes simplex thymidine kinase, cytosine ‘deaminase) in recipient cells (12) nueleic acid segments that ‘inhibit replication, partition or heritability of aucleie acid ‘molecules that contain them; andor (13) aucleie acid seg- ments that encode conltional replication functions, e. replication in certain hosts or host cell stains or under ‘certain environmental conditions (e.., temperature, nei tional conditions, ete) Selection Scheme: As used herein, the phrase “selecto scheme” refers to any method which allows selection, ‘enrichment, or identification ofa desired nucleic acid mol ‘ecules or host eels eoutactng them (in particular Product or Product(s) from a mixture containing an Entry Clone or ‘Vector, a Destination Vector, a Donor Vector, an Expression ‘Clone o Vector, any intermediates (ea Cointegrate or 3 replicon), andlor Bypreducts). In one aspect, selection Schemes of the invention rely on one or more selectable markers. The selection schemes of one embodiment have at Jeast (wo components that are either Inked or unlinked ‘during recombinational cloning. One component isa select able marker. The other component controls te expression in vitro or in vivo ofthe selectable marker or survival of the ‘xl (or the nucleic acid molecule, ga replicon) harboring the plasmid carying the selectable marker. Generally, this controlling clement will be a repressor or inducer of the scloctable marker, but other means for controlling expres: sion or activity of the selectable marker can be used. Whether a repressor of activator is used will depend on whether the marker is for a postive or negative selection, fand the exact arrangement of the various nucleic acid Segments, a8 will be readily apparent to those skilled in the ft. In some preferred embodiment, the selection scheme resulls in seléction of or enrichment for only one or more desired nucleic acid molecules (such as Products). As, ‘defined herein, selecting fora nucleic acid molecule includes (@) selecting or enriching for the presence of the desired nucleic acid molecule (referred (0 a a “positive selection scheme"), and (b) selecting or enriching oganst the presence ‘of nucleic acid molecules that are not the desired nucleic id molecule refered to asa “negative selection scheme”) In one embodiment, the selection schomes (which can be ‘carried out in reverse) will take one of three forms, which ‘will be discussed in tems of FIG. 1. The first, exempliied herein wih a selectable marker and a repressor therefore, selets for molecules having segment and lacking segment C. The second selects against molecules having sepmeat C and for molecules having segment D. Possible embodiments ‘of the second form would have a nbeleie acid segment ‘carrying a gene toxie to ells into which the in vito reaction products are tobe introduced. A toxie gene ean he a aeleic cid that is expressed a a toxic gene prod (atoxie protein ‘oF RNA), or ean be toxie in and of ise. (la the latter case, the toxic gene is understood to carry its classical definition ‘of “heritable wait”) Examples of such toxie gene prodacts are wellknown in the art, and inelnde, but are ot limited to, restriction ‘endonucleases (eg, Dpnl, Nia3, etc: apopiosis-related tenes (eg, ASKI or members of the bel-2eed-9 family) Fetroviral genes: including those of the human immunode- ficiency Virus (HIV); defensins such as NP-I; inverted 0 o 56 repeats or paired palindromic mueleie acid sequences; ba {eriophage Iyie genes such as those fom @X174 or bacte- ophage T4; anibiotie sensitivity genes suc as rps: ant microbial sensitivity genes such as phoS; plasmid killer szenes" cukaryotie transcriptional vector genes that produce gene product toxic to hactera, such as GATA-I; genes that {ul hosts inthe absence of a suppressing function, eg. kieB, cedB, @X174 E (Liu, Q. etal, Curr Biol. 8:1300-1309 (1998)); and other genes that negatively affect replicon stability andor replication. A toxic gene can alternatively be selectable in vitro, eg a resteietion site ‘Many genes coding for resiriction endonucleases oper. ably linked to inducible promoters are known, and may be used in the present invention. (See, eg, US. Pat. No. 4,960,707 (Dpnl and Dpnil); US. Pat. Nos. 5,000,333, 5,082,784 and 5,192,675 (Kp); US. Pat. No. 5.147.800 (NgOAITI and Ngo; US. Pat. No. 5,179,015 (Fspl and Haelll): US. Pat. No. $200.333 (Helland Tag); US. Pa. No. 5,248,605 (pall), US. Pat. No. 5.312,746 (Clal), US. at. Nos. $231,021 and §,304,480 (Xhol and XhoI US. at, No. §,384,526 (Alul}: U.S. Pat. No. 470,740 (Nsil) US. Pat. No. 5,534,428 (Sst/Snel): US. Pat. No. 5202,248 (Neol); US. Pat. No. $139,542 (Néel); and U.S. Pat No. 5,098,839 (Pael). (See also Wilson, G.G., Nucl Acids Res. 39.2565 (1991); and Lunnen, K. D., et al, Gene (1988),) Inthe second form, segment D carries selectable marker ‘The tie gene would eliminate ransformnts harboring the ‘Vector Donor, Cointgrate, and Byproduct molecules, while the selectable marker can be used to select for cells cor taining the Product and against cells harboring only the Insert Donor, "The third form selects fr cells that have both segments A ‘and D inci on the same molecule, but aot for ells that have both segments in trans on dillerent molecules. This could be embodied by a selectable marker that is split into wo inactive fragments, one each on segments A and D. ‘The fragments are so arranged relative tothe recombins tion sites that when the segments are brought together by the recombination event, they reconstitute a functional select- thle marker. For example, the recembinational event can Tink a promoter with a structural nucleic acid molecule (eg, ‘a gene), can link two fragments ofa structural avcleic acid ‘molecule, or ca link nucleic aeid molecules hat encode 3 Ihelerodimerie gene product needed for survival, of can link portions ofa replicon, Site-Specific Recombinase: As used herein, the phrase “site-specific recombinase” refers to type of recombinase whiek typically has atleast the Following four aetvities (oF combinations thereo): (1) recognition of specific nvcleie avid sequences: (2) cleavage of said sequence or sequences: {G) topoisomerase activity involved in strand exchange; and (4) Biase activity to reseal the cleaved strands of nucleic acid. (Soe Saver, B., Current Opinions in Biotechnology '5:521-527 (1994). ) Conservative site-specific recombination js distinguished from homologous recombination an ra position by a high degree of sequence specificity for both partners. The strand exchange mechanism involves the cleavage and rejoining of speifie nucleic acid sequences the absence of DNA synthesis (Landy, A. (1989) dam. Rev: Biochem, 58:913-949), ‘Homologous Recombination: As used hersin, the phrase “homologous recombination” refers to the process in Which nucleic acid molscules with similar nuclotide sequences associate and exchange mucleotide strands. A nucleotide sequence of a fit nucleic acid molecule which is effective {or engaging in homologous recombination at a predefinedUS 7,351,578 B2 37 position of a second mucleie seid molecule will therefore have a nucleotide sequence which Faiitates the exchange of nucleotide strinds between the fst nucleic acid molecule anda defined postion of the second nucleic acid molecule. ‘Thus, the first nuclei acid will generally have a nucleotide sequence which is sliciently complementary toa portion of the second nucleic acd molecule to promote nucleotide base pairing Homologous recombination requires homologous sequences in the two recombining partner nucleic acids ut ‘does not require any specific sequences. As indicated above, site-specific recombination which occurs, for example, at recombination sites such as at sites, is not considered 10 be “homologous recombination,” as the phase is used herein. Vector: As usod herein, the terms “vector” refers 10 a uclee acid molecule (preferably DNA) that provides @ useful biological or biochemical property 10 an. inser. Examples include plasmids, phages, autonomously replicat- ing sequences (ARS), centromeres, and other sequences Which are able to replicate or be replicated in vitro o in @ host cell, or to convey a desired nucleic acid segment 10 2 ‘desire location within a host cell. A veetor ean have one oF ‘more restriction endonuclease recognition sites (¢@.. !, three, four, five, seven, ten, ee.) at which the sequences can be eut ina determinable fashion without loss ofan essential biological finetion of the vector, and into which a nucleic cid Iragment can be spliced in order to bring about its replication and cloning. Vectors can futher provide prin sites (eg, for PCR), transcriptional andor translational ination and/or repulation sites, revombinational signals, replicons, solecable markers, ete. Clearly, methods of inserting desired nucleic acid fragment which do-not regjire the use of recombination, transpositions or restric- tion enzymes (soch as, but not limited to, uracil N-glyeo- sylase (UDG) cloning of PCR fragments (U.S. Pat. Nos 5,384,575 and 5,888,795, both of which are entity incor porated herein by reference), T:A cloning, and the like) can ‘alo be applied to clone a fragment into a cloning vector to be used according to the present invention. The cloning vector can further comin one ot more selectable markers (ex, to, three, four, five, seven, en, et.) suitable for use jn the identification of ceils transformed with the cloning Subeloning Vector: As used herein, the phrase “subelon- ing vector” refers to a cloning vector comprising a circular oF lincar nucleic acid molecule which includes, preferably. an appropriate replicon. In the present invention, the sub- cloning vector (segment D in FIG. 1) can also contain Junetional andor regulatory elements that are desired t0 be ‘ncomporated inl the final product to wet upon or with the cloned nucleic acid insert (segment A in FIG. 1). The subcloning vector can also contain a selectable marker (preferably DNA), ‘Vector Donor: As used herein, the phrase “Vector Donor” refers to one ofthe two parental nucle acid molecules (eg RNA or DNA) of the present invention which earries the nueleie acid segments comprising the nucleic acid vector hich isto become part of the desired Product. The Vector Donor comprises a subcloning vector D (or it can be called the cloning veetor if the Insert Donor does not already ‘contain a cloning vector) and a segment C Nanked by recombination sites (S00 FIG. 1), Sogments C andor D can ‘contain elements that conteibute to seletion for the desired Product daughter molecule as described above for selection Schemes. The recombination signals can be the same or 0 o 58 ferent, and can be acted upon by the same or differs ecombiruases. In addition, the Vector Donor can be linear or circulae Primer As used herein, the term “primer” refers #0 a single stranded or double standed oligonucleotide that is fextended by covalent bonding of nucleotide monomers during amplification or polymerization of « micleie ackd molecule (eg, a DNA molecule). In one aspect, the primer may be a sequencing primer (for example, a universal sojuencing primer). In another aspect, the’ primer may comprise a recombination site or portion there. Adapter: As used herein, the term “adapter” refers to an oligonucleotide or nucleic acid fragment or segment (pref teably DNA) which comprises one oF more recombinstion sites (oF portions of such recombination sites) which in ‘accordance with the iavention ean be added to circular oF linear Insert Donor molecule as well as other nuceic acid molecules described herein, When using portions of recom- bination sites, the missing portion may be provided by the Insert Donor molecule. Such adapters may be added at any location within a cireular or linear molecule, although the adapters are preferably ade at or near one or both termini ff a linear molecule, Preferably, adapters are positioned be located on both sides (Nanking) a particular nucleic acid ‘molecule of interest. In accordance with the inveation, adapters may be added to nocleic avid molecules of interest by standard recombinant techniques (e.g. restriction digest and ligation), For example, adapters may be added to 3 circular molecule by ftst digesting the molecule with an appropriate restriction enzyme, adding the adapter at the cleavage site and refoming the circular molecule which contains the adapter(s) at the site of cleavage. In other aspects, adapters may he added hy homologous recombina- ‘ion, by intepration of RNA molecules, and the like. Alter natively, adapters may be ligated directly to one or more and preferably both termini ofa linear moleeule thereby result ing in linear molocule(s) having adapters at one or bath termini, In one aspect of the invention, adapters may be added to a population of linear molecules, (e., a cDNA. libeary or genomic DNA which has been cleaved oF digested) to form a population of linear molecules contain- ing adapters at one and preferably both termini ofall or substantial portion of sid population. ‘Adapler-Primer: As used herein, the phrase “adapter: primer" refers lo a primer molecule which comprises one oF ‘more recombination sites (or portions of such recombintion sites) which in accordance with the invention ean be added ‘oacireula of linear melee acid molecule deseribed herein, ‘When using portions of recombination sites, the missing portion may be provided by a nuclei acid molecule (ean ‘adapter) of the invention. Such adaplerprimers may be ‘added at any locaton within a eieular or linear molecule, although the adapter primers are preferably add al or near ‘one or both termini ofa linear molecule. Examples of sich adapterprimers and the use thereof in accordance with the ‘methods of the invention are shown in Fxample 8 herein Such adapterprimers may be used t0 add ane or more recombination sites or portions thereof to circular or linear eleie acid molecules in a variety of contexts and by & varity of technigues, including but not limited to ampii cation (eg, PCR), ligation (eg, enzymatic or chemical synthetic ligation), recombination (e, homologous ar non- /omotogous (illegitimate) recombination) and the like “Template: As used herein, the term “template” refers ta double stranded or single stranded nucleic acid molecule ‘which is to be amplified, synthesizad or sequenced. In the case ofa double-stranded DNA molecule, denaturation ofitsUS 7,351,578 B2 59 strands to form a first and a second strand is preferably performed before these molecules may be amplified, sya- thesized or sequenced, or the double stranded molecule may be used directly asa template. For single stranded templates, ‘primer complementary to at least a portion ofthe template hybridizes under appropriate conditions and one oF more polypeptides having. polymerase activity (eg, 60, three four, ive, or seven DNA polymerases andor reverse tran- scriptases) may then synthesize a molecule complementary to all or portion of the template, Altemativel, for double sanded templates, one of more transcriptional regulatory sequences (eg. 1Wo, thre, four, five, seven or more pro- moters) may be used in combination with one or more polymerases to make nucleic acid molecules complementary to all ora portion of the template. The newly synthesized molecule, according to the invention, may be of equal or shorter length compared tothe original template. Mismatch incomporation oF strand slippage during the synthesis oF ‘extension of the newly synthesized molecule may result in fone or a number of mismatched base pairs. Thus, the 2 symhesized molecule need not be exactly complementary to the template. Additionally, a population of micleic acid templates may be used during synthesis or amplification to produce a population of nucleic acid molecules typically representative of the original template population. ‘Incorporating: As used herein, the tem “incorporating” means becoming a part of a nucleic acid (eg, DNA) molecule or primer, Library: As used herein, the tom “library refers 1 2 collection of nucleic acid molecules (circu of linea). In library may comprise « plurality of nucleic acid molecules (e160, thre, four, five, seve, ten, twelve, fieen, twenty, thiny, filly one hundred, two hundred, five hundred one thousand, five thousand, oF more), which may or may aot be from a common source ‘organism, organ, tissue, or cell. In another embodiment, 2 library is representative of all or @ portion or « significant portion of the nucleic acid conten of an organism (a “genomic” library), of a set of nucleic acid molecules representative ofall ora portion or a significant portion of the expressed nucleic acid molecules (a cDNA library or segments detived thereftom) in a cell, tissue, organ or ‘onganism. Library may also comprise nuleie acid mol ‘ecules having random sequences made by de novo synthesis, ‘ulagenesis of one or more neleic aid molecules, and the Tike, Sueh Iibraries may or may not be contained in one oF more vectors (two, thre, four, fve, seven, ten, twelve, fifteen, twenty, tiny, fifty, et.) Amplification: AS used herein, the term “amplification” refers to any in vitro method for increasing the number of ‘copies ofa nulei acid molecule with the use of one or more polypeptides having polymerase activity (ex, ome, (60, three, four or more nucleic acid polymerises or reverse transcripiases). Nucleic acid amplification results in the ‘incorporation of nucleotides into a DNA andor RNA mol- ‘cule or primer thereby farming new nucleic acid molecle ‘complementary 10 a template. The formed nucleic acid molecule and its template can be used as templates 10 synthesize additional nucleic aeid molecules. AS used herein, one amplification reaction may consist of many rounds of nucleic acid replication. DNA amplification weae- tions include, for example, polymerase chain reaction (PCR). One PCR reaetion may consist ofS 10 100 cycles of denaturation and synthesis of # DNA molecule. ‘Nucleotide: As used herein, the tem “nucleotide” refers to a base-sigar-phosphate combination. Nucleotides are monomeric units of & nucleic acid molecule (DNA and 0 o RNA), The term osphates ATP, UTP, CTG. GTP and deoxyribonucleoside ‘ephosphates such as DATP, dCTP, dITP, UTP, dGTP, TTP, or derivatives thoreof. Such derivatives include, for ‘example, JaS]IATP, 7-deaza-dGTP and T-deaza-dATP. The term nucleotide as used herein alsa refers to dideoxyribo- nucleoside teiphosphates (daNTPs} and their derivatives. Ilusiated examples of dideoxyribondicleside rphospiates include, but are not limited to, dJATP, dCTP, daGTP, GAITP, and ddTTP. According to the present invention, a “nucleotide” may be unlabeled or detectably labeled by well know technigues. Detetable labels includ, for example, radioactive isotopes, fhioescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels ‘Nucleic Acid Molecule: As used herein, the phrase clei avid molecule” refers fo a sequence of contiguous nucleotides (riboN'TPs, dNTPs or ddNTPs, or combinations thereo!) of any length which may encode a full-length polypeptide of fragment of any length thereof, or which ‘ay be non-coding, As used herein, the terms “nuclei acid molecule” and “poiynvcleotide” may he used interchange- ahly and include both RNA and DNA, Oligonucleotide: As used herein, the term “oligonucle- ‘otide” refers toa synthetic or natural molecule comprising a covalently Tinked sequence of nucleotides which are joined by a phosphodiester bond between the ¥ position of the pentose of one nucleotide and the 5 postion of the pentose of the adjacent nucleotide, Polypeptide: As used rein, the term “polypeptide” refers to a sequence of contiguous amino acids, of any length. The terms “peptide.” “olignpeptide:” oF “protein ‘may be used interchangeably herein with the tem “polypep- tide Hybridization: As used herein, the terms “hybridization” and “hybridizing” relerto base pairing of two complemien- tary single-stranded nucleic acid molecules (RNA andor DNA) 0 give a double stranded molecule. As used herein, ‘to mcleie acid molecules may hybridize, although the base pairing is not completely complementary: Accordingly, mi ‘matched bases donot prevent hybridization of two nbeleic fcid molecules provided that appropriate concltions, well known inthe art, are used. In some aspects, hybridization is said to be under “stringent conditions,” By stringent con ions,” as the phrase is used herein, is meant ovemight incubation at 42°C. in a solution comprising: 50% forma- imide, 58SC (750 mM NaCl, 75 mM tesodinm citrate), $0 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ig/ml denatured, sheared salmon sperm DNA, followed by washing the fers in O.1x8SC at about 65° C. ‘Reaction Hulfers: The invention further includes reaction butlers for performing recombination reactions (et, Lx reaction, BxP reactions, et.) and reaction mixtures which ‘comprise such retin buffer, as well as methods employing ection buller ofthe invention for performing recombina- tion reactions and products of recombination reactions pro- ‘duced using such reaction butlers, Typically, reation balers ‘of the invention will contain one oF more ofthe following ‘components: (1) one or more buffering agent (ex sod phosphate, sodium acetate, 2-{N-moropholino ethane sulfonic eid (MES), trs-{hydroxymethy)aminomethane (Tris), 3-Ceyeloherylamina)-2-hyeeoxy-I-propaneslfonie acid (CAPS), citrate, N-2-hydroxyethylpiperazine-N' cthanesulfonic acid (HEPES), acetate, 3-(N-morpholino} prpoanesulfonic acid (MOPS), Netis(aydroxymethyl)me- {hyl--aminopropanesulfonio acid (TAPS) et.) 2) one oF pore salt (eat, NaCl, KCI, ee.) 8) one or more chelatingUS 7,351,578 B2 61 ‘agent (ex, one of more chelating sent which predo nantly chelate divalent metal ons such as EDIA of EGTA), (4) one or more polyamine (eg. spermidine, spermine, et.) (6) one or more protein which is not typically directly involved in recombination reactions (e., BSA, ovalbumin, etc), oF (6) one or more diluent (eg, water) The concentration of the buffering agent in the reaction buller of the invention will vary with the particular bulfering agent used. Typically, the working concentration (ie, the ‘concentration inthe reaction mixture) of the buffering agent will be from about 5 mM to about 500 mM (eg, about 10 IM, about 15 mM, about 20 mM, about 25 mM, about 30 IM, about 35 mM, about 40 mM, about 45 mM, about $0 IM, about $$ mM, about 60 mM, about 65 mM, about 70 IM, about 75 mM, about 80 mM, about 85 mM, about 90 ‘mM, about 95 mM, about 100 mM, from about 5 mM about $00 mM, from about 10 mM to about $00 mM, from bout 20 mM wo about $00 mM, fom about 25 mM to about 500 mM, from about 30 mM 10 about $00 mM, from about 440.mM to about $00 mM, from about 50 mM to about SOO iM, from about 75 mM to about 500 mM, fom about 100 ‘IM to about S00 mi, from about 25 mM to about $0 mM, fom about 25 mM to about 75 mM, from about 25 mM to ‘about 100 miM, from about 25 mM to about 200 mM, fom about 25 mM to about 300 mM, ete. When Tris (e., PI is used, the Tris working concentration will tpi cally be from about $ mM to about 100 mM, feom about 5 ‘IM 10 about 75 mM, from about 10 mM to about 75 mM, from about 10 mM to about 60 mM, from about 10 mM © about $0 mM, from about 25 mM to about 50 mM, et “The final pl of solutions of the invention will generally be set and maintained by bulering agents preseatin reaction buffers of the invention, The pli of reaction buffers of the ‘invention, and heace reaction sixtres of the invention, will vary with the particular use and the bulfering agent present but will often be fom about pil 5.5 to about pHi 9.0 (eg. about pH 6.0, about pH 6.5, about pH 7.0, about pH 7.1, ‘about pH 7.2, about pH 7:3, about pH 7-4, ahont pH 7S, about pH 7.6, about pl! 77, about pH 7.8, about pHi 79 about pli 80, about pH 8.1, about pH 8.5, about pH1 90, fom about pH 6.0 to about pil 8. from about pH 6S to about i185, from about pH 7.0 to about pHT8.5, fom about pH7.5 to about pH 8.5, from about pH 6.0 to about pH 8.0. Jrom about pH 6.0 to about pH 7.7, from about pH 60 about pH, from about pH 6.0 to about pH 7.0, from about pH 7.210 about pit 77, from about pH 7:3 to about pH 7.7, trom about pH 7.4 to about pH 7.6, from about pH 7.0 10 about pHT7.4, from about pHT7.6 to about pF 80, from about pH 7.6 to about pil 8.5, ete) As indicated, one or more sills (eg, NaCI, KCI, ete) may be included in reaction ballers of the invention, In many Instances, salts used in reaction buffers of the invention will dissociate in solution to generate atleast one species Which js monovalent (eg. Nae, Ke, te) When included in reaction butlers ofthe invention, salts will often be present ‘iter individeally of in a combined concentration of fom about 0.5 mM to about $00 mM (eg. about 1 mM, about 2 IM, about 3 mM, about 5 mM, about 10 mM, about 12 mM, ‘bout 15 mM, about 17 mM, about 20 mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 27 mM, ‘bout 30 mM, about 35 mM, about 40 mM, about 4S mM, about 50 mM, about 5S mM, about 60 mM, about 64 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, bout 85 mM, about 0 mM, about 9§ mM, about 100 mM, about 120 mM, about 140 mM, about 150 mM, about 175 1M, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, sbout 350 mM, 0 o 62 shout 375 mM, about 400 mM, from about 1 mM to about ‘500 mM, from about SmM to about 500 mM, from about 10 ‘aM to about $00 mM, from about 20 mM to about 500 mM, from about 30 mM to about $00 mM, from about 40 mM t0 bout 500 mM, from about 50 mM bout S00 mM, from bout 60 mM to about $00 mM, from about 65 mM to about ‘500 mM, from about 75 mM to about $00 mM, from about 85 mM to about $00 mM, from about 90 mM to about SOO 1M, from about 100 mM to about 500 mM, from about 125 mM to about $00 mM, from about 150 mM to about SOO ‘2M, fom about 200 mM to about 300 mM, from about 10 ‘aM to about 100 mM, rom about 10 mM to about 75 mM, from about 10 mM to about $0 mM, from about 20 mM 10 bout 200 mM, from about 20 mM to about 150 mM, from bout 20 mM to about 125 mM, fom about 20 mM to sbout 100:mM, from about 20 mM to about 80 mM, from about 20 ‘mM to about 75 mM, from about 20 mM to about 60 mM, {rom about 20 mM to about SO mM, from about 30 mM to bout 500 mM, from about 30 mM to about 100 mM, from fahout 30 mM to about 70 mM, fom about 30 mM to ubout 50 mM, ct) ‘As also indicated above, one or more agents which chelate ‘metal ions (eg.. monovalent or divalent metal ions) with relatively high affinity may also be present in reaction buffers of the invention. Examples of compounds which chelate metal ions with relatively high alinity include ethylenediamine tetraacetic acid (EDTA), dithylenetr- faminepentsacetie aeid (DTPA), trethylenetetrzamine hoxaacetic acid (TTHA), ethylencbis(oxyethytenenitilo)] tetraacetic ac (EGTA), and propylenetriaminepentaaetic acid (PTPA). The fice acid or salt of chelating agents may be used to prepare reaction butlers of the invention ‘When include in reaction hfs othe invention, hel ing agents will often be present either individually or in a ‘combined concentration af from about 0.1 mM to about 0 mM (eg, about 0.2 mM, about 03 mM, about 0.5 mM, about 0.7 mM, about 0.9'mM, about 1 mM, about 2 mM. About 3 mM, about 4 mM, about 5 mM, about 6 mM, about 10 mM, about 12 mM, about 15 mM, about 17 mM, about 20 mM, about 22 mM, abont 23 mM, about 24 mM, about 25 mM, about 27 mM, about 30 mM, about 35 mM, about 40.mM, about 45 mM, about $0 mM, from about 0.1 mM 9 about SO mM, from about 0.5 mM to about $0 mM, from ‘about 1 mM (o about $0 mM, from about 2 mM wo about $0 :M, from about 3 mM to about 5O mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from hout 05 mM to about § mM, from shout 0.5 mM to about 2.5 mM, from about | mM 10 about 20 mM, from about 1 ‘mM to about 10M, from about | mM to about § mM, rom about 1 mM to about 3.4 mM, from about 0.5 mM to abet 3.0mM. from about I mM to about 3.0 mM, from about 1.$ ‘mM to about 3.0 mM, from about 2 mM to about 3.0 mM, rom about 0.5 mM to about 25 mM, fom about 1 mM wo bout 25 mi, fom about 1.5 mM to about 25 mM, from fahout 2 mM 16 about 3,0 mM, from shout 25 mM to about 3.0mM. from about 0.5 mM to about 2 mM, from about 0S ‘mM to about 1.5 mM, from about 0.5 mM to about L.1 mM, ete) ‘Reaction buffers of the invention may also contain one or ‘more polyamine (e.g. spermine, spermidine, protamine, polylysine, and polyetiylenimine, ee), which may be syn- fhetie or naturally oecurring. When inchuded in reaction buffers of the invention, polyamines will often be present either individually or in a combined concentration of from bout 0.1 mM to about 50 mM (eg, about 0.2 mM, about (03:mM, about 0.5 mM, about 0.7 mM, about 0.9 mB, about mM, about 2 mM, about 3 mM, about 4, about 5 mM,US 7,351,578 B2 63 bout 6 mM, about 6.5 mM, about 7 mM, about 7.5 mM, about 8 mM, about 8.5 mM, about 9 mM, about 9.5 mM. ‘bout 10 mM, about 12 mM, about 15 mM, about 17 mM, about 20 mM, about 22 mM, about 23 mM, about 24 mM, ‘about 25 mM, about 27 mM, about 30 mM, about 35 mM, about 40.mM, about 45 mM, about $0:mM, from about 0.1 FIM to about 50’ mM, from about 05 mM to about 50 mM, fom about I mM to shout 50 mM, from about 2 mM 10 about $0 mM, from about 3 mM to about 0 mM, fom about 0.5 mM to about 20 mM, from about 0.5 mM to about 10, ‘iM, from about 05 mM to about SM, rom about 0 mM (o about 25 mM, from about L mM wo about 20 mM, from ‘about 1 mM to abont 10 mM, from about 1 mM to about $ IM, from about mM to about 3.4M, rom about 05 mM to about 3.0 mM, from about 1 mM to about 3.0 mM, from ‘about 1.5 mM to about 3.0 mM, from about 2 mM to about 3.0.mM, from about 0.5 mM to aboot 2.5 mM, from about 1 mM to about 2.5 mM, from about 1.5 mM to about 25 1M, from about? mM to about 3.01, from about 23 mMt {o about 3.0 mM, from about 0.$ mM to about 2 mM, from bout 0.5 mM to about 15 mM, from about 0.5 mM to about 1.1 mM, from about 7.6mM to about 20M, from about 7.7 1M to about 20 mM, from about 78 mM to about 20 mM, from about 8.0 mM to about 20 mM, from about 8.1 mM 10 about 20 mM, from about 8.2 mM to about 20 mM, from About 8.3 mM to about 20 mM, oa about 8.4 iM to about 200M, from about 8.5 mM to about 20 mM, from about 9.0 ‘4M te about 20 mM, fom about 10.0 mM to about 20:mM, from about 12.0 mM to about 20 mM, from about 7.6 mii ‘o about $0 mM, fom about 8.0 mM to about 50 mM, et). For example, reaction burs of the invention may contain spermidine ata concentration of Irom about 7.6 mM to about 201M, from about 77 mMto about 20 mM, from about 7.8 ‘mM to about 20 mM, from about 8.0 mM to about 20 mM, fom about 8.1 mM to about 20 mM, from about 82 mM to ‘bout 20 mM, from about 8.3 mM to about 20 mM, from, bout £4 mM to about 20 mM, from about 8.5 mM to about 20 mM, from about 9.0 mM to about 20 mM, from about 10.0 mM to about 20 mM, from about 12.0 mM to about 20 IM, from shout 7.6 mM to about 30 mM, from about 8.0 ‘mM to about 50 mM, ete ‘Reaction bulfers ofthe invention may also contain one oF more protein which is not typically directly involved ia recombination reactions (eg, bovine serum albumin (BSA); ‘ovalbumin; immunogobins, such as IgE, IgG, IgD: ete). ‘When included in reaction buffers of the invention, sich proteins will ofien be present either individually or in a ‘combined! concenteation of from about 0.1 mg/ml to about 50 mg/il (eg. about 0.1 mg/ml, about 0.2 mere, about 0:3 ‘git, about O.4 mg/ml, shout 0:5 mg/ml, about 0.6 mg/ml, about 0.7 mg/ml, about 0.8 mg/ml, about 0.9 mg/ml, about 1.0 mg/ml, about 1.1 mg/m, about 1.3 mg/ml, about 1.5 ‘mg/ml, about 1.7 mg/ml, about 2.0 mg/ml, about 2S mg/m about 35 mgiml, about 5.0 mg/ml, about 75 mg/ml, bout 10 mg/ml, about 15 meiml, about 20 maiml, about 25 mg/ml, about 30 mg/ml, about 35 mg/ml, about 40 mg/ml, from about 0.5 mg/ml 0 about 30 mg/ml, from about 0.78 ga 1 about 30 mg/ml, from about 1.0 mg/ml to about 30 ‘igi, From about 2.0 mn to about 30 mgm, fom about 3.0 malin © about 30 mg/ml, fom about 4.0 mg/ml to about 30 mg/m, from about 5.0 mgm! to about 30 myn, from about 7.5 mg/ml to about 30 mgiml, from about 10 mg/ml to about 30 mg/l, fom about 15 mg/ml to about 30 mg/ml, from about 0.5 mgiml to about 20 mg/m, from about 0.3 niga to about 10 mga, from about 0.5 mg/ml to about $ ‘ig/ml, from about 0.5 mm to about 2 mg/m, from about (05 maa to about 1 mgiml, from sbout | mg/aal to about 0 o 64 10 mg/m, rom about 1 mg/ml to about 5 mg/ml, from about T mg/ml to about 2 mg/l, et) Examples of reaetion buffers of the invention incl the following (1) 50 mM Tris HCI (pH 7.5), 1 mM EDTA, | mg/ml BSA, 64 mM NaCI, 8 mM spermidine: (2) 50 mM Tris-HCI (pH17.5), 1 mM EDTA, I mg/ml BSA, 64 mM NaCl, 10 mM spermidine; (3) 50 mM Tris-HCI (pH 7.5), | mM EDTA, 1 ‘migiml BSA, 64 mM NaCl, 12 mM spermidine; (4) 50 mM Tris-HCI (pit 7.5), 1 mM EDTA, 1 mgiml BSA, 75 mM NaCl, 8 mM spermidine; (5) $0 mM Tris-HCI (plt 7.5), 1 MEDIA, | migiml BSA, 64 mM NaCl, 15 aM spermi- dine; (6) 25 mM Tris-HCl (pH 7.5), ! mM EDTA, 1 mg/ml BSA, 64 mM NaCl, § mM spermidine: (7) $0 mM Tris-HCI] (pH 7.5), 1 mM EDTA, 2 mgiml BSA, 64 mM NaCl, 8 mM spermine; (8) 25 mM Tris-HCI (pH 7.5), mM EDTA, 1 ‘mgiml BSA, 64 mM NaCl, mM spermidine; (9) 25 mM Tris-HCI (pit 7.5), 1 mM EDTA, 2 maim! BSA, 64 mM NaCl, 8 mM spermidine; (10) 100 mM Tris-HCI (pH 75), T mM EDTA, 1 mg/ml BSA, 64 mM NaCl, 10 mM sper- aiding; (11) 75 mM Tris HCI (pH 7.9), 1 mM EDTA, 1 gil BSA, 65 mM NaCl, 8 mM spermidine; (12) 50 mM ‘Tris-HCl (pil 7.5), 1 mM EDTA, | mgiml BSA, 64 mM NaCl, 8 mM spermine; (13) $0 mM Tris-HCI (pH 7.5). 1 mM EDTA, | mpiml BSA, 65 mM NaCl, 8 mM spermidine: (14) $0 mM Tris-HCI (plt 7.5), mM EDTA, | mail BSA. 664 mM KCI, § mM spermidine; and (15) 75 mM Tris HC] (pH7.5), 1M EDTA, 1 mg/ml BSA, 64 mM KCl, 8 mM spemuiine. Reaetion bulles of the invention may be prepared as concentrated solutions which are diluted to a working eon- centration for final use. For example, a reaction buller ofthe invention may be prepared as a Sx concentrate with the following working concentrations of components being 50 mM Tris-HCI pH 7.5), 1mM EDTA, | mgiml BSA, 64 mM NaCI, 8 mM spermidine. Such a 5x solution would contain 200 mM Tris-HCI (pH 7.5), 5 mM EDTA, S mgiml BSA, 325 mM NaCI, and 40 mM spermidine. Thus, 25:1 dilution is required to bring such a 5x solution to a working con- ceatrtion, Reaction butlers of the invention may be pre- pared, for examples, a a 2x, a 3x, a 4x, a Sx, a 6x, 07%, 8 x, 9x, a 10x, ete, solutions, One major limitation on the {old concentration of such solutions is that, when com- pounds reach particular concentrations in solution, preci {ation oocurs. Thus, concentrated reaction bullers will gene erally be prepared soch that the concentrations ofthe various ‘components are low enough so thet precipitation of baller ‘components will not occur. As one skilled in the art would recognize, the upper limit of concentration whieh is Feasible or each sofation will vary with the particular soltion and the components present. ‘In many instances, reaction buffers ofthe invention will be provided in sterile form. Sterilization may be performed ‘on the individual components of reaction bullers prior to ‘mixing or on reaction butlers after they are prepared. Ster- lization of such solutions may be performed by any suitable ‘means including autoclaving or ulteafitration, [Nucleic acid molecules used in methods of the invention, as well as those prepared by methods of the invention, may be dissolved in an aqueous buffer and added to the reaction mixture. One suitable st of conditions is 4 ul CLONASE™ enzyme mixture (¢., Invitrogen Corporation, Cat. Nos 11791-019 and 11789.013), 4 yl Sx reaction butler and clic acid and water to a final volume of 20 This will ‘ypically result inthe iaclusion of about 200 ag of lat andUS 7,351,578 B2 65 about 80 ng of THE in 2 20 ul BP reaction and about 150 ng. In, about 25 ng IEE aad about 30 ng X is in 9 20 pl LR reaction ‘Adktional suitable sets of eonditions include the use of smaller reaction volumes, for example, 2 il CLONASE™ ‘enzyme mixture (eg. Invitrogen Corporation, Cat. Nos. 11791-019 and 11789013), 2 ql Sx reaction bute and nucleic aeid and water toa final volume of 10 gl. In other ‘embodiments, a suitable set of conditions inchudes 2 yi CLONASE™ enzyme mixture (eg. Invitrogen Corpora tion, Cat, Nos, 11791-019 axl 11789-013), 1 ul 10x reaction buller and nucleic wcid and water toa final volume of 10 Proteins for conducting an LR reaction may be stored in suitable bufer, for example, LR Storage Butfer, whieh may ‘comprise about 80 mM Tis at about pH 75, about SO mM NaC about 0.25 mM EDTA, about 25mM spermidine, and about 0.2 mgiml BSA. When stored, proteins for an LR reaction may be stored ata concentration of about 37.5 mg/l INT, 1Ongial IHF and 15 ngil XIS. Proteins for conducting ‘a BP reaetion may be stored ina suitable Buller, for example, [BP Storage Buffer, which may comprise about 25 mM Tris ‘at about pH1 75, about 22. mM NaCl, about 5 mM EDTA, about S mM spennidine, about 1 mgm SA, and about £0,0025% Triton X-100, When stored, proteins for an BP reaction may be stored at a concentration of about 37.5 nail NT and 20 ngial IHF. One skilled in the art will recognize that enzymatic atvity may vary in dierent preparations of ‘enzymes, The amounts suggested sbove may be modified (0 ant forte amount o tty in any sei preraton A suitable $x reaction buffer for conducting recombina= tion reactions may comprise 100 mM Tes plT 7.5, 88 mM {C1 20mM FDIA, 20 mM spermidine, and 4 mgiml BSA, Thi, ina recombination reaction, th final buffer concen trations may be 20 mM Tris pH 7.5, 17.6 mM NaCl, 4 mM EDTA, 4:mM spermidine, and 08 mpm BSA, Those skilled in the art will appreciate that the final reaction mixture may incorporate ational components added with the reagents use prepare the mixture, for example, a BP reaction may’ include 0.008% Triton X-100 incorporated fom the BP Clonase™ In additional embodiments, a TOX reaction bute for ‘conducting recombination reactions may be prepared and ‘comprise 200 mM ‘Tris pH 7.5, 176 mM NaCl, 40 mM. EDTA, 40 mM spermidise, and § myn! BSA. Thus, in @ recombination reaction, the final buffer concentrations may be 20 mM Tris pH 7.5, 17.6 mM NaCl, 4 mM EDTA, 4 mM spermidine, and 0:8 mg/ml BSA, Those skied inthe art will ‘appreciate thatthe final reaction mixture may ineoeporate ditional components added. with the reagents used © prepare the mixture, for example, a BP reaction may include 10.01% Triton X-100 incorporated from the BP Consse™ In particular embodiments, particulely those in Whiel aut, sites are to be recombined with aR sites, the final reaction mixture may include about $0 mM Tris HCI, pl 7.5, about I mM EDTA, about I mg/ml BSA, about 75 mM NaCl and about 7.5 mMf spermidine in addition to recom- bination enzymes and the nucleic acids to be combined. Ia ‘ther embodiments, particularly those in which an atB ste js to be rocombined with an att site, the final reaction mixture may include about 25 mM Tes HCI, pH 7.3, about 5 mM EDTA, shout 1 mg/l bovine serum albumin (BSA), about 22 mM NaCl, and about 5 mM spermidine In some embodiments, particularly those in which at sites are to be recombined with afi sites, the final reaction mixture may include about 40 mM Tis HCl, pH 7.5, about mM EDTA, about 1 my/ml BSA, about 64 mM NeCl and 66 about 8 mM spermidine in addition to recombination enzymes and the nucleic acids to be combined. One of skill inthe art will appreciate tht the reaction conditions may be varied somewhat without departing from the invention, For ‘example, the pH of the reaction may be varied from about “7.010 about £0; the concentration af buffer may he varied from about 25 mM to about 100 mM; the concentration of EDTA may be varied from about 0.5 mM to about 2 mM the ceoncenttation of NaC may be varied fom about 25 mM t0 fhout 150 mM; and the concentration of BSA may be vari ‘rom 0.5 mg/l to about 5 mgini. In other embodiments particularly those in which an at site is wo be recombined ‘with an aP site, the final reaction mixture may inelude fahout 25 mM Tris HCI, pl1 7.5, about $ mM EDTA, about | mg/m bovine serum albumin (BSA), about 22 mM NaC, about 5 mM spermidine and about 0.008% detergent (€ Triton X-100), In other embodiments, the recombination reactions may be prepared using a buffer which performs the functions of both the storie and reoetionbufTers in one. Suitably, in such embodiments, this buffer may comprise between about 100- 200 mM Tris pH 7.5, between about 88-176 mM NaCl ‘between about 20-40 mM EDTA, between about 20-40 mit spemnidine, and between about 4-8 mg! BSA. Those killed in the art will appreciate that the final reaction xture may incorporate additional components added with, the reagents used to prepare the mixture, for example, a BP reaction may’ include between about 0.005-001%% Triton X-100 incorporated from the AP Clonase"™. These com! ‘ation bulers would aso include proteins for condueting an ER of a BP reaction, When stored, proteins for an LR action may be stored ata concentration of between about 37.575 ngial INT, between about 10-20 ng) THE and between about 15-80 ngial XIS; proteins for an BP reaction ‘may be stored at a concentration of between about 37.5-75 ‘agp INT and between about 20-40 agial THE. arivative: As usod herein the term “derivative, when used in reference to a vector, means that the derivative veetor contains one or more (eg. one, 160, three, four five te.) neleie acid segments which share sequence similar to a least one vector represented in one of more of FIGS. 1,2 5,6,7,8,9, 14, 15,16, 17, 18, 19, 20,21, 22, 25,26, 27, 28, 29,30, 31,32, 38,34, 38,37, 41,42. 43,47, 53, 84. 88. 56, or 57. n particular embodiments, a derivative vector (1) may be oblained by alteration of a vector described herein (eg, a vector represented in FIG. 1, 2,3, 5, 6,7, 8,9, 14, 18, 16, 17, 18, 19, 20,21, 22, 28.26.27, 28, 29, 0,31, 32 34, 38, 37, 41,42, 43, 47, 53, 84, 85,56, or 7), oF 2) ‘may contain one or more elements (e., ampicillin res tance marker, at] recombination site, TOPO site, et.) of a vector described herein. Further, a noted above, a deriva- tive vector may contain one or more element which shares sequence similarity (e., at least 0%, at least 60%, atleast 70%, atleast 80%, atleast 9% at loast 95%, ot. sequence identity atthe nucleotide level) to one or more element of a vector deseribed herein, Derivative vectors may'also share at Teast at Teast S026, atleast 60%, at least 70%, at least 80%, at least 90%, at least 958%, ete. sequence identity at the ruecleotide Jevel to the complete nucleotide sequence of vector deseribed herein. One example of a derivative vectors is the vector represented in FIG, 26 ater the eedBVehloram- phenicol resistance cassette has been replaced by another nucleic acid segment using a recombination reaction, Thus, erivative vectors include those which have been generated by performing a cloning reaction upon a vector described herein. Derivative vectors also inchade vectors which have been generated by the insertion of elements of a weetorUS 7,351,578 B2 67 described herein into another vector, Often these derivative vectors will contain at last S0%, a least 60%, a least 70%, at least 80%, atleast 90% at Feast 95%, ete. of the nucleic ‘cid present in vector deseribed herein. Derivative vectors also include progeny of any ofthe vectors referred to above, fs well as vectors referred to above which have been subjected to mutagenesis (e.g, ransom mutagenesis). The jnvention includes vectors which are derivatives of vectors described herein, as well as uses of these Veetor in various {described methods and compositions comprising these veo ‘Other terms used inthe fies of recombinant meleie acid technology and molecular and cell biology as used herein ‘willbe generally understood by one of ondary skill i the applicable ars Overview egments or nucleic acid moleciles of other molecules and/or compounds (or combinations thereo!). The invention ‘ho relates to alaching such linked aucleie acid molecules ‘or other molecules andior compounds to one or more supports of structures preferably through recombination Sites of portions thereof, ‘Thus, the invention generally» relates to linking any number of nucleic acids or other ‘molecules and/or compounds via nucleic acid linkers com prising one or more recombination sites (eu. two. three, Tour, five, seven ea, twelve filleen, twenty, tify fly ete.) cr portions there, The Tinked products produced by the invention may ‘comprise any numberof the same or different sucleie acids fr other molecules and/or compounds, depending on the Starting materials. Such starting materials include, bul are not limited to, any auelei acid (or derivatives thereof such 1s peptide ucleie acids (PNAS) chemical compounds, ‘detectably labeled motectles (such as fluorescent molectles and chemiluminescent molecules), drugs, peptides oF pro- ns, lipids, carbohydrates and ther molechles andr com= pounds comprising one or more recombination sles oF Portions thereof. Through recombination of such recombi ation sites according to the inventioa, any number oF ‘combination of such stating molecules andor compounds ‘ean be linked to make linked products of the iavention Ia dition, deletion or replacement of certain portions oF ‘components of the linked produets of the invention ean be accomplished by recombination In some embodiments, the joined segments may be inserted into a dilferent nucli¢ acid molecule such as @ vestor, preferably by recombinational cloning methods but also by homologous recombination, Thus, in some embod ments, the present invention relates to the coastniction of rtcleic cid molecules (RNA or DNA) by combining 160 oF more seuments of nucleic acid (eg, two, tee, four, five seven, ten, owelve, fifteen, wwenty,thiny, filly, ete.) by recombination reaction and inserting the joined two or more Segments into a vector by recombinational cloning. ‘In embodiments where the joined nucleic seid molecules ‘are to be further combined with an addtional nucle acid molecule by a recombination reaction, the timing ofthe two recombination events, Le. the joining of the segments and the insertion of the segments into a vector, isnot critical “That is to say, it not extical to the present invention, for ‘example, whether the two or more nicleie acid segments are Joined together before insertion into the vector Or whether ‘one recombination site on each segment first reacts with 3 recombination site on the Vector and subsequently the 68 recombination sites on the nuclei acid segments eaet With each other to join the segments. Moreover, the nucleic acid ‘segments can be cloned in any one or a nomber of postions ‘within the veetor and do not need to be inserted adjacent to each other, although, in some embodiments, joining of two for more of sich segments within the vector is preferred In accordance with the invention, recombinational clon- ing allows elicient selection and identification of molecules (panicularly vectors) containing the combined nucleic acid segments. Thus, two or more nucleic acid segments of interest can be combined and, optionally, inserted imo Single vector suitable for furher manipulation of the com- bined nucleic acid molecule. Tn 8 fundamental embodiment, at least nwo nucleic acid segments, exch comprising at lesst one recombination site, fre contacted with suitable recombination proteins to effet the joining ofall ora portion of the two molecules, depend ing on the postion of the recombination sites in the mol- ecules. Bach individual nuclei acid segment may comprise a variely of sequences including, but not limited 10 sequences suitable foruse as primer sites (eg. sequences for ‘whieh a primer such asa sequencing primer or amplification primer may hybridize to initiate nucleic neid synthesis, ‘amplification or sequencing), transcription oF translation Signals or regulatory sequences such a6 promoters andior enhancers, ribosomal binding sites, Kozak sequences, start codons, temination signals such as stop eadons, origins of replication, recombination sites (or portions thereof, selet- fable markers, and genes or portions of genes 10 create protein sions (eg, Ncterminal or C-terminal) such as GST, GUS, GEP, YFP, CEP. maltose binding protein, 6 histidines (HIS6), epitopes, haptens and the like and combinations thereof. The vectors used for cloning such segments may also comprise these functional sequences (e.. promoters, primer sites, ec). After combination ofthe segments com- prising such sequences and optimally the cloning of the Sequees into one or more vectors (eg, bwo, thre, four, five, seven, ten, twelve, fifteen, ete), the molecules may be ‘manipalatedin'a variety of ways, including sequencing oF amplification of the target mucleie acid motecule (Le, by using at least one of the primer sites introduced by’ the integration sequence), mutation of the target mucleie acid molecule (ie, by insertion, deletion or su the target nucleic acid molecule), insertion into another molecule by homologous recombination, transcription ofthe target nucleic acid molecule, and protein expression from the target nueleie acid molecule or portions thereat (Le, by expression of translation andor transcription signals con- tained by the segments andor vector). Te present invention also relates tthe generation of combinatorial libraries using the recombinational cloning ‘methods disclosed. Thus, one oF more of the nucleic acid segments joined may comprise a nucleic acid brary. Such ‘library may comprise, fr example, nucle acid molecules ‘corresponding to pemmuations of a sequence coding for a peptide, polypeptide or protein sequence. The permtations fan be joined to another nucleic acid segment consisting of single sequence or, alternatively, the second nucleic acid segment may also bea ibrar corresponding to permutation ‘of another peptide, polypeptide or protein sequence such that joining of the two segments may produce a library representing all possible combinations ofall the permita- tions ofthe two peptide, polypeptide or proteins sequences. ‘These nucleie acid segments may be contiguous or nom- contiguous. Numerous examples of the use of combinatorial Iihrafes are known inthe a. (See, eg., Waterhouse ct al Mucleic Acids Res, 1993, Vol. 21, No. 9, 265-2266, Ts.US 7,351,578 B2 69 rushita, etal, Gene, 1996, Val. 172 No, , $9-63, Perssr Int, Rev. Immunol. 1993 0223 153-63, Chanock, et a Infect Agents Dis 1993 June 2:3 118-31, Burin, etal. Res Viol 1997 March-April 148:2 161-4, Leung. Thromb. Hae- ‘most, 1995 Tuly 74:1373-6, Sandhu, Crit. Rex: Biotechnol. 1902, 12:5.6 437-62 and US. Pat. Nos. 8,733,743, 5,871 907 and 5,858,657, all af which are specifically incorporated herein by reference) ‘When one or more nuclei acid segments used in methods ‘and compositions of the invention are mutated, these sex ments may contain either (I) a specified number of muta- tions or (2) an average specified number of mutations. uther, these mutations may be seored with reference to the nueleic acid segments themselves or the expression products (eg. polypeptides of such nucleic acid. segments. For ‘eximple,neleic acid molecules ofa ibrary may be mutated to produce nucleie acid molecules which are, on average, at least 50%, at last 55%, at Teast 6096, atleast 68% at least 70n6, atleast 75%, at least 80%, atleast 85%, atleast 90%, ‘a Teast 95%, at leat 96%, at least 97%, at Teast 98%, or a least 99% identical to corresponding nucleic acid molecules ‘of the original Iibrary. Similarly, nucleic acid molecules of 2 library may be mated to prodace nucleic acid molecules which, encode polypeptides that are, ou average, at least 50%, atleast $$%, a east 60%, at feast 65%, atleast 70%, atleast 75%, a least 8% at Teast 85%, at least 90% at Teast 95%, at least 96%, at leas 97%, a east 98%, oral least 9% ‘dentcal to polypeptides encoded by corresponding aveleie id molecules ofthe original bray. Recombination Sites ‘Recombination sites for use inthe invention may be any rncleie acid that can serve as substrate in recombination reaction, Such recombination sites may be wild-type or naturally occuring recombination sites, er modified, vari ‘at, derivative, ot mutant recombization sites, Examples of recombination sites for use in the invention include, bat are not limited to, phageslambda recombination sites (Sueh as Patt, at, and att and mutans or derivatives therco!) ‘and recombination sites ftom other bacteriophage such a5 phi80, P22, P2, 186, P& and PI (including lox sites such as loxP and loxPS11). Mutated att sites (et, att81-10, attPl- 10, attR1-10 and attl.1-10) are described in Example 9 below and in previous patent US. application Ser. No. 60/136,744, fled May 28, 1999, and US. application Ser. No, 081517466, fled Mar 2, 2000, which are specifically ‘incorporated herwn by reference. Other recombination sites having unique specificity (Le, a fist site will recombine with its corresponding site and will not recombine with 2 second site having a different specificity) ae known to those shilled inthe art and may be used to practice the present invention. Corresponding recombination proteins for these systems may be used in aeconlance withthe invention with the indicated recombination sites. Other systems providing recombination sites and recombination proteins for use a the invention include the FLPIFRT system from Saccharo- Iyces cerevisiae, the resclvase family (e., 18, TdX, TupX, Tad resolvase, Hin, Hie, Gin, SpCCEL, ParA, and Cin), and IS231 and other Bacius thuringiensis transposs able elements. Other suitable recombination systems for use in the present invention include the XexC and XeeD recom- binases and the psi, if and cer recombination sits in F. col ‘Other suitable recombination sites maybe found in U.S. Pat No. 5,851,808 issued to Elledge and Liu which is specifi cally incorporated herein by reference. Suitable ecombins- tion proteins and mutant, modified, variant, or derivative recombination sites for use in the invention inchide those 0 o 70 eseribed ia US. Pat. Nos. 5,888,732 and 6,143,557, and US. application Ser. No. 09/438.358 (led Nov. 12, 1999) based upon U.S. provisional application No, 60V108,324 (filed Nov. 13, 1998), and U.S. application Ser No. 09/51 466 (filed Mar. 2, 2000), based upon U.S. provisional application No. 60/136,744 (iled May 28, 1999), as well as those associated wit the Garrwav™ Cloning Technology and MultiSite Gabway Cloning Technology are available trom Inviteogen Corp. (Carlshad, Calif), the entte disclo- sures of all of which are specifically incomporated here by reference in theie entireties, Representative examples of recombination sites which ‘ean be used inthe protic of the invention include at sites referred to above, The inventors have determined that att sites which specifically recombine with other at ites can be constructed by altering nucleotides in and near the 7 base ‘aie overlap region. Thus, recombination sites suitable for use inthe methods, compesitions, and vectors ofthe inven- ‘ion inelude, but are not limited to, those with insertions, Geletions or substitutions of one, 1Wo, three, four, or more ‘nucleotide bases within the 1S base pair core region (GCTTTTTTATACTAA (SEQ ID NO:37), which is iden- tical inal our wildtype lambda at sites, at, afP atl and Aa (see U.S. application See. Nos, 08663,002, fled Jun, 7, 1996 (now U.S. Pat. No. 5.888.732) and 09/177,387, filed (Gxt, 23, 1998, which describes the core region ia Further detail, and te disclosures of which are incorporated herein by reference in their emiretes), Recombination sites suitable for use in the methods, compositions, and vectors of the invention also include those With insertions, deletions oF substitutions of one, two, three, four, or more nucleotide bases within the 15 base pair core region (GCTTTT TATACTAA (SEQ ID NO:37)) which are at least 50% identical, atleast $5% identical, atleast 60% identical, at least 65% identical, at least 70% identical, at least 75% ‘deatical, at leat 802% identical, atleast 85% identical, at least 90% identical, ora least 95% identical to this 15 ase pair core region ‘Analogously, the core regions in a1, attP1, att and atk are identical to one anther, 88 are the coee rogions in fMR2, a2, at.2 and attR2. Nucleic acid molecules st able for use with the invention also include those which comprising insertions, deletions or substitutions of one, two. three, four, or more aueleaides within the seven base pair ‘overlap region (TTTATAC, which i defined by the eut sites for the integrase protein and is the region where stand exchange takes ploce) that occurs within this 15 hase pair core region (GCTTTITIAACTAA (SEQ 1D NO37), Examples of such mutants, fragments, variants and deriva- tives ince, but are no limited fo, nucleic acid molecules jn whieh (1) the thymine at position 1 of the seven bp ‘overlap region has been deleted or substituted with @ gut nine, cytosine, or adenine: (2) the thymine at position 2 of the seven bp overlap region has been deleted or substituted with a guanine, eytosine, or adenine; (3) the thymine at position 3 of the seven bp overlap region has been deleted or substituted with a guanine, eytosine, or adenine; (4) the adenine postion 4 af the seven bp overlap region has been eleted or substituted with a guanine, cytosine, or thymine; (6) the thymine at position $ ofthe seven bp overlap region thas been deleted of substituted with a guanine, cytosine, oF adenine; (6 the adenine at postion 6 of he seven bp overlap region has been deleted ot substituted with a guanine, cytosine, o thymine; and (7) the eytosine at position 7 ofthe seven bp overlap region has been deleted or substituted with 1 guanine, thymine, or wlenine: or any combination of one ‘ormore sich deletions and/or substitutions within this sevenUS 7,351,578 B2 n bp overlap region, The nveleotide sequences of the ex play seven base par core region ae se out below in Table 2 The present invention also embodies the use of the ination sites afB3 and a4 shown below in a ite Gateway recombination cloning system: sees 5! cnacrrorneaaenaagrTa 3° (S89 2D 40-141) ‘me ANB sites, lke atB1 and at? sites create soquence recombination groups that do not combine with non-like sequences, This sequence specific recombination property of the at sites confers directionality of cloning in Standard Gateway cloning and dirwets the accurate assembly ‘of multiple fragments when cloning with MultiSite Gate way. ‘MltiSite Gateway is an extension of the Gateway site specific recombinational cloning system. The introduction ‘of at site specificities atts3 and a4 (in addition to aT ‘and atiB2 sets presently used in Gateway) allows the simul taneous cloning of multiple DNA fragments in 2 defined ‘onder and orientation. MuliSite Gateway applications are ‘extensive and varod including but not limited; the expres- son of multiple gene products from. single vector, addition ‘of promotertag elements to the ends of standard Gateway Entry Clones (att L1/L2), eonsiruction of gene-arpeting vectors, engineering and shulling of protein coding ‘domains, construction of synthetic operons, biological and biochemical pathway engincering and genome engineering. ‘As inthe present version of Gateway, to eater MuliSite Gateway, set of Entry Clones are obiained or generated, Entry Clones are then simply mixed together with the appropriate MultiSite Gateway Destination Vector in a ‘ingle LR reaction that results in the simultaneous eloning of ruliple fragments into the Destination Vector backbone. The site-specific recombination reactions are precise, ell ‘cient and directional resulting in al ofthe colonies recov~ ‘ered containing the desired Expression Clone constructs, “MultiSite Gateway Fntry Clones ean be sequenced validated ‘and seve as sauce clones in the assembly of complex DNA, ‘constrictions. This eliminates the nced t sequence validate the final assembled products. Further, each element of ‘construct assembly using MuliSite Gateway can be replaced, of similar recombinant ends, affording ty in vector eonsucton, ‘As described below in Examples 9-12, altered att sites have boon constricted which demonstrate that (1) subst tions mode within the first three postions of the seven base pair overlap (LELATAC) strongly allect the specificity of recombination, (2) substitutions made in the last four tions (TTTALAC) only partially alter recombination speci fcity, and (3) nucleotide substitutions outside ofthe seven bp overiap, but elsewhere within the 15 base pair core region, donot affect specificity of recombination but do influence the efciency of recombination. Thus, nuclei acid molecules al methods ofthe invention include those which ‘comprising or employ ane, to, thre, fou, five, six, eight, tea, or more recombination sites whieh affect recombination specificity, particularly one or more (eg, one, two, three, four, five, six, eight, ten, twenty, thing, fay, fy, ete) different recombination sites that may correspond substan- tially tothe seven base pair overlap within the 1S base pai ‘core region, having one or more mations that affect ination specificity, Particularly prefered such mol o nD ecules may comprise a consensus sequence such as NNNA- ‘TAC, wherein “N” refers to any nucleotide (ie, may be A, G, TU or), Preferably, fone ofthe frst three nucleotides in the consensus sequence is a TU, then a least one of the other two of the first thee nucleotides is not TU, ‘The core sequence of each att site (tt, att? a. and aR) can be divided into fugetional units consisting. of integrase binding sites, integrase cleavage sites and sequences that determine specificity. As discussed below ia Example 12, spevfiity determinants are defined by the frst three positions following the integrase top strand cleavage site. These three postions are shown with underlining i the following reference sequence: CAACTTTITEATAC AAAGTTG (SEQ ID NO:38). Modification of these three positions (64 possible combinations) which ean be usod 10 _gencmte at sites which recombine with high specificity with other alt sites having the same sequence forthe fist three ueleotides ofthe seven base pair overlap region are show in Table 1. TABLE 1 ion Specittesty, Representative examples of seven base par att site over. Jap regions suitable for in methods, eompositons and vee- tors of the invention are shown in Table 2. The invention Turther includes nveleic acid molecules comprising one oF more (eg. one, Wo, thee, fou, ive, six, eight, en, sweaty, thiny, fy ill, et.) mclentides soquences set out in Table 2. Thus, for example, in one aspect, the invention provides ueleie acid molecules comprising the nucleotide sequence GAAATAC, GATATAC, ACAATAC, of TGCATAC, Haw ver, in certain embodiments, the invention will nt include elec acd molecules which comprise alt site core regions set out herein in FIGS, 244-24C or in Example 9US 7,351,578 B2 3 TABLE 2 Reprecensative Banpioe of Seren tase Dain 2 As noted above, alterations of nucleotides located 310 the treo base pair region discussed above can also aloct recombination specificity. Far example, alterations within the lst Four positions ofthe seven basepair overlap can also allt recombination specifiy ‘The invention thus provides recombination sites which recombine with a cognate partner, as well as molecules ‘which contain these recombination sites and methods for enerating, ideutifying, and using these sites, Methods Which can be used to identify such sites are set out below in Example 12. Examples of such recombinations sites inelude att sites which contsin 7 hase pairs overlap regions which associate and recombine with cognate partners. The nucle- lide sequences of specific examples OF such 7 base pai ‘overlap regions are set out above in Table 2 Funher embodiments of the invention include isolated nucleic acid molectles comprising a nvcleotide sequence at least 50% identical, at least 60% identical, at least 70% ‘Mentcal, atleast 75% identical, atleast 80% identical, at least 85% identical, atleast 90% identical, or at Feast 95% ‘dentcal to the nucleotide sequences of the seven bp overlap regions set out above in Table 2 or the 15 base pair core region shown in SEQ ID NO:37, as well as @ nbieleotide sequence complementary to any of these nucleotide fexjuences of Fragments, variants, mutants, and derivatives thereot Additional embodiments of the invention include ‘compositions and vectors which contain these nucle acid molecules, as well as methods for using these nucleic acd molecules By apolymueleotide having a nucleotide sequence atleast, for example, 95% “identical” to a reference nucleotide sequence encoding a particular recombination ste or portion thereat is intended that the nucleotide sequence of the polynucleotide is dential to the reerence sequence except 0 o 4 that the polynucleotide sequence may include up to five point mutations (eg. insertions, substitutions, or deletions) per each 100 nucleotides of the reference nucleotide Sequence encoding the recombination ste. For example, to ‘oblain « polynucleotide having a nucleotide sequence at least 95% identical to a reference at nueleatide sequence (SEQ ID NOS}, up to $% of the nucleotides in the att] reference sequence may be deleted or substituted with Another nucletide, oF & number of nucletides up to 3% of the total nucleotides in the at reference sequerice may be inserted into the atB1 reference sequence. These mutations ofthe reference sequence may occur at the Sor 3 erminal positions ofthe reference nucleotide sequence or anywhere between those terminal positions, interspersed either indi- vidually among nucleotides in the referenee sequence or in fone “oF more contiguous groups within the reference sequence, ‘As a practical matter, whether any particular nueleie acid molecule i atleast 50%, 60%, 70%, 75%, 806, 85%, 90%, 95%, 96%, 979%, 98% or 99% identical to, for instance, & given recombination site nucleotide sequence of portion thereol ean be determined conventionally using known ‘computer programs suel as DNAsis software (Hitachi Soft ware, San Bruno, Cali.) for initial sequence alignment followed by FSEE version 3.0 DNA/protein sequence so ware (cabot “at™ trogmbb-sfu.ca) for multiple sequence alignments. Altematively, such determinations ‘may be ‘accomplished using the BESTPIT progmm (Wisconsin Sequence Analysis Package, Geneties Computer Group, University Research Park, $75 Science Drive, Madison, Wis. 53711), which employs a local homology algorithm (Smith and Waterman, Advances in Applied Mathematies 2: 4482-489 (1981)) to find the best seumeat of homology ‘berween ro soquences. When using DNAsis, BSE, BEST- FIT or any other sequence alignment program to determine ‘whether a particular sequence is, for instance, 95% identical toa reference sequence according fo the present invention, the parameters ar set such thatthe percentage of ideality is calculated over the fll length of the reference nucleotide ‘quence and that gaps in homology of upto 5% ofthe total ‘number of nucleotides in the relerence sequence are allowed. ‘As noted above, the invention further provides, in one aspect, methods for constructing and/or identifying recom- bination sites suitable forse With nneleie acid molecules of the invention, as well as recombination sites constricted andar identified by these methods. In Biel the invention provides methods for constructing andor identifying recom bination sites which are capable of recombining with other recombination sites. For example, the invention provides smthous [or eonsiructing recombination sites and ideatily- ‘ng whether these recombination sites recombine with other recombination sites, Recombination sites which are screened for recombination activity and specificity can be constructed by any numberof means, including site-directed ‘mutagenesis and random nucle acid synthesis. The invention further provides “single use” recombina- ‘ion sites which undergo recombination one time and thea either undergo recombination with low frequency (eg. have at least five fold, at Teast ten Fld, at Teast fly fold, at least fone hundred fold, of at least one thousand fold lower recombination aetvity in subsequent recombination reae- sions) or are essentially incapable of undergo recombination. ‘The invention also provides methods for making and using clic scid molecules which contain such single we recom bination sites and molecules which contain these sites.US 7,351,578 B2 5 Examples of methods whieh can be used 10 generate and identify such single use recombination sites are set out below. ‘The at system core integrase binding site comprises an intceropted seven base pair inverted repeat faving the fale ing nucleotide sequence: eagcettnnmnnnnasagttg, (589 19 NO:39), 28 well as variations thereof which ean comprise either perfect or imperfect repeats “The repeat elements cun be subdivided into wo distal andor proximal “domains” composed of caseettg segments (underlined), whieh are distal 10 the central undefined Sequence (the nucleotides of which are represented by the Jetier“a"), and tt/aaa segments, which are proximal to the ‘central undefined sequence Alterations in the sequence composition of the distal ‘and/or proximal domine on one or both sides ofthe central undefined region ean alee the outcome ofa recombination reaction. The scope and seale ofthe effet is a function ofthe specific alterations made, as well as the particular recombi national event (¢., [R vs. BP reactions). For example it is believed that nat ste altered to have the following nucleotide sequence: eazctttmnmmnnnasacaag, (589 19 HO:40}, will functionally interact with a cognate ttP and generate at. and atlR. However, whichever of the latter two recom- bination sites acquires the segment containing “cas” (Io- ‘cated on the left side of the sequence shown above) will be fendered non-finetional to subsequent recombinatr ‘events. The above is only one of many possible alterations in the cor integrase binding sequence whieh can render at sites non-funetional afer engaging ina single recombination ‘event. Thus, single use recombination sites may’be prepared, by altering nucleotides in the seven base pair inverted repeat regions which abut seven base pair overlap regions of all files, This egion is represented schematically as CAC TTT [Seven Base Pair Overlap Region] AAA mG In generating single use recombination sites, one, wo, three, four of more of nucleotides “of the” sequences CAACTTT or AAAGTIG (i.e. the seven base pair inverted repeat regions) may’ be substituted with other aveleotides oF deleted altogether. These seven base pair inverted repeat regions represent complementary sequences with respect 0 ‘each other. Thus, alterations may be made in either seven base pair inverted repeat region sn order to generste single tise recombination sites. Purther, when DNA is double ‘nnded and one seven base pair inverted repeat region is present, the ther seven basepair inverted repeat region Will also be present on the other stand. Using the sequence CAACTT for illustration, examples ‘of seven base pai inverted repeat regions which can form, ‘ingle use recombination sits include, but ake not Timited 0, nucleic acid molecules in which (1) the eytosine at position TTof the seven base pair invered repeat region has been deleted or substituted with 2 guanine, adenine, or thymine: {@) the adenine at postion 2 of the seven base pair inverted repeat region has boen deleted or substituted witha guanine, ‘ytosine, or thymine; (3) the adenine at postion 3 of the 0 o 16 seven base pair inverted repeat region has been deleted or Substituted with a guanine, eytosine, or thymine; (4) the eytosine at postion 4 of the seven base pair inverted repeat rgion has been deloted or substituted with a guanine, adenine, or thymine: (5) the thymine at position 5 of the seven base pair inverted repeat region has boen deleted oF substituted with a guanine, eytosine, or adenine; (6) the {hymine at position 6 ofthe seven hase pair inverted repeat region has been deleted or substituted with guanine, cytosine, or adenine; and (7) the thymine at position 7 ofthe seven base pair inverted repeat region has been deleted or substituted With @ guanine, eyfosine, or adenine: or any combination of one, two, three, four, or more such deletions andlor substitutions within this seven base pair region Representative examples of nucleotide sequences of the have deseribed seven base pair inverted repeat regions are set out below in Table 3 TABLE 3 stoves gutgcte—agtgata gutta gesnan—agenage —agaagen —agaaett sesggsn — seueses © geggata —gogstat etccaan —cteogeg —ctecata et ectat stagsee — taaces stggeat tgeeteg _egetete egeecet Representative examples of nucleotide sequences which orm single use recombination sites may also be prepared by combining a nucleotide sequence st ost in Table 4 Section 1, with a nucleotide sequence set out in Table 4, Section 2 Single use recombination sites may also be prepared by the insertion of one or more (eg. one, 1, thee, four, five sx, seven, ct.) nucleotides interally within these regions TABLE 4US 7,351,578 B2 7 TABLE 4-continued fae ccog gage tees at ete eet aga cege gots tect aga gga can cace gags tact ean gut gaa ogee geas tort gaa gag satan ctce stag tot tan seg ena ace aggg abet eee ate tase tece tagg gtet ect tea In most instanees where one socks to prevent recombi nation events with respect to © particular nucleie acid” segment, the altered sequence will be located proximally 10 the nucleic aid segment. Using the following schematic for Mustation =5' Nucleic Acid Segment 3eaae at [Seven Base Pair 30 ‘Overlap Region] AAA GTTG, the lower ease nueleotide sequence which represent a seven base pur inverted repeat region (Le. caae tt) will generally have a sequence altered by insertion, deletion, andor substitution to form a single use recombination ste when one secks fo prevent recombi- nation atthe 3 end (i.e, proximal end with respect to the nucleic acid Seament) of the nucleie acid seyment shown. Thos, «single recombination reaction can be used, for ‘exumple, to integrate the nucleic aid seymens ito another nucleic acid molecule, then the recombination site becomes effectively non-funetional, preventing the site from engag- jing in further recombination reactions, Similarly, single use recombination sites can be position at both ends of a nucleic id segment so that the nucleic ackd segment can be Integrated into another nucleic acid molecule, or circular ied, and will remain inteyrated, or citeularized even in the presence of recombinase, ‘A number of methods may be used 10 sereen potential single use recombination sites for funtional activity (© undergo one recombination event followed hy the failure to tundergs subsequent recombination events). For example, with respect 10 the sereening of recombination sites © ‘identify those which become non-funetional after a single recombination event, fist recombination reaction my be performed to generate a plasmid in which a nogative selee- tion marker is Knked to one of more potentially defective recombination sites. The plasmid may then be reacted with ‘anothor mucleie acid molecule which comprises a positive selection marker similarly linked to recombination sites. Tihs, this selection system is designed sul that molecules which recombine are susceptible to negative selection and molecules which do not recombine may be selected fro by positive selection. Using such a system, one may then direily select for desired single use core ste mutans As one skilled inthe art would recognize, any number of 5s screening assays may be designed which achieve the same results as those described above. In maa’ instances, these 0 o 8 assays will be designed so that an initial recombination event takes place and then recombination sites which are ‘unable to engage in subsequent recombination events are ‘identified or molecvles which contain such recombination sites are selected for. related sereoning assay would reslt in selection aginst nucleic acid molecule which have under stone a second recombination event. Further, 38 noted above, Screening assays can he designed where there is selection ‘against molecules which have engaged in subsequent recom bination events and selection for those which have not ‘engaged in subsequent recombination events Single use recombination sites are especially wseful for either decreasing the frequency of or preventing ror tation when citer lage number of micleic acid segments are attached to eaeh other or multiple recombination reae- tions are performed. Thus, the invention further inchudes tucleic aeid molecules which contain single use revom! ration sites, as well as methods for performing recombina- ‘ion using these sites, Construction and Uses Nucleic Acid Molecules of the Iaven- ‘As diseussed below in more detail, in one aspect, the invention provides a modular system for consteuctn clei aed molecules having particular functions or act ties. The invention further provides methods for combining populations of nucleic aeid molecules with one oF more known or unknown target soquences of intorest (e.g. 10, three, four, five seven, tea, twelve, fifteen, twenty, thiny fifty, ete.) or with other populations of mucleic acid mol- ecules (known or unknown), thereby ereating populations of ibiatorial molecules (e., combinatorial libraries) from ‘unique andior novel molecules (e.., hybrid mol- ecules) and proteins or peptides encoded by these molecules ‘may be obisined aud fther analyzed, The present invention also includes methods for preparing vectors containing more than one nucleic acid insert (e2., two, three, four five, six eight, ten, twelve, fifteen, twenty. thity, ory, fit, eins). In one general embodiment of the invention, vectors of the invention are prepared as allows, Nucleic acid molecules which are to ultimately be inserted into the Destination Vector are obtained (eg. purchased, prepared by PCR or by the preparation of CDNA. ‘sing reverse transcriptase). Suitable recombination sites are either incorporated into the Sand 3 ends ofthe nuclei acid ‘molecules during synthesis or added later. When one sovks {o prepare a vector containing multiple nucleic acid inserts, those inserts can be inserted into a vector in either one reaction mixture of a seties of reaction mixtures, For ‘example, as shown in FIG. 16, multiple nucleic acid seg- ‘meats can be Tinked end to end and inserted into a vector ‘using reactions performed, for example, in single reaction ture. The melee acid seamen inthis reaetion mixture fan he designed so that recombination sites om their and 3° ends result in their insertion into-a Destination Vector ia ' spovifie order and specific 5 ¥ orientation, Alterna- tively, clic aeid segments can be designed so that hey are inserted into @ Destination Veetor without regard to order, orientation (ie. 510 3 orientation), the numberof inser, nda the numer of duplicate inserts. Furtber, in some instances, one or more of the nucleic acid sogments will have a recombination site on nly one end. Also if desired, this end, or these ends, may’ be linked t0 other nucleic acid segments by the use of, for example, Tigases or topoisomerases, As an example, a Hinear nel cid molecule with an aI site on its 5° terminus can be recombined with a Destination Vector containing « cedBUS 7,351,578 B2 79 ene flanked by an altLt site and an altL? site, Before, ‘during, or after an LR reaction, the Destination Vector ean, be cut for example, by a restriction enzyme on the side of the attR2 site which is opposite to the ceaB gene. Thus, the Destination Vector willbe linear after being cut andl under ‘2oing recombination, Pathe, the atfRI site of the nucleic acid molecule will undergo recombination withthe attL1 site of the Destination Vector to produce # linear vector ‘which contains the nucleic acid molecule. The resulting linear product can then be circularized using an enzyme scl aa Tigase oF topoisomerases, Using the embodiment shown ia FIG. 16 wo exemplify ‘anothor aspect of the invention, a frst DNA segment having, fan at site at the 5° end and am atL3 site atthe end is attached by recombination to a second DNA segment having ‘aR site atthe $end and an att site at the 3° end. A third DNA segment having an aR site atthe 5" end and an ILS site atthe 3" end is attached by recombination with the att siteon the end ofthe second DNA segment. A fourth DNA segment having an altRS site a the Send and an att 2 site at the 3 end i attached by recombination with the att S site on the ¥ end ofthe thied DNA segment, The Destination ‘Vector contains an att site and an attR2 site which flanks ‘a ecdb gene. Thus, upon reaction with LR CLoNast™, the first, second, third, and fou into the insertion Vector but are faked or separated by Bat, a4, at, and atB2 sites. similar process involving assembly of the lux operon is shown in FIGS. 7A-17R and described below in Example I8, ‘As one skilled in the art would recognize, multiple variations of the process shown in FIG. 16 ae possible, For ‘example, various combinations of att, at. att, and at sites, 2s well as other recombination sites, can’ be used. Similarly, various selection markers, origins of replication, promoters and other genetic elements can be used. Further, regions which allow for integration into eukaryotic chromo- somes (eg. transposable elements) can be aided to these vectors. ‘One example of a muli-eaction process for inserting imitiple DNA segments into a vector i shown in FIG. 1% Inthis exemplary embodiment, three DNA segments recom bine with each other in two separate reaction mixtures. The products generated in these mixtures ae then mixed together lunder conditions which facilitate both recombination between the products of the (wo reuction mixtures and insertion of the linked product into a vector (eg., a Dest nation Vector). This embodiment hs the advantages thatthe (1) DNA segments can be inserted directly into @ Destination ‘Vector without prior insertion into another vector, and (2) the same att sites, as well as other recombination sites, can be twsed to prepare each of the linked DNA segments for insertion into the vector. “As one slilled in the art would recognize, multiple variations ofthe processes described herein are possible. For ‘example, single use reoombination sites can be used 10 ‘connect individual nucleic aid segments. Thus, eliminating for reducing potential problems associated with arrays of nucle acid segments engaging in undesired recombination reactions. Further, the processes described above ean be used to connect large numbers of individual nucleic acid molecules together ina varying ways. For example, nucleic segments ean be connected randomly, or in a specified ‘onde, both with or without regard to 510 ¥ orientation of the segments Further, identical copies of one or more nucleic avid segments can be incorporated into another nucleic acid molecule. Thus, the invention also provides nucleic acid h DNA segments are inserted > 80 polecules which contain multiple copies ofa single nucleic avid segment. Further, the selection of recombination sites positioned at the $'and 3 ends ofthese segments can he used fo determine the exact number of identical nucleic acid Segments which are connected and thea inserted, for ‘ample, into a vector. Such vectors may thea be inserted into a host cell where they can, for example, replicate aulonomovsly or integrate into one of more nucleic acid ‘molecules which normally reside in the host eell (ez, Wwgrate by sitespecific recombination or homologous recombination). [Nucleic acd molecules which contsin multiple copies of ‘nuclei acid segment may be used, for example, to amplify the copy number ofa particular gene, Thus, the invention also provides methods for gene amplification, nucleic acid ‘molecules which contain multiple copies of « nucleic acid segment, and host cells which contain nucleic acid mol- cules of the invention, As another example, two different nucleic acid segments ean be connected using processes of the invention. Recom- bination sites can be positioned on these segments, for ‘example, such thatthe segments alternate upon attachment (eg. Segment At Segment Ba Segment A+Segment 2 ct). A nveleie acid molecule having such a stricture will be expecially useful for when one seeks to use inereased copy ‘number ofa nucleic acid to inerease the amount of expees- sion product produced. In such an instance, “Segment A fan be, for exan inducible promoter and “Segment B” can be, for example, 2 nucleic aid molecule comprising an ORF. Thus, cells can be prepared which contain the above construct and do_not ‘express substantial quantities ofthe product of Segment B ia the absence of the inducing signal but produce high levels of ‘his product upon induction, Such a system will be espe- cially usefal when the Segment B expression product is toxic fo cells. Thus, the methods set out above can be used {or the construction and maintenance of cells which contain Segment B in the absence of deleterious effets resulting tom the Segment B expression product. Purther, induction of expression ofthe ORF residing in Segment B can then be ‘used, For example, to transiently produce high levels of the Segment B expression product. ‘Another example of muhistep process for inserting multiple DNA segments into a vector is shown in FIG. 19. In this embodiment, three DNA segments are linked to each ther in separate recombination reactions and then inserted into separate vectors using LR and BP Cvoxase™ reactions. After construction ofthese twa vectors, the inserted DNA ‘segments are translerred to ancrher vector using. an LR reaction, This esuls i all six DNA segments being inserted ‘nto a single Destination Vector. As one skied in the art ‘would recognize, numerous variations ofthe process shown in FIG. 19 are possible and are included within the seape of the invention, ‘The number of genes which may be connected using ‘methods of the invention ina single step wil in general be limited by the nuanber of recombination sites with different specificities which ean be used. Furher, as described above and represented seliematically in FIGS, 18 and 19, recom- bination sites can be chosen so as to link micleic acid segments in one reation and not engage recombination in later reactions. For example, again using the process set aut in FIG. 18 for reference, a series of concatamiers of ordered ‘clic acid segments can be prepared using atl. and att sites and LR Clonase™, These coneatamers can then beUS 7,351,578 B2 81 ‘connected to evel other and, optionally other nuclei acid molecules using another LR reaetion. Numerous variations of this process are possible Similarly, single use recombination sites may’ be used t0 prevent nucleic acid segments, once incorporated into ‘another nucleic seid molecule, from engaging in subsequent recombination reactions. The use of single Use recombi tion sites allows fr the production of nucleic acid molecules prepared from an essentially limitless number of individual rcleie aeid segments. In one aspect, the invention further provides method for ‘combining nucleic acid molecules in a single population With each other oF with other molecules oF poptlations of molecules, thereby creating populations of combinatorial molecules from which unique andor novel molecules (eg. hybrid molecules) and proteins or poptides encoded by these molecules may also be obtained and further analyzed. The Jnvention further provides methods for sereening populs- tions of neleie aeid molecules to identify those which have particular activities or which encode expression products (eg RNAS or polypeptides) which have particular activities. Thus, methods of the invention can be used to combine nucleic acid segments which encode functional domains (eg, SH, domains, antibody binding sites, transmembrane domains, signal peptides, enzymatic active sites) in various ‘combinations with each other and to identify prodvets of these methods which have particular activities For example, nucleic acid segments which contain tran scriptional regulatory sequences can be identified by the following methods. The nclei acd molecules of 2 genomic DNA library are modified to contain recombination sites their Sand ¥ termini, These nucleic acid molecules are thea inserted into « Destination Vector sch that they are located 5'to.a selectable marker. Thus, expression ofthe selectable ‘marker will occur in vectors where the marker isin operable Finkage with a nucleic acid molecule which activates its transcription. The iavention thus futher provides isolated rucleie acid molecules which are capable of activating transcription. In many instances, these nucleic acid mol- ‘ecules which activate transcription will he identified using methods andor compositions of the invention. Further, because some amscrptional regulatory sequences activate gene expression in a tissue-specific man- ner, methods of the iavention can be used 10 identify tissue-specific transcriptional regulatory sequences, Tor ‘example, when one seeks to identify transcriptional regula tory sequences which activate tmnscription in a specifi cll ‘or issue type, the above seeening process can be performed, in cells ofthat cell or tissue type. Similarly, when one seeks to identify regulatory sequences which activate transription in cells at a particular time, at a particular stage of devel- ‘opment, or incubated under particular conditions (eat 3 particular emperatur), the above sereening process can be Performed in cells at an appropriste time, at the particular stage of development or incubated under the particular ‘conditions. Once a sequence which activates transcription has been identified using such methods, the transcriptional regulatory sequences can then be tested to determine if i is ‘capable of activating transcription in other cells types oF tunder conditions other than those which resulted in its ‘dentifieation andor selection. Thus, in ane general aspect, the invention provides methods for constructing andlor ‘entifying transcriptional repulatory sequences, as well as cle aeid molecules which contain transcriptional rg- Jatory sequences identified by methods ofthe inventio 0 o 82 ‘operable linkage with aveeic acid segments which encode expression prolvets and methods for preparing such mol- ecules. ‘Methods similar to those described above can also be used 10 identify origins of replication, Thus, the invention further includes methods for identifying nucleic acid: molecules ‘whieh contain origins of replication, as well as nuclei acid molecules which contain origins of replication identified by ‘methods of the invention and methods for preparing such solecules, [As discussed below in Example 1, the invention is thus particularly suited for the construction of combinatorial Tibrares. For example, methods ofthe invention ean also be used to "shuillo™ nvcleie acid molecules which encode domains ad rvgions of proteins to generate new nucleic acid molecules which ean be used to express proteins having specific properties or activities. In such embodiments, ‘clic atid sogments which encode portions of proteins are joined and then sereened for one oF more properties oF activities. The nucleic acid segments in these combinatorial libraries may be prepared by any number of methods, including reverse transcription of mRNA. Altered forme ofthe neleie ‘acid segments in these libraries may be generated using ‘methods such as error prone PCR. In many applications, it will be desirable for the mucleie aeid segments in these libraries to encode subportions of protein. When this is the case, the methods ean be adjusted to generate populations of ‘clic aid segments the majority of which da not contain {ull length ORFs, This eat be done, for example, by shearing the cDNA library and then separating the sheared molecules (eat, using polyacrylamide or agarose gel electrophoresis). Frugimens between, for example, 300 and 600 nucleotides in Tength (Jragments whieh potentially encode 100 co 200 amino acid residues) may then be recombined and inserted into a veetor in operable linkage with a tanscriptional regllatory sequence. Polypeptide expression predicts of the individyal members of such a combinatorial library may then he sereened to identify those with particular properties or activites The invention further provides methods for producing combinatorial libraries generted using exon nucleic acid derived from genomie DNA. Introa/exan splice boundaries fare kaown in the art thus the locations of exons in genomic DNA can be identified using routine, arknown methods ‘without undue experimentation. Fuser, primers eore- sponding 0 intcon’exon splice boundaries can be used 10 enemite miclic acid molecules Which correspond to exon Sequences. Further, these nveleie acid molecules may thea be connected to each other to generate combinatorial ibrar jes comprising nucleic acid molecules which correspond t0 exon sequences, For example, primers corresponding to intronlexon splice boundaries can be. used to generate ueleic acid molecules which correspond to exon sequences ‘using PCR, Recombination sites may then be added to the termini of the resulting PCR products using Tigases or amplifying the sequences using primers containing recom bination sites. The PCR products may then be connected 10 each other using recombination reactions andl inserted into fan expression Vector. The resulting combinatorial library ‘ay then be sereened to identify nucleic acid molecules ‘whieh, for example, eneode polypeptides having particular funetions or activitis. Further, recombination sites in expression products (¢., RNA or protein) of nucleic acid ‘molecules of the combinatorial library ean be removed by splicing as described elsewhere hereinUS 7,351,578 B2 83 FPunher, nucleic acid molecules wsed to produce combi natorial libraries, as well as the combinatorial libraries themselves, may be mutated to produce nucleic acid mol- ‘ecules which are, on average, atleast 50%, at last 55%, at Teast 60%, at least 65%, at Teast 70%, atleast 75%, at least 80M, atleast 85%, at least 9%, atleast 95%, at least 96%, a Jeast 97%, at least 98%, or atleast 99% identical to the ‘corresponding original nucleic acid molecules. Similarly. nucle acid molecules used to produce combinatorial ibrar jes may be mutated to produce nucleic acid molecules which, encode polypeptides tbat are, on average, are at least 50M, at least $$%, a least 60%, atleast 65%, at least 70%, at least 75%, a least 8%, at Teast 85%, at least 90% at Teast 95%, at least 96% atleast 97%, at least 98%, or atleast 9% ‘identical to polypeptides encoded hy the corresponding ‘original micleic acid molecules. Tn one aspect the invention provides methods for gener ing and identilying dominant/negative suppressors of bio logical processes or biological pathways. For example, ‘combinatorial libraries described above can be sereened for ‘dominantinegative activity. In general dominantinegative ‘activity results inthe suppression ofa Biological process oF biological pathway. In most instances, dominant negative suppressors exhibit their alesis through iersction with cellular components. For example, many dominant/negative suppressors contain domains having binding activities asso- ciated with one or more cellular proteins but do not have ‘lher activities associated with the cellular proteins. While hot intending to be bound by theory, upon expression in @ cell, domtinantinegative suppressors generally interact with ‘one or more cellular ligands and block activation by cella proteins. Thus, one mechanism by which dominant negative fuppressors are believed to interfere with normal cell processes is by ligand sequestration ‘Dominant/ncgative activity can be conferred by mutations in awildaype protein such as analteration ofa single amino i residue ora deletion of an entire region ofthe protein. ‘Ounry et al Biol. Chem. 275:22611-22614 (2000), for ‘example, describe» dominantinegative receptor where ‘dominaninegative activity results from the deletion of a single amino acid residue Protein fragments can also have dominant/negative activ ity. For example, MeNellis etal, Plant Cell :1491-1503 (1996), describe an N-iennizal fragment of constitutive photomorphogeaie 1 protein (COP1) which has dominaay negative activity when expressed in Arabidopsis seedlings. ‘Any number of assays can be used to sereen for dominant negative activities. Macmura et al, J. Biol. Chem, 274: 31565-31570 (1999), for example, describe a deletion Iotant of @ tanseription factor fefered to as endothelial PAS domain protein 1 (EPASI) which bs dominantinegs- tive stivity. In particular, Msemura etal demonstrated thst ‘expression of the EPAS] mutant in cells inhibits induction ‘of VEGF mRNA production, an activity associated with wiklaype EPAS 1 “The invention also. provides methods for identifying rncleic acid molecules Which encode polypeptides having particular funetions oF activities, as well as. nucleic acid molecules produced by these methods, expression produets ‘ofthese nucleic acid molecules, and host eels which contain, these nucleic aeid molecules. Such functions oF activities inchide seeretion from eels, enzymatic activities, ligand binding activities (e binding ainity for metal ions, cll surface receptors, micieie acids, soluble proteins), and the ability (© tart the expression product to a sub-cellulae localization (¢., localization to mitochondria, chloroplasts ‘endoplasmnie reticulum, ete), Assays for identifying these 0 o 84 clei acid molecules will generally be designed to identify the finction of activity associated with the polypeptide. ‘The invention also provides methods for ilentilying nucle acid molecules which encode polypeptides having regions which interact” with other “polypeptides, One ‘example of sich a method involves the wse of two hybrid assays. (See, og, Fields et al, US. Pat. No. 5,667,973, the fnlire disclosure of which is incorporated herein by refer fence.) More specifically, nucleic acid molecules can be prepared using methods of the invention which encode @ Tusion protein between a polypeptide (¢g.. a Gal4N-termi- ‘al domain) that exhibits a particular funtion when in close proximity with another polypeptide (e.g... Gal4C-terminal ‘jperylene, benzo(k)uoraatiene, pyrene, methylene chilo- ride, 1,[-ichloroethane, chloroform, 1,2-dichloropropane, “dibromochloromethane, 1, 1,2-trehloroetiane, 2 ditis elegans cells, and mammals (particularly human calls). Of course, other techniques of nucleic acid synthesis Which may be advantageously used will be readily apparent to one of ordinary skill in the art, In other aspects of the invention, the invention may be used in combination with methods for amplifying oF sequencing miclec acid molecules. Nucleic acid amplifies tion methods according to this aspect ofthe invention may inchide the use of one or more polypeptides having reverse transcriptase activity, in methods generally known inthe et as one-step (eg, one-step RT-PCR) or two-step (6.8. 180+ step REPCR) reverse tanscriptae-amplifcation reactions For amplification of long ncleic acid molecules (.e. arcater than about 3-5 Kb in length), a combination of DNA polymerases may be used, as deseribed in WO 98/0676 and WO 95/16028, Amplification methods according to the invention may ‘comprise one or mone steps (eg, two, three, four, five, seven, ten, ete). For example, the invention provides method for amplifying a nucleic acid molecule comprising (@) mixing one or more enzymes with polymerase activity (ea Wo, thre, four five, seven, ten te) with one or more nucleic acid templates (eg. to tree, four, ive, seven ten, twelve, fifteen, went, thiny, filly. one hundred, ete.) and (b) incubating the mixture ‘under conditions suficient t0 allow the enzyme with polymerase atvity to amplify one oF more nucleic acid molecules complementary to all oF & portion ofthe templates. The invention also provides nucleic jd molecules amplified by such methods. If desired, recombination sites may he added to such amplified mol- ‘cules during or after the amplification process (3%, ©. US. patent application Ser. No, O9/177.887 filed Oxt. 23, 1998 ‘based on US. provisional patent application No. £60V065,930 fled Oxt, 24, 1997) General methods for amplification and analysis of nucleic acid molecules or fragments are well Known to one of ‘ordinary skill in the art Gee, €., US. Pat, Nos. 4,683,195; 44,683,202; and 4.800.159; Innis, M. A., et al, eds. PCR Protocols: A Guide to Methods and Applications, San Diego, Calif: Academic Press, Ine. (1990); Grif HG., and Grif, AM, eds, PCR Technology: Curreat Innovations, Boca Raton, Fla: CRC Press (1994)), For example, ampli fcation methods which may be used in aceordance with the present invention include PCR (US. Pat. Nos. 4,683,195 ‘and 4,683,202), Strand Displacement Amplification (SDA; 0 o 108 US. Pat. No, $485,166; EP 0 684 315), and Nucleic Acid Scquence-Based Amplification (NASBA; US. Pat. No. 5409,818; EP 0329 822), ‘Typically, these amplification methods comprise: (a) mix- ing one of more enzymes with polymerase activity with the uelei acid sample inthe presence of one or more primes, ind (b) amplifying the nucleic acid sample to generste & colletion of amplified nucleic acid fragments, preferably by PCR of equivalent automated amplification technique. Follossing amplification or synthesis by the methods of the present invention, the amplified or synthesized nucl acid fragments may be isolated for farther use or eharacter Thi ination. This step is usually accomplished by separation of the amplified or syathesized nuclei acid fragments by size or by any physical or biochemieal means including. gel electrophoresis, capillary electrophoresis, chromatography ncluding sizing, alliniy’ and immunoehromatography), Sensty gradient “centrifugation and immunoedsorpion. Separation of nucleic acid fragments by gel electrophoresis ‘is particularly preferred, as it provides a rapid. and highly reproducible means of sensitive separation of multitude of aucleic acid fragments, and permits direct, simultancous ‘comparison of the fraginents in several samples of nucleic fcids, One can extend this approach, in another preferred embodiment, to isolate and characterize these fragmeats oF ‘any nucleic acid fragment amplified or synthesized by the ‘methods of tho invention, Thus, the invention i also directed to isolated ucleie seid molecules produced by the samp jeation synthesis methods of the invention, In this embodiment, one o¢ more of the amplified or synthesized nueleie acid frgments are removed from the gel whieh was used for identification (ee above), according 10 standard techniques such as electroelution or physical exei- sion. The isolated unique nucleic aeid fragments may then be inserted into standard vectors, including expression wee- tors, suitable for transfection or wansformation of a variety of prokaryotic (bacterial) or eukaryotic (yeast, plant or animal including human and other mammalian) calls. Aker- natively, nucleic acid molecules produced by the methods of the invention may be futher characterize, for example by sequencing (ie, determining the nucleotide sequence ofthe nucleic aeid fragments), by methods described below and others that are standard in the at (see, eg, US. Pat. Nos. 4,962,022 and 5,498,523, which are directed to methods of DNA sequencing) ‘Nucleic acid sequencing methods according to the inven ‘ion may comprise one or more stops. For example, the invention may be combined with a method for sequencing a rueleie acid molecule comprising (a) mixing an enzyme ‘ith polymerase activity with a nucleic acid molecule to be sequenced, one or more primers, one or more nucleotides, and one or more teminating agents Guel as a dideoxy. ‘nucleotides) to form 2 mixture: (b) incubating the mixture under conditions sullicent to synthesize a population of ‘molecules complementary to all ora portion ofthe molecule to be sequenced; and (c) separating the population to deter ‘mine the micleotide sequence of all or & portion of the molecule to be sequenced, ‘Nucleic cic! sequencing wetuiques which may be employed include dideoxy sequencing methods such as ‘those disclosed in U.S, Pat, Nos, 4,962,022 and 5,498,523 Kits In another aspect, the invention provides kits which may be used in conjunction with the invention Kits according to this aspect of the invention may comprise one oF more containers, which may contain one or more componentsUS 7,351,578 B2 109 ‘cleted from the group consisting of one or more aueleic id molecules of vectors of the invention, ome of more primers, the molecules and/or eompounds of the invention, supports ofthe invention, ane or more polymerases, one oF more reverse transcriptaes, one or more recombination proteins (or other enzymes for carrying out the methods of the invention), one oF more butters, one or more detergents, ‘one of more restriction endonveleases, one or more nucle ‘tides, one oF more terminating agents (-,, ddNTPs), one ‘or more transfection reagents, pyrophosphatase, and the ike A.wide variety of nucleic acid molecules or vectors of the Jnvention can be used with the invention. Furtber, due to the modularity of the invention, these nucleic acid molecules ‘and. vectors can be combined in wide range of ways. Examples of nvcleie aid molecules which ean be supplied Jn kts ofthe invention incide those that contain promoters, sanal peptides, enhancers, repressors, selection markers, transcription signals, translation signals, primer hybridiza: tion ites (e-, lor sequencing or PCR), recombination sites, restriction sites and polyinkers, sites whieh suppress the termination of translation in the presence of a suppressor IRNA, suppressor RNA coding sequences, sequences which ‘encode domains andior regions (eg, 6 Ils tag) for the preparation of fsion proteins, origins of replication, telom- ‘eres, centromeres, and the like. Similadly, libraries can be supplied in Kits ofthe invention, These libraries may’ be the form of replicable nucleic acid molecules or they may ‘comprise nucleie acid molecules which are not associated ‘with an origin of replication. As one skied inthe art would recognize, the nucle aed molecules of libracies, as well as ‘other nucleic acid molecules, which are not associated with, ‘an origin of replication ether could be inserted into other riclec acid molecules which have an origin of replication ‘or would be an expendable kit components Pater, in some embodiments, ibraries supplied in kits of the invention may comprise two components: (1) the nucleic id molecules of those libraries and (2) $' andlor 3" recom bination sites, In some embodiments, when the nucleic acid molecules ofa library are supplied with $*and/oe ¥ recom bination sites, it will be possible to inser these molecules into vectors, which also may he supplied asa kt componest using recombination reactions. In other embodiments, recombination sites can be attached to the nucleic acid molecules of the libraries before we (eg, by the use of & Tigase, which may also be supplied with the ki). In such ‘eases, nucleic acid molecule Which contain recombination sites or primers which ean he used to generate recombina- tion sites may be supplied with the kits, ‘Vector supplied in kis ofthe invention ean vary greatly. In mast instances, these vectors will contain an origin of replication, at lesst one selectable marker and atleast one recombination site. For example, vectors supplied in Kits oF the invention can have four separate recombination sites ‘which allow for insertion of mucleie acid molecules a two “different locations. A vector of this type is shown schemati- cally in FIG. 6. Other attributes of vectors supplied in kits of the invention are describe elsewhere here, Kits ofthe invention can also be supplied with primes. These primers will generally be designed to anneal 10 molecules having specific noclootide sequences. For ‘example, these primers can be designed for use in PCR 10 amplify a panicular nucleic acid molecule. Further, primers supplied with kits of the invention can be sequencing primers designed to hybridize to vector sequences. Thus, such primers will generally be supplied as part of kit for sequencing nueleie acid molecules which have heen inserted into a vector 0 o 10 One or more bullers (one, two three, Four, fe eight, ten, fifteen) may be supplied in kits ofthe invention. These butlers may be supplied at a working concentrations or may be supplied in concentrated form and then difsted to the ‘working, concenteations, These buifers will offen contain salt, metal ons, co-factors, metal ion chelating agents, ee forthe enhancement of activities of the stabilization of either the buller itself or molecules in the buller. Further, these butfers may be supplied in dried or aqueous forms. When bullers are supplied in a dried form, they will generally be issolved in water prioe to use, Examples of butlers suitable Tor use in kts of the invention are set out in the following examples. ‘Supports suitable for use with the invention (e, soid supports, semi-solid supports, beads, muliwell tubes, ete, described above in more detail) may also be supplied with kis of the invention, Exemplary uses of supports in pro- cesses of the invention are shown in FIGS. 1013 Kits ofthe invention may contain virwally any combina- tion ofthe components set out above or described elsewhere herein. As one skillod in the ar would recognize, the components supplied with kits of the invention will vary ‘withthe intended use forthe kts. Ths, kite may be designed to perform various functions set out inthis application and the components of such kits will vary accordingly It will be understood by one of ordinary skill in the relevant arts that other suitable modifications and adapta- ‘ions (0 the methoxls and applications described berein are readily apparent from the description of the invention con- ‘ained herein in view of information known to the oninaily slilled atin, and may be made without departing from the Scope of the invention or any embodiment thereot, Having ‘now descr the present invention in deal, the same will bbe more clearly understood by reference to the following examples, which are included herewith for purposes of illustration only and are not intended to be limiting of the ‘The entire disclosures of US. application Ser. No. 08/486, 139 (now abandoned), filed Jun. 7, 1995, U.S. application Ser, No, 08/663,02, filed Jun. 7, 1996 (now US. Pat. No. '$888,732), U'S. application Ser. No. 09/233.492, fled la 20, 1999, US. Pat. No. 6,143,587, ised Nov. 7, 2000, US. application Ser. No. 601065,930, filed Oct. 24, 1997, US. ‘application See. No, 09/177.387 fled Oct. 23, 1998, US. application Ser. No. 09/296,280, fled Apr. 22, 1999, US. application Ser. No, 09/296,281, fled Apr. 22, 1999, US. application Ser. No. 60/108.324, filed Nov. 13, 1998.0. pplication Ser. No. 09438,358, filed Nov. 12, 1999, US. pplication Ser. No. 09/695.065, fled Oot. 25, 2000, US. pplication Ser. No. 09/432,085 filed Now. 2, 1999, US. application Ser. No. 60/122'389, filed Mar. 2, 1999, US. pplication Ser. No. 60/136.08, filed Mat. 23, 1999, US. ‘pplication Ser. No. 60/136,744, fled May 28, 1999, US. application Sor No. 60V122,392, fled Mar. 2, 1999, and US. application Ser. No. 60/161.408, fled Oct. 25, 1999, are herein incorporated by reference. EXAMPLES Example 1 ‘Simultaneous Cloning of Two Nucleic Acid Segments Using an LR Reaction ‘Two nueleie acid segments may be cloned in a single reaction using methods ofthe resent invention. Methods of the present invention may comprise the steps of providing aUS 7,351,578 B2 ut first nucleic acid segment Maaked by a fist and a second recombination site, providing a second nucleic acid segment flanked by a third aad a fourth recombiastion site, wherein ther the first or the sscand recombination sites capable of recombining with either the third or the fourth recomtina- tion site, conducting # recombination reaction sach that the to nucleic acid segments are recombined into a. single nucleic acid molecule and cloning the single nucleic acid molecule. With reference to FIG. 2, two nucleic acid segments flanked by recombination sites may be provided. Those skilled in the art will appreciate that the nucleic acid segments may be provided either as diserete fragments or as part of a larger ncleie acid molecule and may be circular and optionally supereoiled or linear. The sites can be elected such that one member of a reactive pair of sites flanks each of the two segments [By “reactive pair of sites,” what is meant is two recom= bination sites that can, in the presence of the appropriate ‘enzymes and coficton, recombine. For example, ia some preferred embodiments, one nucleie acid molecule: may ‘comprise an aftR site while the other comprises an atl site that reacts with the al site. As the products of an LR reaction are tivo molecules, one of Which comprises an att site and one of which comprises an atP site, it is possible range the orientation ofthe stating st. ad at sites sue that, ltr joining, the two starting nucleic acd segments are separated by a nucleic acid sequence that comprises either fn ath site of an atP site TInsome preferred embodiments, the sites may be arranged such that the two stating nucleic acid segments are sepa- rated by an att site after the recombination reaction. In coher preferred embodiments, recombination sites om ‘ther recombination systems may be used. For example, ome embodiments one or more ofthe recombination sites ray be a lox site or derivative, In some preferred embed rents, recombination sites from more than one recombi tion system may’be nsod in the same construct, For example, fone of more ofthe recombination sites maybe an att site ‘while others may be lox site. Various combinations of sites fiom differnt recombination systems may oceur to those shilled in the art and such combinations are deemed 10 be ‘within the scope of the present invention, ‘As shown in FIG. 2, nueleie acid segment A (DNA-A) ‘may be flanked by recombination sites having unique speci ficity, for example atl and a3 sites ancl nucleic acid segment B (DNA-B) may he flanked by recombination sites attR3 and aitL2. For ilusrative purposes, the segments are indicated as DNA. This should not be construed as limiting the neleie acids used in the practice of the present invention to DNA tothe exclusion of other nuclei acids, In addition, Jin ths andl the subsequent examples, the designation of the recombination sites (Le. L1, L3, RL, R3, ele.) is meray ‘intend to convey that the recombination sites used have “different spevfieities and should not he construed as Himiting the invention othe use of the specifially recited sites. One skilled inthe art could readily substitute other pais oF sites for those spocitially exemplified Te a3 aad att} sites comprise a reactive par of sites ‘Other pairs of unique recombination sites may’ be used to flank the nucleic acid segments. For example, lox sites could be used as one reactive pair while another reactive pair may be att sites and suitable recombination proteins included in the reaction. Likewise, the recombination sites discussed ‘above ean he used in Various combinations, In this embodi ‘ment, the only eritcal feature is that, ofthe recombination sites Nanking each segment, one member of a reactive pair 0 o 12 of sites, inthis example an LR pair [3 and 3, is present on fone nucleic acid seyment and the other member of the retive pair is present on the other nucleic acid segment. ‘The two segments may be contacted with the appropriate enzymes and a Destination Vector. “The Destination Vector comprises a suitable selectable marker Hanked hy two reeombinaton sites. In some embed mens, the selectable marker may he a negalive selectable ‘maker (such a6 a toxie gene, ©, eed). One site in the Destination Vector will be compatible with one site present ‘on one of the nucleic acid segments while the other com- patible site present in the Destination Vector will be present fn the other nucleic acid segment, "Absent a recombination between the two starting nce acid segments, neither starting nucleic acid segment has recombination sites compatible with both the sites in the Destination Vector. Thus, neither starting nuclei acid sege ‘ment can replace the selectable marker present in the Des- ‘ination Veetor. "The rection mixture may be incubated at shout 28°C. for from about 60 minates to about 16 hours. All or a portion of the reaction mixture will he used fo transform competent ‘microorganisms and the microorganisms screened for the presence of the desired eonsiruct. In some embodiments, the Destination Vector comprises ative selectable marker and the microorganisms tans: ormed are susceptible to the negative selectable marker present on the Destination Vector. The transformed micro- ‘organisms will be grown under conditions pemnitting the rogative selection against microorganisms not containing the desired recombination prot. In FIG. 2, the resulting desired product consists of DNA-A and DNA-E separated by an attR3 site and cloned ino the Destination Vector backbone. In this embodiment, the same type of reaction (ie an LR reaction) may be used {o combine the two fragments and insert the combined fragments into a Destination Vector. ‘In some embodiments, it may not be necessary to contol the orientation of one or more of the nucleic aid segments ‘and recombination sites ofthe same specificity can bo used fon both ends of the segment ‘With reference to FIG. 2, i the orientation of segment A with respect to segment B were not critical, segment Acould be flanked by LI sites on both ends oriented as inverted repeats und the ead of segment Bo be joined to segment. could be equipped with an RI site, This might be useful in ‘generiting additional complexity in the formation of com- binatorial libraries besween segments A and B. That is, the joining ofthe segments can occur in various orientations and sven that one or both segments joined may be derived from ‘one or more libraries, a new population or library compel ing hybrid molecules in random orientations may be eon- structed according to the invention ‘Although, in the present examples, the recombination between the two stating nucleic acd sepments is shown as ‘securing before the recombination reactions withthe Des- ‘ination Vector, the order of the recombination eaetions is ‘ot important. Thus, in some embodiments, it may be ‘desirable to conduct the recombination reaction between the segments and isolate the combined segments. The combined ‘Segments ean be used diredy, for example, may be aml fied, sequenced or used as linear expression elements as taught by Sykes, eta. (Nature Biotechnology 17:385-389, 1999), In some embodiments, the joined sogments may be encapsulated a aight by Tawi, tal (Nature Biotecnol- ‘9g 16:652-656, 1098) and subsequently assayed for one oF ‘more desirable properties. In some embodiments, the comUS 7,351,578 B2 113 bined seuments may be used for in vito expression of RNA by, for example, incloding a promoter such as the 17 promoter or SP6 promoter on one of the segments. Such in vitro expressed RNA may optionally be translated in an in vitro translation system such as rabbit reticufoeyte lysate Optionally, the joined! segments may be further reacted ‘with a Destination Vector resulting in the insertion of the ‘combined segments into the vector. In some instances, it may be desirable to isolate an intermediate comprising one ‘of the segments andthe vector. For insertion ofthe segments Jno a vector, its not extcal to the practice ofthe present Jnvention whether the recombination reaction joining the fo segments oceurs before or after the recombination reaction between the segments and the Destination Vector. ‘According 10 the inveation all three recombination reac tions preferably occur (Le. the reaction between segment A and the Destination Vector, the reaction between segment B tnd the Destination Vector, and the reaction between ey- ment A and segment B) in onder t produce a nucleic acid molecule in which both of the (Wo starting aucleic acid Segments are now joined in a single molecule. In. some ‘embodiments, recombination sites may be selected such that, after insertion into the vector, the rscombination sites flanking the joined segments form a raetive par sites and the joited Segments may be excised from the vector bj reaction of the aking sites with suitable recombinatir proteins. With reference wo FIG. 2, ifthe 2 site on seument B were replaced by an [1 site in the opposite orientation with respect to segment B (ie, the long portion of the box indicating the recombination site was not adjacent tthe segment) and the R2 site inthe vector were replaced By an RI site in opposite orientation, the recombination reaction would prodice aa atPL site in the vector The attP 1 site ‘would then be capable of reaction with the at site on the ‘ther end ofthe joined segments. Thus, the joined segments ‘could be excised using the recombination proteins appro- priate fora BP reaction. ‘This embodiment of the invention is particuady suited for the constmction of combinatorial Ibrares. In some preferred embodiments, cach ofthe nveleic acid segments in FIG. 2 may represent libraries, each of which may have & known or unknown nuclei acid sequence to be screened. la some embodiments, one or more of the segments may have ‘sequence encoding one or more permutations ofthe amino ‘acid sequence ofa given peptide, polypeptide or protein, In some embodiments, each segment may havea sequence that ‘encodes 2 protein doniain ora library representing varions permutations of the sequence of protein domain. For ‘example, one segment may represent library of mutated ors of the variable domsia of an antibody light chia While the other segment represents a hbrary of mutated forms of an antibody heavy chain, Thus, recombination ‘would generate a population of molecules (eg. antibodies, single-chain antigen-binding proteins, et.) each poteatally ‘containing a unigue combination of sequences and, there fore, a unique binding specificity nother preferred embodiments, one of the segments may represent a single nucleic acid sequence while the other represents 2 library. The result of recombination will be & population of sequences all of which have one portion ia ‘common and are varied in the other portion. Embodiments ‘of this type will be wsefl for the generation ofa ibary of fusion constructs. For example, DNA-A may comprise & regulatory sequence for directing expression (ie, pro- moter) and a sequence encoding a purification tag. Suitable Purification tags include, but are not limited to, glutathione 0 o 4 Sctransferae (GST), the maltose binding protein (MBP), epitopes. defined amino acid sequences such as epitopes, hapten, six histdines (HIS6), and the like, DNAS may comprise library of maiated forms of a protein of intrest. ‘The resultant constructs could be assayed for a desired chareterstic such as enzymatic activity or ligand binding, ‘Alternatively, DNA-B might comprise the common por- tion ofthe resulting fision molecule. In sme embostiments, the above described methods may be used to facilitate the fusion of promoter regions or transcription temination signals to the Send or 3-end of structural genes, respec: tively, to create expression cassettes designed for expression in different collar contexts, for example, by adding 9 tissue-specific promoter to a structural pene ‘In some embodiments, one oF mare ofthe segments may representa sequence encoding members ofa random peptide library. This approach might be used, for example, 10 szenerite a population of molecules with certain desirable characteristic. For example, one segment might contain @ sequence coding for a DNA binding domain while the other segment represents a random protein library. The resulting population might be sereened forthe ability to modulate the expression of a target gone of interest. In other embodi- ‘ments, both segments may represeat sequences eneoding ‘members of a random protein library and the resultant synthetic proteins (eg. fsion proteins) could be assayed for any desirable characteristic such a, for example, binding & specific ligand or receptor or possessing some enzymatic activity Ts not necessary that the nucleic acd segments encode fan amino acid sequence. For example, both of the segments ‘may direct the transription of an RNA molecule that isnot translated into protein. This wil be usefil forthe constric- tion of (RNA molecules, ribozymes and anti-sense mol- ecules. Alternatively, one segment may direct the wanserip- ‘ion of an untranslated RNA molecule while the ether codes fora protein. For example, DNA-A may diret the transerip- ‘ion ofan untranslated lender sequence that enhances protein expression sich as the encephalomyacardtis viris leader sequence (FMC leader) while DNA-B encodes a peptide, polypeptice or protein of interest. In some embodiments, ‘Segment comprising a leader sequence might further con Prise a sequence encoding an amino acid sequence. For ‘example, DNA-A might have a nucleie acid sequence cor responding i an EMC leader sequence and «purification tag while DNA-B has a mueleie acid sequence encoding a peptide, polypeptide oF protein oF interest "The above process is especially usefl for the preparation of combinatorial libraries of single-chain antigen-binding. proteins. Methods for preparing single-chain antigen-bind- dng proteins are known in the at (See, ¢.. PCT Publication No. WO 9407921, the entre disclosure of which is incor porated herein by reference) Using the consiucts shown ia FIG. 6 for illustration, DNA-A could encode, for example, uated forms of the variable domain of an antibody light chain and DNA-B could encode, for example, mutated Torms of the variable domain of an antibody light chain Furer, the intervening nucleic acid between DNA-A and NAB could encode a peptide linker for connecting the ight and heavy chains. Cells which express the single-chain ‘antigen-binding. proteins can then be screened to identify those which produce molecules that bind to a particular antigen ‘Numerous variation of the above are possible. For ‘example, instead of using a construct illustrated in FIG. 6, fonstncts such as that illstrated in PIG. 2 could be used with the linker peptide coding region being embedded intheUS 7,351,578 B2 site embeded Functionality discussed above. As aotber example, single-hain antigen-binding pro- teins composed of two antibody light chains and two ani body heavy chins can also be produced. These single-chain antigen-binding proteins can be designed to associate and form multivalent antigen binding. complexes. Using the ‘constructs shown in FIG. 2 again for illystration, DNA-A, and DNA-B could each encode, for example, mutate forms ‘of the variable domain of am antibody light clsin, At the same site in-@ similar vector or at another site ina. vector Which is designed for the insertion of four aucleic acid inser, DNA-A and DNA-B could each encode, for ‘example, mutated forms of the variable domain of aa antibody heavy chain. Cells which express both single-chain tigen-binding proteins could then be sereened to entity for example, those which produce multivalent antgen-bind- ing complexes having specificity for a particular antigen ‘Thus, the methods of the invention can be used, for ‘example, to prepare and sereen combisuiorial ibrares 10 ‘dontify cells which produce antigen-binding proteins (eg. antibodies andior antibody fragments or antibody fragment ‘complexes comprising variable heavy or variale light ‘donisins) having spocitiiies for particular epitopes. The methods of the invention also methods for preparing ani en-binding proteins and antigen-binding proteins prepared by the methods ofthe invention. Example 2 Simultaneous Cloning of Two Nucleie Acid Froaments Using an LR Reaction to Join the ‘Segments and a BP Reaction to Insert the ‘Segments into a Vector As shown in FIG. 3, frst occ acid segment flanked by an atB recombination site and an atl recombinaton site may be joined to second nucleic acid segment flanked by ‘an aR recombination site tht is compatible with the at site present on the first mocleie acid segment and flanked by ‘anal site that may be the same or different as the atB site present on the first segment. FIG. 3 shows an embodiment Wherein the two at sites are different. The two segments may be contacted witha vector containing at? sites in a BP reaction ‘A subsequent LR reaction would generite @ product ‘consisting of DNA-Aand DNA-B separated by either an atP site or an aiB site (he product of the LR reaction) and ‘lone into the vector backbone. In the embodiment shown jn FIG. 3, the afl and aR sites are arranged 80 as 10 generate an at site between the segments upon recombi nation. In other embodiments, the att and the at may be ‘oriented differently so as to produce an ait ste between the Segments upon recombination, Ia prefered embodiments, aller recombination, the two segments may be separated by ‘an at site, “Those skilled in the art ean realy optimize the condi tions for condveting the reactions described above without the use of undue experimentation. Ina typical reaction from about 50 ng to about 1000 ng of veetor may be contacted with the Jragments to be cloned under suitable reaction ‘conditions. Fach fragment may be present na molar ratio of from about 25:1 t@ about 1:25 veetorfragment, In some ‘embodiments one o more ofthe fragments may be present ‘at molar ratio of from about 10:1 to 1:10 veetorsaigment Ina preferred embodiment, each fragment may be present at 44 molar ratio of bout 1:1 Vectorfragment, 0 o 116 Typically, the avceic seid may be dissolved in an aqueous duller and added to the reaction mixture, One suitable set of conditions is 4 yl Cxowss™ enzyme mixture (eg, Invitto- gen Comp. (Carlsbad, Calif), Cat. Nos. 11791-019 and 11789-013), 4 yl 5x reaction butler and mucleie acid and ‘water fo final volume of 20 pl. This will typically result in the inclusion of about 200 ng of Int and about 80 ng of IHF jn 204i BP reaction and about 150 ng int, about 25g IHE And about 30 ng X is in a 20 pt LR reaction. In some prefered embodiments, particularly those ia whieh at, sites are to be recombined with att sites, the final reaction mixture may inelude about SO mM Tris HCl pH 7.5, abont I mM EDTA, about I mg/ml BSA, about 75 mM NaCl and about 7.5 mM spermidine in addition to recombination enzymes and the nucleic acids to be com- bined, In other prefered embadimens, particularly Those in ‘which an at site isto be recombined with an at? site, the final reaction mixture may inelude about 25 mM Tris HCl pH 75, about $ mM EDIA, about 1 mg/ml bovine serum albumin (BSA), about 22 mM NaCl, and about § mM spermidine. ‘When it is desired to conduct both a BP and an LR action without purifying the nucleic acids in between, the [BP reaction ean be condicted first and then the reaction conditions adjusted to about 80. mM NaCI, about 3:8 mM spemnidine, about 34 mM EDTA and about 0.7 mgiml by the addition ofthe LR Cioxssi™ enzymes and concentrated NaCl. The reaction solution may be incubated at suitable temperature such a, for example, 25°C for from about 60 ‘mines to 16 hours, After the recombination reaction, the solution may be use to transform competent ost ells and the host cells sereened as described above ‘One example of a “one-tuhe” reaction protocol, which ‘aeilitates the transfer of PCR produets directly to Expres- sion Clones in two-step reaction performed in single tbe follows, This process can also be used (0 transler pene from one Expression Clone plasmid backbone to another ‘The Expression Clane is first be linearized within the plasmid backbone to achieve the optimal topology for the [BP reaction and to eliminate false-positive colonies due 40 covtransormation Twenty-five jl BP resction mixture is preparedia a 1.5m. tube with the following componeats: 7 DNA (100200) Tas a SEP DNA (pDONHO1) 150 np 3 SBF Rowson ger Ed ‘The contents of the tube is mixed and incubated for 4 hours, or longer, at 25° C. If the PCR product is amplified from a plasmid template containing selectable. markers presont on the Garrwav™ pDONR or pDEST vectors (he. kan or amp’), the PCR product may be treated with the restriction endonuclease Dpal to degrade the plasmid. Such plasmids are a potential source of false-positive colonies ia the transformation of Gareway™ reactions. Eunher, when the template for PCR or starting Expression Clone his the same selectable marker as the final Destination Vestor (eg, amp’), plating on LB plates containing 100 ygiml ampicilin fan be used to determine the amount of false postive colonies earied over tothe LR reaction step. Five ofthe reaction mixture is transfered t a separate tube to which is added 0.5 yl Proteinase K Solution. ThisUS 7,351,578 B2 7 tube is then incubate For 10 minutes at 37° C, One hundred lof competent cells are then trtsformed with 1-2 yl ofthe mixture and plated on LB plates vontaning 50 jy/ml Kana- mycin. This Yields colonies for isolation of individval Pity ‘Clones anc! for assessment of the BP Reaction eficiney. ‘The following components are added tothe remaining 20 UI BP reaction described above: Neti OEM Tae Desai Vstor 130 agi Si Leche al Talk oa “The mixture is then incubate at 28° C. for 2 hours, alter hicl 3 of proteinase K solution, followed by a further ‘incubation of 10 minutes at 37°C, 1-2 ofthis mistures is then used to transform 100 ji competent eels, which are then plated on LB plates containing 100 pal ampicillin Example 3 ‘Cloning of PCR Products Using Fragments by ‘Converting atB Sites into a Resetive Pair of at, ‘and alk Sites in a BP Reaction and Subsequent LR Reaction A similar strategy to that described in Example 2 ean be used to recombine wo PCR products and clone them simultaneously into a veetor backbone, Since atl. and att sites are 100 and 125 basepairs long respectively, it may be “desirable to incorporate at sites into the PCR primers since ‘an atB site is 25 base pairs in length. Depending on the ‘orientation of the atB site with respect to the nucleic acid sexment being transfered, atB sites can be converted (0 citer an ator attR site by the BP reaction. Thus, the ‘orientation of the ath site in the att PCR primer deter- mines whether the att site is converte to atL or aR. This affords the Garcxav™ system and methods of the invention ‘great flexibility in the atilization of multiple att sites with Unique speiticty ‘As shawn in FIG. 4, 0 segments (eg, PCR products) ‘consisting of segment A flanked by mutated atB sites each having a dierent specificity (eg. by at81 and att83) and segment B flanked by mutated att sites of different speci Sieity, wherein one of the atB sites present on segment Ais the same as one of the attB sites present on seument B (eg. segment B may contain att and at sites) may be joined ‘and inserted into a vector, The segments may be reacted ‘iter individually or together with two at? site containing veetors in a BP reaction, Alternatively the attP sites might be present on near segments. One vector contains at sites ‘compatible with the ftB sites present on segment A (et, (PL and atP3 sites). The other vector contains al sites ‘compatible with the at sites present on segment B (et, (PS and attP2 sites). When linear segments are used 10 provide tho atP sites, each atP site may be provided on & egment, The orientations of the a3 and aNP3 sites are such that an aftR3 site woud be generated atthe S-end of the DNA-B segment and an atl site generated atthe ¥-end ‘of segment A. The resulting entry clones are mixed with 3 Destination Veetor in a subsequent LR reaction to penerate product consisting of DNA-A and DNA-B separated by an ‘AK13 site and cloned into the Destination Vector backbone, ‘This basi scheme has been sed to link two segments, a att. L-fragment A-atL3 entry clone tht is reacted with a 0 o us ‘aiR3 fragment Beat? entry clone, and to insert the linked ragments into the destination vector. To generate the appro- priate entry clones, two atP Donor vectors Were constricted consisting of attPI-cedP-atP3 and attP3R-codB-atP2 sich ‘hat they could be reacted with appropriate atts PCR prod. vets in order to convert the atl site to at and att sites. The designation attP3R is used to indicated thatthe orien tion of the atP3 site is such that reaction with a DNA segment having a cognate at site will result in the pro- duction of an aR site on the segment. This is represented schematically in FIG. 4 by the reversed orientation of the Sippled and lined sections of the allB3 on segment B as ‘compared to segment A. On segment B the stippled portion is adjacent to the segment while on segment A the lined portion is adjacent to the segment This methodology was exemplified by constructing. 3 DNA segment in which the tetracycline resistance gene (Lt) ‘was recombined with the f-galactosidase gene such that the ‘to genes were separated by an at site inthe product. The {et gene was PCR amplified with Sat und 3atB3 ends ‘The lacZ gone was PCR amplified with S-atB3R-and ath? ens. The two PCR products were precipitated with polyethylene glycol (PEG). The Bl-te-B3 PCR prod was ‘xed with an attPl-cedB-uttP3 donor vector and reacted ‘with BP CLoxast™ using a standard protocol to generate an atl. L-letattL3 entey clone. A correct tet entry clone was isolated and plasmid DNA prepared using standard tec igues. In @ similar fashion, the altB3R-laeZ-atB2 PCR product was mixed with an afP3R-cedB-atP2 donor vector And reacted with BP CLonast™ to generate an attR3-lae7- fat.2 entry clone: Tn order to join the two segments ina single vector, an LR CCuexast™ reaction was prepared ina reaction volume of 20 ul containing the following components: 60 ng (25 fimoles) fof the supercoiled tet entry lone: 75 mg (20 dinoles) of the supercoiled lacZ entry clone; 150 ng (35 iinoles) of pDESTS (described in PCT Publication WO 00/52027, the entire iselosure of which is ineoeporated herein by reference) linearized with Neol; 4 yl reaction buffer and 4 il of LR Cioxast™, The final reation mixture contained $1 mM ‘Tris HCI, 1 mM EDTA, 1 mgiml BSA, 76 mM NaCl, 7.5 1M spermidine, 160 ng of Tat, 35 ng of THF and 35 ng of Xis, The reaction was incubated at 25° C. ovemight and ‘stopped with 2 wl of proteinase K solution (2 mg/ml). A 2 yl flguot Was used to transform 100 yl of E: colt DHS LE cells and plated on LB plates containing ampicillin and XGal. Approximately 35,000 colonies were generated inthe transformation mixture with ells at an elieieney of 1.610" cfuling of pUC DNA. All the colonies appeared ble indi- cating the presence of the lacZ gene. 24 colonies were streaked onto plates containing tetrcycline and XGal, All of the colonies tested, 24/24, were resistant to tetracyeline. 12 colonies were used to inoculate 2m of LB broth containing ampicillin for mini preps. 12/12 minipreps contained a supercoiled plasmid of the correct size (7 Kb) Tn some embodiments, such as that shown in FIG. 5,180 segments can be reacted with a vector containing a single recombination site in order to convert one of the recombi ‘ation sites on the Segments into a different recombination site. In some embodiments, segments containing att sites may be reacted with a target vector having atP sites. For cxample, segments A and B are reacted ether togethor or separately with a vector having an atP3 site in order 40 conver the att sites on the segments ino an att and an AatR3, respectively. Ths is done so thatthe subsequent LR ‘action between the two segments results in their being joined by an att site. The segments may be joined with theUS 7,351,578 B2 19 AQP site containing vector before, simultaneously with oF aller the recombination reaction to convert the sites to generate a co-inteprate molecule consisting of DNA-A fManked by at 1 and atl 3 and DNA-B flanked by ott and ‘att.2, A subsequent LR reaction will generate a product ‘lone consisting of DNA-A and DNA-B separates by att ‘toned jnto-a vector backbone. Tn some embodiments, an atP site designed to convert the ftB used to Tink te segments toa reactive pir of atl and IR sites may be provided as shorter segments such as restriction fragments, duplexes of synthetic oligonucleotides ‘or PCR fragments, Revelions involving linear fragment ia 2 BP reaction may require longer incubation times, such a ‘overnight incubation, The conversion of atB sites toatl or aR sites can also be accomplished solely by PCR. PCR primers eontaining ator aR sites can be used to amplify a segment having fn at ste on the end, Since the sequence of alt and ttt sites contains a portion ofthe sequence of an aftB site, the ait, or attR-PCR primer can anneal. Extension of the ‘annealed at. or attR primer through tothe end of the PCR. product will generate fision template for PCR amplifca- tion of the full Iength PCR product using flanking primers that anneal tothe ends ofthe ator att sites. The primers Jor the PCR reaction may be provided as single stranded ‘oligonucleotides. In some preferred embodiment, the prim= ‘ers may be provided asa duplex, for example, asthe product fof a PCR reaction to amplify either an af or aR site Example 4 Cloning of Two or More Nucleic Acid Fragments {no Different Places in the Same Vector Two or more nucleic acid fragments can be cloned sin taneously into different regions ofa veetor having multiple sets of recombination sites each flanking. a selectable ‘marker. Ia some embodiments, one or more of the selectable markers may be a negative selectable matke. ‘As showin in FIG, 6, two mocleic soid segments A and B. Which may be preseat as discrete fragments or as part of @ Jarger nucleic acid molecule such ss a plasmid, can be simultaneously cloned into the same destination vector Nacleie acid segment A (DNA-A) flanked! by recombination sites that do not recombine with each other (eg. at] and at.2) and nucleic acid segment B (DNA-B) flanked by recombination sites that do not recombine with each other tnd donot recombine with the sites flanking segment A (¢.8. ‘att3 and att 4) may be combined witha Destination Vector jn an LR reaction, The Destination Vector will contain two pais of recombination sites, each pair selected to recombine With te sites Nanking one ofthe segments. Asan example, FIG. 6 shows two pairs of ati sites (atRV/atR2 and aR3/atiR4) cach flanking a ccdB negative selectable ‘marker. The three nucleic acids can be combined in a single TER reaction, The resulting product will consist of DNA-A ‘and DNA-B flanked by paits of at sites and cloned into distinct regions of the Destination Vector. ‘As shown in FIG. 7, an analogous method for inserting rucleic acid segments into-a vector can be accomplished tusing # BP reaction. For example, DNA-A flanked by recombination sites a3] and atfB2 can be combined With DNA-B faked by recombination sites at and atP4 and ‘a Nector containing at sites in a BP reoetion. The resulting product would consist of NA-A and DNA-H cloned between pairs oF at sites int distinct regions ofthe vector I stein this case serves as an overlap region to Which the 120 In some embodiments, it may be desirable to inset the segments into the target vector sequentially and isolate an intermediate molecule comprising only one of the segments Tis nt necessary tha all ofthe sites be derived form the same recombination system, For example, one segment may be flanked by lox sites while the other segment i flaked by ait sites. segment may have a lox site on one end and an site on the other end of anit site on one end. Various ‘combinations of sites may be envisioned by those skilled in the art and such combinations are within the scope of the present invention, In some embodiments it may be desirable to isolate {intermediates in the regetion shovsn in FIGS, 6 and 7, For ‘example, it may be desirable fo isolate a vector having only fone of the segments inserted. The intermediate might be used as is oF might serve a the substrate in 2 subseques recombination reaction to insert the second segment. Tn some embodiments, the preset invention is 9 method of cloning a nucleic acid segments, wherein is an integer treater than 1, comprising the steps of providing a nucleic fcid segments, exch segment flanked by two unique recom bination sites, providing a vector comprising 2n recombi ration sites wherein each of the 2a recombination sites is capable of recombining with one of the recombination sites ‘Nanking one of the nucleic acid segments and conducting a ecombiation reaction such that the a mveleie ae segen are recombined ino the vector thereby cloning then nveleic ‘acid segments In futher embodiments, the vector comprises fn copies of a selectable marker each copy flanked by two recombination sites In other embodiments, the Wector com prises twa or more different selectable markers each Hank by two recombination sites. In some embodiments, one oF sore ofthe selectable markers may be a negative selectable vacker In some embodiments, the present invention provides 2 ‘method of cloning, compesing the steps of providing a first, ‘second anda third nucleie acid segment, wherein the first nucleic acid seyment is flanked by a fist and a second recombination site, the second muicleic acid segment is flanked by a third and a fourth recombination site and the third nucleic acid segment is Hanked by a fiflh and a sixth recombination site, wherein the second recombination site is capable of recombining with the thin! recombination site ‘and none ofthe frst, foun, fithorsxth recombination sites is capable of recombining with any of the first through sixth recombination sites, providing a vector comprising a sev- centh and an ejghth recombination ste fanking a first see able marker and comprising a ninth and a tenth recombina- tion site flanking a second selectable marker wherein none of the seventh through tenth recombination sites can recom bine with any of the seventh through tenth recombination sites, conducting a fst recombination reation such thatthe sovond and the third recombination sites recombine and tcondocting @ second recombination reaction such that the Tint and the fourth recombination sites reeorabine with the seventh andthe eighth recombination sites respectively and the fitth and the sixth recombination sites recombine With the ninth and the tenth recombination sites thereby cloning the frst, second and third neleie aed segments In some embodiments, a nucleic acd segment may come prise & sequence that finetions af a promoter, In some embodiments the frst and the second nucleic acl segments ‘may comprise a sequence encoding a polypeptide and the recombination places both polypeptides inthe same reading frame. In some embodiments, a nucleic seid segment may comprise a sequence that functions as a transcription term ation sequenceUS 7,351,578 B2 124 The present invention provides an extremely versatile method for the modular construction of nucleic acide and proteins, Both the inserted nucleic acid segments and the Yestor can contain saquences selected so aso confer desired ‘characteristics on the product molecules, In those embodi ments exemplified ia FIGS, 6 and 7, in addition to the inserted segments, one or more of the portions of the vector adjacent to the inserted segments as wel asthe portion ofthe vector separating the inserted segments can contain one oF ore selected sequences. In some embodiments, the selected sequences. might ‘encode ribozymes, epitope tag, stractural domains, select able markers internal ribosome entry sequences, promoters, ‘enhancers, recombination sites and the ike. In some pre ferred embodiments, the portion ofthe vector separating the inserted seaments may comprise one or more selectable markers flanked by a reactive pair of recombination sites in ‘dition to the recombination sites used to insert the nucleic i segments “This methodology will be particularly well suited forthe ‘construction of gene targeting vectors. For example, the fegment of the vector between the pais of recombination sites may encode one or more a selectable markers such as the neomycin mesistance gene. Segments A and B may ‘contain meleie acid sequences selected sos to be identical fr substantially dential toa portion of gene target thats to be disrupted. After the recombination reaction, the Des- ination Veetor will eontsin wo portions of a zene of interest flanking a positive selectable marker. The vector ean then be inserted into a cell using any conventional technology, such as transfection, whereupon the portions of the gene of interest present on the vector can recombine with the hhomologois portions ofthe genomic copy af the gene. Cells ‘containing the inserted vector ean be selected Based upo ‘one or more chanicerstics conferred by the selectable ‘marker, for example, in the case when the selectable marker js the neomycin resistance gene, their resistance to G-418, In some embodiments, one oF more a negative selectable markers may be inclided in the portion of the Destination ‘Vector that does not contain the target gene segments and the positive selectable marker. The presence of one or more negative selectable markers permits the selection against cells in which the entire Destination Vector was inserted into the genome or against eels in which the Destination Veetor is maintained extraehromosomally In some preferred embodiments, akltional recombinas tion sites may be positioned adjaeeat tothe recombination sites used fo inser the nveloie acid segments. Molecules of this type will be useful in gene targeting application where it is desirable to remove the selectable marker from the targeted gene after targeting, the so called “bit and run" methodology. Those skilled inthe art will appreciate that the segments containing homologous sequence nee! not neces sarily comespond to the sequence of @ gene. In some instanes, the sequences may be selected 10 be homologous to a chromosomal locaton other than @ gene. This methodology is also well suited forthe construction of biccstronic expression vectors. In some embodiment, ‘expression vectors containing bicistronic expression ele ments where two structural genes are expressed rom single promoter and ate separated by an internal ribosome ‘entry sequence (IRFS, soe Encamacion, Current Opinion in Biotechnology 10:458-464 (1999), specifically incorporated herein by reference), Such vectors ean be used to express to proteins from a single constnic In some embodiments, it may not he necessary to contol the orientation of one or more of the aeleie acid segments 0 o 122 ‘and recombination sites ofthe same specifiy can be used ‘on both ends ofthe segment. With reference to FIG. 6 ifthe orientation of segment A with respect seyment B were not critical, segment A could be ankod by 1 sites on both ends And the vector equipped with two RI sites. This might be ‘efi in generating additional complexity inthe formation ‘of combinatorial libraries between Segments A and B. Pxample 5 Combining Multiple Fragments into a Single Site ina Vector 1 some embodiments, tbe preset invention provides method of cloning n nucleic acid segments, wherein nis an Jntegerarcater than 1, comprising the stops of providing a I through ann nice aid segment cach segment Marked by two unique recombination sites, whorein the recombina- thon sites ar sslected sc that one of he to recombination sites Manking the i seument, ny, feats with one of the recombination sles Sinking the’, segment and the ‘ter recombination ste lanking thei segment reats with fone ofthe recombination sites Nanking the oth seument providing a vector comprising at leat two Fecombination Ses wherein one of the 60 resombination sites on the vector Feats with ane of the sits on the I” nucleic acid Segment and another ste onthe vector reacts with a recone bination ste on the n® nocleie acid seymet. It is forther object of the present invention to provide a method of cloning, comprising the ses of providing fist second fun a tied nucleic acid segment wherein the fist nucleic acid Segment is Hanke by a first and a second recombina- tion sie, the second nucleic acid segment is Banke by third and a fourth recombination site andthe third nucleic aid seyment sank by a fifth and sixth recombination Site, wherein the second recombination ste is capable of recombining wth the thi recombination site and the fourth recombination site eapable of recombining withthe fith recombination ste, providing a vector having at Test @ Seventh and an eighth recombination site such that the Seventh recombination site i capable of reetng With the first recombination site and te evghth recombination sites capable of eating with the sixth recombination ste and ondcting a east one recombination scion such thatthe Second nd the third recombination sites recombine, the fourth and the fith recombination sits recombine, the ist aun! the seventh recombination sites resombine ad the sixth fn the eighth recombination sites recombine thereby lon- Jn tho fist, second and third nucle cid segment. a some embodiments at least one nicl acid sogment comprises a Sequence tha fanctions as a promoter. Ta some embodiments, at least two nucleic acid segments comprise sequences encoding a polypeptide andthe recom- bination paces both polypeptides in the same reading rame In some embodiments, at Teast one noclsic acid segment comprises 8 sequence tht functions as a transcription tet ination sequence. In some embodiments, at Teast one fragment comprises an origin of replication, In some cmbodimens, at ast one fragment comprises 8 sesuence coving for a Selectable marker “his embodiments exemplified in FIGS. 8 and 9 for dhe ease when n-3. In this embed, the present invention provides « method of cloning, comprising the steps of Providing fist second and third nuclei acid segment, ‘whorin the fst nace oid segment island by a fist hn sccond recombination site the second muicleie acid Seument is Hanke bya thd anda Fou ecombination site