Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Look up keyword
Like this
0Activity
0 of .
Results for:
No results containing your search query
P. 1
Diferenciacion en Cardiomiocitos a Partir de Celulas Madre

Diferenciacion en Cardiomiocitos a Partir de Celulas Madre

Ratings: (0)|Views: 1 |Likes:
Published by jcfranzoia

More info:

Published by: jcfranzoia on Aug 28, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

08/28/2013

pdf

text

original

 
458
REVISTA ARGENTINA DE CARDIOLOGÍA
VOL 77 Nº 6
NOVIEMBRE-DICIEMBRE 2009
Palabras clave >Abreviaturas >
 
INVESTIGACIÓNBÁSICA
Diferenciación en cardiomiocitos a partir de células madreembrionarias humanas
MARÍA ÉLIDA SCASSA
1
, DARÍO FERNÁNDEZ ESPINOSA
1
, MARÍA QUESTA
1
, GUILLERMO VIDELA RICHARDSON
1
, NOELIA LOSINO
2
,CARLOS LUZZANI
2
, ALEJANDRA S. GUBERMAN
2, 3
, HUGO O. GRANCELLI
MTSAC, 4
, GUSTAVO SEVLEVER
1
, SANTIAGO G. MIRIUKA
MTSAC, 1, 3, 4
MTSAC
Miembro Titular de la Sociedad Argentina de Cardiología
1
Laboratorio de Biología del Desarrollo Celular, FLENI
2
Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires
3
Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET)
4
Departamento de Cardiología, FLENI
 Recibido
: 12/02/2009
 Aceptado
: 07/08/2009
 Dirección para separatas:
Dr. Santiago MiriukaInstituto FLENIDepartamento de CardiologíaMontañeses 2325(C1428AQK) Ciudad Autónomade Buenos Aires
RESUMEN
Introducción
Las células madre son motivo de intensa investigación debido a la posibilidad de su utiliza-ción en el tratamiento de numerosas enfermedades, en particular las cardiovasculares. Ladiferenciación de células madre embrionarias humanas en cardiomiocitos se ha realizadoexitosamente
in vitro
. Se han establecido métodos de cultivo y diferenciación, señalesinvolucradas en la cardiogénesis y los cardiomiocitos generados se han utilizado en modelosde regeneración miocárdica. Sin embargo, aún quedan muchos interrogantes que se estáninvestigando activamente.
Objetivo
Desarrollar una metodología que permita el cultivo de células embrionarias y su diferencia-ción en cardiomiocitos.
Material y métodos
Se utilizaron cuatro líneas de células madre embrionarias humanas. Se cultivaron y dife-renciaron a través de los métodos publicados previamente en la bibliografía. El estado indi-ferenciadoyladiferenciaciónencardiomiocitosseverificaronpormediodeinmunomarcaciónfluorescente y RT-PCR.
Resultados
La metodología utilizada permitió cultivar las células y mantenerlas en estado indiferencia-do. Aunque con eficacia dispar, se logró la diferenciación en cardiomiocitos de las cuatrolíneas celulares utilizadas. La confirmación se realizó por medio de la expresión de factoresde transcripción miocárdicos y proteínas estructurales cardíacas.
Conclusiones
El cultivo y la diferenciación de células madre embrionarias humanas fue posible en nues-tro sistema. Estos resultados preliminares nos impulsan a continuar y a desarrollar nues-tros métodos con células pluripotentes inducidas.R
EV 
RGENT
C
 ARDIOL
2009;77:458-464.
Células madre embrionarias - Miogénesis - Cardiomiocito
CME
Células madre embrionarias
RT-PCR
Reacción en cadena de la polimerasa con
FERi
Fibroblastos embrionarios de ratón inactivados transcripción inversa
PNA
Péptido natriurético auricular
INTRODUCCIÓN
Las células madre son motivo de activa investigacióndebido a la posibilidad de su utilización en el trata-mientodenumerosasenfermedades,enparticularlascardiovasculares. La definición actual de célula ma-dre se basa en la presencia de tres características: enprimer lugar, su capacidad de perpetuarse y renovarsu linaje. Segundo, su capacidad de diferenciación enuno o varios tipos celulares. Por último, la capacidadde regularse y así limitar su potencial de propagación y crecimiento. En mayor o menor grado, estas trescaracterísticas están presentes en las poblaciones ce-lulares que conocemos como células madre. Sin em-bargo, estas células comprenden un grupo heterogé-neo. Existen diferencias pronunciadas entre distin-
 
459
DIFERENCIACIÓN EN CARDIOMIOCITOS A PARTIR DE CÉLULAS MADRE EMBRIONARIAS HUMANAS / María Élida Scassa y col.
tas células madre, que incluyen su capacidad de dife-renciación, proliferación, localización y ciclo celular.La división más general establece las células madreadultas y las células madre embrionarias (CME). En-tre las primeras se encuentran las células madrehematopoyéticas y mesenquimáticas (presentes ma- yormente en la médula ósea), las células progenitorasendoteliales y las células madre presentes en los dife-rentes tejidos especializados, como las cardíacas. To-das las células madre adultas presentan un gran po-tencial de diferenciación en linajes adultos, aunquesu espectro de diferenciación es relativamente limita-do (multipotencialidad). Así, las células madrehematopoyéticas presentan la capacidad de diferen-ciarse en las diferentes líneas sanguíneas, pero supotencial para diferenciarse en células no hemato-poyéticas se ha discutido ampliamente (transdi-ferenciación) y, en caso de que exista, parece ser unfenómeno raro y de dudosa relevancia biológica y clí-nica.Las células madre embrionarias presentan un po-tencial de diferenciación mucho mayor (pluripoten-cialidad). Estas células son capaces de diferenciarseen todas las formas adultas. Además, las CME pre-sentan una capacidad proliferativa prácticamente ili-mitada y senescencia nula o mínima. Estas caracte-rísticas se deben a su origen, ya que se obtienen de lamasa celular interna del blastocisto. Las primerascélulas embrionarias fueron derivadas de un blas-tocisto de ratón en 1981 por Evans y colaboradores.(1) La originalidad del trabajo se basó en establecerlas condiciones de cultivo necesarias para mantenerlas células embrionarias en un estado indiferenciadopor tiempo indefinido. Debe aclararse que
in vivo
lasCME mantienen sus propiedades por períodos muybreves durante la formación embrionaria. Posterior-mente, se diferencian para dar origen a distintos ti-pos celulares. Las CME humanas no fueron deriva-das sino hasta el año 1998 por Thompson y colabora-dores. (2) Nuevamente, su generación fue un hito y,una vez más, las condiciones de cultivo fueron com-plicadas y difíciles. Estos trabajos mostraban que unacaracterística de estas células era la capacidad de di-ferenciarse en todos los tejidos adultos y que, al serinyectadas en ratones inmunosuprimidos, generabanteratomas. En el año 2001, el grupo de Lior Gepstein,enIsrael,estableciólasbasesparadiferenciarlasCMEen cardiomiocitos. (3) Posteriormente han aparecidonumerosos trabajos que ampliaron los conocimientosacerca de los mecanismos involucrados en el procesode diferenciación miocárdica. Se han establecido mé-todosdecultivoydiferenciación,señalesinvolucradasen la cardiogénesis y los cardiomiocitos generados sehanutilizadoenmodelosderegeneracnmiocárdica.(4,5)Sinembargo,aúnquedanmuchosinterrogantesque se están investigando activamente.El objetivo de nuestro trabajo fue el de reproducirlas condiciones para mantener en estado indiferen-ciado las células embrionarias humanas y, posterior-mente, diferenciarlas en cardiomiocitos en nuestrolaboratorio. El cumplimiento de este objetivo tiene elpropósito desarrollar un laboratorio con la capacidadpara realizar estudios básicos y preclínicos en el áreade las células pluripotentes.
MATERIAL Y MÉTODOS
Células y método de cultivo
Todas las células embrionarias humanas utilizadas se obtu-vieron de los laboratorios que las derivaron. En los experi-mentos realizados se utilizaron las líneas celulares origina-das en los Estados Unidos H9, H5, H16 y una línea origina-da en Suecia (S351). Las CME fueron cocultivadas confibroblastos embrionarios de ratón inactivados (FERi) porirradiación en medio
knockout
-DMEM (Invitrogen) suple-mentado con 10% de suero sustituto (
 knock-out serumreplacement
,KSR,Invitrogen),bFGF4ng/ml(Calbiochem),penicilina100U/ml,estreptomicina100
µ
g/ml,L-glutamina2 mM, aminoácidos no esenciales 100 mM y
β
-mercap-toetanol 55
µ
M. Alternativamente, las células se cultivaronen placas cubiertas con Matrigel
®
(BD Bioscience) diluido1:40 en PBS y en medio condicionado con FERi. Los FER seobtuvieron en nuestro laboratorio luego de ser aislados yexpandidos a partir de embriones de ratones CF-1 en el día13,5 de desarrollo.
 Diferenciación en cardiomiocitos
: las células embrio-nariassecultivaronporlosmétodospreviamentedescriptos.Las colonias de CEH se incubaron con colagenasa (0,5 mg/ ml) (Sigma) y dispasa (0,25 mg/ml) (Sigma) por aproxima-damente 1-2 minutos y luego se disgregaron mecánicamen-te con un
cell-scraper
(raspador de células). Luego, las colo-nias se suspendieron en placas no adherentes y en medioDMEM suplementado con suero fetal bovino 20% (Invitro-gen), penicilina 100 U/ml, estreptomicina 100
µ
g/ml, L-glutamina 2 mM y aminoácidos no esenciales100 mM. Estemétodo lleva a la formación de conglomerados celulares lla-mados cuerpos embrioides. Luego de 7 días de crecimientoen suspensión, estos cuerpos se traspasaron a placasadherentes previamente cubiertas con gelatina bovina 0,1%(Sigma). El cultivo se continuó en las mismas placas y elmedio se cambió cada 2 o 3 días.
Inmunomarcación
Para la inmunomarcación, las células se fijaron con para-formaldehído al 4% en PBS; tras tres lavados con 0,1% deseroalbúmina bovina (BSA) en PBS, las células se trataronconsolucióndepermeabilizaciónybloqueo(0,1%BSA,0,1%Triton X-100 y 10% suero normal de cabra en PBS) por 45minutos. Posteriormente, las células se incubaron con losrespectivos anticuerpos primarios diluidos en solución debloqueo (0,1% BSA y 10% de suero normal de cabra en PBS)por 2 horas a temperatura ambiente. Finalmente, luego detres lavados con 0,1% BSA en PBS, se agregaron los corres-pondientes anticuerpos secundarios. La tinción nuclear serealizó con el colorante fluorescente 4,6-diamidino-2-feni-lindol (DAPI) (5
µ
g/ml). Las imágenes se tomaron con unmicroscopio Nikon Eclipse TE2000-S.Seutilizaronlossiguientesanticuerposprimarios:mono-clonal de ratón anti-SSEA4 (clon 813-70), monoclonal deratón anti-Tra-1-81, monoclonal de ratón anti-Tra-1-60,monoclonal de ratón anti-OCT3/4 (clon C-10), policlonal deconejoanti-NANOG(cloneH-155),policlonaldeconejoanti- ANP (clon FL-153), policlonal de conejo anti-Nkx2.5 (clonH-114), monoclonal de ratón anti-GATA-4 (clon G-4), poli-clonal de conejo anti-GATA-6 (clon H-92), monoclonal de
 
460
REVISTA ARGENTINA DE CARDIOLOGÍA
VOL 77 Nº 6
NOVIEMBRE-DICIEMBRE 2009
ratón anti-troponina T cardíaca (clon CT3), monoclonal deratón anti-SCN5A (clon H-170), policlonal de cabra anti-Islet-1 (clon K-20). Todos los anticuerpos son de Santa CruzBiotechnology,USA.Seemplearonlossiguientesanticuerpossecundarios conjugados con fluoróforos: anti-IgG-FITC deratón,anti-IgG-TexasRed-Xdeconejo,yanti-IgG-Alexa594de cabra.
RT-PCR
El cDNA se sintetizó a partir de 0,5 mg de RNA total obte-nido con el
kit
de aislamiento y purificación de RNA total“PureLink
®
Micro-to-Midi” de Invitrogen por retrotrans-cripción con la enzima SuperScript
®
III y hexámeros de se-cuencia al azar, de acuerdo con las instrucciones del provee-dor (Invitrogen). La amplificación de los cDNA se realizópor PCR con empleo de la enzima Platinum
®
Taq DNA polimerasa(Invitrogen)yoligonucleótidosespecíficoscuyassecuencias se detallan en Tabla 1.Los productos de amplificación se sometieron a elec-troforesis en gel de agarosa al 1,5% en
buffer
TAE 1x (Tris40 mM Tris, ácido acético glacial 20 mM y EDTA 1 mM).Los fragmentos se visualizaron por tinción con bromuro deetidio (0,5
µ
g/ml) en un analizador de imágenes.
RESULTADOS
Las cuatro líneas celulares se cultivaron como se hapublicadoporunlargomerodepasajessinquepre-sentaran modificaciones en su morfología o aspecto. A través de los sucesivos pasajes se observan coloniasen cocultivo con FERi. Estas colonias adoptan la típi-caformadescripta,conbordesnetosycompactos.Lascélulas embrionarias presentan una relación núcleo/ citoplasma alta, con nucléolos prominentes. La inmu-nomarcaciónmostqueestascoloniasexpresanmar-cadores de indiferenciación, incluidos OCT-4, SSEA-4, Tra-1-60, Tra-1-81 y NANOG. La expresión de es-tos marcadores es homogénea. Las colonias fueronnegativas para otros marcadores de indiferenciación,como Nkx2.5 y Pax-6 (dato no mostrado). Posterior-mente, las CME se cultivaron por varios pasajes so-bre Matrigel y con medio condicionado de FERi y seobservóquelascoloniasindiferenciadassemanteníancomo tales, expresando en la inmunomarcación losmarcadores de indiferenciación, sin presentar signosmorfológicos de diferenciación.Por último, la expresión de marcadores de indi-ferenciación se confirmó por medio de RT-PCR paraOCT-4 y NANOG (datos no mostrados).Las células se diferenciaron por medio de la for-mación de cuerpos embrioides. Estos cuerpos en sus-pensión adoptan una forma esférica con bordes regu-lares y definidos. Luego de ser pasados a placasadherentes, los cuerpos embrioides se adhieren y suscélulas se expanden y adoptan diferentes morfologíaspertenecientes a diferentes linajes celulares. A partirdel día 8 a 9 desde el inicio de la diferenciación seobservaronzonasconactividadcontráctilespontáneaenunporcentajemenordeloscuerposadheridos(véa-se video en material suplementario
on line
). Estaszonas presentan un ritmo y una contractilidad simi-lares a los de las células cardíacas. Las zonas corres-ponden a una porción menor del total de las células ypublicaciones previas establecen que el porcentaje delas células con actividad contráctil es menor del 10%.(3) Las diferentes zonas observadas difieren en la fre-cuencia de contracción, que varía en un rango deaproximadamente 5 a 10 veces por minuto hasta 60-80 veces por minuto. Esta diferencia fue estudiadapreviamente y se corresponde con la diferenciaciónde cardiomiocitos con fenotipos diferentes y corres-pondientes a tejido de conducción, auricular o ven-tricular. (6) Las zonas contráctiles mantienen su acti-vidad por largos períodos y algunas zonas se mantu-vieron por 60 días sin que se observaran cambios. Además,lafrecuenciadecontracciónsemantienepordías sucesivos sin alteraciones. Por último, se en-contraron diferencias en la propensión a formar zo-nas contráctiles entre las distintas líneas celulares. Así, los cuerpos embrioides de las células H5 pre-sentaron zonas contráctiles en el 10% de los casos,las H9 en el 5% y las H16 y las S351 en el 0,5%.Estas diferencias se informaron recientemente y po-drían deberse a diferencias epigenéticas entre las lí-neas utilizadas. (7)
Tabla 1.
Primers
(cebadores)utilizados en RT-PCR
Directa: 5-a-3Inversa: 5-a-3
Oct-4 CTGGGTTGATCCTCGGACCT CACAGAACTCATACGGCGGGNANOG AAAGAATCTTCACCTATGCC GAAGGAAGAGGAGAGACAGTGATA-4 CATCAAGACGGAGCCTGGCC TGACTGTCGGCCAAGACCAGNkx2.5 CCCACGCCCTTCTCAGTCAA GTAGGCCTCTGGCTTGAAGGTroponina T cardíaca ATGATGCATTTTGGGGGTTA CAGCACCTTCCTCCTCTCAG
α
-MHC ACCCAAGTTCGACAAAATCG TAAGGGTTGACGGTGACACAKDR TGATCGGAAATGACACTGGA CACGACTCCATGTTGGTCAC
α
-fetoproteína TGCTGGATTGTCTGCAGGATG ACGTTCCAGCGTGGTCAGTTTPAX-6 CTAATGGGCCAGTGAGGAG TACTCACACATCCGTTGGACACIsl-1 CACAAGCGTCTCGGGATTGTGTTT AGTGGCAAGTCTTCCGACAA
β
-actina CAATGTGGCCGAGGACTTTG CATTCTCCTTAGAGAGAAGTGG

You're Reading a Free Preview

Download
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->