Welcome to Scribd. Sign in or start your free trial to enjoy unlimited e-books, audiobooks & documents.Find out more
Download
Standard view
Full view
of .
Look up keyword
Like this
1Activity
0 of .
Results for:
No results containing your search query
P. 1
Dietary Iron Enhances Colonic Inflammation and IL-6IL-11-Stat3 Signaling Promoting Colonic Tumor Development

Dietary Iron Enhances Colonic Inflammation and IL-6IL-11-Stat3 Signaling Promoting Colonic Tumor Development

Ratings: (0)|Views: 9|Likes:
Published by Crohn_Global

More info:

Published by: Crohn_Global on Nov 15, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

11/23/2014

pdf

text

original

 
Dietary Iron Enhances Colonic Inflammation andIL-6/IL-11-Stat3 Signaling Promoting Colonic TumorDevelopment in Mice
Anita C. G. Chua
1,2
*
.
, Borut R. S. Klopcic
1,3
.
, Desiree S. Ho
1,2
, S. Kristine Fu
1,3
, Cynthia H. Forrest
4,5
,Kevin D. Croft
6
, John K. Olynyk 
7,8,9
, Ian C. Lawrance
1,3
, Debbie Trinder
1,2
1
School of Medicine and Pharmacology, Fremantle Hospital, University of Western Australia, Fremantle, Western Australia, Australia,
 2
Western Australian Institute forMedical Research, Perth, Western Australia, Australia,
 3
Centre for Inflammatory Bowel Diseases, Fremantle Hospital, Fremantle, Western Australia, Australia,
 4
Departmentof Histopathology, PathWest, Fremantle Hospital, Fremantle, Western Australia, Australia,
 5
School of Pathology and Laboratory Medicine, University of Western Australia,Perth, Western Australia, Australia,
 6
School of Medicine and Pharmacology, Royal Perth Hospital, University of Western Australia, Perth, Western Australia, Australia,
7
Department of Gastroenterology, Fremantle Hospital, Fremantle, Western Australia, Australia,
 8
Institute for Immunology and Infectious Diseases, Murdoch University,Murdoch, Western Australia, Australia,
 9
Curtin Health Innovation Research Institute, Curtin University, Perth, Western Australia, Australia
Abstract
Chronic intestinal inflammation and high dietary iron are associated with colorectal cancer development. The role of Stat3activation in iron-induced colonic inflammation and tumorigenesis was investigated in a mouse model of inflammation-associated colorectal cancer. Mice, fed either an iron-supplemented or control diet, were treated with azoxymethane anddextran sodium sulfate (DSS). Intestinal inflammation and tumor development were assessed by endoscopy and histology,gene expression by real-time PCR, Stat3 phosphorylation by immunoblot, cytokines by ELISA and apoptosis by TUNEL assay.Colonic inflammation was more severe in mice fed an iron-supplemented compared with a control diet one week post-DSStreatment, with enhanced colonic IL-6 and IL-11 release and Stat3 phosphorylation. Both IL-6 and ferritin, the iron storageprotein, co-localized with macrophages suggesting iron may act directly on IL-6 producing-macrophages. Iron increasedDSS-induced colonic epithelial cell proliferation and apoptosis consistent with enhanced mucosal damage. DSS-treatedmice developed anemia that was not alleviated by dietary iron supplementation. Six weeks post-DSS treatment, iron-supplemented mice developed more and larger colonic tumors compared with control mice. Intratumoral IL-6 and IL-11expression increased in DSS-treated mice and IL-6, and possibly IL-11, were enhanced by dietary iron. Gene expression of iron importers, divalent metal transporter 1 and transferrin receptor 1, increased and iron exporter, ferroportin, decreased incolonic tumors suggesting increased iron uptake. Dietary iron and colonic inflammation synergistically activated colonic IL-6/IL-11-Stat3 signaling promoting tumorigenesis. Oral iron therapy may be detrimental in inflammatory bowel disease sinceit may exacerbate colonic inflammation and increase colorectal cancer risk.
Citation:
 Chua ACG, Klopcic BRS, Ho DS, Fu SK, Forrest CH, et al. (2013) Dietary Iron Enhances Colonic Inflammation andIL-6/IL-11-Stat3 Signaling Promoting Colonic Tumor Development in Mice. PLoS ONE 8(11): e78850. doi:10.1371/journal.pone.0078850
Editor:
 Hiroyasu Nakano, Juntendo University School of Medicine, Japan
Received
 April 11, 2013;
 Accepted
 September 16, 2013;
 Published
 November 6, 2013
Copyright:
 
 2013 Chua et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding:
 This work was supported by grants from the National Health and Medical Research Council, Australia (NHMRC; APP1007769 to DT, JKO, ACGC, ICL),Cancer Council of Western Australia (to DT, JKO, ICL, ACGC, BRSK), Fremantle Hospital Medical Research Foundation (to ACGC, BRSK, ICL, DSH) and Raine MedicalResearch Foundation (to ACGC). ACGC is a recipient of a Bushell Postdoctoral Fellowship from the Gastroenterological Society of Australia. DT is a recipient of aSenior Research Fellowship (APP1020437) and JKO is a recipient of a Practitioner Fellowship (APP1042370) from NHMRC. The funders had no role in study design,data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests:
 The authors have declared that no competing interests exist.* E-mail: anita.chua@uwa.edu.au
.
 These authors contributed equally to this work.
Introduction
Inflammatory bowel diseases (IBD) are life-long incurableconditions that are increasing in frequency[1] with high morbidityincluding an increased risk for colorectal cancer (CRC).[2] Thesecancers are frequently multiple, flat, histologically high-grade anddifficult to recognize by colonoscopy with poor long-termprognosis. Whilst the pathogenesis of IBD associated-CRC isunclear, chronic inflammation is thought to be a significantcontributor.[3] Intestinal inflammation can result in abdominalpain, intestinal bleeding and diarrhea, and many IBD patientssuffer systemic symptoms of malnutrition and anemia. Anemia isthe most common systemic complication of IBD[4] and irondeficiency is evident in many IBD patients.[5,6]Chronic intestinal inflammation in IBD results in the upregula-tion of pro-inflammatory cytokines causing damage to theintestinal mucosa resulting in recurrent intestinal blood loss andanemia.[7] These cytokines also contribute to anemia of inflam-mation,[7,8] a condition where inflammation causes dysregulationof iron metabolism and inhibition of erythropoiesis. Theinflammatory cytokine interleukin (IL)-6 increases the synthesisof liver hepcidin, a major iron-regulatory hormone central to ironhomeostasis, resulting in reduced duodenal iron absorption andretention of iron in macrophages and hepatocytes promoting ironstorage thus limiting the availability of iron for erythropoiesis.[9]
PLOS ONE | www.plosone.org 1 November 2013 | Volume 8 | Issue 11 | e78850
 
In addition, tumor necrosis factor (TNF), IL-1
b
 and interferon
 c
(IFN
c
 ) impair erythropoiesis by inhibiting erythroid progenitor cellproliferation and erythropoietin synthesis.[8]Oral or parenteral iron supplementation is frequently used totreat anemia in IBD. Although oral iron may be beneficial, it mayinduce oxidative stress contributing to intestinal inflammation andmucosal damage.[10,11] Furthermore, excess iron can promoteoxidative stress-induced carcinogenesis.[12] Numerous populationstudies have suggested that high dietary iron intake and body ironstores increase CRC risk.[13,14] Conversely, iron chelation mayreduce intestinal oxidative stress in IBD patients.[15] Interestingly,a reduction of body iron stores has been associated with lower risksfor numerous human malignancies.[16] The mechanistic linbetween iron, colorectal inflammation and carcinogenesis, how-ever, remains to be elucidated.The aim of this study was to examine the effects of dietary ironon the development of colonic inflammation and tumorigenesis inthe azoxymethane/dextran sodium sulfate (DSS) mouse model of inflammation-induced colorectal cancer. We found that dietaryiron and acute intestinal inflammation synergistically activatedcolonic IL-6/IL-11-Stat3 signaling and promoted tumorigenesis.Increased intratumoral IL-6 and possibly IL-11 expressionsuggested that Stat3 activation may contribute to the developmentof dietary iron induced-colonic tumors. Anemia was also evident,but was not alleviated by dietary iron supplementation. This studyindicates that the practice of using oral iron for the treatment of anemia in IBD should be avoided as it is unlikely to improveanemia, may exacerbate colonic inflammation and increase therisk of CRC.
Materials and Methods
Ethics statement
This study was undertaken in accordance with the recommen-dations of the
 Australian code of practice for the care and use of animals for scientific purposes 
 and was approved by the Animal EthicsCommittee of the University of Western Australia (RA/3/100674 and RA/3/100972). Colonoscopy and all surgicalprocedures were performed under anesthesia.
Mouse model
Female mice (C57BL6; Animal Resources Centre, Murdoch,WA, Australia) were fed, from 4 weeks of age, either a control(0.02% iron) or an iron-supplemented diet (1% carbonyl iron for 6weeks followed by 0.1% iron thereafter). At 8 weeks of age, micewere administered a single dose of azoxymethane (AOM; 7.4 mg/kg body weight ip; Sigma-Aldrich Pty Ltd, Castle Hill, NSW, Australia) followed by dextran sodium sulfate (DSS; 2% w/v; MPBiomedicals, Seven Hills, NSW, Australia) in the drinking waterfor various times using a modified method of Becker et al.[17] Inacute studies, mice were treated with DSS for 3 to 7 days post- AOM injection whilst in long-term studies, mice were adminis-tered 3 cycles of DSS with each cycle consisting of one week onDSS followed by 2 weeks on plain water. Untreated mice wereinjected with isotonic saline and given plain drinking water. Forbrevity, untreated mice fed the iron-supplemented or control irondiet will be referred to as Iron and Control mice, respectively,whilst their AOM/DSS-treated counterparts will be referred to asIron/DSS and Control/DSS mice. At the end of the experiment,blood was collected by cardiac puncture and tissues were perfused
in situ
 with 0.9% sodium chloride before removal. Liver and colonwere snapped frozen in liquid nitrogen for gene and proteinanalyses as well as formalin-fixed for histology or frozen in Tissue-Tek optimal cutting temperature (Sakura Finetek, Alphen aan denRijn, The Netherlands) embedding medium for immunofluores-cence studies.
Hematological parameters
Whole blood (200
 m
L) was collected into Minicollect
H
 tubescoated with tripotassium ethylenediamine tetraacetic acid (GreinerBio-One, Kremsmu¨nster, Austria). Hemoglobin (Hb), hematocrit,mean cell hemoglobin (MCH), mean cell volume (MCV), redblood cell (RBC) count, reticulocyte count and white blood cell(WBC) count were measured using a Cell-Dyn Sapphire analyzer(Abbott Diagnostics, North Ryde, NSW, Australia) at PathWestLaboratories, Fremantle Hospital.
Iron parameters
Plasma transferrin saturation (TS) and liver non-heme ironconcentration were measured as previously described.[18] Coloniciron was detected by histology using enhanced Perls’ Prussian bluestaining according to the method of Brookes et al.[19]
Lipid peroxidation
The lipid peroxidation marker, F
2
-isoprostane, was measured inthe colon by gas chromatography-mass spectrometry using adeuterium-labeled internal standard, as previously described.[20]
Immunofluorescence
Immunofluorescence was performed on cryosections of thecolon fixed in 4% paraformaldehyde in phosphate-bufferedsaline as previously described.[21] Rabbit anti-ferritin (1:500,Dako), biotinylated rat anti-F4/80 (1:50, AbD Serotec, Raleigh,NC), rat anti-IL-6 (1:100, BD Biosciences, North Ryde, NSW, Australia) and rabbit anti-pStat3 (1:50, Santa Cruz Biotechnol-ogy, Santa Cruz, CA) were detected using anti-rabbit/rat AlexaFluor 594 (1:200, Life Technologies, Mulgrave, VIC, Australia),anti-rat Alexa Fluor 488 (1:200, Life Technologies) or strepta- vidin-Alexa Fluor 488 conjugate (1:800, Life Technologies) andmounted with Long Gold antifade reagent containing 4
9
,6-diamidino-2-phenylindole (Life Technologies) for nuclear visualization.Terminal deoxynucleotide transferase dUTP nick end labeling (TUNEL) was performed to detect cellular apoptosis on cryosec-tions of colonic Swiss roll preparations ( 
,
5 cm from anus; rolledfrom distal to proximal end) that had undergone 1% paraformal-dehyde fixation, using the Apopta
H
 Fluorescein Direct In Situ Apoptosis Detection Kit (Merck Millipore, Kilsyth, VIC, Aus-tralia) according to the manufacturer’s instructions. TUNELpositive cells and the number of crypts (detected by 4
9
,6-diamidino-2-phenylindole counterstaining) were determined frommerged pictures of sequentially captured images of eachfluorophore at 20
6
magnification from the entire colonic Swissroll of each mouse. TUNEL positive cells were expressed per 100crypts for each sample.
Colonic inflammation and tumor development
Colonic inflammation and tumor development were monitoredusing a high-resolution mouse video endoscopy. Colonic (proximaland distal) inflammation was assessed using a modified murineendoscopic score of colitis severity (MEICS), examining changes incolonic wall translucency, vascular pattern, presence of fibrin,mucosal granularity and stool consistency.[17] Histological scoring of colonic inflammation (colitis score) using hematoxylin andeosin-stained distal sections of the colon was performed by ahistopathologist blinded to the treatment groups and quantifiedaccording to a modified method of Dieleman et al.[22] The
Iron-Induced Colonic IL-6/IL-11-Stat3 SignalingPLOS ONE | www.plosone.org 2 November 2013 | Volume 8 | Issue 11 | e78850
 
severity and extent of colonic inflammation as well as cryptdamage were assessed. The number and size of colonic tumorswere also determined by colonoscopy with tumor size graded from1 to 5 based on the ratio of tumor coverage of the coloniccircumference as described previously by Becker and col-leagues.[17,23] Tumor score was calculated from the sum of sizeof all tumors in each mouse whilst average tumor size wasdetermined from the division of the tumor score by the number of tumors in each mouse.
RNA expression
Total RNA was isolated from colonic tissue and reverse-transcribed using Superscript III (Life Technologies) as describedpreviously.[24] Gene transcript levels of cytokines, TNF, IFN
c
,IL-6, IL-11 and IL-1
b
, cell cycle regulators, cyclin D1, cyclin B1and c-myc, iron transporters, divalent metal transporter 1 (Dmt1),transferrin receptor 1 (Tfr1) and ferroportin (Fpn), and house-keeping genes, hypoxanthine-guanine phosphoribosyltransferase(Hprt) and acidic ribosomal phosphoprotein PO (Arbp), weremeasured by real-time polymerase chain reaction using aFastSyBR mastermix (Roche Diagnostics, Castle Hill, NSW, Australia). Primer sequences are listed in Table 1. Geneexpression was normalized against Hprt or Arbp mRNAexpression.
Colonic cytokine release
Colonic explants (5 mm sections taken from distal colon) werecultured in serum free RPMI-1640 containing 25 mM HEPES(Life Technologies) for 24 hours at 37
u
C. The incubation mediumwas centrifuged at 20,000 g at 4
u
C and the explant supernatantcollected for cytokine analysis. Colonic IL-6 (R&D Systems Inc.,Minneapolis, MN), IL-11 (Sigma-Aldrich) and IL-1
b
 (R&DSystems) concentrations were measured using enzyme-linkedimmunosorbent assay (ELISA) kits as per manufacturers’ instruc-tions.
Colonic epithelial cell isolation
Whole mouse colons were removed, incised longitudinally andflushed with phosphate buffered saline. The colons were incubatedin isolation buffer containing 2 mM ethylenediamine tetraaceticacid (Sigma-Aldrich), 1 mM ethylene glycol tetraacetic acid(Sigma-Aldrich) and 1% fetal bovine serum (Life Technologies)for 30 min at 37
u
C, with shaking, after which the colons wereremoved and the incubation solution centrifuged at 300 g for15 min at 4
u
C. The supernatant was removed and the resultantcell pellet consisted of the isolated colonic epithelial cells.
Immunoblotting
Protein from distal colonic tissue of mice or isolated colonicepithelial cells was extracted in a lysis buffer [150 mM NaCl,25 mM Tris-HCl (pH7.5) and 0.5% Triton X-100] containing cOmplete protease (Roche Diagnostics) and PhosStop phospha-tase (Roche Diagnostics) inhibitors. Briefly, protein samples(30
 m
g) were separated on 4–12% gradient gels (Life Technologies)by sodium dodecyl sulfate-polyacrylamide gel electrophoresis andelectroblotted onto nitrocellulose membranes (Pall Life Sciences,Somersby, NSW, Australia). Membranes were incubated withphosphorylated signal transducer and activator of transcription 3(pStat3, 1:1000; Cell Signaling Technology Inc, Danvers, MA),total Stat3 (Stat3, 1:1000; Cell Signaling), proliferating cell nuclearantigen (PCNA, 1:100; BD Biosciences) and actin (1:2000; Merck Millipore) at 4
u
C overnight after which they were incubated withthe appropriate secondary antibodies conjugated with horseradishperoxidase (1:2000; Santa Cruz Biotechnology). Protein expressionwas detected using enhanced chemiluminescence and quantifiedby densitometry. Protein expression was normalized against actinexpression.
Statistics
Results are expressed as the mean and SEM, n=3–8.Differences between groups were analyzed using one-way analysisof variance with Tukey’s multiple comparison post-test orunpaired Student’s t-test (GraphPad PRISM, La Jolla, CA).Differences between groups were defined as being statisticallysignificant for
 P 
,
0.05.
Results
Dietary iron increased colonic iron levels and lipidperoxidation
Dietary iron increased iron and ferritin levels in the colon. Ironaccumulated in the epithelium and macrophages in the laminapropria of the colonic mucosa in Iron/DSS and Iron mice at day 3(Fig. 1A). Iron staining was very low or not detected in Controlmice (Fig. 1A). Likewise ferritin, an indicator of iron stores, waslocalized in the colonic epithelium as well as co-localized with F4/80
+
macrophages in the lamina propria of Iron/DSS and Ironmice (Fig. 1B). Ferritin was also detected in colonic epithelial cells
Table 1.
 Mouse primers.
Gene Primer sequences 5
9
-3
9
TNF
 Forward 
 CTGTAGCCCACGTCGTAGC
Reverse
 TTGAGATCCATGCCGTTGIFN
c
 Forward 
 ATCTGGAGGAACTGGCAAAA
Reverse
 TTCAAGACTTCAAAGAGTCTGAGGTAIL-6
 Forward 
 GTATGAACAACGATGATGCACTTG
Reverse
 ATGGTACTCCAGAAGACCAGAGGAIL-11
 Forward 
 CTGCACAGATGAGAGACAAATTCC
Reverse
 GAAGCTGCAAAGATCCCAATGIL-1
b
 Forward 
 GTGGCTGTGGAGAAGCTGTG
Reverse
 GAAGGTCCACGGGAAAGACACCyclin D1
 Forward 
 CCCTGACACCAATCTCCTCAAC
Reverse
 GCATGGATGGCACAATCTCCTCyclin B1
 Forward 
 ACTTCAGCCTGGGTCGCC
Reverse
 ACGTCAACCTCTCCGACTTTAGAc-myc
 Forward 
 TCTCCACTCACCAGCACAACTACG
Reverse
 ATCTGCTTCAGGACCCTDmt1
 Forward 
 TCTATCGCCATCATCCCCACCC
Reverse
 TCCACAGTCCAGGAAAGACAGACCCTfr1
 Forward 
 TTCCTACATCATCTCGCTTAT
Reverse
 CATAGTGTTCATCTCGCCGAFpn
 Forward 
 GTCATCCTCTGCGGAATCATCCTGA
Reverse
 GAGACCCATCCATCTCGGAAAGTGC
Reverse
 CCAGCAAGCTTGCAACCTTAACCAArbp
 Forward 
 ACTGGTCTAGGACCCGAGAAG
Reverse
 TCCCACCTTGTCTCCAGTCTdoi:10.1371/journal.pone.0078850.t001
Iron-Induced Colonic IL-6/IL-11-Stat3 SignalingPLOS ONE | www.plosone.org 3 November 2013 | Volume 8 | Issue 11 | e78850

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->