Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Save to My Library
Look up keyword
Like this
0Activity
0 of .
Results for:
No results containing your search query
P. 1
Searching for the Origin of Gagauzes- Inferences from Y-Chromosome Analysis.pdf

Searching for the Origin of Gagauzes- Inferences from Y-Chromosome Analysis.pdf

Ratings: (0)|Views: 3 |Likes:
Published by Üntaç Güner

More info:

Published by: Üntaç Güner on Dec 01, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/01/2013

pdf

text

original

 
Original Research Article 
Searching for the Origin of Gagauzes: Inferences fromY-Chromosome Analysis
 ALEXANDERVARZARI,
1,2
* VLADIMIR KHARKOV,
3
WOLFGANG STEPHAN,
1
 VALENTIN DERGACHEV,
4
 VALERY PUZYREV,
3
ELISABETH H. WEISS,
1
 AND
 VADIM STEPANOV 
31
 Biocentre, Ludwig-Maximilians University Munich, Munich, Germany
2
 National Centre of Reproductive Health and Medical Genetics, Kishinev, Moldova
3
 Research Institute of Medical Genetics, Russian Academy of Medical Sciences, Tomsk, Russia
4
 Department of Archaeology, Institute of Cultural Patrimony, Academy of Sciences of Moldova, Kishinev, Moldova
 ABSTRACT 
 The Gagauzes are a small Turkish-speaking ethnic group living mostly in southern Moldova and north-eastern Bulgaria. The origin of the Gagauzes is obscure. They may be descendants of the Turkic nomadic tribes fromthe Eurasian steppes, as suggested by the ‘‘Steppe’’ hypothesis, or have a complex Anatolian-steppe origin, as postu-lated by the ‘‘Seljuk’’ or ‘‘Anatolian’’ hypothesis. To distinguish these hypotheses, a sample of 89 Y-chromosomes repre-senting two Gagauz populations from the Republic of Moldova was analyzed for 28 binary and seven STR polymor-phisms. In the gene pool of the Gagauzes a total of 15 Y-haplogroups were identified, the most common being I-P37(20.2%), R-M17 (19.1%), G-M201 (13.5%), R-M269 (12.4%), and E-M78 (11.1%). The present Gagauz populations werecompared with other Balkan, Anatolian, and Central Asian populations by means of genetic distances, nonmetric multi-dimentional scaling and analyses of molecular variance. The analyses showed that Gagauzes belong to the Balkan pop-ulations, suggesting that the Gagauz language represents a case of language replacement in southeastern Europe.Interestingly, the detailed study of microsatellite haplotypes revealed some sharing between the Gagauz and Turkishlineages, providing some support of the hypothesis of the ‘‘Seljuk origin’’ of the Gagauzes. The faster evolving micro-satellite loci showed that the two Gagauz samples investigated do not represent a homogeneous group. This findingmatches the cultural and linguistic heterogeneity of the Gagauzes well, suggesting a crucial role of social factors inshaping the Gagauz Y-chromosome pool and possibly also of effects of genetic drift. Am. J. Hum. Biol. 00:000–000,2009.
 '
2008 Wiley-Liss, Inc.
The Gagauzes are a small Turkish-speaking ethnicgroup living mostly in southern Bessarabia (MoldovaRepublic, southwestern Ukraine) and southern Dobruja(northeastern Bulgaria, southeastern Romania). TheGagauzes speak the Oghuz version of the Turkic lan-guages, which also includes the Azeri, Turkish, and Turk-meni languages. The Gagauz language is particularlyclose to the Balkan Turkish dialects spoken in Greece,northeastern Bulgaria, and in the Kumanovo and Bitolaareas of Macedonia. The Balkan Turkic languages, includ-ing Gagauz, are a typologically interesting case, becausethey are closely related to Turkish and at the same timecontaina North-Turkic (Tartar or Kypchak)element besidesthe main South-Turkic (Oghuz) element (Pokrovskaya,1964). The modern Gagauz language has two dialects: cen-tral (or ‘‘Bulgar’’) and southern (or maritime) (Pokrovskaya,1964; Gordon, 2005). It is also important to mention thatthe Gagauzes are Orthodox Christians, whereas most of theTurkic groups mentioned above are Muslims.It is historically documented that the Gagauzesmigrated to Bessarabia from northeastern Bulgaria(Dobruja) in the beginning of the 19th century fleeingfrom political and religious oppression by the OttomanTurks. However, very little is known about their previoushistory. Several hypotheses about the ethnogenesis of theGagauzes have been proposed (Pokrovskaya, 1964; Gubo-glo, 1967). Two of them seem to be most popular amongthe ethnologists and linguists. One theory considers theGagauzes as descendants of the Turkic nomadic tribesfrom the South Russian steppe (Bulgars, Cumans, Peche-negs, or Torks, etc.). According to the other, the Gagauzesdescend from the Seljuk Turks that settled in northeast-ern Bulgaria in the second half of the 13th century, and to-gether with some Turkic tribes from South-Russiansteppes they founded a Turkic state there. The militarypower of the Balkan Turks was used by the ByzantineEmpire, because the Turkic hordes ensured its protectionagainst the Slavs (Bulgarians). Having settled in the Bal-kans the Turkic clans had been converted to OrthodoxChristianity before this area was conquered by the Otto-man Turks, i.e., before the 15th century.The distribution of genetic variation within and amongpopulations has long been used to gain insight into the
 Additional Supporting Information may be found in the online version of this article.Contract grant sponsor: DFG; Contract grant number: Ste 325/7; Con-tract grant sponsor: Russian Federation for Basic Research; Contractgrant numbers: 03-04-4902, 06-04-48274; Contract grant sponsor: Presi-dent of the Russian Federation; Contract grant number: MD-840.2003.04;Contract grant sponsors: FCI, DAAD.*Correspondence to: Alexander Varzari, National Centre of ReproductiveHealth and Medical Genetics, Burebista str. 82, 2062 Kishinev, Moldova.E-mail: a_varsahr@yahoo.comReceived 24 July 2008; Revision received 23 October 2008; Accepted 11November 2008DOI 10.1002/ajhb.20863Published online in Wiley InterScience (www.interscience.wiley.com).
 AMERICAN JOURNAL OF HUMAN BIOLOGY 00:000–000 (2009)
V
V
C
2008 Wiley-Liss, Inc.
 
demographic history of humans. The previous genetic stud-ies in the Dniester-Carpathian region based on classicaland autosomal DNA markers showed closer affinities of the Gagauzes to their geographical neighbors from South-east Europe than to other Turkic populations (Varsahret al., 2001, 2003; Varzari et al., 2007). A recent analysisof mtDNA and Y-chromosome variation in one Moldavianand one Gagauz population has confirmed similaritiesbetween the Gagauzes and their geographical neighbors(Nasidze et al., 2007). The authors of the article suggestthat the Gagauzes gained their genetic similarity withMoldavians as a result of extensive gene exchangebetween them after the Gagauzes migrated from Turkeyto Moldavia two hundred years ago and were converted toOrthodox Christianity. However, this conclusion disagreeswith the historical and linguistic data; it was based on asmall set of binary markers and a relatively small samplesize (50 individuals), and did not take into account thedegree of substructuring of the Gagauz population.In the present study we have further characterized thegenetic structure of the Gagauzes, using a comprehensive Y-chromosome analysis of two Gagauz populations fromsouthern Moldavia that speak different dialects, and havecompared them with the populations from the Balkans, Anatolia and Central Asia that have had a great historicalinfluence on the Gagauzes. Analysis of Y-chromosome var-iation is particularly useful in studies of the Gagauz ori-gins because invasions were primarily carried out bymales and, therefore, one might expect the Gagauz malepool to retain some trace of the invaders.
MATERIALS AND METHODS
Samples and DNA extraction
 A total of 89 unrelated male samples were collected fromtwo Gagauz locations: the Kongaz settlement,
 N 
5
48, andthe Etulia settlement,
 N 
5
41 (see Fig. 1). Informed consentwas obtained from all participants in this study, and infor-mation about geographic and ethnic origins of their parentsand grandparents was recorded. DNA was extracted fromperipheral blood lymphocytes by a salt-based extractionmethod (Miller et al., 1988) or by using the Amershamgenomic DNA extraction reagentsand protocols.
Y-chromosome polymorphisms
The Y-chromosomal haplotype composition and struc-ture was examined using two genetic marker systemsfrom the nonrecombining portion of the Y-chromosome: bi-nary markers, mostly represented by SNPs, and multial-lelic, highly variable microsatellites (STRs).
Binary markers.
 Y-chromosome haplogroups were definedby the analysis of 28 binary markers. 23 markers weretyped according to previous reports, namely YAP[DYS287] (Hammer and Horai, 1995), 12f2 [DYS11](Rosser et al., 2000), M17 and M89 (Kharkov et al., 2004),92R7 (Mathias et al., 1994), Tat [M46] (Zerjal et al., 1997),M9 (Hurles et al., 1998), M70 and M223 (Kharkov et al.,2007), M78 (Flores et al., 2003; Underhill et al., 2001),M123 (Flores et al., 2003), P25 and P37 (Kharkov et al.,2005), M130, M172, M178, M201, M207, M242, and M269(Underhill et al., 2001; Kharkov et al., 2005), M253 (Chin-niog˘lu et al., 2004; Kharkov et al., 2007), and SRY-2627(Hurles et al., 1999). M170 was typed by sequencing fromthe forward primer (Underhill et al., 2001). In addition,we genotyped five polymorphisms reported previously,namely M12, M47, M67, and M92 (Underhill et al., 2001),and M267 (Cinniog˘lu et al., 2004). Primer sequences foreach of these five markers were used as previouslydescribed, or were designed by introducing a mismatchedbase to produce a variable restriction site on the amplifica-tion products (Table 1). The samples were examined in ahierarchical way, in agreement with the Y-chromosome
Fig. 1.
 A map of the geographic location of the Gagauz populations. The Gagauz inhabited areas are shaded.
2
 A. VARZARI
 American Journal of Human Biology
 
haplogroup tree (Karafet et al., 2008). The genealogicalrelationship of the haplogroups (defined by the markers)is shown in Figure 2. M9 was chosen as the initial markerand surveyed in all samples.
Microsatellite markers.
 The following seven Y-specificmicrosatellites were analyzed:
 DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392
, and
 DYS393
.These markers form the so-called minimal haplotype (deKnijff et al., 1997) and are the most comprehensively stud-ied Y-STR set in different world populations. All loci werePCR-amplified using primers and conditions describedelsewhere (de Knijf et al., 1997; Kayser et al., 1997). Theforward primers were labeled with TET (green) for
 DYS390
 and
 DYS391
, FAM (blue) for
 DYS392
 and
 DYS393
, and HEX (yellow) for
 DYS19, DYS389I,
 and
 DYS389II 
. The amplification products were then pooledtogether and run on an ABI Prism 310 sequencer (AppliedBiosystems) using GeneScan500-TAMRA (red) as the in-ternal standard. Gene Scan Analysis Software v.3.7(Applied Biosystems) was used to analyze fragment sizes.The alleles were named according to the number of repeatunits they contain. The number of repeat units was estab-lished through the use of sequenced reference DNA sam-ples as suggested by de Knijf et al., (1997). Allele lengthfor
 DYS389b
 was obtained by subtraction of the
 DYS389I 
allele length from that of 
 DYS389II 
.
Statistical analysis
The software package Arlequin 2.000 (Schneider et al.,2000) was used to calculate several population genetic pa-rameters, including diversity of haplogroups and haplo-types, exact tests of population differentiation, as well aspairwise
 
ST
 (for haplogroup) and
 R
ST
 (for haplotype) val-ues. The significance of these statistics was examined with10,000 permutations.
 
ST
 and
 R
ST
 distances among com-pared populations were represented in two dimensions withmultidimensional scaling (MDS), using the STATISTICA 5.5 software package (StatSoft, Inc 1995). Arlequin was alsoused to perform analyses of molecular variance (AMOVA) of the SNP and STR data. Network analysis of the STR datawas carried out with the software package NETWORK ver-sion 4.2.0.1 (http://www.fluxus-technology.com). Networkswere calculated by the median-joining method (
g5
0) afterhaving processed the data with the reduced median method(Bandelt et al., 1999). To score different mutation ratesupon the networks construction, each STR locus wasweighted in accordance with the values estimated previ-ously (Kayser et al., 2000).
RESULTS
Y-chromosome lineages in the Gagauzes
Haplogroup frequencies in the Gagauz samples and inthe pooled sample are reported in Table 2. A total of 23 of 
TABLE 1.
 PCR-RFLP protocols developed for five binary markers
Marker Primers used (5
0
-3
0
)
 
a
Size
b
Digestion Fragment/s (allele)
c
M12 F: ACTAAAACACCATTAGAAACAAAGG 62 309
 Hin
fI 23/67/219 (G)
?
90/219 (T)R: CTGAGCAACATAGTGACCCGAAT
d
M47 F: AGATCATCCCAAAACAATCATAA 61 430
 Eco
RI 35/395 (G)
?
430 (A)R: GAAATCAATCCAATCTGTAAATTTTATGTAGAATTM67 F: CCATATTCTTTATACTTTCTACCTGC 60 409
 Ssp
I 379/30 (A)
?
409 (T)R: GTCTTTTCACTTGTTCGTGGACCCCTCAATATM92 F: TTGAATTTCCCAGAATTTTGC 61 470
 Bst
SNI 470 (T)
?
340/130 (C)R: TTCAGAAACTGGTTTTGTGTCCM267 F: TTATCCTGAGCCGTTGTCCCTG 60 183
 Bst
SNI 150/33 (T)
?
183 (G)R: CTAGATTGTGTTCTTCCACACAAAATACTGTACGT
d
F refers to the forward primer, and R refers to the reverse primer for a particular locus.
a
PCR annealing temperature in C
8
.
b
PCR product size in base pairs.
c
RFLP fragments in base pairs.
d
Mismatched primer (mismatched bases are underlined).
Fig. 2.
 Maximum parsimony phylogeny of the haplogroups definedby the 28 binary markers used in this study. The names of hap-logroups are according to Karafet et al., (2008).
3
Y-CHROMOSOME ANALYSIS IN GAGAUZES
 American Journal of Human Biology

You're Reading a Free Preview

Download
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->