Genet Resour Crop Evol
DOI 10.1007/s10722-014-0128-z
RESEARCH ARTICLE
A comparative study of ancient DNA isolated from charred
pea (Pisum sativum L.) seeds from an Early Iron Age
settlement in southeast Serbia: inference for pea
domestication
Petr Smýkal • Živko Jovanović • Nemanja Stanisavljević
Bojan Zlatković • Branko Ćupina • Vuk Ðord̄ević •
Aleksandar Mikić • Aleksandar Medović
Received: 5 November 2013 / Accepted: 2 May 2014
Ó Springer Science+Business Media Dordrecht 2014
Abstract The development of agriculture was a key
turning point in human history, a central part of which
was the evolution of new plant forms, domesticated
crops. Grain legumes were domesticated in parallel
with cereals and formed important dietary components
of early civilizations. First domesticated in the Near
East, pea has been cultivated in Europe since the Stone
and Bronze Ages. In this study, we present a molecular
analysis of ancient DNA (aDNA) extracted from
carbonized pea seeds recovered from deposits at
Hissar, in southeast Serbia, that date to the eleventh
century B.C. Four selected chloroplast DNA loci
(trnSG, trnK, matK and rbcL) amplified in six
fragments of 128–340 bp with a total length of
Electronic supplementary material The online version of
this article (doi:10.1007/s10722-014-0128-z) contains supple-
mentary material, which is available to authorized users.
P. Smýkal (&)
Department of Botany, Faculty of Science, Palacký
University in Olomouc, Šlechtitelů 11, 783 71 Olomouc,
Czech Republic
e-mail: petr.smykal@upol.cz
Ž. Jovanović
N. Stanisavljević
Plant Molecular Biology Lab, Institute of Molecular
Genetics and Genetic Engineering, University of
Belgrade, P.O. Box 23, 11010 Belgrade, Serbia
B. Zlatković
Department of Biology and Ecology, Faculty of Sciences
and Mathematics, University of Niš, Višegradska 33,
18000 Niš, Serbia
•
1,329 bp were successfully recovered in order to
distinguish between cultivated and wild gathered pea.
Based on identified mutations, the results showed that
genuine aDNA was analyzed. Moreover, DNA ana-
lysis resulted in placing the ancient sample at an
intermediate position between extant cultivated [Pi-
sum sativum L. and wild P. sativum subsp. elatius
(Steven ex M. Bieb.) Asch. et Graebn.]. Consequently,
based on a combination of morphological and molec-
ular data, we concluded that the material represents an
early domesticated pea. We speculate that Iron Age
pea would be of colored flower and pigmented testa,
similar to today’s fodder pea (P. sativum subsp.
sativum var. arvense (L.) Poir.), possibly of winter
type. This is the first report of successful aDNA
extraction and analysis from any legume species thus
far. The implications for pea domestication are
discussed here.
B. Ćupina
Department of Field and Vegetable Crops, Faculty of
Agriculture, University of Novi Sad, Trg Dositeja
Obradovića 8, 21000 Novi Sad, Serbia
V. Ðord̄ević
A. Mikić
Institute of Field and Vegetable Crops, Maksima Gorkog
30, 21000 Novi Sad, Serbia
A. Medović
Museum of Vojvodina, Dunavska 35, 21000 Novi Sad,
Serbia
123

Keywords Ancient DNA
Archeogenetics

Domestication
Early Iron Age
Legumes

Pea
Introduction
The development of agriculture was a key turning
point in human history, a central part of which was the
evolution of new plant forms, domesticated crops.
Domestication occurs when cultivated plants consis-
tently exhibit morphological (and genetic) changes not
found in wild populations (Abbo et al. 2013, 2014).
These resulting changes represent adaptations to
cultivation and human harvesting. Common sets of
traits have been recorded in unrelated crops, which are
said to display domestication syndrome (Hammer
1984; Zohary and Hopf 2000). Similar human
demands led to similar adaptations of many domes-
tication traits over a wide range of plant species,
thereby providing numerous examples of convergent
phenotypic evolution (Lenser and Theißen 2013).
These include two key traits: (1) loss of germination
inhibition (dormancy) and (2) loss of seed dispersal.
Members of the Fabaceae were domesticated as
grain legumes in parallel with cereals and formed
important dietary components of early civilizations
(De Candolle 1884; Vavilov 1951; Hopf 1986; Smartt
1990; Zohary and Hopf 2000; Abbo et al. 2014).
Among the first legumes domesticated in the Fertile
Crescent were members of the galegoid tribe: pea,
faba bean, lentil, grass pea and chickpea (Smýkal et al.
2014). Archaeological evidence of pea in the Near
East dates from 10,000 years before present (B.P.)
(Baldev 1988; Zohary and Hopf 2000; Helbaek 1964,
1970; Fairbairn et al. 2002, 2005; Willcox et al. 2008)
and suggests that the domestication of grain legumes
accompanied or possibly preceded that of cereals
(Baldev 1988; Kislev and Bar-Yosef 1988; Weiss et al.
2006). Rich etymological evidence also supports the
status of pea as one of the most ancient Eurasian crops
(Mikić 2012). Later on, cultivation of pea spread from
the Fertile Crescent to southern Europe, where it has
been cultivated since the Stone and Bronze Ages
(Zohary and Hopf 2000), and westward through the
Balkans (Kroll 1991; Borojević 2006) to northern and
western Europe. Pea cultivation also moved south-
ward to Egypt and modern-day Sudan (7,000 years
B.P.), eastward to Persia and India (4,000 years B.P.),
123
Genet Resour Crop Evol
and to China (Makesheva 1979; Chimwamurombe and
Khulbe 2011; Zohary and Hopf 2000; Hancock 2012).
Despite of the crucial position of legumes as protein
crops in the human diet, comparably little is known
about their domestication. The removal of seed dor-
mancy was by far the most important domestication
trait in legumes (Ladizinsky 1985; Abbo et al. 2013,
2014). In the wild, many seeds exhibit dormancy and
will only germinate after exposure to certain environ-
mental conditions or after the seed coat has been
physically damaged. In contrast, seeds produced by
domesticated crops tend to germinate as soon as they
are imbibed and planted; meaning seed dormancy was a
potentially unwanted trait. Moreover, seed imbibition
plays a crucial role in the ability to cook most grain
legumes; it is often called hard-seededness due to the
testa’s resistance to water permeability. Hence, reduc-
ing seed coat thickness led to a concurrent reduction of
seed coat impermeability in all domesticated grain
legumes (Werker et al. 1979; Smartt 1990; Weeden
2007). Seed dormancy was identified as a monogenic
trait in lentil (Lens culinaris Medik., Ladizinsky 1985),
lupine (Lupinus angustifolius L., Forbes and Wells
1968), yardlong (Vigna unguiculata (L.) Walp., Kon-
gjaimun et al. 2012), rice bean (V. umbellata (Thunb.)
Ohwi and Ohashi, Isemura et al. 2010), mungbean (V.
radiata (L.) R. Wilczek, Isemura et al. 2012); associ-
ated with one to two loci in common bean (Phaseolus
vulgaris L., Koinange et al. 1996); and with two to three
loci in pea (Pisum sativum L., Weeden 2007).
Ladizinsky (1987) argued that the low germination
rates in wild pulses, particularly Lens, would have
precluded successful cultivation due to their very low
yields from planted seeds. He therefore suggested that
hunter–gatherers must have recognized favorable wild
mutants with quick germination from which to begin
cultivation. That germplasm could have been part of a
‘pre-cultivation domestication’ process. Therefore,
only after the seed dormancy-free mutation occurred
could lentils be cultivated (Ladizinsky 1979; Weiss
et al. 2006). The experimental harvest of wild lentils by
Abbo et al. (2008) provided strong support for Ladi-
zinsky’s (1979, 1985, 1987, 1998) arguments. This also
holds true for pea, as intact wild pea seeds have a
germination rate of only 2.6–7 % in a given year (Abbo
et al. 2011, 2014). These results suggest that the free
germination trait was a more important criterion for the
adoption of a wild pea, lentil and possibly chickpea than
their seed dispersal mode.
Genet Resour Crop Evol
The second crucial domestication trait relates to the
loss of fruit shattering, which has been under selection
in most seed crops and resulted in better seed harvesting
(Purugganan and Fuller 2009, Erskine 1985), whereas,
shattering in wild plants is a fundamental trait to assure
seed dispersal. The evolution of non-shattering would
have occurred as a result of particular methods of
harvesting that favored non-shattering mutants in
harvested populations, which were then sown. Seed
dispersal in wild legumes normally occurs via pod
dehiscence. Central to the ballistic mechanisms of seed
dispersal in pea is the dehiscent pod (single carpel fused
along its edges), where the central pod suture undergoes
an explosive rupturing along a dehiscence zone
(Ambrose and Ellis 2008).
Orthologous genes for seed shattering mechanisms
and functions were identified to be purposefully
conserved in mono and dicotyledonous plants (Koni-
shi et al. 2006; Lenser and Theißen 2013) but not yet in
legumes. Ladizinsky (1985) found that two different
monogenic systems operated in crosses of Lens
orientalis (Boiss.) Schmalh. and L. ervoides (Brign.)
Grande, to cultivated lentil L. culinaris Medic. In the
former, the allele for dormancy was dominant, while
in the latter it was recessive. Moreover, the gene for
dormancy in L. orientalis Popow appeared to be linked
to one controlling pod shattering. The concurrent
increase in the seed size of domesticates compared to
that of their wild relatives is seen in almost all grains
and even in forage legumes, and it has been suggested
that this resulted from greater planting depth in
agricultural systems leading to the selection of larger
seeds that produced more vigorous seedlings, although
this was recently refuted by Kluyver et al. (2013).
Experimental in which wild peas and lentil were
grown have demonstrated that both seed dormancy
and pod dehiscence cause poor crop establishment via
reduced germination, as well as dramatic yield losses
via seed shattering (Abbo et al. 2011). These results
were inconsistent with models suggesting the pro-
tracted domestication of Near Eastern grain legumes
(Abbo et al. 2013).
The genus Pisum contains the wild species P.
fulvum Sibth. & Sm. found in Jordan, Syria, Lebanon
and Israel; the cultivated species P. abyssinicum A.
Braun from Yemen and Ethiopia, possibly indepen-
dently domesticated of P. sativum; and a large
aggregate of both wild [P. sativum L. subsp. elatius
(Steven ex M. Bieb.) Asch. et Graebn.] and cultivated
forms of P. sativum subsp. sativum L. (Jing et al. 2010;
Smýkal et al. 2011, 2013, 2014; Ellis 2011). The
current range of wild representatives of P. sativum
extends from Iran and Turkmenistan through Anterior
Asia, northern Africa, the Mediterranean region and
southern Europe (Vavilov 1951; Makasheva 1979;
Maxted and Ambrose 2001; Smýkal et al. 2011, 2013,
2014). However, due to the early cultivation of pea, it
is difficult to identify the precise location of the center
of its diversity, especially considering that the large
parts of the Mediterranean region and Near East have
been substantially modified by human activities and
changing climatic conditions since that time. Domes-
ticated pea is thought to have originated from wild P.
sativum subsp. elatius var. pumilio Meikle [formerly
P. humile Mill. (P. syriacum (A. Berger) C. O. Lehm.]
(Ben-Zéev and Zohary 1973; Ambrose 1995; Jing
et al. 2010; Smýkal et al. 2011), native to herbaceous
formations in the open forest and in steppe habitats of
the eastern Mediterranean. Together with faba bean,
pea is the only legume species with robust growth
(Zohary and Hopf 2000). However, when encountered
in the wild, stands are extremely thin, comprising only
few individuals (Abbo et al. 2013; Zlatković et al.
2010).
Archeobotanical remains of legumes consist of
charred seeds; therefore, in the absence of the remains
of pods, pod indehiscence and seed dormancy are
invisible (Abbo et al. 2014). However, the survival of
fragmentary DNA in archaeological tissue has been
recognized, and the first successful extraction of
ancient DNA (aDNA) occurred nearly 30 years ago
(Higuchi et al. 1984). To recognize the historical
origin, the term aDNA was introduced, which denotes
nucleic acid isolated from ancient specimens of plants,
animals and humans (reviewed in Schlumbaum et al.
2008). aDNA was used in numerous studies devoted to
the domestication of animals, including the origin of
humans, and, to a lesser extent, to the analysis of plant
material (Jones and Brown 2000). The aDNA has been
recovered from charred wheat grains from dating to
the Iron Age (Allaby et al. 1994), Neolithic dwellings
(Schlumbaum et al. 2008), desiccated Egyptian barley
(Palmer et al. 2009) or olive stones (Elbaum et al.
2006) to name a few. One of the main reasons such
studies tend to disproportionately focus on animals is
that while DNA in bones is relatively well preserved, it
is less so in plant material, which is more prone to
decay, with the exception of seeds.
123

Until now, crop domestication and plant archaeo-
logical studies focused largely on cereals, both due to
the abundance of material and genetic information
available (reviewed in Hancock 2012). Although
genes underlying domestication traits in legumes have
not yet been identified, the analysis of plastid-encoded
genes can lead to inference on origin of plant material.
In this study, we present an analysis of chloroplast
encoded aDNA fragments to elucidate the identity of
charred pea seeds from the Early Iron Age in
comparison to modern cultivated and wild peas. This
is the first report of successful aDNA analysis of any
legume.
Materials and methods
Archeobotany
The fortified hill fort settlement Hissar in Leskovac
is a multilevel settlement of the Brnjica cultural
group, 1350–1000 B.C., Iron Age I in the Morava
valley at southern Serbia (Stojić et al. 2007). The
earliest occupation at Hissar is believed to have been
by Neolithic cultures, Starčevo and Vinča. Moreover,
Hissar was continuously inhabited throughout Eneo-
lithic, Bronze Age, Iron Age, Roman, Byzantine,
Serbian medieval and Turkish periods, the providing
thus a continuous record of over 3,000 years of
human activities. The hill (341 m alt.) is in a
strategic position at a crossroads along the Jablanica
and Veternica river valleys and along the Morava
river valley. The site is very important for the precise
chronological determination of the transitional period
from the Bronze to the Iron Age. In addition to
classical archaeological remains, the site has been
sampled for plant remains since 1999 (Medović
2005, 2012; Medović et al. 2011). In 2005, a rich
charred seed sample was gathered from a storage pit
of the Brnjica II a-level (eleventh century B.C.). The
volume of the subjectively taken sample was 7 liters.
Earth substrate was packed in the plastic bag and
transported to the Museum of Vojvodina, Novi Sad,
Serbia. The flotation took place in 2006. The sieve
with mesh size of 0.25 mm was used for the hand
flotation. The sample was dried in shade and then
packed in a paper bag. The dried, charred material
weighed 121 g. The identification work was done in
2006 (Medović et al. 2011).
123
Genet Resour Crop Evol
Ancient DNA extraction
Protocols for aDNA analysis were strictly followed
(Gilbert et al. 2005). Extraction was carried out in
dedicated laboratory, which had not been used previ-
ously to extract DNA from modern pea samples,
physically isolated from PCR set up and post PCR
analyses (in separate institutes). Extraction and ampli-
fication blanks were carried out in parallel, with each
sample extraction and PCR analysis to ensure authen-
ticity. All equipment was thoroughly cleaned with
70 % ethanol and DNA away solution (Molecular
Bioproducts, UK) before processing to reduce the risk
of contamination. The whole laboratory area, includ-
ing PCR setup boxes and equipment, was UV irradi-
ated before use. PCR setup was done in a forensic
laboratory, in which modern plant material had never
been analyzed. Protective clothing and gloves were
worn at all times, and rigorous cleaning procedures
were carried out (treatment with bleach, UV-irradia-
tion), including the use of sterile tips with filter
(Neptune, Schoeller) and dedicated chemicals and
instruments. Two independent extractions of DNA
from ancient material (500 mg, e.g. about 250 of
charred seeds) were performed using a modified
cetyltrimethylammonium bromide (CTAB) protocol
(Doyle and Doyle 1987). Seeds were ground to fine
powder in liquid nitrogen, with mortar and pestle, all
UV treated and not used previously for any pea
analysis. The powder was transferred to a 2 ml tube
with preheated (65 °C) extraction buffer (2 % CTAB,
0.1 M Tris–HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl
and 1 % PVPP) and mixed thoroughly. The mixture
was incubated for 3 days at 35 °C with agitation. After
incubation, the mixture was centrifuged at 14,000 rpm
for 10 min. The supernatant was removed, placed in a
new tube and mixed with 500 ll of chloroform:
isoamyl alcohol (24:1). Two phases were separated by
centrifuging for 5 min at 14,000 rpm. The top layer
was transferred into a new tube and centrifuged for
10 min at 14,000 rpm. The supernatant was trans-
ferred into a new tube and mixed with five volumes of
AP3/E buffer (DNAeasy Mini Plant Kit, QIAGEN).
The mixture was incubated at room temperature
overnight. After incubation, the mixture was applied
to Qiagen mini-spin column and processed according
to the manufacturer’s protocol. Elution was performed
with 100 ll of AE buffer, allowed to stand for more
than 1 h, and DNA was recovered by centrifuging at
Genet Resour Crop Evol
8,000 rpm for 1 min. Isolated DNA was quantified by
NanoVue Spectrophotometer (GE Healthcare).
Modern cultivated and wild pea material
Several pea samples were included as comparative
controls for sequencing analysis, namely wild col-
lected [P. sativum subsp. elatius (Steven ex M. Bieb.)
Asch. et Graebn.], from John Innes Centre, UK pea
germplasm (JI1794, JI3147, 3155); specimens from
the valley of the river Pčinja in far southeastern Serbia,
near the Bulgarian and Macedonian borders (Zlatk-
ović et al. 2010); and one sample of P. abyssinicum
A.Br. (JI1974), P. fulvum Sibth. et Sm. (JI1006), and
cultivated (L0100001, L0100530) P. sativum subsp.
sativum var. sativum L. or fodder pea (L0200201,
L0200206) P.s.s. var. arvense (L.) Poir. accessions
(Smýkal et al. 2008, 2011). These accessions were
purposely selected from a larger, ongoing biosyste-
matics study of the Pisum genus (Smýkal et al. 2011)
to represent diverse haplotypes. DNA was extracted
from young seedlings by DNAeasy Mini Plant Kit
(QIAGEN, Germany) in accordance with the manu-
facturer’s instructions.
PCR amplification and sequencing analysis
Four genetic loci of chloroplast DNA were analyzed to
capture informative single nucleotide polymorphic
(SNP) sites. To assure amplification from fragmented
aDNA, several short fragments of trnS(GCU)–
trnG(UCC) intergenic spacer, tRNA-Lys (trnK)—ma-
turase K (matK), ribulose-1,5-bisphosphate carboxyl-
ase/oxygenase large subunit (rbcL) partial gene
regions (128–333 bp) were amplified using specific
primers (Generi Biotech, Czech Republic) in 20 ll
PCR reaction (Table 1). In modern pea samples, larger
(537–2,394 bp) fragments of respective genes were
amplified (Table 1). These phylogenetically informa-
tive fragments were selected based on previous
analysis of wild and cultivated pea samples, including
related Vicieae tribe (Lathyrus, Vicia, Lens and
Vavilovia) species (Kenicer et al. 2005; Smýkal
et al. 2011, unpublished; Schaefer et al. 2012; Mikić
et al. 2013). Each reaction consisted of 1 unit of Phire
Hot Start II polymerase (Finnzymes, Czech Republic),
19 supplier PCR buffer, 0.25 lM of each dNTP
(Fermentas, Czech Republic), 0.5 lM of forward and
reverse primers and 5 ll (about 5 ng) of aDNA
template. PCR amplifications were run at 2 min
98 °C initial denaturation, followed by 45 cycles of
98 °C for 30 s, 55 or 58 °C for 1 min and 72 °C for
1 min on a Gradient Master Cycler (Eppendorf,
Germany) machine. Two negative controls were
performed and included in each PCR run, one which
contained all necessary PCR components except those
of the template DNA, another with the template input
from the blank extraction procedure. In separate
reactions at a different institute, PCR amplification
of extant pea material was performed, with amplifica-
tion of entire fragments of respective genes. PCR
products were subjected to 1.5 % NuSieve agarose gel
electrophoresis in 19 TAE buffer, stained with
ethidium bromide and visualized by UV light. Frag-
ments of respective sizes were excised and purified
using Invisorb Fragment CleanUp kit (Invitek, Ger-
many). Finally, fragments were either directly
sequenced or cloned into pJET 2.1 (Fermentas, Czech
Republic) vector. Six clones per sample were
sequenced using pJET 2.1 Forward and Reverse
primers and BigDye terminator sequencing kit
(Applied Biosystems, UK) at the DNA sequencing
facility of Charles University, Prague, Czech Repub-
lic. Sequence visualization and editing were per-
formed using Sequence Scanner version 1.0 (Applied
Biosystems) and BioEdit Sequence Alignment Editor
version 7.09.0 (Hall 1999) software. Sequences
obtained from aDNA have been deposited in GenBank
under accession numbers JX677840–JX677844,
JX677866-67, and sequences of extant pea samples
under accession numbers JX677845–JX677862.
BLAST (Altschul et al. 1990) search and CLUSTAL
alignment (Thompson et al. 1994) were performed to
identify homologies. MEGA 5.05 software was used
to compute and construct maximum likelihood (with
Tamura-Nei model) and UPGMA trees using Maxi-
mum Composite Likelihood model (Tamura et al.
2007).
Results and discussion
Morphological analysis of charred pea seeds
The flotation yielded a total of 3,002 charred seeds and
one-seeded fruits (Medović et al. 2011). Small,
rounded, ca. 3–4 mm large pulse seeds comprised
almost 87 % of all charred plant items. Five hundred
123
 Genet Resour Crop Evol

Table 1 Primer sequences, amplified regions and primer annealing temperature (Tm) used for the ancient and extant DNA analysis
cpDNA marker NCBI Forward primer sequence Reverse primer sequence Tm Fragment
accession (°C) length (bp)
number

Ancient DNA
tRNA-Lys (trnK) gene JX677840 matK1L: matK340R: 58 340
ctcaatggtagagtactcggc gtataattagatgtggtaatcattc
Maturase K (matK) gene JX677841 matK760F: matK1050R: 58 333
cgatctagatctcgccaacaggac gaggatttctgcctcctcgaagg
trnS–trnG intergenic spacer JX677842 trnSGF1: trnSG128R: 55 128
caaaaccgaacgtgaaacttttg cattaattgtattcataccgaaagg
trnS–trnG intergenic spacer JX677843 trnSG530F: trnSG758R: 55 253
ribulose-1,5-bisphosphate ggattcttgatccaattgcaaaaac caataatggtattgtagcgggt
Carboxylase/oxygenase (rbcL) JX677844 rbcLF: rbcLR1: 55 275
gene atgtcaccacaaacagagactaaag ccaggaacaggctcgatctcgtagc

Modern pea DNA

Maturase K (matK) gene matK1L: trnK2R: 55 2,394
ctcaatggtagagtactcggc aactagtcggatggagta
trnS–trnG intergenic spacer trnSF: trnGR: 58 1,562
ribulose-1,5-bisphosphate catcgcccttagcttgggcgt ctttagtccactcagccatctctc
Carboxylase/oxygenase (rbcL) rbcLF: rbcLR2: 55 537
gene atgtcaccacaaacagagactaaag gtaaaatcaagtccaccacg

seeds maintained pea-like hilum. The pea sample from
Hissar was fairly free of admixtures of other pulses.
Only 32 seeds of lentil (L. culinaris Medik.), bitter
vetch (Vicia ervilia (L.) Willd.) and faba bean (Vicia
faba L.) were observed and their identity clearly
determined (Medović et al. 2011). There are three
Pisum subspecies or varieties expected to grow in the
area. They differ in the shape and size of their hilum,
although some overlap exists. The hilum of P. s. subsp.
sativum var. arvense (L.) Poir. is ovoid or oval, and is
the smallest among these three subspecies. The hilum
of P. s. subsp. sativum L. makes up 1/14-1/10 of the
seed’s circumference, while the elliptic hilum of P. s.
subsp. elatius (Steven ex M. Bieb.) Asch. et Graebn.,
makes up 1/8-1/6 of the seed’s circumference
(Bojňanský and Fargašová 2007). The ‘‘coffee-bean-
shaped hilum’’ (Kroll 1983) of the Early Iron Age
seeds at Hissar match the description of the second
subspecies listed above, cultivated P. s. subsp. sativum
L. However, the bulk of the pulse seeds in material had
no hilum. Charred pea seeds with preserved hilum
were 3–4 mm long and 2.5–3.8 mm wide. They were
broad ellipsoid (84.38 %) to globose (15.63 %).
Length/Width (L/W) index of broad ellipsoid seeds
was above 1 in 78.13 % cases, and only 6.25 % of
seeds were wider than they were long. The ‘‘naked’’
pea seeds had almost the same values: 2.8–4.5 mm
long, 2.5–4.2 mm wide, broad ellipsoid (85.29 %) and
sometimes globose (14.71 %). Among broad ellipsoid
‘‘naked’’ seeds, L/W-index was above 1 in 75.53 % of
cases and under 1 in 11.76 % of cases. The seeds of
cultivated fodder pea, P. s. var. arvense (L.) Poir., are
also ellipsoid, but mostly globose to angular, while
seeds of wild pea, P. sativum subsp. elatius (Steven ex
M. Bieb.) Asch. et Graebn., are globose (Bojňanský
and Fargašová 2007). Generally, the seed shape of
peas depends on their position and space within a pod
(Kroll 1983); however, this characteristic is not
reliable in charred pea seeds, nor can seed size be
used as a determining factor in distinguishing the three
specimens of pea. In early finds, there was consider-
able overlapping in the dimensions of wild and
domesticated forms (Weiss and Zohary 2011). Con-
sequently, the most reliable morphological indication
of domestication in peas was provided by the surface
of the seed coat (Weeden 2007). Wild peas are
characterized by a rough or granular surface, while
domesticated varieties have smooth seed coats (Hel-
baek 1970; Weiss and Zohary 2011). However, only
few pea seeds at Hissar displayed preserved, intact

123
Genet Resour Crop Evol
smooth-surfaced testa, as the cultivated-type seed coat
was retained in small fragments on less than one fifth
of the recovered seeds. Seed coat was preserved
mostly in the embryonic axis area and occasionally
inside the concavities of the seeds.
Comparative DNA analysis with wild Pisum
species and cultivated pea
The extraction procedure of approximately 250 seeds
(500 mg) yielded 80 and 120 ng of isolated nucleic
acids, as estimated spectrophotometrically. This
amount likely included DNA that had been subject
to microbial and fungal contamination. The extrac-
tions had to be performed from bulk rather than single
seeds, considering the age, damage and presumed
amount of DNA preserved in the sample. The use of
bulk samples is well documented and has been used in
numerous paleogenetic studies (Vahdati Nasab 2010;
Allaby et al. 1994, 1999; Li et al. 2011). Consequently,
we assume that several seeds contributed to the
obtained results. As described in the archaeological
section, seeds have been carefully identified to prevent
admixture of any other legume species. Even so, any
of the amplified DNA fragments were sufficient to
identify the sample with a given species, so we could
exclude any Vicia or Lathyrus sp. We have not been
able to systematically test amplification success or
amplicon length, since only a limited amount of DNA
was available. Three to four independent amplifica-
tions from two independent extractions were per-
formed for each marker, and the results of
amplification success are summarized in Supplemen-
tary Table 1. These indicate that with the increasing
length of amplicon there was a decrease in amplifica-
tion, with failures from 290 bp. This result supports
our assertion that we have analyzed genuine aDNA.
Two regions of 340 and 333 bp lengths were success-
fully amplified from the matK-trnH gene, 128 and
253 bp of trnS-G gene and 275 bp fragment of rbcL
gene, from two extractions, while negative controls
did not yield any detectable product. In order to
authenticate aDNA results, the products of indepen-
dent amplifications from each DNA extraction were
cloned and sequenced. Although we attempted to
amplify selected nuclear encoded gene fragments,
including part of bHLH (Mendels A) gene for pea
flower color (Hellens et al. 2010), the convicilin gene
for seed storage protein (Sáenz de Miera et al. 2008)
and the phylogenetically informative internal tran-
scribed spacer (ITS) of rDNA (Polans and Saars
2002), we failed to amplify any of these regions
irrespective of fragment size. This likely indicates
both extensive DNA degradation of extracted aDNA
and/or minor quantity, which, together with single- or
low-copy number (except of ITS, which is present in
thousands of copies in genomes), prevented successful
PCR amplification. This contrasts the preliminary
study on the same material performed by Jovanović
et al. (2010), which obtained a 26S DNA fragment,
although it was not sequenced. We also commonly
experienced such failures on herbarium vouchers older
than 40–50 years (not shown). This contrasts to results
obtained in cereals (Banerjee and Brown 2002).
Whether this reflects the differences between legumes
and cereals in genome size and ploidy is a question for
further study. Generally, in the case of charred and
aged archaeological material, extensive DNA damage
often prevents single-copy gene amplification.
Selected chloroplast DNA regions are sufficiently
phylogenetically informative (Palmer et al. 1985;
Kosterin and Bogdanova 2008) and more successful in
amplification, likely due to the greater number of
copies and the circular character of the plastid DNA
molecule. There was no difference between the six
sequenced clones from the respective independently
amplified regions in SNP sites. BLAST search and
CLUSTAL alignment confirmed homologies to
expected regions of Pisum. There were five informa-
tive SNPs in trnK, matK sequences, four SNPs in
trnSG, and one SNP in rbcL (Fig. 1, Electronic
Supplementary material S1). There were several
additional substitutions (12 or 14 SNP in trnSG, 1
SNP in trnK, matK, 2 SNPs in rbcL fragment) likely
attributed to damaged DNA or to polymerase errors
(Binladen et al. 2006). Since the majority (12) of these
16 substitutions in 1,329 bp sequence were of type two
transitions (C to T, G to A), it supports the evidence of
amplification of truly ancient and not modern pea
DNA. Such substitutions result from deamination of
cytosine (and 5-methyl cytosine) to uracil (and
thymine), which have been shown previously to be
associated with post mortem damage (Binladen et al.
2006; Ho et al. 2007). The regions containing these
unique mutations were excluded from the MEGA
clustering analysis, since these 16 extra SNPs would
result in a severe distortion of the results. This
approach is justified, as we have not attempted any
123

Fig. 1 Fragments alignment of amplified ancient and extant
(John Innes germplasm and sample from Serbia, Pčinja river)
pea chloroplast trnK, matK, trnSG and rbcL genes with
phylogenetic study; we instead seek to infer on the
origin of the pea seeds.
Data showed that extant [P. sativum subsp. elatius
(Steven ex M. Bieb.) Asch. & Graebn.] is composed of
two groups (Smýkal et al. 2011, 2013), one repre-
sented by JI1794 of P. sativum subsp. elatius var.
pumilio Meikle (syn. Pisum humile Mill.), which is
hypothesized to belong to the group of the putative
ancestor of cultivated pea (Ben-Zéev and Zohary
1973; Ambrose 1995; Smýkal et al. 2011, 2013, 2014),
while another, represented by JI3151, is identical to
cultivated pea P. sativum subsp. sativum L. (Figure 2).
Two other species, P. abyssinicum A.Br. and P. fulvum
Sibth. & Sm., are clearly separated (Fig. 2). The
discrimination between wild and domesticated mate-
rial is complicated, as there is currently no known
single-marker (gene) to do so. Without an identified
gene underlying domestication traits in legumes,
including pea, we may only speculate about its origins.
Moreover, there is a continuum among domesticated
and wild P. sativum subsp. elatius/sativum complex
(Jing et al. 2010; Smýkal et al. 2011, 2014). All this
agrees with studies by Jing et al. (2010) and Kosterin
and Bogdanova (2008) performed using various
marker types. The additional P. sativum subsp. elatius
JI3147 accession is distinct, with intermediate posi-
tion. Interestingly, the aDNA sample is different both
from wild and cultivated peas, even when only
phylogenetically informative sites are considered
(e.g. with excluded SNPs related to post mortem
damage). This makes ancient pea samples closer to
wild than to modern cultivated pea (Fig. 2). Fragments
of trnSG and rbcL were the most informative, and, in
both analyzed aDNA samples, these sequences were
identical (except in extra SNPs) to P. sativum subsp.
elatius JI3147, which is true wild tall pea. It has large
(20–30 mm), bicolor flowers with dark violet keels
123
Genet Resour Crop Evol
indicated polymorphic sites. Numbers indicate position of the
fragments with reference to modern pea DNA
and long peduncles (2–49 longer than stipules) with 2
flowers per node and producing large pods
(50–80 9 10–12 mm). Leaflets are (1) 2–4 paired,
ovate-elliptic, and subdentate. This subspecies has a
chromosomal translocation difference from cultivated
P. sativum, but it is inter-fertile, although some
nucleo-cytoplasmatic conflict has been reported in
specific crosses (Bogdanova et al. 2009, 2012). The
second wild subspecies, P. sativum subsp. elatius var.
pumilio Meikle, formerly P. humile Mill., in our
analysis, represented by JI1794, has shorter internodes
(20–40 cm stem length), shorter peduncles, smaller
(40–45 9 7–10 mm) and often pigmented pods, and
small flowers (15–18 mm). This is the presumed
ancestor of cultivated pea. According to the ‘lost’
crops rationale, the Israeli southern P. humile Mill.
populations may serve as evidence for a past pea
domestication center (Abbo et al. 2013). Although it
displays traits typical of wild pea (e.g. fully dehiscent
pods, camouflage seed coloration, and strong
(*90 %) seed dormancy mediated by water-imper-
meable seed coats), these southern P. humile Mill.
never invade adjacent, less disturbed habitats (Abbo
et al. 2013). It must be mentioned that extant wild P.
sativum subsp. elatius (Bieb.) Aschers. and Graebn
collected in southern Serbia, around 70 km from the
Hissar locality (Zlatkovic et al. 2010) has a cpDNA
haplotype identical to that of the JI3151 accession. On
the other hand, owing to the high substitution rate in
the trnSG region, we might speculate on a closer
affinity to cultigen rather than to wild peas.
In the ongoing study of the Pisum genus biogeog-
raphy (Smýkal unpublished), the wild P. sativum L.
complex falls into two main groups, while P.
abyssinicum A.Br. and P. fulvum Sibth. & Sm. were
separated. Importantly, all tested cultivated pea
accessions showed only one cpDNA haplotype,
Genet Resour Crop Evol
0.025 0.020 0.015 0.010
Fig. 2 UPGMA dendrogram for composed trnSG, trnK, matK
and rbcL data. Real seed testa pigmentation and flower color are
shown for extant and hypothesized for ancient pea sample. In
case of cultivated Pisum sativum subsp. sativum both varieties:
suggesting a single domestication origin (Kosterin and
Bogdanova 2008; Smýkal unpublished). Moreover,
there is substantial difference from any Vicia, Lathy-
rus or Lens sequences in each of the amplified
fragments (Kenicer et al. 2005; Schaefer et al. 2012;
Mikić et al. 2013); thus, any seed heterogeneity can be
excluded or would be under the detection limit.
Finally, although included in the analysis, it was
obvious that charred seeds should not be P. fulvum
Sibth. & Sm., which was never used for human feed or
animal feed and does not grow in the Balkans, and
DNA analysis confirmed that. Similarly, P. abyssin-
icum A.Br. is not considered to be found in that given
area. Taken together, aDNA analysis suggests that our
ancient pea seeds might represent an early domesti-
cated form distinct from extant wild and cultivated
peas.
Conclusion
Although pea served as one of the founding crops of
Neolithic agriculture, a lucky find of 2,572 pea seeds
in the Hissar settlement is unique in southeastern
Europe. Pea from Hissar was a distinct crop, stored
separately from others. Archeobotanically, the bulk of
the peas recovered at eleventh century B.C. settlement
at Hissar belongs to cultivated pea. Several morpho-
logical characteristics indicate this: the smooth surface
of the seed coat, the ‘‘coffee-bean-shaped’’ hilum, the
broad ellipsoid seed shape, the small size difference
between seeds and the high 1,000-grain weight of
charred seeds. However, since wild or semi-wild pea
species can be found today in the area, it could be
P elatius-JI3151
Cultigen
P sativum(humile)JI1794
Ancient
P elatius-JI3147
P abyssinicum-JI1974
P fulvum-JI1006
0.005 0.000
arvense (fodder pee, colored flower and pigmented testa) and
var. sativum (dry seed pea, white flowering, and no pigmented
testa) are shown. (Color figure online)
assumed that the seeds could have been gathered in the
wild rather than cultivated. However, even when
collected in sufficient quantities, seed testa perme-
ability will prevent proper imbibition of wild peas,
resulting in impaired cooking ability, palatability and
digestibility. Based on a molecular analysis of recov-
ered aDNA, we found that the material used in our
study was not wild pea; rather, it represents early pea
domesticates. We speculate that Iron Age pea would
be of colored flower and pigmented testa, similar to
today’s fodder pea [P. sativum subsp. sativum var.
arvense (L.) Poir.], possibly of winter type. Although
charred pea seeds were found in many archeological
sites previously, this is the first report of ancient pea
seeds DNA analysis.
Acknowledgments This work was supported by the projects
173005, 173030, 31016 and 31024 of the Ministry of Education
and Science of the Republic of Serbia, and SEELEGUMES-168
within the EU programme SEE-ERA.NET. P.S. acknowledges
funding from Grant Agency of Palacký University in Olomouc,
IGA PrF-2013-003. The authors cordially thank Noel Ellis,
Gérard Duc for useful suggestions, Milorad Stojić for providing
archeobotanical material and Clarice Coyne for manuscript style
improvement.
References
Abbo S, Zezak I, Schwartz E, Lev-Yadun S, Gopher A (2008)
Experimental harvesting of wild peas in Israel: implica-
tions for the origins of Near East farming. J Arch Sci
35:922–929. doi:10.1016/j.jas.2007.06.016
Abbo S, Rachamim E, Zehavi Y, Zezak I, Lev-Yadun S, Gopher
A (2011) Experimental growing of wild pea in Israel and its
bearing on Near Eastern plant domestication. Ann Bot
107:1399–1404. doi:10.1093/aob/mcr081
123

Abbo S, Lev-Yadun S, Heun M, Gopher A (2013) On the ‘lost’
crops of the neolithic Near East. J Exp Bot 64:815–822.
doi:10.1093/jxb/ers373
Abbo S, Pinhasi van-Oss R, Gopher A, Saranga Y, Ofner I,
Peleg Z (2014) Plant domestication versus crop evolution:
a conceptual framework for cereals and grain legumes.
Trends Plant Sci. doi:10.1016/j.tplants.2013.12.002
Allaby RG, Jones MK, Brown TA (1994) DNA in charred wheat
grains from the Iron Age hillfort at Danebury, England.
Antiquity 68:126–132
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)
Basic local alignment search tool. J Mol Biol 215:403–410.
doi:10.1016/S0022-2836(05)80360-2
Ambrose MJ (1995) From Near East centre of origin the prized
pea migrates throughout world. Diversity 11:118–119
Ambrose MJ, Ellis THN (2008) Ballistic seed dispersal and
associated seed shadow in wild Pisum germplasm. Pisum
Genet 40:5–10
Baldev B (1988) Origin, distribution, taxonomy, and morphol-
ogy. In: Baldev B, Ramanujam S, Jain HK (eds) Pulse
crops. Oxford and IBH, New Delhi, pp 3–51
Banerjee M, Brown TA (2002) Preservation of nuclear but not
chloroplast DNA in archaeological assemblages of charred
wheat grains. Anc Biomol 4:59–63. doi:10.1080/
1358612021000010659
Ben-Zéev N, Zohary D (1973) Species relationship in the genus
Pisum L. Israel J Bot 22:73–91
Binladen J, Wiuf C, Gilbert TP, Bunce M, Barnett R, Larson G,
Greenwood AD, Haile J, Ho SYW, Hansen AJ, Willerslev
E (2006) Assessing the fidelity of ancient DNA sequences
amplified from nuclear genes. Genetics 172:733–741.
doi:10.1534/genetics.105.049718
Bogdanova VS, Galieva ER, Kosterin OE (2009) Genetic ana-
lysis of nuclear-cytoplasmic incompatibility in pea asso-
ciated with cytoplasm of an accession of wild subspecies
Pisum sativum subsp. elatius (Bieb.) Schmahl. Theor Appl
Genet 118:801–809. doi:10.1007/s00122-008-0940-y
Bogdanova VS, Galieva ER, Kosterin OE (2012) Inheritance
and genetic mapping of two nuclear genes involved in
nuclear-cytoplasmic incompatibility in peas (Pisum sati-
vum L.). Theor Appl Genet 124:1503–1512. doi:10.1007/
s00122-012-1804-z
Bojňanský V, Fargašová A (2007) Atlas of seeds and fruits of
central and East-European Flora: the Carpathian Moun-
tains region. Springer, Dordrecht
Borojević K (2006) Terra and Silva in the Pannonian plain. Opovo
agro-gathering in the late neolithic. Archaeopress, Oxford
Chimwamurombe PM, Khulbe RK (2011) Domestication of
food legumes. In: Aditya P (ed) Food legumes. CABI.
ISBN:9781845937669
De Candolle A (1884) The origin of cutlivated plants. London,
K. Paul, Trench
Doyle JJ, Doyle JL (1987) Rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Phytochem Bull 19:11–15
Elbaum R, Melamed-Bassudo C, Boareto E, Galili E, Lev-Ya-
dun S, Levy AA, Weiner S (2006) Ancient olive DNA in
pits: preservation, amplification and sequence analysis.
J Archeol Sci 33:77–88. doi:10.1016/j.jas.2005.06.011
Ellis THN (2011) Pisum. In: Kole C (ed) Wild crop relatives:
genomic and breeding resources. Springer, Berlin,
pp 237–248
123
Genet Resour Crop Evol
Erskine W (1985) Selection for pod retention and pod dehis-
cence in lentils. Euphytica 34:105–112. doi:10.1007/
BF00022869
Fairbairn A, Asouti E, Near J, Martinoli D (2002) Macro-
botanical evidence for plant use at Neolithic Çatalhöyük
south-central Anatolia, Turkey. Veget Hist Archaeobot
11:41–54. doi:10.1007/s003340200005
Fairbairn A, Near J, Martinoli D (2005) Macrobotanical inves-
tigations of the north, south and KOPAL areas at Çat-
alhöyük. In: Hodder I (ed) Inhabiting Çatalhöyük: reports
from the 1995–1999 seasons. Cambridge/Ankara:
McDonald Institute for Archaeological Research, Cam-
bridge, pp 137–201
Forbes I, Wells HD (1968) Hard and soft seededness in Blue
Lupine, Lupinus angustifolius L.: inheritance and pheno-
type classification. Crop Sci 8:195–197. doi:10.2135/
cropsci1968.0011183X000800020018x
Gilbert MTP, Bandelt HJ, Hofreiter M, Barnes I (2005)
Assessing ancient DNA studies. Trends Ecol Evol
20:541–544. doi:10.1016/j.tree.2005.07.005
Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/
NT. Nucleic Acids Sci 41:95–98
Hammer K (1984) Das Domestikationssyndrom. [The domes-
tication syndrome]. Kulturpflanze 32:11–34
Hancock JF (2012) Plant evolution and origin of species, 3rd
edn. CABI, Wallingford
Helbaek H (1964) First impressions of the Çatal Hüyük plant
husbandry. Anatol Stud 14:121–123
Helbaek H (1970) The plant husbandry of Haçilar. In: Mellaart J
(ed) Excavations at Haçilar. Edinburgh University Press,
Edinburgh, pp 189–244
Hellens RP, Moreau C, Lin-Wang K, Schwinn KE (2010)
Identification of Mendel’s white flower character. PLoS
One 5:e13230. doi:10.1371/journal.pone.0013230
Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC
(1984) DNA sequences from the quagga, an extinct
member of the horse family. Nature 312:282–284. doi:10.
1038/312282a0
Ho SY, Heupnik TH, Rambaut A, Shapiro B (2007) Bayesian
estimation of sequence damage in ancient DNA. Mol Biol
Evol 24:1416–1422. doi:10.1093/molbev/msm113
Hopf M (1986) Archaeological evidence of the spread and use of
some members of the Leguminosae family. In: Barigozzi C
(ed) The original and domestication of cultivated plants.
Oxford, Elsevier, pp 35–60
Jing R, Vershinin A, Grzebyta J, Shaw P, Smýkal P, Marshall D,
Ambrose MJ, Ellis THN, Flavell AJ (2010) The genetic
diversity and evolution of field pea (Pisum) studied by high
throughput retrotransposon based insertion polymorphism
(RBIP) marker analysis. BMC Evol Biol 10:44. doi:10.
1186/1471-2148-10-44
Jones M, Brown T (2000) Agricultural origins: the evidence of
modern and ancient DNA. Holocene 10:769–776. doi:10.
1191/09596830095024
Jovanović Ž, Stanisavljević N, Nikolić A, Medović A, Mikić
A, Radović S, Ðord̄ević V (2010) Pisum and Ervilia
Tetovac—made in Early Iron Age Leskovac. Part two:
extraction of the ancient DNA from CHARRED SEEDS
FROM the site of Hissar in South Serbia. Ratar Povrt
48:227–232
Genet Resour Crop Evol
Kenicer GJ, Kajita T, Pennington RT, Murata J (2005) Sys-
tematics and biogeography of Lathyrus (Leguminosae)
based on internal transcribed spacer and cpDNA sequence
data. Am J Bot 92:1199–1209. doi:10.3732/ajb.92.7.1199
Kislev ME, Bar-Yosef O (1988) The legumes: the earliest
domesticated plants in the Near East? Curr Anthropol
29:175–179
Konishi S, Izawa T, Lin S-Y, Ebana K, Fukuta Y, Sasaki T,
Yano M (2006) An SNP caused loss of seed shattering
during rice domestication. Science 312:1392–1396. doi:10.
1126/science.1126410
Kosterin OE, Bogdanova VS (2008) Relationship of wild and
cultivated forms of Pisum L. as inferred from an analysis of
three markers, of the plastid, mitochondrial and nuclear
genomes. Genet Res Crop Evol 55:735–755. doi:10.1007/
s10722-007-9281-y
Kluyver TA, Charles M, Jones G, Rees M, Osborne CP (2013)
Did greater burial depth increase the seed size of domes-
ticated legumes? J Exp Bot doi:10.1093/jxb/ert304
Kroll H (1983) Kastanas. Ausgrabungen in einem Sied-
lungshügel der Bronze- und Eisenzeit Makedoniens
1975–1979. Die Pflanzenfunde. Verlag Volker Spiess,
Berlin
Kroll H (1991) Southeast Europe. In: van Zeist, Wasylikowa K,
Behre KE (eds) Progress in old world palaeoethnobotany.
Balkema, Rotterdam, pp 161–177
Ladizinsky G (1979) The genetics of several morphological
traits in lentil. J Hered 70:135–137
Ladizinsky G (1985) The genetics of hard seed coat in the genus
Lens. Euphytica 34:539–543. doi:10.1007/BF00022952
Ladizinsky G (1987) Pulse domestication before cultivation.
Econ Bot 41:60–65. doi:10.1007/BF02859349
Ladizinsky G (1998) Plant evolution under domestication.
Kluwer Academic, Dordrecht
Lenser T, Theißen G (2013) Molecular mechanisms involved in
convergent crop domestication. Trends Plant Sci
18:704–714. doi:10.1016/j.tplants.2013.08.007
Li J, Fu C, Lei G (2011) Biogeographical consequences of
Cenozoic tectonic events within East Asian margins: a case
study of Hynobius biogeography. PLoS One 6:1–10.
doi:10.1371/journal.pone.0021506
Makasheva RKH (1979) Flora of cultivated plants IV, grain
legumes 1, pea. Kolos, St. Petersburg
Maxted N, Ambrose M (2001) Peas (Pisum L.). In: Maxted N,
Bennett SJ (eds) Plant genetic resources of legumes in the
Mediterranean. Kluwer, Dordrecht, pp 181–190
Medović A (2005) Plant husbandry of fortified settlement Hisar
near Leskovac southern Serbia (ca. 1350–1000 bc). Leskov
Zb 45:201–209 (Serbian with English summary)
Medović A (2012) Late Bronze Age plant economy at the Early
Iron Age hill fort settlement Hissar? Rad Muz Vojv
54:105–118
Medović A, Mikić A, Ćupina B, Jovanović Ž, Radović S, Nik-
olić A, Stanisavljević N (2011) Pisum and Ervilia Tetovac:
made in Early Iron Age Leskovac. Part one. Two charred
pulse crop storages of the fortified hill fort settlement
Hissar in Leskovac, south Serbia. Ratar Povrt 48:219–226
Mikić A (2012) Origin of the words denoting some of the most
ancient Old World pulse crops and their diversity in
modern European languages. PLoS One 7:e44512. doi:10.
1371/journal.pone.0044512
Mikić A, Smýkal P, Kenicer G et al (2013) The bicentenary of
the research on ‘beautiful’ vavilovia (Vavilovia formosa), a
legume crop wild relative with taxonomic and agronomic
potential. Bot J Linn Soc 172:524–531. doi:10.1111/boj.
12060
Palmer JD, Jorgensen RA, Thompson WF (1985) Chloroplast
DNA variation and evolution in Pisum: patterns of change
and phylogenetic analysis. Genetics 109:195–213
Palmer S, Moore JD, Clapham AJ, Rose P, Allby RG (2009)
Archelogical evidence of ancient nubian barley evolution
from six to two-row indicates local adaptation. PLoS One
4:e6301. doi:10.1371/journal.pone.0006301
Polans NO, Saar DE (2002) ITS sequence variation in wild
species and cultivars of pea. Pisum Genet 34:9–13
Purugganan MD, Fuller DQ (2009) The nature of selection
during plant domestication. Nature 457:843–848. doi:10.
1038/nature07895
Sáenz de Miera LE, Ramos J, Pérez de la Vega M (2008) A
comparative study of convicilin storage protein gene
sequences in species of the tribe Vicieae. Genome
7:511–523. doi:10.1139/G08-036
Schaefer H, Hechenleitner P, Santos-Guerra A, de Sequeira MM
et al (2012) Systematics, biogeography, and character
evolution of the legume tribe Fabeae with special focus on
the middle-Atlantic island lineages. BMC Evol Biol
12:250. doi:10.1186/1471-2148-12-250
Schlumbaum A, Tensen M, Jaenicke-Després V (2008) Ancient
plant DNA in archaeobotany. Veg Hist Archaeobot
17:233–244. doi:10.1007/s00334-007-0125-7
Smartt J (1990) Grain legumes: evolution and genetic resources.
Cambridge University Press, Cambridge
Smýkal P, Hýbl M, Corander J, Jarkovský J, Flavell AJ, Griga M
(2008) Genetic diversity and population structure of pea
(Pisum sativum L.) varieties derived from combined ret-
rotransposon, microsatellite and morphological marker
analysis. Theor Appl Genet 117:413–424. doi:10.1007/
s00122-008-0785-4
Smýkal P, Kenicer G, Flavell AJ, Corander J, Kosterin O,
Redden RJ, Ford R, Coyne CJ, Maxted N, Ambrose MJ,
Ellis THN (2011) Phylogeny, phylogeography and genetic
diversity of the Pisum genus. Plant Genet Res 9:4–18.
doi:10.1017/S147926211000033X
Smýkal P, Coyne C, Redden R, Maxted N (2013) Peas. In: Singh
M, Upadhya H (eds) Genetic and genomic resources of
grain legume improvement. Elsevier, The Netherlands
Smýkal P, Coyne CJ, Ambrose MJ et al. (2014) Legume
crops phylogeny and genetic diversity for science and
breeding. Crit Rev Plant Sci. doi:10.1080/07352689.
2014.897904
Stojić M, Pešić J, Jović S (2007) Cultural stratigraphy of
archaeological site Hisar near Leskovac. Leskov Zb
47:29–40
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4:
molecular evolutionary genetics analysis (MEGA) Soft-
ware Version 4.0. Mol Biol Evol 24:1596–1599. doi:10.
1093/molbev/msm092
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position specific
gap penalties and weight matrix choice. Nucleic Acids Res
22:4673–4680. doi:10.1093/nar/22.22.4673
123

Vahdati Nasab H (2010) The assessment of the prehistory of
Southwestern Iran report (Hole and Flannery 1967). Int J
Hum 17:1–12
Vavilov NI (1951) The origin, variation, immunity and breeding
of cultivated plants. Translated by Chester KS. The Ronald
Press Company, New York
Weeden NF (2007) Genetic changes accompanying the
domestication of Pisum sativum: is there a common genetic
basis to the ‘domestication syndrome’ for legumes? Ann
Bot 100:1017–1025. doi:10.1093/aob/mcm122
Weiss E, Zohary D (2011) The neolithic Southwest Asian
founder crops: their biology and archaeobotany. Curr
Anthr 52:S237–S254. doi:10.1086/658367
123
Genet Resour Crop Evol
Weiss E, Kislev ME, Hartmann A (2006) Autonomous culti-
vation before domestication. Science 12:1608–1610
Werker E, Marbach I, Mayer AM (1979) Relation between the
anatomy of the testa, water permeability and the presence
of phenolics in the genus Pisum. Ann Bot 43:765–771
Willcox G, Fornite S, Herveux L (2008) Early Holocene culti-
vation before domestication in northern Syria. Veg Hist
Archaeobot 17:313–325. doi:10.1007/s00334-007-0121-y
Zlatković B, Mikić A, Smýkal P (2010) Distribution and new
records of Pisum sativum subsp. elatius in Serbia. Pisum
Genet 42:15–18
Zohary D, Hopf M (2000) Domestication of plants in the Old
World. Oxford University Press, Oxford