Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Look up keyword
Like this
3Activity
0 of .
Results for:
No results containing your search query
P. 1
Cloning, Sequencing, And Characterization of the Gene Encoding

Cloning, Sequencing, And Characterization of the Gene Encoding

Ratings: (0)|Views: 19|Likes:
Published by huynhvankiet

More info:

Published by: huynhvankiet on Dec 31, 2009
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/08/2010

pdf

text

original

 
Vol.
175,
No.
22
OURNAL
OF
BACrERIOLOGY,
Nov.
1993,
P.
7495-7499
0021-9193/93/227495-05$02.00/0
Copyright
C
1993,
American
Society
for
Microbiology
Cloning,
Sequencing,
and
Characterizationof
the
Gene
Encoding
theClass
I
Fructose-1,6-Bisphosphate
Aldolase
of
Staphylococcus
carnosus
CLAUDIAWITKE
AND
FRIEDRICH
GOTZ*
Mikrobielle
Genetik,
Universitat
Tubingen,
Waldhauser
Strasse
70/8,
72076
Tubingen,
Germany
Received
26
May
1993/Accepted
13
September
1993
fdafrom
Staphylococcus
carnosus
TM300,
encoding
the
class
I
fructose-1,6-bisphosphate
aldolase,
was
cloned
in
Escherichia
coli
and
sequenced.
The
888-nucleotide
open
reading
frame
encoding
a
protein
with
an
Mr
of
32,855
had
an
E.
coli-like
promoter
sequence.
Plasmids
containing
fda
complemented
E.
coli
NP315
(Fda-).Expression
offda
in
S.
carnosus
led
to
a
six-
to
eightfold
increase
in
aldolase
production
and
activity;
low
levels
ofglucose
in
the
growth
medium
stimulated
activity.
Fructose-1,6-bisphosphate
(FBP)
aldolase
(EC
4.1.2.13)
is
a
glycolytic
enzyme
which
catalyzes
the
reversible
cleavage
of
fructose-1,6-bisphosphate
to
form
dihydroxyacetone
phos-
phate
and
glyceraldehyde
3-phosphate.
There
are
two
classes
of
FBP
aldolases.
Class
I
aldolases,
typical
ofhigher
eucaryotes
such
as
animals
and
plants,
consist
of
tetramers
with
a
total
molecularweight
of
about
160,000
(16).
Class
I
aldolases
form
an
intermediate
with
their
substrate
through
a
Schiff
base
bycondensation
of
the
carbonyl
group
with
the
s-amino
group
of
a
lysyl
residue
in
the
active
center.
This
complex
can
be
fixed
by
reduction
with
NaBH4,
leading
to
an
irreversibleinactivation
ofthe
enzyme
(16).
In
contrast,
FBP
aldolases
of
most
bacteria
are
class
II
aldolases.
They
do
not
form
a
Schiff
base
intermediate;they
require
a
divalent
cation,
such
as
Ca2+,
Fe2+,
or
Zn2+,
to
stabilize
the
carbanion
intermediate
of
the
enzyme-substrate
complex
(15);
and
they
can
be
inhibited
by
EDTA
(16).
Since
it
was
believed
that
class
I
aldolases
were
restricted
to
highereucaryotic
organisms,
it
was
a
surprise
to
find
them
in
Pepto-
coccus
aerogenes
(20),
Lactobacillus
casei
(21),
Escherichia
coli
(33),
and
most
staphylococcal
species
(12).
The
class
I
aldolase
of
Staphylococcusaureushas
been
studied
indetail.
The
enzyme
is
unusually
heat
resistant
and
extremely
acid
and
base
stable
(11).
While
the
rabbit
muscle
aldolase
is
active
as
a
tetramer,
the
33-kDa
S.
aureus
aldolase
is
active
as
a
monomer.
The
kinetics
of
thermally
and
guani-
dinium
chloride-induced
unfolding
and
refolding
of
this
aldo-
lase
are
complex
andcomprise
at
least
one
fast
and
twoslow
reactions
(25).
Recently
it
wasfound
thatthe
class
I
aldolase
of
the
staphylococcalcloning
host
Staphylococcus
carnosus
(10)
is
also
unusually
temperature
and
pH
stable
(4,
5).
Furthermore,
the
S.
carnosus
aldolase
reacts
with
a
wide
range
of
aliphatic
aldehydes
and
is
much
more
stable
than
therabbitaldolase.
Because
of
its
substrate
range
and
stability,
the
S.
carnosus
aldolase
is
the
enzyme
of
choice
for
large-scale
synthesis
ofglycosidase
inhibitors(36),
6-desoxy-fructose-1-phosphate
(35),
C8
and
Cg
sugars
(2),
and
similar
compounds.
From
the
biophysicalpointof
view,
the
staphylococcal
class
I
aldolase
could
become
a
model
enzyme
to
study
unfolding
and
refolding
kinetics.
To
continue
those
studies
whichhave
*
Corresponding
author.
been
already
initiated,
it
is
necessary
to
know
theprotein
sequence
and
to
have
the
clonedgene
available
to
determine
the
refolding
pathway
by
using
specific
mutations.
Here
we
report
the
isolation
and
DNA
sequence
ofthe
class
I
aldolase
gene
from
S.
carnosus
and
its
expression
in
the
donor
strain.
Chromosomal
location
of
fda.
The
aldolase
of
S.
carnosus
has
been
purified
(5).
On
the
basis
of
the
N-terminalsequence
A.
1
2
34
56
7
8
9
10
11
12131415161718
s~~
K*
h00rj<S40
B.
PstI
HindIIIClaI
EcoRI
I
I
EcoRV
Clal
EcoRI
Pstl
HindIlI
XbaI
PvuIII
I
fda
FIG.
1.
(A)
Hybridization
of
Aldol
to
S.
carnosus
TM300
genomic
DNA.
Autoradiograph
of
the
Southern
blot
hybridized
with
purified
and
32P-labeled
Aldol.
Chromosomal
DNA
was
digested
with
thefollowing
restriction
endonucleases.Lanes:
1,
ClaI;
2,
ClaI-HindIII;
3,
ClaI-PstI;
4,
ClaI-BamHI;
5,
HindIII;
6,
HindIII-PstI;
7,
HindIII-
BamHI;
8,
BamHI-PstI;
9,
HindIII-ClaI-PstI;
10,
HindIII-ClaI-EcoRI;
11,
PvuII;
12,
PvuII-EcoRI;
13,
PvuII-HindIII;
14,
PvuII-ClaI;
15,
PvuII-PstI;
16,
PvuII-XbaI;
17,
ClaI-XbaI;
18,
PstI-XbaI.
(B)
Location
of
fda
in
the
genome,
based
on
hybridization
of
Aldol.7495
  a t   S  G U I   S I   on e c  em b  e , 0  0  9  j   b . a s m. o g ownl   o a d  e d f   om 
 
7496
NOTES
J.
BACTERIOL.
EcoRV
1
AAQATATUATTTTGTTGAATAGGTCCTTCCTTTAATACACGAAAATACCATCCAGTTCTTCCAGTTTCTTGGATACGTCTTCCCCATTCAATCCAACGCA
101
CACGTCTCCCTGGCTTCCAACAAGGTCTGCGCGGTTGTGAAACTTGTACAGTCGCTCCTCCGATTTGATAGATGTCACCAATATAAACAGAAGTTTCATC
201
CATATCAATTACGGAAACATTCTCTCCATTCAACCCTGGTTTAAAATGAACITCCGGATATTCTACTGTCCATTTTTCATAATGCGATTTACTATAAGCA
301
AATAATGCTTTTTCTGGTCCGCCATGATGTTTTTTCTCCCCGACATCATCACCAACTAAACCTGTTTTCGTTAGTAAAACCGCTTGGTCTGTCGGATTTT
SalI
401
TAAACGCTGCTGTCGACCATTCTTGTTCTAAAGGATTTTCAGCATTCGGATCACCTACTTTTTGAATGCCGCCTCTAAATAATTGCTCGATTTGACTCAC
-35501
TTGTTCCACCCTCTCTCAAAGCTATTATAACGACTTTTTGACAAATTCTTAAGAGTAAGCGTTTTTTTTAATTTTTTTAAAGTAAAGTA¶AATC
+1
-10
I
S.D.
601
AATTATTTTTTTCCATACAGACATTGAAAGAGAAAAGCAAAATGCGGAAAGArTCAATAAATGAACCAAGAACAATTTGACAAAATTAAAAATG
M
N
Q
BQ
F
DK
I
K
N
11
701
GTAAAGGATTTATCGCAGCATTGGACCAAAGCGGTGGTAGTACTCCGAAAGCGCTAAAAGATTATGGCGTTGAAGAAAATGAATACTCTAACGATGAAGA
G
K
G
F
I
AA
L
D
Q
S
GG
S
T
P
K
A
L
K
D
Y
G
V
E
EN
E
Y
S
N
DE
E
45
801
AATGTTCAACCTTGTACACGATATGCGTACTCGTATCATTACTTCACCTGCATTTAACGGAGAAAAAATCTTAGGTGCGATTCTATTCGAACAAACTATG
M
F
N
L
V
H
D
M
RT
R
II
T
S
P
A
F
NG
E
K
I
L
G
A
I
L
FE
QT
M78
SalI
901
GACCGTGAAGTTGAGGGCAAATACACAGGTTCATATTTAGCAGATAAAGGTATCGTTCCATTCTTGAAAGTCGACAAAGGTTTGGCTGAAGAAGCTGACG
D
RE
V
EGK
Y
T
G
S
Y
L
A
D
K
G
I
V
P
F
L
K
V
D
KG
L
A
E
EA
D
111
1001
GCGTTCAATTAATGAAACCTATTCCAGACTTAGATAAATTATTAGATCGTGCGAACGAACGTGGTATCTTCGGTACTAAAATGCGTTCTAACATCTTAGA
G
V
Q
L
M
K
P
I
PD
L
DK
LLD
R
AN
E
RG
I
F
GT
KM
R
S
N
I
L
E
145
PvuII1101
AAATAATAAAGAAGCAATTGAAAAAGTTGTTAAACAACAATTTGAAGTTGCAAAAGAAATCATTGCAGCGTCTAGTACCAATTATCGAACCTGAAGTT
N
N
K
E
A
I
EK
VV
K
Q
Q
FE
V
A
KE
I
I
AAG
L
V
P
I
I
E
P
E
V
178
1201
AACATCAATGCTAAAGACAAAGAAGCTATCGAAGCTAACTTAGCTGAAGCAATCAAAGCTGAATTAGATAACTTGAAAAAAGATCAATATGTAATGTTGA
N
I
NA
K
DKE
A
I
E
A
N
L
A
E
A
I
K
A
E
L
D
N
L
K
K
D
Q
Y
V
M
L
211
1301
AATTAACTATTCCAACTAAAGTGAATGCTTACAGCGAATTAATTGAACATCCACAAGTAATCCGCGTGGTTGCATTATCTGGTGGTTACAGCCGCGACGA
K
L
T
I
P
T
KV
NA
Y
S
E
L
I
E
HP
QV
I
R
V
V
A
L
S
G
G
Y
S
R
D
E245
HindIII
EcoRI
1401
AGCAAACAAAATCTTGAAACAAAATGATGGTTTAATCGCA=G
CTCACGTGCATTAGTATCTGACTTAAACGCACAACAATCAGATGCA
AT
A
N
K
I
L
KQN
D
G
L
I
A
S
F
S
R
A
L
V
S
DL
NAQQ
S
D
AEF
N
278
ClalHindlll
HindlIl
1501
GAAAAATTACAAGAAGCTATCGATACAATCTTCGATGCTTCAGTAAACAAAGCTAATCTAAGCTTAAAATAATAACGAGCCCC
TTC
TTGAGGGCT
EK
L
Q
EA
I
D
T
I
F
D
A
S
V
N
K
A2961601
CGCTTTTTTGTATAATTCCATAGATTTTCTCCGCAAATTTTCTCATACGTAATATTTTCACAATAAAAGTTCTTTTCTTTCACTGTCATACATAATAAAA
1701
TACAAGAGACTTTCAGAAATAAAGAACTAAGTCGCCAAACTTACAACAGGATCTGAACACACATGGCGTCTAATCCTATTCCTCGTTATTTACAAGATAA
1801
GCGCGCAAATTTCCATGAACTATTTTATATTAATATTTGTATATGCCTTACAAAAAATTGCGCATGTGCTTTTACATACTGAAAAAATGGCACACTTT
Xba
I
1901
CCTAGA
FIG.
2.
Nucleotidesequence
of
thefda-containing
1.9-kb
EcoRV-XbaI
fragment
of
S.
carnosus
TM300.The
transcriptional
start
is
marked
with
+1.
The
-35
and
-10
regions
and
thepotential
ribosome
binding
sequences
(S.D.)
areunderlined.
The
determined
N-terminal
protein
sequence
is
marked
withboldface
letters.
The
Schiff
base-forming
lysine
residue
is
marked
with
an
asterisk.
The
terminator
is
underlined
with
arrows.
NQEQFDK
(18a),
we
synthesized
(Gene
Assembler
Plus;
Chromosomal
DNA
from
S.
carnosus
(29)
was
preparedby
a
Pharmacia
LKB)
the
wobble
oligonucleotide
Aldol:
modificationofthe
cleared-lysate
method
(22).
Colonies
AAT
AA
AA
A-A
                                                                                                                                                                 TT
AT
AA
grown
onone
B
plate
(10
g
of
casein
hydrolysate
140
[GIBCO,
AT
CAA
GAA
CAA
Eggenstein-Leopoldshafen,
Germany],
5
gof
yeast
extract
CG
G
G
CC
[Difco],
5
g
of
NaCl,
1
g
of
glucose,
1
gof
K2HPO4,
and
12
g
The
oligonucleotide
was
labeled
with
[_y-32P]ATP
(Amersham)
of
agar
[GIBCO]
per
liter
[pH
7.3])
were
resuspended
in
1
ml
with
T4
polynucleotide
kinase
(Stratagene)
(27).
Unincorpo-
of
NT
buffer
(100
mM
NaCl
and
20
mM
Tris-HCl,
pH
7.5).
rated
nucleotides
were
separated
from
the
radiolabeled
oligo-
After
incubationwith
14
U
of
lysostaphin
(Sigma,
Deisen-nucleotide
by
using
the
Nuc
Trap
Push
Columns
(Stratagene).hofen,
Germany)
for
30
min
at
room
temperature,
the
cells
  a t   S  G U I   S I   on e c  em b  e , 0  0  9  j   b . a s m. o g ownl   o a d  e d f   om 
 
NOTES
7497
human
A:
215
-
human
B:
215-
humanC:
214-
dros.mel.:
212-
zea
mays:
2
09
-
S.
aureus:
S.carnosus:
197-
K
A
L
S
r
H
H
I
Y
LE
G
T
L
L
K
A
L
N
IDH
H
V
Y
LE
G
TLL
K
K
A
L
N
DIH
H
V
YL
Q
G
T
L
L
K
K
A
L
S
HH
V
YL
Q
G
TLL
K
A
L
N
E
HH
V
L
L
E
G
TLL
R
KGL
A
S
E
QDD
V
-
v
ML
K
AE
LEN
LKKD
YV
ML
K
P
N
M
V
P
N
M
V
P
D
M
V
P
N
MV
P
N
M
V
P
I
N
LLT
I
P
A
G-237
A
G-237
P
G-236
A
G-234
P
G-232
D
E
K
V-219
A.
2.52
E
E
1.5
go
0.5
FIG.
3.
Alignment
of
class
I
aldolase
sequences
around
the
pro-
posed
active
site.
The
amino
acid
sequence
of
S.
carnosus
FBP
aldolase,
deducedfrom
thefda
nucleotide
sequence,
is
shown
aligned
with
the
corresponding
human
aldolase
A
(17),
human
aldolase
B
(26),
human
aldolase
C
(24),
D.melanogaster
(dros.mel.)
(3),
Z.
mays
(18),
and
S.
aureus
(9)
sequences.
DNA
and
protein
sequences
were
analyzed
by
usingthe
computerprograms
of
Microgenie
(Beckman)
and
PC/Gene
(IntelliGenetics,
Inc.).
Amino
acids
identical
to
those
in
the
S.
carnosus
sequence
are
boxed.
were
lysed
by
theaddition
of
110
,ul
of
cold
lysis
buffer
(50
mM
Tris-HCl,
300
mM
EDTA,
0.5%
Brij58,
0.04%
Na-desoxy-
cholate,
pH
8.0)
on
ice
for
about
1
h.
The
proteins
were
removed
by
proteinase
K
digestion.
DNA
was
separated
byCsCl
centrifugation.
Established
protocols
(27)
were
followed
for
molecular
biological
techniques
unless
otherwise
stated.
Isolated
chromo-
somal
DNA
was
digested
with
several
restriction
enzymes.
DNA
fragmentswere
blotted
(32)
onto
nylon
membranes
(Pall;
BiodyneA,
0.2-,um
pore
size,
unloaded)
by
using
a
vacuum
blotting
system
(Pharmacia
LKB)
according
to
the
instructions
of
the
manufacturer.
DNA
was
cross-linked
with
a
UV-Stratalinker
(Stratagene).
Prehybridization
was
performed
at
42°C
for
at
least
2
h
with
50
jig
of
heparin
(Sigma)
per
ml
as
a
blocking
agent.
Hybridization
was
performed
with
10
pmol
of
labeled
Aldol
at
42°C
for
at
least
12
h
to
identify
fda-
containingfragments.
To
remove
unbound
oligonucleotides,
filters
were
washed
for
30
min
at
room
temperature
and
for
10
min
at
50°C.
Nylon
membranes
were
exposed
to
an
RX
NIF
18
x
24
film(Fuji)
at
-
70°C
withan
intensifying
screen
(Dupont).
The
hybridization
pattern
of
Aldol
(Fig.
1A)
allowed
the
construction
of
a
restriction
map
(Fig.
1B).
The
smallest
fragment
which
hybridized
with
the
probe
was
a
2.2-kb
EcoRI-
PvuII
fragment.
Cloningand
sequencingoffdafrom
S.
carnosus.
Since
it
was
possible
that
Aldol
hybridized
verynear
the
EcoRI
or
the
PvuII
site,
we
cloned
thelarger
encompassing
5.2-kb
PstI
fragment.
An
enriched
gene
library
was
made
by
digesting
chromosomal
DNA
with
PstI.
Fragments
of
4.5
to
6.5
kb
were
isolated
and
ligatedinto
PstI-digested
pBluescriptll
KS+
(Stratagene)
and
transformed
into
E.coli
SURE
(Stratagene).
One
thousand
transformantswith
inserts
were
analyzed
by
hybridization
with
Aldol.
Two
positive
clones,
bothhaving
the
supposed
restriction
map,
were
found.
The
plasmid
containing
the5.2-kbPstI
fragmentwas
designatedpBluescriptll-fdalO.
The
approximate
position
of
fdawasdetermined
by
exonucle-
ase
III
digestion
and
subcloning
(Fig.
1B).
The
insert
was
sequencedby
double-stranded
DNA
se-
quencing
(7)
by
using
the
dideoxy
procedure
(28),
the
Phar-
macia
AutoRead
Sequencing
kit,
and
the
A.L.F.
DNA
Se-
quencer
from
Pharmacia
LKB.
Exonuclease
III
clones
were
sequenced
with
universal
and
reverse
primers
obtained
with
the
sequencing
kit.
Othersequencingprimers
were
synthesized
by
a
synthesizer
(Pharmacia)and
labeled
with
fluoresceinamidite.
0
0
1
2345
t
(h)
1
0
0
-J
00
0.1
0.01
67
8
B.
4h
5h
6h
7h
A
B
A
B
A
B
A
B
8h
A
B
S
kd
-
7.4
-
6.2
-
5.0
-
31.0
-
1.5
-
4.4
FIG.
4.
(A)
Comparison
of
aldolase
activity
in
S.
carnosus
wild
type
andfda
clone.
Black
squares,
S.
carnosus
TM300(pRB473fda20);
white
squares,
S.
carnosus
TM300;
triangles,
growth
curveof
S.
carnosus
TM300
and
S.
carnosus
TM300(pRB473fda20).
OD,
optical
density.
(B)
Coomassie
blue-stained
SDS-PAGE.
Proteins
of
cell
extracts
of
S.
carnosus
TM300
(lanes
A)
and
S.
carnosus
TM300(pRB473fda20)
(lanesB),
prepared
at
theindicatedtimes,
wereseparated
on
an
SDS-12.5%
polyacrylamide
gel.
The
aldolase
band
is
marked
by
an
arrow.
Molecular
mass
standards
were
obtained
from
Bio-Rad.
DNA
sequencing
of
the
1.9-kb
EcoRV-XbaI
fragment
re-
vealed
one
open
reading
frame
of
888
nucleotides
encoding
a
protein
withan
Mr
of
32,855
(Fig.
2).
The
deduced
N-terminal
amino
acid
sequence
corresponds
exactly
with
that
determined
by
Edman
degradation
of
the
purified
aldolase(3a).
The
fda
stop
codon
is
followed
by
an
inverted
repeat
sequence
(AG
=
-
29.2
kcal
[ca.
-
122
kJ])
(34)
which
is
indicative
of
a
rho-independent
transcription
terminator
sequence
(Fig.
2).
Transcriptional
start.
The
transcriptional
start
of
fda
was
determined
byprimer
extension
analysis.
Total
RNA
from
S.
carnosuswas
isolated
by
the
guanidine
isothiocyanate
method
as
previously
described
(8)
with
some
modifications.
The
culture
was
incubated
at
37°C
in
B
broth
to
an
A578
of
2.2.
The
VOL.
175,
1993
  a t   S  G U I   S I   on e c  em b  e , 0  0  9  j   b . a s m. o g ownl   o a d  e d f   om 

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->