Welcome to Scribd. Sign in or start your free trial to enjoy unlimited e-books, audiobooks & documents.Find out more
Download
Standard view
Full view
of .
Look up keyword
Like this
37Activity
0 of .
Results for:
No results containing your search query
P. 1
O que caiu no vestibular - Genética

O que caiu no vestibular - Genética

Ratings: (0)|Views: 6,551|Likes:
Published by Professora Carol

More info:

Published by: Professora Carol on Jun 06, 2010
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/05/2013

pdf

text

original

 
 
O que caiu no vestibular ??
Genética- prof.
ª
Carol JUNHO de 2010- 2
º
E.M
1. (FUVEST 2010)
Há uma impressionante continuidade entre os seres vivos (...). Talvez o exemplo maismarcante seja o da conservação do código genético (...) em praticamente todos os seres vivos. Um
código genético de tal maneira “universal” é evidência de que todos os seres vivos são aparentados e
herdaram os mecanismos de leitura do RNA de um ancestral comum
Morgante & Meyer, Darwin e a Biologia,
O Biólogo
10:12
 –
20, 2009.
O termo “código genético” refere
-sea) ao conjunto de trincas de bases nitrogenadas, cada trinca correspondendo a um determinadoaminoácido.b) ao conjunto de todos os genes dos cromossomos de uma célula, capazes de sintetizar diferentesproteínas.c) ao conjunto de proteínas sintetizadas a partir de uma sequência específica de RNA.d) a todo o genoma de um organismo, formado pelo DNA de suas células somáticas e reprodutivas.e) à síntese de RNA a partir de uma das cadeias do DNA, que serve de modelo.2. (Unicamp 2010) Em famílias constituídas a partir da união de primos em primeiro grau, é mais alta aocorrência de distúrbios genéticos, em comparação com famílias formadas por casais que não têmconsanguinidade.a) A que se deve essa maior ocorrência de distúrbios genéticos em uniões consanguíneas?b) A fenilcetonúria (FCU) é um distúrbio genético que se deve a uma mutação no gene que expressa aenzima responsável pelo metabolismo do aminoácido fenilalanina. Na ausência da enzima, a fenilalaninase acumula no organismo e pode afetar o desenvolvimento neurológico da criança. Esse distúrbio éfacilmente detectado no recém-nascido pelo exame do pezinho. No caso de ser constatada a doença, aalimentação dessa criança deve ser controlada. Que tipos de alimento devem ser evitados: os ricos emcarboidratos, lipídeos ou proteínas?Justifique.3. (Unicamp 2010) Nos cães labradores, apenas dois genes autossômicos condicionam as cores preta,chocolate e dourada da pelagem. A produção do pigmento da cor preta é determinada pelo alelodominante
B
e a do pigmento chocolate, pelo alelo recessivo
b
. O gene
E
também in ter fere na cor doanimal, já que controla a deposição de pigmento na pelagem. A cor dourada é determinada pelogenótipo
ee
. Uma fêmea dourada cruzou com um macho chocolate e teve filhotes com pelagem preta efilhotes com pelagem chocolate, na mesma proporção. Quando essa mesma fêmea dourada cruzou comum macho preto, nasceram oito filhotes sendo um chocolate, três pretos e quatro dourados.a) Qual o genótipo da fêmea mãe? Identifique e expli que o tipo de interação gênica observa da entre osgenes envolvidos.b) Quais são os genótipos do cão preto (pai) e do seu filho te chocolate? Mostrar como chegouà resposta.
 
4. (UNESP 2010) Um estudante de biologia tem em seu quintal um lindo pé de malva-rosa (
Hibiscusmutabilis
), planta cujas flores apresentampétalas que são brancas pela manhã, quando a flor se abre, e vão se tornando de um cor-de-rosaintenso conforme o dia vai passando. Em um mesmo pé de malva-rosa, pode-se apreciar flores comcores de diferentes tons: desde as totalmente brancas, que acabaram de se abrir, até as totalmenterosas, abertas há várias horas.O estudante tem uma hipótese para explicar o fenômeno: ao longo do dia a radiação solar induzmutações genéticas nas células das pétalas, que as levam à alteração da cor; se flores já totalmente cor-de-rosa forem polinizadas com pólen de flores da mesma cor, ou seja, se a polinização ocorrer depois daocorrência das mutações, as sementes resultantes darão origem a plantas que produzirão apenas florescor-de-rosa.A explicação do estudante para a mudança da cor da pétala de malva-rosa e sua explicação para atransmissão hereditária dessa característica estão corretas? Justifique.5. (UNIFESP 2010) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vírus influenza A(H1N1), causando perdas econômicas, sociais e de vidas. O referido vírus possui, além de seusreceptores protéicos, uma bicamada lipídica e um genoma constituído de 8 genes de RNA.Considerando:1. a sequência inicial de RNA mensageiro referente a um dos genes deste vírus:
5’
AAAUGCGUUACGAAUGGUAUGCCUACUGAAU
3’
 2. a tabela com os códons representativos do código genético universal:responda:a) Qual será a sequência de aminoácidos que resultará da tradução da sequência inicial de RNAmensageiro, referente a um dos genes deste vírus indicada em 1?b) Considerando os mecanismos de replicação do genoma viral, qual a principal diferença entre o vírusda gripe e o vírus que causa a AIDS?6. (UFSCAR 2010) Considere que as abelhas da espécie
Partamona helleri 
possuem 34 cromossomos,sendo que as fêmeas originam-se por reprodução sexuada e os machos, por partenogênese. É esperadoque fêmeas e machos tenham nos núcleos de suas células somáticas, respectivamente,a) 34 e 17 cromossomos.b) 68 e 34 cromossomos.c) 17 e 34 cromossomos.d) 34 e 68 cromossomos.e) 51 e 17 cromossomos.
 
 
7. (PUC- SP 2010) Leia o texto com atenção:
Alternativa para daltonismo
Macacos daltônicos passaram a enxergar cores após terem sido submetidos a um tratamento baseadoem terapia genética. A novidade, descrita na edição desta quinta-feira (17/9) da revista
Nature
,demonstra o potencial da terapia para o tratamento de problemas de visão emhumanos. Os pesquisadores introduziram genes para fotopigmentação presentes em algumasfêmeas em células fotorreceptoras nas retinas de dois machos adultos. A introdução se deu por meio devírus inofensivos. Os genes produziram proteínas chamadas opsinas, que atuam para a produção, naretina, de pigmentos sensíveis ao vermelho e ao verde.Cinco semanas após o tratamento, testes físicos e comportamentais comprovaram que os animaispassaram a distinguir entre as cores verde e vermelho, o que não conseguiam fazer antes da terapiagenética.
(Extraído da Agência de Noticias da FAPESP, 17/09/2009)
Considerando as informações contidas no texto e supondo que esse tipo de daltonismo encontrado nosmacacos seja determinado geneticamente da mesma forma que na espécie humana, um estudante doEnsino Médio fez cinco afirmações. Assinale a única
ERRADA
.a) As fêmeas doadoras de genes produziam normalmente opsinas.b) As sequências de nucleotídeos introduzidas nas retinas dos dois machos controlaram, no interior dascélulas fotorreceptoras, os processos de transcrição e tradução gênica.c) Após o tratamento, os macacos receptores passaram a expressar gene dominante localizado nocromossomo X.d) Originalmente, os macacos receptores apresentavam gene recessivo localizado no cromosomo X.e) Os vírus utilizados como vetores no experimento foram responsáveis pela transferência de RNAmensageiro de fêmeas para machos.8- (UERJ-2010) Em uma pesquisa, cientistas extraíram amostras de DNA de três espécies diferentes edeterminaram suas relações (G=T) / (A=T), apresentadas na tabela abaixo.Em seguida, aqueceram-se as amostras e mediu-se atemperatura de desnaturação de cada uma delas. Sabe-seque, na temperatura de desnaturação, todas as pontes dehidrogênio entre as bases nitrogenadas estão rompidas.Identifique a amostra com maior temperatura dedesnaturação. Justifique sua resposta.
 
9- (FATEC-2010) Observe o heredograma a seguir que representa indivíduos albinos (afetados) e compigmentação normal (normais).
 
Hélio e Maria vão se casar.A chance de que o casal tenha uma filha albina, considerando que Maria é filha de pais heterozigotos, éa) zero. b) 1/12 c) 1/8 d) 1/6 e) ¼

Activity (37)

You've already reviewed this. Edit your review.
1 hundred reads
1 thousand reads
Sintia Moreira liked this
inês_damião liked this
Marcia Barret liked this
Matheus Pinho liked this
Gezy Junior liked this

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->