Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Look up keyword
Like this
9Activity
0 of .
Results for:
No results containing your search query
P. 1
ARN Salta Ala Escena

ARN Salta Ala Escena

Ratings: (0)|Views: 4,278|Likes:
Published by arcadia_hb

More info:

Published by: arcadia_hb on Sep 04, 2010
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

01/10/2013

pdf

text

original

 
44
ciencia
octubre-diciembre 2008
l siglo
XX
ha pasado a la historia como el siglodel gen. Y es que, empezando por el redescubri-miento de los trabajos de Mendel, que dieronorigen a la genética, pasando por la descripciónde la estructura del ácido desoxirribonucleico (
ADN
) ycerrando con la puesta en marcha del Proyecto Geno-ma Humano, el
ADN
acaparó la atención de variasgeneraciones de científicos, medios de comunicacióny público en general. Sin embargo, apenas iniciandoel siglo
XXI
, esta molécula está a punto de ser destro-nada por su “hermano incómodo”, el ácido ribonu-cleico (
ARN
), gracias al descubrimiento de una asom-brosa propiedad de ciertas moléculas de
ARN
llamada“interferencia”.Todo inició en la década de 1980, con varios estu-dios realizados en plantas: una serie de experimentosparticularmente interesantes, cuyo fin era obtener pe-tunias con colores más intensos. El color de los pétalosde las petunias, como en todas las flores, depende de laactividad de ciertos genes que contienen las instruc-ciones para elaborar las proteínas necesarias para laproducción de sustancias coloridas.Sin embargo, los pasos necesarios para pasar de unfragmento de
ADN
(el gen) a una proteína son máscomplicados de lo que parecen, y tienen como paso in-termedio la producción de una molécula de
ARN
llama-da
 ARN
mensajero
(
ARN
m). El
ARN
mensajero no es másque una copia de las instrucciones contenidas en elgen. A diferencia del
ADN
, que está permanentemen-te encerrado en el núcleo de la célula, el
ARN
mensa-jero puede viajar hacia el citoplasma, que es donde lasinstrucciones contenidas en él son traducidas para for-mar la proteína en cuestión.La idea que usaron los investigadores para aumentarel color de las petunias fue precisamente inducir la pro-ducción de grandes cantidades del
ARN
mensajero quecontiene la información para producir una de las pro-teínas responsables del color. Su idea era, lógicamente,que si se tenían más “órdenes de fabricación” se podríanproducir cantidades mayores de proteína, y por lo tantose obtendrían flores más coloridas. Pero para sorpresa detodos, lo que obtuvieron fueron flores práctica-mente blancas. Es decir, ¡al aumentar la can-tidad de
ARN
mensajero, se redujo lacantidad de proteína, en lugarde aumentar!A este fenómeno, en queuna molécula de
ARN
inter-fiere de alguna forma con lafunción de un determinadogen, se le llamó “interferen-cia de
ARN
”. Sin embargo, eldescubrimiento del fenóme-no de interferencia de
ARN
permaneció como una rarezaúnica de las plantas, una sim-ple paradoja más que nadiesupo cómo explicar; hasta 1998,cuando el mismo efecto fue obser-vado al alimentar gusanos de tierra(
Caenorhabditis elegans
) con fragmentosde
ARN
.
El
ácido ribonucleico
salta a la escena
Laura Angélica Díaz-Martínez
E
 
octubre-diciembre 2008
ciencia
45
El ácido ribonucleico salta a la escena
A partir de entonces, el uso de la interferencia de
ARN
se ha extendido de una forma explosiva, con másde cuatro mil artículos científicos sobre el tema en tansólo siete años, y ha sido descrito en una amplia varie-dad de seres vivos, incluyendo algas, hongos, animalesy plantas.
¿Cómo funciona la interferenciade
 ARN
?
El efecto de interferencia de
ARN
depende de unconjunto de proteínas llamado
RISC
, siglas de“Complejo de Silenciamiento Inducido por
ARN
(en inglés,
RNA
-Induced Silencing Complex
). Básica-mente, cuando se introducen pequeños fragmentos de
ARN
en una célula, esos fragmentos se unen al comple-jo
RISC
, que de alguna forma los estabiliza y permiteque los pedacitos de
ARN
“busquen”
ARN
mensajeroscomplementarios y se peguen a ellos por complemen-tariedad de bases (las bases son las “letras” que formanlas moléculas de ácido nucleico; la complementarie-dad es la propiedad que tienen las cadenas sencillas deácido nucleico de unirse a otras cadenas que tengan lasecuencia de bases “opuesta”, o complementaria. El
ADN
está compuesto por combinaciones de cuatrobases: adenina, guanina, citosina y timina, A, G, C yT. El
ARN
, por su parte, está también formado por cua-tro bases, con uracilo en vez de timina: A, G, C y U).
 
46
ciencia
octubre-diciembre 2008
Es decir, si un investigador decide introducir fragmentos de
ARN
con la siguiente secuencia:A G C U A A G C C G A C C U U A U A G G,entonces, un
ARN
mensajero que contenga la secuencia…U C G A U U C G G C U G G A A U A U C C…podría formar un
dúplex
(dos cadenas sencillas unidas por complementariedad para formar una cadena doble) conel fragmento de
ARN
de la siguiente manera (A se aparea con U, y C se aparea con G):A G C U A A G C C G A C C U U A U A G G…U C G A U U C G G C U G G A A U A U C C…Cuando el fragmento de
ARN
y el
ARN
mensajero se aparean, el complejo
RISC
funciona como un par detijeras que cortan el
ARN
mensajero. Los fragmentos de
ARN
mensajero son posteriormente destruidos por otrasproteínas, y el
ARN
mensajero desaparece (Figura 1).
Célula azulCélula blanca
RNA 
im
RNA 
complejo
RISC
Núcleo{genes}
m
RNA 
destruído (no hay proteína azul)El m
RNA 
produce proteína “azul”
UCGAUUCGGCUGGAAUAUCG
CGAUUCGGCUGGAAUAUCG
auucggcuggaauaucg
uucggcuggaauaucg
 
auucggcuggaauau
uucggcuggaauau
auucggcuggaauaucg
uucggcuggaauaucg
auucggcuggaauau
uucggcuggaauau
UCGAUUCGGCUGGAAUAUCG
CGAUUCGGCUGGAAUAUCG
UCGAUUCGGCUGGAAUAUCG
CGAUUCGGCUGGAAUAUCG
Figura 1.
El efecto de la interferencia de
 ARN
(ejemplo de las petunias azules)
. En condiciones normales, las células de la flor de laspetunias (célula de la izquierda) producen ciertas proteínas de color azul. Este proceso requiere la presencia de un gen que codifique esaproteína. Sin embargo, los genes están encerrados dentro del núcleo de la célula, y para que la proteína sea producida se necesita un pasointermedio: el ácido ribonucleico mensajero (
 ARN
m). El
 ARN
mensajero es una copia de las instrucciones del gen, y puede salir hacia el cito-plasma, en donde tras un complejo proceso llamado “traducción”, las instrucciones contenidas en el
 ARN
mensajero se usan para produciruna proteína (en este caso, proteína azul). Cuando se introducen a la célula pequeños pedazos de
 ARN
que son complementarios al
 ARN
mensajero, estos fragmentos de
 ARN
se unen al arn mensajero y son reconocidos por un complejo llamado
RISC
. Este complejo funcionacomo un par de tijeras que cortan el
 ARN
mensajero en cuestión, ocasionando su destrucción. Sin
 ARN
mensajero no hay proteína azul, y portanto las flores se vuelven blancas.
Comunicaciones libres

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->