Welcome to Scribd, the world's digital library. Read, publish, and share books and documents. See more
Download
Standard view
Full view
of .
Save to My Library
Look up keyword
Like this
23Activity
0 of .
Results for:
No results containing your search query
P. 1
El Ribosoma y la traducción genética

El Ribosoma y la traducción genética

Ratings: (0)|Views: 5,385 |Likes:
Published by arcadia_hb

More info:

Published by: arcadia_hb on Sep 04, 2010
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

11/18/2013

pdf

text

original

 
T
odo lo r o  r  uou oro d lo r rd ro: Eub-r, Arqu  Eur. El prmr roomprd ormo ululr múu-lo; por jmplo, l br
Escherichia coli 
 
Salmonella
 
typhimurium
,
 
 odo lo p-o humo d urlz br. Elro Arqu  ompo mbé d or-mo ululr d mño quprbl ld l br, pro mu dfr d lldd l puo d  boquímo. Aoum-br mdrr  mb o mprur odo quím xrm. El rod lo ormo  ur  l roEur, qu o  lo r o qu oo má fmlr: l pl, lo ml lo hoo.S o rmo  Eur,  prmr prrí qu l rup d ormo dfr dro d u mmo ro hub rlzdo d form prho. ¿Cmo pobl qu u ldur (ubro Fu)o luo u po (ubro Pl) ébjo l mm orí qu lo r hum-o (ubro Aml)? P  l drfí r dho ormo, l élul qulo ompo mur mjz ombro-. E fo, od l élul d ormouro (lo pr  Eur) oráulo, o fuo mu plzd,d lo qu r l élul d lo oro doro. Admá, od l élul uropo u úlo lulr, dl qu r lélul d Eubr  Arqu. E l úlo ur l form é,  form d ADN. E omprmlz dl mrléo o x  lo ro Eubr Arqu.S b  l lulr podmo orrmjz r ormo  prmr  dpr omo lo d lo r ubrouro,  l molulr l mjz má llá dl ro Eur. El rhoprdo molulr r lo r ro rflju mmo or oluo d lo r o.E rldd, qu ll  u má xrm o-u l orí d Drw obr l olu, h dubro r,  bu mdd, ludo dl rboom, u máqu bolmolulr qu hllmo  odo lo r o qu  por fu “rdur” l mrléo  ruo pr l élul [
véase 
 “Rborrupor”, por Jffr E. Brrk  Rold R. Brkr; Investigación y Ciencia,mrzo d 2007]. Edr l fu dl r-boom  dr l urlz dl mrléo, u ríz olu  l or d ld l  omo l oomo.
El ribosomay la traduccióngenética
El alto grado de conservación del ribosoma en todos los organismos indica que su temprana aparición fue crucial para el desarrollo de la vida. Además de traducir la información genética en proteínas, participa en la regulación de la expresión génica
Daniel A. Colón Ramos y Antón Vila Sanjurjo
CONCEPTOS BASICOS
El ribosoma es el orgánulocelular que traduce elcódigo genético eninstrucciones funcionales.El proceso ocurre en todoslos organismos.
Su estructura y su funciónno han variado muchodesde su aparición enla faz de la Tierra, en unperíodo anterior al sur-gimiento de las primerascélulas.
Sin embargo, poseetambién una versatilidadbioquímica que le permiteadaptar su función a lascircunstancias con que seenfrentan los organismos.
48
 
INVESTIGACIONYCIENCIA,
diciembre, 2009
 
EUBACTERIAARQUEAEUCARIA
 A prmr , lo do ádo ul-o, l ADN  l ARN, podrí prr ul. D hho, l ú dfr rllo  l pr d u áomo xr doxío  l ruur quím dl ARN.E pquñ dfr d lur  prop-dd boquím mu d, qu d lm l fu bol d d ud  moléul. El ADN, qu  orz lr d d dobl hél,  mu bl químm; ou, pu, uompuo dl pr l lmmo dform é, rz por l ul loormo  od l élul ul dlo r ro d l d.No pr,  mbro, qu l ADN hdo l moléul prm qu do lur l d. Srr d mrl éo rí lou d l rrí d l moléul prm-; l or rí l d por pdd duorrpl, lo ul rqur l hblddd podr drr ro quím d uo-mblj. L bldd quím dl ADN,qu  b l h rdo  u fu dlmmo d form  l élulul, ompor u r lm pru pdd lí.
El ARN y su “mundo”
El ARN mbé pud lmr formé, pro u ruur quím lo hmá bl qu l ADN. U propdd qu, mbro, l ofir pdd pr drrro quím. H mddo d looh  rí qu lo úo polímro lu-lr qu podí orolr ro quím, dr, o podr lío, r u rupo dproí domd zm. Fu oudo Tom Ch  Sd Alm, d lurdd d Colordo  Yl, obrroqu,  luo ormo, r moléuld ARN obrb ro quím. Sl dom rbozm, o zm d ARN.El dubrmo l l l prmo Nobl 1989  upuo u rolu  l oríobr l or d l d, l rr l ARNomo l moléul prm pz d umplrl fu d lmmo  rpl dform é.S r í l hp dl “mudo d ARN”, qu propo qu l r dl
1. PESE A LAS ENORMES DIFERENCIAS macros-cópicas y microscópicas entre ellos, los seresde los tres reinos de la vida, Arquea, Eubacteriay Eucaria, presentan sorprendentes semejanzasen el nivel molecular. El ribosoma, cuya estructurase ha conservado en muy buena medida a lo largode miles de millones de años de evolución de lavida, es uno de los más claros ejemplos.
 Salmonella Metanógenas Plantas, hongos y animales
   R   O   C   K   Y   M   O   U   N   T   A   I   N   L   A   B   O   R   A   T   O   R   I   E   S ,   N   I   A   I   D ,   N   I   H    (
   S   a    l   m   o   n   e    l    l   a
    )   ;   M   A   R   Y   L   A   N   D   A   S   T   R   O   B   I   O   L   O   G   Y   C   O   N   S   O   R   T   I   U   M ,   N   A   S   A   Y   S   T   S   c   I    (
   m   e   t   a   n    ó   g   e   n   a   s
    )   ;   R   Y   A   N   K   I   T   K   O ,   B   O   R   G   Q   U   E   E   N   Y   S   T   E   M   O   N   I   T   I   S   /   W   I   K   I   M   E   D   I   A   C   O   M   M   O   N   S    (
   r   e   i   n   o   e   u   c   a   r   i   a
    )
INVESTIGACIONYCIENCIA,
diciembre, 2009
49
 
50
 
INVESTIGACIONYCIENCIA,
diciembre, 2009
mudo prbo l mudo o  rlzpor mdo d moléul d ARN o p-dd d uorrpl. D urdo o orí, l proí  l ADN urropororm l flormo dl mudo d ARN. Auqu x mulud d o rpo  l hp,  d por roqu  l prmordl mudo d ARN x, ufil obro u z qu l ARN “prd” zr l prmr proí. Dd lrldd  l podro pdd líd l proí, é brí por rmplzrl ARN  l morí d l fuo z-má. Por u pr, l ADN rm poruur l ARN  l r d lmmod form.L olu dl ADN omo mrl -éo  d l proí omo prpl lío d l élul o lm d lélul l ARN. Mu l orro: do u qu o h  lo ormo modroproo má fudml qu l rdud l form é lmd  l ADN, r  l ul l ARN dmpñ uppl prpl, podrímo dr qu l ARN l molul rl d l d.
ARNr y traducción genética
El rboom  u ompljo o. Co- ormlm 3 o 4 d d ARN—l ARN rbomo (ARNr)—  u ú-mro rbl d proí, dpddo dlormo  u. Cro mo dl u dl ARNr  h ordo lo lro d l olu  ré d lo rro: Eubr, Arqu  Eur. Dl mm mr qu u boáo pudmrr lo llo dl roo d u árbol  dr u hor, u bloo molulrpud omprr l u rbomd do ormo  omprdr uhor olu. L u d ARNrou l má dlldo rho xd l olu d l d  l rr, dhí qu lo r ro d l d  hdfdo  prr d l ompr d u. L or d lo ARNr l, qu d  dr qu odo lo rboo-m x dd d u prmoproorrboom. S r qu l pr dlproorrboom mr  l olu l fldl “mudo dl ARN”  l prpo d lélul modr.
LA ESTRUCTURA DEL ARN Y LA LECTURA DEL CODIGO GENETICO
E
l ARN celular no forma largas cadenas de doble hélice como elADN. Raramente produce cadenas con complementariedadperfecta; es decir, un nucleótido de adenosina (A) de una cadena nosiempre se liga a uno de uracilo (U) de la otra, o uno de citosina (C)con uno de guanina (G). Esto no significa que sus bases no tiendantambién a emparejarse, ya que las bases del ARN no sólo se emparejansiguiendo la ley de la complementariedad, sino que explotan ademásotras posibilidades de interacción que el ADN no utiliza.La doble hélice de ARN se forma a través del emparejamiento depequeñas regiones complementarias pertenecientes a una mismacadena, como se observa en
 a
,correspondiente a un ARN detransferencia (ARNt) que codificaal aminoácido fenilalanina. Nóte-se la presencia de un empareja-miento de bases inusual G-U,marcado con un punto, y la deuna base modificada, wibutosina,representada por Y. (La presenciade bases modificadas es comúnen los ARNt.)Los ARNt portan su aminoáci-do correspondiente en su extremoaceptor. Esto se muestra en
 a
pormedio de la estructura molecularde la fenilalanina (
en rojo
) unidaal último nucleótido del ARNt. Al mismo tiempo, los ARNt se unenpor su extremo anticodón a su secuencia de bases complementaria(el codón) en el ARN mensajero (ARNm). En
 a
se muestra cómoel ARNt de la fenilalanina “lee” el codón que especifica a esteaminoácido, UUC. Tras un primer plegamiento de las cadenasde ARN a través de la formación de zonas discretas de doble hélice,la estructura tridimensional del polímero se complica medianteel establecimiento de otros tipos de interacciones entre sus nucleó-tidos. Se generan estructuras tridimensionales muy complicadas,como se muestra en
 b
.
   D   A   N   I   E   L   A .   C   O   L   O   N   R   A   M   O   S   Y   A   N   T   O   N   V   I   L   A   S   A   N   J   U   R   J   O
ACCCCGCUUAAGCGGAUUCCAGAGGUCUUAAAGUUUCCAUGGCUGAACUUA
Anticodón (ARNt)
Fenilalanina
Codón (ARNm)
YGACCGGGGCGAGUUGCUCCACAGGUGUC
 
CCCCCCH
2
C NH
2
COOHHCHHHH
Extremo aceptor
Estructuratridimensionaldel ARNde transferencia
Extremo anticodón
 a b

Activity (23)

You've already reviewed this. Edit your review.
Vannya Herrera liked this
1 hundred reads
1 thousand reads
Ivonne Carvajal liked this

You're Reading a Free Preview

Download
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->