CNCER DE PULMN

Curso de la ESO en espaol 17-18 febrero 2005 Coordinadores: M. Snchez-Cspedes, ES - R. Rosell, ES

Auditorio Centro Nacional de Investigacin Oncolgicas (CNIO) Melchor Fernndez Almagro, 3 28029 Madrid www.cnio.es
La reproduccin del material de este libro est condicionada a la obtencin previa del permiso correspondiente de los ponentes.

NDICE
Introduccin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Programa del curso . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lista de ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contribuciones de los ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Sesin I: Etiologa y bases moleculares del cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . Moderador: ngel Lpez-Encuentra Epidemiologa del cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jos Franco Factores de susceptibilidad al cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . Juan Miguel Barros Dios Carcingenos y origen del cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Julin Carretero Alteraciones gentico-moleculares en el cncer de pulmn . . . . . . . . . . . . . . . . . . . . Montserrat Snchez-Cspedes Telmeros y telomerasa en cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jean Charles Soria Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn . . . . . Esteve Fernndez-Muoz Sesin II: Alteraciones gentico-moleculares en cncer de pulmn: utilizacin clnica . . . . . . . Moderador: Rafael Rosell Clasificacin histolgica y lesiones preneoplsicas en cncer de pulmn . . . . . . . . . . . Jos Ramrez Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn . Luis M. Montuenga Factores pronsticos en cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ngel Lpez-Encuentra Aplicacin de las matrices de tejido ("tissue microarrays") al estudio de los carcinomas de pulmn no microcticos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fernando Lpez-Ros Metilacin y cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Manel Esteller Sesin III: Perspectivas de las nuevas terapias en cncer de pulmn . . . . . . . . . . . . . . . . . . Moderador: Montserrat Snchez-Cspedes Dianas moleculares y nuevas terapias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rafael Rosell Factores de resistencia a quimioterapia en cncer de pulmn . . . . . . . . . . . . . . . . . . Miquel Taron Terapia gnica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Noem Regart Cuidados de enfermera en las nuevas modalidades teraputicas . . . . . . . . . . . . . . . . Ana Jimnez Avances en el manejo multimodal del cncer de pulmn no microctico . . . . . . . . . . . Pilar Garrido Actualizacin del tratamiento de cncer de pulmn . . . . . . . . . . . . . . . . . . . . . . . . . Jos Miguel Snchez
ndice

7 8 10 13 13 15 23 39 45 51 71 81 83 89 111

. . . . . . . . . . .

. . . . . . . . .

129 135 155 157 195 205 213 231 247

Introduccin

En primer lugar les damos nuestra ms cordial bienvenida a este segundo curso de la Escuela
Europea de Oncologa (ESO) en el CNIO sobre cncer de pulmn. El primero, que vers sobre cncer de mama, se celebr en octubre de 2003. El cncer de pulmn es la primera causa de muerte por cncer en los pases occidentales. El factor etiolgico responsable de la mayor parte de los casos es el tabaco. Durante este curso, adems del efecto de los carcingenos del tabaco se tratar de los genes alterados en los tumores pulmonares as como de otras anormalidades moleculares que tienen lugar durante el desarrollo de este tipo de cncer. El pronstico de los pacientes con cncer de pulmn depende claramente del estadio tumoral en que se diagnostica la enfermedad. Varios estudios han demostrado que es posible detectar alteraciones genticas y moleculares en lavados broncoalveolares de pacientes con cncer de pulmn y se estn llevando a cabo trabajos prospectivos que determinarn su posible uso en el diagnstico precoz de este tipo de cncer. Otras investigaciones revelan factores moleculares relacionados con la respuesta a la terapia, los patrones de toxicidad y el pronstico del enfermo de cncer de pulmn. Como consecuencia de los estudios dedicados a la elucidacin del conjunto de alteraciones genticas y de las vas moleculares que producen la formacin de un tumor esperamos que se produzcan mejoras en el tratamiento del cncer en un futuro no muy lejano. Algunos de estos esfuerzos ya han dado sus frutos con el diseo de drogas dirigidas a alteraciones genticas concretas, como es el caso del frmaco STI571 para el tratamiento de la Leucemia Mieloide Crnica. Durante el curso se presentarn los frmacos que actualmente se estn ensayando o se estn desarrollando para el tratamiento del cncer de pulmn. La contribucin de cada ponente en esta publicacin ha sido especificada en la por tadilla correspondiente. Esperamos sinceramente les sirva de referencia en el estudio de esta neoplasia.

Un saludo muy cordial,

Montserrat Snchez-Cspedes Jefe del Grupo de Cncer de Pulmn CNIO Rafael Rosell Jefe del Servicio de Oncologa Mdica Institut Catal dOncologia, Hospital Germans Trias i Pujol,
Introduccin 7

PROGRAMA

Jueves 17 de febrero 15.00 Bienvenida Miguel ngel Piris Etiologa y bases moleculares del cncer de pulmn Moderador: ngel Lpez-Encuentra Epidemiologa del cncer de pulmn Jos Franco Factores de susceptibilidad al cncer de pulmn Juan Miguel Barros Dios Carcingenos y origen del cncer de pulmn Julin Carretero Caf Alteraciones gentico-moleculares en el cncer de pulmn Montserrat Snchez-Cspedes Telmeros y telomerasa en cncer de pulmn Jean Charles Soria Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn Esteve Fernndez

Sesin I: 15.10 15.50 16.30

17.10 17.50 18.30 19.10

Viernes 18 de febrero Sesin II: Alteraciones gentico-moleculares en cncer de pulmn: utilizacin clnica Moderador: Rafael Rosell 09.00 09.40 Clasificacin histolgica y lesiones preneoplsicas en cncer de pulmn Josep Ramrez Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn Luis M. Montuenga

Cncer de pulmn

10.20 11.00 11.40

Caf Factores pronsticos en cncer de pulmn ngel Lpez-Encuentra Aplicacin de las matrices de tejido ("tissue microarrays") al estudio de los carcinomas de pulmn no microcticos Fernando Lpez-Ros Metilacin y cncer de pulmn Manel Esteller Almuerzo

12.20

13.00

Sesin III: Perspectivas de las nuevas terapias en cncer de pulmn Moderador: Montserrat Snchez-Cspedes 14.30 15.10 Dianas moleculares y nuevas terapias Rafael Rosell Factores de resistencia a quimioterapia en cncer de pulmn Miquel Taron Caf Terapia gnica Noem Regart Cuidados de enfermera en las nuevas modalidades teraputicas Ana Jimnez Avances en el manejo multimodal del cncer de pulmn no microctico Pilar Garrido Actualizacin del tratamiento de cncer de pulmn Jos Miguel Snchez

15.50 16.20 17.00 17.40 18.20

Programa

PONENTES

Juan Miguel Barros Dios (mrbarros@usc.es) Universidad de Santiago de Compostela, Santiago de Compostela, ES

Julin Carretero (jcarretero@cnio.es) Centro Nacional de Investigaciones Oncolgicas, Madrid, ES

Manel Esteller (mesteller@cnio.es) Centro Nacional de Investigaciones Oncolgicas, Madrid, ES

Esteve Fernndez (efernandez@iconcologia.catsalut.net) Institut Catal d'Oncologia y Universitat de Barcelona, Barcelona, ES

Jos Franco (franco_jos@gva.es) Hospital Clnico Universitario, Valencia, ES

Pilar Garrido (pgarrido.hrc@salud.madrid.org) Hospital Ramn y Cajal, Madrid, ES

Ana Jimnez (ajimenezarate@hotmail.com) Institut Catal d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

ngel Lpez-Encuentra (lencuent@h12o.es) Hospital Universitario 12 de Octubre, Madrid, ES

Fernando Lpez-Ros (flopezrios.hdoc@salud.madrid.org) Hospital Universitario 12 de Octubre, Madrid, ES

10

Cncer de pulmn

Luis M. Montuenga (lmontuenga@unav.es) Centro de Investigacin Mdica Aplicada, Universidad de Navarra, Pamplona, ES

Miguel ngel Piris (mapiris@cnio.es) Centro Nacional de Investigaciones Oncolgicas, Madrid, ES

Jos Ramirez (JRAMIREZ@clinic.ub.es) Hospital Clinic, Universitat de Barcelona, ES

Noem Regart (32497nra@comb.es) Institut Catal d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Rafael Rosell (rrosell@ns.hugtip.scs.es) Institut Catal d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Jos Miguel Snchez (jmst@ns.hugtip.scs.es) Institut Catal d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Montserrat Snchez-Cspedes (msanchez@cnio.es) Centro Nacional de Investigaciones Oncolgicas, Madrid, ES

Jean-Charles Soria (soria@igr.fr) Institut Gustave-Roussy, Paris, FR

Miquel Taron (mtaron@saludalia.com) Institut Catal d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Ponentes

11

Sesin 1 ETIOLOGA Y BASES MOLECULARES DEL CNCER DE PULMN Moderador: ngel Lpez-Encuentra

EPIDEMIOLOGA DEL CNCER DE PULMN

Jos Franco Hospital Clnico Universitario, Valencia

Contenido: Resumen de la ponencia Bibliografa Artculo del ponente

Epidemiologa del cncer de pulmn

Jos Franco
Servicio de Neumologa Hospital Clnico Universitario, Valencia

l tabaco es la causa principal de cncer de pulmn, siendo responsable de ms del 90% de los casos no slo directamente sino indirectamente (tabaquismo pasivo) y en asociacin con otras sustancias. Existen otras causas (polucin ambiental, laboral o en los hogares) y factores modificadores del riesgo individual como la dieta o la susceptibilidad gentica. Sin embargo, el consumo de cigarrillos es el elemento que confiere el carcter de epidemia a la enfermedad. Adems, debido a la clara relacin entre tabaco y cncer de pulmn, se puede considerar al cncer de pulmn como marcador del tabaquismo de una poblacin.

El hbito de fumar se ha iniciado en momentos diferentes y ha seguido patrones distintos segn las caractersticas culturales y socioeconmicas de cada pas. En pases como Estados Unidos o el Reino Unido se adquiri tempranamente en el siglo XX, primero en varones y poco despus en mujeres, y comenz a declinar en los aos 60. En Espaa sin embargo, se desarroll tardamente respecto a estos pases y las mujeres se incorporaron a fumar mucho despus que los varones. La supervivencia global del cncer de pulmn es baja (slo del 10-13% a los 5 aos) y no ha cambiado sustancialmente durante las ltimas 2 dcadas a pesar del desarrollo de tratamientos multidisciplinarios en pacientes con estadios ms avanzados de la enfermedad. Esto determina una estrecha correlacin entre incidencia y mortalidad, de manera que se puede estudiar la evolucin de la epidemia en una poblacin dada a partir de los datos de mortalidad. El hbito de fumar se establece generalmente a una edad temprana y tiende a seguir patrones especficos para cada generacin (hbito generacional). Adems existe un largo perodo de latencia de unos 30 aos entre el establecimiento del hbito de fumar y el desarrollo de la enfermedad, que se manifiesta de forma ms temprana en los individuos ms jvenes y se extiende posteriormente a los de mayor edad. As, de la misma manera que los datos de mortalidad por cncer de pulmn son un indicador del hbito tabquico de la poblacin durante las dcadas pasadas, tambin los cambios recientes en el hbito de fumar junto con las tendencias de la mortalidad en las jvenes generaciones permiten predecir el curso de la epidemia en el futuro. Segn datos de la Encuesta Nacional de Salud, el consumo de tabaco en la poblacin espaola mayor de 16 aos ha disminuido en hombres del 64% en 1978 al 42% en 2001 y ha aumentado en mujeres del 17% en 1978 al 27,2% en 2001. Este diferente comportamiento respecto al tabaco segn el gnero se refleja tambin en las tasas de mortalidad por cncer de pulmn. En hombres, la tasa estandarizada para todas las edades se ha doblado en las ltimas dcadas (de 31,4 x 100.000 en 1973 a 64,2 en 2001). Sin embargo, en mujeres las tasas han permanecido bajas hasta recientemente (6,3 en 1973 y 6,4 en 1997) difiriendo apenas de lo esperado en una poblacin nunca fumadora, pero en los ltimos aos empieza a observarse un incremento significativo (7,6 en 2001). Respecto a las tasas especficas por edad, en varones se observan incrementos en todos los grupos mayores de 35 aos, pero en los ms jvenes (30-34 aos) la mortalidad ha disminuido desde 1988. En mujeres el patrn es muy diferente: las tasas disminuyen en la mayora de los grupos de edad hasta finales de la dcada de los 80 y despus aumentan significativamente en los grupos ms jvenes. Debido al carcter generacional del hbito tabquico, el estudio de la mortalidad mediante modelos edad-periodo-cohorte constituye una aproximacin ms exacta a la evolucin de la epidemia
Epidemiologa del cncer de pulmn 17

de cncer de pulmn. Utilizando este mtodo se puede observar que el efecto cohorte aumenta en varones hasta las generaciones nacidas alrededor de 1952, y despus la mortalidad disminuye ligeramente en los ms jvenes. En mujeres, sin embargo, el efecto cohorte disminuye hasta las generaciones nacidas en 1932 y aumenta de forma marcada a partir de 1942. En resumen, sobre la base de las variaciones de la mortalidad en las jvenes generaciones y los datos sobre el consumo de tabaco se pueden esperar cambios de tendencia en la evolucin de la epidemia de cncer de pulmn en Espaa. As, en mujeres, el incremento de mortalidad observado en las ms jvenes seala el comienzo de la epidemia de cncer de pulmn debido al continuo aumento de la prevalencia de mujeres fumadoras. Por el contrario en hombres, considerando la leve disminucin de la mortalidad en los ms jvenes, es posible prever una evolucin ms favorable de la epidemia si la prevalencia de tabaquismo sigue disminuyendo. Por ltimo, la discreta pero significativa disminucin de la mortalidad observada en mujeres hasta finales de los aos 80 podra estar relacionada con una menor exposicin al tabaquismo pasivo en casa como consecuencia de la disminucin del nmero de varones fumadores.

Bibliografa:
Bray F, Tyczynski JE, Parkin DM. Going up or coming down? The changing phases of the lung cancer epidemic from 1967 to 1999 in the 15 European Union countries. Eur J Cancer. 2004 Jan; 40(1):96-125. Franco J, Prez-Hoyos S, Plaza P. Changes in lung-cancer mortality trends in Spain. Int J Cancer. 2002 Jan 1; 97(1):102-5.

18

Cncer de pulmn

Int. J. Cancer: 97, 102105 (2002) 2002 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

CHANGES IN LUNG-CANCER MORTALITY TRENDS IN SPAIN

1

Jose FRANCO1*, Santiago P REZ-HOYOS2 and Pedro PLAZA3 E Servicio de Neumologa, Hospital Clnico Universitario, Valencia, Spain 2 Escuela Valenciana de Estudios para la Salud, Valencia, Spain 3 Servicio de Neumologa, Hospital Universitario Dr. Peset, Valencia, Spain
Several changes in smoking patterns over the past decades in Spain can be expected to result in a shift in lung-cancer mortality rates. We examined time trends in lung-cancer mortality from 19731997 using a log-linear Poisson ageperiod-cohort model. The standardized lung-cancer mortality rate for men almost doubled, from 31.4 per 100,000 in 1973 to 58.6 in 1997, with an average annual increase of 2.7%. Mortality increased for male generations born until 1952 as a consequence of the increasing cigarette smoking in successive birth cohorts. However, the slight downward trend observed for the 2 youngest generations suggests a more favorable outcome of the lung-cancer epidemic among Spanish males in the coming years, if this trend continues. For women, mortality rates were 5 to 9 times lower than those for men, 6.3 per 100,000 in 1973 and 6.4 in 1997. However, the increasing mortality among younger generations born since 1942 reects the rise in the prevalence of smoking women during the last decades and can be expected to spread to older age groups as a cohort effect, indicating the early phase of the smoking-related lung-cancer epidemic among Spanish females. The decreasing mortality trend observed in women until the late 1980s could be attributed to a lower exposure to environmental tobacco smoke at home as a result of a signicant reduction in the prevalence of smoking men. 2002 Wiley-Liss, Inc. Key words: lung-cancer mortality; Spain; smoking habits; age-period-cohort model; time trends

In Mediterranean countries and in Spain since 1990, malignant tumors are the leading cause of death, whereas heart diseases are placed second.1 Lung cancer is the most frequent fatal cancer among men in Spain2 as well as in many other developed countries. Because of the poor survival from lung cancer, there is a close correlation between incidence and mortality. The overall 5-year survival rate of 10 13% has not changed over the past 2 decades, though the implementation of multimodality therapy in locally advanced disease has begun to modestly improve survival in patients with more advanced stages of disease.3 Cigarette smoking plays a dominant role in lung-cancer causation, being responsible for up to 90% of the lung-cancer epidemic, not only directly but indirectly (passive smoking) and in association with other substances such as asbestos and radon.4 Smoking patterns have changed markedly and in different directions in several countries over the past decades; therefore, time trends in lung-cancer mortality differ between countries, cohorts and sexes.5 Several changes in smoking habits in Spain, such as a decline in the prevalence of smoking among men and a rise among women, can be expected to result in a shift in lung-cancer mortality trends. Because tobacco smoking habits are generally established at an early age and are characteristic for a given birth cohort,5 the development of the lung-cancer epidemic can be analyzed most accurately by studying age-specic rates by birth cohort.6 We analyzed trends in lung-cancer mortality in Spain from 19731997, using a Poisson log-linear age-period-cohort model.
MATERIAL AND METHODS

tions of the Instituto Nacional de Estadstica (INE, National Insti tute of Statistics). The population was that estimated at 1 July of each year by the INE based on ofcial censuses. Deaths from lung cancer corresponded to code 162 of the International Classication of Diseases, Eighth and Ninth Revisions (ICD-8 and ICD-9). From these data, age-specic death rates for 5 calendar periods of 5 years each (19731977 to 19931997) and 9 age groups of 5 years each (30 34 to 70 74 years) were derived. Using this classication of age and time, 13 overlapping birth cohorts of 10 years each were identied and dened according to the central year of birth (1902/3 to 1962/3). Because death certication is less reliable at elderly ages and problems arise from random variation from small numbers at young ages, only the age groups between 30 and 74 years were considered.7 Age-standardized mortality rates were calculated for men and women using the direct method with the Spanish population of 1980 as the reference. The percent annual change in age-specic rates was calculated from a regression equation after transforming the dependent variable (single calendar year rate) into natural logarithms, with the year as the independent variable. The coefcient B (slope) in the equation with a 95% condence interval (CI) was considered the mean annual percentage of variation. Based on the matrix of lung-cancer deaths and population broken down by 5-year calendar period and age group, the effects of age, period and cohort were calculated through a log-linear Poisson model tted using the S-PLUS program (Insightful Corp., Seattle, WA) with the appropriate macro adapted from the Decarli and La Vecchia8 GLIM macro. Estimates were derived from the model, including the 3 factors that minimize the sum of the Euclidean distances from the 3 possible 2-factor models: age period (AP), age cohort (AC) and cohort period (CP). The procedure of minimization is based on the least squares weighted on the inverse of the log-likelihood of each 2-factor model.7 Log-likelihood ratio statistics (deviance) were used to test the goodness of t, while the difference between 2 models was tested by comparing the change in the deviance with the degrees of freedom. This test, however, often indicates lack of t in population-based data even when the model appears qualitatively to describe the data well since the number of events (deaths) is often large, so even small departures from the model are detected.9 Assuming no period or cohort slope, the average of the period values was xed at unity, as was the average of the cohort values; thus, age values were of the same order of magnitude as agespecic rates.7 Because age, period and birth cohort variables are arithmetically interrelated, knowing 2 of them xes the third, implying that the chosen solution is not unique,10 a problem known as nonidenti*Correspondence to: Servicio de Neumologa, Hospital Clnico Univer sitario, Avda. Vicente Blasco Ib nez 17, 46010 Valencia, Spain. a Fax: 34-96 3862657. E-mail: jfs01v@nacom.es Received 4 July 2000; Revised 17 April, 19 July 2001; Accepted 30 July 2001

Population gures and data on deaths from lung cancer in Spain during the period 19731997 were obtained from ofcial publica-

LUNG-CANCER MORTALITY IN SPAIN

103

FIGURE 1 Age-standardized lung-cancer mortality rates for men and women in Spain, from 19731997.
TABLE I GOODNESS OF FIT FOR AND COMPARISONS BETWEEN DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS OF LUNG-CANCER MORTALITY FOR MALES IN SPAIN Model Residual Deviance d.f. Deviance Change d.f. p

FIGURE 2 Age-specic lung-cancer mortality rates by 5-year age intervals and birth cohort for Spanish males.

Age (A) Age-period (AP) Age-cohort (AC) Age-period-cohort (APC)

6,031.9 390.4 437.9 70.4

36 32 24 21

5,641.5 5,594.0 320.0 367.5

4 12 11 3

0.0011 0.0012 0.0013 0.0014

1 A vs. AP.2A vs. AC.3AP vs. APC.4AC vs. APC. d.f., degrees of freedom.

TABLE II GOODNESS OF FIT FOR AND COMPARISONS BETWEEN DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS OF LUNG-CANCER MORTALITY FOR FEMALES IN SPAIN Model Residual Deviance d.f. Deviance Change d.f. p

Age (A) Age-period (AP) Age-cohort (AC) Age-period-cohort (APC)

187.7 118.3 70.6 26.7

36 32 24 21

69.4 117.1 91.6 43.9

4 12 11 3

0.0011 0.0012 0.0013 0.0014

FIGURE 3 Results of age, period and cohort modeling for Spanish men. Age values are expressed as rates per 100,000 population. Period-of-death and cohort-of-birth values are expressed in relative terms against their weighted average set to unity.

1 A vs. AP.2A vs. AC.3AP vs. APC.4AC vs. APC. d.f., degrees of freedom.

ability of parameters. Moreover, when the majority of age-specic rates are in the same direction, both cohort-of-birth and period-ofdeath patterns are similar and it is difcult to establish whether the major underlying trend is a cohort or period effect. Consequently, the results of the model should be chiey viewed as a guide toward summarizing overall tendencies, and age-specic rates should be considered before any conclusions are drawn.7
RESULTS

The standardized lung-cancer mortality rate for men almost doubled over the study period, from 31.4 per 100,000 in 1973 to 58.6 in 1997, with an average annual increase of 2.7% (95% CI 2.4 3.0). For women, mortality rates were 5 to 9 times lower than that for men (Fig. 1), 6.3 and 6.4 per 100,000 in 1973 and 1997, respectively; there was a slight annual decrease of 0.7% (95% CI

1.1 to 0.3) until 1988 and then an increase of 1.5% (95% CI 1.11.9) annually. Age-specic trends in lung-cancer mortality rates for men showed a statistically signicant annual increase over the whole study period in all groups aged 35 years and over, ranging from 2.1% (95% CI 1.8 2.4) annually for the age group 65 to 69 years to 4.5% (95% CI 3.75.2) for the age group 40 to 44 years. In the youngest group (30 34 years), rates increased until 1988, with an opposite trend thereafter of 5.4% (95% CI 10.1 to 0.7) annually. For women, the patterns were quite different: age-specic mortality rates showed a statistically signicant decrease over the whole study period in groups aged 55 years and over, ranging from 0.5% (95% CI 0.1 to 0.9) annually among 70- to 74-year-olds to 1.0% (95% CI 0.3 to 1.6) among 55- to 59-year-olds; this decline was also observed until 1984 for groups aged 35 to 54 years. However, since 1984, rates have increased signicantly in younger groups (30 49 years), ranging from 3.9% (95% CI 1.6 6.1) annually in 45- to 49-year-olds to 7.9% (95% CI 3.6 12.1) in 35- to 39-year-olds. Tables I and II show the goodness of t (scaled deviances) for the age-period-cohort models and comparisons between models. Mortality trends for both genders were better explained by the full

104

FRANCO ET AL.

FIGURE 6 Prevalence of smoking among men and women aged 16 years and above in Spain, from 1978 1997.

FIGURE 4 Age-specic lung-cancer mortality rates by 5-year age intervals and birth cohort for Spanish females.

FIGURE 5 Results of age, period and cohort modeling for Spanish women. Age values are expressed as rates per 100,000 population. Period-of-death and cohort-of-birth values are expressed in relative terms against their weighted average set to unity.

age period cohort (APC) model, though the APC model t mortality data only for women (deviance 26.7 on 21 degrees of freedom, p 0.18). For men, deviances were greater than those for women and the APC model did not t, probably due to the large number of deaths, though overdispersion could exist. One must be cautious with the interpretation of the multiplicative age, period and cohort effects resulting from the modeling. Both period and cohort effects were statistically signicant for men and women when the APC model was compared with the AC or AP submodel. As expected, mortality increased with age in both sexes. For men (Figs. 2, 3), the cohort effect was steadily upward to the cohort born around 1952, with a slight reversal downward for the 2 youngest generations; also, a rising period effect was observed up to 1992. For women (Figs. 4,5), cohort values decreased moderately until the cohort born around 1932, then leveled off and increased for young women born since 1942; moreover, there was evidence of a period effect downward until 1987 and upward thereafter.
DISCUSSION

Recent changes in mortality from lung cancer are mainly related to changes in smoking patterns over the past decades.11 Unfortu-

nately, in Spain, question-based studies on the general publics tobacco consumption are available only since 1978. Rates observed in young adults should reect recent carcinogenic exposure and can be expected to spread to older age groups in future years12 because smoking habits tend to be a characteristic of particular generations. Our analysis of lung-cancer mortality in Spain shows different trends for men and women. In men, mortality increased for generations born up to 1952 as a consequence of the increasing cigarette smoking in successive birth cohorts. However, the decrease in the prevalence of smoking men (Fig. 6) from 64% in 1978 to 45% in 199713,14 and the slight decrease in mortality for the youngest cohorts observed in our study suggest a more favorable outcome of the lung-cancer epidemic among Spanish males in the coming years, though major efforts to discourage tobacco use should be made so that the decreasing trend in the number of smoking men continues. The relative risk of lung cancer decreases following smoking cessation,15 and the impact of the decline in cigarette smoking on lung-cancer mortality would be expected to show up rst in the younger groups as a cohort effect. The downturn in cigarette consumption since the 1960s combined with lower tar content of cigarettes was a clear precursor to the decline in lung-cancer mortality rates in the United States and the United Kingdom.6 According to data from Tabacalera, a state owned company that monopolized the tobacco market in Spain until 1998, the continuous increase in cigarette sales began to decline in the early 1990s, with a decrease of 17.1% from 2,685.5 cigarettes per adult aged 15 years and older in 1991 to 2,226.2 in 1996.16,17 However, sales of black tobacco, which has been related to a higher risk of lung cancer in case-control studies,18 decreased over the last decades, falling from 94% of total sales in 1961 to 31.3% in 1996, being replaced by Virginia tobacco. The low lung-cancer mortality rate observed among Spanish women differs hardly at all from what might be expected if none had ever smoked, suggesting that few of their lung-cancer deaths are still due to smoking.19 However, the increasing mortality among younger generations born since 1942 reects the rise in tobacco consumption among females during the last decades and can be expected to spread to older age groups in the coming years as a cohort effect. The increasing prevalence of smoking women (Fig. 6) by 58.8%, from 17% in 1978 to 27% in 1997,13,14 and the upward mortality trend in young adult life indicate the early phase of the smoking-related lung-cancer epidemic among females. The later onset of the epidemic in Spain compared with other developed countries can be attributed to smoking having become widespread among women only in the last few decades as well as to the

LUNG-CANCER MORTALITY IN SPAIN

105

latency period between the onset of exposure and the development of disease. The small but statistically signicant decrease of mortality observed in Spanish women until 1988 is difcult to explain.5 Although caution is warranted in making inferences on the basis of statistical modeling,20 the age-period-cohort analysis shows a cohort effect for generations born up to 1932, aside from the decrease in mortality with the period of death up to 1987. In addition, age-specic rates decreased continuously for women aged 55 years and over and until the mid-1980s for younger women. In countries with a female population that smokes relatively rarely and a high male smoking prevalence, the risk and population burden of lung cancer due to environmental tobacco smoke (ETS) are considered relatively important.21 Therefore, because of the reduction in the prevalence of smoking men in Spain, we can hypothesize that the decreasing mortality trend observed in women might be related to changes in exposure to ETS at home, though we cannot exclude a role of other modiable risk factors, such as domestic radon, dietary factors, occupational carcinogens and air contamination. Exposure to ETS from a spouse is a risk factor for lung cancer among nonsmoking women, and the risk increases consistently with increasing levels of exposure.22 In Spain, for some decades, while smoking was rare among women, a great number of nonsmoking wives would have been exposed to ETS from their husbands smoking. Changes in the prevalence of risk factors usually alter the pattern of risk seen among birth cohorts; however, a substantial decrease in a relatively common carcinogenic exposure could cause a calendar-period decrease in risk after a sufcient latency period. The effect of reducing tobacco carcinogen exposure on the late stage of the carcinogenic process will be seen soon after the change in exposure.20 The risk of lung cancer decreases with time since cessation of ETS exposure, and there is no detectable risk

after a 15-year period.23 Therefore, once a signicant number of smoking men quit, the reduction in risk for wives decreases as a cohort effect and, by affecting all age groups simultaneously, can be manifest also as a period effect. Thus, the decreasing lungcancer mortality trend observed among Spanish women until the late 1980s could be attributed to a lower exposure to ETS at home as a result of a signicant reduction in the prevalence of smoking men. The quality of ofcial data on mortality can be affected in different ways. Changes in the international death classication rules or inaccuracy in certication may lead to variation in mortality statistics. Two ICD revisions came into force in Spain during the study period; but code 162, assigned to malignant tumors of the trachea, bronchus and lung, remains unchanged for both ICD-8 and ICD-9 revisions. Previous studies on the quality of death certicates in Spain have shown reliable data on the cause of death with regard to malignant tumors.24,25 In summary, on the basis of the variations observed among younger generations, changes in the epidemiologic trends of lungcancer mortality rates can be expected in Spain. The upward trend observed in younger women shows the beginning of the smokingrelated lung-cancer epidemic due to the continuous increase in the prevalence of smoking women. Conversely, considering the decreasing tobacco consumption among men and the decline in mortality observed in the youngest, an opposite downward trend can be expected if the prevalence of smoking men continues to diminish. The decrease in mortality observed for women until the late 1980s could be related to a lower spousal ETS exposure.
ACKNOWLEDGEMENTS

We thank Dr. V. Moreno from Institut Catala dOncologia for ` providing the S-PLUS macro.

REFERENCES

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

Alonso I, Regidor E, Rodrguez C, et al. Principales causas de muerte en Espa a, 1992. Med Clin (Barc) 1996;107:4415. n Fern ndez E, Borr s JM, Levi F, et al. Mortalidad por c ncer en a a a Espa a, 19551994. Med Clin (Barc) 2000;114:449 51. n Reif MS, Socinski MA, Rivera MP. Evidence-based medicine in the treatment of non-small-cell lung cancer. Clin Chest Med 2000;1:107 20. Yesner R. Pathogenesis and pathology. Clin Chest Med 1993;1:17 30. Coleman MP, Esteve J, Damiecki P, et al. Trends in cancer incidence and mortality. IARC Sci Publ 121. Lyon: IARC, 1993. Kubik AK, Parkin DM, Plesko I, et al. Patterns of cigarette sales and lung cancer mortality in some central and eastern European countries, 1960 1989. Cancer 1995;75:2452 60. La Vecchia C, Negri E, Levi F, et al. Cancer mortality in Europe: effects of age, cohort of birth and period of death. Eur J Cancer 1998;34:118 41. Decarli A, La Vecchia C. Age, period and cohort models: review of knowledge and implementation in GLIM. Riv Stat Appl 1987;20:32 46. Moolgavkar SH, Lee JAH, Stevens RG. Analysis of vital statistics data. In: Rothman KJ, Greenland S. Modern epidemiology. New York: Raven Press, 1998. 48197. Osmond C. Using age, period and cohort models to estimate future mortality rates. Int J Epidemiol 1985;14:124 9. Bailar JC, Gornik HL. Cancer undefeated. N Engl J Med 1997;336: 1569 74. Doll R. Progress against cancer: an epidemiologic assessment. Am J Epidemiol 1991;134:675 88. Regidor E, Rodrguez C, Guti rrez-Fisac JL. Indicadores de Salud. e Tercera evaluaci n en Espa a del programa regional europeo Salud o n para todos. Madrid: Ministerio de Sanidad y Consumo, 1995.

14. Ministerio de Sanidad y Consumo. Encuesta Nacional de Salud de Espa a 1997. Madrid: Ministerio de Sanidad y Consumo, 1999. n 15. Halpern MT, Gillespie BW, Warner KE. Patterns of absolute risk of lung cancer mortality in former smokers. J Natl Cancer Inst 1993;85: 457 64. 16. Tabacalera SA. Series hist ricas de consumo de tabaco elaborado, o 19571991. Madrid: Tabacalera SA, 1992. 17. Tabacalera SA. Memoria de actividades, 19921996. Madrid: Tabacalera SA, 1997. 18. Armadans-Gil I, Vaqu -Rafart J, Rossell J, et al. Cigarette smoking e o and male lung cancer risk with special regard to type of tobacco. Int J Epidemiol 1999;28,614 9. 19. Peto R, L pez AD, Boreham J, et al. Mortality from tobacco in o developed countries: indirect estimation from national vital statistics. Lancet 1992;339:1268 78. 20. Jemal A, Chu KC, Tarone RE. Recent trends in lung cancer mortality in the United States. J Natl Cancer Inst 2001;93:277 83. 21. Lee CH, Ko YC, Coggins W, et al. Lifetime environmental exposure to tobacco smoke and primary lung cancer of non-smoking Taiwanese women. Int J Epidemiol 2000;29:224 31. 22. Zhong L, Goldberg MS, Parent ME, et al. Exposure to environmental tobacco smoke and the risk of lung cancer: a meta-analysis. Lung Cancer 2000;27:318. 23. Boffetta P, Agudo A, Ahrens W, et al. Multicenter case-control study of exposure to environmental tobacco smoke and lung cancer in Europe. J Natl Cancer Inst 1998;90:1440 50. 24. Benavides FG, Bolumar F, Peris R. Quality of death certicates in Valencia, Spain. Am J Public Health 1989;79:1352 4. 25. Panella H, Borrell C, Rodrguez C, et al. Validacion de la causa b sica de defuncion en Barcelona, 1985. Med Clin (Barc) 1989; a 92:129 34.

FACTORES DE SUSCEPTIBILIDAD AL CNCER DE PULMN

Juan Miguel Barros Dios Universidad de Santiago de Compostela Santiago de Compostela

Contenido: Resumen de la ponencia Publicaciones del grupo de investigacin Bibliografa

Se presenta una breve revisin, desde el punto de vista epidemiolgico, del uso de biomarcadores de susceptibilidad del cncer de pulmn, definindolos y diferencindolos del resto (exposicin y efecto) completada con esquemas del papel jugado por los mismos en el metabolismo de las diferentes sustancias xenobiticas y el posible papel modulador de determinados polimorfismos de genes, principalmente de Fase I y Fase II. Se acompaa de una extensa bibliografa.

Biomarcadores epidemiolgicos del cncer de pulmn

Alberto Ruano-Ravia / Juan M. Barros Dios
rea de Medicina Preventiva e Sade Pblica Universidade de Santiago de Compostela
TIPOS DE BIOMARCADORES Los marcadores biolgicos se clasifican habitualmente en tres grandes familias: marcadores de exposicin, marcadores de efecto o de respuesta y marcadores de susceptibilidad. Otra clasificacin distingue marcadores de dosis interna, marcadores de dosis biolgicamente efectiva, marcadores de efecto biolgico y marcadores de susceptibilidad. Ambas clasificaciones son equivalentes salvo pequeos matices. Marcadores de exposicin En esta clasificacin entraran los marcadores de dosis interna y de dosis biolgicamente efectiva. Un marcador de exposicin puede ser un compuesto xenobitico, un metabolito de ese compuesto dentro del cuerpo u otro suceso relacionado con la exposicin. Los marcadores de exposicin deben ser medidos en muestras apropiadas, como la sangre, suero u orina. Llamamos muestras apropiadas a aquellas que sean de fcil acceso y conservacin para su posible uso posterior. Fcil acceso implica poca complejidad tcnica para su obtencin, que se puedan obtener en cualquier momento y que causen pocas molestias para el sujeto. Como ejemplos tpicos de marcadores de dosis interna tenemos: PCBs (bifenilos policlorados) en el tejido adiposo procedentes de la contaminacin ambiental Cotinina en plasma o en saliva procedente del tabaco. Derivados N-nitrosos en orina originados por el tabaco o la dieta. Estos dosmetros internos tienen la ventaja de ser relativamente fciles de vigilar y demuestran que la exposicin ha derivado en la bioactivacin de carcingenos. Los marcadores de dosis biolgicamente efectiva reflejan la cantidad de carcingeno que ha interactuado con macromolculas celulares (DNA, RNA o protenas). Este tipo de marcadores es ms relevante para la carcinognesis que los de dosis interna, pero poseen ms problemas analticos. Los aductos de DNA y protenas pertenecen a este grupo. Antes de proseguir hay que matizar los conceptos de dosis y de exposicin. La dosis es la cantidad de sustancia depositada en el cuerpo en un momento dado y la exposicin es cualquier condicin que proporciona a un agente externo una oportunidad para actuar en el organismo. Por lo tanto, de la misma exposicin pueden resultar dosis significativamente diferentes. Las diferencias en las
Factores de susceptibilidad al cncer de pulmn 25

dosis se ven influenciadas por la variabilidad fisiolgica entre los individuos, debido a la absorcin, distribucin o metabolizacin. Una misma exposicin no es igual a una misma dosis. El marcador ideal de exposicin debera reunir las siguientes caractersticas: a) La recogida de la muestra y su anlisis deben ser simples y reproducibles. b) El marcador debe ser especfico para un tipo particular de exposicin y tener una clara relacin con el grado de exposicin. c) El marcador slo debe reflejar un cambio subclnico y reversible. d) Podrn considerarse intervenciones u otras medidas preventivas si as lo indica el resultado del biomarcador. e) Su uso debe ser ticamente aceptable. Un ejemplo en el que se usan marcadores de exposicin es el de los estudios transversales para determinar si los compuestos qumicos en el ambiente o en la dieta son realmente absorbidos, ayudando as a establecer la plausibilidad biolgica de las asociaciones exposicin-enfermedad descritas en investigaciones anteriores. Esta utilidad ha jugado un importante papel al demostrar, por ejemplo, que los compuestos presentes en el humo del tabaco pueden ser detectados en personas no fumadoras expuestas al humo de otros individuos. Validez de los BM de exposicin Algunos BM miden factores que son fijos y que no varan con el tiempo en las personas, por ejemplo los genes de susceptibilidad que pueden interaccionar con factores xenobiticos en el origen del cncer. Otros BM miden parmetros que cambian con el tiempo (por ejemplo, los niveles de micronutrientes varan de da a da). En los estudios epidemiolgicos es importante que la principal exposicin bajo estudio sea analizada de un modo tiempo-dependiente, teniendo en cuenta una posible induccin y perodos de latencia, y una relativa importancia etiolgica de la intensidad de la exposicin, la duracin de la exposicin y la exposicin acumulada. La aproximacin ms simple es analizar la exposicin acumulada de un modo tiempo-dependiente. Esto sera suficiente cuando el objetivo es simplemente considerar si hay o no un efecto de la exposicin. Muchos BM actualmente disponibles slo indican exposiciones relativamente recientes. Por ejemplo, los niveles sricos de micronutrientes reflejan una ingesta reciente ms que lejana. Debido al largo perodo de induccin de muchos cnceres, las exposiciones de hace 10-30 aos son las etiolgicamente relevantes. Esta es una importante limitacin en los estudios de cohortes y casos y controles que buscan medir los efectos de las exposiciones histricas. Algunos BM son mejores que otros en este aspecto, pero incluso los mejores BM de exposicin qumica reflejan slo las ultimas semanas o meses de exposicin. Por otro lado, con algunos BM (niveles sricos de TCDD) puede ser posible estimar exposiciones pasadas si el perodo de exposicin es conocido, si la vida media es relativamente larga (y es conocida) y si se asume que no ha habido exposiciones significativas recientemente o si se sabe que los niveles de exposicin han permanecido constantes en el tiempo. Marcadores de efecto Un marcador de efecto puede ser un compuesto endgeno, una medida de la capacidad funcional (volumen de aire inspirado) u otro indicador del estado o equilibrio del cuerpo o de un rgano que est afectado por la exposicin. Los marcadores de efecto suelen ser indicadores preclnicos de alteraciones. Estos marcadores pueden ser especficos o no especficos. Los especficos indican un efecto
26 Cncer de pulmn

biolgico de una exposicin particular, proporcionando una evidencia que puede ser usada con propsitos preventivos. Los no especficos no sealan ninguna causa en particular del efecto, indican el efecto total e integrado que podra deberse a una exposicin mltiple. Algunos autores clasifican los marcadores de efecto como marcadores de estructura alterada y marcadores de funcin alterada (como, por ejemplo, alteraciones fisiolgicas en el intercambio gaseoso). Entre los marcadores de efecto se encuentran las aberraciones cromosmicas, intercambios de cromtidas hermanas (Sister Chromatide Exchanges), la aparicin de microncleos y las alteraciones en oncogenes o genes supresores de tumores, que se vern ms adelante. Se podran incluir en este apartado los marcadores tumorales, que se utilizan para el diagnstico del cncer. Marcadores de susceptibilidad Un marcador de susceptibilidad, heredado o inducido, es un indicador de que el individuo es particularmente sensible al efecto de un agente xenobitico o a los efectos de un grupo de estos compuestos. El inters de este tipo de marcadores reside en la pregunta: por qu, para un nivel dado de exposicin a un carcingeno, slo una proporcin de los individuos expuestos desarrolla cncer? Es decir, por qu personas con una misma exposicin aparente tienen un riesgo diferente de enfermedad? Para otros autores, los marcadores de susceptibilidad slo son indicadores estadsticos cuyo valor predictivo depende de la frecuencia con la cual aquellos individuos con ese marcador desarrollen la alteracin esperada. La susceptibilidad puede ser absoluta o parcial. Por ejemplo, si la susceptibilidad es debida a un enzima, ste puede presentarse en unas cantidades menores de las normales (parcial), estar ausente en el individuo (absoluta) o aparecer con una estructura diferente debido a alteraciones en el DNA, implicando la prdida de su funcin (absoluta). Podemos decir que una susceptibilidad es gentica si las diferencias se localizan a nivel del DNA. Se han propuesto diferentes subreas para la susceptibilidad gentica: a) variaciones heredadas en los enzimas que metabolizan carcingenos, b) mutaciones en lneas celulares (germline) de genes asociados a tumores y, c) diferencias heredadas en la formacin de aductos de DNA y en sus mecanismos de reparacin. Los individuos con predisposicin hereditaria al cncer son portadores de una mutacin en alguno de los genes crticos en el control de los procesos de crecimiento y divisin celular. Esta mutacin, en s misma no es suficiente para el desarrollo de un tumor, ya que requiere la acumulacin adicional de alteraciones sobre otros genes crticos. Por ello, puede afirmarse que las mutaciones heredadas slo confieren una mayor susceptibilidad para desarrollar cncer, ya que necesitan de menos alteraciones adicionales que la poblacin general para sufrir una transformacin maligna, lo que justifica la tendencia al desarrollo del cncer en etapas ms tempranas de la vida.

Efectos sobre el riesgo de los marcadores de susceptibilidad

Mayor E N F E R M O S Individuos susceptibles S A N O S

Riesgo de enfermedad

Efecto umbral fisiolgico

Menor Individuos normales

Factores de susceptibilidad al cncer de pulmn

27

El estudio de la interaccin entre la dotacin gentica y el ambiente puede aumentar nuestra capacidad de caracterizar riesgos relativamente bajos en la poblacin. Adems, estos estudios proporcionan una aproximacin a los mecanismos de la carcinognesis, que pueden contribuir a establecer la plausibilidad biolgica de una asociacin entre exposicin y cncer. Conocer la intensidad con la que la susceptibilidad gentica contribuye al riesgo de un individuo de padecer cncer (lo que se denomina penetrancia), es particularmente importante en situaciones profesionales donde, con pocas excepciones, la exposicin a sustancias qumicas nocivas se desea reducir a niveles que proporcionen un riesgo aceptable. La epidemiologa molecular ha introducido la posibilidad de estudiar los polimorfismos en el DNA, los cuales son responsables de una parte de la susceptibilidad gentica a los carcingenos. Variaciones habituales (ocurren en una frecuencia mayor del 1%) en la secuencia gentica que pueden acabar en una protena alterada se denominan polimorfismos. Muchos polimorfismos no son funcionales, es decir, no tienen fenotipo. Sin embargo, otros pueden dar origen a protenas estructuralmente diferentes, lo que provoca un impacto en la actividad enzimtica. Como se ha podido determinar el locus gentico de muchos enzimas, se ha hecho posible la identificacin de polimorfismos y la capacidad de distinguir diferencias genotpicas y fenotpicas en la poblacin. El conocimiento del exceso de riesgo (susceptibilidad) en una poblacin puede utilizarse para excluir individuos de un estudio, pues podran alterar los resultados.

Ejemplos de marcadores de susceptibilidad del individuo

1. Variacin metablica: adquirida o heredada Ejemplos: CYP1A1a, GSTM1b, NAT2c, colinesterasas 2. Estado nutricional Ejemplos: -caroteno, selenio, retinoides 3. Factores inmunogenticos Ejemplos: polimorfismos del MHCd de clase I y clase II Fuente: elaboracin propia a: Gen de la familia del citocromo P450. b: Glutation S-transferasa mu 1 c: N-acetil-transferasa 2 d: Complejo principal de histocompatibilidad Los diseos de casos y controles son muy eficientes para examinar la interaccin entre los marcadores de susceptibilidad gentica y las exposiciones ambientales, particularmente cuando disponemos de datos de alta calidad sobre la exposicin procedentes de cuestionarios o de vigilancia ambiental. Las mejoras en el diseo de los estudios y en el ajuste de la estratificacin de la poblacin combinando el uso de entrevistas y marcadores genticos conduce a una nueva era en los estudios de casos y controles al dotarlos de una potencia mucho mayor. Los factores genticos no cambian con el tiempo, no estn afectados por el status de la enfermedad y son fciles de medir retrospectivamente comparados con los factores de riesgo ambientales. Los estudios de casos y controles son capaces de estimar el riesgo de enfermedad en la poblacin, ya que dan una informacin detallada sobre la presencia o ausencia de un gen de susceptibilidad y permiten definir la magnitud de los riesgos y de la interaccin gen-ambiente, un paso crucial en la prevencin de la enfermedad y en la promocin de la salud.
28 Cncer de pulmn

Limitaciones Con el uso de los biomarcadores surgen problemas de tipo tico o legal, originados por la determinacin de marcadores de susceptibilidad. Entre ellos est la posibilidad de que el genotipaje sea aplicado prenatalmente, donde se podra ofrecer el aborto a los padres que hayan concebido un feto afectado. Cuando la profilaxis o el tratamiento de esa susceptibilidad no pueden ser aplicados y el aborto es rechazado, se podra argumentar que el conocimiento es ms malo que bueno y podra generar una grave carga psicolgica en la persona afectada y/o su familia. Por ahora es difcil sopesar la contribucin de un polimorfismo particular al riesgo total de enfermedad y sobre todo explicrselo a la poblacin general. Un polimorfismo metablico puede proteger frente a un compuesto qumico pero aumentar el riesgo de cncer para otro. Puede aumentar el riesgo de cncer para un rgano pero proteger otro. Por esto es muy arriesgado generalizar para todo el organismo las conclusiones obtenidas en el estudio concreto de un solo tipo de cncer. Los polimorfismos de dos o ms enzimas diferentes en la misma persona pueden interactuar. En el supuesto de que estos aspectos se conozcan y se haga posible la identificacin de genes que confieran susceptibilidad o resistencia a los cnceres inducidos por agentes exgenos (como las radiaciones ionizantes o los compuestos qumicos de las industrias), hasta qu punto podra ser usada esta informacin? Podran los empresarios de industrias qumicas exigir que todos los potenciales empleados proporcionasen sus genotipos a la hora de darles un puesto de trabajo? Sera tico poner individuos con genotipos resistentes en reas de elevada exposicin o denegar el empleo a personas con perfiles genticos de alto riesgo? Sera posible bajar los estndares de higiene industrial al emplear una fuerza de trabajo resistente? Adems de la limitacin de obtener el consentimiento informado de los sujetos, tambin surge la complicacin de poder utilizar esas muestras para otros fines diferentes del original. Los investigadores tienen la responsabilidad de interpretar correctamente los resultados de los estudios de biomarcadores. Esto se debe a que la informacin obtenida puede ser usada de forma indebida o tener un efecto no deseado en los sujetos del estudio. Para muchos casos de cncer, las exposiciones ocurridas hace 10-30 aos son etiolgicamente relevantes. Incluso los mejores marcadores de exposicin qumica reflejan slo las ltimas semanas o meses de exposicin. Otra dificultad es que no siempre est claro si estamos midiendo la exposicin, el efecto biolgico o alguna etapa del proceso patolgico. Otro problema es que, en ausencia de enfermedad (o con ella), los individuos se resisten a someterse a una toma de muestras invasiva (biopsias, aspirados). El uso de esas muestras hace esencial para el desarrollo de la epidemiologa molecular la colaboracin eficaz de diversos especialistas, como por ejemplo qumicos analticos, bioqumicos, bilogos moleculares, anatomo-patlogos, etc. Aunque los ensayos de laboratorio generalmente se van mejorando con el tiempo, es casi inevitable algn grado de mala clasificacin (misclassification), especialmente durante la aplicacin inicial del ensayo a poblaciones humanas. Adems, en las condiciones de campo comunes a la investigacin epidemiolgica, hay factores externos al laboratorio que pueden aumentar la mala clasificacin, como la variacin en el cumplimiento, por parte del sujeto, de protocolos fenotpicos y variaciones en la recoleccin de muestras, procesado, tiempo de almacenamiento y condiciones de transporte. Las principales fuentes de error para los ensayos fenotpicos metablicos incluyen la exposicin a medicamentos, ciertos alimentos u otras exposiciones que inhiben o inducen la actividad enzimtica y que podran provocar que los individuos que fuesen metabolizadores rpidos se clasificasen como lentos, y viceversa. Tambin puede haber una mala clasificacin del genotipaje por algn fallo al reconocer una variante que contribuye
Factores de susceptibilidad al cncer de pulmn 29

al genotipo de inters o por el empleo de un cebador errneo cuando se hace una PCR (polymerase chain reaction). Finalmente, errores de codificacin en cualquier momento durante la recogida de la muestra, el anlisis en el laboratorio o en el procesado de los datos son casi inevitables y acumulables en los resultados. Por otra parte, existe tambin la dificultad de la validacin. Hasta ahora, al ser un campo de investigacin que ha surgido hace poco tiempo no est muy claro si algunos biomarcadores reflejan realmente lo que queremos medir. La validacin de los biomarcadores implica la identificacin sistemtica de los factores que influyen en la capacidad del marcador para predecir la exposicin o un suceso en la poblacin a estudio. El primer paso, la validacin en el laboratorio, implica averiguar factores tales como el perfil de la curva dosis-respuesta, la sensibilidad a dosis bajas, la especificidad de las exposiciones y la reproducibilidad del ensayo. En el segundo paso, la validacin epidemiolgica, se evalan la sensibilidad y especificidad en la poblacin, la variacin inter e intraindividual en la respuesta del biomarcador, la persistencia, el nivel base, el valor predicitivo positivo y la posibilidad de realizacin y su relevancia biolgica.

Validacin necesaria de los biomarcadores en la epidemiologa molecular

Laboratorio Curva dosis-respuesta Reproducibilidad del ensayo de un ensayo a otro da a da de un laboratorio a otro Lmite de deteccin (sensibilidad a dosis bajas) Especificidad de la exposicin Epidemiolgica Niveles base en poblacin no expuesta Variacin intraindividual en el tiempo sin alterar la exposicin al finalizar la exposicin (persistencia/vida media) Variacin interindividual respuesta a una exposicin dada persistencia del biomarcador Niveles en el tejido sustituto frente al tejido diana (en su caso) Relevancia biolgica para la enfermedad Valor predicitvo positivo Viabilidad cantidad y disponibilidad del tejido coste tiempo requerido para cada ensayo Fuente: adaptado de Perera. Otro aspecto de la validacin comprende la contribucin especfica que un biomarcador puede hacer a la epidemiologa, por ejemplo el valor aadido que se gana con el uso del marcador. La mayora de los marcadores de dosis interna (exposicin) tienen una vida media corta o son biolgicamente inestables, de manera que su uso en estudios epidemiolgicos de cncer es limitado. La estabilidad de los marcadores debe ser elevada, de forma que el almacenamiento de material biolgico durante aos sea vlido y eficiente.
30 Cncer de pulmn

La contribucin adicional de los biomarcadores debe ser medida siguiendo los principios que se aplican para evaluar la efectividad de un test diagnstico. Si suponemos que queremos medir adecuadamente el hbito tabquico de una poblacin, y que el valor predictivo positivo de un cuestionario es 0,94: cul es la ganancia adicional conseguida con la medida de la cotinina-nicotina? De acuerdo con los conceptos utilizados en epidemiologa clnica, 0,94 es la probabilidad pre-test de que el individuo fume y la medida de la nicotina-cotinina representa la probabilidad post-test. La contribucin del biomarcador puede ser, por lo tanto, estimada como la diferencia entre las dos probabilidades. Una consecuencia de este razonamiento es que el empleo del marcador es mejor en situaciones intermedias, por ejemplo, cuando la probabilidad a priori no es ni muy alta ni muy baja. En otras palabras, el uso de un biomarcador es justificable cuando se reduce significativamente la incertidumbre.

Factores de susceptibilidad al cncer de pulmn

31

Publicaciones sobre epidemiologa del cncer de pulmn: factores de riesgo

Grupo de Investigacin del rea de Medicna Preventiva e Sade Pblica. Universidade de Santiago de Compostela

Juan M. Barros Dios

DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, et al. RESIDENTIAL RADON AND LUNG CANCER: DETAILED RESULTS OF A COLLABORATIVE ANALYSIS OF INDIVIDUAL DATA ON 7,148 SUBJECTS WITH LUNG CANCER AND 14,208 SUBJECTS WITHOUT LUNG CANCER FROM 13 EPIDEMIOLOGICAL STUDIES IN EUROPE SCANDINAVIAN JOURNAL OF WORK, ENVIRONMENT AND HEALTH (Aceptado para publicar) DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, BAYSSON H, BOCHICCHIO F, DEO H, FALK R, FORASTIERE F, HAKAMA M, HEID I, KREIENBROCK L, KREUZER M, LAGARDE F, MKELINEN I, MUIRHEAD C, OBERAIGNER W, PERSHAGEN G, RUANO-RAVINA A, RUOESTEENOJA E, SCHAFFRATH ROSARIO A, TIRMARCHE M, TOMASECK L WHITLEY E, WICHMANN HE, DOLL R. RADON IN HOMES AND LUNG CANCER RISK: COLLABORATIVE ANALYSIS OF INDIVIDUAL DATA FROM 13 EUROPEAN CASE-CONTROL STUDIES. BRITHIS MEDICAL JOURNAL (Aceptado en edicin normal) Versin on-line publicada el 21/12/2004. RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM. TYPE OF WINE AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY IN SPAIN. THORAX 2004 (59): 981-85. BARROS-DIOS JM, RUANO RAVIA A. CNCER DE PULMN. FACTORES DE RIESGO. INVESTIGACIN Y CIENCIA 2004 (37):31-33. RUANO-RAVINA A, FIGUEIRAS A, MONTES-MARTNEZ A, BARROS-DIOS JM. DOSE-RESPONSE RELATIONSHIP BETWEEN TOBACCO AND LUNG CANCER. EUROPEAN JOURNAL OF CANCER PREVENTION C: A 12(4) 257-63 2003 RUANO-RAVINA A, FIGUEIRAS A, LOIDI L, BARROS-DIOS JM. GSTM1 AND GSTT1 POLYMORPHISMS, TOBACCO AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY FROM GALICIA, SPAIN. ANTICANCER RESEARCH 23:4333-4338 C: A 23 4333-4338 2003
32 Cncer de pulmn

RUANO-RAVINA A, FIGUEIRAS A, BARREIRO CARRACEDO MA, BARROS-DIOS JM. OCCUPATION AND SMOKING AS RISK FACTORS FOR LUNG CANCER: A POPULATION-BASED CASECONTROL STUDY. AMERICAN JOURNAL OF INDUSTRIAL MEDICINE C: A 43(2) 149-155 2003 UK RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM. LUNG CANCER AND RELATED RISK FACTORS:AN UPDATE OF THE LITERATURE PUBLIC HEALTH C: A 117 149-156 2003

UK

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM. MUSICIANS PLAYING WIND INSTRUMENTS AND RISK OF LUNG CANCER: IS THERE AN ASSOCIATION? OCCUP ENVIRON MED C: Carta 60: 143 2003 USA RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM. NOXIOUS EXPOSURES IN LEISURE TIME AND RISK OF LUNG CANCER: A NEGLECTED EXPOSURE? EPIDEMIOLOGY C: Carta 13 (2): 235-6 2002 USA BARROS-DIOS JM, BARREIRO MA, RUANO-RAVINA A, FIGUEIRAS A EXPOSURE TO RESIDENTIAL RADON AND LUNG CANCER IN SPAIN: A POPULATION-BASED CASECONTROL STUDY AMERICAN JOURNAL OF EPIDEMIOLOGY C: A 156(6) 548-555 2002 USA PREMIO AL MEJOR ARTCULO DE INVESTIGACIN EPIDEMIOLGICA PUBLICADO EN 2002. OTORGA: SOCIEDAD ESPAOLA DE EPIDEMIOLOGA RUANO-RAVINA A, FIGUEIRAS A, DOSIL-DIAZ O, BARREIRO CARRACEDO MA, BARROS-DIOS JM. A POPULATION-BASED CASE-CONTROL STUDY ON FRUIT AND VEGETABLE INTAKE AND LUNG CANCER: A PARADOX EFFECT? NUTRITION AND CANCER C:A 43(1) 47-51 2002 USA RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM. THE GENOMICS REVOLUTION: WILL THIS MEAN A RESURGENCE OF CUSTOMIZED PRESCRIPTIONS? DRUG INFORMATION JOURNAL C:Carta 36(4) 725-6 2002-11-10 USA RUANO RAVIA A, FIGUEIRAS A, BARROS DIOS JM. DIET AND LUNG CANCER: A NEW APPROACH. EUROPEAN JOURNAL OF CANCER PREVENTION. C: A 9(6) 395-400
Factores de susceptibilidad al cncer de pulmn

2000

HOLANDA
33

RUANO RAVIA A; BARROS DIOS JM UNA BREVE APROXIMACIN A LA EPIDEMIOLOGA DEL CNCER DE PULMN APUNTES DE SALUD PBLICA C: A 2(20) 15-17 1999 RUANO RAVIA A; BARROS DIOS JM APLICACIN DE LOS BIOMARCADORES A LOS ESTUDIOS EPIDEMIOLGICOS APUNTES DE SALUD PBLICA C: A 2 (5) 5-9 1998

ESPAA

ESPAA

BARROS-DIOS JM, BARREIRO MA et al. CNCER DE PULMN Y RADN DOMSTICO. DESCRIPCIN DE UN ESTUDIO EN EL REA SANITARIA DE SANTIAGO DE COMPOSTELA:1992-1994. En La Sanidad Ambiental y la Salud Pblica, 1997: 117-122. ISBN-84-884 39-49-0

34

Cncer de pulmn

Bibliografa
1. Kawajiri K; Nakachi K; Imai K; Yoshii A; Shinoda N; Watanabe J. Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IA1 gene. FEBS, 1990. 263 (1): 131-133. Zhong S; Wyllie AH; Barnes D; Wolf CR; Spurr NK. Relationship between the GSTM1 polymorphism and susceptibility to bladder, breast and colon cancer. Carcinogenesis, 1993. 14 (9): 1821-1824 Uematsu F; Ikewa S; Kikuchi H; Sagami I; Kanamaru R; Abe T; Satoh K Motomiya M; Watanabe M. Restriction fragment length polymorphism of the human CYP2E1 (cytochrome P450IIE1) gene and susceptibility to lung cancer: possible relevance to low smoking exposure. Pharmacogenetics, 1994. 4: 58-63. Alexandrie AK, Sundberg MI, Seidegard J, Tornling G, Rannung A. Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to age at onset, gender and histological cancer type. Carcinogenesis 1994;15(9):1785-90. Wei Q, Cheng Lie, Hong WK, Spitz MR. Reduced DNA repair capacity in lung cancer patients. Cancer Research 1996. 56: 4103-4107. Garca-Closas M; Kelsey KT; Wiencke JK; Xu X; Wain JC; Christiani DC. A case-control study of cytochrome P450 1A1, glutathione S-transferase M1, cigarette smoking and lung cancer susceptibility (Massachusetts, United States). Cancer Causes and Control, 1997. 8: 544-553. To-Figueras J; Gen M; Gmez-Cataln J; Galn MC; Fuentes M; Ramn JM; Rodamilans M; Huguet E; Corbella J. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) polymorphisms and lung cancer risk among Northwestern Mediterraneans. Carcinogenesis, 1997. 18 (8): 1529-1533. Kelsey KT, Spitz MR, Zuo ZF, Wiencke JK. Polymorphisms in the glutathione S-transferase class mu and theta genes interact and increase susceptibility to lung cancer in minority populations (Texas, United States). Cancer, Causes and Control 1997;8:554-59. Rebbeck TR. Molecular epidemiology of the human Glutathione-S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiology, Biomarkers and Prevention 1997; 6: 733-743. Jourenkova-Mironova N; Wikman H; Bouchardy C; Voho A; Dayer P; Benhamou S; Hirvonen A. Role of Glutathione S-transferase GSTM1, GSTM3, GSTP1 and GSTT1 genotypes in modulating susceptibility to smoking-related lung cancer. Pharmacogenetics 1998. 8:495-502. Pianezza ML; Sellers EM; Tyndale RF. Nicotine metabolism defect reduces smoking. Nature, 1998. 393: 750. Oscarson M; Gullstn H; Rautio A; Bernal ML; Sinues B; Dahl ML; Stengard JH; Pelkonen O; Raunio H; Ingelman-Sundberg M. Genotyping of human cytochrome P450 2A6 (CYP 2A6), a nicotine C-oxidase. FEBS Letters, 1998. 438: 201-205. Butkiewicz D; Cole KJ, Phillips DH; Harris CC; Chorazy M. GSTM1, GSTP1, CYP1A1 and CYP2D6 polymorphisms in lung cancer patients from an environmentally polluted region of Poland: correlation with lung DNA adduct levels. Eur J of Cancer Prevention 1999; 8 : 315-323.
35

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

Factores de susceptibilidad al cncer de pulmn

14.

To-Figueiras J, Gen M, Gmez-Cataln J, Piqu E, Borrego N, Carrasco JL, Ramn J, Corbella J. Genetic polymorphims of glutathione-S-transferase P1 gene and lung cancer risk. Cancer Causes and Control 1999;10:65-70. Rojas M, Cascorbi I, Alexandrov K, Kriek E, Auburtin G, Mayer M, Kopp-Schneider A, Roots I, Bartsch H. Modulation of benzo(a)pyrene diolepoxide-DNA adduct levels in human white blood cells by CYP1A1, GSTM1 and GSTT1 polymorphism. Carcinogenesis 2000; 21 (1): 35-41. Stcker I, Jacquet M, de Waziers I, Cne S, Beaune Ph. Relation between inducibility of CYP1A1, GSTM1 and lung cancer in a French population. Pharmacogenetics 2000;10:617-27. Hou SM, Flt S, Nyberg F. Glutathione S-transferase T1-null genotype interacts synergistically with heavy smoking on lung cancer risk. Environmental and Molecular Mutagenesis 2001;38:83-86. Bouchardy .Ch, Benhamou S, Jourenkova N, Dayer P, Hirvonen A. Metabolic genetic polymorphims and susceptibility to lung cancer. Lung Cancer 2001; 32:109-12. To-Figueras J. Gen M, Gmez-Cataln J, Piqu E, Borrego N, Corbella J. Lung cancer susceptibility in relation to combined polymorphims of microsomal epoxide hydrolase and glutathione Stransferase P1. Cancer Letters 2001. 173: 155-162. Zhou W, Liu G, Thurston SW, Xu LL, Miller DP, Wain JC, Lynch TJ, Su L, Christiani DC. Genetic polymorphism in N-acetyltransferase-2 and microsomal epoxide hydrolase, cumulative cigarette smoking, and lung cancer. Cancer Epidemiology, Biomarkers & Prevention 2002. 11: 15-21. Stcker I, Hirvonen A, de Waziers I, Cabelguenne A, Mitrunen K, Cne S, Koum-Besson E, Hmon D, Beaune Ph, Loriot MA. Genetic polymorphims of glutathione S-transferases as modulators of lung cancer susceptibility. Carcinogenesis 2002;9:1475-81. Park JY, Lee SY, Jeon HS, Bae NC, Chae SC, Joo S, Kim CH, Park HO, Kam S, Kim IS, Jung TH. Polymorphism of the DNA repair gene XRCC1 and risk of primary lung cancer. Cancer Epidemiology, Biomarkers & Prevention 2002. 11: 23-27. Miller DP, Liu G, De Vivo I, Lynch TJ, Wain JC, Su L, Christiani DC. Combinations of the variant genotypes of GSTP1, GSTM1, and p53 are associated with an increased lung cancer risk. Cancer Research 2002;62:2819-23. Perera FP Mooney LV, Stampfer M, Phillips DH, Bell DA, Rundle A, Cho S,Tsai WY, Ma J, Blackwood A, , Tang D. Associations between carcinogene-DNA damage, glutathione S-transferase genotypes, and risk of lung cancer in the prospective Physicians Health Cohort Study. Carcinogenesis 2002;23:1641-46. Paz-Elizur T, Krupsky M, Blumenstein S, Elinger D, Schechtman E, Livneh Z. DNA repair activity for oxidative damage and risk of lung cancer. J Natl Can Inst 2003. 95 (17): 1312-19. Miller DP, Neuberg D, de Vivo I, Wain JC, Lynch JC, Su L, Christian DC. Smoking and the risk of lung cancer: susceptibility with GSTP1 polymorphims. Epidemiology 2003;14(5):545-51. Ruano-Ravina A, Figueiras A, Loidi L, Barros-Dios JM. GSTM1 and GSTT1 polymorphims, tobacco and risk of lung cancer: a case-control study From Galicia, Spain. Anticancer Research 2003; 23:4333-38.
Cncer de pulmn

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

36

28.

Alexandrie AK, Nyberg F, Warholm M, Rannug A.Influence of CYP1A1, GSTM1, GSTT1, and NQO1 genotypes and cumulative smoking dose on lung cancer risk in a Swedish population. Cancer Epidemiology Biomarkers & Prevention 2004. 13 (6): 908-14. Kiyohara C, Yoshimasu K, Shirakawa T, Hopkin JM. Genetic polymorphisms and environmental risk of lung cancer: a review. Reviews on Environmental Health 2004. 19 (1): 15-38. Marin MS, Lpez-Cima MF, Garca-Castro L, Pascual T, Marrn MG,Tardn A. Poly (AT) polymorphims in intron 11 of the XPC DNA repair gene enhances the risk of lung cancer. Cancer Epidemiol, Biomarkers & Prevention 2004;13(11):1788-93. Wenzlaff AS, Cote ML, Bock CH, Land SJ, Schwartz AG. GSTM1, GSTT1 and GSTP1 polymorphims, environmental tobacco smoke exposure and risk of lung cancer among never smokers: a population-based study. Carcinogenesis 2005;26(2):395-401. Perera FP; Weinstein IB. Molecular epidemiology and carcinogen-DNA adduct detection: new approaches to studies of human cancer causation. J of Chron Dis, 1982. 35: 581-600. Taioli E, Zocchetti C, garte S. Models of interaction between metabolic genes and environmental exposure in cancer susceptibility. Environ Health Perspect 1998; 106:67-70. Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL, Strom SS, Spitz MR, Wei Q. Polymorphims of DNA repair gene XRCC1 in squamous cell carcinoma of the head and neck. Carcinogenesis 1999;20:2125-29. Butkiewicz D, Rusin M, Enewold L, Shields PG, Chorazy M, Harris CC. Genetic polymorphims in DNA genes and risk of lung cancer. Carcinogenesis 2001;22(4):593-97. Garte S et al. Metabolic Gene Polymorphims frequencies in control populations. Cancer Epidemiol, Biomarkers & Prev 2001;10:1239-48. Garte S. Metabolic susceptibility genes as cancer risk factors: time for reassesment? Cancer Epidemiol, Biomarkers & Prev 2001;10:1233-37. (Comentario) Ingelmana-Sundberg M, Oscarson M, Daly AK, Garte S, Nebert DW. Human cytochrome P-450 (CYP) genes: a web page for the nomenclature of alleles. Cancer Epidemiol, Biomarkers & Prev 2001;10:1307-08 (Carta) Lemon WJ, Bernert H, Sun H, Wang Y,You M. Identification of candidate lung cancer susceptibility genes in mouse using oligonucleotide arrays. J Med Genetics 2002;39:644-55. Hou SM, Flt S, Angelini S, Yang K, Nyberg F, Lambert B, Hemminki K. The XPD variant alleles are associated with increased aromatic DNA adduct level and lung cancer risk. Carcinogenesis 2002;23(4):599-603.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

Factores de susceptibilidad al cncer de pulmn

37

CARCINGENOS Y ORIGEN DEL CNCER DE PULMN

Julin Carretero Centro Nacional de Investigaciones Oncolgicas (CNIO) Madrid

Contenido: Resumen de la ponencia Bibliografa

Carcingenos y origen del cncer de pulmn

Julin Carretero
Grupo de cncer de pulmn Cantro Nacional de Investigaciones Oncolgicas (CNIO) Madrid

1. Introduccin El cncer de pulmn es el tumor ms importante en cuanto a mortalidad en el mundo occidental. La carcinognesis pulmonar es el resultado final de la accin de mltiples factores que de forma aislada, aditiva o sinrgica, lesionan irreversiblemente el epitelio bronquial. El cncer es una enfermedad gentica, resultado de las alteraciones que presentan las clulas cancerosas en genes relacionados con el control de la proliferacin y muerte celular. Sin embargo el origen de estas alteraciones (mutaciones) es, la mayor parte de las veces, ambiental, y en el caso del cncer de pulmn, el principal agente ambiental implicado en la carcinognesis es el tabaco, responsable del 90% de los casos en varones y del 55-80% de los casos entre las mujeres en los paises de mayor incidencia. Adems, tambin existe una asociacin segura entre exposicin ocupacional a otras sustancias (asbestos, radn, arsnico, bis-cloro-metil-ster, berilio, cromo, gas mostaza, nquel) y aparicin de cncer de pulmn. Sin embargo, no en todos los casos de cncer de pulmn existe una causa concreta detectada, ni la presencia de un agente etiolgico conlleva siempre la aparicin de cncer de pulmn (p.ej. slo el 10-15% de los fumadores desarrollar un cncer de pulmn a lo largo de su vida). Estos hechos hacen pensar en la existencia de efectos aditivos y sinrgicos entre las distintas causas para determinados casos; as como en la existencia de factores de predisposicin y de riesgo para el cncer de pulmn que quizs por s solos no son suficientes para la carcinognesis pero asociados a otros factores conducen a la aparicin del tumor (p.e., factores de susceptibilidad gentica).

2. Tabaco y cncer de pulmn Los estudios epidemiolgicos y experimentales sealan al tabaco como el principal factor etiolgico en el cncer de pulmn. La consistencia de estos estudios, su especificidad, la secuencia temporal entre la exposicin y la enfermedad, y la relacin dosis-respuesta avalan la evidencia de la asociacin entre el consumo de cigarrillos y el cncer de pulmn. El tabaco induce cualquiera de los grupos histolgicos ms frecuentes, existiendo una fuerte asociacin con los carcinomas escamosos y los indiferenciados de clula pequea. 2.1. Carcinognesis inducida por el tabaco El humo del tabaco contiene alrededor de 4.800 compuestos diferentes, que se pueden separar en compuestos gaseosos y partculas. Al menos 60 de estos compuestos se consideran cancergenos por la Agencia Internacional para la Investigacin del Cncer (IARC) en base a evidencias epidemiolgicas y experimentales. La fase gaseosa contiene molculas potencialmente carcinognicas como xidos de nitrgeno, isopreno, butadieno, benzeno, estireno, formaldehdo, acetaldehdo, acrolena y furano, mientras que la fase de partculas cuenta con carcingenos como los hidrocarburos aromticos policclicos (PAH), nitrosaminas, aminas aromticas y metales (cromo, nquel, cadmio). Si bien el efecto individual de los carcingenos del tabaco es dificil de estudiar a nivel molecular ya que estamos tratando un problema de exposicin crnica a una mezcla compleja de molculas carcingenas y/o procarcingenas, numerosas evidencias experimentales han demostrado la implicacin del tabaco en todos los pasos de la carcinognesis.
Carcingenos y origen del cncer de pulmn 41

Los compuestos carcinognicos del tabaco se absorben y son metabolizados en los individuos fumadores, y muchos de estos compuestos reaccionan con el DNA provocando mutaciones, hechos comprobados experimentalmente utilizando diferentes fracciones de condensados de humo de cigarrillos aplicados sobre animales de laboratorio, y tambin en experimentos de inhalacin, donde se inducen alteraciones en el DNA, as como lesiones preneoplsicas. 2.2. Principales carcingenos del humo del tabaco

Hidrocarburos aromticos policclicos (PAH): el benzopireno es el ms estudiado, y su capacidad para inducir tumores en el pulmn tras la administracin local o inhalatoria est plenamente establecida. Adems, existen otros PAH como el dibenzopireno, dibenzoantraceno y el 5-metilcriseno, cuya potencia carcinognica es mayor pero que aparecen a menores concentraciones en el humo del tabaco. Nitrosaminas: la 4-(metilnitrosamino)-1-(3-piridil)-1-butanona (NNK) es una nitrosamina especfica del humo del tabaco y un potente carcingeno en roedores. De hecho, es el nico carcingeno capaz de inducir tumores en el pulmn de los tres modelos murinos de experimentacin ms utilizados. Adems, es el carcingeno ms abundante del humo del tabaco. El 1,3-butadieno es otro de los compuestos que induce el desarrollo de tumores de pulmn en roedores, aunque depende mucho de la capacidad detoxificadora de cada especie: en ratones, el 1,3-butadieno es transformado en 1,2,3,4-diepoxibutano, un compuesto mucho ms reactivo y carcinognico. Radicales libres y oxidantes. En el humo del tabaco hay importantes cantidades de radicales libres que se generan en la combustin, derivados del nitrgeno, como el xido ntrico, o derivados del oxgeno, como el radical superxido o el perxido de hidrgeno. Estas especies altamente reactivas son capaces de oxidar, y por tanto daar, todo tipo de macromolculas, entre ellas el DNA. Adems, al entrar en contacto el humo del tabaco con los alveolos pulmonares se van a activar los macrfagos alveolares, los cuales liberarn ms radicales libres que contribuyen a la inflamacin. La inflamacin crnica se considera hoy en dia como una situacin potencialmente carcinognica precisamente por la genotoxicidad de las especies oxidantes y tambin porque induce la activacin de rutas moleculares que fomentan la transformacin tumoral. Otros compuestos carcinognicos: etilcarbamato, xido de etileno, nquel, cromo, cadmio, arsnico, hidrazina, formaldehdo, acetaldehdo.

2.3. Mecanismos de genotoxicidad inducida por el humo del tabaco La respuesta del organismo a los carcingenos es similar a la que ocurre durante la exposicin a cualquier xenobitico. Muchos de estos compuestos son de naturaleza lipfila, cualidad que les permite atravesar las membranas biolgicas, y por esta misma razn son difcilmente eliminables por la principal va de excrecin, que es la orina. Con el objeto de incrementar esta excrecin el organismo somete al xenobitico a una serie de transformaciones que se clasifican en dos grupos:

Reacciones de Fase I: biotransformaciones que aumentan la hidrosolubilidad del compuesto mediante la introduccin de grupos o funciones de carcter polar, como hidroxilaciones, que capacitan al compuesto para experimentar la fase siguiente. Estas reacciones son llevadas a cabo por oxidorreductasas, entre las que se encuentran las enzimas de la familia citocromo P450 (CYP-P450).
Cncer de pulmn

42

Reacciones de Fase II: son reacciones de conjugacin en las que los compuestos con los grupos polares aludidos se unen a reactivos endgenos, como el glutatin, para formar derivados ms hidrosolubles, a travs de la reaccin catalizada por las glutatin-S-transferasas (GST).

Si bien las enzimas del sistema del citocromo P450 aumentan la polaridad de los compuestos potencialmente txicos con el fin de hacerlas ms fcilmente eliminables, estas mismas enzimas de hidroxilacin activan los compuestos carcinognicos del tabaco (nitrosaminas, benzopirenos), hacindolos ms reactivos y confirindoles capacidad mutagnica. Los carcingenos activados reaccionan con el DNA formando aductos con las bases nitrogenadas. Si estos aductos no se reparan convenientemente mediante los mecanismos celulares pertinentes (nucleotide excision repair pathway) pueden llevar a que, durante la replicacin del DNA, se introduzcan errores en la copia, dando lugar a mutaciones. La existencia de diferentes polimorfismos en estas enzimas detoxificadoras de xenobiticos (CYP, GST) explicaran en parte las diferentes susceptibilidades individuales a la accin de los carcingenos, al igual que ocurre con las protenas responsables de la reparacin del DNA, que podramos considerar como genes supresores de tumores. En el caso del benzopireno, este carcingeno es activado por los sistemas de detoxificacin para dar benzopirenol-epxido (BPDE), un intermediario altamente reactivo capaz de unirse covalentemente al grupo amino exocclico de la deoxiguanosina (dG) y formar el aducto BPDE-dG, el cual, si no es corregido, introducir una mutacin puntual con el cambio de G por T (transversin). En el caso concreto de la inactivacin del gen supresor tumoral p53, el cual se encuentra mutado en un 40% de los casos de cncer de pulmn humano, se ha encontrado un patrn mutacional especfico de los fumadores relacionado con la formacin de aductos BPDE-dG, en concordancia con datos experimentales obtenidos tras tratar clulas del epitelio bronquial con BPDE. La selectividad de la reaccin del BPDE con la deoxiguanosina de los codones calientes 157, 158, 245, 248 y 273 de p53 se debera a que la formacin del aducto est facilitada cuando existe 5-metilcitosina en el dinucletido CpG, algo que ocurre precisamente en todas las secuencias CpG de los exones cinco al nueve de p53. Las nitrosaminas activadas metablicamente, el 1,3-butadieno o el cloruro de vinilo, median reacciones de alquilacin del DNA, dando lugar a sitios absicos que al ser replicados introducirn mutaciones, predominantemente transversiones de G a T.

3. Otros agentes cancergenos Como hemos explicado anteriormente, los carcingenos del tabaco son los responsables de la mayoria de los cnceres de pulmn, si bien existen importantes carcingenos, especialmente relacionados con exposiciones ocupacionales, como los asbestos o el radn. Otros factores carcinognicos reconocidos seran la contaminacin atmosfrica y la menor ingesta de vegetales y frutas frescas, alimentos ricos en antioxidantes naturales, que hipotticamente implicara menor proteccin frente al dao oxidativo inducido por otros carcingenos. 3.1. Asbestos El asbesto aumenta el riesgo de cncer de pulmn, mesotelioma y asbestosis. Mineros, molineros, trabajadores del textil, del cemento, frenos, mscaras y aislamientos, materiales de calefaccin, constructores de embarcaciones y similares son profesionales habitualmente expuestos al asbesto; entre ellos, el 20% fallece de cncer de pulmn y el 5-10% de mesotelioma. La exposicin tiene un efecto dosis-respuesta y un sinergismo con el tabaco. El riesgo relativo para el cncer de pulmn es de 1,5 a 13,1 cuando se
Carcingenos y origen del cncer de pulmn 43

combinan ambos factores. Todos los tipos histolgicos pueden verse aumentados, y habitualmente se localizan en lbulos inferiores o en localizaciones perifricas. Su accin carcinognica se explica por la inflamacin crnica que ocasionan las fibras largas y delgadas que penetran, se retienen en los pulmones y que los alvolos son incapaces de expulsar. La genotoxicidad estara mediada por la generacin de especies reactivas del oxgeno y del nitrgeno capaces de daar al DNA. En este sentido se ha demostrado experimentalmente que las partculas inducen por s mismas, incubndolas en medio acuoso junto con DNA, la generacin de radicales libres como el hidroxilo, capaz de provocar oxidaciones en las cuatro bases y roturas de la hebra de DNA. Adems, cuando las partculas de asbesto son captadas por las clulas fagocitarias inducen la inflamacin y posterior generacin de especies reactivas genotxicas. El producto de la oxidacin del DNA ms estudiado es la 8-hidroxideoxiguanosina (8-OhdG), cuya aparicin provoca transversiones de G a T y que se utiliza como marcador de dao oxidativo al DNA al ser fcilmente detectable en muestras de tejido y orina de animales de experimentacin tratados con asbesto. 3.2. Radn El radn es un gas inerte derivado del uranio.Tiene un dbil poder radiactivo y alguno de sus subproductos emite partculas alfa, que pueden irradiar el epitelio de las vas respiratorias; el efecto carcinognico vendra dado por la accin directa de la radiacin, capaz de inducir roturas cromosmicas y alteraciones en las bases nitrogenadas, y por accin indirecta al provocar la formacin de radicales libres a partir de la radiolisis o rutura homoltica del agua. Los trabajadores de las minas de uranio tienen un riesgo mayor de muerte por cncer de pulmn con una ratio de 12,7. El radn se ha relacionado, sobre todo, con una mayor incidencia de carcinoma microctico de pulmn. Aunque el radn ambiental se encuentra en el subsuelo, en el aire, en el agua y en los materiales de construccin de los edificios, no est claro que las observaciones de los trabajadores de las minas de uranio, con niveles de exposicin ms altos, puedan extrapolarse a la poblacin general.

Bibliografa: 1. 2. 3. DeMarini DM. Genotoxicity of tobacco smoke and tobacco smoke condensate: a review. Mutat Res. 2004 Nov;567(2-3):447-74. Donaldson MS. Nutrition and cancer: A review of the evidence for an anti-cancer diet. Nutr J. 2004 Oct 20; 3(1):19. Gazdar A, Franklin WA, Brambilla E, Hainaut P, Yakota J, Harris CC. Genetic and molecular alterations. In: Pathology and genetics, tumours of the lung, pleura, thymus and heart, Travis WD, Brambilla E, Mller-Hermelink K, Harris CC, eds. IARC Press, publisher. 2004. Knaapen AM, Borm PJ, Albrecht C, Schins RP. Inhaled particles and lung cancer. Part A: Mechanisms. Int J Cancer. 2004 May 10;109(6):799-809. Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco smoke carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene. 2002 Oct 21; 21(48):7435-51. IARC monograph on the evaluation of carcinogenic risk to humans: tobacco smoke and involuntary smoking. Volume 83, IARC, Lyon, 2004.
Cncer de pulmn

4. 5.

6.

44

ALTERACIONES GENTICO-MOLECULARES EN EL CNCER DE PULMN

Montserrat Snchez-Cspedes Centro Nacional de Investigaciones Oncolgicas (CNIO) Madrid

Contenido: Resumen de la ponencia Bibliografa

Alteraciones gentico-moleculares en el cncer de pulmn

Montserrat Snchez-Cspedes
Grupo de cncer de pulmn Cantro Nacional de Investigaciones Oncolgicas (CNIO) Madrid

pesar de los avances, el cncer de pulmn es la primera causa de muerte por cncer en nuestro pas. Evidentemente, el mayor logro conseguido hasta el momento ha sido identificar el consumo de tabaco como el principal factor responsable de la aparicin de cncer de pulmn. A pesar de ello, mucha gente seguir desarrollando durante los prximos aos este tipo de cncer y, por lo tanto, es necesario aumentar los esfuerzos para comprender los mecanismos biolgicos que contribuyen a su aparicin y a su evolucin. El proceso de carcinognesis se inicia y progresa debido a la acumulacin de alteraciones en genes esenciales para el crecimiento y divisin celular. Un objetivo bsico de la investigacin molecular del cncer es la identificacin de todos aquellos genes implicados en el desarrollo tumoral y la elucidacin de sus caractersticas funcionales. Hasta la fecha se han descrito diversas alteraciones genticas y moleculares que caracterizan a la clula tumoral, las cuales son diversas y suelen producirse en vas bioqumicas muy concretas. Sin embargo, no todas las protenas implicadas en una determinada va bioqumica son susceptibles de alterarse gentica o epigenticamente en la clula tumoral. De hecho, hasta la fecha tan slo se han identificado unos pocos genes con anormalidades en la secuencia del DNA. Las principales rutas bioqumicas que contienen genes con alteraciones genticas o epigenticas y que, por lo tanto, se encuentran anormalmente reguladas en tumores incluyen: la divisin celular, deteccin y reparacin del dao al DNA, muer te celular programada (o apoptosis), factores de transcripcin, vas transductoras de seales y molculas de adhesin celular. A continuacin se describirn las principales molculas alteradas genticamente en tumores pulmonares. 1. Alteraciones genticas en componentes del ciclo celular en el cncer de pulmn Las alteraciones genticas en componentes reguladores del ciclo celular son muy comunes en el cncer. En el caso del cncer de pulmn los principales genes alterados son los genes supresores tumorales retinoblastoma (Rb) y p16. Rb se altera principalmente en cncer de pulmn de clula pequea (CPCP) y p16 en cncer de pulmn de clula no pequea (CPCNP). En ambos casos las alteraciones son mediante mutaciones puntuales, deleciones gnicas y, en el caso de p16, hipermetilacin de su regin promotora. Otra alteracin menos frecuente es la amplificacin gnica del oncogn ciclina D1. Adems de alteraciones a nivel del gen, existen alteraciones en los niveles de distintas protenas implicadas en el ciclo celular. Como se comentar en algunas de las sesiones del presente curso, es frecuente la prdida de los inhibidores del ciclo P21, P27, as como incrementos en los niveles de distintas ciclinas (ciclina A, B, E, D) y quinasas dependientes de ciclinas (CDK1, CDK2, CDK4, CDK6) que promueven la progresin del ciclo celular. En definitiva, todas estas anormalidades conllevan una desregularizacin del ciclo celular permitiendo que se produzca una divisin celular constante en la clula tumoral.

Alteraciones gentico-moleculares en el cncer de pulmn

47

2. Alteraciones gnicas en vas transductoras de seales bioqumicas Las alteraciones en estas vas dan lugar a la transmisin de un estmulo constante al interior de la clula, independientemente de los factores reguladores. El resultado suele ser un efecto mitognico, es decir, transmisin de seales que inducen a la clula a dividirse. De entre las mutaciones ms frecuentes de esta categora en cncer de pulmn estn las mutaciones en Kras, en tumores de tipo histolgico adenocarcinomas. Otros genes habitualmente mutados son PTEN y LKB1, el primero en CPCP y el segundo en adenocarcinomas. Adems de alteraciones gnicas existen, como en el caso anterior, alteraciones en los niveles de ciertas protenas implicadas en dichas vas que participan en el proceso carcinognico de estos tumores. 3. Alteraciones gnicas en la va de la apoptosis La apoptosis es la muerte celular programada de una clula ante ciertos daos que son incompatibles con su buen funcionamiento. As, por ejemplo, cuando se produce un excesivo dao al DNA (p.e. un exceso de radiacin ionizante) se activan dentro de la clula mecanismos que promueven la reparacin de ese dao gentico o, si el dao es irreparable, se promueve la apoptosis. Entre las molculas que regulan estos mecanismos y que se encuentran alteradas en cncer de pulmn tenemos p53 y p14, ambas alteradas en distintas proporciones en los distintos tipos histolgicos de cncer de pulmn. Adems de alteraciones genticas o epigenticas de estos componentes son comunes los cambios en los niveles de distintas protenas implicadas en la apoptosis como los reguladores fas, survivina, NFKB, etc. 4. Alteraciones gnicas en reguladores de la transcripcin gnica En tumores pulmonares se encuentran frecuentemente amplificados los genes de la familia myc en el CPCP. Adems, se ha demostrado la presencia de mutaciones y alteraciones en los niveles de protenas implicadas en la regulacin transcripcional a travs de la remodelacin de la cromatina. As pues, son comunes las prdidas de BRG1/SMARCA4, el componente con actividad ATPasa del sistema regulador de la cromatina denominado SWI/SNF. Los genes que se han descrito alterados hasta el momento son probablemente una pequea parte del conjunto de genes que participan en el desarrollo del cncer de pulmn. Estudios de alteraciones cromosmicas globales basados en cariotipos, alelotipos, CGH (Comparative Genome Hybridization) y otros indican que existen distintos cromosomas que presentan frecuentes ganancias o prdidas de material gentico, lo que sugiere que debe existir oncogenes y genes supresores tumorales todava por identificar. De entre estas regiones cromosmicas se encuentran los cromosomas 6q, 8q, 19q y 3p. Un aspecto muy interesante, aunque todava poco estudiado del cncer de pulmn, es la identificacin de genes cuyas alteraciones en lnea germinal conllevan un elevado riesgo de desarrollar cncer de pulmn. Tal y como se expondr en alguna de las presentes sesiones, polimorfismos en genes que metabolizan ciertos carcingenos parecen contribuir a un mayor riesgo de desarrollar tumores asociados al consumo de tabaco, como cncer de pulmn y tumores de cabeza y cuello. Adems, recientes estudios parecen demostrar que existe un gen en el cromosoma 6 responsable de la elevada predisposicin a cncer de pulmn en individuos fumadores. Finalmente, en la ltima dcada se estn desarrollando tecnologas de anlisis masivo que permiten el estudio de la expresin global (cDNA microarrays) y de tejidos (tissue microarrays), y que impulsarn el descubrimiento de nuevas molculas con importancia en el desarrollo del cncer de pulmn y permitir la deteccin de marcadores moleculares tiles en el manejo del enfermo de cncer. En algunas de las sesiones del presente curso se darn a conocer algunos resultados y ejemplos del uso de estas tecnologas.
48 Cncer de pulmn

En definitiva, la descripcin de las alteraciones gentico-moleculares de los tumores tiene un amplio potencial para el manejo del enfermo de cncer ya que, en un futuro prximo, podran ser utilizadas a varios niveles: a) identificacin de individuos con susceptibilidad a padecer cncer; b) nuevos marcadores para el diagnstico precoz en individuos de alto riesgo; c) posibles marcadores con aplicacin en el pronstico y respuesta a tratamiento del enfermo de cncer; d) nuevas dianas para el diseo y nuevas terapias diseadas de forma especfica a dichas alteraciones.

Bibliografa: 1. 2. 3. 4. Snchez-Cspedes M. Dissecting the genetic alterations implicated in lung carcinogenesis. Lung Cancer, 40(2):111-21 (2003). Osada H & Takahashi T. Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer. Oncogene, 21(48): 7421-7434 (2002). Snchez-Cspedes M & Sidransky D. DNA-based detection of neoplastic cells for clinical cancer management. Revista de Oncologia, .1 (6): 284-290 (2001). Sekido Y, Fong KM, Minna JD. Progress in understanding the molecular pathogenesis of human lung cancer. Biochim Biophys Acta. 1378(1): F21-59 (1998).

Alteraciones gentico-moleculares en el cncer de pulmn

49

TELMEROS Y TELOMERASA EN CNCER DE PULMN

Jean-Charles Soria Institut Gustave Roussy Villejuif, Francia

Contenido: Resumen de la ponencia Bibliografa Ponencia en PowerPoint

Telomerase and telomeres in lung carcinogenesis

Jean-Charles Soria
Institut Gustave Roussy Villejuif, France

Background Human telomeres are simple repeated sequences of TTAGGG located at the ends of chromosomes. Those guanine-rich structures capping the chromosome termini are essential to prevent aberrant recombination, protect chromosomes against exonucleolytic DNA degradation and appear to be important for the regulation of genes at distal loci (Blackburn et al, 1991; Zakian et al, 1995). Furthermore telomeres are supposed to be involved in senescence and immortalization of normal cells. Increasing evidence indicates that telomeric DNA shortens during the maturation of various human somatic cells (Allsopp et al, 1995; Harley et al, 1990). Senescence of these cells may occur as a result of a checkpoint arrest in response to shortened telomeres. The loss of telomeric repeats after each cell division may constitute a biological clock limiting the proliferative life span of somatic cells (Allsopp et al, 1995). To compensate for the shrinking of telomeres that results from incomplete terminal replication, germline, immortalized and tumor cells express an RNA-dependent DNA polymerase named telomerase. The ribonucleoprotein enzyme synthetizes the telomeric DNA repeats by using an RNA template, termed hTR, subunit of the telomerase holoenzyme (Feng et al, 1999). The second major component, hTERT, is the catalytic subunit of the telomerase. The expression of hTERT is regulated (both positively and negatively) and tightly correlated to the enzymatic activity (Liu et al, 1999; Oh et al, 1999). Various other proteins are also associated with the telomerase complex (e.g. TP1, the chaperonin hsp90, and Ku, which is involved in repair of DNA double-strand breaks), the duplex telomeric region (e.g. TRF1 and associated proteins tankyrase and TIN2), and the single-stranded G-rich telomeric overhang (e.g. TRF2 and associated proteins MRE11 and RAD50) (Steensel et al, 1997; Kim et al, 2000; Zhu et al, 2000; Smith et al, 2000). Telomerase and cancer Telomerase has been detected in the great majority of tumours investigated, establishing it as the most widespread marker of cancer currently under study. Although, overall, telomerase activity is detectable in around 90% of tumour samples, some specific tumour types, such as glioblastomas, astrocytomas, and retinoblastomas, show a low proportion of telomerase positive samples (Dhaene et al, 2000). Telomerase is preferentially expressed in tumor cells with short telomeres and is not expressed in most somatic cells, which usually have longer telomeres. Telomerase is expressed in 80-85% of NSCLC and in almost all SCLC (Albanell et al, 1997). Telomerase and lung tumorigenesis Histological changes associated with chronic smoking and cancer includes loss of cilia, cellular atypia, reserve cell hyperplasia, squamous metaplasia and dysplasia, and carcinoma in situ. Treatment or control of precancerous lesions may be a way to avoid the development of invasive cancers. Growing evidence links hTERT to a multi-step model of lung cancer progression. An important question is where exactly in cancer progression for telomerase-positive tumors is the enzyme switched on? Telomerase activity is detected in precancerous lesions of the lung, reflecting the early involvement of the molecule in lung tumorigenesis (Yashima et al, 1997, Soria et al, 2003). It is therefore believed that the progression from hyperplasia to dysplasic pre-cancerous lesions is accompanied by telomerase on-switching in lung cancer.
Telmeros y telomerasa en cncer de pulmn 53

Telomerase as a prognostic biomarker The data supporting a role for telomerase as a prognostic indicator are compelling in several cancer types and especially in early stage NSCLC. Telomerase activity has been correlated with cell proliferation, higher TNM tumor stage, and node invasion (Albanell et al, 1997). The following table summarizes those studies:

Prognostic value of hTERT in different cancer types: Reference Hiyama et al. 1995 Hiyama et al. 1995 Langford et al.1996 Clark et al. 1997 Tatsumoto et al. 2000 Marchetti et al 1999 Wang et al 2002 Cancer Neuroblastoma Gastric Meningioma Breast Colon Lung Lung Prognostic value Overall survival Overall survival Overall survival Overall survival Overall survival Overall survival Overall survival

Telomerase and telomeres as a therapeutic targets (Hahn et al 1999, Hamilton et la, 1999, Raymond et al, 2000; Kelland et al, 2001)

Targeting hTERT Reverse transcriptase inhibitors that can block telomerase because of its RNA-dependent telomerase activity: AZT (IC50 mM to nM), ddG The results are inconsistent and may be related to mitochondrial DNA replication inhibition. Dominant negative hTERT approach Transfection of dominant-negative constructs into tumor cells The telomerase becomes catalytically inactive but able to sequester hTR (and hTERT?) Very promising and fits the criteria of telomerase inhibition selectivity. A problem is the cell delivery (target cancer cells and uptake of the vector) Immunotherapy hTERT is an ideal tumor antigen and hTERT can be processed by the proteosomes and presented in an MHC context as an Ag recognized by CTLs. It has been shown that hTERTderived peptides can be recognized in this setting. Different working groups have isolated hTERT-specific CTL able to lyse cancer cell lines and tumors in a telomerase and MHCrestricted fashion. hTERT-derived peptides can be identified for several of the prevalent MHC haplotypes. There might be a risk of auto-immunity.
54 Cncer de pulmn

Targeting hTR Ribozymes Those are molecules that can cleave other RNAs in a sequence specific manner. When used against hTR, there is a good telomerase inhibition and cell growth delay but no reduction in telomere length. Use this strategy against the against hTERT messenger RNA could be even more promising. Antisense oligonucleotides Tests with standard oligodesoxynucleotides have shown disappointing results with limited stability and bioavailability. The use of peptic nucleic acids, PNA, (analogs of DNA and RNA), resistant to the degradation of exo and endonucleases, is more promising because PNAs act through a specific inhibition of telomerase and fit the criteria of telomerase inhibition selectivity. The main obstacle is still how to ensure optimal cell delivery. Targeting the telomeres and associated proteins The G-rich singlestrand telomere overhang can fold back on itself in vitro to form fourstrand G quadruplex (or tetraplex) structures that then inhibit the elongation steps catalysed by telomerase. 49 Searches for compounds that bind selectively to G-quadruplexes rather than duplex DNA resulted in the discovery of the first potent small-molecule inhibitors of telomerase. Inhibition of telomerase by stabilization of the G-quadruplexes by porphyrin derivatives, acridine derivatives, anthraquinones and fluorenone-based compounds are the most promising ones.

Conclusion Telomerase has a key role in the multistep carcinogenic process of the lung, is frequently expressed in invasive NSCLC tumors and is associated with poor outcome for some authors. The rationale for targeting telomerase in NSCLC is robust. The first telomerase inhibitors have entered clinical trials and may represent an exciting novel approach to cancer chemotherapy (Kelland et al, 2001). However, much more needs to be learned rapidly, to integrate the biological properties of this enzyme to the optimum clinical use of inhibitors. Other questions such as which tumours should be targeted, and what are relevant pharmacodynamic markers of inhibition, must also be answered.

References 1. Albanell J, Lonardo F, Rusch V, Engelhardt M, Langenfeld J, Han W et al. High telomerase activity in primary lung cancers : association with increased cell proliferation rates and advanced pathologic state. J Natl Cancer Inst 1997 ; 89 : 1609-15. Blackburn EH. Structure and function of telomeres. Nature 1991; 350: 56972. Blackburn EH. Telomere states and cell fates. Nature 2000; 408: 5356. Dhaene K, Marck EV, Parwaresch R.; Telomeres, telomerase and cancer: an update; Virchows Arch. 2000; 437: 1-16. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999; 5:116470.
55

2. 3. 4. 5.

Telmeros y telomerasa en cncer de pulmn

6. 7. 8. 9. 10.

Hiyama E, Hiyama K, Yokoyama T, et al. Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med1995; 1: 24955. Kelland LR. Telomerase: biology and phase I trials. Lancet Oncol 2001; 2: 95102 Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994; 266: 201115. Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I non-small cell lung cancer. Clin Cancer Res 1999; 5: 207781. Raymond E, Soria JC, Izbicka E, Boussin F, Hurley L, Von Hoff DD. DNA G-quadruplexes, telomere-specific proteins and telomere-associated enzymes as potential targets for new anticancer drugs. Invest New Drugs, 2000, 18: 123-37. Soria JC, Xu X, Liu DD, Lee JJ, Kurie J, Morice RC, Khuri F, Mao L, Hong WK, Lotan R. Retinoic Acid receptor Beta and telomerase catalytic subunit expression in bronchial epithelium of heavy smokers. J Natl Cancer Inst 2003; 95: 165-168. Wang L, Soria JC , Kemp BL, Liu DD, Mao L, Khuri FR. hTERT Expression Is a Prognostic Factor of Survival in Patients with Stage I Non-Small Cell Lung Cancer. Clin Cancer Res 2002; 8: 2883-2889. Yashima K, Litzky LA, Kaiser L, et al. Telomerase expression in respiratory epithelium during the multistage pathogenesis of lung carcinomas. Cancer Res 1997; 57: 2373-7.

11.

12. 13.

56

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

57

58

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

59

60

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

61

62

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

63

64

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

65

66

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

67

68

Cncer de pulmn

Telmeros y telomerasa en cncer de pulmn

69

LECTURA CRTICA DE LOS ARTCULOS SOBRE FACTORES ETIOLGICOS DEL CNCER DE PULMN
Esteve Fernndez Institut Catal dOncologia Institut dInvestigaci Biomdica de Bellvitge (IDIBELL) Barcelona

Contenido: Resumen de la ponencia

Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn
Esteve Fernndez
Servicio de Prevencin y Control del Cncer Institut Catal dOncologia, IDIBELL Departamento de Salud Pblica Universitat de Barcelona

Texto preparado a partir de los materiales del curso sobre Preparacin de publicaciones biomdicas del Master a distancia en Metodologa de la investigacin: Diseo y Estadstica en Ciencias de la Salud de la Universitat Autnoma de Barcelona (Fernndez E., Garca A.M. Cmo evaluar y leer artculos cientficos. Barcelona: Signo; 2005). Agradecimientos A Ana M. Garca y Josep Maria Domnech por la oportunidad de haber reflexionado y trabajado con ellos acerca de diferentes aspectos de la publicacin cientfica y sobre la lectura crtica de la literatura. Se agradece la financiacin de las Redes Cooperativas de Investigacin en Cncer (C03/010) y Epidemiologa y Salud Pblica (C03/09) del Instituto de Salud Carlos III.

1. Introduccin La lectura crtica y sistemtica de la literatura nos ayudar a conocer bien la literatura, a separar el grano de la paja, tanto en la preparacin de nuestros trabajos como en la revisin o evaluacin que podamos hacer de otros trabajos para alguna revista. En esta sesin se dan unas normas o criterios generales para evaluar crticamente la literatura y se entra de manera individualizada en los principales tipos de diseo y de artculos relevantes en el estudio etiolgico del cncer de pulmn. 2. Objetivos 1. Conocer los criterios generales de lectura crtica de la literatura. 2. Conocer los criterios especficos de lectura crtica de acuerdo con los principales tipos de diseo de investigacin observacional sobre el cncer de pulmn. 3. Criterios generales para la lectura crtica de artculos En demasiadas ocasiones se ha sacralizado la letra impresa: es decir, se da por vlido y relevante cualquier informacin que venga avalada por el peer review de una prestigiosa (o no tan prestigiosa) revista. Es evidente que no se puede dudar de todo lo que cae en nuestras manos, pero sera incluso ms peligroso aceptarlo todo sin evaluacin crtica. Cuando tengamos en nuestras manos un trabajo que vayamos a incorporar a nuestro cuerpo de conocimiento es acertado plantearse una duda razonable y ser sistemticos en la lectura de ese artculo. Debemos utilizar, en la medida de lo posible, una serie de criterios que nos ayuden a discernir acerca de si los resultados o las evidencias presentadas son vlidos, es decir, prximas a la verdad, y para decidir si los resultados son importantes.
Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn 73

Vamos a identificar cuestiones que tienen que ver con la dimensin del diseo y de los resultados obtenidos, en trminos de validez interna y externa, relevancia y utilidad prctica, que repasaremos sistemticamente segn la presentacin habitual del trabajo, es decir, segn los apartados en que se estructuran la mayora de trabajos cientficos (estructura IMRD). Es decir, cuando leamos crticamente un artculo deberemos responder sistemticamente a las cuestiones planteadas segn la presentacin clsica del artculo para pasar a decidir sobre las cuestiones de validez, relevancia y utilidad. Respecto a la validez interna del estudio, se tratar de evaluar si los resultados obtenidos en el estudio se desvan o no de la realidad, es decir, si el estudio est libre de sesgos o error sistemtico y por tanto tiene una alta validez interna o no. En algunas ocasiones, grandes estudios que responden a hiptesis y objetivos bien planteados presentan deficiencias metodolgicas que hipotecan cualquier resultado que se pueda derivar, sencillamente porque el estudio no est bien hecho. Buena parte de los criterios sugeridos para la lectura tienen que ver con la validez interna del estudio. Si un trabajo carece de validez interna puede ser incluso recomendable no proseguir con su lectura, puesto que cualquier inferencia o conclusin que se pueda derivar de l carecer realmente de valor. En muchas ocasiones no existe una respuesta dicotmica (es vlido/no es vlido) a esta pregunta, y las diferentes preguntas sobre el diseo del estudio, los pacientes incluidos y excluidos o sobre cmo se recogi la informacin, ayudan a situar la respuesta en una escala entre el absolutamente invlido y el absolutamente vlido. Algunos de los criterios que se van a presentar tienen que ver con la relevancia de los resultados, es decir, saber qu resultados se han obtenido y con qu precisin se han estimado, para poder valorar su importancia sanitaria, social o clnica. Por ejemplo, un estudio sobre riesgo de cncer de pulmn y exposicin al radn puede determinar que existe un RR de 1,12 estadsticamente significativo para una exposicin al radn en el cuartil superior de su distribucin (concentracin 1.000 veces ms elevada que la habitual). Qu importancia daremos a esa estimacin? Finalmente, la dimensin sobre utilidad de los resultados tiene que ver con su aplicabilidad en nuestra experiencia profesional y ello tiene que ver tanto con nuestro contexto como con el contexto en que se ha realizado la investigacin cuyos resultados abordamos crticamente, es decir, con su validez externa, entendida como generabilidad de los resultados. Por ejemplo, la efectividad de un programa poblacional de deteccin precoz del cncer de pulmn mediante PET en un estudio realizado en Estocolmo, donde la participacin es elevada (del 75%). Su aplicabilidad en nuestro mbito (por ejemplo, una ciudad de mediano tamao espaola) puede quedar muy lejana, dado que conocemos que este tipo de dispositivos est disponible slo en algunos centros de alta tecnologa y que la participacin en este tipo de programas no alcanzara el 35% de nuestra poblacin. Debemos recordar en ltimo lugar que la lectura crtica de artculos es una actividad (personal o de grupo) encaminada a discernir la validez de trabajos escritos por otros colegas para nuestros objetivos de investigacin. No debemos confundir la lectura crtica con la lectura que haramos para realizar una revisin editorial por encargo como evaluadores externos (aunque los criterios propuestos pueden servir de ayuda para ello). Por ejemplo, al valorar la utilidad de un artculo cuando actuamos como evaluadores externos debemos pensar en la audiencia de la revista, mientras que en la lectura crtica pensamos fundamentalmente en nuestra propia prctica profesional. Por ello, es conveniente finalizar la lectura del artculo y la aplicacin de los criterios respondiendo, como decamos anteriormente, a tres cuestiones bsicas: 1) el artculo es vlido?, 2) sus resultados son relevantes?, y 3) el artculo nos es til?
74 Cncer de pulmn

4. Criterios para la lectura crtica de artculos de casos y controles Aunque en algunos textos de epidemiologa los estudios de casos y controles son considerados muy inferiores en calidad a los estudios de cohortes y mucho ms susceptibles a la accin de diferentes tipos de sesgos sistemticos, muchos epidemilogos consideran que un estudio de casos y controles bien diseado presenta muchas ventajas y muy pocos inconvenientes en comparacin con los costosos estudios de cohortes. En relacin con la lectura crtica de los estudios de casos y controles se deben considerar cuestiones comunes a la lectura de cualquier otro diseo de investigacin y aspectos ms especficos de este tipo de estudios. En la Tabla 1 se resumen los criterios propios para la lectura crtica de los estudios de casos y controles. Un aspecto especialmente determinante de la validez en los estudios de casos y controles es la seleccin de los grupos a comparar. En los estudios de casos y controles la representatividad poblacional no es la cuestin relevante. La clave se encuentra en la medida en la que casos y controles representan la misma poblacin fuente o de origen. Puesto que la seleccin de los casos suele anteceder a la de los controles, lo fundamental ser elegir un grupo control que represente adecuadamente la poblacin de la que proceden los casos. Por ejemplo, si los casos se eligen a travs de los servicios de un hospital, en principio los controles ms adecuados seran los que llegaran a travs de la misma fuente que los casos, es decir, la poblacin usuaria de dicho hospital. El objetivo fundamental es que los controles permitan estimar la distribucin de la exposicin o exposiciones de inters en la poblacin base de la que proceden los casos. As, los controles sern los individuos que, de haber desarrollado la enfermedad, se encontraran en el grupo de casos incluidos en el estudio o, al menos, en el grupo de casos elegibles para el estudio. En un artculo que presente los resultados de un estudio de casos y controles podemos fijar nuestro inters inicial en los casos. En primer lugar, la correcta identificacin de la poblacin origen de los casos deber permitirnos valorar la adecuacin en el proceso de seleccin de los controles. En segundo lugar, los propios criterios de seleccin de los casos (incidentes/prevalentes, criterios diagnsticos, criterios de inclusin/exclusin) nos permitirn valorar la validez del estudio y las conclusiones que podremos extraer del mismo. En principio un estudio de casos y controles basado en casos incidentes es ms slido que si se trata de casos prevalentes. De hecho, cuando se trata de casos incidentes es muy fcil asimilar el estudio de casos y controles al estudio de cohortes (los casos equivaldran a los casos que apareceran en el estudio de cohortes y los controles seran una muestra representativa de las cohortes de origen de los casos). Cuando se trabaja con casos prevalentes las conclusiones del trabajo pueden ser ms inciertas. Elementos tambin importantes en la seleccin de casos y controles es la garanta de su calidad como tales (es decir, que los casos no sean falsos positivos de la enfermedad, o los controles falsos negativos de la misma). Los autores debern explicar claramente los criterios diagnsticos aplicados para la seleccin de los casos y los criterios utilizados para descartar la condicin de inters en los controles. Otro aspecto fundamental en ambos grupos es su representatividad respecto a los sujetos inicialmente seleccionados (es decir, las caractersticas de la no respuesta en casos y controles). En este ltimo sentido, al igual que en otros tipos de diseo, es muy conveniente que los autores puedan describir las caractersticas de participantes y no participantes en el estudio o, al menos, hagan algunas asunciones respecto al efecto que pueda haber tenido la falta de participacin de los sujetos inicialmente considerados para su inclusin en la investigacin tanto en el grupo de los casos como en el de los controles. La medida adecuada de la exposicin u otros factores de inters es igualmente importante, no slo en este diseo sino en cualquier otro tipo de investigacin. En los estudios de casos y controles la exposicin se mide tpicamente de manera retrospectiva, y por lo tanto los errores de clasificacin
Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn 75

respecto a esta variable son potencialmente ms probables. Tanto si la exposicin se mide a travs de marcadores biolgicos (que pueden utilizarse, por ejemplo, para caracterizar la exposicin a sustancias persistentes en el organismo, como es el caso de los compuestos organoclorados), como si se aborda a travs de los clsicos cuestionarios, los autores deben proporcionar toda la informacin relevante al respecto para que podamos caracterizar adecuadamente la validez en la medida de la exposicin y otras variables de inters. Por otra parte, en la presentacin de los resultados, tal y como se presenta en los criterios de la Tabla 1, deber valorarse adecuadamente la precisin del estudio (intervalos de confianza, tamao muestral), as como controlar adecuadamente por las variables de confusin relevantes. Asimismo, al tratarse de estudios fundamentalmente de naturaleza etiolgica (es decir, con el objetivo de aportar evidencias para evaluar las relaciones de causa-efecto entre la exposicin o exposiciones de inters y la enfermedad o proceso que presentan los casos) es muy importante encontrar en la discusin una valoracin adecuada de los criterios de causalidad, por ejemplo siguiendo la bien conocida propuesta de Hill (Hill A.B. The environment and disease: association or causation? Proc R Soc Med 1965; 58: 295300): la consistencia se evaluar de acuerdo con los resultados de estudios previos sobre el mismo tema, la secuencia temporal y el gradiente dosis-respuesta en base a la calidad y validez de la informacin disponible en relacin con la exposicin de inters, la plausibilidad y coherencia en funcin del conocimiento disponible sobre los mecanismos de accin biolgica de dicha exposicin y su relacin con los procesos de desarrollo de la enfermedad, etc. Por ltimo, deberemos encontrar en el artculo una discusin razonada y suficientemente exhaustiva de las ventajas (qu cualidades presenta este estudio respecto a la investigacin previa disponible en el rea?) y limitaciones (qu problemas de precisin y validez pueden haber afectado los resultados del estudio y de qu forma?) del estudio. 5. Criterios para la lectura crtica de artculos de cohortes El estudio de cohortes es el diseo ms lgico y directo para determinar la existencia de una asociacin entre una exposicin o determinante de inters y la aparicin o desarrollo de un estado de salud. Segn se defina el perodo de seguimiento de los participantes en un estudio de cohortes, hablamos de cohortes prospectivas, retrospectivas o bidireccionales (prospectivas y retrospectivas). Por otra parte, en funcin de los criterios de entrada y salida de los individuos de la cohorte se definen las denominadas cohortes fijas y cohortes dinmicas. En algunos casos, en los estudios de cohortes se incluye una cohorte nica, y a continuacin se clasifican los individuos en funcin de su estado de exposicin (comparacin interna). Este es el caso del estudio de los efectos del tabaco en mdicos britnicos, en el cual se clasific a los sujetos a posteriori en funcin de su consumo de tabaco. En otros casos, en el estudio se selecciona inicialmente una cohorte de individuos expuestos y se utiliza como grupo de referencia la poblacin general de origen de la cohorte (comparacin con la poblacin general). Por ejemplo, en un estudio de cohortes se puede comparar la mortalidad por diferentes tipos de cncer en trabajadores de la industria textil con las tasas de mortalidad por esta misma enfermedad en la poblacin general. En ocasiones el estudio se basa en la comparacin de dos cohor tes definidas y seleccionadas deliberadamente en funcin de su estado de exposicin al factor de inters (comparacin externa). Por ejemplo, una cohorte de personas usuarias de telfono mvil (cohorte expuesta) con otra cohorte de personas que no lo utilizan (cohorte no expuesta). Al igual que se comentaba en relacin con los estudios de casos y controles, en la lectura crtica de los estudios de cohortes hay aspectos ms especficos y propios de este tipo de estudios y otros comunes con cualquier diseo de investigacin. En la Tabla 2 se presentan los criterios propios a considerar en los estudios de cohortes. Los autores deben definir claramente las caractersticas de la cohorte o cohortes en el estudio: tipo de cohorte (fija/dinmica, retrospectiva/prospectiva, etc.), tiempos de seguimiento, criterios de
76 Cncer de pulmn

entrada de los individuos en la cohorte, etc. En caso de una comparacin con la poblacin general se debe presentar tambin la informacin disponible sobre la misma que pueda de alguna manera afectar las comparaciones. Para una mnima comparabilidad entre la cohorte expuesta y la poblacin general, o la cohorte de comparacin, habitualmente las tasas de mortalidad o la incidencia se presentarn estandarizadas por edad. Es posible tambin estandarizar por otras variables que puedan relacionarse de forma decisiva con los resultados, o bien calcular los estimadores ajustados por estas variables. Tambin los criterios y resultados de la medida de la exposicin y la enfermedad en los estudios de cohortes deben presentarse con toda la informacin necesaria para evaluar adecuadamente su validez. La medida de la exposicin puede basarse en marcadores biolgicos o ambientales, cuestionarios u otro tipo de registros o instrumentos. Aunque los estudios de cohortes tienen ventajas evidentes para caracterizar la exposicin en comparacin con los estudios de casos y controles, pueden igualmente existir problemas de validez en la aproximacin utilizada para la medida de la exposicin y los autores deben proporcionar toda la informacin adecuada para que el lector pueda valorar crticamente este elemento. Por otra parte, idealmente la experiencia de enfermedad se debe cuantificar de forma completa y vlida en todos los sujetos de la cohorte. La capacidad de los investigadores para conseguir este objetivo determina de forma crucial la validez del estudio de cohortes. Asimismo, para evitar sesgos diferenciales, es importante garantizar un nivel aceptable de equivalencia en los mtodos aplicados sobre las cohortes en comparacin y sobre todos los individuos incluidos en las mismas. La definicin del perodo de seguimiento durante el cual se observa la experiencia de enfermedad en los sujetos incluidos en la cohorte es clave. Este perodo de tiempo debe decidirse y justificarse en funcin del conocimiento disponible sobre los mecanismos etiopatognicos y el perodo de induccin de la enfermedad. Por otra parte, al igual que en los estudios de casos y controles un problema fundamental puede ser la no respuesta, en los estudios de cohortes uno de los problemas ms frecuentes sern las prdidas de seguimiento, y los investigadores deben proporcionar la informacin necesaria acerca de cmo abordaron esta cuestin y, en su caso, como minimizaron el problema. Algunos epidemilogos fijan el mximo admisible de prdidas en los estudios de cohortes en el 20%, aunque este criterio puede ser variable. Los criterios relativos a la lectura crtica de los resultados y discusin no difieren sustancialmente entre los estudios de casos y controles y los de cohortes. En estos ltimos, los autores debern presentar los estimadores de frecuencia adecuados en funcin del tipo de diseo de cohortes (tasas de incidencia, incidencia acumulada, tasas estandarizadas por edad, etc.) y los respectivos estimadores de asociacin (riesgos relativos, razones de incidencia, razones de mortalidad, etc.), crudos y, en su caso, estandarizados o ajustados por las variables de confusin relevantes. Los intervalos de confianza y el tamao muestral nos permitirn evaluar la precisin del estudio. Por ltimo, en la discusin deberemos encontrar la adecuada comparacin de los resultados ms relevantes con las evidencias procedentes de estudios previos. Tambin es muy conveniente que se incluya una reflexin respecto a los criterios habituales de causalidad, tales como la evaluacin de las relaciones dosis-respuesta o la plausibilidad y/o coherencia biolgica de la asociacin entre la exposicin y la enfermedad de inters. A diferencia de los estudios de casos y controles, y especialmente de los estudios transversales, el adecuado establecimiento de la secuencia temporal es menos o nada problemtica en los estudios de cohortes, ya que precisamente en el seguimiento se obtiene informacin directa sobre la relacin temporal entre la exposicin al factor de estudio y el desarrollo de la enfermedad. Finalmente, la discusin debe siempre incluir la adecuada valoracin crtica de los puntos fuertes y dbiles del estudio, sealando su potencial influencia sobre los resultados y las conclusiones que puedan derivarse de los mismos.
Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn 77

Tabla 1. Criterios para una lectura crtica de los estudios de casos y controles 1. Respecto a los casos: Cul es la fuente y base del estudio de donde provienen los casos? Son casos incidentes (entran en el estudio al inicio de la enfermedad) o prevalentes? Se describen claramente los criterios diagnsticos de la enfermedad? Se describen claramente los criterios de inclusin y, en su caso, los criterios de exclusin? Se describen claramente las prdidas en la inclusin de los casos (casos identificados vs. casos incluidos finalmente)?

2. Respecto a los controles: Cul es la fuente y base del estudio de donde provienen los controles? Tienen la misma probabilidad de exposicin que los casos? En caso de que enfermaran por el proceso de inters, seguiran un proceso asistencial similar al de los casos? Si son una muestra sesgada de todos los posibles controles, es este sesgo similar al que pueda haber determinado la seleccin de los casos? En el caso de existir ms de un grupo control, qu diferencias existen entre estos grupos y cmo pueden afectar estas diferencias a las estimaciones de ORs? De otra forma, qu sesgos se ponen de manifiesto al utilizar los diferentes grupos de controles? Se describen claramente los criterios de inclusin y, en su caso, los criterios de exclusin? Se describen claramente las prdidas en la identificacin e inclusin de los controles (controles identificados vs. controles incluidos finalmente)? 3. Respecto a los casos y los controles: Provienen los casos y controles de la misma base del estudio? Se han hecho los mismos esfuerzos para detectar/descartar la enfermedad en los casos y los controles (es necesario asegurarse de que los controles lo son realmente)? 4. Respecto a la exposicin: Se ha definido y medido claramente (criterios, marcadores, duracin, dosis, instrumentos y cuestionarios validados, etc.)? Se ha determinado la exposicin de manera no sesgada respecto a la enfermedad estudiada (se ha hecho el mismo esfuerzo para recoger informacin sobre la exposicin en casos y en controles)? Se ha hecho el esfuerzo necesario para garantizar que la exposicin es previa a la aparicin de la enfermedad en los casos? 5. Respecto a los resultados: Se expresan con sus intervalos de confianza las estimaciones de las ORs? Se ha tenido en cuenta tanto la significacin estadstica como la relevancia clnico-epidemiolgica? En el caso de resultados no significativos estadsticamente, era suficiente el tamao del estudio? Se controlan los resultados por las variables de confusin relevantes? 6. Respecto a la discusin: Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente dosis-respuesta, plausibilidad y coherencia, etc.)? Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos de seleccin e informacin y confusin y su efecto sobre los resultados)? Adaptado a partir de: Fletcher RH, Fletcher SW, Wagner EH. Epidemiologa clnica. Barcelona: eds. Consulta; 1989. Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiologa Clnica. Una ciencia bsica para la Medicina Cnica. Madrid: Editorial Mdica Panamericana; 1994.
78 Cncer de pulmn

Tabla 2. Criterios para una lectura crtica de los estudios de cohortes 1. Respecto a la definicin de la cohorte o cohortes: Se describen suficientemente las caractersticas de la cohorte (origen, tipo de cohorte, tiempo de seguimiento, criterios de inclusin y exclusin de los individuos en la cohorte)?

2. Respecto a la definicin de la exposicin: Se ha definido y medido claramente (criterios, marcadores, duracin, dosis, instrumentos y cuestionarios validados, etc.)? Se determinaron sin sesgos (se hizo el mismo esfuerzo para recoger la informacin en todos los miembros de la cohorte)? Se ha hecho el esfuerzo necesario para garantizar que la exposicin es previa a la aparicin de la enfermedad? 3. Respecto a la condicin de inters o enfermedad: Se describen claramente los criterios diagnsticos de enfermedad? Se ha realizado el mismo esfuerzo para recoger la informacin sobre la enfermedad en todos los miembros de la cohorte? 4. Respecto al seguimiento: Se describe adecuadamente el seguimiento para todos los miembros de la cohorte? (momento de entrada en la cohorte, de salida o censura, y de desarrollo de la condicin de estudio) Se realiz el mismo esfuerzo en el seguimiento de todos los miembros de la cohorte? Est definido de forma adecuada el tiempo de seguimiento (suficiente para observar el suceso de inters)? 5. Respecto a los resultados: Se expresan con intervalos de confianza las estimaciones de incidencia y del RR? Se ha tenido en cuenta tanto la significacin estadstica como la relevancia clnico-epidemiolgica? En el caso de resultados no significativos estadsticamente, era suficiente el tamao del estudio? Se controlan los resultados por las variables de confusin relevantes? 6. Respecto a la discusin: Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente dosis-respuesta, plausibilidad y coherencia, etc.)? Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos de seleccin e informacin y confusin y su efecto sobre los resultados)? Adaptado a partir de: Fletcher RH, Fletcher SW, Wagner EH. Epidemiologa clnica. Barcelona: eds. Consulta; 1989. Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiologa Clnica. Una ciencia bsica para la Medicina Cnica. Madrid: Editorial Mdica Panamericana; 1994.

Lectura crtica de los artculos sobre factores etiolgicos del cncer de pulmn

79

Sesin II ALTERACIONES GENTICO-MOLECULARES DEL CNCER DE PULMN: UTILIZACIN CLNICA Moderador: Rafael Rosell

CLASIFICACIN HISTOLGICA Y LESIONES PRENEOPLSICAS EN CNCER DE PULMN

Jos Ramrez Hospital Clnic Universitat de Barcelona Barcelona

Contenido: Resumen de la ponencia Bibliografa

Clasificacin histolgica y lesiones preneoplsicas en cncer de pulmn

Jos Ramrez
Servicio de Anatoma Patolgica Hospital Clnic. Universitat de Barcelona

1. Clasificacin histolgica del cncer de pulmn Cncer de pulmn es un trmino que incluye todas aquellas neoplasias malignas que la Organizacin Mundial de la Salud (OMS) define en su ltima clasificacin de 1999(1). El nmero total de variantes de cncer pulmonar es de 46, si bien las que corresponden a ms del 95% son siempre de tipo epitelial (carcinomas), por lo que los diversos subgrupos, se reducen a cinco tipos principales, que se indican con cursiva en la siguiente tabla:

Neoplasias malignas epiteliales de pulmn

Tabla 1

Carcinoma escamoso Carcinoma de clulas pequeas Adenocarcinoma Carcinoma de clulas grandes Carcinoma adenoescamoso Carcinoma con elementos pleomrficos, sarcomatosos o sarcomatoides Tumor carcinoide Carcinoma tipo glndula salival Carcinoma inclasificable

Teniendo en cuenta que el procedimiento diagnstico y la actitud teraputica inicial del carcinoma de pulmn distingue solo dos tipos, frecuentemente se habla nicamente de ellos: carcinoma de clulas pequeas (microctico) y carcinoma de clulas no-pequeas (no microctico). Frecuentemente se confunden los trminos, de forma que no es excepcional en conferencias, e incluso en la literatura que se describa cncer de clulas pequeas en lugar de carcinoma, que sera lo correcto. Otra particularidad del carcinoma pulmonar es que es histopatolgicamente heterogneo. La literatura acepta desde hace muchos aos(2) ste hecho, a pesar de lo cual hasta la ltima clasificacin de la OMS(1) no se ha considerado abiertamente. Es en esta clasificacin donde se establece que hasta el 50% de los carcinomas tienen un segundo componente minoritario en el estudio histolgico. Teniendo en cuenta este hecho y de forma arbitraria, la OMS decide que ser clasificado como carcinoma mixto aquel que tenga al menos un 10% del componente minoritario. En el campo de la Oncologa, los carcinomas mixtos se consideran infrecuentes, por lo que siempre se indica la teraputica de acuerdo con el subtipo predominante.
Clasificacin histolgica y lesiones preneoplsicas 85

La utilizacin de tcnicas inmunohistoqumicas para diagnstico tumoral ha permitido conocer con ms detalle los rasgos de las clulas del carcinoma. Estas tcnicas han permitido el estudio de diferentes filamentos intermedios y la localizacin de protenas estructurales que han dado como resultado una diversidad de respuesta ante la aplicacin de anticuerpos como citoqueratinas. La posibilidad de realizar evaluaciones del subtipo inmunohistoqumico cruzadas con marcadores proliferativos abre nuevas expectativas a la clasificacin morfo-funcional de los carcinomas(3-4). La generalizacin de tcnicas de biologa molecular aplicadas al conocimiento de las neoplasias aporta por una parte la confirmacin de la heterogeneidad de este grupo de neoplasias, pero por otra parte puede conducir a la renovacin completa de la clasificacin. No podemos cerrar nuestra mente a que, a medio plazo, los estudios de expresin gnica permitan la clasificacin de los carcinomas pulmonares mediante subgrupos con grandes diferencias sobre los conceptos morfolgicos actuales, tanto en carcinoma de clulas pequeas(5), como en otros subtipos(6). Los criterios bsicos de clasificacin de stos carcinomas se inician con la demostracin de que son tumores con rasgos de malignidad cuyas clulas son epiteliales y presentan o no cantidades apreciables de citoplasma. Aquellos tumores con escaso citoplasma cuyas clulas se agrupan, adaptndose los ncleos entre s, corresponden al carcinoma de clulas pequeas. Por el contrario, los tumores con clulas de citoplasma amplio, que pueden diferenciarse hacia formaciones tubulares, secrecin o formacin de escamas de queratina, corresponderan al grupo de los carcinomas de clulas no pequeas. Estos subtipos, si bien en el momento inicial suponen una actitud teraputica similar, pueden recibir tratamientos diversos, lo que hace necesaria esta amplia tipificacin. Hay dos grupos de tumores de especial inters por la dificultad diagnstica y el confusionismo terminolgico. En primer lugar los carcinomas neuroendocrinos. Estos tumores quedan reflejados en la Clasificacin de la OMS en varios grupos, sin homogeneizarlos, a pesar de la consideracin generalmente aceptada de que stos tumores representan un abanico desde carcinomas poco agresivos, de bajo grado, como el Tumor Carcinoide hasta otros de alto grado, entre los cuales se diferencia el carcinoma de clulas pequeas y el carcinoma de neuroendocrino de clulas grandes. El punto de confluencia de estos tumores es la demostracin de diferenciacin neuroendocrina, ya sea mediante estudio inmunohistoqumico (Sinaptofisina, Cromogranina, Enolasa Neuronal Especfica o CD56) o bien mediante estudio por microscopa electrnica. En segundo lugar el Adenocarcinoma Bronquioloalveolar (AB), variante de adenocarcinoma que puede presentarse con patrn puro o tambin con patrn mixto. El patrn que permite el diagnstico, siguiendo las pautas de la OMS, se corresponde con un tumor "in situ", es decir, sin objetivarse invasin. Dentro de este concepto, hay diferente grado de reaccin estromal, siendo esto y su tamao, criterios que algunos autores correlacionan con el pronstico. La generalizacin de la utilizacin de los sistemas de radiologa avanzada, como el TAC helicoidal, han permitido describir lesiones incipientes, cuya distincin entre el AB, lesiones hiperplsicas y otros tipos de adenocarcinoma es difcil. Es aceptado que definir el componente de tipo bronquioloalveolar en cualquier adenocarcinoma, es importante, ya que estos patrones se correlacionan con mejor pronstico. De esta forma, se ha demostrado que adenocarcinomas con ms del 50% de patrn bronquioloalveolar tienen mejor pronstico a los 5 aos(7). Como comentario a esta clasificacin, conviene resaltar que la caracterizacin definitiva de un tumor pulmonar como carcinoma requiere el conocimiento de la clasificacin de la OMS para no solo limitarse a dividir los carcinomas en clulas pequeas y no-pequeas; sino para llegar a un diagnstico ms exacto.
86 Cncer de pulmn

La posibilidad de aplicar tratamientos especficos obliga a llegar al mximo en la caracterizacin histolgica, ya que sabemos que la diversidad celular de stos tumores puede dificultar su tipificacin. 2. Lesiones preneoplsicas bronco-pulmonares Consideramos que las lesiones preneoplsicas son alteraciones celulares que comportan pasos intermedios hacia el desarrollo de la neoplasia maligna. Este concepto se mezcla con el de lesiones pre-invasivas, siendo ambos sinnimos, desde el punto de vista morfolgico(1-7). Los cambios moleculares o genticos no se hallan bien definidos, si bien hay alteraciones morfolgicas que pueden demostrarse microscpicamente. Estos cambios morfolgicos son las que a continuacin se describen y se separan en las de origen en la va area, en parnquima pulmonar o en clulas neuroendocrinas. Lesiones de la va area. Agrupamos aquellas lesiones de la mucosa bronquial, referidas siempre al componente epitelial y que podemos considerarlas como una progresin desde la primera, ms simple, a la ms agresiva: Hiperplasia de clulas basales. Consiste en el incremento del nmero de capas de estas clulas, que representa una alteracin en el equilibrio del epitelio, con predominio del componente proliferativo sobre el maduro, ciliado, superficial. Metaplasia escamosa. Es un proceso que habitualmente se desarrolla sobre el previo, con sustitucin del epitelio superficial, ciliado por un epitelio ms resistente como es el escamoso poliestratificado. Si bien este nuevo epitelio es anmalo, su morfologa no muestra rasgos atpicos. Displasia leve. Cuando el epitelio escamoso metaplsico comienza a sufrir alteraciones citolgicas, entramos en el concepto de displasia. En su grado inicial es una simple distorsin epitelial del rea metaplsica. Displasia moderada. La OMS no define de forma exacta esta fase intermedia, dejando a una evidente subjetividad su diagnstico. En reas de la patologa diferentes del pulmn, se ha separado nicamente la lesin displsica de alto grado de la de bajo grado, en un intento de mejorar la correlacin entre los diferentes patlogos. En el momento actual an no ha consolidado este concepto (Kerr 2001). Displasia severa. Esta lesin muestra ya cambios citolgicos de evidente proliferacin, con atipia e imgenes de mitosis, siendo difcil de separar del carcinoma. Carcinoma in situ. Es la lesin de mxima alteracin epitelial escamosa, siempre en la superficie, sin superar la membrana basal. Hiperplasia adenomatosa atpica (HAA): Consiste en proliferacin focal del epitelio bronquiolar y alveolar que cubre los septos, con clulas cuboideas montonas, moderadamente atpicas, con ncleo hipercromtico y citoplasma escaso, dando lugar a rea sutil, de difcil visualizacin macroscpica, con dimetro inferior a 5 mm. Su variable atipia y el carcter multicntrico ocasional, le confieren una gran dificultad diagnstica(8). Al ser su aparicin casi siempre subclnica, incidental en el estudio de una pieza quirrgica, su trascendencia clnica an no se halla establecida. Su presentacin puede ser como lesin nica o mltiple(1). Proliferaciones neuroendocrinas: Son lesiones incipientes, que se han relacionado con el desarrollo de carcinomas neuroendocrinos y cuya aparicin se relaciona con simultaneidad de estos tumores. Desde el punto de vista morfolgico se encuadran como Hiperplasia Difusa Idioptica Neuroendocrina. nicamente se observan asociadas a otros tumores neuroendocrinos, siendo excepcional su aparicin de forma aislada.
Clasificacin histolgica y lesiones preneoplsicas 87

Bibliografa: 1. 2. 3. 4. Travis et al. Tumors of the lung and pleura. W.H.O. Springer, 1999. Roggli VL et al. Lung cancer heterogeneity: a blinded and randomized study of 100 consecutive cases. Hum Pathol 1985; 16: 569-579. Bombi JA et al. Ultrastructural and molecular heterogeneity in non-small cell lung carcinomas: Study of 110 cases and review of the literature. Ultrast Pathol 2002; 26: 211-218. Tsubokawa F et al. Heterogeneity of expresin of cytokeratin subtypes in squamous cell carcinoma of the lung: with especial reference to CK14 overexpression in cancer of high proliferative and lymphogenous metastatic potential. Pathol Internat 2002; 52: 286-293. Anbazhagan R et al. Classification of small cell lung cancer and pulmonary carcinoid by gene expression profiles. Cancer Research 1999; 59: 5119-5122. Bhattacharjee A et al. Classification of lung carcinoma by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Aci USA 2001; 98: 13790-13795. Kerr KM. Pulmonary preinvasive neoplasia. J Clin Pathol 2001; 54: 257-271. Niho S, Yokose T, Suzuki K, Kodama T, Nishiwaki Y, Mukai K. Monoclonality of atypical adenomatous hyperplasia of the lung. Am J Pathol 1999; 154: 249-254.

5. 6. 7. 8.

88

Cncer de pulmn

BSQUEDA DE MARCADORES MOLECULARES PARA LA DETECCIN PRECOZ DEL CNCER DE PULMN

Luis M. Montuenga Centro de Investigacin Mdica Aplicada (CIMA) Universidad de Navarra Pamplona

Contenido: Resumen de la ponencia Bibliografa

Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn

Luis M. Montuenga, Mara J. Pajares, Mara D. Lozano, Maribel Zudaire, Jackeline Agorreta, Mara Collantes, Silvestre Vicent, Gorka Bastarrika, Rubn Po, Javier Zulueta
rea de Oncologa, Centro de Investigacin Mdica Aplicada, rea de Cncer de Pulmn, Clnica Universitaria de Navarra y Departamentos de Histologa y Anatoma Patolgica y Bioqumica Universidad de Navarra

l cncer de pulmn es la neoplasia ms comn y con mayor tasa de mortalidad en los pases occidentales. En Espaa, la incidencia de cncer de pulmn en la poblacin masculina en los noventa era de 78,4 casos por cada 100.000 habitantes, muy prxima a los 79,3 de la media europea. En cuanto a la poblacin femenina, el cncer de pulmn ha pasado a ocupar en pases como EEUU el primer puesto en mortalidad entre los tumores malignos, incluso por delante del cncer de mama que haba sido tradicionalmente el tipo de tumor ms letal(1). Las tendencias en cuanto a incidencia y mortalidad por cncer de pulmn en las mujeres espaolas comienzan a ser tambin inquietantes(2).

Adems de ser el cncer ms frecuente, el pronstico del carcinoma pulmonar es pobre y, lo que es ms preocupante, los innegables avances teraputicos de los ltimos 20 aos han tenido escasa repercusin en las expectativas de supervivencia de esta neoplasia. Hoy en da y de forma global, la supervivencia a 5 aos de los pacientes con carcinoma de pulmn no supera el 15%(1). Sin embargo, el pronstico de esta enfermedad es muy diferente segn el estadio clnico-patolgico en el momento del diagnstico. Mientras que en los estadios precoces, mediante reseccin quirrgica, se consiguen supervivencias a los cinco aos prximas al 80%, en los tumores avanzados las expectativas de larga supervivencia son menores del 10%. Desgraciadamente, tan slo el 15% de los tumores malignos de pulmn se encuentran en fases precoces en el momento del diagnstico(3). La reduccin de la mortalidad por cncer de pulmn es una prioridad en la poltica sanitaria. Esta reduccin de la mortalidad slo se conseguir en la medida en que se desarrollen estrategias eficaces en tres direcciones: disminucin de los hbitos tabquicos, deteccin precoz y nuevas terapias dirigidas contra dianas moleculares. Deteccin precoz mediante TAC de baja dosis Dado que, a diferencia de otras neoplasias, no existe todava una prueba estadsticamente validada para la deteccin precoz del cncer de pulmn, la actitud recomendada actualmente para esta neoplasia es esperar a que aparezcan sntomas o sospechas de la enfermedad. El inters por la deteccin precoz del cncer de pulmn se ha intensificado de modo muy notable tras la publicacin en 1999 en la revista Lancet del estudio ELCAP (Early Lung Cancer Detection Program) desarrollado por Henschke y cols en la Universidad de Cornell(4). Este estudio demostr que la utilizacin del TAC (Tomografa Axial Computerizada) helicoidal con baja dosis de radiacin permite detectar ndulos pulmonares malignos de pequeo tamao en personas de riesgo (Fig 1) y propuso esta prueba como potencial herramienta de cribado. Asimismo se ha demostrado que el TAC helicoidal mejora notablemente la capacidad de deteccin de tumores en estadios iniciales en relacin a las tcnicas utilizadas hasta el momento (radiografa de trax y citologa de esputo). Entre las ventajas que se han mencionado para esta tcnica de deteccin precoz est la rapidez (se puede analizar el pulmn entero en menos de 10 segundos),
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 91

su sensibilidad, la baja dosis de radiacin, y la posibilidad de reconstruccin tridimensional y cuantificacin automatizada. Todos estos aspectos estn siendo objeto de investigacin por parte de los tcnicos de desarrollo en este campo y probablemente se refinarn an ms en el futuro inmediato. Aunque hay aspectos que deben ser estudiados a fondo antes de proponerlo formalmente a los sistemas de salud pblica, los estudios que se han publicado desde entonces siguen sugiriendo que esta tcnica puede ser una excelente herramienta para estrategias de cribado en poblaciones de alto riesgo(5-7). Es importante, por tanto, invertir esfuerzos para validar y refinar esta tecnologa de deteccin precoz de cncer de pulmn.

Figura 1: Imagen de un ndulo pulmonar detectado por TAC helicoidal de baja dosis

La experiencia en el diagnstico precoz de otras neoplasias como mama o prstata, sugieren que ste es el camino correcto para reducir la mortalidad por cncer de pulmn, siempre y cuando se cumplan una serie de requisitos tcnicos y organizativos(8). A continuacin (Tabla 1) traducimos la tabla publicada por Warner y Mulshine(8) que resume los criterios que cualquier protocolo de deteccin precoz debe reunir para que pueda justificarse su uso generalizado en el sistema sanitario.

TABLA 1: Criterios necesarios para poner en marcha un protocolo de cribado en individuos de riesgo (traducido de referencia 8)

La enfermedad que se busca ha de ser un problema sanitario de importancia La enfermedad debe tener un periodo de latencia o presintomtico La historia natural de la enfermedad, incluida el paso del estadio latente al sintomtico, debe ser adecuadamente comprendida Debe existir una prueba adecuada con la que hacer el cribado La prueba debera ser aceptable a la poblacin Debe existir un tratamiento eficaz para los pacientes con enfermedad temprana Debe existir un consenso sobre a quines considerar pacientes de la enfermedad El costo (incluido el diagnstico y el tratamiento de los pacientes diagnosticados) debe ser proporcional al gasto sanitario general por la enfermedad La bsqueda de nuevos casos debe ser un proceso continuado, no algo que se lleve a cabo una nica vez

92

Cncer de pulmn

No es este el momento para detenernos a comentar cada uno de estos criterios. Sin embargo, es preciso sealar que las nuevas tecnologas de diagnstico precoz por TAC helicoidal de baja dosis han permitido dar pasos de gigante en relacin al cumplimiento de estos criterios. Es, en efecto, necesario seguir investigando en diversas direcciones sobre esta tcnica para responder a diversos interrogantes. Por ejemplo, conviene aclarar el efecto del uso de esta tecnologa en la disminucin de la mortalidad por cncer de pulmn en una poblacin concreta (ensayos diagnsticos aleatorizados). Asimismo, es preciso determinar su pertinencia desde el punto de vista del coste-beneficio. Por ltimo, es imprescindible aclarar muchos aspectos de la biologa de las lesiones que se resecan en estos individuos(9). No obstante, todos los datos de los estudios observacionales apuntan a que en breve tendremos una excelente herramienta para poner en marcha estrategias de deteccin precoz de cncer pulmonar a nivel poblacional. Biomarcadores en la deteccin precoz Para que las tcnicas de imagen sean realmente eficaces en programas de cribaje poblacional de deteccin precoz, es necesario conseguir niveles altos de sensibilidad y especificidad. En este sentido, resulta tambin especialmente interesante la posibilidad de combinar estas tcnicas radiolgicas con el uso de marcadores moleculares que confirmen la presencia de clulas transformadas en el tracto respiratorio del paciente, o que nos permitan conocer su perfil molecular o predecir su respuesta biolgica ante tratamientos concretos(10). En los aos recientes se han identificado algunos biomarcadores que pueden ayudar a clarificar ms o menos ajustadamente la naturaleza/clasificacin de una determinada neoplasia, su pronstico, o su capacidad de producir metstasis o responder a determinadas pautas quimioteraputicas. Sin embargo, la identificacin de biomarcadores para la deteccin precoz y para lesiones premalignas ha tenido un xito relativamente limitado. Algunos de los trabajos se han basado en el estudio de muestras obtenidas por mtodos invasivos y caros (por ejemplo la broncoscopia) y que tienen cierto riesgo para el paciente. Es probable que los biomarcadores que finalmente vayan a ser de utilidad prctica para la deteccin precoz del cncer de pulmn en el entorno clnico se determinen en muestras ms asequibles y menos invasivas. Un buen biomarcador que tenga posibilidades de xito, equivalente al PSA en prstata (aunque tambin tiene sus limitaciones), debera tener una serie de caractersticas, que se resumen en la Tabla 2

TABLA 2: Caractersticas de un buen biomarcador

Diferente expresin en clulas (pre)neoplsicas respecto a clulas normales; o expresin en clulas no neoplsicas en presencia de un cncer Presente y detectable en muestras mnimamente invasivas Existe un criterio claro de validacin en el tiempo, por ejemplo una situacin clnicopatolgica concreta y bien definida Hay un sistema bien establecido para cuantificar sus niveles Detectable en muestras pequeas Estable con el tiempo y el procesamiento de las muestras Se puede establecer un mtodo rutinario y automatizado de anlisis

En los intentos de desarrollar nuevos biomarcadores para la deteccin precoz del cncer de pulmn, la investigacin ha de recorrer necesariamente diversas fases, algunas de las cuales han sido resumidas recientemente por Chanin y cols(11). En primer lugar hay que conocer mejor la biologa de
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 93

la progresin tumoral en los diversos tipos de cncer de pulmn. En segundo lugar, hay que delimitar algunos candidatos entre los genes (DNA y RNA) y las protenas alteradas, en el proceso de carcinognesis. Despus, conviene desarrollar herramientas tcnicas robustas y sencillas para analizar estas alteraciones moleculares en muestras mnimamente invasivas. Por ltimo, hay que validar estas tecnologas en poblaciones de riesgo. Los protocolos de investigacin organizados para validar el TAC helicoidal como herramienta de deteccin precoz son el contexto idneo para llevar adelante el anlisis y la validacin de los posibles biomarcadores. De hecho, nosotros estamos recogiendo muestras de sangre y esputo de todos los participantes en el proyecto ELCAP de la Clnica Universitaria de Navarra. A continuacin comentaremos algunos aspectos de la situacin de cada una de estas fases de la investigacin en relacin a los biomarcadores de deteccin precoz. Genes candidatos Para el desarrollo de tecnologas diagnsticas, basadas en marcadores moleculares, es necesario conocer mejor las alteraciones moleculares implicadas en el desarrollo del carcinoma pulmonar, como por ejemplo las alteraciones cromosmicas, genticas y epigenticas. De hecho, la urgencia por desarrollar nuevas estrategias de deteccin y estrategias teraputicas novedosas ha conducido a una bsqueda muy activa y productiva de alteraciones cromosmicas, genticas, epigenticas y fenotpicas asociadas al cncer de pulmn. El nmero de genes, vas metablicas y regiones cromosmicas relacionadas con la carcinognesis pulmonar es muy abundante. La citogentica convencional y molecular ha aportado numerosos datos que demuestran abundantes cambios cromosmicos somticos implicados en la patognesis del cncer de pulmn. A pesar de la complejidad de los cambios genmicos observados en estas neoplasias, se han detectado algunos patrones comunes o ms frecuentes. En el carcinoma escamoso, por ejemplo, son frecuentes las prdidas en 2q, 3p, 3q, 4q, 7p, 9q, 13q, 16q, 17p y 21q, as como las ganancias en 3q. Las ganancias en 1q23, 7p, 15q y 20q y la delecin en 6q, 13q, 18q y 19q22 se han asociado a adenocarcinomas. Sin embargo, todava se conoce poco de los genes localizados en esas regiones en las que probablemente puedan hallarse oncogenes (regiones amplificadas) y genes supresores de tumores (regiones de prdidas). Varios grupos en todo el mundo se estn especializando en el anlisis de las alteraciones cromosmicas en cncer de pulmn, utilizando la tcnica de FISH con una o mltiples sondas(12) y la tcnica de hibridacin genmica comparada (CGH). Nosotros estamos desarrollando una tcnica que combina el Multi-FISH con el inmunofenotipaje, y que recibe el nombre de FICTION(13). Los estudios que han utilizado arrays CGH como herramienta de anlisis de series amplias de pacientes(14) han demostrado una alta frecuencia de aumento selectivo de copias en varias regiones cromosmicas, as como regiones en las que el nmero de copias est frecuentemente disminuido (Tabla 3). TABLA 3: Regiones cromosmicas ms frecuentemente alteradas en carcinoma no microctico de pulmn (NSCLC), segn estudios de arrays de CGH(11) Regiones con ganancias cromosmicas 1q31 5p13-14 3q25-27 8q23-24

Regiones con prdidas cromosmicas 3p21 13q22 8p22 17p12-13 9p21-22

94

Cncer de pulmn

Existen algunos rasgos moleculares especficos de la clula tumoral, resumidos magistralmente por Hannahan y Weinberg en su revisin The hallmarks of cancer(15), que suelen venir determinados por alteraciones moleculares genticas o epigenticas. Muchas de estas alteraciones se han asociado especficamente a la carcinognesis pulmonar humana.Tanto mutaciones puntuales de genes, amplificaciones o deleciones cromosmicas, prdidas de heterocigosidad o alteraciones de microsatlites pueden activar oncogenes o inactivar genes supresores de tumores, perturbando por ejemplo la regulacin de la proliferacin, apoptosis y angiognesis, invasin y metstasis. La alteracin epigentica mejor estudiada es la hipermetilacin del promotor de genes determinados, en especial de genes supresores de tumores. La Tabla 4 resume los cambios moleculares ms estudiados en cncer de pulmn, que han sido revisados recientemente por Sekido y cols(16). TABLA 4: Principales alteraciones genticas y epigenticas asociadas al cncer de pulmn Alteraciones gnicas Mutaciones en ras Amplificacin de myc Sobreexpresin de bcl-2 Mutacin en p53 Expresin anormal de p53 Baja o nula expresin de Rb Mutacin en p16 Ausencia de expresin de p16 Hipermetilacin del promotor CDH1 (E-cadherina) CDH13 (H-cadherina) p16 APC RAR FHIT RASSF1A TIMP-3 DAPK MGMT SCLC < 1% 15-30% 75-95% 75-100% 40-70% > 90% < 1% 0-10% SCLC 60% 15% 5% 15% 45% 64% 79-85% / / 16% NSCLC 15-20% 80% 10-35% 50% 40-60% 15-30% 10-40% 30-70% NSCLC 18-33% 43-45% 25-40% 46-96% 40-43% 37% 30-40% 20-26% 16-44% 16-27%

En cncer de pulmn K-ras est mutado en un 15-20% de todos los carcinomas no microcticos de pulmn (Non Small Cell Lung Cancer, NSCLC) y en un 20-30% de los adenocarcinomas. Las mutaciones ocurren preferentemente en el codn 12 de K-ras, y con menor frecuencia en los codones 13 y 61. Los genes supresores de tumores ms frecuentemente alterados en el cncer de pulmn son p53, p16
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 95

y Rb. La elevada frecuencia de deleciones en 3p21 ha generado multitud de estudios en busca de otros posibles genes supresores localizados en esta regin. Estudios mediante polimorfismos de fragmentos de restriccin (RFLPs), RT-PCR y marcadores de prdida de heterocigosidad (LOH) han sugerido el posible papel supresor de varios genes localizados en 3p21.3. As, se han descrito deleciones homocigticas en una regin de 120 kb en 3p21.3 afectando a CACNA2D2, 101F6, NPRL2, BLU, FUS1, HYAL2, HYAL1, SEMA3B, SEMA3F y RBM5/H37, entre otros. Sin embargo, la tasa de mutacin para estos genes es muy baja (menos de 5% de los casos) en la mayora de los estudios, sugiriendo que, en el caso de ser supresores tumorales, la va de inactivacin no es la mutacin genmica. Uno de los mecanismos de inactivacin de genes supresores frecuente en pulmn es la hipermetilacin del promotor, descrita en genes como RASSF1A (tambin en 3p21), RAR, TIMP-3, CDKN2A/p16, MGMT, DAPK, ECAD, GSTP1 y tambin FHIT. En nuestro laboratorio estamos estudiando un potencial nuevo gen supresor de tumores en esa regin cromosmica: el gen que codifica para la protena unidora de RNA alfaCP4(17). Tambin estamos investigando las alteraciones en los mecanismos de procesamiento de RNA y su efecto en la regulacin de la expresin gnica en cncer de pulmn(18). En ciertos tumores, incluido el cncer de pulmn, la sealizacin a travs de factores de crecimiento est anormalmente intensificada. La expresin de factor de crecimiento transformante beta-1 (TGF-1) en cncer de pulmn se ha asociado con angiognesis, progresin tumoral, mal pronstico y menor supervivencia(19-21). El factor de crecimiento fibroblstico-2 (fibroblast growth factor-2, FGF-2) induce la angiognesis, proliferacin y migracin y algunos estudios sugieren que protege frente a la apoptosis. FGF-2 se expresa en tumores NSCLC y esta expresin se correlaciona con mal pronstico y menor supervivencia(22). Asimismo, niveles elevados en suero de FGF-2 se correlacionan con un mal pronstico en pacientes con NSCLC y carcinoma microctico de pulmn (Small cell lung cancer, SCLC)(22). El factor de crecimiento epidrmico (EGF) acta a travs de su receptor (EGF receptor, EGFR/erbB1/HER1), que tiene actividad quinasa de tirosinas y que se encuentra sobreexpresado en muchos tumores pulmonares(23). Tras la unin al ligando, el EGFR forma homo o heterodmeros con alguno de los otros tres receptores de su misma familia (ErbB-2, tambin llamado HER2/neu, ErbB-3 y ErbB-4). El EGFR se encuentra sobreexpresado en el 40-80% de los NSCLC. HER2/neu, se encuentra sobreexpresado con frecuencia en carcinomas pulmonares. Se ha demostrado que la sobreexpresin de HER2/neu y la sobreexpresin simultanea de EGFR y HER2/neu, correlacionan con una peor evolucin de la enfermedad en NSCLC(23). El factor de crecimiento de hepatocitos (hepatocyte growth factor, HGF) acta a travs de un receptor quinasa de tirosinas denominado c-met, que se encuentra sobreexpresado tanto en SCLC como en NSCLC. Sin embargo, la sobreexpresin de HGF se ha detectado slo en NSCLC(24). La alta expresin de HGF en NSCLC se asocia con una menor supervivencia de los pacientes(29). En nuestro laboratorio hemos estudiado la relevancia de un factor de crecimiento, la adrenomedulina, presente en clulas normales y tumorales. Tambin nos hemos interesado por la activacin de la va del las MAPKs en cncer de pulmn y su potencial utilidad diagnstica o como diana teraputica(25,26) La tcnica de arrays de expresin aplicada al cncer de pulmn est proporcionando asimismo una gran cantidad de datos y diversas listas de genes aparentemente asociados a la carcinognesis pulmonar. Los estudios pioneros de Garber y cols(27) analizaron la expresin gnica en 67 carcinomas pulmonares, e identificaron un patrn de expresin gnica caracterstico de cada tipo histolgico. Casi simultneamente, Bhattacharjee y cols(28) Analizaron 186 tumores pulmonares y 17 muestras normales y tambin definieron un patrn de expresin gnica que diferenciaba cada tipo de carcinoma pulmonar, distinguiendo incluso 4 subcategoras dentro de los adenocarcinomas. El estudio de Beer y cols(29) fue diseado especficamente para identificar patrones de expresin gnica que predicen supervivencia en cncer de pulmn. Tras la interpretacin de sus datos, seleccionaron un conjunto de 50 genes cuya expresin podra discriminar entre grupos de pacientes de carcinoma pulmonar en estadio I con mejor
96 Cncer de pulmn

o peor supervivencia. En su estudio sugieren que la identificacin de este grupo de pacientes carcinoma pulmonar en estadio precoz de alto riesgo, puede ayudar a determinar qu pacientes podran beneficiarse de la quimioterapia adyuvante. Estos tres estudios fueron los pioneros en la utilizacin de microarrays en cncer de pulmn. En los ltimos dos aos, se han seguido publicado numerosos artculos describiendo el perfil de expresin gnica del carcinoma no microctico de pulmn en diversas series de pacientes y utilizando diversas plataformas. Los distintos trabajos informan de perfiles de expresin gnica del cncer de pulmn comparando situaciones variadas: mayor o menor actividad metastsica(30); grupos de genes que distinguen el adenocarcinoma de la clula epitelial pulmonar normal(31); tumores ms o menos diferenciados(32); patrones de genes relacionados con la respuesta o la resistencia a quimioterapia(33,34,35), etctera. Son ya ms de 30 los artculos sobre expresin gnica diferencial en cncer de pulmn. La combinacin de arrays de CGH con arrays de expresin est generando muchos datos, que requieren ser integrados, y abre el camino hacia una clasificacin molecular de los carcinomas pulmonares. En muchos casos las plataformas de anlisis que se utilizan son diversas y los diseos experimentales y criterios de interpretacin difieren notablemente. De ah que recientemente se estn haciendo esfuerzos importantes en la lnea de la integracin, comparacin y validacin estadstica de los datos que se generan por las diversas tecnologas. La bioinformtica tiene mucho que decir en estos momentos, para llegar a disponer de una lista suficientemente robusta de genes que puedan ser utilizados como marcadores diagnsticos de cncer de pulmn(36, 37). Parmigiani y colaboradores(36) han publicado recientemente un trabajo de comparacin de los datos sobre expresin gnica en cncer de pulmn obtenidos por los tres grupos pioneros en la utilizacin de los microarrays en cncer de pulmn que ya hemos citado anteriormente(27-29). Estos grupos utilizaron plataformas y diseos distintos. Se trata de un estudio bioinformtico complejo, con grandes dificultades metodolgicas, motivadas por la gran diversidad de los datos de partida. En su estudio concluyen que hay acuerdo, aunque incompleto, entre el patrn de genes relacionados con la biologa del cncer de pulmn, y de hecho presentan una lista de genes que predicen reproduciblemente el curso de la enfermedad (Tabla 5). Sin embargo, observan tambin niveles importantes de variabilidad entre los estudios que puede ser el reflejo de la variabilidad biolgica entre las muestras de partida, las divergencias tecnolgicas, o simplemente del azar. Otra de las reas de mayor inters en el campo de los biomarcadores, y en especial en la deteccin precoz, es la de la protemica. Los datos obtenidos por arrays de cDNA han proporcionado listas amplias de genes, sin embargo la expresin de mRNA correlaciona pobremente con la de protenas. En la medida en que podamos analizar los patrones de expresin de protenas de modo global y rpido mejoraremos notablemente nuestra capacidad de comprensin de las complejidades moleculares de las clulas tumorales. Los estudios iniciales de protemica de cncer en el contexto clnico, publicados por el grupo de Liotta del NCI, han sugerido que el uso de los perfiles protomicos del suero pueden discernir entre pacientes con cncer e individuos sanos. El estudio de Petricoin y cols(38) obtuvo el perfil protemico tras espectrometra de masas a partir de sueros de 50 pacientes de cncer de ovario y de 50 controles. Un algoritmo de anlisis fue capaz de distinguir entre ambos perfiles, identificando un patrn discriminatorio. Este patrn de picos, especfico de cncer, se utiliz para examinar otro grupo de muestras independiente y adivinar las que eran de cncer ovrico con un 100% de sensibilidad y un 95% de especificidad. Ms recientemente, el grupo de Carbone, ha publicado en Lancet el primer estudio de perfiles de protemica en cncer de pulmn(39). En este estudio se han obtenido los perfiles de expresin proteica de las clulas neoplsicas mediante la tcnica de MALDI-TOF, y basados en sus resultados han podido clasificar los tumores pulmonares en subgrupos biolgicamente homogneos, correspondientes a las variables clinicopatolgicas clsicas. Este resultado (la utilizacin de una tecnologa muy sofisticada para clasificar tumores ya clasificados por microscopa de luz) no tendra mayor relevancia
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 97

TABLA 5: Genes identificados como predictores significativos de supervivencia concordantes en los tres estudios pioneros de array de expresin en cncer de pulmn (referencia 19) Nombre Glypican 3 BENE protein Iroquois homeobox protein 5 Fibroblast growth factor rec. 2 Folate receptor 1 (adult) Tyrosinase-related protein 1 Syntaxin 1A Immunoglobulin J polypeptide MAD2 mitotic arrest def-like 1 Vasc. endoth. growth factor C KIAA0101 gene product Interleukin 6 signal transducer Selectin L Rho GDP diss inhib (GDI)
* UID: unigene ID

UID

119651 185055 25351 278581 73769 75219 75671 76325 79078 79141 81892 82065 82848 83656

clnica de por s. Sin embargo, el anlisis de sus datos tambin ha proporcionado un patrn de picos de espectrometra de masas que clasifican a los pacientes en dos grupos de buen y mal pronstico. Asimismo, ha identificado dos protenas (SUMO-2 y timosina -4) como potenciales protenas marcadoras de NSCLC. Ms recientemente, se han publicado otros dos estudios de protemica en cncer de pulmn(40,41). El estudio de Chen y cols(40) identific por electroforesis bidimensional una serie de puntos aparentemente especficos de cncer de pulmn, 33 de los cuales parecan asociados a supervivencia. De ellos, 12 protenas candidatas fueron confirmadas por inmunohistoqumica. En combinacin con un estudio paralelo de cDNA se identificaron 11 protenas de la va glicoltica como asociadas con supervivencia baja, y en especial los niveles en suero de fosfogliceratoquinasa 1 como un ajustado biomarcador de mal pronstico. Ninguno de los dos estudios propone por ahora el uso de la protemica como biomarcador de deteccin precoz. De genes especficos a biomarcadores Hasta ahora, muchos de los esfuerzos se han dirigido a identificar los posibles genes o grupos de genes alterados en el proceso de carcinognesis pulmonar. Se han buscado bsicamente herramientas para una clasificacin molecular del cncer de pulmn, y para entender mejor el proceso de carcinognesis. Recientemente Meyerson y cols(42) han resumido los datos disponibles hasta la actualidad en esta fase del descubrimiento de biomarcadores. Chanin y cols(11) han realizado el esfuerzo de compilar una lista de biomarcadores prometedores para la deteccin precoz, aunque el grado de desarrollo de cada uno
98 Cncer de pulmn

es muy variable, y ninguno est validado. En el supuesto de que lleguemos pronto a consensuar una lista de estas alteraciones, habremos llegado slo a cubrir un primer paso de nuestro trayecto, que terminar con la utilizacin rutinaria de marcadores moleculares para el diagnstico precoz. El siguiente paso es desarrollar tcnicas para detectar estas alteraciones, no slo en los tejidos tumorales sino en otras muestras biolgicas que puedan obtenerse en la rutina clnica y de modo mnimamente invasivo. Al proceso de descubrimiento de marcadores candidatos, le sigue la puesta a punto de tcnicas para demostrarlo en las muestras clnicas. Qu muestras clnicas pueden ser informativas de la presencia de un tumor pulmonar en estadios precoces? A continuacin, mencionaremos el tipo de muestras biolgicas de las que se puede obtener informacin desde el punto de vista de los biomarcadores (Fig 2). Nos referiremos, en concreto, sangre, a biopsias del tumor, cepillado bronquial, lavado bronquioalveolar, puncin aspirativa con aguja fina (FNA), esputo inducido, y exhalado respiratorio, poniendo algunos ejemplos en relacin a la posible utilidad de estas muestras y sealando ventajas e inconvenientes.

Figura 2: Posibles fuentes de biomarcadores: A: sangre; B: lavado bronquioalveolar y esputo; C: exhalado respiratorio

Biomarcadores en sangre La gran ventaja del anlisis de biomarcadores en sangre, sea suero o plasma, es la facilidad de obtener y procesar las muestras, la mnima invasividad y el hecho de que se han desarrollado ya numerosas tecnologas para el anlisis masivo y rpido de numerosos casos. De hecho, la bsqueda de biomarcadores de cncer de pulmn en sangre es la que comenz ms tempranamente. El gran inconveniente de este tipo de muestra es que los cambios en el medio interno pueden provenir de cualquier localizacin del organismo y no tienen por qu reflejar nicamente las alteraciones que ocurren en el pulmn. La presencia de clulas tumorales de cncer de pulmn circulantes es conocida desde hace tiempo(43), pero probablemente sea menos relevante en los tumores de estadio precoz muy localizados. En todo caso, el biomarcador en sangre, paralelo por ejemplo a lo que ocurre con el PSA, sera sin duda un biomarcador ideal. En este sentido, los trabajos sobre deteccin en suero o plasma de mutaciones de k-ras(44,45) o p53(46), alteraciones de microsatlites(46,47), DNA circulante(48), LOH para varias regiones(49), y metilacin aberrante de diversos promotores(50,51,52) son buenas bases para el desarrollo de los biomarcadores de deteccin precoz basados en en anlisis de sangre. Es muy probable que la estrategia de desarrollo de biomarcadores se concrete ms adelante en forma de un anlisis simultneo de una batera ms o menos amplia de alteraciones. El trabajo publicado recientemente por el grupo de Pastorino y Sozzi, es un ejemplo en esta lnea. Su estudio(46) presenta un anlisis simultneo de mutaciones de p53, y alteraciones de microsatlite para el lugar de FHIT y otras regiones de 3p en pacientes de carcinoma
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 99

pulmonar. Existen tambin propuestas para el anlisis de niveles de algunos factores de crecimiento en suero, como VEGF, que parecen tener valor pronstico(53). Adems, la concentracin en suero de VEGF-C parece que puede tener utilidad diagnstica en combinacin con TAC helicoidal(54). Sin embargo, una revisn reciente comparando los resultados de diversas publicaciones arroja cierta duda sobre la utilidad de la medida de factores de crecimiento como marcadores tumorales en cncer de pulmn(55). Segn ese mismo estudio los datos ms convincentes son los que se refieren a la medida en suero del marcador Cyfra 21-1 (fragmentos de citoqueratina 19), para el que la mayora de los trabajos publicados han presentado resultados positivos como marcador de NSCLC. Los niveles de Cyfra 21-1 han sido analizados en poblaciones amplias de pacientes con resultados significativos en cuanto a su valor pronstico(56). Como se puede deducir por lo expuesto hasta ahora, ninguna de las publicaciones mencionadas plantea por el momento el anlisis prospectivo de individuos de alto riesgo con intenciones de deteccin precoz. Como hemos dicho ms arriba, estamos todava en los primeros pasos de la investigacin dirigida a encontrar el biomarcador ms adecuado para la deteccin precoz. Anlisis de biomarcadores en otras muestras biolgicas Como hemos dicho anteriormente, la desventaja del anlisis de biomarcadores en suero o plasma es que la presencia de un biomarcador en sangre no es informativa en relacin al origen local de ese biomarcador. Otras muestras biolgicas como el lavado bronquioalveolar, el esputo o las biopsias (obtenidas por broncoscopia o puncin por aguja fina) nos proporcionan datos que proceden de la composicin molecular de fluidos procedentes de las vas reas, es decir, geogrficamente mucho ms cercanos a las posibles clulas neoplsicas o preneoplsicas del pulmn. Las muestras citadas se pueden comparar al parte meteorolgico emitido por la estacin local, que es siempre mucho ms exacto y ajustado, en comparacin a la informacin que proporciona sobre esa misma localidad el servicio meteorolgico nacional, basado en la informacin general de todo el planeta obtenida por el satlite. El anlisis de las biopsias que proporciona el broncoscopista, las clulas de un aspirado de aguja fina de un ndulo perifrico, del material exfoliativo del cepillado bronquial, del lavado bronquioalveolar, del esputo inducido o del exhalado respiratorio nos informan nica y exclusivamente de los cambios celulares o moleculares que ocurren en el epitelio del pulmn o las vas areas. De ah su ventaja terica de partida. Desde el punto de vista del conocimiento de la historia natural y la carcinognesis de los ndulos detectados por TAC helicoidal, el material biolgico ms preciado son las clulas enteras y los restos celulares obtenidos en la puncin de aguja fina de estos ndulos. Son todava pocos los grupos multidisciplinares que tienen incorporada la FNA de los ndulos detectados por TAC helicoidal, en especial en el caso de los ndulos de tamao ms reducido. Aunque hay algunas publicaciones referidas al anlisis citolgico de estas clulas, utilizando tcnicas de tincin convencional(57), no existen estudios moleculares con este material realizados en relacin a la deteccin precoz mediante TAC helicoidal. Fuera de este contexto, el anlisis morfolgico de muestras citolgicas obtenidas por puncin de aguja fina o broncoscopia es un mtodo importante en el diagnstico del carcinoma broncognico. Sin embargo, la sensibilidad de este mtodo no es completa (entre el 60 y el 80%). Warner y cols(58) han utilizado RT-PCR semicuantitativa para evaluar la expresin relativa de c-myc, E2F1 y p21 como metodologa complementaria al anlisis morfolgico, aumentando notablemente la sensibilidad diagnstica. El anlisis molecular de las biopsias obtenidas por broncoscopia es equivalente al que se puede hacer en cualquier muestra de reseccin. Se han llevado a cabo numerosos estudios en relacin a este material, cuyo resumen est fuera del objetivo de este trabajo. El material de broncoscopia es muy til
100 Cncer de pulmn

para el diagnstico de lesiones preneoplsicas y neoplsicas en las vas areas ms centrales y es un material muy valioso para estudiar los cambios moleculares sucesivos en el proceso de carcinognesis pulmonar, en especial del carcinoma escamoso(59, 60). Sin embargo, se obtiene por medios relativamente invasivos y caros, y difcilmente se impondr como estrategia de rutina para la deteccin precoz. McWilliams y cols.(61) han proporcionado algunos datos que sugieren que el cribado de individuos de alto riesgo mediante una combinacin de tres tcnicas, TAC helicoidal y broncoscopia de fluorescencia, tras anlisis previo de la citologa del esputo, podra constituir un nuevo paradigma para organizar la deteccin precoz a nivel poblacional. La complejidad de esta propuesta desde el punto de vista logstico, y su dudosa eficiencia desde el punto de vista del coste-beneficio han sido subrayadas recientemente(62). Desde el punto de vista del anlisis rutinario de biomarcadores, probablemente el lavado bronquioalveolar (BAL), pueda llegar a ser ms informativo y prctico que la biopsia,. De hecho, son numerosos los trabajos recientes que informan de la deteccin de potenciales biomarcadores de cncer de pulmn (DNA, RNA o protenas) en lavado bronquioalveolar. Por ahora, la mayor parte de los estudios son ensayos de desarrollo tecnolgico (proof of concept) en un nmero limitado de muestras. Con tcnicas suficientemente sensibles, se pueden detectar en el BAL alteraciones de microsatlites propias del cncer de pulmn(63). Carstensen y cols(64) pudieron encontrar, tanto en sobrenadante como en la fraccin celular del BAL, DNA amplificable y de calidad. Casi el 50% de los pacientes de cncer de pulmn fueron positivos para alteraciones de microsatlites en el BAL. Existen tambin varios trabajos recientes en la literatura que demuestran que en el BAL se puede analizar la metilacin aberrante del promotor de diversos genes, y sugieren que esta tcnica podra ser eficaz en la deteccin precoz del cncer de pulmn(65,66,67) Desde el punto de vista de la deteccin precoz, hay muchas esperanzas puestas en el uso del esputo como fuente de deteccin de biomarcadores de cncer de pulmn. El esputo es una muestra no invasiva y fcil de obtener, aunque normalmente requiere un protocolo de induccin que garantice la calidad de la muestra, de modo que sea informativa no slo de las vas altas, sino tambin del pulmn perifrico. Recientemente, Thunnissen(68) ha revisado los datos disponibles en la literatura sobre el anlisis de esputo y su papel en la deteccin del cncer de pulmn. La citologa convencional de esputo, buscando clulas epiteliales anormales, es una tcnica de rutina. El estudio citopatolgico rutinario ha demostrado poca eficacia relativa en los protocolos de cribado de individuos de alto riesgo para la deteccin precoz de cncer de pulmn que se llevaron a cabo a finales de los aos 70(69). Sin embargo, algunos estudios recientes subrayan la utilidad del anlisis de anormalidades del esputo como marcadores del desarrollo de cncer de pulmn en una poblacin de alto riesgo(70,71). El desarrollo de las tcnicas de biologa molecular y de anlisis de imagen han abierto nuevas perspectivas muy prometedoras para el uso del esputo como fuente de informacin sobre la presencia o el perfil biolgico de un carcinoma pulmonar. La citometra semiautomatizada del esputo se ha propuesto como una herramienta potencialmente til para protocolos de cribado y deteccin precoz(72). El anlisis inmunocitoqumico del esputo con anticuerpos contra protenas propias de las clulas neoplsicas es otro campo de inters. De hecho, el anlisis del esputo con anticuerpos contra hnRNP A2/B1 se propuso hace unos aos como una herramienta potencialmente til(73), sin embargo la afinidad y especificidad de los anticuerpos monoclonales utilizados no los hace ptimos como herramienta de cribado. Posteriormente se propuso utilizar otros anticuerpos contra hnRNP B1(74), pero esta tcnica tambin requiere refinamiento y validacin. En todo caso, la aproximacin inmunohistoqumica es sin duda una manera de aumentar la sensibilidad de la tcnica citolgica. Nuestro grupo est desarrollando en este momento una tecnologa tericamente mucho ms informativa que combina el inmunofenotipaje de las clulas con el anlisis de alteraciones genticas mediante la tcnica de multi-FISH(13).
Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn 101

El objetivo de la deteccin precoz con muestras de esputo son las clulas neoplsicas o preneoplsicas presentes en la muestra, que normalmente suponen una fraccin muy pequea de todas las clulas (frecuentemente menos de un 1%). Adems de las clulas, es posible que haya restos celulares disueltos en el fluido, que tambin puedan ser informativos, por ejemplo por su contenido en DNA desnudo de las clulas tumorales. La baja cantidad relativa de DNA tumoral (menos de un 1%) respecto al resto supone que las tcnicas de anlisis que se utilicen para estudiarlo han de ser especialmente sensibles. En su revisin, Thunnissen(68) describe con detalle las diversas tecnologas que se han propuesto para el estudio de alteraciones en el DNA. Utilizando tecnologa especialmente sensible, se detectan ya en muestras de esputo mutaciones de k-ras(75,76,77). En los ltimos aos se han publicado artculos sobre deteccin de alteraciones de microsatlite y metilacin aberrante de promotores(78,79). En el trabajo de Palmisano y cols(79) se demuestra que la alteracin molecular es detectable en el esputo inducido hasta 3 aos antes del diagnstico clnico. El reto de la utilizacin del esputo como fuente de informacin sobre el epitelio respiratorio y, en especial, sobre la presencia de marcadores (pre)neoplsicos es un reto puramente tcnico. Por ejemplo, en relacin a lo comentado hasta ahora, es imprescindible asegurar unos niveles muy altos de robustez, control de calidad y reproducibilidad, de modo que se puedan confirmar estos hallazgos iniciales esperanzadores en poblaciones de alto riesgo ms numerosas. En el caso de la metilacin es de especial importancia la homogeneizacin de protocolos y la proteccin frente a falsos positivos o negativos. Tambin es un reto tcnico poner a punto tcnicas para valorar los perfiles de expresin y la presencia de determinados mRNA y protenas utilizando como muestra de partida el esputo, que es un fluido cargado de proteasas y RNasas. De ah que el avance de la tecnologa microarray y de la protemica sea todava muy lento en cuanto se pretende estudiar el esputo inducido. Estrategias de futuro Despus de referirnos a muestras en las que se est estudiando activamente, terminaremos con algunos datos sobre una nueva estrategia de deteccin de biomarcadores para cncer de pulmn, que se han propuesto recientemente. Nos referimos en concreto al anlisis de biomarcadores en el exhalado respiratorio. Dentro de las cavidades respiratorias (alvolos y sacos alveolares) se da un activo intercambio gaseoso, y tambin una salida de algunos fluidos al medio extracelular. Algunos de esos fluidos y gases pueden contener informacin valiosa, que en teora, con tcnicas suficientemente sensibles podra ser detectable. El anlisis del exhalado respiratorio est en su infancia ms absoluta, pero sin duda es una idea prometedora, que podra ayudar en los protocolos de deteccin precoz por imagen, quizs informando de la presencia de un ncleo de clulas tumorales oculto al radilogo. El concepto terico que subyace a estos anlisis es el de que hay numerosos compuestos orgnicos voltiles en la sangre y en el aire exhalado de cualquier individuo, y que la concentracin o composicin relativa de estos compuestos son diferentes en el are exhalado por un paciente con cncer y un paciente normal(80). Un reciente estudio va ms all al demostrar la posibilidad de detectar DNA secuenciable, y en concreto mutaciones de p53, en el condensado del aire exhalado. El condensado se obtiene haciendo respirar al paciente durante 10-20 minutos a travs de un dispositivo de recogida que condensa la humedad del aire respirado enfrindolo rpidamente(81). Todava no hay datos comparativos con casos pareados entre estas tecnologas que analizan el aire exhalado y otras tecnologas propuestas para la bsqueda de biomarcadores. Antes de que se pueda poner marcha un protocolo eficaz de cribado para la deteccin precoz del cncer de pulmn se requiere una serie de condiciones, que por ahora ningn biomarcador para esta neoplasia rene. Uno de los beneficios de tener un reto tan exigente es que el desarrollo tecnolgico mantiene un ritmo muy fuerte y poco conformista. Se trata de aumentar la sensibilidad y especificidad
102 Cncer de pulmn

de las tecnologas, incidiendo no slo en aspectos clave como el procesamiento y conservacin de las muestras, sino tambin desarrollando nuevas tecnologas ms eficaces. Algunos ejemplos de reciente desarrollo tecnolgico, publicados en la literatura de la deteccin precoz de cncer de pulmn son: la mejora de las tcnicas de hibridacin cromosmica (FISH) para clulas exfoliativas(82,83), y el intento de poner a punto protocolos de protemica sobre muestras obtenidas de microdiseccin (aunque para este trabajo requirieron 15.000 golpes de lser por muestra)(84) Brambilla y cols(85) subrayan como conclusin de un reciente artculo de revisin sobre biomarcadores en cncer de pulmn que los biomarcadores entrarn en el contexto clnico en la medida en que se llegue a la automatizacin y miniaturizacin perfecta de estas tcnicas, lo que tambin permitir que sean aplicadas de modo extenso una vez validadas clnicamente. Recientemente, por ejemplo, se ha presentado una tecnologa que analiza de modo automatizado las mutaciones del codn 12 de k-ras en muestras de cncer de pulmn(86). Como acabamos de ver, en los ltimos tres o cuatro aos se han llevado a cabo numerosos estudios basados en diversas tecnologas, incluidas las tecnologas microarray y protemica, para definir el perfil propio de expresin de gnica del cncer de pulmn. Aunque la interpretacin de estos estudios en su conjunto no es fcil, se trabaja con una lista de genes que podran ser buenos candidatos como biomarcadores. Probablemente, el anlisis de biomarcadores para deteccin precoz no se llevar a cabo en el futuro sobre un nico gen, sino en bateras de varios genes estudiados con diversas tecnologas. Tambin hemos mencionado que existen una serie de genes clave, que estn alterados en un porcentaje alto de tumores pulmonares y que en la actualidad estn siendo analizados en series ms amplias de pacientes. Por ltimo, hemos comentado las diversas muestras sobre las que se puede disear el anlisis con las variadas herramientas tecnolgicas disponibles. Imaginemos que ya hemos conseguido el anlisis ms sencillo del biomarcador ms prometedor en la muestra ms asequible. Hemos terminado el trabajo? Por supuesto que no. Falta la validacin de los resultados en poblaciones amplias de individuos, para demostrar que en efecto ese biomarcador es til en el contexto clnico. Henscke insiste en un reciente editorial(62) que los investigadores implicados en el desarrollo de biomarcadores deben reconocer que ningn biomarcador ser aceptado a menos que se demuestre que es efectivo en un estudio clnico cuidadosamente diseado. Nuestro grupo trabaja activamente en un proyecto de validacin de biomarcadores para la deteccin precoz del cncer de pulmn que se est llevando a cabo en el Grupo Europeo de Deteccin Precoz de Cncer de Pulmn (EU-ELCDG)(87). En estudiamos una batera de marcadores bien conocidos desde diversos puntos de vista: optimizacin y estandaracin, validacin y anlisis de numerosas muestras. En febrero de 2005 habremos reclutado 1200 pacientes de estadios iniciales de cncer de pulmn y 2500 controles y habremos procesado las muestras biolgicas (sangre, biopsia de reseccin tumoral y normal, sangre, lavado bronquioalveolar) de estos pacientes. De ellos un porcentaje relativamente bajo se presentarn ms adelante con un segundo primario. Nuestro estudio persigue identificar una lista de biomarcadores que sea capaz de predecir la aparicin de un segundo primario de pulmn. En una revisin muy reciente, Petty y colaboradores(88) se preguntan cmo llevar los impresionantes hallazgos de la Biologa Molecular del cncer de pulmn de la mera Biologa a la aplicacin clnica real. Hay muchas preguntas concretas que se pueden hacer tambin en relacin a la aplicacin clnica de los biomarcadores en la deteccin precoz del cncer de pulmn. Estas preguntas hay que ir resolvindolas en los prximos aos. Mientras tanto, nuestro papel es seguir construyendo con esfuerzo y entusiasmo el edificio de la deteccin precoz, apoyndolo sobre los slidos cimientos que se han construido en los ltimos aos.

Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn

103

Bibliografa: 1. 2. 3. 4. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, and Thun MJ. Cancer statistics, 2003; CA Cancer J Clin. 53: 5-26, 2003. Franco J, Perez-Hoyos S, and Plaza P. Changes in lung-cancer mortality trends in Spain; Int J Cancer. 97: 102-105, 2002. Merrill RM, Henson DE, and Barnes M. Conditional survival among patients with carcinoma of the lung; Chest. 116: 697-703, 1999. Henshke CI, McCauley DI, Yankelevitz DF, Naidich DP, McGuinness G, Miettinen OS, Libby DM, Pasmantier MW, Koizumi J, Altorki NK, and Smith JP. Early Lung Cancer Action Project: overall design and findings from baseline screening; Lancet. 354: 99-105, 1999. Henschke CI, Naidich DP,Yankelevitz DF, McGuinness G, McCauley DI, Smith JP, Libby D, Pasmantier M, Vzquez M, Koizumi J, Flieder D, Altorki N, and Miettinen OS. Early lung cancer action project: initial findings on repeat screenings; Cancer. 92: 153-9, 2001. Mulshine JL and Henschke CI. Prospects for lung-cancer screening; Lancet. 355: 592-593, 2000. Pastorino U, Bellomi M, Landoni C, De Fiori E, Arnaldi P, Picchio M, Pelosi G, Boyle P, and Fazio F. Early lung-cancer detection with spiral CT and positron emission tomography in heavy smokers: 2-year results; Lancet. 362: 593-597, 2003. Warner EE and Mulshine JL. Lung Cancer Screening with spiral CT: toward a working strategy; Oncology. 18: 564-587, 2004. Bach PB, Kelley MJ, Tate RC and McCrory DC. Screening for lung cancer. A review of the current literature; Chest. 123: 72S-82S, 2003. Montuenga LM and Mulshine JL. New molecular strategies for early lung cancer detection; Cancer Invest. 18: 555-63, 2000. Chanin TD, Merrick DT, Franklin WA and Hirsh FR. Recent developments in biomarkers for the early detection of lung cancer: perspectives based on publications 2003 to present; Curr Opin Pulmonol. 10: 242-247, 2004. Berrieman HK, Ashman JN, Cowen ME, Greenman J, Lind MJ and Cawkwell L. Chromosomal analysis of non-small-cell lung cancer by multicolour fluorescent in situ hybridization; Br J Cancer. 90: 900-905, 2004. Zudaire I, Po R, Martn-Subero I, Lozano MD, Blanco D, Garca Lpez JJ, Odero de Dios MD, Rey N, Zulueta J, Siebert R, Calazanz MJ and Montuenga LM. FICTION as a new tool to early lung cancer diagnosis; An Sist Sanit Navar. 25: 305-315, 2002. Balsara BR and Testa JR. Chromosomal imbalances in human lung cancer; Oncogene. 21: 68776883, 2002. Hanahan D and Weinberg RA. The hallmarks of Cancer; Cell. 100: 57-70, 2000. Sekido Y, Fong KM and Minna JD. Molecular genetics of cancer; Annu Rev Med. 54: 73-87, 2003. Po R, Zudaire I, Pino I, Castao Z, Zabalegui N, Vicent S, Garca-Amigot F, Odero MD, Lozano MD, Garca-Foncillas J, Calasanz MJ and Montuenga LM. AlphaCP-4, a putative tumor suppressor gene at 3p21, but not its alternative splice variant alphaCP-4, is underexpressed in lung cancer; Cancer Res. 64: 4171-4179, 2004.
Cncer de pulmn

5.

6. 7.

8. 9. 10. 11.

12.

13.

14. 15. 16. 17.

104

18.

Pino I, Po R, Toledo G, Zabalegui N, Vicent S, Rey N, Lozano MD, Torre W, Garca-Foncillas J and Montuenga LM. Altered patterns of expression of members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family in lung cancer; Lung Cancer. 41: 131-143, 2003. Barthelemy-Brichant N, David JL, Bosquee L, Bury T, Seidel L, Albert A, Bartsch P, Baugnet-Mahieu L and Deneufbourg JM. Increased TGFbeta1 plasma level in patients with lung cancer: potential mechanisms; Eur J Clin Invest. 32: 193-198, 2002. Hasegawa Y, Takanashi S, Kanehira Y, Tsushima T, Imai T and Okumura K. Transforming growth factorbeta1 level correlates with angiogenesis, tumor progression, and prognosis in patients with nonsmall cell lung carcinoma; Cancer. 91: 964-971, 2001. Bennett WP, el-Deiry WS, Rush WL, Guinee DG Jr, Freedman AN, Caporaso NE, Welsh JA, Jones RT, Borkowski A, Travis WD, Fleming MV, Trastek V, Pairolero PC, Tazelaar HD, Midthun D, Jett JR, Liotta LA and Harris CC. p21waf1/cip1 and transforming growth factor beta 1 protein expression correlate with survival in non-small cell lung cancer; Clin Cancer Res. 4: 1499-1506, 1998. Iwasaki A, Kuwahara M, Yoshinaga Y and Shirakusa T. Basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) levels, as prognostic indicators in NSCLC; Eur J Cardiothorac Surg. 25: 443-448, 2004. Franklin WA, Veve R, Hirsch FR, Helfrich BA and Bunn PA Jr. Epidermal growth factor receptor family in lung cancer and premalignancy; Semin Oncol. 29: 3-14, 2002. Maulik G, Shrikhande A, Kijima T, Ma PC, Morrison PT and Salgia R. Role of the hepatocyte growth factor receptor, c-Met, in oncogenesis and potential for therapeutic inhibition; Cytokine Growth Factor Rev. 13: 41-59, 2002. Vicent S, Garayoa M, Lpez-Picazo JM, Lozano MD, Toledo G, Thunnissen FB, Manzano RG and Montuenga LM. Mitogen-activated protein kinase phosphatase-1 is overexpressed in non-small cell lung cancer and is an independent predictor of outcome in patients; Clin Cancer Res. 10: 36393649, 2004. Vicent S, Lpez-Picazo JM, Toledo G, Lozano MD, Torre W, Garca-Corchn C, Quero C, Soria JC, Martn-Algarra S, Manzano RG and Montuenga LM. ERK1/2 is activated in non-small-cell lung cancer and associated with advanced tumours; Br J Cancer. 90: 1047-1052, 2004. Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thaesler Z, Pacyna-Gengelbach M, van de Rijn M, Rosen GD, Perou CM, Whyte RI, Altman RB, Brown PO, Botstein D and Petersen I. Diversity of gene expression in adenocarcinoma of the lung; Proc Natl Acad Sci U S A. 98: 1378413789, 2001. Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Vasa P, Ladd C, Beheshti J, Bueno R, Gillette M, Loda M, Weber G, Mark EJ, Lander ES, Wong W, Johnson BE, Golub TR, Sugarbaker DJ and Meyerson M. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses; Proc Natl Acad Sci U S A. 98: 13790-5, 2001. Beer DG, Kardia SL, Huang CC, Giordano TJ, Levin AM, Misek DE, Lin L, Chen G, Gharib TG, Thomas DG, Lizyness ML, Kuick R, Hayasaka S, Taylor JM, Iannettoni MD, Orringer MB and Hanash S. Gene-expression profiles predict survival of patients with lung adenocarcinoma; Nat Med. 8: 816-24, 2002.
105

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn

30.

Hoang CD, DCunha J, Tawfic SH, Gruessner AC, Kratzke RA and Maddaus MA. Expression profiling of non-small cell lung carcinoma identifies metastatic genotypes based on lymph node tumor burden; J Thorac Cardiovasc Surg. 127: 1332-1341, 2004. Kobayashi K, Nishioka M, Kohno T, Nakamoto M, Maeshima A, Aoyagi K, Sasaki H, Takenoshita S, Sugimura H and Yokota J. Identification of genes whose expression is upregulated in lung adenocarcinoma cells in comparison with type II alveolar cells and bronchiolar epithelial cells in vivo; Oncogene. 23: 3089-3096, 2004. Creighton C, Hanash S and Beer D. Gene expression patterns define pathways correlated with loss of differentiation in lung adenocarcinomas; FEBS Lett. 540: 167-170, 2003. Kikuchi T, Daigo Y, Katagiri T, Tsunoda T, Okada K, Kakiuchi S, Zembutsu H, Furukawa Y, Kawamura M, Kobayashi K, Imai K and Nakamura Y. Expression profiles of non-small cell lung cancers on cDNA microarrays: identification of genes for prediction of lymph-node metastasis and sensitivitycto anti-cancer drugs; Oncogene. 22: 2192-2205, 2003. Taxman DJ, MacKeigan JP, Clements C, Bergstralh DT and Ting JP. Transcriptional profiling of targets for combination therapy of lung carcinoma with paclitaxel and mitogen-activated protein/extracellular signal-regulated kinase kinase inhibitor; Cancer Res. 63: 5095-104, 2003. Whiteside MA, Chen DT, Desmond RA, Abdulkadir SA and Johanning GL. A novel time-course cDNA microarray analysis method identifies genes associated with the development of cisplatin resistance; Oncogene. 23: 744-52, 2004. Parmigiani G, Garrett-Mayer ES, Anbazhagan R and Gabrielson E. A cross-study comparison of gene expression studies for the molecular classification of lung cancer; Clin Can Res. 10: 29222927, 2004. Jiang H, Deng Y, Chen HS,Tao L, Sha Q, Chen J,Tsai CJ and Zhang S. Joint analysis of two microarray gene-expression data sets to select lung adenocarcinoma marker genes; BMC Bioinformatics. 5: 81, 2004. Petricoin EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, Mills GB, Simone C, Fishman DA, Kohn EC and Liotta LA. Use of proteomic patterns in serum to identify ovarian cancer; Lancet. 359: 572-577, 2002. Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, Gonzlez A, Nadaf S, Moore JH, Caprioli RM and Carbone DP. Proteomic patterns of tumour subsets in non-small-cell lung cancer; Lancet. 362: 433-439, 2003. Chen G, Gharib TG, Wang H, Huang CC, Kuick R, Thomas DG, Shedden KA, Misek DE, Taylor JM, Giordano TJ, Kardia SL, Iannettoni MD, Yee J, Hogg PJ, Orringer MB, Hanash SM and Beer DG. Protein profiles associated with survival in lung adenocarcinoma; Proc Natl Acad Sci U S A. 100: 13537-13542, 2003. Xiao X, Liu D, Tang Y, Guo F, Xia L, Liu J, He D. Development of proteomic patterns for detecting lung cancer; Dis Markers. 19: 33-39, 2004. Meyerson M, Franklin WA and Kelley MJ. Molecular classification and molecular genetics of human lung cancers; Semin Oncol. 31: 4-19, 2004.
Cncer de pulmn

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

106

43.

Kurusu Y, Yamashita J and Ogawa M. Detection of circulating tumor cells by reverse transcriptasepolymerase chain reaction in patients with resectable non-small-cell lung cancer; Surgery. 126: 820826, 1999. Kimura T, Holland WS, Kawaguchi T, Williamson SK, Chansky K, Crowley JJ, Doroshow JH, Lenz H, Gandara DR and Gumerlock PH. Mutant DNA in plasma of lung cancer patients: potential for monitoring response to therapy; Ann.N.Y. Acad. Sci. 1022: 5560, 2004. Ramrez JL, Sarris C, de Castro PL, Roig B, Queralt C, Escuin D, de Aguirre I, Snchez JM, Manzano JL, Margeli M, Snchez JJ, Astudillo J, Taron M and Rosell R. Methylation patterns and K-ras mutations in tumor and paired serum of resected non-small-cell lung cancer patients; Cancer Lett. 193: 207216, 2003. Andriani F, Conte D, Mastrangelo T, Leon M, Ratcliffe C, Roz L, Pelosi G, Goldstraw P, Sozzi G and Pastorino U. Detecting lung cancer in plasma with the use of multiple genetic markers; Int J Cancer. 108: 91-96, 2004. Chen XQ, Stroun M, Magnenat JL, Nicod LP, Kur t AM, Lyautey J, Lederrey C and Anker P. Microsatellite alterations in plasma DNA of small cell lung cancer patients; Nat Med. 2: 10331035, 1996. Sozzi G, Conte D, Len M, Ciricione R, Roz L, Ratcliffe C, Roz E, Cirenei N, Bellomi M, Pelosi G, Pierotti MA and Pastorino U. Quantification of free circulating DNA as a diagnostic marker in lung cancer; J Clin Oncol. 21: 3902-3908, 2003. Snchez-Cspedes M, Monz M, Rosell R, Pifarr A, Calvo R, Lpez-Cabrerizo MP and Astudillo J. Detection of chromosome 3p alterations in serum DNA of non-small-cell lung cancer patients; Ann Oncol. 9: 113-116, 1998. Esteller M, Snchez-Cspedes M, Rosell R, Sidransky D, Baylin SB and Herman JG. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients; Cancer Res. 59: 67-70, 1999. Usadel H, Brabender J, Danenberg KD, Jernimo C, Harden S, Engles J, Danenberg PV, Yang S and Sidransky D. Quantitative adenomatous polyposis coli promoter methylation analysis in tumor tissue, serum, and plasma DNA of patients with lung cancer; Cancer Res. 62: 371-375, 2002. Bearzatto A, Conte D, Frattini M, Zaffaroni N, Andriani F, Balestra D, Tavecchio L, Daidone MG and Sozzi G. p16(INK4A) hypermethylation detected by fluorescent methylation-specific PCR in plasmas from non-small cell lung cancer; Clin Cancer Res. 8: 3782-3787, 2002. Imoto H, Osaki T, Taga S, Ohgami A, Ichiyoshi Y and Yasumoto K. Vascular endothelial growth factor expression in non-small-cell lung cancer: prognostic significance in squamous cell carcinoma; J Thorac Cardiovasc Surg.115: 1007-1014, 1998. Tamura M, Oda M, Tsunezuka Y, Matsumoto I, Kawakami K, Ohta Y and Watanabe G. Chest CT and serum vascular endothelial growth factor-C level to diagnose lymph node metastasis in patients with primary non-small cell lung cancer; Chest. 126: 342-346, 2004. Nieder C, Andratschke N, Jeremic B and Molls M. Comparison of serum growth factors and tumor markers as prognostic factors for survival in non-small cell lung cancer; Anticancer Res. 23: 5117-5123, 2003.
107

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn

56.

Pujol JL, Molinier O, Ebert W, Daures JP, Barlesi F, Buccheri G, Paesmans M, Quoix E, Moro-Sibilot D, Szturmowicz M, Brechot JM, Muley T and Grenier J. CYFRA 21-1 is a prognostic determinant in non-small-cell lung cancer: results of a meta-analysis in 2063 patients; Br J Cancer. 90: 20972105, 2004. Yankelevitz DF, Vzquez M and Henschke CI. Special techniques in transthoracic needle biopsy of pulmonary nodules; Radiol Clin North Am. 38: 267-279, 2000. Warner KA, Crawford EL, Zaher A, Coombs RJ, Elsamaloty H, Roshong-Denk SL, Sharief I, Amurao GV, Yoon Y, Al-Astal AY, Assaly RA, Hernandez DA, Graves TG, Knight CR, Harr MW, Sheridan TB, DeMuth JP, Zahorchak RJ, Hammersley JR, Olson DE, Durham SJ and Willey JC. The c-myc x E2F1/p21 interactive gene expression index augments cytomorphologic diagnosis of lung cancer in fine-needle aspirate specimens; J Mol Diagn. 5: 176-183, 2003. Jeanmart M, Lantuejoul S, Fievet F, Moro D, Sturm N, Brambilla C and Brambilla E. Value of immunohistochemical markers in preinvasive bronchial lesions in risk assessment of lung cancer; Clin Cancer Res. 9: 2195-2203, 2003. Wistuba II, Mao L and Gazdar AF. Smoking molecular damage in bronchial epithelium; Oncogene. 21: 7298-7306, 2002. McWilliams A, Mayo J, MacDonald S, leRiche JC, Palcic B, Szabo E and Lam S. Lung cancer screening: a different paradigm; Am J Respir Crit Care Med. 168: 1167-1173, 2003. Henschke CI. Medicine on lung cancer screening. A Different Paradigm; Am J Respir Crit Care Med. 168: 1143-1143, 2003. Field JK and Liloglou T. Fluorescent microsatellite analysis in bronchial lavage as a potential diagnostic tool for lung cancer; Methods Mol Med. 75: 251-262, 2003. Carstensen T, Schmidt B, Engel E, Jandrig B, Witt C and Fleischhacker M. Detection of cell-free DNA in bronchial lavage fluid supernatants of patients with lung cancer; Ann N Y Acad Sci. 1022: 202-210, 2004. Kim H, Kwon YM, Kim JS, Lee H, Park JH, Shim YM, Han J, Park J and Kim DH. Tumor-specific methylation in bronchial lavage for the early detection of non-small-cell lung cancer; J Clin Oncol. 22: 2363-2370, 2004. Topaloglu O, Hoque MO, Tokumaru Y, Lee J, Ratovitski E, Sidransky D and Moon CS. Detection of promoter hypermethylation of multiple genes in the tumor and bronchoalveolar lavage of patients with lung cancer; Clin Cancer Res. 10: 2284-2288, 2004. Grote HJ, Schmiemann V, Kiel S, Bocking A, Kappes R, Gabbert HE and Sarbia M. Aberrant methylation of the adenomatous polyposis coli promoter 1A in bronchial aspirates from patients with suspected lung cancer; Int J Cancer. 110: 751-755, 2004. Thunnissen FB. Sputum examination for early detection of lung cancer; J Clin Pathol. 56: 805-810, 2003. Frost JK, Ball WC Jr, Levin ML, Tockman MS, Baker RR, Carter D, Eggleston JC, Erozan YS, Gupta PK, Khouri NF, et al. Early lung cancer detection: results of the initial (prevalence) radiologic and cytologic screening in the Johns Hopkins study; Am Rev Respir Dis. 130: 549-554, 1984.
Cncer de pulmn

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

69.

108

70.

Prindiville SA, Byers T, Hirsch FR, Franklin WA, Miller YE, Vu KO, Wolf HJ, Baron AE, Shroyer KR, Zeng C, Kennedy TC and Bunn PA. Sputum cytological atypia as a predictor of incident lung cancer in a cohort of heavy smokers with airflow obstruction; Cancer Epidemiol Biomarkers Prev. 12: 987-993, 2003. Kennedy TC, Miller Y and Prindiville S. Screening for lung cancer revisited and the role of sputum cytology and fluorescence bronchoscopy in a high-risk group; Chest; 117: 72S-79S, 2000. Marek W, Kotschy-Lang N, Muti A, Kohler CH, Nielsen L, Topalidis TH, Atay Z and Nakhosteen JA. Can semi-automated image cytometry on induced sputum become a screening tool for lung cancer? Evaluation of quantitative semi-automated sputum cytometry on radon- and uraniumexposed workers; Eur Respir J. 18: 942-950, 2001. Tockman MS, Mulshine JL, Piantadosi S, Erozan YS, Gupta PK, Ruckdeschel JC, Taylor PR, Zhukov T, Zhou WH, Qiao YL and Yao SX. Prospective detection of preclinical lung cancer: results from two studies of hnRNP A2/B1 overexpression; Clin Cancer Res. 3: 2237-2246, 1997. Sueoka E, Goto Y, Sueoka N, Kai Y, Kozu T and Fujiki H. Heterogeneous nuclear ribonucleoprotein B1 as a new marker of early detection for human lung cancers; Cancer Res. 59: 1404-1407, 1999. Mao L, Hruban RH, Boyle JO, Tockman M and Sidransky D. Detection of oncogene mutations in sputum precedes diagnosis of lung cancer; Cancer Res. 54: 1634-1637, 1994. Kersting M, Friedl C, Kraus A, Behn M, Pankow W and Schuermann M. Differential frequencies of p16(INK4a) promoter hypermethylation, p53 mutation, and K-ras mutation in exfoliative material mark the development of lung cancer in symptomatic chronic smokers; J Clin Oncol. 18: 32213229, 2000. Somers VA, Pietersen AM, Theunissen PH, Thunnissen FB. Detection of K-ras point mutations in sputum from patients with adenocarcinoma of the lung by point-EXACCT; J Clin Oncol. 16: 30613068, 1998. Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, Baylin SB, Herman JG and Belinsky SA. Predicting lung cancer by detecting aberrant promoter methylation in sputum; Cancer Res. 60: 5954-5958, 2000. Belinsky SA, Palmisano WA, Gilliland FD, Crooks LA, Divine KK, Winters SA, Grimes MJ, Harms HJ, Tellez CS, Smith TM, Moots PP, Lechner JF, Stidley CA and Crowell RE. Aberrant promoter methylation in bronchial epithelium and sputum from current and former smokers; Cancer Res. 62: 2370-7, 2002. Phillips M, Cataneo RN, Cummin AR, Gagliardi AJ, Gleeson K, Greenberg J, Maxfield RA and Rom WN. Detection of lung cancer with volatile markers in the breath; Chest. 123: 2115-2123, 2003. Gessner C, Kuhn H, Toepfer K, Hammerschmidt S, Schauer J, Wirts H. Detection of p53 gene mutations in exhaled breath condensate of non-small cell lung cancer patients; Lung Cancer. 43: 215-222, 2004. Fiegl M, Massoner A, Haun M, Sturm W, Kaufmann H, Hack R, Krugmann J, Fritzer-Szekeres M, Grunewald K and Gastl G. Sensitive detection of tumour cells in effusions by combining cytology and fluorescence in situ hybridisation (FISH); Br J Cancer. 91: 558-563, 2004.
109

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

81.

82.

Bsqueda de marcadores moleculares para la deteccin precoz del cncer de pulmn

83.

Romeo MS, Sokolova IA, Morrison LE, Zeng C, Baron AE, Hirsch FR, Miller YE, Franklin WA and Varella-Garca M. Chromosomal abnormalities in non-small cell lung carcinomas and in bronchial epithelia of high-risk smokers detected by multi-target interphase fluorescence in situ hybridization; J Mol Diagn. 5: 103-112, 2003. Zhukov TA, Johanson RA, Cantor AB, Clark RA and Tockman MS. Discovery of distinct protein profiles specific for lung tumors and pre-malignant lung lesions by SELDI mass spectrometry; Lung Cancer. 40: 267-279, 2003. Brambilla C, Fievet F, Jeanmart M, de Fraipont F, Lantuejoul S, Frappat V, Ferretti G, Brichon PY and Moro-Sibilot D. Early detection of lung cancer: role of biomarkers; Eur Respir J Suppl. 39: 36S44S, 2003. Hilbe W, Dlaska M, Duba HC, Dirnhofer S, Eisterer W, Oberwasserlechner F, Mildner A, Schmid T, Kuhr T and Woll E. Automated real-time PCR to determine K-ras codon 12 mutations in nonsmall cell lung cancer: comparison with immunohistochemistry and clinico-pathological features; Int J Oncol. 23: 1121-1126, 2003. Field JK, Brambilla C, Caporaso N, Flahault A, Henschke C, Herman J, Hirsch F, Lachmann P, Lam S, Maier S, Montuenga LM, Mulshine J, Murphy M, Pullen J, Spitz M, Tockman M, Tyndale R, Wistuba I and Youngson J. Consensus statements from the Second International Lung Cancer Molecular Biomarkers Workshop: a european strategy for developing lung cancer molecular diagnostics in high risk populations; Int J Oncol. 21: 369-73, 2002. Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E and Murray GI. Gene expression profiling in non-small cell lung cancer: from molecular mechanisms to clinical application; Clin Cancer Res. 10: 3237-48, 2004.

84.

85.

86.

87.

88.

110

Cncer de pulmn

FACTORES PRONSTICOS EN CNCER DE PULMN

ngel Lpez-Encuentra Hospital Universitario 12 de Octubre Madrid

Contenido: Resumen de la ponencia Bibliografa Artculos del ponente

Factores pronsticos en cncer de pulmn

ngel Lpez Encuentra
Servicio Neumologa Hospital Universitario 12 de Octubre, Madrid

Introduccin En Cncer de Pulmn (CP) interesan diversos pronsticos como puede ser el de supervivencia global, el de supervivencia especfica por cncer, el de calidad de vida durante supervivencia, el de respuesta o resistencia teraputica. Los ms estudiados son los factores pronsticos (FP) de supervivencia, global o especfica para CP. Revisiones recientes sobre este tema han detectado que la mayora de los estudios publicados sobre FP en CP tienen baja potencia estadstica y son marcadamente heterogneos. Tipos de factores pronsticos En CP se consideran tres tipos de FP. En primer lugar los ms clsicos relacionados con la extensin anatmica tumoral y que estn contenidos en la clasificacin TNM ampliamente conocida. Otra fuente de FP potenciales son los factores clnicos relacionados con el husped del tumor, por las propias caractersticas del paciente o por la interaccin entre enfermedad y enfermo. Finalmente, una fundada esperanza: que los posibles FP de Biologa Molecular mejoren la capacidad predictiva pronstica de los otros dos tipos de FP referidos. Clasificacin de extensin anatmica TNM-estadios Cada estadio en la clasificacin de 1997 est compuesto de una serie de combinaciones entre los apartados T, N y M, y cada uno de estos apartados contienen diversos componentes agrupados (tamao, invasin de estructuras locales concretas, etc.). Por tanto, la unidad clasificatoria inicial es la presencia de elementos individuales, como el tamao tumoral, que, agrupados con otros elementos, van conformando una escala clasificatoria ascendente y reduccionista. La ltima clasificacin TNM de 1997 est validada en su aspectos ms groseros como son los estadios patolgicos en las fases ms iniciales del CB. Sin embargo, hay diversos problemas en la clasificacin TNM. La estadificacin patolgica, que es la ms exacta a nivel pronstico, exige la presencia de pieza quirrgica del tumor extirpado. Esta situacin slo ocurre en alrededor de un 20% de todos los CP diagnosticados. La estadificacin TNM clnica (la que no se efecta con los datos de la pieza extirpada en toracotoma) tiene una baja certeza clasificatoria cuando se compara con la prueba de referencia (gold standard), que es la TNM patolgica. Tambin, la clasificacin TNM de 1997, tiene algunos parmetros como es el tamao tumoral con baja capacidad discriminativa para pronstico al utilizar nicamente una escala dicotmica (igual-menor, o mayor de 3 cm), disminuyendo su capacidad para establecer un mayor abanico de pronsticos. Se prev que para el ao 2007 se efecte una propuesta de nueva clasificacin TNM para el CP al evaluar una base de datos de ms de 50.000 pacientes.
Factores pronsticos en cncer de pulmn 113

Factores pronsticos clnicos Cuando se analizan las curvas de supervivencia del CP, aun en los mejores casos de estirpe no microctica resecados curativos y en estadios iniciales (estadio I p) se observa que la clasificacin de extensin anatmica es insuficiente como escala pronostica para predecir a los supervivientes a largo plazo. Existen numerosos estudios que observan que diversos factores clnicos intervienen de forma independiente en el pronstico. Entre las determinaciones de laboratorio estn los niveles de calcio, de la hemoglobina, de la LDH, de la albmina. Entre los datos clnicos, la prdida de peso, el estado clnico general (PS), el sexo, la edad o la presencia de sntomas. Un ndice clnico, que agrupa diferentes condiciones de la clnica o de las determinaciones bioqumicas, no parece discriminar pronstico cuando se analiza en la poblacin CP no microctica resecados completos y en estadios iniciales. Sin embargo, un ndice de comorbilidad, que considera diversas enfermedades, asociadas, si parece comportarse como un factor pronstico independiente en todas las poblaciones de CP quirrgico, inclusive en los tumores ms pequeos de igual o menos de 2 cm de tamao en pieza quirrgica. Este efecto de la comorbilidad se detecta, fundamentalmente en el grupo de edad mas joven. Algunas enfermedades asociadas, como es la enfermedad pulmonar obstructiva crnica, slo tienen impacto pronstico cuando se analiza este factor en forma de supervivencia condicional tras 2 3 aos vivo desde la ciruga. Cuando se han considerado diferentes metodologas de anlisis multivariable combinando factores pronsticos de extensin anatmica TNM con factores pronsticos clnicos, el rea bajo la curva ROC para prediccin de pronstico a 3 aos no es superior a 0,72. Ello implica que existe un margen, aun importante, para la mejora predictiva del pronstico en CP. Los factores pronsticos derivados de los estudios de genmica y protemica pueden ayudar a esa mejora? Factores pronsticos de biologa molecular Existen suficientes datos para afirmar que los FP de Biologa Molecular (BM) pueden mejorar, y en ocasiones sustituir, la prediccin de pronstico de supervivencia hasta ahora conocida con los parmetros TNM y los clnicos. Sin embargo, tras un perodo inicial de aparentes avances significativos, el mejor conocimiento de la BM en CP ha demostrado su complejidad y la necesidad de disponer de cuatro tecnologas bsicas: una base clnica de datos controlados, un anlisis masivo de genes o de protenas (arrays), un conocimiento y manejo adecuado variable por variable (anlisis uni y multivariable), y una excelente organizacin, gestin y coordinacin de todos los aspectos multidisciplinarios y multicntricos que estos estudios precisan. Conclusiones Actualmente existe un numeroso grupo de investigadores que intentan mejorar el conocimiento de los factores pronsticos (FP) en el cncer de pulmn (CP). En primer lugar, y por primera vez en la historia de la estadificacin, actualmente se est manejando la informacin de ms de 50.000 pacientes provenientes de todo el mundo a fin de producir una nueva clasificacin TNM para esta enfermedad en 2007. En segundo lugar, en supervivencia global, ciertos factores clnicos en una poblacin con CP, con una edad media cada vez ms avanzada, son FP independientes como es la presencia de la comorbilidad.
114 Cncer de pulmn

Finalmente, todas las limitaciones aprendidas en la construccin de clasificaciones tumorales pronsticas son lecciones tiles para manejar, de forma integrada, la nueva fuente de informacin predictiva que es la Biologa Molecular. Ciertos requerimientos deben de ser cubiertos para que esa posibilidad pueda confirmarse de forma consistente.

Bibliografa 1. 2. Buccheri G, Ferrigno D. Prognostic factors. Hematol Oncol Clin North Am 2004; 18: 187-201. Buccheri G, Ferrigno D. Prognostic factors in lung cancer: tables and comments. Eur Respir J 1994; 7: 1350-64. Brundage MD, Davies D, Mackillop WJ. Prognostic factors in non-small cell lung cancer: a decade of progress. Chest 2002; 122: 1037-57. Gospodarowicz MK, Henson DE, Hutter RVP, OSullivan B, Sobin LH, Wittekind Ch (eds). Prognostic Factors in Cancer. UICC. Wilwy Liss. New York. 2001. Snchez-Cspedes M. Dissecting the genetic alterations involved in lung carcinogenesis. Lung Cancer 2003; 40: 111-21. Snchez-Cspedes M. Pronstico biolgico y farmacogenmica. Congreso Nacional SEPAR. Junio 2004. URL (disponible septiembre 2004): www.separ.es (Oncologa / Reuniones). Fong KM, Minna JD. Molecular biology of lung cancer: clinical implications. Clin Chest Med 2002; 23: 83-101 Driscoll B (ed). Methods in Molecular Medicine. Lung Cancer. Diagnostic and Therapeutic Methods and Reviews. Volumen II. Humana Press. New Jersey. 2003. Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, Gonzalez A, Nadaf S, Moore JH, Caprioli RM, Carbone DP. Proteomic patterns of tumour subsets in nonsmall-cell lung cancer. Lancet 2003; 362: 33-9. Fong KM, Sekido Y, Gazdar AF, Minna JD. Lung cancer. 9: Molecular biology of lung cancer: clinical implications. Thorax 2003; 58: 892-900. Kallioniemi OP, Wagner U, Kononen J, Sauter G. Tissue microarray technology for high-throughput molecular profiling of cancer. Hum Mol Genet 2001; 10: 657-62 Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E, Murray GI. Gene expression profiling in nonsmall cell lung cancer: from molecular mechanisms to clinical application. Clin Cancer Res 2004; 10: 3237-48. Fernando HC, Goldstraw P. The accuracy of clinical evaluative intrathoracic staging in lung cancer as assessed by postsurgical pathologic staging. Cancer 1990; 65: 2503-6.
115

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

Factores pronsticos en cncer de pulmn

14.

Lpez-Encuentra, A, Garca-Lujn R, Rivas JJ, Rodrguez-Rodrguez J, Torres-Lanza J, Varela-Simo G; and Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Comparison between clinical and pathological staging in 2,994 cases of lung cancer. Ann Thorac Surg 2004 (en prensa). Lopez-Encuentra A, Bulzebruck H, Feinstein AR, Motta G, Mountain CF, Naruke T, Sanchez JM, Tsuchiya R, Wittekind C. Tumor staging and classification in lung cancer. Lung Cancer 2000; 29: 79-83. Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Eur Respir J 1999; 14: 812-6. Lopez-Encuentra A, Duque-Medina JL, Rami-Porta R, de la Camara AG, Ferrando P; Bronchogenic Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery. Staging in lung cancer: is 3 cm a prognostic threshold in pathologic stage I non-small cell lung cancer? A multicenter study of 1,020 patients. Chest 2002; 121: 1515-20. Lopez-Encuentra A; Bronchogenic Carcinoma Co-operative Group. Comorbidity in operable lung cancer: a multicenter descriptive study on 2992 patients. Lung Cancer 2002; 35: 263-9. Tammemagi CM, Neslund-Dudas C, Simoff M, Kvale P. In lung cancer patients, age, race-ethnicity, gender and smoking predict adverse comorbidity, which in turn predicts treatment and survival. J Clin Epidemiol 2004; 57: 597-609. Janssen-Heijnen ML, Smulders S, Lemmens VE, Smeenk FW, van Geffen HJ, Coebergh JW. Effect of comorbidity on the treatment and prognosis of elderly patients with non-small cell lung cancer. Thorax 2004; 59: 602-7. Iizasa T, Suzuki M,Yasufuku K, Iyoda A, Otsuji M,Yoshida S, Sekine Y, Shibuya K, Saitoh Y, Hiroshima K, Fujisawa T. Preoperative pulmonary function as a prognostic factor for stage I non-small cell lung carcinoma. Ann Thorac Surg 2004; 77: 1896-902 Gomez de la Cmara A, Lpez-Encuentra A, Ferrando P and Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Heterogeneity of prognostic profiles in non-small cell lung cancer. J Clin Epidemiol 2004 (enviado para publicacin)

15.

16.

17.

18.

19.

20.

21.

22.

116

Cncer de pulmn

Staging in Lung Cancer: Is 3 cm a Prognostic Threshold in Pathologic Stage I Non-small Cell Lung Cancer?
A Multicenter Study of 1,020 Patients
Angel Lopez-Encuentra, MD, PhD; Jose Luis Duque-Medina, MD, PhD; Ramon Rami-Porta, MD, PhD; Agustn Gomez de la Camara, MD, PhD; Paloma Ferrando, MSc; for the Bronchogenic Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery

Introduction: Since 1974, a tumor size of 3 cm in diameter has been regarded as the prognostic threshold in the staging of bronchogenic carcinoma. Objective: To study the prognostic behavior of surgical-pathologic tumor size in non-small cell lung cancer (NSCLC) with complete resection. Design: Four-year multi-institutional prospective study from 1993 to 1997. Patients: Consecutive cases of NSCLC in pathologic stages IA-IB (pIA-pIB) treated surgically with complete resection in hospitals belonging to the Bronchogenic Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Methods: The Schoenfeld procedure was used to identify different prognostic groups, considering 1 cm as the measurement unit. Results: Based on the 1,020 cases evaluated, four prognostic groups were identified: 0 to 2 cm (group A; n 147), 2.1 to 4 cm (group B; n 448), 4.1 to 7 cm (group C; n 336), and > 7 cm (group D; n 89). At 5 years, survival was 0.63 (95% confidence interval [CI], 0.58 to 0.68), 0.56 (95% CI, 0.53 to 0.59), 0.49 (95% CI, 0.46 to 0.52), and 0.38 (95% CI, 0.32 to 0.44) for groups A, B, C, and D, respectively. Differences between paired groups (log-rank) were significant: 0.0074 between groups A and B, 0.0048 between groups B and C, and 0.0034 between groups C and D. Conclusions: In initial stages (pIA-pIB) of NSCLC, the 3-cm value was not found to behave as a prognostic threshold; in this study, four surgical-pathologic tumor size groups were identified with strong prognostic differences: from 0 to 2 cm, from 2.1 to 4 cm, from 4.1 to 7 cm, and > 7 cm. (CHEST 2002; 121:15151520)
Key words: lung cancer; lung neoplasms; size; surgery Abbreviations: CI confidence interval; GCCB-S Bronchogenic Carcinoma Co-operative Group of Spanish Society of Pneumology and Thoracic Surgery; NSCLC non-small cell lung cancer

ince 3 as the only S tumor1974, to cm has been regardedthreshold in size establish a prognostic
1

the staging of bronchogenic carcinoma. Even though the staging classification has been updated repeat*From Hospital Universitario (Dr. Duque-Medina), Valladolid; Hospital Universitario 12 de Octubre (Drs. Lopez-Encuentra and de la Camara, and Ms. Ferrando), Madrid; and Hospital Mutua de Terrassa (Dr. Rami-Porta), Barcelona, Spain. A complete list of GCCB-S members is given in the Appendix. Partly financed by FIS grant 97/0011, FEPAR-1995 grant, Fundacion RESPIRA-2000 grant, and financial aid from Castilla Leon regional government and Menarini Foundation. Manuscript received July 2, 2001; revision accepted November 14, 2001. Correspondence to: Angel Lopez-Encuentra, MD, FCCP, Pneu mology Service, Hospital Universitario 12 de Octubre, Ctta. Andaluca 5.4, 28041 Madrid, Spain; e-mail: lencuent@h12o.es
www.chestjournal.org

edly (the last update being in 1997),2 criteria for tumor size has remained unchanged for the last 25 years. There is a need to conduct further research on other clinical or molecular biological prognostic factors in patients with lung cancer; therefore, it becomes essential for the basic anatomic classification of tumors to be founded on solid grounds. A new prognostic factor could only be considered useful, and included as part of the tumor classification, if it has the ability to modify the prediction and accuracy of the TNM anatomic classification.3 The TNM classification is simplified to make its use easier; however, that simplicity may lead to decreased prognostic certainty or, in other words, a
CHEST / 121 / 5 / MAY, 2002

1515

loss of prognostic discrimination. Repeatability or validation of the prognostic values for the main pathologic stages in a surgical population with nonsmall cell lung cancer (NSCLC) has been demonstrated in the United States, Japan, Germany, and Spain.4 Nonetheless, and as it was to be expected, it has now been acknowledged that the consideration of TNM descriptors was more predictive of prognosis than the assessment of tumor stages.5 The Bronchogenic Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S) has recently evaluated its experience in the prognostic analysis of prethoracotomy clinical tumor size in lung cancer.6 This study was able to identify four different prognostic groups of tumor size based on radiography. However, since this clinical staging was based on a population that in the end required surgery, it involved some problems: the greater the tumor size, the greater the probability to have invaded mediastinal lymph nodes at thoracotomy, even in cases of small NSCLC; or the higher frequency of exploratory thoracotomies or incomplete resections in larger tumors, among other limitations.710 The goal of this study is to evaluate tumor size as a prognostic factor in patients with pT1-T2N0M0 NSCLC undergoing complete resection in a nonselected surgical population. Materials and Methods
Study Subjects All the patients included prospectively in this study had NSCLC in initial stages (pIA-pIB) and underwent thoracotomy with complete resection in hospitals pertaining to the GCCB-S11 between October 1993 and September 1997, both inclusive. Similar criteria for the functional operability of patients and oncologic operability of the tumor were used in all the GCCB-S hospitals.12 The participating GCCB-S centers had a wide variety of activities, including a representative range of number of beds, type of activity (university and nonuniversity, community, public, and private ownership), and number of interventions per year (range, 8 to 100 interventions). The sample was complete, as verified by the inclusion in the registry of all patients undergoing complete surgical resection. Patients with death due to operative mortality or patients receiving neoadjuvant therapy were excluded from the analysis. The total number of NSCLC patients operated on with any pathologic stage and any type of surgery was 2,300. The final number of cases included in this study was 1,020. Data were collected prospectively, in real-time, over the 4-year study period, using a unified single self-copying form that included the original and a copy (the original form was filed at the hospital and a copy omitting affiliation data was sent to the GCCB-S headquarters). At the GCCB-S Registry, each classificatory component for the different T categories (tumor size, pleural tumor involvement, or tumor involvement of other endothoracic structures) was considered differently and on an individual basis for each patient. The diagnostic procedure employed was marked using a previously agreed-on code and the procedure showing the best resolution recorded in the registry.
1516

The surgical-pathologic size was obtained by measuring the greatest diameter of the fresh surgical specimen. Surgical-pathologic stage N0 was assigned when there was no lymph node involvement after systematic nodal dissection or when sampling of at least four lymph node stations was performed (stations 2, only on the right side, 4, 7, and 10 ipsilateral to the tumor).13 These criteria were similar to those proposed in recent recommendations,14 such as the need to obtain six hilarmediastinal lymph nodes, in order to define pN0. For the purpose of classifying the presence or absence of mediastinal lymph node involvement, a randomized study15 demonstrated that sampling had a value similar to that of mediastinal lymph node dissection. The GCCB-S operational definition for standard complete resection requires the absence of tumor involvement of resection margins, extracapsular involvement of resected mediastinal lymph nodes, positive biopsy finding in unresected mediastinal lymph nodes, and the absence of tumor pleural effusion. Internal and external audits were performed to review the ratio between the number of patients undergoing surgery and the number of cases included in the GCCB-S Registry (standard 95%), and to review the presence and validity of the data collected and recorded for each case (standard 75%), including the consistency of tumor staging. The criterion for the validity of survival data was established on the existence of a known follow-up of, at least, 85% of the case-patients registered in each hospital. In the hospitals that did not meet all these conditions, the cases corresponding to the anomalous period were excluded. Finally, correct data transmission from the paper record to the computer database was verified on two separate occasions. These procedures were designed to control the following aspects: selection bias of surgical cases, registered cases over the total number of surgical cases, sample size, type of hospital, prognostic migration due to the prolonged period of case recruitment, classification with low or deficient degrees of certainty, contamination by data from incomplete series or erroneous data, and loss of adequate long-term follow-up. Analysis Tumor size has been analyzed in different studies16,17 using different methods and perspectives. Notwithstanding, it is a known fact that compilation of observations of supposedly continuous variables is bound to include errors that affect both the accuracy and validity of such estimations. The terminal digit preference phenomenon and rounding up have been cited as typical examples.18,19 The statistical reliability, the way the variable is distributed, and the accurate classification of the study subjects can be seriously affected as a result of this phenomenon. This study verified the distribution of the tumor size variable in order to choose the best method of analysis by observing the mentioned digit preference. A distribution of absolute and relative frequencies of pathologic tumor size was performed, and the normality of such distribution of data subsequently analyzed using the ShapiroWilks method. The Schoenfeld procedure20 was used to identify prognostic tumor size intervals. In this procedure, the continuous variable of tumor size was reclassified arbitrarily into intervals (centimeters in this case). A series of consecutive intervals was generated and its correlation with survival confirmed statistically using the Cox proportional risk procedure,21 which revealed the magnitude of the relative risk of each stratum. Different survival outcomes at various periods of time were analyzed and 95% confidence intervals (CIs) calculated using life tables (actuarial survival); survival curves were compared using the log-rank method. Statistical significance was adjusted using the Bonferroni correction for paired comparisons between strata.22
Clinical Investigations

Results Distribution of Tumor Size Data Figure 1 shows the histogram of pathologic tumor size, where those population subjects with a tumor size of 7 cm were selected, clearly showing the discontinuity and nonnormality behavior displayed by this variable. This is why the Schoenfeld procedure was used for analysis. Population Characteristics Of the 1,020 patients that comprised this series, 945 patients (93%) were men. Mean (SD) age was 64.1 (8.85) years (range, 36 to 87 years). By histologic typing of the surgical specimen, 607 tumors (60%) were epidermoid, 180 tumors (18%) were large cell, 136 tumors (13%) were adenocarcinomas, and the remaining 97 tumors (9%) were of an undefined type or a mixture of the previously mentioned types. Prognosis According to Pathologic Tumor Size Mean pathologic tumor size was 4.27 cm (SD, 2.2 cm; median, 4 cm; range, 0.4 to 15 cm). Table 1 shows the four prognostic intervals yielded by the Schoenfeld procedure20 and the Cox procedure.21 Figure 2 shows a graphic representation of the four survival curves for each prognostic stratum according to the pathologic tumor size. Discussion This study comprised a large series collected in a short and recent time period. The study was multi-

Figure 1. Frequency distribution of pathologic tumor size (in centimeters). Data corresponding to tumors 7 cm in diameter are presented. A digit preference is detected in whole values and in their halves (1 cm, 1.5 cm, 2 cm, 2.5 cm, etc.).
www.chestjournal.org

institutional and representative of cases of NSCLC treated surgically in Spain, with an initial design conceived to control the usual bias in prognostic and/or therapeutic studies. Even though, based on the pathologic stage, similar survival rates are seemingly reported in different experiences,4 those aspects of the methodology are particularly important in view of the variations in survival reported by different series for the same prognostic TNM categories in NSCLC.23 This prospective multi-institutional analysis conducted by the GCCB-S between 1993 and 1997 included a prognosis-specific analysis of pathologic tumor size in 1,020 pIA-pIB NSCLC patients who underwent a complete resection. The analyses conducted point to the existence, in this population of subjects whose initial NSCLC was treated, of four different prognostic groups distributed according to tumor size; the 3-cm value is not a threshold of prognostic significance. The pathologic tumor size intervals yielded by this study (0 to 2 cm, 2.1 to 4 cm, 4.1 to 7 cm, and 7 cm) are identical to those observed by our group6 for the analysis of clinical tumor size although, evidently, with different survival values. In resected pathologic stage I NSCLC, with a surgical specimen of 4.1 to 7 cm, survival at 4 and 5 years of 0.53 and 0.49, respectively (our study), is worse than the survival specified for pathologic stage IIA (0.61 and 0.55, respectively).16 For tumors 7 cm, the prognosis at 2, 3, 4, and 5 years (0.51. 0.45, 0.41, and 0.38, respectively) is identical to that reported for descriptors pT2N1M0-pT3N0M0 (stage IIB) [0.56, 0.46, 0.42, and 0.39, respectively].16 Comparison between this GCCB-S series and that published by Mountain16 in 1997 seems adequate, as both these series refer, in terms of pathologic staging, to NSCLC cases with complete resection, and both exclude operative mortality. In these last few years, there has been regained interest for the early screening and detection of lung cancer, due in part to the availability of procedures such as low-radiation CT for detection of small nodules.24 Besides the controversy raised by the design of population screening research studies, contradictory data have been identified regarding prognosis within the different magnitudes in T1N0M0 lung cancer ( 3 cm). One report17 describes experiences that do not indicate prognostic differences among tumors of 3 cm; however, another study25 found such differences. Editorials26 and letters27 continue to fuel this current controversial issue. Ten years ago, Watanabe et al28 considered a 5-cm diameter to be a prognostic threshold for tumor size. He then proposed that category T2 be divided into two groups (a and b), depending on whether the
CHEST / 121 / 5 / MAY, 2002

1517

Table 1Risk Ratio (Death) and Survival According to Different Strata of Pathologic Tumor Size
Tumor Size Diameter, cm 02 2.14 4.17 7 Risk Ratio (95% CI) 1 1.5 (1.12.2) 2.1 (1.53.1) 3.5 (2.35.4) Survival, yr 2 0.90 0.81 0.71 0.51 3 0.83 0.71 0.61 0.45 4 0.76 0.65 0.53 0.41 5 0.63 0.56 0.49 0.38 Log Rank 0.0074 0.0048 0.0034

Groups A B C D

No. 147 448 336 89

tumor was above or below that diameter.28 One study29 evaluated the risk ratio for recurrence, taking into account the centimeters of the tumor. That risk ratio was 1.2 per centimeter (95% CI, 1.1 to 1.4). Some European series30 on surgical lung cancer of a predominantly squamous type (57%), and with the majority of patients being male (63%), have conducted a prognostic analysis on various strata of tumor size. When a size of 2 cm was taken as reference, strata of 4 and 4 cm were shown to have a direct correlation with survival. Finally, other analyses have considered the magnitude of estimated tumor volume in NSCLC stages I and II.31 The death risk increases in line with tumor volume for each of the stages, in a significant and independent fashion. The Schoenfeld procedure used in our study affords the advantages, in this type of tumor size analysis, of examining progressive changes in the dependent variable (survival), depending on the levels of the independent variable (tumor size), enabling delimitation of critical borderlines in which substantial changes in such dependent variable may occur. Our study may have certain limitations and a specific reproducibility problem attached to it. The pathologic tumor size was obtained by measuring the

Figure 2. Survival in NSCLC in stage pIA-B with complete resection (n 1,020) according to pathologic (p) tumor size. cum cumulative.
1518

actual surgical specimen. A possible problem with a double implication could be the presence of accompanying atelectasis or pneumonitis. Since atelectasis or pneumonitis is more likely to appear in large tumors, and such clinical picture is another criterion for T2,16 the combination of these two factors could worsen the prognosis. In addition, such association could wrongly overestimate the presumed size of the tumor. In the present study, the frequency of surgical-pathologic atelectasis or pneumonitis, as measured in the four mentioned tumor strata, was 22%, 23%, 29%, and 21% for groups A, B, C, and D (Table 1), respectively. In a previous GCCB-S study6 on prognostic analysis of clinical tumor size, cases with visceral pleural involvement were excluded. In this study (1,020 patients with pIA-pIB), the presence or absence of visceral pleural involvement does not modify prognosis in the different pathologic tumor size strata. For instance, survival at 3 years for tumor groups A, B, C, and D (Table 1) was 0.83, 0.72, 0.61, and 0.42, respectively, if there was no visceral pleural involvement. If, however, there was visceral pleural involvement, survival at 3 years for the same groups was 0.93, 0.68, 0.60, and 0.51, respectively. Other groups5,32 report similar experiences. Other classificatory or definer components for T2, such as proximal bronchial involvement, do not appear to add any prognostic value to tumor size.25 Our population may be regarded as representative of NSCLC in stage pIA-pIB with complete resection in Spain in view of the multi-institutional nature of the GCCB-S, the magnitude of our sample, and quality controls undertaken. Nonetheless, given that the majority of our patients in our study were male with an epidermoid type of tumor, with scarce presentation of adenocarcinoma, and infrequent bronchioalveolar carcinomas, extrapolating our experience to other communities (the United States or Japan) might be somewhat problematic. Based on our criteria, and on the data shown in the evaluation of clinical tumor size for a surgical population and for pathologic tumor size, the prognostic groups observed must be taken into account when evaluating any new potential prognostic factor (bioClinical Investigations

logical, clinical, molecular, etc.) or when designing stratification criteria in clinical trials in which patients with initial tumor stages take part. In some studies on new prognostic factors, multivariate analysis only looks at tumor size as either 3 cm or 3 cm,33 or as T1-T2.34 New assessments that take the new prognostic spectrum of tumor size into account may or may not confirm the independent value of these new factors. As previously discussed, prognostic accuracy improves when a more discriminative staging is performed using TNM descriptors instead of stages.5 This improvement in prognostic discrimination also occurs, as shown in our study, when a classificatory component (such as tumor size) is examined in greater detail. In conclusion, this multi-institutional study, conducted by the GCCB-S on NSCLC cases with complete resection, did not find the 3-cm value to be a prognostic threshold. The study did, however, identify four prognostic groups with different tumor sizes within initial pIA-IB stages. Appendix: the GCCB-S
Coordinators: Jose Luis Duque, MD (Hospital Universitario, Valladolid); Angel Lopez-Encuentra, MD (Hospital Universitario 12 de Octubre, Madrid); Ramon Rami-Porta, MD (Hospital Mutua de Terrassa, Barcelona). Local representatives: Julio Astudillo, MD (Hospital Germans Trias i Pujol, Barcelona); Emilio Canals, MD; Jose Belda, MD (Hospital Clinic, Barcelona); Antonio Canto, MD; Antonio Ar nau, MD (Hospital Clnico, Valencia); Juan Casanova, MD; Manuel Marinan, MD (Hospital de Cruces, Bilbao); Jorge Cerezal, MD; Jose Mara Matilla, MD (Hospital Universitario, Valladolid); Antonio Fernandez de Rota, MD; Ricardo Arrabal, MD (Hospital Carlos Haya, Malaga); Federico Gonzalez Ara goneses, MD; Nicolas Moreno, MD (Hospital Gregorio Mara non, Madrid); Jorge Freixinet, MD; Pedro Rodrguez, MD (Hospital Nuestra Senora del Pino, Las Palmas); Nicolas Llobre gat, MD, (Hospital Universitario del Aire, Madrid); Nuria Manes, MD (Fundacion Jimenez Daz, Madrid); Miguel Mateu, MD; Guadalupe Gonzalez Pont, MD (Hospital Mutua de Terrassa, Barcelona); Jose Luis Martn de Nicolas, MD (Hospital Univer sitario 12 de Octubre, Madrid); Nuria Novoa, MD (Complejo Hospitalario, Salamanca); Jesus Rodrguez, MD (Complejo Hos pitalario, Oviedo); Antonio Jose Torres Garca, MD (Hospital Universitario San Carlos, Madrid); Mercedes de la Torre, MD (Hospital Juan Canalejo, La Coruna); Abel Sanchez-Palencia, MD; Ruz Zafra, MD (Hospital Virgen de las Nieves, Granada); Andres Varela de Ugarte, MD; Pablo Gamez, MD (Clnica Puerta de Hierro, Madrid); Yat Wah Pun, MD (Hospital de la Princesa, Madrid). Data analysis: Agustn Gomez de la Camara, MD; Francisco Pozo Rodrguez, MD; Paloma Ferrando, MSc (Hospital Univer sitario 12 de Octubre, Madrid).

References
1 Mountain CF, Carr DT, Anderson WA. A system for the clinical staging of lung cancer. AJR Am J Roentgenol Radium Ther Nucl Med 1974; 120:130 138
www.chestjournal.org

2 Sobin LH, Wittekind Ch. TNM classification of malignant tumors. UICC International Union Against Cancer. 5th ed. New York, NY: Wiley-Liss, 1997 3 Gospodarowicz MK, Henson DE, Hutter RVP, et al. Prognostic factors in cancer, 2nd ed. New York, NY: Wiley-Liss, 2001 4 Lopez-Encuentra A, Bulzebruck H, Feinstein AR, et al. Tumor staging and classification in lung cancer. Lung Cancer 2000; 29:79 83 5 Buccheri G, Ferrigno D. Prognostic value of stage grouping and TNM descriptors in lung cancer. Chest 2000; 117:1247 1255 6 Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Clinical tumor size and prognosis in lung cancer. Eur Respir J 1999; 14:812 816 7 Riquet M, Manach D, Le Pimpec-Barthes F, et al. Prognostic value of T and N in non-small cell lung cancer three centimeters or less in diameter. Eur J Cardiothorac Surg 1997; 11:440 443 8 Watanabe Y, Murakami S, Oda M, et al. Tumor size and extension of lymph node metastases in N2 lung cancer. Ann Ital Chir 1999; 70:889 892 9 Graham AN, Chan KJ, Pastorino U, et al. Systematic nodal dissection in the intrathoracic staging of patients with nonsmall cell lung cancer. Thorac Cardiovasc Surg 1999; 117: 246 251 10 Saito M, Nakamura H, Hiyoshi T, et al. Lymph node status of small lung cancers 2.0 cm or less in size [abstract]. Lung Cancer 2000; 29(suppl 2):141 11 Grupo Cooperativo de Carcinoma Broncogenico de SEPAR (GCCB-S): ciruga del carcinoma broncogenico en Espana; estudio descriptivo. Arch Bronconeumol 1995; 31:303309 12 Lopez Encuentra A. Criteria of functional and oncological operability in surgery for lung cancer: a multicenter study. The Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Lung Cancer 1998; 20:161168 13 American Thoracic Society. Clinical staging of primary lung cancer. Am Rev Respir Dis 1983; 127:659 664 14 Wittekind CH, Henson DE, Hutter RVP, et al. UICC TNM supplement: a commentary on uniform use. 2nd ed. New York, NY: Wiley-Liss, 2001 15 Izbicki JR, Passlick B, Karg O, et al. Impact of radical systematic mediastinal lymphadenectomy on tumor staging in lung cancer. Ann Thorac Surg 1995; 59:209 214 16 Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997; 111:1710 1717 17 Patz EF, Rossi S, Harpole DH, et al. Correlation of tumor size and survival in patients with stage IA non-small cell lung cancer. Chest 2000; 117:1568 1571 18 Hessel P. Terminal digit preference in blood pressure measurements: effects on epidemiological associations. Int J Epidemiol 1986; 15:122125 19 Bennett S. Blood pressure measurement error: its effects on cross-sectional and trend analyses. J Clin Epidemiol 1994; 47:293301 20 Schoenfeld DA. Analysis of categorical data: logistic model. In: Mike V, Stanley KE, eds. Statistics in medical research. New York, NY: Wiley, 1982; 443 454 21 Cox DR. Regression models and life table. J R Stat Soc 1972; 34:187220 22 Hastings RP. Supplementary library users guide. Cary, NC: SAS Institute, 1986; 437 466 23 Nesbitt JC, Putnam JB, Walsh GL, et al. Survival in earlystage non-small cell lung cancer. Ann Thorac Surg 1995; 60:466 472
CHEST / 121 / 5 / MAY, 2002

1519

24 Patz EF, Goodman PC, Bepler G. Screening for lung cancer. N Engl J Med 2000; 343:16271633 25 Padilla J, Calvo V, Penalver JC, et al. Surgical results and prognostic factors in early non-small cell lung cancer. Ann Thorac Surg 1997; 63:324 326 26 Black WC. Unexpected observations on tumor size and survival in stage IA non-small cell lung cancer. Chest 2000; 117:1532 1534 27 Reich J. Hazards of lung cancer screening. Chest 2001; 119:659 660 28 Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding some deficiencies in the new international staging system for nonsmall cell lung cancer. Jpn J Clin Oncol 1991; 21:160168 29 Lacasse Y, Bucher HC, Wong E, et al. Incomplete resection in non-small cell lung cancer: need for a new definition. Canadian Lung Oncology Group. Ann Thorac Surg 1998; 65:220226

30 Bouchardy CH, Fioretta G, De Perrot M, et al. Determinants of long term survival after surgery for cancer of the lung: a population-based study. Cancer 1999; 86:2229 2237 31 Jefferson MF, Pendleton N, Faragher EB, et al. Tumor volume as a predictor of survival after resection of non-smallcell lung cancer. Br J Cancer 1996; 74:456 459 32 Deslauriers J, Gregoire J. Surgical therapy of early non-small cell lung cancer. Chest 2000; 117:104S109S 33 Ahuja V, Coleman RE, Hendon J, et al. The prognostic significance of fluorodeoxyglucose positron emission tomography imaging for patients with non-small cell lung carcinoma. Cancer 1998; 83:918 924 34 Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I non-small cell lung cancer. Clin Cancer Res 1999; 5:20772081

1520

Clinical Investigations

Eur Respir J 1999; 14: 812816 Printed in UK all rights reserved

Copyright # ERS Journals Ltd 1999 European Respiratory Journal ISSN 0903-1936

Clinical tumour size and prognosis in lung cancer

Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S)
Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). #ERS Journals Ltd 1999. ABSTRACT: In the staging of lung cancer (LC), tumour size is a variable that can be used to separate primary tumour, regional nodes, metastasis (TNM), stages T1 and T2 (<3 or >3 cm). The objective of this study was to evaluate the prognostic value of tumour size before thoracotomy and to determine whether tumour size can be used to classify LC as T3. This multi-institutional cooperative longitudinal prospective study in Spanish hospitals located throughout the country, with a broad range of activity levels, included all consecutive cases of LC treated surgically from October 1993 to September 1996 (n=2,361). Four prognostic groups, characterized by tumour size, were identified according to the Schoenfeld procedure: a) 02 cm (n=173); b) 2.14 cm (n=542); c) 4.17 cm (n= 413); and d) >7 cm (n=77). The 2-yr survival rates by group were a=0.78 (95% confidence interval (CI) 0.710.84); b=0.67 (95% CI 0.620.71); c=0.58 (95% CI 0.530.63); d=0.41 (95% CI 0.290.52). The log-rank comparisons of the survival curves were significant for the four groups (a versus b=0.0008, b versus c=0.003, c versus d=0.016). The clinical tumour size of lung cancer defined four prognostic groups (02 cm, 2.1 4 cm, 4.17 cm; and >7 cm). Lung cancer with a diameter >7 cm had a prognosis similar to that of stage T3 or stage IIB. Eur Respir J 1999; 14: 812816.
Correspondence: A. Lopez-Encuentra Pneumology Service Hospital Universitario 12 de Octubre Ctra. de Andaluc , km 5,4 a E-28041 Madrid Spain Fax: 34 913908358 Keywords: Cohort study lung neoplasm registry staging TNM classification tumour size Received: January 19 1999 Accepted after revision May 15 1999 This work was partly financed by FIS grant (97/0011), FEPAR-PENSA 1995 grant, and financial aid from the Castilla Leon government and Menarini Foundation.

In Spain, the incidence and mortality of lung cancer (LC) have increased in recent decades [1]. In the initial stages (stages III) of non-small-cell lung cancer (NSCLC), the therapy of choice is surgery if the patient can tolerate lung resection. However even in these stages, surgery is not a guaranteed cure. Only 63.5% of patients with stage I LC treated surgically survive $5 yrs [2]. Moreover, the results obtained for the same prognostic groups vary widely from one series to another; for instance, reported 5-yr survival rates for primary tumour, regional nodes, metastasis (TNM) classification, T1N0M0 tumours range 68.583% [3]. These findings suggest the need for other factors, perhaps of a molecular type, to improve the accuracy of prognostic predictions and to establish the most suitable adjuvant therapies [4]. However, in spite of the initially promising results that have been obtained in initial LC with factors other than the TNM classification, subsequent studies have failed to confirm the reproducibility of these factors as prognostic markers [5]. In recent studies of resected NSCLC, certain molecular markers and tumour size have shown a similar prognostic value in multivariate analysis [6, 7]. In other studies of stage IIIA tumours with complete resection, univariate analysis shows that tumour size is not an independent prognostic factor for survival when using a cut-off value of 4 cm, but variables such as angiogenesis are [8]. In patients with NSCLC undergoing surgery with intent to cure (stages IIIIA), univariate

analysis confirms the prognostic value of molecular factors, separately or associated, but not the prognostic value of the surgical-pathologicaltumour size classification [9]. One source of discrepancies in the prognostic value of molecular factors may be the inconsistency of measurements of the fundamental prognostic factors [3], which are included in the classification of anatomic extension (TNM classification stages) [10, 11]. Assuming that studies of multiple prognostic factors in LC are a necessary step toward improving our capability for predicting prognosis, each factor used to classify anatomic extension should be analysed independently. The most frequent category is T2, defined as a tumour >3 cm in diameter (with no upper limit), with or without other circumstances (proximity to a main bronchus, visceral pleural invasion, atelectasis or pneumonitis involving less than a whole lung). The validation or correction, if necessary, of the data that sustain anatomic classifications is the first goal in the construction of multifactorial prognostic indexes [12]. As noted by a consensus group of the International Association for the Study of Lung Cancer (IASLC), the construction of prognostic scales in LC using data collected before 1980 may yield questionable results [12]. Therefore, the IASLC has appointed a staging group to consider, among other questions, "confirmation of the prognostic independence of size in T2 (3 cm versus 4 cm versus 5 cm, etc) in cases of resectable NSCLC" [12].

TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER

813

The goal of this study was to evaluate the prognostic value of clinical tumour size. It was determined whether various cut-off values for tumour diameter, in the absence of either visceral pleural involvement or other anatomic factors justifying a higher T classification, or metastases to lymph nodes or at a distance, could be an independent prognostic factor for classifying tumours as higher tumour (T) (T3) or stage classification in the clinical phase before thoracotomy. Material and methods Study subjects All the patients included in the study had lung cancer in initial stages and underwent thoracotomy with intent to cure in hospitals pertaining to the Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S) [13]. The population characteristics are described in table 1. In summary, the authors prospectively included all patients treated surgically from October 1993 to September 1996 in hospitals participating in the GCCB-S who presented the clinical picture that defined the initial population (table 1) [13]. The annual cumulative number of cases was close to 50% of total cases occurring in Spain. The participating GCCB-S centres had a wide variety of activities, including a representative range of number of beds, teaching or research activities (university and nonuniversity hospitals), public and private ownership, and number of interventions per year (8100 interventions were performed in participating centres for this disease). The sample was complete, as verified by the inclusion in the registry of all patients undergoing surgery, including incomplete resections and exploratory thoracotomy. Table 2 shows the initial total number of patients and exclusions for each study year. Death due to operative mortality has been excluded. The final number of cases included in the study of prognostic factors was 1,859. For the study of clinical tumour size as a prognostic factor, the cases classified as T1 or T2 without involvement of the visceral pleura, regional lymph nodes (with classificatory certainty) (see Methods section), or metastases at a distance were considered. Within the T2 criteria, proximity to the main bronchus was not considered to be an exclusion factor in this study because of its low probability of modifying the prognosis [14]. Although a correct multivariate analysis of all the cases should control the prognostic value of tumour size using other T or nodal (N) factors, it was considered more appropriate to avoid contaminating the results with data from more advanced tumours. These
Table 1. Population characteristics Clinical situation index Bronchogenic carcinoma Initial stages Thoracotomy Sample attributes Representativity Completeness Exclusion criteria Operative mortality Neoadjuvant treatment with surgery Unknown evolution since surgery

Table 2. Initial total number of patients and exclusions for each study year 199394 Patients registered Surgical mortality Induction treatment Loss of follow-up Final population 718 51 42 13 610 199495 822 62 31 94 634 199596 821 75 38 96 611 Total 2361 188 111 203 1859

conditions were met by 1,205 cases, which included incomplete resections and exploratory thoracotomies because these particular conditions were not known at the time of the "clinical phase" analysis before thoracotomy. Methods In accordance with the initial design, the period of case recruitment was short. The same criteria for the functional operability of patients and oncological operability of the tumour were used in all the GCCB-S hospitals [15]. Each variable recorded in the registry was accompanied by the diagnostic procedure used for its classification. When several procedures were used, the procedure with the best resolution was chosen. Depending on the characteristics of the tumour, clinical tumour size was established using a chest radiograph or computerized axial tomography (CAT); for instance, in vertical diameters, a radiograph may, in some patients, prove to be more reliable than CAT. For other characteristics, for example, the classification of clinical N2 involvement, CAT or mediastinoscopy was used and the procedure was recorded in the registry. The degree of certainty of the TNM-stages classification depends on the diagnostic methods used. According to some international organizations, postmortem study yields the maximum certainty factor and the clinical findings yield the minimum certainty factor [10]. The clinical classification of isolated involvement of the visceral pleura is considered certain only if it is verified by a validated procedure (thoracoscopy). The classification of clinical N0 requires, as a minimum, the absence of lymph node involvement of >1 cm in diameter in areas 4, 7, and 10 in CAT or magnetic resonance imaging (MRI), or the presence of negative mediastinoscopy in these zones [16]. For the clinical N1 classification, cytohistological certainty is based on transbronchial fine needle aspiration biopsy (FNAB) or hilioscopy, and none of the patients in these series underwent these tests. To confirm the presence of clinical N2, cytohistological certainty obtained by transbronchial,transthoracic or transesophagealFNAB, by mediastinoscopy-mediastinotomy,or by thoracoscopy is required. Surgical-pathological N0 is classified by radical mediastinal lymph node dissection or sampling of at least four lymph node areas (2 (only in right LC), 4, 7, and 10 on the same side as the tumour) [16]. For the purpose of classifying the presence or absence of mediastinal lymph node involvement, a randomized study has demonstrated that sampling has a value similar to that of radical mediastinal lymph node dissection [17]. Internal and external audits were made firstly to review the ratio between the number of patients undergoing surgery and the number of cases included in the registry (standard over 95%) and secondly, to review the validity

814

GCCB-S

of the data recorded for each case (standard >70%), including the consistency of tumoural staging. The criterion for the validity of the survival data was established as the existence of a known follow-up for $85% of the cases registered in each hospital [18]. In the hospitals that did not meet all these conditions, the cases corresponding to the period of problems were excluded. Finally, correct data transmission by a single central office from the paper record to the computer database was verified. These procedures were designed to control the following aspects: selection bias of surgical cases; registered cases out of the total number of surgical cases; sample size; type of hospital; prognostic migration due to the prolonged period of case recruitment; classification with low or deficient degrees of certainty; contamination by data from incomplete series or erroneous data, and loss of long-term follow-up. Analysis The Schoenfeld procedure [19] was used to identify intervals of tumour size related with specific survival outcomes. In this procedure, the continuous variable of tumour size was reclassified arbitrarily into intervals or unit segments (centimetres in this case) with suspected clinical significance. A series of consecutive and overlapping segments was generated and its correlation with survival was confirmed statistically using the Cox proportional risk procedure [20], which revealed the magnitude of the relative risk for each stratum. The 2-yr and 3 yr survival of the resulting prognostic groups was anaysed and 95% confidence intervals (CI) were calculated using life tables (actuarial survival) and log-rank comparisons of survival curves. Statistical significance was adjusted using the Bonferroni correction for paired comparisons between strata [21]. Results Population characteristics The mean age of the studied population for the purpose of examining clinical tumour size in relation to prognosis was 63.411 yrs (SD). The clinical tumour type was epidermoid in 526 patients (44%), adenocarcinoma in 306 (25%), large cell carcinoma in 185 (15%), unclassified carcinoma (non-small cell) in 180 (15%), and small-cell in 8 patients (1%). Tumour size in small-cell lung cancer ranged 1.54 cm. Ninety per cent of the patients were male. Exploratory thoracotomy was performed in 161 patients (13%), lobectomy or bilobectomy in 744 patients (62%), pneumoectomy in 270 (22%), and segmentectomy, atypical resection, or a combination of procedures in the rest of the patients

Survival

0.5

12 24 Months after treatment

36

Fig. 1. Cumulative probability of survival after treatment according to clinical tumour size; : 02 cm in diameter; : 2.14 cm; - - - : 4.17 cm; - - : >7 cm. Operative deaths are excluded.

Clinical tumour size Mean tumour size before thoracotomy in the 1,205 classified cases was 4.24 cm (SD 1.97; median 2.4 cm; range 0.515 cm). In these 1,205 cases categorized as T1T2 without visceral pleural involvement, N0 metastasis (M0), 12-month survival was 0.78 (95% CI 0.760.80) and 24month survival was 0.63 (95% CI 0.600.66). Using the Schoenfeld procedure [19], the Cox method [20] several cut-off values of tumour size were determined and selected on the basis of survival. Four tumour size intervals, generally 27 cm (table 3) were found. Each interval increased the risk of death by 50.8%, with respect to the previous stratum; the different intervals showed increases of the same magnitude in the 2-yr and 3-yr survival analysis. In this study, 3 cm was not a cutoff value for tumour size between prognostic categories. The tumour-size groups had short-term survivals (12 yrs after surgery), showing statistically significant differences (table 3). At 3 yrs the statistical differences between the four groups were maintained (log-rank =0.0002, 0.009, 0.002, respectively) (fig. 1). Discussion The goal of the study was to analyse the prognostic value of clinical tumour size (as determined by radiology) of LC, independently of other factors, in initial clinical (c)T1T2 stages without invasion of local structures (visceral pleura), involvement of regional lymph nodes, or distant metastases. Apart from being helpful in other areas, such information is perceived to be a valuable tool in quantifying the magnitude of benefit of the surgical

Table 3. Prognostic groups and survival defined by clinical tumour size in relation to risk of death* Group a b c d Size diameter in cm 02 2.14 4.17 >7 n 173 542 413 77 Risk ratio 2 yrs 95% CI 1 1.9 (1.32.7) 2.6 (1.83.7) 3.9 (2.56.2) 0.90 0.82 0.72 0.62 S1 95% CI (0.860.95) (0.790.86) (0.680.76) (0.510.73) 0.78 0.67 0.58 0.41 S2 95% CI (0.710.84) (0.620.71) (0.530.63) (0.290.52) Log-rank 0.0008 0.003 0.016

Data are presented as absolute number with 95% confidence intervals in parentheses. *: according to the procedure of SCHOENFELD [19]. The risk ratio was calculatedaccording to the Cox method [20]; S1: cumulative probabilityof survival at 1 yr; S2: cumulative probabilityof survival
at 2 yrs.

TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER

815

treatment with regard to risk. The study comprised a large series of recent cases collected over a short time period. The study was multi-institutional and representative of cases of LC treated surgically in Spain, with an initial design conceived to control the usual bias in prognostic and/or therapeutic studies. These aspects of the methodology are particularly important in view of the variations in survival reported by different series for the same prognostic categories of LC [3]. The analysis found four groups of clinical tumour sizes related to risk of death: 02 cm; 2.14 cm; 4.17 cm; and >7 cm. The 3 cm value was not confirmed as a prognostic separator in staging by the current study. The short-term survival (12 yrs) after surgery in the group of patients with tumours >7 cm in diameter is similar to that of TNM anatomic classifications and/or stages superior to T2/IB (table 4). For LC >7 cm in diameter, the 2-yr probability of survival is closer to that of cT3N0M0 or cT2N1M0, or stage cIIB [22], than to the survival of the category in which it theoretically belongs, cT2N0M0 (2-yr survival probability: 0.54) [22]. When evaluating these results, the univariate nature of the study, which excluded other LC groups from analysis, should be emphasized. These other LC groups, might, in multivariate analysis, demonstrate the independent prognostic value of tumour size, even in the presence of more advanced tumour classification conditions. The comparison of the present data with a recently published study of survival using the TNM-staging classification [22] is appropriate because its prognostic data was used for the elaboration of the new 1997 classification [11], (data is reported in clinical and/or surgicalpathological categories on a yearly basis for 5 yrs), and also because it includes small-cell LC in cT1-2N0M0 (3.8% in their series [22]) and excludes cases of surgical mortality that occurred in the first 30 days after surgery. However, it is not clear if thoracotomy with incomplete resection and exploratory thoracotomy are included in the data relative to the clinical phase and the surgicalpathological classification. Each prognostic category of the TNM classification (T1, T2, N2, etc) contains distinct internal components (tumour size, atelectasis, invasion of specific neighbouring structures). In theory, each component should be analysed independently so that, after a correct classification has been made, their prognostic value in relation to different survival times can be determined. Of the components making up each prognostic category, the first factor evaluated by the GCCB-S was tumour size. This variable has a high level of classificatory certainty that is attainable with simple, universally available methods (chest radiograph or thoracic CAT); no prognostic migration is expected as a result of advances in diagnostic
Table 4. Prognostic equivalence between some clinical tumour sizes and the new tumour classification (1997) First author [Ref] Present author MOUNTAIN [22] MOUNTAIN [22] MOUNTAIN [22] Category T >7 cm, N0, M0 T3, N0, M0 T2, N1, M0 IIB n 77 107 250 357 2-yr survival 0.41 0.37 0.42 0.41

technology. The prognostic value of tumour size has been studied for many years [2325]. In 1974, the first TNM classification was described after an evaluation of more than 300 curves and survival tables for 2,155 patients treated in the previous 4 yrs [26], which has conserved its basic structure until the present. One criterion that has not changed is the tumour size used to differentiate the T1 and T2 categories, which has a cut-off value of 3 cm. In fact, T3, as described in 1974, has undergone more modifications as a result of the prognostic stratification of its internal variables. However, T2 has not changed substantially other than to incorporate visceral pleural involvement. In a recent publication of prognostic data, which largely sustains the new tumoural classification of anatomic extension of 1997 [22], ~7,000 cases were evaluated, of which >5,000 cases were collected after 1975 and almost 4000 cases were evaluated before CAT was introduced in 1982. As shown in table 4, the prognostic significance of tumours >7 cm is similar to that of TNM groups or more advanced clinical stages. Compared with other recent experiences (2,382 resected NSCLC), the probability of survival at 2 yrs calculated by the GCCB-S for tumours >7 cm in diameter was similar to that of stage IIIA (T. Naruke, National Cancer Centre, Tokyo, Japan; personal communication, 1997). Some groups have recommended, in the light of survival data, that LC >5 cm in diameter be classified as a higher category of T2 (stage IB) or by creating a new category, T2bN0M0, within stage II [24]. In recent literature, cases of LC treated by surgical resection in Spain show significant prognostic differences for small variations in tumour size: for example, between two groups of tumours <3 cm (02 cm versus 23 cm) found in a population of 154 T1N0M0 patients had significantly different 5- and 10-yr prognoses after surgery [14]. In initial stages of LC in functionally inoperable patients who were treated by irradiation, different survival levels (considering only LC-specific mortality) have been detected for different tumour-size cut-off values. The 3-yr survival rate was 30% for tumours >3 cm, 17% for 36 cm, and 0% for tumours >6 cm (only 9 cases) [27]. Prognostic results vary for initial lung cancer stages when the variable tumour size is controlled, even when restricted to T1-2N0M0 groups. This may be due to the presence of other variables contained within T1 or T2 [10], to biological-molecular factors [4], or to association with other diseases [28]. With regard to comorbidity, a large percentage of patients with initial stages of LC die from associated disease [27, 28]. This study has certain limitations, the first of which is the absence of internal validation. The study population is described herein, but not the validation population, which has not yet been evaluated because it was recruited in the final year (19961997). Another limitation is that the data correspond to a short follow-up period (2 yrs), although ideally the final analysis time in LC should be 10 yrs. However, values obtained at 1, 2 and 3 yrs and the survival curves are fundamental for responsible decision-making by the physician and patient [29]. Given the current possibilities for obtaining homogeneous populations and using homogeneous study methods, and the current ease of information exchange, a process of convergence among databases throughoutthe world should be started and their compatibility studied. This would lead

816

GCCB-S

to larger and more representative sample sizes; which would probably improve prediction and prognostic accuracy. This measure is considered necessary and is defended as a major research challenge in lung cancer by the International Association for the Study of Lung Cancer [12], which proposes to "collect and review existing databases of cooperative groups and other institutions in order to validate clinical primary tumour, regional nodes, metastasis" in non-small-cell lung cancer. Bronchogenic carcinoma cooperative group of the Spanish society of pneumology and thoracic surgery
Coordinators: J. Luis Duque (Hospital Universitario, Valladopez Encuentra (Hospital Universitario 12 de Octubre, lid); A. Lo Madrid); R. Rami Porta (Hospital Mutua de Terrassa, Barcelona). Local representatives: J. Astudillo (Hospital Germans Trias i Pujol, Barcelona); E. Canal , J. Belda (Hospital Clinic, Barces lona); A. Canto, A. Arnau (Hospital Cl ico, Valencia); J. Casann ova, M. Marinan (Hospital de Cruces, Bilbao); J. Cerezal, F. Heras (Hospital Universitario, Valladolid); A. Fernandez de Rota, R. Arrabal (Hospital Carlos Haya, Malaga); F. Gonzalez Arago neses, N. Moreno (Hospital Gregorio Maranon, Madrid); J. Freixinet, P. Rodr uez Suarez (Hospital Nuestra Senora del Pino, g Las Palmas); N. Llobregat, J. Antonio Garrido (Hospital Universitario del Aire, Madrid); N. Manes, J.M. Garc Prim (Fun a dacion Jimenez D z, Madrid); M. Mateu, E. Barbeta Sanchez a (Hospital Mutua de Terrassa, Barcelona); J. Luis Mart de n Nicolas, C. Marron (Hospital Universitario 12 de Octubre, Madrid); N. Novoa (Complejo Hospitalario, Salamanca); J. Rod r uez, F.A. de Linera (Complejo Hospitalario, Oviedo); A. Jose g Torres Garc , A. Gomez (Hospital Universitario San Carlos, a Madrid); J. Jose Rivas, M. de la Torre (Hospital Juan Canalejo, La Coruna); A. Sanchez-Palencia, F. Javier Ruiz Zafra (Hospital Virgen de las Nieves, Granada); A. Varela Ugarte, P. Gamez (Cl ica Puerta de Hierro, Madrid); Y. Wah Pun (Hospital de la n Princesa, Madrid). Data analysis: P. Ferrando, A. Gomez de la Camara (Unidad de Epidemiolog Cl ica, Hospital Universitario a n 12 de Octubre, Madrid). References 1. 2. 3. 4. 5. 6. Izarzugaza Lizarraga I. El cancer de pulmon en Espana. Revision epidemiologica. Arch Bronconeumol 1992; 28: 311319. Mountain CF. A new internationalstaging system for lung cancer. Chest 1986; 89: Suppl. 4, 225233. Nesbitt JC, Putnam JB, Walsh GL, Roth JA, Mountain CF. Survival in early-stage non-small cell lung cancer. Ann Thorac Surg 1995; 60: 466472. Hermanek P, Gospodarowicz MK, Henson DE, Hutter RVP, Sobin LH. Prognostic factors in cancer, 1st Edn. Berlin, Springer-V erlag, 1995. Pastorino U, Andreola S, Tagliabue E, et al. Immunocytochemical markers in stage I lung cancer: relevance to prognosis. J Clin Oncol 1997; 15: 28582865. Fontanini G, Lucchi M, Vignati S, et al. Angiogenesis as a prognostic indicator of survival in non-small-cell lung carcinoma: a prospective study. J Natl Cancer Inst 1997; 89: 881886. Apolinario RM, Van-der-Valk P, de Jong JS, et al. Prognostic value of the expression of p53, bc12, and bax oncoproteins, and neovascularization in patients with radically resected non-small-cell lung cancer. J Clin Oncol 1997; 15: 24562466. Angeletti CA, Lucchi M, Fontanini G, et al. Prognostic significance of tumoral angiogenesis in completely resec-

9. 10. 11. 12. 13.

14. 15.

16. 17. 18.

19. 20. 21. 22. 23. 24.

25. 26. 27.

7.

28. 29.

8.

ted late stage lung carcinoma (stage IIIA-N2). Cancer 1996; 78: 409415. Dosake-Akita H, Hu SX, Fujimo M, et al. Altered retinoblastoma protein expression in non-small cell lung cancer. Cancer 1997; 79: 13291337. Sobin LH, Wittekind Ch. UICC International Union Against Cancer, TNM Classification of malignant tumors. Fifth edition. New York, Wiley-Liss, 1997. American Thoracic Society/European Respiratory Society. Pretreatment evaluation of non-small-cell lung cancer. Am J Respir Crit Care Med 1997; 156: 320332. Ginsberg R, Cox J, Green M, et al. Staging Classification Committee Consensus report. Lung Cancer 1997; 17: Suppl. 1, 1113. Grupo Cooperativo de Carcinoma Broncogenico de SEPAR (GCCB-S). Cirug del carcinoma broncogenico a en Espana. Estudio descriptivo.Arch Bronconeumol1995; 31: 303309. Padilla J, Calvo V, Pen alver JC, Sales G, Morcillo A. Surgical results and prognostic factors in early non-small cell lung cancer. Ann Thorac Surg 1997; 63: 324326. pez Encuentra A and the Bronchogenic Carcinoma Lo Cooperative Group of the Spanish Society of Pneumology and Thoracic Society (GCCB-S). Criteria of functional and oncologicaloperability in surgery for lung cancer. A multicenter study. Lung Cancer 1998; 20: 161168. American Thoracic Society. Clinical staging primary lung cancer. Am Rev Respir Dis 1983; 127: 16. Izbicki JR, Passlick B, Karg O, et al. Impact of radical systematic mediastinal lymphadenectomy on tumor staging in lung cancer. Ann Thorac Surg 1995; 59: 209214. Grupo Cooperativo de Carcinoma Broncogenico de SEPAR (GCCB-S). Control de calidad en un registro multiinstitucional de carcinoma broncogenico. Arch Bronconeumol 1996; 32: Suppl. 2, 70. Schoenfeld DA. Analysis of categorical data: logistic model. In: Mike and Stanley KE, eds. Statistics in Medical Research. New York, Wiley, 1982; pp. 433454. Cox DR. Regression models and life table. J R Stat Soc 1972; 34: 187220. Hastings RP. Supplementary library users guide. Cary, NC, USA, SAS Institute, 1986; 437466. Mountain CF. Revisions in the International System for staging lung cancer. Chest 1997; 111: 17101717. Soorae AS, Abbey-Smith R. Tumor size as a prognostic factor after resection of lung carcinoma. Thorax 1977; 32: 1925. Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding some deficiencies in the new international staging system for non-small cell lung cancer. Jpn J Clin Oncol 1991; 21: 160168. Strauss GM. Prognostic markers in resectable non-small cell lung cancer. Hemat Oncol Clin North Am 1997; 11: 409434. Mountain CF, Carr DT, Anderson WAD. A system for the clinical staging of lung cancer. Am J Roentg Rad Ther Nucl Med 1974; 120: 130138. Sandler HM, Curran WJ, Turrisi III AT. The influence of tumor size and pre-treatment staging on outcome following radiation therapy alone for stage I non-small cell lung cancer. Int J Radiat Oncol Biol Phys 1990; 19: 913. Pastorino U, Valente M, Bedini U, et al. Effect of chronic cardiopulmonary disease on survival after resection for stage Ia lung cancer. Thorax 1982; 37: 680683. Mazur DJ, Hickam DH. Five-year survival curves: How much data are enough for patient-physiciandecision making in general surgery? Eur J Surg 1996; 162: 101104.

APLICACIN DE LAS MATRICES DE TEJIDO (TISSUE MICROARRAYS) AL ESTUDIO DE LOS CARCINOMAS DE PULMN NO MICROCTICOS
Fernando Lpez-Ros Hospital Universitario 12 de Octubre Madrid

Contenido: Resumen de la ponencia Bibliografa

Aplicacin de las matrices de tejido (tissue microarrays) al estudio de los carcinomas de pulmn no microcticos
Fernando Lpez-Ros
Departamento de Anatoma Patolgica Hospital Universitario 12 de Octubre, Madrid

Introduccin A pesar del extendido concepto de que los carcinomas pulmonares son relativamente homogneos desde el punto de vista histolgico, la realidad es bien distinta. En la recientemente publicada clasificacin de tumores pulmonares de la Organizacin Mundial de la Salud se llega a considerar que hasta el 50% de estos tumores presentan varios tipos histolgicos, lo que evidentemente dificulta su diagnstico anatomopatolgico y, por extensin, su estudio clnico y biolgico. Por tanto, la divisin histolgica se basa en muchas ocasiones en porcentajes, presencia de un determinado rasgo microscpico, etc., hechos que no reflejan de forma precisa las caractersticas clnico-biolgicas del tumor. Como ejemplos de esta relativa imprecisin me gustara referirme a los siguientes: Falta de consenso en los criterios del adenocarcinoma bronquioloalveolar. Llamativa heterogeneidad histolgica en los carcinomas epidermoides, no siendo infrecuentes los carcinomas epidermoides tpicos que presentan reas de enorme atipia y pleomorfismo. Utilizacin excesiva del diagnstico genrico de carcinoma de pulmn de clulas grandes, al ser ste un diagnstico de exclusin. Por todo lo anteriormente descrito no sorprende demasiado que el carcinoma de pulmn sea, comparndolo con otras neoplasias y considerando su elevada frecuencia y mortalidad (ms de 1 milln de muertes anuales, supervivencia a los 5 aos de un 10%), relativamente desconocido desde el punto de vista anatomopatolgico y biolgico. Las matrices de tejido (tissue microarrays)(1-7) La idea de estudiar muchos tejidos simultneamente en una sola seccin no es nueva y data de los aos 80. Sin embargo, la tcnica de las matrices de tejido (tissue microarrays), descrita con detalle en 1998, permite estudiar y localizar de manera rpida y precisa muchos cilindros de tejido en una sola seccin histolgica. El primer paso en la construccin de una matriz de tejido es seleccionar las reas de inters en los sucesivos bloques de parafina (bloques donantes). De las zonas marcadas se obtendrn cilindros de tejido (mediante un aparato de precisin previsto de sondas metlicas), que se insertarn ordenadamente en forma de matriz en un bloque vaco de parafina (bloque receptor). Como es evidente el paso previo a la insercin consiste en la realizacin de un agujero en el bloque receptor, que permitir albergar el cilindro procedente del bloque donante. Las sondas utilizadas para estas operaciones son de dimetros variables, aunque posiblemente las ms usadas sean de 0,6 mm. Una vez finalizada la matriz, el bloque de parafina puede ser utilizado con mltiples fines, principalmente estudios inmunohistoqumicos, produciendo al menos 100 secciones. Es todava objeto de cierto debate qu se puede considerar representativo de una seccin completa (nmero de cilindros del mismo caso y su
Aplicacin de las matrices de tejido (tissue microarrays) al estudio de los carcinomas de pulmn no microcticos 131

dimetro). La heterogeneidad intratumoral no parece ser un obstculo para el uso de matrices de tejido; como regla general cada tumor debe ser includo al menos en duplicado, y es fundamental una seleccin muy cuidadosa de las reas que van a ser muestreadas. Probablemente la mayor utilidad actual de las matrices de tejido es su uso en la validacin de la informacin generada mediante el estudio de los perfiles de expresin gnica, demostrando en la mayora de las ocasiones que los niveles elevados de mRNA se correlacionan con niveles elevados de protena, estudiada mediante inmunohistoqumica. El que esta validacin, que idealmente debe de ser realizada en una serie independiente de casos, pueda ser realizada mediante una tcnica muy estandarizada y difundida como es la inmunohistoqumica, est permitiendo explorar de forma ms rpida y reproducible las hiptesis generadas mediante el estudio de los perfiles de expresin gnica. Utilizacin de las matrices tisulares para el estudio del carcinoma de pulmn no microctico Validacin conjunta de marcadores publicados previamente de forma individual. Esta es la aplicacin ms inmediata de las matrices de tejido. Por un lado, podemos en una sola seccin estudiar tumores de muy diferente histologa; por otro, se pueden analizar de forma conjunta docenas de protenas. En este sentido, son interesantes los trabajos recientes de Au et al.(8) y de Ullmann et al.(9) en donde analizan mltiples protenas usando matrices de tejido, que contenan ms de 100 carcinomas de pulmn no microcticos. Validacin de la informacin obtenida mediante el uso de matrices de DNA. Yang et al.(10) y Meyerson et al.(11) revisan recientemente los estudios de perfiles de expresin gnica en cncer de pulmn. La informacin de algunos de ellos es pblica y gratuita. Los genes identificados pueden eventualmente ser validados mediante matrices de tejido, si sto no ha sido ya realizado. Cualquiera que sea el abordaje que utilicemos para seleccionar los genes de inters (y sus correspondientes protenas y anticuerpos de inmunohistoqumica), stas seran algunas de las principales aplicaciones(12-23): Correlacin con los datos clnicos (principalmente con la supervivencia global) con el fin de identificar marcadores con valor pronstico. Diagnstico diferencial entre subtipos histolgicos o identificacin de nuevas categoras dentro de los mismos. Diagnstico diferencial con otras neoplasias. Diagnstico diferencial entre la neoplasia y su correspondiente parnquima no tumoral. Correlacin con datos moleculares o citogenticos.

132

Cncer de pulmn

Bibliografa 1. Kononen J, Bubendorf L, Kallioniemi A, Brlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ, Sauter G, Kallioniemi OP. Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med 1998, 4 (7): 844-847. Descripcin por vez primera de una matriz de tejido. http://www.beecherinstruments.com La compaa ms prestigiosa que produce matrices de tejido proporciona informacin til de esta tcnica. http://www.tissuearray.org/ Ejemplo de un laboratorio de referencia de matrices de tejido, en este caso el de la Universidad de Yale. Liu CL, Prapong W, Natkunam Y, Alizadeh A, Montgomery K, Gilks CB, van de Rijn M. Software tools for high-throughput analysis and archiving of immunohistochemistry staining data obtained with tissue microarrays. Am J Pathol 2002, 161: 1557-1565. Van de Rijn M, Gilks CB. Applications of microarrays to histopathology. Review. Histopathology 2004, 44: 97-108. Lakhani SR, Ashworth A. Microarray and histopathological analysis of tumours: the future and the past? Nat Rev Cancer 2001, 1: 151-157. Packeisen J, Korsching E, Herbst H, Boecker W, Buerger H. DemystifiedTissue microarray technology. J Clin Pathol: Mol Pathol 2003; 56: 198-204. Tres artculos generales sobre la tcnica de las matrices de tejido; el primero de ellos tiene una orientacin muy anatomopatolgica y explica muy bien las matrices de cDNA y su relacin con las matrices de tejido. Au NHC, Cheang M, Huntsman DG, Yorida E, Coldman A, Elliott WM, Bebb G, Flint J, English J, Gilks CB, Grimes HL. Evaluation of immunohistochemical markers in non-small cell lung cancer by unsupervised hierarchical clustering analysis: a tissue microarray study of 284 cases and 18 markers. J Pathol 2004; 204: 101-109. Ullmann R, Morbini P, Halbwedl I, et al. Protein expression profiles in adenocarcinomas and squamous cell carcinomas of the lung generated using tissue microarrays. J Pathol 2004; 203: 798807. Dos grandes series de carcinomas de pulmn no microcticos estudiados mediante matrices de tejido. Yang P, Sun Z, Aubry MC, Kosari F, Bamlet W, Endo C, Molina JR, Vasmatzis G. Study design considerations in clinical outcome research of lung cancer using microarray analysis. Lung cancer 2004, 46: 215-226. Meyerson M, Franklin WA, Kelley MJ. Molecular classification and molecular genetics of human lung cancers. Sem Oncol 2004; 31 : 4-19. Resumenes tiles de los principales estudios de los perfiles de expresin gnica en cncer de pulmn. Sugita M, Geraci M, Gao B, et al. Combined use of oligonucleotide and tissue microarrays identifies cancer/testis antigens as biomarkers in lung carcinoma. Cancer Res 2002, 62: 3971-3979. Wikman H, Kettunen E, Seppnen JK, et al. Identification of differentially expressed genes in pulmonary adenocarcinoma by using cDNA array. Oncogene 2002; 21: 5804-5813.
133

2.

3.

4.

5. 6. 7.

8.

9.

10.

11.

12. 13.

Aplicacin de las matrices de tejido (tissue microarrays) al estudio de los carcinomas de pulmn no microcticos

14.

Parmigiani G, Garrett-Mayer ES, Anbazhagan R, Gabrielson E. A cross-study comparison of gene expression studies for the molecular classification of lung cancer. Clin Cancer Res 2004; 10: 29222927. Giordano TJ, Shedden KA, Schwartz DR, et al. Organ-specific molecular classification of primary lung, colon and ovarian adenocarcinomas using gene expression profiles. Am J Pathol 2001;159: 1231-1238. Bhattacharjee A, Richards WG, Staunton J, et al. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci 2001; 98: 13790-13795. Beer DG, Kardia SLR, Huang CC, et al. Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat Med 2002; 8: 816-824. Wigle DA, Jurisica I, Radulovich N, et al. Molecular profiling on non-small cell lung cancer and correlation with disease-free survival. Cancer Res 2002; 62: 3005-3008. Garber ME, Troyanskaya OG, Schluens K, et al. Diversity of gene expression in adenocarcinoma of the lung. Proc Natl Acad Sci 2001; 98: 13784-13789. Jones MH, Virtanen C, Honjoh D, et al. Two prognostically significant subtypes of high-grade lung neuroendocrine tumours independent of small-cell and large-cell neuroendocrine carcinomas identified by gene expression profiles. Lancet 2004; 363: 775-781. Kikuchi T, Daigo Y, Katagiri T, et al. Expression profiles of non-small cell lung cancers on cDNA microarrays: Identification of genes for prediction of lymph-node metastasis and sensitivity to anticancer drugs. Oncogene 2003; 22: 2192-2205. Borczuk AC, Gorenstein L, Walter KL, et al. Non-small-cell lung cancer molecular signatures recapitulate lung developmental pathways. Am J Pathol 2003; 163: 1949-1960. Wikman H, Seppnen JK, Sarhadi VK, et al. Caveolins as tumour markers in lung cancer detected by combined use of cDNA and tissue microarrays. J Pathol 2004; 203: 584-593. Principales estudios de los perfiles de expresin gnica en carcinoma de pulmn.

15.

16.

17. 18. 19. 20.

21.

22. 23.

134

Cncer de pulmn

METILACIN Y CNCER DE PULMN

Manel Esteller Centro Nacional de Investigaciones Oncolgicas (CNIO) Madrid

Contenido: Ponencia en power point

Metilacin y cncer de pulmn

137

138

Cncer de pulmn

Metilacin y cncer de pulmn

139

140

Cncer de pulmn

Metilacin y cncer de pulmn

141

142

Cncer de pulmn

Metilacin y cncer de pulmn

143

144

Cncer de pulmn

Metilacin y cncer de pulmn

145

146

Cncer de pulmn

Metilacin y cncer de pulmn

147

148

Cncer de pulmn

Metilacin y cncer de pulmn

149

150

Cncer de pulmn

Metilacin y cncer de pulmn

151

152

Cncer de pulmn

Metilacin y cncer de pulmn

153

Sesin III PERSPECTIVAS DE LAS NUEVAS TERAPIAS EN CNCER DE PULMN Moderadora: Montserrat Snchez-Cspedes

DIANAS MOLECULARES Y NUEVAS TERAPIAS

Rafael Rosell Institut Catal dOncologia Hospital Germans Trias i Pujol Barcelona

Contenido: Resumen de la ponencia Artculos del ponente

Molecular Targets and Novel Therapies

Rafael Rosell
Servicio de oncologa mdica Institut Catal dOncologia Hospital Germans Trias i Pujol, Barcelona

tandard cancer management consists in the empirical approach of randomized trials without taking into consideration the predicting role of multiple genetic cancer abnormalities, including gene mutations, overexpression of anti-apoptotic genes, mutations in pro-apoptotic genes, loss of transcription by promoter gene hypermethylation. We will focus on our recent findings and the clinical implications of EGFR tyrosine kinase mutations in lung cancer and the pattern of serum DNA methylation in the promoter of the 14-3-3s gene. Recently, it has been discovered that mutations on the EGFR tyrosine kinase domain confer enhanced response to EGFR drug inhibitors, but increased resistance to chemotherapy. The potential relevance of EGFR mutations to NSCLC treatment has recently been identified. In the present study, laser capture microdissection was performed for the accurate procurement of tumor cells. EGFR exons 18, 19 and 21 and flanking intron sequences were amplified from genomic DNA by means of PCR, and the samples were then subjected to bidirectional automatic sequencing. So far, 34 gefitinib-treated patients have been screened, 18 from Japan and 16 from Spain, in addition to 1 cetuximab-treated Spanish patient and 1 untreated patient. Most of the female patients and non-smokers were Japanese, while there were more males and more smokers among the Spanish patients. The median number of prior chemotherapy regimens was 3 in the Spanish and 2 in the Japanese group (P = 0.02). EGFR mutations were observed in 12.5% of the Spanish patients and in 41% of the Japanese patients (P = 0.17). 7/9 Japanese gefitinib responders harbored EGFR mutations: 3 missense mutations at exon 18, and 4 in-frame deletions removing amino acids 746 through 750 (ELREA), one of which was a heterozygous in-frame deletion (747-751) and insertion of phenylalaline residue. The only Spanish gefitinib responder also harbored a heterozygous in-frame deletion (746-751) and insertion of alanine residue. Some of the other mutations were homozygous. Although no mutations were found in non-responders, one was found in a Spanish patient with stable disease who had two primary lung cancers. The mutation was found in the resected specimen of lung adenocarcinoma but not in the second relapsing primary squamous cell carcinoma. Missense mutations were also found in the untreated patient and in the cetuximab-treated responder (L861R). In Japanese patients, mutations were more frequently observed in patients < 60 years (P = 0.05) and in non-smokers (P = 0.05). Median survival for Japanese patients with EGFR mutations was 15.6 months from the start of gefitinib treatment, while for the remaining Japanese patients with wild-type EGFR, it was 2.3 months (P = 0.04). Sequencing analysis is being performed in additional Spanish, German and Chinese gefitinib-treated patients and in the gefitinibsensitive human NSCLC cell line PC9. Since median survival of Spanish patients with stable disease was 14 months, other genetic alterations are being examined in these patients. EGFR mutations are present more frequently in Japanese, non-smokers, and patients < 60 years, and can be used as a predictive marker for EGFR inhibition. In the meaningful number of non-Japanese patients with stable disease, other markers may predict the relatively good response to EGFR inhibition. Final data will be presented. Survival in advanced non-small-cell lung cancer patients treated with platinum-based doublets is rather variable. Methylation-dependent transcriptional silencing of 14-3-3s, a major G2/M checkpoint

Dianas moleculares y nuevas terapias

159

control gene, detected in patient pre-treatment sera, could predict better survival. A sensitive methylationspecific polymerase chain reaction assay was used to evaluate 14-3-3s methylation status in pre-treatment serum DNA obtained from 115 cisplatin-plus-gemcitabine-treated non-small-cell lung cancer patients. 14-3-3s methylation was observed in all histologic types in 39 patients (34%). After a median followup of 9.8 months, median survival was significantly greater in the methylation-positive group (15.1 versus 9.8 months; P = 0.004 by the log-rank test). Median survival for 22 methylation-positive responders has not been reached, while it was 11.3 months for 29 methylation-negative responders (P = 0.001). The risk of death for methylation-negative responders was almost five times greater than that of methylationpositive responders (P = 0.001). Methylation of 14-3-3s can be detected in the pre-treatment sera of non-small-cell lung cancer patients, obviating the need for tumor tissue and offering a novel method to predict survival after treatment with platinum-based doublets.

160

Cncer de pulmn

Overexpression of ERCC1 may play a role in cisplatin resistance in nonsmall-cell lung cancer.

Gary Ernest Smith. Old Road, New Road. Oil on canvas, 40 60. Courtesy of Raymond E. Johnson's Overland Gallery of Fine Art, Scottsdale, Arizona.

Nucleotide Excision Repair Pathways Involved in Cisplatin Resistance in NonSmall-Cell Lung Cancer
Rafael Rosell, MD, Miquel Taron, PhD, Agusti Barnadas, MD, Giorgio Scagliotti, MD, Carme Sarries, PhD, and Barbara Roig, PhD
Background: In spite of the growing list of genetic abnormalities identified as being involved in DNA repair pathways that alter chemosensitivity in nonsmall-cell lung cancer (NSCLC) patients, translational assays have not yet been developed for use in individualized chemotherapy. Methods: In metastatic NSCLC, no single cisplatin-based chemotherapy regimen has been shown to be superior to any other. Although these studies show a small survival tail at 3 years, the majority of patients had a median survival of 8 to 10 months. We review the principal mechanisms of cisplatin resistance, particularly those involved in the nucleotide excision repair (NER) pathways (transcription-coupled repair and global genomic repair). Results: ERCC1 is a single-stranded DNA endonuclease that forms a tight heterodimer with xeroderma pigmentosum complementation group F. It incises DNA on the 5 side of a lesion such as cisplatin-DNA adduct. Therefore, overexpression of ERCC1 and other NER enzymes during ovarian cancer chemotherapy with cisplatin appears to be implicated in the formation of cellular and clinical drug resistance. Recently, baseline ERCC1 mRNA overexpression has been related to poor response and survival in cisplatin-treated NSCLC patients. Conclusions: The level of evidence for many assays is limited, and only ERCC1 mRNA levels have been analyzed extensively. The impact of ERCC1 should be fully validated in prospective clinical trials.

From the Medical Oncology Service, Hospital Germans Trias i Pujol, Badalona (Barcelona), Spain (RR, MT, AB, CS, BR), and the Thoracic Oncology Unit, Department of Clinical and Biological Sciences, University of Torino, Torino, Italy (GS). Submitted August 5, 2002; accepted September 30, 2002. Address reprint requests to Rafael Rosell, MD, Medical Oncology
July/August 2003, Vol. 10, No.4

Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916 Badalona (Barcelona), Spain. E-mail: rrosell@ns.hugtip.scs.es Dr. Scagliotti receives honoraria from Eli Lilly and Co, Aventis Pharmaceuticals Inc, and AstraZeneca Pharmaceuticals LP. The other authors report no significant relationship with the companies/organizations whose products or services are referenced in this article.
Cancer Control 297

Introduction
Cisplatin has long been the foundation of chemotherapy in lung cancer, and the role of noncisplatin combinations has not yet been fully demonstrated. Cisplatin is the platinum agent of choice in the treatment of germ-cell tumors. On the other hand, oxaliplatin is effective in colorectal cancer, unlike cisplatin, and shows higher activity in vitro in cancer cell lines with an impaired DNA mismatch repair (MMR) system.1 The mechanisms of resistance to cisplatin have recently been reviewed in depth, illustrating how multiple proteins and several pathways intervene in this resistance.1 Although cisplatin or carboplatin are the essential partners in combination chemotherapy in nonsmallcell lung cancer (NSCLC), there are still many paradoxical findings. In a European study, more than 400 patients with stage IIIB (30%) or IV (70%) NSCLC were randomized to receive cisplatin 100 mg/m2 or a combination of paclitaxel 175 mg/m2 by 3-hour infusion plus cisplatin 80 mg/m2 every 3 weeks. Although differences in response were observed in favor of the combination, there were no differences in median survival (8.6 months in the cisplatin arm and 8.1 months in the combination arm).2 These results are open to various explanations, ranging from the low paclitaxel dose to the differences in the cisplatin dose between the two arms. Similarly, the Cancer and Leukemia Group B (CALGB) has reported its trial of paclitaxel 250 mg/m2 by 3-hour infusion plus carboplatin at a dose based on the area under the concentration-time curve (AUC) of 6 compared with paclitaxel alone at the same dose. The same phenomena were observed: significant differences in response and median survival3 in favor of the combination regimen but similar 1-year survival in the two arms.4

In the landmark four-arm Eastern Cooperative Oncology Group (ECOG) trial in advanced NSCLC, all four platinum-based combination chemotherapy regimens attained the same pattern of response, median survival, and 1- and 2-year survival rates. In the control arm (cisplatin 75 mg/m2 plus paclitaxel 135 mg/m2 by 24-hour infusion), the response rate was 21%, median survival was 7.8 months, 1-year survival was 31%, and 2year survival was 10%. Similar results were observed in patients treated with cisplatin plus gemcitabine, cisplatin plus docetaxel, and carboplatin plus paclitaxel5 (Table 1). In the three-arm Italian Lung Cancer Project trial, patients were randomized to receive gemcitabine plus cisplatin or paclitaxel plus carboplatin or vinorelbine plus cisplatin. Again, no differences in response rate (30%), time to progression (4.6 months), or median survival (9.8 months) were observed.6 However, in the first trial comparing cisplatin plus paclitaxel vs carboplatin plus paclitaxel, differences in time to progression (4.2 vs 3 months; P=.03) and median survival (9.8 vs 8.2 months; P=.01) were observed in favor of the cisplatin arm7 (Table 1). These results can be interpreted as a reflection of the failure of chemotherapy in advanced NSCLC, which seems unable to progress beyond the frontier of 8month median survival. However, the ECOG trial5 has ushered in a new era in cancer management that will include not only the concepts of new therapeutic targets, chemoprevention, and spiral computed tomography screening,8 but also the genetic bases of chemoresistance, which can pave the way for tailored chemotherapy. Cisplatin damages DNA, inducing the formation of chemically stable DNA adducts. The absence of measurable cisplatin DNA adducts, determined by enzyme-linked immunosorbent assay (ELISA),

Table 1. Outcomes in Selected NonSmall-Cell Lung Cancer Trials Response Rate Schiller et al5 Pac/cis Gem/cis Docetaxel/cis Pac/carbo Scagliotti et al6 Vrb/cis Gem/cis Pac/carbo Pac/cis = paclitaxel/cisplatin Gem/cis = gemcitabine/cisplatin Pac/carbo = paclitaxel/carboplatin Vrb/cis = vinorelbine/cisplatin * Significant difference in time to progression between the paclitaxel/cisplatin control arm and the gemcitabine/cisplatin arm (P=.001). Survival Median (mos) 7.8 8.1 7.4 8.1 9.5 9.8 10.0 Median Time to Progression (mos) 3.4* 4.2* 3.7 3.1 4.6 5.3 5.5

1 Year 31% 36% 31% 34% 37% 37% 43%

21% 22% 17% 17% 30% 30% 32%

298 Cancer Control

July/August 2003, Vol. 10, No.4

is associated with poor outcome. In one study, multiple tissues, including ovarian tumor, were obtained at autopsy from 8 patients who had received either cisplatin or carboplatin chemotherapy. Cisplatin DNA adducts were detected in most of the tissues examined, and DNA adduct levels were similar in the majority of tissues from the same subject, whether taken from the bone marrow, liver, brain, or peripheral nerve.9 The assessment of DNA adduct levels could become one predictive assay for cisplatin and/or radiotherapy. Schaake-Koning et al10 observed an improvement in survival in patients with locally advanced NSCLC who were treated with daily radiotherapy plus daily cisplatin 6 mg/m2 approximately 1 hour before irradiation (20 administrations for a total of 120 mg/m2), compared with radiotherapy alone. Three-year survival was 16% for concomitant cisplatinradiotherapy vs 2% for radiotherapy alone. Differences in survival according to cisplatin DNA adduct levels have been observed in patients treated with concomitant cisplatin and radiotherapy. Dutch investigators studied 27 patients treated with daily cisplatin and radiotherapy.11 To assess cisplatin DNA adduct levels, buccal cells were collected by wiping the inner cheek with a cotton swab before cisplatin treatment and 1 hour after the fifth course of cisplatin. The immunohistochemical method used for cytospins enabled cisplatin DNA adducts to be visualized in nuclei of the buccal cells. Nuclear signal intensity (arbitrary units) ranged from 0.4 to 2.8. Striking differences in survival were observed according to DNA adduct levels. Thirteen patients with low DNA adduct levels (1.16) had a median survival of 5.2 months compared to 14 patients with high levels (>1.16), who had a median survival of 30.2 months (P<.0001). If these data are validated in a large-scale study, cisplatin DNA adduct levels could be used to identify the nearly 50% of patients who could obtain the greatest benefit from a concomitant cisplatin-radiotherapy approach and enable us to look for a different therapy for the 50% who would not benefit from such an approach. Several molecular assays can be used to tailor chemotherapy in the care of lung cancer patients. Accumulated evidence indicates that several genetic markers are related to cisplatin resistance, and current research is providing hints that predictive markers may also affect resistance to gemcitabine and/or microtubule-interacting drugs.

the DNA. A growing number of reports identify DNA damage with the regulation of DNA repair gene transcription and the control of cell cycle progression and apoptosis via DNA damage checkpoints. Different pathways of DNA repair are polymorphic and vary interindividually and with age. These features influence the chemosensitivity of tumor cells toward DNA-reactive cytotoxic drugs. DNA repair is a counteragent in carcinogenesis and an accomplice in cancer therapy resistance.12 There are several major DNA repair pathways. Excision repair, including nucleotide excision repair (NER), has been strongly linked to cisplatin resistance. Base excision repair (BER) also plays an important role in chemotherapy resistance. The mRNA levels of the excision repair cross-complementing (ERCC1) gene, involved in the NER pathway, have recently been found to be closely correlated with levels of 8-oxoguanine DNA glycosylase (OGG1), involved in the BER pathway. The repair of double-strand breaks, induced by cytotoxic agents, radiotherapy, and reactive oxygen species, is carried out by homologous recombination and nonhomologous DNA end joining. Other pathways are MMR and onestep repair (OSR), meaning the direct reversal of DNA damage. The repair protein O6-alkylguanine-DNA alkyltransferase, also known as O6-methylguanine-DNA methyltransferase (MGMT), intervenes in OSR through removal of an alkyl group from the O6-atom of guanine in the DNA of cells exposed to alkylating agents. With increasing size of the alkyl group, the relative contribution of MGMT to the repair of O6-alkylguanines in DNA decreases and excision repair becomes more relevant.12 As an example of OSR, treatment with chloroethylnitrosourea (BCNU) correlates with MGMT activity; in the process of cytotoxic interstrand cross-links in target cell DNA, BCNU initially alkylates the O6-atom of guanine. Intriguingly, MGMT levels vary greatly among tumors, which has been used in pharmacogenomic interpretation. Hypermethylation of MGMT (abrogating OSR) was observed in 40% of brain tumors treated with BCNU and was related to significantly better survival.13 Interestingly, the activity of temozolomide has been linked to tumor MGMT. However, when temozolomide was combined with CPT-11, this mechanism of resistance was circumvented in tumor cells that were either MGMT proficient or MMR deficient.14 The possibility of individualizing DNA repair profiles is becoming a central issue in the search for improved chemotherapy results. Current bioinformatics tools for microarray data have correlated gene expression profiles in cell lines with response to chemotherapy, leading to the identification of genes that may be important for drug sensitivities. However, profiling with microarray requires relatively large
Cancer Control 299

DNA Repair
Cell repair capacity is stored in the linear sequence of approximately 3 109 copies of the four bases guanine, cytosine, adenine and thymine aligned in
July/August 2003, Vol. 10, No.4

quantities of RNA, making the process inappropriate for certain applications. Cancer cells accumulate multiple genetic abnormalities in signal transduction pathways during carcinogenesis and cancer progression. NER deficiencies are related to lung oncogenesis yet simultaneously confer a chemotherapy advantage. Like many DNA alkylators, cisplatin acts as a cross-linker, inhibiting DNA replication, which is the critical target in cancer chemotherapy. Cross-links between guanine bases are induced by cisplatin, carboplatin, and oxaliplatin. Cisplatin and carboplatin form an identical cross-link, while the oxaliplatin cross-link is structurally different due to the bulky 1,2-diaminocyclohexane group in the adduct.15 The mechanisms of DNA repair have been investigated in depth, primarily the nuclear DNA repair pathways involving BER, recombination, MMR, NER, and OSR. Mitochondrial DNA repair pathways can also play an important role and are reviewed elsewhere.16 In this review, we focus primarily on the NER pathway.

In an experimental model, elevated DRC was associated with resistance to cisplatin in lung cancer cell lines.19 In this case, the overall DRC was estimated based on the ability of cells to reactivate the pRSV-CAT (chloramphenicol acetyltransferase) plasmid damaged by cisplatin. The pRSV-CAT plasmid contains the bacterial gene for CAT under the control of the RSV longterminal repeat promoter. Platination of the pRSV-CAT plasmid will diminish or abolish CAT gene expression as a consequence of DNA damage after transfection into cells. Repair of these lesions will restore CAT gene expression and provide information about the overall repair capacity of a given cell population. NSCLC cells were found to be significantly more resistant to cisplatin than small-cell cancer cell lines isolated from untreated patients.19 The epidemiology of DRC and its effect on cancer susceptibility has been fully developed. In 1998, 64 reports addressed the association of cancer susceptibility with defects in DRC.20 Several assays of DRC have been used. With the host-cell reactivation assay,DRC has been measured in peripheral blood lymphocytes with the host-cell reactivation assay and calculated as the percentage of residual CAT gene expression after the repair of ultraviolet radiation- or cisplatin-damaged plasmid DNA divided by that in undamaged plasmid DNA. The host-cell reactivation assay measuring the activity of the CAT gene has been used in cells transfected with BPDEtreated plasmid. Because a single unrepaired DNA adduct can effectively block CAT transcription, any CAT activity will reflect the ability of the transfected cells to remove BPDE-induced adducts from the plasmids. The most susceptible subgroup of cigarette smokers on the basis of their low DRC were case patients who were young (<60 years if age), female, or light smokers, or who reported a family history of cancer. In contrast, in a study comparing 316 newly diagnosed lung cancer patients and 316 cancer-free control subjects, heavy smokers among both case patients and control subjects tended to have more proficient DRC than lighter smokers, suggesting that cigarette smoking may stimulate DRC in response to the DNA damage caused by tobacco carcinogens.20 Similarly, women smokers with the GSTM1 null genotype, which results in diminished glutathione S-transferase (GST) activity, had the greatest lung cancer risk compared with other groups of women and men with different GSTM1 genotypes. The absence of detoxifying GST activity may result in an excess of internal exposure to tobacco carcinogens, leading to a higher level of DNA damage or adduct formation.21 In short, defective DRC is one of the major factors responsible for carcinogenesis, and at the same time, it can confer a favorable cytotoxic effect. Preliminary hints as to the therapeutic benefit of deficient DRC
July/August 2003, Vol. 10, No.4

DNA Repair Capacity, Lung Cancer Risk, and Chemoresistance

Many cancer chemotherapeutic agents, including cisplatin, cause interstrand cross-links, which accounts for their therapeutic cytotoxic properties. Similarly, many carcinogens are bifunctional, causing both monoadducts and intrastrand or interstrand cross-links in DNA. DNA repair capacity (DRC) is genetically determined; it modulates lung cancer susceptibility and treatment response.17 Carcinogeninduced DNA damage induces breaks in the sugarphosphate DNA backbone, either in one or both of the two strands of the double helix. Covalent binding of the carcinogen results in the formation of a chemically altered base in DNA that is called an adduct. A nucleotide adduct is a fragment consisting of carcinogen-base-deoxyribose-phosphate, a nucleoside adduct consists of carcinogen-base-deoxyribose, and a base adduct is the carcinogen-modified base only. DRC has been assessed in peripheral blood lymphocytes by the host-cell reactivation assay, which measured cellular reactivation of a reporter gene damaged by exposure to 75 m benzo[a]pyrene diol epoxide (BPDE).18 With this functional assay, the mean level of DRC was significantly lower in patients with lung cancer than in controls. Younger cases (<65 years of age) and smokers were more likely than controls to have reduced DRC.18 BPDE-induced DNA adducts are repaired by the NER pathway, in which ERCC1 plays a pivotal role, raising the hypothesis that lung cancer patients with lower ERCC1 levels and thus lower DRC may have enhanced response and survival with cisplatin-based chemotherapy.
300 Cancer Control

stem from molecular epidemiology studies assessing the DRC by the host-cell reactivation assay in lymphocytes, which measures the NER capacity.22 As stated above, one determinant of the level of cisplatin DNA adducts in host tissues (cancer patients) treated with cisplatin-based chemotherapy is the rate of DNA repair. Subjects vary considerably in their capacity to remove DNA adducts.18 It is thought that NER is the primary mechanism for repairing cisplatin DNA adducts. The relationship between DRC and survival in patients with NSCLC treated with cisplatin-based chemotherapy was recently examined.22 In this study, patients who had received chemotherapy were divided into quartiles according to their DRC. Patients in the top quartile (DRC >9.2%) had a risk of death that was more than two times the risk of death for patients in the bottom quartile (DRC <5.8%; P=.01). Median survival was 8.9 months for patients in the top quartile compared with 15.8 months for those in the bottom quartile (P=.04). Intriguingly, among the 36 chemonaive patients who underwent curative surgical resection, there was a slight survival advantage associated with increased DRC. This finding could be relevant when interpreting the results of neoadjuvant chemotherapy trials in early NSCLC. The assessment of DRC, either by measuring cisplatin DNA adducts, the host-cell reactivation assay, or the overexpression of ERCC1 gene transcript, is warranted in such trials to identify the subgroup of patients with low DRC, who could have lower survival when treated with surgery alone and at the same time could benefit from neoadjuvant or adjuvant chemotherapy. In contrast, patients with high DRC could have better survival when treated with surgery alone and could be refractory to neoadjuvant or adjuvant approaches.

NER Capacity and Cisplatin Effect

It is a common belief that cisplatin exerts its cytotoxic effect by disrupting the DNA macromolecule, mainly through the formation of intrastrand adducts and interstrand cross-links that are repaired through the NER pathway. It is also postulated that tumors that are defective in MMR become more resistant to cisplatin than their MMR-proficient counterparts. The NER pathway consists of several steps: damage recognition, dual incision/excision, repair synthesis, and ligation. Approximately 30 proteins participate in this repair process; above all, ERCC1 has a crucial role in the incision process, which is the rate-limiting step of the pathway. ERCC1 is a 15-kb repair gene located on human chromosome 19. ERCC1 forms a heterodimer with XPF, and the ERCC1/XPF complex is responsible for the incision to cleave the damaged strand at the phosphodiester bonds between 22 and 24 nucleotides 5 to the lesion.
July/August 2003, Vol. 10, No.4

Functional ERCC1 is important in the repair of cisplatin DNA adducts and in cisplatin sensitivity in intact cells.23 ERCC1 mRNA levels, measured by quantitative polymerase chain reaction (PCR), were examined in gastric cancer patients treated with cisplatin/fluorouracil (FU). Before chemotherapy, cDNA was obtained from primary gastric tumors, and ERCC1 mRNA levels were expressed as the ratio of the PCR product of the ERCC1 gene and the -actin housekeeping gene. The median ERCC1 mRNA level for the 17 responders was 4.9, while the median ERCC1 mRNA level for the 16 resistant patients was 8. The difference between responders and nonresponders was statistically significant.23 The median survival for patients with ERCC1 mRNA levels <5.8 was not reached at the time the report was published, while the median survival for those with levels >5.8 was only 5.4 months. The difference was highly significant, disclosing for the first time that intratumoral levels of ERCC1 mRNA influence the outcome of gastric cancer patients treated with cisplatin/FU.23 This study gave no conclusive results on whether ERCC1 mRNA levels could be an independent predictive marker for cisplatin benefit. Originally, ERCC1 mRNA levels were assessed in ovarian cancer tissue harvested from 28 patients before treatment with carboplatin- or cisplatin-based chemotherapy. RT-PCRbased assay was used to determine the level of expression of ERCC1 and -actin, as well as human xeroderma pigmentosum group A correcting (XPAC) gene. Numerical values for the expression of the ERCC1 and XPAC genes in the ovarian tumor tissue samples were obtained using the densitometric readout of the autoradiographic signal generated by the 32 P-labeled ERCC1 or XPAC probe divided by the densitometric reading for -actin. In this case, the numerical values were different from those reported in the literature using quantitative PCR. Thirteen nonresponders showed greater levels of ERCC1 mRNA than 15 responders.24 The cisplatin effect on ERCC1 mRNA expression has been examined in vitro. In response to a 1-hour cisplatin exposure, human ovarian cancer cells showed a two- to six-fold increase in steady-state levels of ERCC1 mRNA over basal expression levels.25,26 A positive association has also been demonstrated between the level of ERCC1 mRNA expression and the amount of cisplatin-DNA adduct repair in ovarian tumor cells in vitro.26 Intriguingly, ERCC1 antisense RNA abrogates the gemcitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells that were proficient in NER. Experimental results indicate that stable expression of ERCC1 antisense mRNA downregulates the level of mRNA and repair activity. The downregulaCancer Control 301

tion of the repair activity significantly correlates with the reduction of the cytotoxic synergism between gemcitabine and cisplatin.27 Along the same lines, ERCC1 mRNA levels have been correlated with oxaliplatin resistance in colorectal cancer patients. Median survival for patients with ERCC1 expression <4.9 was 10 months, while for patients with ERCC1 expression >4.9, it was 1.9 months.28 These findings indicate that intratumoral ERCC1 mRNA may be an independent predictive marker for oxaliplatin combination chemotherapy. Both this study and the original study in gastric cancer23 were conducted by investigators from the University of Southern California (USC)/Norris Comprehensive Cancer Center and Response Genetics. ERCC1 mRNA levels have not been correlated with noncisplatin chemotherapy response. When the correlation between the expression of eight genes involved in NER and DRC was examined, only ERCC1 and XPD mRNA levels were highly correlated both with each other and with DRC.29 ERCC1 and XPD (also known as ERCC2) are closely linked on chromosome 19q13.2-13.3. More recently, the same investigators observed a strong correlation between ERCC1 and OGG1 mRNA levels in peripheral lymphocytes. OGG1 encodes the 8-oxoguanine-DNA glycosylase, which removes 8-oxoguanine from DNA as part of the BER pathway.30 XPD polymorphism has been related to lower DRC.31 Approximately half of the population examined had the genotype Lys751Lys and also had Asp312Asp. These patients had a good DRC and therefore are presumably resistant to cisplatin. In an epidemiological study matching 341 lung cancer cases with 360 smoker control subjects, a host-cell reactivation assay measuring the activity of the CAT gene was used in cells transfected with plasmids treated with BPDE. DRC was lower in the lung cancer patients than in the controls. The variants Gln751Gln and Asn312Asn had suboptimal DRC, with a significant increase in the hazard ratio, in contrast with the wildtype genotypes both in cases and controls, which exhibited the most proficient DRC.31 The frequency of homozygous variants was 10% for either codon. In an intermediate group with heterozygous polymorphisms, the frequency was 40% at either codon. The clinical interest of these findings lies in their potential usefulness in identifying in constitutional DNA from lymphocytes the polymorphisms associated with suboptimal DRC and their potential role in identifying patients with better response to cisplatin chemotherapy. UV light, BPDE DNA adducts, and cisplatin DNA adducts are effective blocks to RNA polymerase II and thus block transcription. These DNA lesions are
302 Cancer Control

removed by NER, which is split into subpathways: transcription-coupled repair (TCR) and global genomic repair (GGR). Importantly, TCR repairs transcriptionblocking lesions in transcribed DNA strands of active genes, whereas GGR repairs the lesions in the nontranscribed strand of active genes and nontranscribing genome.32 When transcribing RNA polymerase II encounters the lesion, two TCR-specific factors, CSA and CSB, are implicated for the activation of the common NER molecular pathway.32 The clinical implications of TCR lie in the fact that cisplatin-resistant tumors show an intact TCR system, while tumors are sensitive to cisplatin when the TCR subpathway is deficient. For GGR, the xeroderma pigmentosum group C (XPC) complex is activated. Along with the basal transcription factor (TFIIH), an XPG binds to the DNA around the lesion. TFIIH contains two helicases, XPB and XPD, which open approximately a 30-base-long DNA segment around the damage. This open intermediate is stabilized by replication protein A and XPA. The DNA strand that contains the damaged base(s) is excised by the two NER endonucleases, XPG and XPF/ERCC1. XPG cleaves the damaged DNA strand 3 from the lesion, and XPF/ERCC1 cleaves the damaged strand 5 from the DNA lesion. Finally, the resulting gap is filled in by DNA polymerases in the presence of replication factors. Molecular deficiencies (in both GGR and TCR subpathways) in primary fibroblasts confer marked hypersensitivity to cisplatin compared to normal primary fibroblasts. These results demonstrate that any one deficiency in XPA, XPD, XPF, or XPG confers marked hypersensitivity to cisplatin.32

ERCC1 Expression
We have analyzed the role of ERCC1 expression in metastatic NSCLC patients treated with gemcitabine/ cisplatin. mRNA was isolated from paraffin-embedded primary tumor specimens obtained by bronchoscopy biopsy. The median ERCC1 expression in 56 patients analyzed relative to the expression of the control actin was 6.7. Patients with ERCC1 expression above 6.7 had a median survival of 5 months, while those with lower levels had a median survival of 15 months. This difference was statistically significant, and importantly, in a Cox multivariable analysis, ERCC1 levels surfaced as an independent predictive variable. The fact that the cutoff was higher than previously described indicates that a certain level of ERCC1 is required for synergism between gemcitabine and cisplatin.33 The potential role of the 5-untranslated region (5UTR) in ERCC1 mRNA expression has also been examined. RT-PCR was carried out with primers targeting the 5-UTR to amplify a fragment containing exon I
July/August 2003, Vol. 10, No.4

(UTR) and exon II (containing the initiation codon) of the ERCC1 gene in 121 ovarian cancer samples. Interestingly, two PCR amplimers from the same sample for the target segment within the UTR appeared in some samples. The prevalence of the two amplimers occurred in the group of patients with high ERCC1 mRNA levels (48%). In contrast, only 5% of patients with a single amplimer showed high ERCC1 mRNA levels. Direct DNA sequencing of the cDNA from each of the 121 ovarian cancer tumor samples confirmed that tumors with two amplimers contained two distinct sequences. The longer sequences included the complete target sequence, 261-bp (wild type), and the shorter sequences demonstrated a 42-bp deletion.34 This 42-bp deletion seems to be associated with high ERCC1 mRNA levels. Overall, ERCC1 stands out as a potential predictive marker for cisplatin-based chemotherapy and it could be the basis for customized chemotherapy.

enhanced in some cisplatin-resistant cell lines.40 Multidrug resistance protein 2 (MRP2) is also a putative cisplatin efflux pump.41 Other mechanisms involve cisplatin detoxification by glutathione/glutathione acetylS-transferases (GSH/GST). The four major GST-related genes (GSTP1, GSTT1, GSTM1, and GSTZ1) attach reduced glutathione to electrophilic groups in a wide variety of toxic compounds, including chemotherapeutic agents, and GSTP1 overexpression has been correlated with increased cisplatin resistance.42 Recently, the GSTP1 Ile105 Val polymorphism has been associated with increased survival in patients with advanced colorectal cancer receiving FU/oxaliplatin chemotherapy.43 This polymorphism has been related to substantially diminished GSTP1 enzyme activity, reducing the detoxification pathway mediated by GSTP1.44 Metallothioneins are also involved in low cisplatinadduct formation. Metallothioneins are metal binding proteins of low molecular weight; they are cysteine rich and have an important role in the homeostasis of trace metals and in the detoxification of metals such as Cd2+ and Hg2+. Metallothioneins are transcriptionally induced by these metals through metal-responsive elements located in the 5-regulatory regions of human methallothionein genes. Overexpression of methallothionein has been correlated with cisplatin-resistance, and transfection of the gene encoding for methallothionein increases cisplatin resistance.45 BRCA1 plays an important role in DNA damage repair mediated-cisplatin sensitivity.46 Increased levels of BRCA1 have been observed in cisplatin-resistant breast and ovarian carcinoma cell lines derived from MCF7 and SKOV3. Furthermore, antisense inhibition of BRCA1 in SKOV3 cisplatin-resistant cell lines resulted in increased sensitivity to cisplatin, decreased DRC, and increased apoptosis. BRCA1 and Rad5116 co-localize and interact in the S-phase of the cell cycle.47

Other Genetic Markers Conferring Cisplatin Resistance

Defects in DNA MMR may result from mutation or methylation-mediated silencing of three mismatch repair genes: hMLH-1, hMSH-2, or hPMS-2. These defects have been shown to be a mechanism of resistance to cisplatin but not to oxaliplatin both in vivo and in vitro.35 It is thought that an MMR complex recognizes cisplatin-DNA adducts but not oxaliplatin-DNA adducts, and that MMR proteins are involved in mediated response to DNA damage.35,36 This has been demonstrated in experiments using MMR-proficient and MMRdeficient cells, where different DNA repair pathways have been linked to cisplatin but not to oxaliplatin.37,38 In addition to members of the MMR family, other proteins also interact with cisplatin DNA adducts, including numerous nuclear proteins binding to cisplatin DNA adducts, such as linker histones H1, high mobility group 1 (HMG1) box-containing proteins, and many different transcription factors. HMG1 is a nonhistone chromosomal protein that appears to be involved in DNA replication and repair. HMG1 was overexpressed in three cisplatin-resistant cell lines. The expression of HMG1 is increased at the transcriptional level, which may be due to enhanced activity of the CCAAT-binding transcription factor/nuclear factor 1 (CTF/NF-1).39 Other mechanisms of cisplatin resistance involve decreased net intracellular accumulation of cisplatin. ATP-dependent pathways activate outward efflux of cisplatin through the plasma membrane, which is
July/August 2003, Vol. 10, No.4

Conclusions
Preclinical data indicate that TCR is involved in cisplatin resistance. However, clinical findings, with a level of evidence of 2 (positive phase II studies), have focused on ERCC1, which is involved in GGR. Further research is required to validate ERCC1 mRNA levels in randomized trials, and customized chemotherapy trials including ERCC1 assessment are ongoing. However, an important limitation is the availability of tumor samples. Stage IV NSCLC is often diagnosed through cytology, which can impede ERCC1 assessment. In addition, in some instances, the amount of tumor tissue in bronchial biopsies is scarce. Another test to assess the GGR pathway is the host-cell reactivation assay, which
Cancer Control 303

Table 2. Predictive Tests Considered for Use in Cisplatin-Based Customized Chemotherapy Trials Marker ERCC1 Damaged CAT reporter genes repaired in test lymphocytes transfected with BPDEtreated plasmids Cisplatin-DNA adducts Ap endonuclease XPD polymorphisms Assay cDNA quantitation Host-cell reactivation Level of Evidence 2 2

Immunohistochemistry Immunohistochemistry Genotyping

2 3 2/3

examines the ability to repair BPDE-induced DNA adducts in peripheral lymphocytes. Like the assessment of ERCC1, this test has a level of evidence of 2. A third test is the measurement of cisplatin-DNA adducts in nuclei of buccal cells, which also has a level of evidence of 2. The only limitation for this method is that it requires at least the prior administration of one cycle of cisplatin-based chemotherapy. Cisplatin-DNA adducts can be detected a few days after the first cycle, and the results can be used by the medical oncologist when deciding whether to continue with cisplatin or switch to a noncisplatin regimen in those cases with poor nuclear signal intensity (Table 2). The role of adjuvant chemotherapy has not yet been demonstrated in NSCLC, and there are some hints that patients with proficient GGR can have better prognosis though paradoxically, proficient GGR can cause resistance to cisplatin-based adjuvant chemotherapy. The assessment of ERCC1 in surgical samples could be used to select patients with low ERCC1 levels who could most benefit from adjuvant chemotherapy. Along the same lines, apurinic/apyrimidinic endonuclease (Ap endo) is a key DNA repair enzyme that confers resistance to radiotherapy and alkylating drugs. Ap endo is crucial in the BER pathway. High nuclear Ap endo expression correlated with better survival in surgically resected NSCLC patients.48 At the same time, it is reported to be a mechanism of resistance to alkylating agents.49 Finally, XPD polymorphisms can be examined in constitutional DNA, and for this reason, lymphocytes from peripheral blood are a practical source of DNA. The level of evidence for this test is 2/3 (ie, little clinical evidence). References
1. Guminski AD, Harnett PR, deFazio A. Scientists and clinicians test their metal-back to the future with platinum compounds. Lancet Oncol. 2002;3:312-318. 2. Gatzemeier U, von Pawel J, Gottfried M, et al. Phase III comparative study of high-dose cisplatin versus a combination of paclitaxel and cisplatin in patients with advanced non-small-cell lung cancer. J Clin Oncol. 2000;18:3390-3399.
304 Cancer Control

3. Lilenbaum RC, Herndon J, List M, et al. Single-agent (SA) versus combination chemotherapy (CC) in advanced non-small cell lung cancer (NSCLC): a CALGB randomized trial of efficacy, quality life (QOL), and cost-effectiveness. Proc Annu Meet Am Soc Clin Oncol. 2002;21:2. Abstract. 4. Garfield D. Two drugs better than one for NSCLC. Lancet Oncol. 2002;3:389. 5. Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med. 2002;346:92-98. 6. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinum-based doublets in advanced nonsmall cell lung cancer. J Clin Oncol. 2002;20:4285-4291. 7. Rosell R, Gatzemeier U, Betticher DC, et al. Phase III randomised trial comparing paclitaxel/carboplatin with paclitaxel/cisplatin in patients with advanced non-small cell lung cancer: a cooperative multinational trial. Ann Oncol. 2002;13:1539-1549. 8. Carney DN. Lung cancer: time to move on from chemotherapy. N Engl J Med. 2002;346:126-128. 9. Poirier MC, Reed E, Litterst CL, et al. Persistence of platinumammine-DNA adducts in gonads and kidneys of rats and multiple tissues from cancer patients. Cancer Res. 1992;52:149-153. 10. Schaake-Koning C, van den Bogaert W, Dalesio O, et al. Effects of concomitant cisplatin and radiotherapy on inoperable non-smallcell lung cancer. N Engl J Med. 1992;326:524-530. 11. van de Vaart PJ, Belderbos J, de Jong D, et al. DNA-adduct levels as a predictor of outcome for NSCLC patients receiving daily cisplatin and radiotherapy. Int J Cancer. 2000;89:160-166. 12. Rajewsky MF, Mller R. DNA repair and the cell cycle as targets in cancer therapy. In: Alison M, ed. The Cancer Handbook. London: Nature Publishing Group; 2002:1507-1519. 13. Esteller M, Garcia-Foncillas J, Andion E, et al. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med. 2000;343:1350-1354. 14. Houghton PJ, Stewart CF, Cheshire PJ, et al. Antitumor activity of temozolomide combined with irinotecan is partly independent of O6-methylguanine-DNA methyltransferase and mismatch repair phenotypes in xenograft models. Clin Cancer Res. 2000;6:4110-4118. 15. Siddik ZH. Mechanisms of action of cancer chemotherapeutic agents: DNA-interactive alkylating agents and antitumour platinum-based drugs. In: Alison M, ed. The Cancer Handbook. London: Nature Publishing Group; 2002:1295-1313. 16. Kohn KW, Bohr VA. Genomic instability and DNA repair. In: Alison M, ed. The Cancer Handbook. London: Nature Publishing Group; 2002:87-106. 17. Phillips DH. The formation of DNA adducts. In: Alison M, ed. The Cancer Handbook. London: Nature Publishing Group; 2002: 293-307. 18. Wei Q, Cheng L, Hong WK, et al. Reduced DNA repair capacity in lung cancer patients. Cancer Res. 1996;56:4103-4107. 19. Zeng-Rong N, Paterson J,Alpert L, et al. Elevated DNA repair capacity is associated with intrinsic resistance of lung cancer to chemotherapy. Cancer Res. 1995;55:4760-4764. 20. Wei Q, Cheng L,Amos CI, et al. Repair of tobacco carcinogeninduced DNA adducts and lung cancer risk: a molecular epidemiologic study. J Natl Cancer Inst. 2000;92:1764-1772. 21. Berwick M,Vineis P. Markers of DNA repair and susceptibility to cancer in humans: an epidemiologic review. J Natl Cancer Inst. 2000;92:874-897. 22. Bosken CH,Wei Q,Amos CI, et al. An analysis of DNA repair as a determinant of survival in patients with non-small-cell lung cancer. J Natl Cancer Inst. 2002;94:1091-1099. 23. Metzger R, Leichman CG, Danenberg KD, et al. ERCC1 mRNA levels complement thymidylate synthase mRNA levels in predicting response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J Clin Oncol. 1998;16: 309-316. 24. Dabholkar M, Vionnet J, Bostick-Bruton F, et al. Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy. J Clin Invest. 1994;94:703-708. 25. Li Q, Gardner K, Zhang L, et al. Cisplatin induction of ERCC1 mRNA expression in A2780/CP70 human ovarian cancer cells. J Biol Chem. 1998;273:23419-23425.
July/August 2003, Vol. 10, No.4

26. Li Q,Yu JJ, Mu C, et al. Association between the level of ERCC1 expression and the repair of cisplatin-induced DNA damage in human ovarian cancer cells. Anticancer Res. 2000;20:645-652. 27. Yang LY, Li L, Jiang H, et al. Expression of ERCC1 antisense RNA abrogates gemcitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but proficient in nucleotide excision repair. Clin Cancer Res. 2000;6:773-781. 28. Shirota Y, Stoehlmacher J, Brabender J, et al. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil chemotherapy. J Clin Oncol. 2001;19:4298-4304. 29. Vogel U, Dybdahl M, Frentz G, et al. DNA repair capacity: inconsistency between effect of over-expression of five NER genes and the correlation to mRNA levels in primary lymphocytes. Mutat Res. 2000;461:197-210. 30. Vogel U, Moller P, Dragsted L, et al. Inter-individual variation, seasonal variation and close correlation of OGG1 and ERCC1 mRNA levels in full blood from healthy volunteers. Carcinogenesis. 2002;23:1505-1509. 31. Spitz MR,Wu X,Wang Y, et al. Modulation of nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients. Cancer Res. 2001;61:1354-1357. 32. Furuta T, Ueda T, Aune G, et al. Transcription-coupled nucleotide excision repair as a determinant of cisplatin sensitivity of human cells. Cancer Res. 2002;62:4899-4902. 33. Lord RV, Brabender J, Gandara D, et al. Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin Cancer Res. 2002;8:2286-2291. 34. Yu JJ, Thornton K, Guo Y, et al. An ERCC1 splicing variant involving the 5-UTR of the mRNA may have a transcriptional modulatory function. Oncogene. 2001;20:7694-7698. 35. Fink D, Zheng H, Nebel S, et al. In vitro and in vivo resistance to cisplatin in cells that have lost DNA mismatch repair. Cancer Res. 1997;57:1841-1845. 36. Fink D, Aebi S, Howell SB. The role of DNA mismatch repair in drug resistance. Clin Cancer Res. 1998;4:1-6. 37. Nehme A, Baskaran R, Nebel S, et al. Induction of JNK and cAbl signalling by cisplatin and oxaliplatin in mismatch repair-proficient and -deficient cells. Br J Cancer. 1999;79:1104-1110. 38. Vaisman A, Varchenko M, Umar A, et al. The role of hMLH1, hMSH3 and hMSH6 defects in cisplatin and oxaliplatin resistance: correlation with replicative bypass of platinum-DNA adducts. Cancer Res. 1998;58:3579-3585. 39. Nagatani G, Nomoto M, Takano H, et al. Transcriptional activation of the human HMG1 gene in cisplatin-resistant human cancer cells. Cancer Res. 2001;61:1592-1597. 40. Fujii R, Mutoh M, Sumizawa T, et al. Adenosine triphosphatedependent transport of leukotriene C4 by membrane vesicles prepared from cisplatin-resistant human epidermoid carcinoma tumor cells. J Natl Cancer Inst. 1994;86:1781-1784. 41. Taniguchi K, Wada M, Kohno K, et al. A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res. 1996;56:4124-4129. 42. Ban N, Takahashi Y, Takayama T, et al. Transfection of glutathione S-transferase (GST)-pi antisense complementary DNA increases the sensitivity of a colon cancer cell line to adriamycin, cisplatin, melphalan, and etoposide. Cancer Res. 1996;56:3577-3582. 43. Stoehlmacher J, Park DJ, Zhang W, et al. Association between glutathione S-transferases P1, T1 and M1 genetic polymorphism and survival of patients with metastatic colorectal cancer. J Natl Cancer Inst. 2002;94:936-942. 44. Watson MA, Stewart RK, Smith GB, et al. Human glutathione S-transferase P1 polymorphisms. Carcinogenesis. 1998;19:275-280. 45. Vandier D, Calvez V, Massade L, et al. Transactivation of metallothionein promoter in cisplatin-resistant cancer cells: a specific gene therapy strategy. J Natl Cancer Inst. 2000;92:642-647. 46. Husain A, He G,Venkatraman ES, et al. BCRA1 up-regulation is associated with repair-mediated resistance to cis-diamminedichloroplatinum (II). Cancer Res. 1998;58:1120-1123. 47. Scully R, Livingston DM. In search of the tumor-suppressor functions of BRCA1 and BCRA2. Nature. 2000;408:429-432.
July/August 2003, Vol. 10, No.4

48. Kakolyris S, Giatromanolaki A, Koukourakis M, et al. Nuclear localization of human AP endonuclease 1 (HAP1/Ref-1) associates with prognosis in early operable non-small-cell lung cancer (NSCLC). J Pathol. 1999;189:351-357. 49. Bobola MS, Blank A, Berger MS, et al. Apurinic/apyrimidinic endonuclease activity is elevated in human adult gliomas. Clin Cancer Res. 2001;7:3510-3518.

Cancer Control 305

Human Molecular Genetics, 2004, Vol. 13, No. 20 doi:10.1093/hmg/ddh260 Advance Access published on August 18, 2004

24432449

BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer

Miquel Taron1, Rafael Rosell1,*, Enriqueta Felip2, Pedro Mendez1, John Souglakos5, Maria Sanchez Ronco6, Cristina Queralt1, Joaquim Majo3, Jose Miguel Sanchez1, Jose Javier Sanchez6 and Jose Maestre4
1 2

Medical Oncology Service, Institut Catala dOncologia, Hospital Germans Trias i Pujol, Badalona, Barcelona, Spain, Medical Oncology Service, 3Pathology Department and 4Department of Thoracic Surgery, Hospital Vall dHebron, Barcelona, Spain, 5Department of Medical Oncology, General Hospital of Heraklion, Crete, Greece and 6Autonomous University of Madrid, Madrid, Spain

Received April 27, 2004; Revised July 15, 2004; Accepted August 4, 2004

Lung cancer is the most common cancer, with dismal outcome. Treatment approaches, including cisplatinbased chemotherapy and surgery, are currently based on the clinical classication of the tumor, without genetic assessment for predicting differential chemosensitivity. BRCA1 plays a central role in DNA repair, and decreased BRCA1 mRNA expression in the human breast cancer HCC1937 cell line caused cisplatin hypersensitivity, but the relation between BRCA1 and survival in lung cancer patients has never been examined. We used real-time quantitative polymerase chain reaction to determine BRCA1 mRNA levels in 55 surgically resected tumors of non-small-cell lung cancer patients who had received neoadjuvant gemcitabine/cisplatin chemotherapy, and divided the gene expression values into quartiles. When results were correlated with outcome, two cut-offs were observed; patients with levels <0.61 had better outcome, and those >2.45 had poorer outcome. Median survival was not reached for the 15 patients in the bottom quartile, whereas for the 28 in the two middle quartiles, it was 37.8 months (95% CI, 10.6 65), and for the 12 patients in the top quartile, it was 12.7 months (95% CI, 0.28 28.8) (P 5 0.01). Moreover, when patients were stratied by pathologic stage, those in the bottom quartile had a decreased risk of death (HR 5 0.206; 95% CI, 0.05 0.83; P 5 0.026) compared with those in the top quartile, and those in the two middle quartiles also had a decreased risk of death (HR 5 0.294; 95% CI, 0.10 0.83; P 5 0.020) compared with those in the top quartile. BRCA1 expression is potentially an important tool for use in cancer management and should be assessed for predicting differential chemosensitivity and tailoring chemotherapy in lung cancer.

INTRODUCTION
Breast cancer 1 (BRCA1) plays a crucial role in DNA repair, and decreased BRCA1 mRNA expression has been observed in both sporadic and hereditary breast cancers (1); however, its potential effect in lung cancer has never been examined. BRCA1 is implicated in transcription-coupled nucleotide excision repair (TC-NER), and modulation of its expression leads to modication of TC-NER and hence to radio- and chemoresistance. Upregulation of BRCA1 expression led to increased cisplatin resistance in the SKOV-3 human ovarian cancer cell line (2), and restoration of BRCA1 in the BRCA1negative HCC1937 human breast cancer cell line restored

radioresistance (3). BRCA1 is also involved in homologous recombination repair (HRR) and non-homologous end joining, in response to DNA damage (4). In addition, it is a component of a large DNA repair complex termed the BRCA1-associated genome surveillance complex, which contains a number of mismatch repair proteins, indicating a potential role for BRCA1 in mismatch repair (1,4). BRCA1 may also be a regulator of mitotic spindle assembly, as BRCA1 and b-tubulin colocalize to the microtubules of the mitotic spindle and to the centrosomes (5). Finally, enhanced BRCA1 expression has been linked to apoptosis through the c-Jun N-terminal kinase pathway (6), which is activated by cisplatin-induced DNA damage; inhibition of this pathway

*To whom correspondence should be addressed at: Medical Oncology Service, Catalan Institute of Oncology, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916 Badalona, Barcelona, Spain. Tel: 34 934978925; Fax: 34 934978950; Email: rrosell@ns.hugtip.scs.es

Human Molecular Genetics, Vol. 13, No. 20 # Oxford University Press 2004; all rights reserved

2444

Human Molecular Genetics, 2004, Vol. 13, No. 20

increased cisplatin sensitivity in cell lines (7). Decreased BRCA1 mRNA expression in a breast cancer cell line, as determined by real-time quantitative polymerase chain reaction (RT-QPCR), led to greater sensitivity to cisplatin and etoposide, but to greater resistance to the microtubule-interfering agents paclitaxel and vincristine (8). Recently, furthermore, reconstitution of wild-type BRCA1 into the BRCA1-negative HCC1937 breast cancer cell line (9) resulted in a 20-fold increase in cisplatin resistance and, in contrast, in a 1000 10 000-fold increase in sensitivity to antimicrotubule drugs (paclitaxel and vinorelbine) (4,10). Mouse models carrying conditional disruption of BRCA1 were highly sensitive to doxorubicin and gamma irradiation but resistant to tamoxifen, providing additional evidence for differential chemosensitivity linked to BRCA1 expression (11). When BRCA1 expression was examined by semi-quantitative PCR in women with sporadic breast cancer, low BRCA1 mRNA levels (bottom quartile) were associated with a higher frequency of distant metastases (12). Despite the wealth of data in cell lines and mouse models, only one small study has examined the correlation of BRCA1 and BRCA2 mRNA expression with response to chemotherapy in the clinical setting. Among 25 women with docetaxel-treated locally advanced or metastatic breast cancer (13), only BRCA2 mRNA levels were signicantly lower in responders than in non-responders, though a slight difference was also observed for BRCA1. Non-small-cell lung cancer (NSCLC) accounts for 80% of all lung cancers, with 1.2 million new cases worldwide each year. NSCLC resulted in more than 1 million deaths worldwide in 2001, and is the leading cause of cancer-related mortality in both men and women (31 and 25%, respectively) (14). The overall 5-year survival of patients with NSCLC has remained at ,15% for the past 20 years. Stage grouping of TNM subsets (T, primary tumor; N, regional lymph nodes; M, distant metastases) permits the identication of patient groups with similar prognosis and treatment options. Five-year survival is around 25% for pathologic stage IIB (T1-2N1M0, T3N0M0), 13% for stage IIIA (T3N1M0, T1-2-3N2M0) and a low 7% for stage IIIB (T4N0-1-2M0) (15). Small randomized studies of cisplatin-based chemotherapy followed by surgery in clinical stage IIIA (16) or stage IIB IIIB (17) showed remarkable improvement in survival over patients treated either with surgery alone or with surgery followed by radiotherapy. Event-free survival was similar in the two studies (12.7 (16) and 20 (17) months in the neoadjuvant chemotherapy arm and 5.8 (16) and 5 (17) months in the surgery arm). In general, neoadjuvant chemotherapy induces tumor shrinkage and sterilizes metastatic lymph nodes, leading to pathologic downstaging in 33% and complete pathologic remission in up to 14% of patients (18). Although a wealth of data indicates that changes in the level of several gene transcripts can modulate differential chemosensitivity between patients with the same TNM subset, at present no predictive genetic markers of chemotherapy response are used for tailoring treatment. On the basis of the evidence for the role of BRCA1 in breast and ovarian cancers, we reasoned that BRCA1 mRNA expression could also play an important role in predicting differential chemotherapy sensitivity in NSCLC. We examined the potential predictive value of BRCA1 mRNA expression in resected specimens from stage IIB, IIIA and

IIIB NSCLC patients treated with neoadjuvant gemcitabine/ cisplatin followed by surgery.

RESULTS
Median survival was 37.8 months (95% CI, 27 48.5 months) for all patients, 51.9 months (95% CI, 31.6 72.4 months) for patients who underwent lobectomy and 25.8 months (95% CI, 12.7 38.8 months) for those who underwent pneumonectomy. BRCA1 was detected in all tumors, although there was considerable variation in its level of expression, with values relative to the b-actin internal control ranging 37fold, from 0.28 to 10.43. Amplication plots obtained for the genes BRCA1 and b-actin are shown in Figure 1. Values ranged from 0.28 to 0.61 [interpatient coefcient of variation (ICV), 30.7%] for the 15 patients in the bottom quartile, from 0.65 to 1.20 (ICV, 17.4%) for the 14 patients in the second quartile, from 1.23 to 2.37 (ICV, 17.7%) for the 14 patients in the third quartile, and from 2.45 to 10.43 (ICV, 54.7%) for the 12 patients in the top quartile. Owing to the similar values and ICVs observed in the second and third quartiles, these two groups were merged for statistical analyses. No differences in clinical characteristics were observed according to quartiles of BRCA1 mRNA expression levels (Table 1). However, for patients in the bottom quartile, radiographic response tended to be higher than for those in the middle or top quartiles (66.7, 57.1 and 58.3%, respectively), complete resection was attained more often (93.3, 78.6 and 83.3%, respectively), and a lobectomy was performed more often [73.3, 32.1 (P 0.005) and 58.3% (P 0.2), respectively] (Table 1). Median survival was not reached for the 15 patients in the bottom quartile, whereas for the 28 patients in the two middle quartiles, it was 37.8 months (95% CI, 10.6 65), and for the 12 patients in the top quartile, it was 12.7 months (95% CI, 0.28 28.8) (P 0.01) (Fig. 2). Five patients who attained a complete pathologic response (T0N0) were all in the bottom quartile of BRCA1 levels (Table 2). Conversely, in the majority of patients with high BRCA1 levels, no clinical or pathologic downstaging was observed following chemotherapy and surgery (Table 3). When patients were stratied by pathologic stage, those in the bottom quartile had a decreased risk of death (HR 0.206; 95% CI, 0.05 0.83; P 0.026) compared with those in the top quartile, and those in the two middle quartiles also had a decreased risk of death (HR 0.294; 95% CI, 0.10 0.83; P 0.020) compared with those in the top quartile. When patients were stratied by clinical stage, a similar pattern was observed. Those in the bottom quartile had a decreased risk of death (HR 0.220; 95% CI, 0.06 0.77; P 0.018) compared with those in the top quartile, and those in the two middle quartiles also had a decreased risk of death (HR 0.430; 95% CI, 0.17 1.1; P 0.078) compared with those in the top quartile.

DISCUSSION
Resistance to cytotoxic drugs is the major impediment to the successful treatment of many tumor types, especially in lung cancer. The elucidation of the mechanisms of this resistance

Human Molecular Genetics, 2004, Vol. 13, No. 20

2445

Figure 1. Example of the amplication plots (DRn versus cycle number) of (A) b-actin and (B) BRCA1 cDNAs. Both gures correspond to serial dilutions of cDNA obtained from one of the samples. (C) and (D) Examples of the validation curves for relative quantication. Different primers and probe concentrations were assayed for b-actin and BRCA1 gene expression analysis to obtain the optimal PCR efciency. In order for the relative quantication to be valid, the amplication efciency of the target (BRCA1 ) and the reference (b-actin ) amplication must be approximately equal. A sensitive method for assessing whether two amplicons have the same amplication efciency is to see how DCt varies when using a serial dilution of a control cDNA. We performed two validations: one using control cDNA, another using cDNA from parafn-embedded samples. (C) Several runs with serial dilutions were performed to conrm that the slope ,0.1 in the plot DCt value versus log10 input amount cDNA, dened as Ct BRCA1 in each dilution minus Ct b-actin in the same dilution. (D) For primers and probe sets, the slope of the plot Ct versus log10 input amount cDNA needed to be between 23.25 and 23.45, since a slope of 23.33 represents 100% efciency. The slopes in our assays were 23.36 for b-actin and 23.32 for BRCA1, with a correlation coefcient (R 2) .0.98.

is crucial for improving treatment outcome and for selecting and customizing chemotherapy. Upregulation of DNA repair genes has been related to resistance to cisplatin and radiotherapy. The repair of cisplatin DNA damage occurs via the activity of the nucleotide excision repair endonuclease (ERCC1/XPF) and Rad51-related HRR proteins (19,20). We had previously used RT-QPCR to assess mRNA levels of ERCC1 and RRM1, genes related to global genome NER but not directly to TC-NER (20), and found that overexpression of either of these genes inuenced survival in gemcitabine/cisplatin-treated stage IV NSCLC patients (21 23). However, unlike ERCC1, BRCA1 is involved in TC-NER (3,24), and may thus be a better predictive marker of cisplatin response. The availability of fresh tumor tissue in the clinical setting is not yet common, and the recovery of mRNA from parafnembedded tissue has therefore become very important. mRNA real-time assays permit quantitative and accurate measurement of gene expression (25). In the present study, we used RTQPCR to quantitatively analyze BRCA1 mRNA expression in processed formalin-xed, parafn-embedded tissues from

resected lung cancer patients and demonstrated that BRCA1 expression can be accurately assessed. BRCA1 gene expression was detectable in all 55 samples analyzed in this study. Patients in the bottom quartile of BRCA1 mRNA levels (,0.61) obtained the maximum benet of neoadjuvant gemcitabine/cisplatin chemotherapy, whereas those in the top quartile (.2.45) had the poorest outcome. These ndings support the hypothesis that BRCA1 mRNA expression levels could be an indicator of differential cisplatin sensitivity in NSCLC, which is consistent with ndings in pre-clinical models in breast cancer (2 4,8,10,11). The HCC1937 cell line (9), from a primary breast carcinoma with a germline BRCA1 mutation, was transfected with either wild-type BRCA1 or an empty vector to test response to antimicrotubule drugs (paclitaxel and vinorelbine) and DNA-damaging drugs (cisplatin, bleomycin and etoposide). Reconstitution of wildtype BRCA1 function into HCC1937 resulted in a 1000-fold increase in sensitivity to paclitaxel and a 10 000-fold increase in sensitivity to vinorelbine. Conversely, it resulted in a 2-fold increase in resistance to bleomycin, a 20-fold increase in

2446

Human Molecular Genetics, 2004, Vol. 13, No. 20

Table 1. Patient characteristics according to BRCA1 mRNA expression levels (bottom quartile versus two middle quartiles versus top quartile) Bottom quartile of BRCA1 levels (0.280.61) N Sex Female Male Age Median, range Histology Squamous cell carcinoma Adenocarcinoma Large cell carcinoma Initial staging IIB T3N0 IIIA T3N1 T1N2 T2N2 T3N2 IIIB T4N0 T4N1 T4N2 Chemotherapy regimen Gemcitabine/cisplatin Gemcitabine/carboplatin Radiographic response Partial response Stable disease Progressive disease Surgical results Complete resection Incomplete resection Unresectable Surgical procedures Lobectomy Pneumonectomy Bilobectomy Unresectable 3 (20%) 12 (80%) 60 (4974%) 5 (33.3%) 7 (46.7%) 3 (20%) 2 (13.3%) 0 0 1 (6.7%) 3 (20%) 6 (40%) 1 (6.7%) 2 (13.3%) 15 (100%) 0 10 (66.7%) 5 (33.3%) 0 14 (93.3%) 1 (6.7%) 0 11 (73.3%) 4 (26.7%) 0 0 Middle quartiles of BRCA1 levels (0.65 2.37) N 3 (10.7%) 25 (89.3%) 65 (5176%) 16 (57.1%) 11 (39.3%) 1 (3.6%) 3 (10.7%) 1 (3.6%) 0 6 (21.4%) 7 (25%) 8 (28.6%) 2 (7.1%) 1 (3.6%) 26 (92.9%) 2 (7.1%) 16 (57.1%) 10 (35.7%) 2 (7.1%) 22 (78.6%) 5 (17.9%) 1 (3.6%) 9 (32.1%) 14 (50%) 4 (14.3%) 1 (3.6%) Top quartile of BRCA1 levels (2.4510.43) N 0 12 (100%) 61 (4571%) 5 (41.7%) 2 (16.7%) 5 (41.7%) 1 (8.3%) 3 (25%) 0 1 (8.3%) 2 (16.7%) 3 (25%) 1 (8.3%) 1 (8.3%) 10 (83.3%) 2 (16.7%) 7 (58.3%) 4 (33.3%) 1 (8.3%) 10 (83.3%) 2 (16.7%) 0 7 (58.3%) 5 (41.7%) 0 0

resistance to cisplatin and a .100-fold increase in resistance to etoposide (10). Interestingly, BRCA1 failed to modulate resistance or sensitivity to the antimetabolite 5-uorouracil, perhaps reecting the distinct mode of action of antimetabolites (10). BRCA1 mRNA is reduced in sporadic breast cancer cells despite a lack of mutations. Aberrant cytosine methylation of the BRCA1 CpG island promoter may be a partial mechanism of BRCA1 repression in sporadic breast cancer (26,27). Along the same lines, it has been shown that the Fanconi anemia (FANC)-BRCA pathway (28) regulates cisplatin sensitivity, with the clinical nding that methylation of FANCF confers increased cisplatin sensitivity in ovarian cancer (29). FANC genes interact with those involved in DNA repair pathways, including BRCA1, Rad-51, ATM and NBS1 (28). Cigarette smoking remains the principal cause of lung cancer, with 85 90% of all lung cancer patients having smoked cigarettes at some time. The profound role of cigarette smoking in lung cancer development and DNA damage could also contribute to the dismal outcome and the limited effect of chemotherapy as DNA repair capacity is stimulated in response to DNA damage caused by tobacco carcinogens.

Among heavy smokers, both lung cancer patients and controls have more procient DNA repair capacity (measured by hostcell reactivation assay) in lymphocytes than non- or light smokers (30). Elevated DNA repair capacity has been associated with cisplatin resistance both in NSCLC cell lines (31) and in lung cancer patients (32). The expression levels of DNA repair genes, including BRCA1, can be expected to be elevated in lung cancer patients, particularly those who are heavy smokers. Several cisplatin-based doublets demonstrated similar survival in a randomized study of more than 1000 metastatic NSCLC patients (33); furthermore, other studies have found no survival differences between cisplatin alone and cisplatin/ paclitaxel (34), or between docetaxel alone and docetaxel/ cisplatin (35). On the basis of our results and of pre-clinical data (10), we can speculate that patients with low BRCA1 mRNA levels can benet from single-agent cisplatin, whereas those with high levels would benet from singleagent docetaxel or paclitaxel. In contrast, high BRCA1 levels may diminish the synergism between taxanes and cisplatin or carboplatin. Although sensitivity to antimetabolites, such as gemcitabine, may not be affected by BRCA1 levels,

Human Molecular Genetics, 2004, Vol. 13, No. 20

2447

Figure 2. Median survival according to quartiles of BRCA1 mRNA expression levels. Median survival was not reached for those in the bottom quartile, whereas it was 37.8 months for those in the middle quartiles, and 12.7 months for those in the top quartile.

Table 2. BRCA1 mRNA levels and clinical stage in patients who attained complete pathologic response after neoadjuvant chemotherapy followed by surgery Patient 1 2 3 4 5 BRCA1 mRNA levels 0.31 0.28 0.30 0.33 0.34 Pre-treatment clinical stage T3N2 T2N2 T4N2 T4N2 T4N1 Post-treatment clinical stage T2N0 T1N0 T2N1 T2N0 T4N1 Pathologic stage T0N0 T0N0 T0N0 T0N0 T0N0

gemcitabine/cisplatin synergism may be partially abrogated in tumors with high BRCA1 mRNA levels; on the other hand, these tumors may benet from the synergism observed between taxanes and gemcitabine. To date, no other clinical study has assessed BRCA1 mRNA expression as a predictive marker of chemotherapy response in lung cancer. If further research validates our ndings, BRCA1 mRNA assessment will provide an important tool for customizing NSCLC chemotherapy in order to improve survival in this very common and fatal disease.

BRCA1 gene expression analysis by RT-QPCR We examined BRCA1 gene expression in formalin-xed, parafn-embedded surgical resected specimens from the 55 patients as previously described (36,37). After standard tissue sample deparafnization using xylene and alcohols, samples were lyzed in a Tris chloride, EDTA, sodium dodecyl sulfate (SDS) and proteinase K containing buffer. RNA was then extracted with phenol chloroform isoamyl alcohol followed by precipitation with isopropanol in the presence of glycogen and sodium acetate. RNA was resuspended in RNA storage solution (Ambion Inc., Austin TX, USA) and treated with DNase I to avoid DNA contamination. cDNA was synthesized using M-MLV retrotranscriptase enzyme. Template cDNA was added to TaqMan Universal Master Mix (AB; Applied Biosystems, Foster City, CA, USA) in a 12.5ml reaction with specic primers and probe for each gene. The primer and probe sets were designed using Primer Express 2.0 Software (AB). Quantication of gene expression was performed using the ABI Prism 7900HT Sequence Detection System (AB). Primers and probe for BRCA1 mRNA expression analysis were designed according to the Ref Seq NM_007294 (http://www.ncbi.nlm.nih.gov/LocusLink). Forward primer is located in exon 8 (position 4292 4317 bp), reverse primer in exon 9 (position 4336 4360 bp) and probe in the exon 8/9 junction (position 4313 bp 4333 bp). The PCR product size generated with these

MATERIALS AND METHODS

Patients In all patients, neoadjuvant chemotherapy was indicated after evaluation by a thoracic surgeon, a radiologist, a medical oncologist and a radiation oncologist. Patients received three cycles of neoadjuvant chemotherapy; 51 received cisplatin 100 mg/m2 day 1 plus gemcitabine 1250 mg/m2 days 1 and 8 every 21 days, and four received carboplatin AUC 5 day 1 plus gemcitabine 1000 mg/m2 days 1 and 8 every 21 days. A thoracotomy was performed within 4 5 weeks after the last chemotherapy cycle; the surgical procedure was based on the extent of tumor at the time of the initial presentation.

2448

Human Molecular Genetics, 2004, Vol. 13, No. 20

Table 3. Correlation of clinical and pathologic stage in patients in the top quartile of BRCA1 mRNA expression Patient 1 2 3 4 5 6 7 8 9 10 11 12
a

Investigacion Cooperativa de Centros de Cancer (CO-010) and through Ayuda Carlos III (RCESP 03/09) and by funding from La Fundacio Badalona Contra El Cancer. `

mRNA BRCA1 levels 2.8 5.5 10.43 2.45 4.12 6.93 2.81 3.09 5.61 3.36 2.8 2.62

Pre-treatment clinical stage T3N2 T2N2 T3N1 T3N0 T4N0 T4N2 T4N1 T3N1 T3N1 T3N2 T4N0 T4N0

Post-treatment clinical stage T3N2 a T2N0 T3N0 T1N0 T3N0 T4N1 T2N0 T2N0 T3N2 T3N0 T4N0

Pathologic stage T2N2 T2N0 T2N0 T3N0 T4N0 T2N0 T3N1 T2N0 T2N0 T2N2 T3N0 T2N0

REFERENCES
1. Kennedy, R.D., Quinn, J.E., Johnston, P.G. and Harkin, D.P. (2002) BRCA1: mechanisms of inactivation and implications for management of patients. Lancet, 360, 10071014. 2. Husain, A., He, G., Venkatraman, E.S. and Spriggs, D.R. (1998) BRCA1 up-regulation is associated with repair-mediated resistance to cisdiamminedichloroplatinum(II). Cancer Res., 58, 11201123. 3. Abbott, D.W., Thompson, M.E., Robinson-Benion, C., Tomlinson, G., Jensen, R.A. and Holt, J.T. (1999) BRCA1 expression restores radiation resistance in BRCA1-defective cancer cells through enhancement of transcription-coupled DNA repair. J. Biol. Chem., 274, 1880818812. 4. Mullan, P.B., Quinn, J.E., Gilmore, P.M., McWilliams, S., Andrews, H., Gervin, C., McCabe, N., McKenna, S., White, P., Song, Y.H. et al. (2001) BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents. Oncogene, 20, 61236131. 5. Lotti, L.V., Ottini, L., DAmico, C., Gradini, R., Cama, A., Belleudi, F., Frati, L., Torrisi, M.R. and Mariani-Costantini, R. (2002) Subcellular localization of the BRCA1 gene product in mitotic cells. Genes, Chromosomes Cancer, 35, 193203. 6. Harkin, D.P., Bean, J.M., Miklos, D., Song, Y.H., Truong, V.B., Englert, C., Christians, F.C., Ellisen, L.W., Maheswaran, S., Oliner, J.D. et al. (1999) Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell, 97, 575 586. 7. Potapova, O., Haghighi, A., Bost, F., Liu, C., Birrer, M.J., Gjerset, R. and Mercola, D. (1997) The Jun kinase/stress-activated protein kinase pathway functions to regulate DNA repair and inhibition of the pathway sensitizes tumor cells to cisplatin. J. Biol. Chem., 272, 14041 14044. 8. Lafarge, S., Sylvain, V., Ferrara, M. and Bignon, Y.J. (2001)Inhibition of BRCA1 leads to increased chemoresistance to microtubule-interfering agents, an effect that involves the JNK pathway. Oncogene, 20, 65976606. 9. Tomlinson, G.E., Chen, T.T.L., Stastny, V.A., Virmani, A.K., Spillman, M.A., Tonk, V., Blum, J.L., Schneider, N.R., Wistuba, I.I., Shay, J.W. et al. (1998) Characterization of a breast cancer cell line derived from a germ-line BRCA1 mutation carrier. Cancer Res., 58, 32373242. 10. Quinn, J.E., Kennedy, R.D., Mullan, P.B., Gilmore, P.M., Carty, M., Johnston, P.G. and Harkin, D.P. (2003) BRCA1 functions as a differential modulator of chemotherapy-induced apoptosis. Cancer Res., 63, 62216228. 11. Brodie, S.G., Xu, X., Qiao, W., Li, W.M., Cao, L. and Deng, C.X. (2001) Multiple genetic changes are associated with mammary tumorigenesis in Brca1 conditional knockout mice. Oncogene, 20, 75147523. 12. Seery, L.T., Knowlden, J.M., Gee, J.M.W., Robertson, J.F.R., Kenny, F.S., Ellis, I.O. and Nicholson, R.I. (1999) BRCA1 expression levels predict distant metastasis of sporadic breast cancers. Int. J. Cancer (Pred. Oncol.), 84, 258 262. 13. Egawa, C., Miyoshi, Y., Takamura, Y., Taguchi, T., Tamaki, Y. and Noguchi, S. (2001) Decreased expression of BRCA2 mRNA predicts favorable response to docetaxel in breast cancer. Int. J. Cancer (Pred. Oncol.), 95, 255259. 14. Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E. and Thun, M.J. (2004) Cancer statistics, 2003. CA Cancer J. Clin., 54, 8 29. 15. Mountain, C.F. (1997) Revisions in the international system for staging lung cancer. Chest, 111, 17101717. 16. Pass, H.I., Pogrebniak, H.W., Steinberg, S.M., Mulshine, J. and Minna, J. (1992) Randomized trial of neoadjuvant therapy for lung cancer: interim analysis. Ann. Thor. Surg., 53, 992 998. 17. Rosell, R., Gomez-Codina, J., Camps, C., Maestre, J., Padilla, J., Canto, A, Mate, J.L., Li Shanrong, Roig J., Olazabal, A. et al. (1994) A randomized trial comparing preoperative chemotherapy plus surgery with surgery alone in patients with non-small-cell lung cancer. N. Engl. J. Med., 330, 153158. 18. Martini, N., Kris, M.G., Flehinger, B.J., Gralla, R.J., Bains, M.S., Burt, M.E., Heelan, R., McCormack, P.M., Pisters, K.M.W., Rigas, J.R. et al. (1993) Preoperative chemotherapy for stage IIIa (N2) lung cancer: The SloanKettering experience with 136 patients. Ann. Thorac. Surg., 55, 13651374.

Data not available.

primers was 69 bp. The primers and 50 labeled uorescent reporter dye (6FAM) probe were as follows: b-actin: forward 50 -TGA GCG CGG CTA CAG CTT-30 , reverse 50 -TCC TTA ATG TCA CGC ACG ATT T-30 , probe 50 -ACC ACC ACG GCC GAG CGG-30 ; BRCA1: forward 50 -GGC TAT CCT CTC AGA GTG ACA TTT TA-30 , reverse 50 -GCT TTA TCA GGT TAT GTT GCA TGG T-30 , probe 50 -CCA CTC AGC AGA GGG-30 . Relative gene expression quantication was calculated according to the comparative Ct method using b-actin as an endogenous control and commercial RNA controls (Stratagene, La Jolla, CA) as calibrators. Final results, were determined as follows: 22(DCt sample 2 DCt calibrator), where DCt values of the calibrator and sample are determined by subtracting the Ct value of the target gene from the value of the bactin gene. In all experiments, only triplicates with a SD of the Ct value ,0.20 were accepted. In addition, for each sample analyzed, a retrotranscriptase minus control was run in the same plate to assure lack of genomic DNA contamination (Fig. 1). Statistical methods In order to provide an easily interpretable evaluation of the effect of BRCA1 mRNA expression, gene expression values were divided into quartiles. ICVs were calculated to assess similarities between quartiles. Hazard ratios were calculated with the univariate Cox model, stratifying by pathologic and clinical stage, and comparison between Kaplan Meier survival curves was performed with the log-rank test. All tests of statistical signicance were two-sided, with a statistical power of 80%, and signicance was set at 0.05 except in multiple comparisons, where it was set at 0.017 in accordance with the Bonferroni correction.

ACKNOWLEDGEMENTS
The authors thank Renee OBrate for assistance with the manuscript. This study was supported by Spanish Ministry of Health research grants provided through Red Tematica de

Human Molecular Genetics, 2004, Vol. 13, No. 20

2449

19. Aloyz, R., Xu, Z.Y., Bello, V., Bergeon, J., Han, F.Y., Yan, Y., Malapetsa, A., Alaoui-Jamali, M.A., Duncan, A.M.V. and Panasci, L. (2002) Regulation of cisplatin resistance and homologous recombinational repair by the TFIIH subunit XPD. Cancer Res., 62, 54575462. 20. Furuta, T., Ueda, T., Aune, G., Sarasin, A., Kraemer, K.H. and Pommier, Y. (2002) Transcription-coupled nucleotide excision repair as a determinant of cisplatin sensitivity of human cells. Cancer Res., 62, 48994902. 21. Lord, R.V.N., Brabender, J., Gandara, D., Alberola, V., Camps, C., Domine, M., Cardenal, F., Sanchez, J.M., Gumerlock, P.H., Taron, M. et al. (2002) Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small-cell lung cancer. Clin. Cancer Res., 8, 22862291. 22. Rosell, R., Scagliotti, G., Danenberg, K.D., Lord, R., Bepler, G., Novello, S., Cooc, J., Crino, L., Sancehz, J.J., Taron, M. et al. (2003) Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic non-small-cell lung cancer. Oncogene, 22, 35483553. 23. Rosell, R., Danenberg, K.D., Alberola, V., Bepler, G., Sanchez, J.J., Camps, C., Provencio, M., Isla, D., Taron, M., Diz, P. et al. (2004) Ribonucleotide reductase mRNA expression and survival in gemcitabine/ cisplatin-treated advanced non-small-cell lung cancer patients. Clin. Cancer Res., 10, 13181325. 24. LePage, F., Randrianarison, V., Marot, D., Cabannes, J., Perricaudet, M., Feunteun, J. and Sarasin, A. (2000) BRCA1 and BRCA2 are necessary for the transcription-coupled repair of the oxidative 8-oxoguanine lesion in human cells. Cancer Res., 60, 55485552. 25. Einspahr, J.G., Krouse, R.S., Yochim, J.M., Danenberg, P.V., Danenberg, K.D., Bhattacharyya, A.K., Martinez, M.E. and Alberts, D.S. (2003) Association between cyclooxygenase expression and colorectal adenoma characteristics. Cancer Res., 63, 38913893. 26. Rice, J.C., Massey-Brown, K.S. and Futscher, B.W. (1998) Aberrant methylation of the BRCA1CpG island promoter is associated with decreased BRCA1 mRNA in sporadic breast cancer cells. Oncogene, 17, 18071812. 27. Esteller, M., Silva, J.M., Domnguez, G., Bonilla, F., Matias-Guiu, X., Lerma, E., Bussaglia, Prat, J., Harkes, I.C., Repasky, E.A. et al. (2000) Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J. Natl Cancer Inst., 92, 564 569.

28. Hussain, S., Uit E, Huber, P.A.J., Medhurst, A.L., Ashworth, A. and Mathew, C.G. (2003). Direct interaction of the Fanconi with BRCA2/ FANCD1. Hum. Mol. Genet., 12, 25032510 29. Taniguchi, T., Tischkowitz, M., Ameziane, N., Hodgson, S.V., Mathew, C.G., Joenje, H., Mok, S.C and DAndrea, A.D. (2003) Disruption of the Fanconi anemiaBRCA pathway in cisplatin-sensitive ovarian tumors. Nat. Med., 9, 568574. 30. Wei, Q., Cheng, L., Amos, C.I., Wang, L.E., Guo, Z., Hong, W.K.H and Spitz, M.R. (2000). Repair of tobacco carcinogen-induced DNA adducts and lung cancer risk: a molecular epidemiologic study. J. Natl Cancer Inst., 92, 17641772. 31. Zeng-Rong, N., Paterson, J., Alpert, L., Tsao, M.S., Viallet, J. and Alaoui-Jamali, M.A. (1995) Elevated DNA repair capacity is associated with intrinsic resistance of lung cancer to chemotherapy. Cancer Res., 55, 47604764. 32. Bosken, C.H., Wei, Q., Amos, C.I. and Spitz, M.R. (2002) An analysis of DNA repair as a determinant of survival in patients with non-small-cell lung cancer. J. Natl Cancer Inst., 94, 10911099. 33. Schiller, J.H., Harrington, D., Velan, C.P., Langer, C., Sandler, A., Krrok, J., Zhu, J. and Johnson, D.H. (2002) Comparison of tour chemotherapy regimens for advanced non-small-cell lung cancer. N. Engl. J. Med., 346, 9298. 34. Gatzemeier, U., von Pawel, J., Gottfried, M., ten Velde, G.P.M., Mattson, K., DeMarinis, F., Harper, P., Salvati, F., Robinet, G., Lucenti, A. et al. (2000) Phase III comparative study of high-dose cisplatin versus a combination of paclitaxel and cisplatin in patients with advanced nonsmall-cell lung cancer. J. Clin. Oncol., 18, 33903399. 35. Georgoulias, V., Ardavanis, A., Agelidou, A., Agelidou, M., Chandrinos, V., Tsaroucha, E., Toumbis, M., Kouroussis, C., Syrigos, K., Polyzos, A. et al. (2004) Docetaxel versus docetaxel plus cisplatin as front-line treatment of patients with advanced non-small-cell lung cancer: A randomized, multicenter phase III trial. J. Clin. Oncol., 22, 26022609. 36. Specht, K., Richter, T., Muller, U., Walch, A., Werner, M. and Hoer, H. (2001) Quantitative gene expression analysis in microdissected archival formalin-xed and parafn-embedded tumor tissue. Am. J. Pathol., 158, 419429. 37. Krafft, A.E., Duncan, B.W., Bijwaard, K.E., Taubenberger, J.K. and Lichy, J.H. (1997) Optimization of the isolation and amplication of RNA from formalin xed, parafn-embedded tissue: The Armed Forces Institute of Pathology experience and literature review. Mol. Diagn., 3, 217230.

2286 Vol. 8, 2286 2291, July 2002

Clinical Cancer Research

Low ERCC1 Expression Correlates with Prolonged Survival after Cisplatin plus Gemcitabine Chemotherapy in Non-Small Cell Lung Cancer1
Reginald V. N. Lord,2 Jan Brabender,2 David Gandara, Vicente Alberola, Carlos Camps, Manuel Domine, Felip Cardenal, Jose M. Sanchez, Paul H. Gumerlock, Miquel Taron, Jose J. Sanchez, Kathleen D. Danenberg, Peter V. Danenberg, and Rafael Rosell3
University of Southern California/Norris Comprehensive Cancer Center, Los Angeles, California 90033 [R. V. N. L., J. B., P. V. D.]; University of California, Davis Cancer Center, Sacramento, California 95817 [D. G., P. H. G.]; Hospital Arnau de Vilanova, 46015 Valencia, Spain [V. A.]; Hospital General de Valencia, 46014 Valencia, Spain [C.C.]; Fundacion Jimenez Diaz, 28005 Madrid, Spain [M. D.]; Institut Catala dOncologia, 08907 Bellvitge, Barcelona, Spain ` [F. C.]; Hospital Germans Trias i Pujol, Badalona, s/n 08916 Barcelona, Spain [J. M. S., M. T., R. R.]; Free University of Madrid, 28029 Madrid, Spain [J. J. S.]; and Response Genetics, Los Angeles, California 90033 [K. D. D.]

ABSTRACT
Purpose: Overexpression of the excision repair crosscomplementing 1 (ERCC1) gene, which is crucial in the repair of cisplatin (CDDP)-DNA adducts, is reported to negatively influence the effectiveness of CDDP-based therapy for gastric and ovarian cancers. Recent evidence indicates that Gemcitabine (Gem) may modulate ERCC1 nucleotide excision repair activity, and down-regulation of DNA repair activity by ERCC1 antisense RNA reportedly inhibits synergism of CDDP/Gem. We investigated whether ERCC1 mRNA expression levels were associated with clinical outcomes after treatment with a combination Gem/CDDP regimen for patients with advanced stage non-small cell lung cancer (NSCLC). Experimental Design: Response and survival were correlated with the level of ERCC1 expression in 56 patients

with advanced (stage IIIb or IV) NSCLC treated as part of a multicenter randomized trial with Gem 1250 mg/m2 days 1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks. mRNA was isolated from paraffin-embedded pretreatment primary tumor specimens, and relative expression levels of ERCC1/ -actin were measured using a quantitative reverse transcription-PCR (Taqman) system. Results: ERCC1 expression was detectable in all tumors. There were no significant differences in ERCC1 levels by gender, age, performance status, weight loss, or tumor stage. The overall response rate was 44.7%. There were no significant associations between ERCC1 expression and response. Median overall survival was significantly longer in patients with low ERCC1 expression tumors (61.6 weeks; 95% confidence interval, 42.4 80.7 weeks) compared to patients with high expression tumors (20.4 weeks, 95% confidence interval, 6.9 33.9 weeks). ERCC1 expression, Eastern Cooperative Oncology Group performance status, and presence of weight loss were significant prognostic factors for survival in a Cox proportional hazards multivariable analysis. Conclusions: These data suggest that ERCC1 expression is a predictive factor for survival after CDDP/Gem therapy in advanced NSCLC. Although there was a trend toward decreased response with high ERCC1 mRNA levels, this difference failed to reach statistical significance. This result may reflect the impact of Gem and the requirement for ERCC1 expression for CDDP/Gem synergism or may be attributable to the relatively small patient sample size in this study. Prospective studies of ERCC1 as a predictive marker for activity of CDDP-based regimens in NSCLC are warranted.

INTRODUCTION
Lung cancer is the leading cause of cancer death in both men and women in many countries, including Spain and the United States. More than 75% of lung cancers are NSCLC.4 Except for some patients with surgically resectable disease, the prognosis for patients with NSCLC is poor. Platinum-based chemotherapy has been shown to provide survival and quality of life benefits for patients with advanced stage, unresectable NSCLC, but overall 2-year survival rates for this group remain 15% (1, 2).

Received 12/11/01; revised 4/15/02; accepted 4/15/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Funded in part by NIH/National Cancer Institute Grant CA 63265 (to D. G.), Grant CA 71716 (to P. V. D.), and Grants CM 17101 and CA 62505 to University of California, Davis Cancer Center (to D. G. and P. H. G.), and a grant from the University of Southern California (to K. D. D. and P. V. D.). 2 Both authors contributed equally to this work. 3 To whom requests for reprints should be addressed, at Hospital Germans Trias i Pujol, Medical Oncology Service, Ctra de Canyet, s/n 08916 Badalona, Barcelona, Spain. Phone: 3493-497-8925; Fax: 3493497-8950; E-mail: rrosell@ns.hugtip.scs.es.

The abbreviations used are: NSCLC, non-small cell lung cancer; CDDP, cisplatin, cis-diamminedichloroplatinum; Gem, Gemcitabine, 2 ,2 -difluorodeoxycytidine; ERCC1, excision repair cross-complementing gene 1; XPA, xeroderma pigmentosum group A protein; ECOG, Eastern Cooperative Oncology Group; SLCG, Spanish Lung Cancer Group; CI, confidence interval.

Clinical Cancer Research 2287

Pharmacogenetics, the study of genes that influence drug activity and toxicity, offers the possibility of tailoring therapy to the specific genetic profile of individual patients and tumors. A pharmacogenetic approach can thus potentially increase response rates and survival outcomes while decreasing toxicity and overall treatment costs. The cytotoxic effect of the anticancer drug CDDP is principally attributable to the formation of bulky intrastrand platinum-DNA adducts. Removal of these adducts from genomic DNA is mediated by the nucleotide excision repair pathway, (3, 4), a critical element of which for this function is the ERCC1 gene (3, 5, 6). DNA repair can be attenuated by blocking the interaction between ERCC1 protein and the XPA (7), and high ERCC1 expression is associated with resistance to platinum-containing therapy in human ovarian and gastric tumor specimens (8, 9). Cytotoxic synergism has been demonstrated between Gem and CDDP, (10 13), and a higher response rate was found for the combination of Gem plus CDDP compared with a standard CDDP plus etoposide regimen in patients with advanced NSCLC (14). Importantly, this Gem/ CDDP synergism has been shown to involve ERCC1 and the nucleotide excision repair pathway; expression of ERCC1 antisense RNA abrogates gemcitabine-mediated cytotoxic synergism with CDDP in vitro in human colon cancer cells defective in mismatch repair but proficient in nucleotide excision repair (15). In this study, we investigated whether these in vitro findings apply in vivo by measuring ERCC1 mRNA levels in primary NSCLC tissues and correlating these with the clinical outcomes for patients treated as part of a prospective randomized trial with a combined Gem/CDDP regimen.

MATERIALS AND METHODS

Patients and Samples. Clinical data were retrieved from the medical and trial database records of patients with advanced NSCLC who were treated with a standardized Gem/CDDP regimen at various hospitals of the SLCG. All patients were enrolled in the Gem/CDDP arm of a prospective multicenter three-arm randomized trial (GECP/98-02), the SLCG Phase III trial of Gem/CDDP versus Gem/CDDP/vinorelbine versus sequential doublets of Gem/vinorelbine followed by ifosfamide/ vinorelbine in advanced NSCLC (16). The patients were treated between October 1998 and September 2000. All patients received Gem 1250 mg/m2 on days 1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks. Eligibility criteria for GECP/ 98-02 were measurable stage IV (with brain metastases eligible if asymptomatic) or stage IIIB (malignant pleural and/or pericardial effusion and/or supraclavicular adenopathy) NSCLC and ECOG performance score 0 2. All patients had chest X-ray and a computed tomography scan of the chest and upper abdomen before entry into the study and underwent repeat evaluations at least every 6 weeks. Tumor response was assessed according to WHO criteria as complete response, partial response, stable disease, and progressive disease. Tumors were reassessed during treatment with the same imaging methods used to establish the baseline tumor measurement. All patients gave signed informed consent, and the study was approved by the institutional ethics review boards. Archival primary tumor specimens from each patient were retrieved from

the participating SLCG centers after review of the H&E-stained slides. RNA Isolation and cDNA Synthesis. RNA isolation from paraffin-embedded specimens was done according to a proprietary procedure (US patent number 6,248,535). After RNA isolation, cDNA was prepared from each sample as described previously (17). Reverse Transcription-PCR Quantification of mRNA Expression. Relative cDNA quantitation for ERCC1 and an internal reference gene ( -actin) was done using a fluorescencebased, real-time detection method (ABI PRISM 7700 Sequence Detection System; TaqMan; Applied Biosystems, Foster City, CA), as described previously (1719). The primers and probe sequences used are given below. In each case, the first primer is the forward PCR primer, the second is the reverse PCR primer, and the third is the Taqman probe: ERCC1, GGGAATTTGGCGACGTAATTC, GCGGAGGCTGAGGAACAG, and 6FAM (carboxyfluorescein) 5 -CACAGGTGCTCTGGCCCAGCACATA-3 TAMRA (N,N,N ,N -tetramethyl-6-carboxyrhodamine); -actin, TGAGCGCGGCTACAGCTT, TCCTTAATGTCACGCACGATTT, and 6FAM5 ACCACCACGGCCGAGCGG-3 TAMRA. The PCR reaction mixture consisted of 600 nM of each primer, 200 nM probe, 2.5 units of AmpliTaq Gold polymerase, 200 M each dATP, dCTP, dGTP, 400 M dUTP, 5.5 mM MgCl2, and 1 Taqman Buffer A containing a reference dye, to a final volume of 25 l (all reagents were from Applied Biosystems, Foster City, CA). Cycling conditions were 50C for 10 s, 95C for 10 min, followed by 46 cycles at 95C for 15 s and 60C for 1 min. Colon, liver, and lung RNAs (all from Stratagene, La Jolla, CA) were used as control calibrators on each plate. All gene expression analyses were performed in a blinded fashion with the laboratory investigators unaware of the clinical data. Statistical Analysis. TaqMan analyses yield values that are expressed as ratios between two absolute measurements (gene of interest/internal reference gene). The Mann-Whitney t test was used to test for significant associations between the continuous test variable ERCC1 expression and dichotomous variables (patient sex, age above and below the median age, presence of weight loss, presence of pleural effusion, and tumor stage). The Kruskal-Wallis test was used to test for significant differences in ERCC1 expressions within multiple groups (ECOG performance status and histology). Fishers exact test was used for the analysis of categorical clinicopathological values including response and dichotomized ERCC1 values. All patients were followed from first study treatment until death or until the data were censored, with the patient considered to be alive as of April 2001. Kaplan-Meier survival curves and the log-rank test were used to analyze univariate distributions for survival and disease-free survival. The maximal 2 method of Miller and Siegmund (20) and Halpern (21) was adapted to determine which expression value best segregated patients into poor and good prognosis subgroups (in terms of likelihood of surviving), with the log-rank test as the statistic used to measure the strength of the grouping. To determine a P that would be interpreted as a measure of the strength of the association based on the maximal 2 analysis, 1000 boot-straplike simulations were used to estimate the distribution of the

2288 ERCC1 Expression and Survival in NSCLC

Table 1

Patient characteristics n (%)

No. of patients Sex Male Female Age, yr Median Range ECOG performance status 0 1 2 Weight loss Stage IIIB IV Pleural effusion Histopathology Adenocarcinoma Squamous cell carcinoma Large cell carcinoma Unspecified Response Complete response Partial response Stable disease Progressive disease Not evaluablea
a

56 (100) 48 (85.7) 8 (14.3) 60.5 3275 13 (23.2) 35 (62.5) 8 (14.3) 21 (37.5) 16 (28.6) 40 (71.4) 11 (19.6) 30 (53.6) 20 (35.7) 4 (7.1) 2 (3.6) 3 (5.4) 18 (32.1) 8 (14.3) 18 (32.1) 9 (16.1) Fig. 1 Kaplan-Meier survival curve for patients with intratumoral ERCC1 levels above and below the median ERCC1 level.

Due to early death or malignant pleural effusion.

maximal 2 statistics under the hypothesis of no association (21). Coxs proportional hazards modeling of factors that were significant in univariate analysis was performed to identify which factors might have a significant influence on survival. SPSS version 10.0.5 software (SPSS, Inc., Chicago, IL) was used for all statistical analyses. All Ps were two-sided.

RESULTS
Patient and Tumor Characteristics. Demographic details on the 56 patients included in the study and tumor stage and cell type details are shown in Table 1. The median number of treatment cycles received was three (range, one to six). Three of the 56 patients had received radiotherapy, and 5 patients had undergone surgical resection of the primary tumor. ERCC1 Expression Levels. ERCC1 mRNA expression was detectable in all 56 samples analyzed. The median ERCC1 expression, relative to the expression of the internal control housekeeping gene -actin, was 6.7 10 3 (range, 0.8 10 3 to 24.6 10 3; values shown hereafter without x 10 3, e.g., median, 6.7). Twenty-eight (50%) patients had an ERCC1 level greater than the median, and 50% had a level 6.7. There were no significant associations between ERCC1 levels and any of the factors age (P 0.66), sex (P 0.18), presence of weight loss in the 6 months before randomization (P 0.74), tumor stage (IIIB versus IV; P 0.39), or presence of pleural effusion (P 0.25, all Mann-Whitney t test). There were also no significant differences between the ERCC1 levels among patients with different performance status grades (P 0.48, Kruskal-Wallis test) or different tumor cell types (all four tumor types, P 0.10, Kruskal-Wallis test), but ERCC1 expression

levels were significantly higher in squamous cell carcinomas (median, 8.6) compared with adenocarcinomas (median, 5.2; P 0.015, Mann-Whitney test). Response to Chemotherapy. The tumor response frequencies for the 47 patients who were evaluable for response are shown in Table 1. The overall response rate was 44.7%. The ERCC1 expression levels in the complete response and partial response, i.e., responding tumors (median, 4.3; range, 1.2 24.6) were not significantly different from the levels in the stable disease and progressive disease, i.e., non-responding tumors (median, 7.85; range, 0.8 24.3; P 0.31, Mann-Whitney test). There were also no significant differences between the proportion of responding and nonresponding tumors with ERCC1 values greater and less than any ERCC1 level (all Fishers exact test). The response rate in tumors with ERCC1 expression below the median value (low expression, 52% responders) was higher than for tumors with ERCC1 expression above the median value (high expression, 36.4% responders; Fishers exact test, P 0.38). Association between Patient Overall Survival and ERCC1 Levels. The median overall survival time was 36.6 weeks (range, 0 113.4 weeks), and the median time to progression was 24.4 weeks (range, 0 102.9 weeks). Use of the logrank test and the maximal 2 statistic to identify ERCC1 levels that segregated patients into poor and good prognosis subgroups showed that the range of discriminatory values included the median value, which was therefore used as the cutoff value for the survival analysis. Fig. 1 shows the Kaplan-Meier survival curve for patients with intratumoral ERCC1 levels above and below the median ERCC1 level. As shown in Table 2, patients with ERCC1 levels below the median had a significantly longer median survival of 61.6 weeks (95% CI, 42.4 80.7 weeks) compared with 20.4 weeks (95% CI, 6.9 33.9 weeks) for patients with ERCC1 levels above the median. Adjusted for tumor stage, the log-rank statistic for the association between low or high ERCC1 expression and overall survival was 3.97, and the P was 0.046. The unadjusted log-rank results are shown in Table 2.

Clinical Cancer Research 2289

Table 2

Factors associated with overall survival Univariable analysis Multivariable analysis Hazard ratio (95% CI) 0.32 (0.140.71) 0.36 (0.170.75) (0 vs. 1 or 2) 0.26 (0.090.76) P 0.005 0.007 0.014

Median survival (wk) ERCC1 expression Lowa Higha Weight loss Absent Present ECOG performance status 0 1 2 62 20 46 14 61 31 5

Log-rank statistic 6.78 8.89 10.29

P 0.009 0.003 0.005

a ERCC1 expression values are categorized according to whether there was less than the ERCC1 median value of 6.7 (low expression) or greater than the median (high expression).

An ERCC1 cutoff value of 5.8 was tested because this value was shown in a previous study to be associated with overall survival for patients with gastric cancer (9). Overall survival was significantly better for the group of NSCLC patients in this study with ERCC1 levels 5.8 (median, 74.71 weeks; 95% CI, 71.7777.66 weeks) compared with those with ERCC1 levels 5.8 (median, 61.0 weeks; 95% CI, 45.6176.39 weeks; unadjusted log-rank statistic, 6.37; P 0.011). Other factors that were significantly associated with overall survival on univariable analysis using Kaplan Meier survival curves and the log-rank test were the presence of pretreatment weight loss and the ECOG performance status (Table 2). Patient age (P 0.18), sex (P 0.87), tumor stage (P 0.99), tumor cell type (SCC versus adenocarcinoma P 0.63), and presence of pleural effusion (P 0.71) were not significant prognostic factors for overall survival. ERCC1 level, ECOG performance status, and weight loss remained significant prognostic factors for survival in the Cox proportional hazards regression model multivariable analysis (Table 2). Ps for a Cox regression model stratified on tumor stage were 0.038 for ERCC1, 0.017 for weight loss and 0.02 for ECOG performance status (performance status 0 versus 1 or 2).

DISCUSSION
This study found an association between lower ERCC1 mRNA expression levels and improved survival after treatment with a combination Gem/CDDP regimen for patients with advanced stage NSCLC. Experimental studies have shown that high ERCC1 levels are associated with increased removal of CDDP-induced DNA adducts and relative CDDP resistance (5), and ERCC1-defective cells or knockout mice are highly sensitive to DNA cross-linking agents (22, 23). Lee et al. (24) showed that transfecting ERCC1 into a UV repair-deficient [ERCC1( )] Chinese hamster ovary cell line conferred DNA adduct repair capability and CDDP resistance. These findings suggest that the likely explanation for our results is that intratumoral ERCC1 levels are associated with the effectiveness of CDDP therapy because ERCC1 expression influences ERCC1mediated DNA adduct repair activity (25). Confidence in our results is derived from the fact that, although the genetic analysis was performed retrospectively

after the trial was closed, the clinical data were collected prospectively under the conditions of a multicenter randomized trial, and the laboratory work was performed in a blinded fashion. Furthermore, other studies have also found an association between lower intratumoral ERCC1 expressions and improved clinical outcomes for patients treated with platinumcontaining regimens. Metzger et al. (9) found a significant association between ERCC1 levels and survival after CDDP/5fluorouracil therapy for patients with gastric cancer. Metzger et al. (9) used a cutoff ERCC1 mRNA expression value of 5.8, which also divided patients in a statistically significant way into good and poor survival arms in our study, although a higher ERCC1 level was a more powerful discriminator. Dabholkar et al. (26) reported that patients with ovarian cancer who were clinically resistant to platinum-based therapy had a statistically significant 2.6-fold higher expression level of ERCC1 in their tumor tissue than patients who responded to that therapy. A further study showed that both ERCC1 and XPAC (the human excision repair gene that corrects the defect in xeroderma pigmentosum group A cells) were important for response to platinum-based chemotherapy in ovarian cancer tissues (8). Other studies have also reported associations between higher ERCC1 expressions and worse clinical outcomes for CDDP-based therapy for esophageal cancer (27, 28) and for oxaliplatin/5-fluorouracil treatment for colorectal cancer (29). In addition to associations with survival outcomes, several of these studies found associations between ERCC1 expression and chemoresponse (8, 9, 26, 28, 29). These studies included patients treated with CDDP but not with Gem. A significant association with response was not found in our study, but this finding was not unexpected because of the requirement for ERCC1 for CDDP/Gem synergism (15). Despite this requirement, ERCC1 levels remain important, as indicated by the association with survival and the trend toward a lower response rate in patients with high ERCC1 mRNA tumor levels. It is also noteworthy that the 52% response rate in the low ERCC1 group is considerably higher than the 21 40.6% response rates reported in other CDDP/Gem NSCLC randomized trials (14, 30 32). Cisplatin- or carboplatin-containing regimens have been considered a standard of care in the therapy of advanced stage

2290 ERCC1 Expression and Survival in NSCLC

NSCLCs for 15 years (1). Recently, randomized studies have sought to determine whether nonplatinum combinations of newer agents were either more efficacious or less toxic. Results have been inconclusive, suggesting that a therapeutic plateau for currently available chemotherapy has been reached (3338). Instead, novel therapeutic approaches will likely be required to optimize chemotherapy effectiveness in individual patients, and the use of potential molecular predictors of response and survival in individual NSCLC patients may well become important criteria for chemotherapy selection (39, 40). Recent studies of NSCLC cells or tissues have identified several potentially valuable chemosensitivity markers in addition to ERCC1 (8, 39, 41 43), but validation of these markers is still required. Another potential clinical consequence of our findings is that, as suggested by Li et al. (5), pharmacological approaches that inhibit ERCC1 expression may increase cellular sensitivity to CDDP. UCN-01 (7-hydroxylstaurosporine) is a cell cycle checkpoint abrogator that has been shown to inhibit nucleotide excision repair, attenuate the interaction of ERCC1 with XPA (7), and potentiate CDDP cytotoxicity (44). In the present study, the multivariate analyses confirmed the strength of the ERCC1 mRNA levels, which was even more significant than that of performance status. Further validation of these findings could lead to a dramatic change in clinical practice, avoiding unnecessary CDDP chemotherapy in almost half of NSCLC patients. The Preliminary Genotypic International Lung Trial, a prospective randomized trial testing the importance of ERCC1 expression and other factors for CDDP effectiveness in NSCLC patients, is under way.

REFERENCES
1. Bunn, P. A., Jr., and Kelly, K. New chemotherapeutic agents prolong survival and improve quality of life in non-small cell lung cancer: a review of the literature and future directions. Clin. Cancer Res., 4: 10871100, 1998. 2. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Br. Med. J., 311: 899 909, 1995. 3. Reed, E. Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treat. Rev., 24: 331344, 1998. 4. Reardon, J. T., Vaisman, A., Chaney, S. G., and Sancar, A. Efficient nucleotide excision repair of cisplatin, oxaliplatin, and bis-acetoammine-dichloro-cyclohexylamine-platinum(IV) (JM216) platinum intrastrand DNA diadducts. Cancer Res., 59: 3968 3971, 1999. 5. Li, Q., Yu, J. J., Mu, C., Yunmbam, M. K., Slavsky, D., Cross, C. L., Bostick-Bruton, F., and Reed, E. Association between the level of ERCC-1 expression and the repair of cisplatin-induced DNA damage in human ovarian cancer cells. Anticancer Res., 20: 645 652, 2000. 6. Yu, J. J., Lee, K. B., Mu, C., Li, Q., Abernathy, T. V., BostickBruton, F., and Reed, E. Comparison of two human ovarian carcinoma cell lines (A2780/CP70 and MCAS) that are equally resistant to platinum, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol., 16: 555560, 2000. 7. Jiang, H., and Yang, L. Y. Cell cycle checkpoint abrogator UCN-01 inhibits DNA repair: association with attenuation of the interaction of XPA and ERCC1 nucleotide excision repair proteins. Cancer Res., 59: 4529 4534, 1999. 8. Dabholkar, M., Vionnet, J., Bostick-Bruton, F., Yu, J. J., and Reed, E. Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy. J. Clin. Investig., 94: 703708, 1994.

9. Metzger, R., Leichman, C. G., Danenberg, K. D., Danenberg, P. V., Lenz, H. J., Hayashi, K., Groshen, S., Salonga, D., Cohen, H., Laine, L., Crookes, P., Silberman, H., Baranda, J., Konda, B., and Leichman, L. ERCC1 mRNA levels complement thymidylate synthase mRNA levels in predicting response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J. Clin. Oncol., 16: 309 316, 1998. 10. van Moorsel, C. J., Pinedo, H. M., Veerman, G., Bergman, A. M., Kuiper, C. M., Vermorken, J. B., van der Vijgh, W. J., and Peters, G. J. Mechanisms of synergism between cisplatin and gemcitabine in ovarian and non-small-cell lung cancer cell lines. Br. J. Cancer, 80: 981990, 1999. 11. Bergman, A. M., Ruiz, V. H. V., Veerman, G., Kuiper, C. M., and Peters, G. J. Synergistic interaction between cisplatin and gemcitabine in vitro. Clin. Cancer Res., 2: 521530, 1996. 12. Rosell, R., Tonato, M., and Sandler, A. The activity of gemcitabine plus cisplatin in randomized trials in untreated patients with advanced non-small cell lung cancer. Semin. Oncol., 25: 2734, 1998. 13. Edelman, M. J., Quam, H., and Mullins, B. Interactions of gemcitabine, carboplatin and paclitaxel in molecularly defined non-small-cell lung cancer cell lines. Cancer Chemother. Pharmacol., 48: 141144, 2001. 14. Cardenal, F., Lopez-Cabrerizo, M. P., Anton, A., Alberola, V., Massuti, B., Carrato, A., Barneto, I., Lomas, M., Garcia, M., Lianes, P., Montalar, J., Vadell, C., Gonzalez-Larriba, J. L., Nguyen, B., Artal, A., and Rosell, R. Randomized Phase III study of gemcitabine-cisplatin versus etoposide-cisplatin in the treatment of locally advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 17: 1218, 1999. 15. Yang, L. Y., Li, L., Jiang, H., Shen, Y., and Plunkett, W. Expression of ERCC1 antisense RNA abrogates Gemicitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but proficient in nucleotide excision repair. Clin. Cancer Res., 6: 773781, 2000. 16. Alberola, V., Camps, C., Provencia, M., Rosell, R., Vadell, C., Bover, I., Rui Zcasado, A., Azagra, P., Jimenez, U., Gonzalez-Larriba, J., Cardenal, F. A. A., Carrato, A., Morales, S., and Sanchez, J. Cispla tin/Gemcitabine (CG) versus cisplatin/Gemcitabine/vinorelbine (CGV) versus sequential doublets of Gemcitabine/vinorelbine followed by ifosfamide/vinorelbine (GV/IV) in advanced NSCLC: results of a Spanish Lung Cancer Group Phase III trial (GEPC/98-02). Proc. Am. Soc. Clin. Oncol., 20: 308a, 2001. 17. Lord, R. V., Salonga, D., Danenberg, K. D., Peters, J. H., DeMeester, T. R., Park, J. M., Johansson, J., Skinner, K. A., Chandrasoma, P., DeMeester, S. R., Bremner, C. G., Tsai, P. I., and Danenberg, P. V. Telomerase reverse transcriptase expression is increased early in the Barretts metaplasia, dysplasia, adenocarcinoma sequence. J. Gastrointest. Surg., 4: 135142, 2000. 18. Gibson, U. E., Heid, C. A., and Williams, P. M. A novel method for real time quantitative RT-PCR. Genome Res., 6: 9951001, 1996. 19. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. Real time quantitative PCR. Genome Res., 6: 986 994, 1996. 20. Miller, R., and Siegmund, D. Maximally selected 2 statistics. Biometrics, 38: 10111016, 1982. 21. Halpern, J. Maximally selected 2 statistics for small samples. Biometrics, 38: 10171023, 1982. 22. Westerveld, A., Hoeijmakers, J. H., van Duin, M., de Wit, J., Odijk, H., Pastink, A., Wood, R. D., and Bootsma, D. Molecular cloning of a human DNA repair gene. Nature (Lond.), 310: 425 429, 1984. 23. Melton, D. W., Ketchen, A. M., Nunez, F., Bonatti-Abbondandolo, S., Abbondandolo, A., Squires, S., and Johnson, R. T. Cells from ERCC1-deficient mice show increased genome instability and a reduced frequency of S-phase-dependent illegitimate chromosome exchange but a normal frequency of homologous recombination. J. Cell Sci., 111: 395 404, 1998. 24. Lee, K. B., Parker, R. J., Bohr, V., Cornelison, T., and Reed, E. Cisplatin sensitivity/resistance in UV repair-deficient Chinese hamster ovary cells of complementation groups 1 and 3. Carcinogenesis (Lond.), 14: 21772180, 1993.

Clinical Cancer Research 2291

25. Chaney, S. G., and Sancar, A. DNA repair: enzymatic mechanisms and relevance to drug response. J. Natl. Cancer Inst., 88: 1346 1360, 1996. 26. Dabholkar, M., Bostick-Bruton, F., Weber, C., Bohr, V. A., Egwuagu, C., and Reed, E. ERCC1 and ERCC2 expression in malignant tissues from ovarian cancer patients. J. Natl. Cancer Inst., 84: 1512 1517, 1992. 27. Moore-Joshi, M. H., Danenberg, K. D., Lord, R. V., Johansson, J., Uetake, H., Danenberg, P. V., and Harpole, D. H., Jr. Low thymidylate synthase and ERCC1 gene expressions are associated with increased survival after neoadjuvant 5-FU/cisplatin/radiotherapy for esophageal adenocarcinoma. Proc. Am. Soc. Clin. Oncol., 19: 244A, 2000. 28. Metzger, R., Schneider, P. M., Baldus, S. E., et al. Quantitative ERCC1 RNA expression identifies non-response to cis-platinum based neoadjuvant radiochemotherapy for esophageal cancer. Proc. Am. Soc. Clin. Oncol., 20: 130a, 2001. 29. Shirota, Y., Stoehlmacher, J., Brabender, J., Xiong, Y., Uetake, H., Danenberg, K. D., Groshen, S., Tsao-Wei, D. D., Danenberg, P. V., and Lenz, H. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil chemotherapy. J. Clin. Oncol., 19: 4298 4304, 2001. 30. Sandler, A. B., Nemunaitis, J., Denham, C., von Pawel, J., Cormier, Y., Gatzemeier, U., Mattson, K., Manegold, C., Palmer, M. C., Gregor, A., Nguyen, B., Niyikiza, C., and Einhorn, L. H. Phase III trial of gemcitabine plus cisplatin versus cisplatin alone in patients with locally advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 18: 122130, 2000. 31. Crino, L., Scagliotti, G. V., Ricci, S., De Marinis, F., Rinaldi, M., Gridelli, C., Ceribelli, A., Bianco, R., Marangolo, M., Di Costanzo, F., Sassi, M., Barni, S., Ravaioli, A., Adamo, V., Portalone, L., Cruciani, G., Masotti, A., Ferrara, G., Gozzelino, F., and Tonato, M. Gemcitabine and cisplatin versus mitomycin, ifosfamide, and cisplatin in advanced non-small-cell lung cancer: a randomized Phase III study of the Italian Lung Cancer Project. J. Clin. Oncol., 17: 35223530, 1999. 32. Schiller, J. H., Harrington, D., Belani, C., Langer, C., Sandler, A., Krook, J., Zhu, J., and Johnson, D. H. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N. Engl. J. Med., 346: 9298, 2002. 33. Georgoulias, V., Papadakis, E., Alexopoulos, A., Tsiafaki, X., Rapti, A., Veslemes, M., Palamidas, P., Vlachonikolis, I., and the Greek Oncology Cooperative Group G. Platinum-based and non-platinumbased chemotherapy in advanced non-small-cell lung cancer: a randomised multicentre trial. Lancet, 357: 1478 1484, 2001. 34. Gridelli, C., Perrone, F., Palmeri, S., DAprile, M., Cognetti, F., Rossi, A., Gebbia, V., Pepe, R., Veltri, E., Airoma, G., Russo, A., Incoronato, P., Scinto, A. F., Palazzolo, G., Natali, M., Leonardi, V.,

Gallo, C., De Placido, S., and Bianco, A. R. Mitomycin C plus vindesine plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin (MVP) in stage IV non-small-cell lung cancer: a Phase III multicentre randomised trial. The Gruppo Oncologico Centro-Sud-Isole (G. O. C. S. I.). Ann. Oncol., 7: 821 826, 1996. 35. Gatzemeier, U., Heckmayr, M., Hossfeld, D. K., Kaukel, E., Koschel, G., and Neuhauss, R. A randomized trial with mitomycin-C/ ifosfamide versus mitomycin-C/vindesine versus cisplatin/etoposide in advanced non-small-cell lung cancer. Am. J. Clin. Oncol., 14: 405 411, 1991. 36. Kosmidis, P. A., Bacoyiannis, C., Mylonakis, N., et al. A randomized Phase III trial of paclitaxel plus carboplatin versus paclitaxel plus gemcitabine in advanced non small cell lung cancer (NSCLC). A preliminary analysis. Proc. Am. Soc. Clin. Oncol., 19: 488, 2000. 37. Yamamoto, N., Fukuoka, M., Nakagawa, K., et al. Randomized Phase II study of docetaxel (DOC) plus cisplatin (CDDP) versus DOC plus irinotecan in advanced non-small cell lung cancer (NSCLC): A West Japan Thoracic Oncology Group (WJTOG) study. Ann. Oncol., 11 (Suppl. 4): S107, 2000. 38. Van Meerbeeck, J. P., Smit, E. F., Lianes, P., Schramel, F., Lenz, M., Debruyne, C., and Giaccone, G. A EORTC randomized Phase III trial of three chemotherapy regimens in advanced non-small-cell lung cancer (NSCLC). Proc. Am. Soc. Clin. Oncol., 20: 308a, 2001. 39. Rosell, R., Taron, M., and OBrate, A. Predictive molecular markers in non-small cell lung cancer. Curr. Opin. Oncol., 13: 101109, 2001. 40. Rosell, R., Green, M., and Gumerlock, P. Advances in the treatment of non-small cell lung cancer: molecular markers take the stage. Semin. Oncol., 28: 28 34, 2001. 41. Young, L. C., Campling, B. G., Cole, S. P., Deeley, R. G., Gerlach, J. H. Multidrug resistance proteins MRP3. MRP1, and MRP2 in lung cancer: correlation of protein levels with drug response and messenger RNA levels. Clin. Cancer Res., 7: 1798 1804, 2001. 42. Mack, P. C., Gandara, D. R., Bowen, C., Edelman, M. J., Paglieroni, T., Schnier, J. B., Gelmann, E. P., and Gumerlock, P. H. RB status as a determinant of response to UCN-01 in non-small cell lung carcinoma. Clin. Cancer Res., 5: 2596 2604, 1999. 43. Monzo, M., Rosell, R., Sanchez, J. J., Lee, J. S., OBrate, A., Gonzalez-Larriba, J. L., Alberola, V., Lorenzo, J. C., Nunez, L., Ro, J. Y., and Martin, C. Paclitaxel resistance in non-small-cell lung cancer associated with -tubulin gene mutations. J. Clin. Oncol., 17: 1786 1793, 1999. 44. Pollack, I. F., Kawecki, S., and Lazo, J. S. Blocking of glioma proliferation in vitro and in vivo and potentiating the effects of BCNU and cisplatin: UCN-01, a selective protein kinase C inhibitor. J. Neurosurg., 84: 1024 1032, 1996.

Vol. 10, 4215s 4219s, June 15, 2004 (Suppl.)

Clinical Cancer Research 4215s

Gene Expression as a Predictive Marker of Outcome in Stage IIB-IIIA-IIIB Non-Small Cell Lung Cancer After Induction Gemcitabine-Based Chemotherapy Followed By Resectional Surgery
Rafael Rosell,1 Enriqueta Felip,2 Miquel Taron,1 Joaquim Majo,3 Pedro Mendez,1 Maria Sanchez-Ronco,4 Cristina Queralt,1 Jose Javier Sanchez,4 and Jose Maestre5
Institut Catala dOncologia, Medical Oncology Service, Hospital Germans Trias i Pujol, Barcelona; 2Medical Oncology Service, Pathology Department, 4Autonomous University of Madrid, Madrid, Spain; and 5Department of Thoracic Surgery, Hospital Vall dHebron, Barcelona
3 1

(65% versus 54%; P 0.24), complete resections (94% versus 72%; P 0.03), lobectomies (71% versus 34%; P 0.004), and pathological complete responses (29% versus 0%; P 0.00001) Conclusions: Patients with RRM1 levels in the bottom quartile benefited significantly from gemcitabine/cisplatin neoadjuvant chemotherapy, leading us to conclude that RRM1 mRNA levels should be additionally validated to proceed with tailored chemotherapy.

ABSTRACT
Purpose: The first suggestions of a relationship between gene mRNA expression and differential sensitivity to gemcitabine/cisplatin are now emerging. ERCC1, RRM1, and XPD are involved in the nucleotide excision repair pathways, and tumor up-regulation of these genes leads to chemotherapy failure. In the present study, we have examined the potential correlation and predictive value of ERCC1, RRM1, and XPD mRNA expression in resected specimens from 67 stage IIB, IIIA, and IIIB non-small cell lung cancer patients treated with neoadjuvant gemcitabine/platinum followed by surgery Experimental Design: ERCC1, RRM1, and XPD expression was quantified using real-time quantitative reverse transcription-PCR. Results: A good correlation was found between mRNA expression levels of the three genes. For RRM1 levels, patients in the bottom quartile had a decreased risk of death compared with those in the top quartile (risk ratio 0.30; P 0.033). Median survival for the 17 patients in the bottom quartile was 52 months, whereas for the 15 in the top quartile, it was 26 months (P 0.018). When the characteristics of these 17 patients were compared with all of the other 50 patients, no differences in initial staging were observed. However, the 17 patients in the bottom quartile had better outcomes, including more radiographic responses

INTRODUCTION
The overall 5-year survival of patients with non-small cell lung cancer (NSCLC) has remained at 15% for the past 20 years. For patients with clinical stage IIB (T12N1M0 and T3N0M0), 5-year survival is 25%; for those with stage IIIA (T3N1M0 and T12-3N2M0), it is 13%; and for those with stage IIIB (T4N0 1-2M0), it bottoms out at 7% (1). Small randomized studies of neoadjuvant chemotherapy in stage IIIA (2) or stage IIB-IIIB (3) showed remarkable improvement in survival over patients treated either with surgery alone or with surgery followed by adjuvant radiotherapy. Event-free survival was similar in the two studies: 12.7 (2) and 20 (3) months in the neoadjuvant chemotherapy arm and 5.8 (2) and 5 (3) months in the surgery arm. The efficiency of removal of cisplatin DNA adducts by the nucleotide excision repair (NER) system is assumed to be one of the determinants of cisplatin resistance (4, 5). Excision repair cross-complementation group 1 (ERCC1) is a single-stranded DNA endonuclease, which forms a tight heterodimer with xeroderma pigmentosum complementation group F. Its role in NER is to incise DNA on the 5 side of lesions such as cisplatin DNA adducts. Overexpression of ERCC1 and other NER genes has been associated with repair of cisplatin-induced DNA damage and clinical resistance to cisplatin (4 8), and repair of cisplatin DNA adducts does not occur in the absence of functional ERCC1 (4 8). Ribonucleotide reductase is responsible for the reduction of ribonucleotides to their corresponding deoxyribonucleotides, providing a balanced supply of precursors for DNA synthesis and repair. Alterations in ribonucleotide reductase levels can have significant effects on such biological properties of cells as tumor promotion and tumor progression and can potentiate metastasis. It has been reported that transcription coupled-NER-deficient cells, with underexpression of xeroderma pigmentosum group D (XPD), are hypersensitive to cisplatin regardless of their global genome-NER status. On the basis of these data, we have examined for the first time the potential correlation and predictive value of ERCC1, ribonucleotide reductase subunit M1 (RRM1), and XPD mRNA expression in resected specimens from stage IIB, IIIA, and IIIB

Presented at the First International Conference on Novel Agents in the Treatment of Lung Cancer, October 1718, 2003, Cambridge, Massachusetts. Grant support: Eli Lilly & Co., Redes Tematicas de Investigacion Cooperativa de Centros de Cancer (CO-010), Red de Centros de Epi demiologa y Salud Publica (RCESP), and by La Fundacio Badalona Contra El Cancer. ` Requests for reprints: Rafael Rosell, Medical Oncology Service, Scientific Director of Oncology Research, Institut Catala dOncologia, ` Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916 Barcelona, Spain. Phone: 34-93-497-89-25; Fax: 34-93-497-89-50; E-mail: rrosell@ ns.hugtip.scs.es.

4216s RRM1 mRNA Expression in NSCLC

NSCLC patients treated with neoadjuvant gemcitabine/cisplatin followed by surgery.

PATIENTS AND METHODS

Patients. The present study composed of 67 consecutive stage IIB-IIIA-IIIB NSCLC patients from one single institution (Hospital Vall dHebron, Barcelona, Spain). Initially, surgical resection of both primary disease and hilar/mediastinal nodal disease was recommended for patients with stage IIB-IIIA NSCLC, and patients with potentially resectable T4 N0 lesions (stage IIIB) were also eligible for this study. All of the patients were medically fit to undergo surgical resection, and they underwent surgery between September 1998 and December 2002, after receiving neoadjuvant gemcitabine/platinum chemotherapy. Baseline patient characteristics are shown in Table 1. Patients received three cycles of neoadjuvant chemotherapy; 63 received cisplatin 100 mg/m2 day 1 and gemcitabine 1250 mg/m2 day 1 and 8 every 21 days; and 4 patients with creatinine clearance 60 ml/min received carboplatin area under the curve 5 day 1 and gemcitabine 1000 mg/m2 day 1 and 8 every

Table 1

Patient characteristics and surgical results for all patients Characteristic No. patients 7 60 64 4576 29 26 11 1 6 5 10 13 20 8 5 63 4 38 23 6 52 10 5 5 29 29 4 5 43 39 16 1 9 7 15 19 30 12 7 94 6 57 34 9 78 15 7 7 43 43 6 7 % 10 90

Sex Female Male Age, years Median Range Histology Squamous cell carcinoma Adenocarcinoma Large-cell carcinoma Other Initial staging IIB T3N0 IIIA T3N1 T1N2 T2N2 T3N2 IIIB T4N0 T4N1 T4N2 Chemotherapy regimen Gemcitabine/cisplatin Gemcitabine/carboplatin Radiographic response Partial response Stable disease Progressive disease Surgical results Complete resection Incomplete resection Unresectable Pathologic complete response Surgical procedures Lobectomy Pneumonectomy Bilobectomy Unresectable

21 days. Clinical tumor response was evaluated after three chemotherapy cycles according to the Eastern Cooperative Oncology Group criteria for solid-tumor response. A thoracotomy was performed within 4 5 weeks after the last chemotherapy cycle; the surgical procedure was based on the extent of tumor at the time of the initial presentation. Laboratory Methods. Total RNA was recovered from formalin-fixed, paraffin-embedded surgical specimens using proteinase K digestion and phenol-chloroform extraction as described previously (9). After cDNA synthesis XPD, ERCC1, and RRM1 expression was analyzed with real-time quantitative PCR. Quantification of gene expression was performed using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA). The primers and 5 -labeled probe were as follows: -actin, forward 5 TGA GCG CGG CTA CAG CTT 3 , reverse 5 TCC TTA ATG TCA CGC ACG ATT T 3 , and probe 5 ACC ACC ACG GCC GAG CGG 3 ; ERCC1, forward 5 GGG AAT TTG GCG ACG TAA TTC 3 , reverse 5 GCG GAG GCT GAG GAA CAG 3 , probe 5 CAC AGG TGC TCT GGC CCA GCA CAT A 3 ; XPD, forward 5 GCT CCC GCA AAA ACT TGT GT 3 , reverse 5 CAT CGA CGT CCT TCC CAA A 3 , probe 5 ACC CTG AGG TGA CAC CCC TGC G 3 ; and RRM1, forward 5 ACT AAG CAC CCT GAC TAT GCT ATC C 3 , reverse 5 CTT CCA TCA CAT CAC TGA ACA CTT T 3 , probe 5 CAG CCA GGA TCG CTG TCT CTA ACT TGC A 3 . Relative gene expression quantification was calculated acCt cording to the comparative threshold cycle method (2 ) using -actin as an endogenous control and commercial RNA controls (Stratagene, La Jolla, CA) as calibrators. Statistical Methods. Survival curves were obtained by the Kaplan-Meier method, and the difference in survival in subgroups was analyzed using either the log-rank test or TaroneWare test (SPSS 11.5 software). We performed survival analysis using Cox proportional hazards models. We assessed the fit of the hazard models by plotting the cumulative hazard of death against the Cox-Snell residuals. In addition, we assessed the effect of gene mRNA expression on the relative risk (RR) of death using gene mRNA expression quartiles. All of the statistical tests were two-sided, and the level of significance was set at 5%.

RESULTS
Radiographic and surgical results are summarized in Table 1. Pathological complete response occurred in 5 patients (1 patient with radiographic stable disease and 4 patients with radiographic partial response to chemotherapy). Median overall survival for all of the patients was 37.80 months [95% confidence interval (CI), 27.04 48.56 months], and median eventfree survival for all of the patients was 11.84 months (95% CI, 5.48 18.21 months). Thirty-day postoperative mortality was 7.5% (5 patients). This included a bronchopleural fistula resulting in death in 1 patient who underwent a bilobectomy; pneumonia and respiratory failure occurred in 2 patients who underwent a right pneumonectomy; a fourth patient died from respiratory failure after a left pneumonectomy; and the fifth cause of death was pneumonia after the patient had undergone a right upper lobectomy.

Clinical Cancer Research 4217s

The 52 completely resected patients attained a median survival of 45.1 months (95% CI, 24.5 65.6 months). The 10 patients with incomplete resection and the 5 unresectable patients had a significantly shorter survival [6.8 months (95% CI, 5.5 8.1 months) and 5.6 months (95% CI, 3.6 7.5 months), respectively; log-rank P 0.0001]. Twelve of the 67 patients received postoperative radiotherapy: 5 for residual N2 disease, 3 for rib involvement, and the remaining 4 for unresectable disease. Relapse occurred in 38 patients (57%). Sites of initial failure included only local-regional in 37% (14 of 38), only systemic in 18% (7 of 38), and both local and systemic in 45% (17 of 38). Of the 24 patients who relapsed at distant sites, 10 had brain metastases. Gene Expression. Significant correlations were found between ERCC1 mRNA expression and XPD mRNA expression (r 0.48; P 0.0001) and between RRM1 mRNA expression and XPD mRNA expression (r 0.48; P 0.0001). A nearly significant correlation was found between ERCC1 mRNA expression and RRM1 mRNA expression (r 0.22; P 0.07). For RRM1 mRNA levels, patients in the bottom quartile had a decreased risk of death compared with those in the top quartile (RR 0.30; 95% CI, 0.10 0.91; P 0.033; Table 2). For XPD mRNA levels, patients in the bottom quartile (0.08 0.71) had a decreased risk of death compared with those in the top quartile (1.713.78; RR 0.40; 95% CI, 0.121.37; P 0.145). For ERCC1 mRNA levels, patients in the bottom quartile (2.73 4.96) had a higher risk of death compared with those in the top quartile (7.4512.31; RR 1.51; 95% CI, 0.55 4.10; P 0.422) Significant differences in median survival were observed between the 17 patients in the bottom quartile of RRM1 expression and the 15 in the top quartile (52 versus 26 months; P 0.018). Of these 17 patients in the bottom quartile, 5 underwent a pneumonectomy with a median survival of 31.12 months, and 12 underwent a lobectomy with a median survival of 51.97 months (P 0.191). When the characteristics of these 17 patients were examined, no differences in the initial staging were observed in comparison with the remaining 50 patients in the other 3 quartiles. However, for patients in the bottom quartile, radiographic response tended to be higher (65% versus 54%; P 0.24), complete resection was attained more often (94% versus 72%; P 0.03), and a lobectomy was performed more often (71% versus 34%; P 0.004). Furthermore, pathological complete response was observed in 29% of patients in the bottom quartile versus 0% of the remaining patients (P 0.00001). No significant differences were observed according to ERCC1 or XPD mRNA levels (data not shown).

DISCUSSION
In the present study, a good correlation has been found among ERCC1, RRM1, and XPD gene expression levels, indicating that a single assessment of one of these genes could provide information about all three. This confirms our previous findings of a strong correlation between ERCC1 and RRM1. We carried out three different studies, examining individually the role of ERCC1, RRM1, and then both, mRNA expressions in paraffin-embedded pretreatment bronchial biopsies from gemcitabine/cisplatin-treated advanced NSCLC patients. In the first study, median overall survival was significantly longer in patients with low ERCC1-expressing tumors than in those with high ERCC1-expressing tumors (15 versus 5 months; P 0.009). ERCC1 mRNA expression, performance status, and weight loss were significant independent prognostic factors (10). Then we analyzed RRM1 expression in pretreatment bronchial biopsies from a second group of gemcitabine/cisplatintreated advanced NSCLC patients. Median time to progression was 7.6 months for patients with low RRM1 levels and 4.3 months for those with high levels (P 0.005). Median survival was 15.5 months for patients with low RRM1 levels and 6.8 months for those with high levels (P 0.002; Ref. 11). In a third group of patients, we studied both ERCC1 and RRM1 mRNA expression in pretreatment bronchial biopsies again from gemcitabine/cisplatin-treated advanced NSCLC patients who were part of a large randomized trial (12). There was a strong correlation between ERCC1 and RRM1 mRNA expression levels (r 0.4; P 0.001). Patients with low RRM1 mRNA levels had significantly longer median survival than those with high levels (13.7 versus 3.6 months; P 0.009). There were no significant differences according to ERCC1 mRNA levels, although there was a tendency to longer median survival among patients with low ERCC1 levels. Median survival was significantly longer among patients with low levels of both RRM1 and ERCC1 (not reached) than among those with high levels of both genes (6.8 months; P 0.016; Ref. 13). These observations confirm the preclinical data in which the overexpression of ribonucleotide reductase confers gemcitabine resistance in the human oropharyngeal carcinoma KB cells (14). In the present study, patients with the lowest RRM1 levels attained better survival, which was also correlated with a high complete resection rate, with a median survival of 52 months. Martini et al. (15) demonstrated for the first time that complete resection was essential for effective disease control and longterm survival in stage IIIA N2 disease after neoadjuvant chemotherapy. Eighty-nine patients with complete resection had a median survival of 27 months, a 3-year survival of 41%, and a 5-year survival of 26%, whereas 47 patients with incomplete or no resection had a median survival of 12 months and a 5% survival at 3 and 5 years (15). Several other studies (16 18) have reported a 40% or more 3-year survival in patients with complete resection. Pathological complete remission was also higher for the group of patients with the lowest RRM1 levels (29%), both compared with other patients in this trial (0%) and with the average reported in the literature (12%; Ref. 19). We did not observe differences in median survival according to surgical procedure, although a tendency toward longer survival was observed in those patients who underwent a lobectomy.

Table 2 Univariate Cox proportional hazards model of the RRa of death associated with RRM1 mRNA expression levels divided into quartiles Quartile 1 (lowest) 2 3 4 (highest)
a

RRM1 0.400.84 0.841.23 1.231.79 1.795.15

RR (95% CI) 0.30 (0.100.91) 0.76 (0.301.90) 0.54 (0.191.51) 1.00

P 0.033 0.555 0.238

RR, relative risk; CI, confidence interval.

4218s RRM1 mRNA Expression in NSCLC

Pneumonectomy has been found to be an adverse prognostic factor in multivariate analyses (20). Further prospective research is being carried out to test whether patients with low RRM1 mRNA levels (bottom quartile) will obtain the maximum survival benefit from cisplatin doublets, whereas those with high levels (top three quartiles) could obtain better outcomes when treated with noncisplatin doublets.

OPEN DISCUSSION
Dr. Thomas Lynch: Dr. Gandara, you have done a lot of work in terms of thinking about how one selects chemotherapy. What do you think is the most promising course? Dr. David Gandara: Although all of these data are very interesting, Dr. Rosell and I have had practical problems in terms of how do you apply these to a patient population. The problem of course is that our patients are very heterogeneous in regard to all of these pathways and that it really takes a large prospectively designed trial to validate some of these of markers. SWOG is now doing a repeat of the Noda study in small cell lung cancer [N. Engl. J. Med., 346:8591, 2002]. As part of that study we are selecting genomic DNA from all the patients to look at polymorphisms for UGT1A1 and for all of the DNA repair genes. Among 620 patients, we will probably be able to sort out at least that component of the polymorphisms. The NCI Japan has agreed to provide genomic DNA from similar patients treated there as part as a collaborative project, so we can also see about interracial differences. Dr. Eric Rowinsky: Given the extremely low rates of polymorphism in the population in regard to any target protein, do you really think any of these studies would be able to discern if there are truly functional differences in activity in those patients? I think the numbers required, if you really tried to do some calculations, are astounding. I dont think that can be answered in clinical trials and possibly could be answered in the laboratory if we understood the polymorphisms. Dr. Gandara: In actuality, we have put incidence into the statistical design, and we have very good data for the incidence of the UGT1A1 polymorphism. If European heritage is 13% for the 77 genotype, Hispanic 19%, African Americans 15%, and Japanese 2%, that would predict toxicity from irinotecan, so that could explain a lot of differences between Japan and the US. On the basis of the incidence of the polymorphisms, we can discern it with a 620 patient trial. Dr. Bruce Johnson: I believe the data to support the study design examining the role of ERCC1 was done mostly with response to gemcitabine, is that correct? Why use docetaxel as a control arm? Most of your results are based on about 50 patients and with your planned multivariate analysis, I would assume the logistics of doing this trial are incredibly difficult. You have to be able to see a difference between 180 patients. Did you think about doing another prospective study with a group that is homogeneously treated, rather than going straight to a randomized study? Dr. Rosell: Again, we have much preclinical evidence that is used in the design of this trial. It is still relatively difficult to organize clinical trials with mandatory biopsy and a central review because in stage IV, as you know, at least one subset of

the patients never have biopsy, they have only positive cytology. This kind of a study should be requested even with targeted therapies, to have the tumor or the tissues analyzed at baseline as a possible parameter. All these studies were analyzed in a few patients because there were no means to find more tissue. Even from the 600-patient Italian study, only 100 tumor samples were available. This is one of the major pitfalls that we have today. If I had the opportunity to reshape the study, I would put RRM1 as a marker, to test if gemcitabine could be valid in patients with overexpression with RRM1 with just changing the cisplatin to an antimicrotubule drug. We are also in this study validating the importance of BRCA1. Dr. Paul Bunn: What really needs to happen is to validate these assays. These quantitative PCR tests may not give you the same result in two different laboratories. Dr. Rosell: In the study I have presented they have the same results. But, a major caveat: this is almost impossible unless there is a consensus meeting of people involved in the laboratory. Dr. Bunn: We need to do a large randomized trial: it is very costly and the question is whether there are really enough data to put resources into that type of trial. There should first be a prospective trial with a reasonable number of patients, where you are going to give them all of the same treatment to see if this really does predict in a large set of patients. I would submit that trial should have two laboratories doing the laboratory tests, and they should be blinded. If you can show that the results are reproducible and predictive, then you could go to a prospective trial. It is very difficult to get these samples. Dr. Rosell: To avoid potential confusion, I will clarify: RNA isolation can be performed in any laboratory. Quantitative PCR analysis can be performed in any laboratory. It is not necessary to validate. The calibration can be different, because the values you are providing are completely different from another laboratory. There could be consensus on the values, but that is not absolutely necessary.

REFERENCES
1. Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997;111:1710 7. 2. Pass HI, Pogrebniak HW, Steinberg SM, Mulshine J, Minna J. Randomized trial of neoadjuvant therapy for lung cancer: interim analysis. Ann Thor Surg 1992;53:992 8. 3. Rosell R, Gomez-Codina J, Camps C, et al. A randomized trial comparing preoperative chemotherapy plus surgery with surgery alone in patients with non-small-cell lung cancer. N Engl J Med 1994;330: 153 8. 4. Sarries C, Haura EB, Roig B, et al. Pharmacogenomic strategies for developing customized chemotherapy in non-small-cell lung cancer. Pharmacogenomics 2003;3:763 80. 5. Rosell R, Lord RVN, Taron M, Reguart N. DNA repair and cisplatin resistance in non-small cell lung cancer. Lung Cancer 2002;38:21727. 6. Rosell R, Taron M, Alberola V, Massuti B, Felip E. Genetic testing for chemotherapy in non-small cell lung cancer. Lung Cancer 2003;41: S97102. 7. Rosell R, Crino L, Danenberg KD, et al. Targeted therapy in combination with gemcitabine in non-small cell lung cancer. Sem Oncol 2003;30:19 25. 8. Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B. Nucleotide excision repair pathways involved in cisplatin resistance in non-small cell lung cancer. Cancer Control 2003;10:297305.

Clinical Cancer Research 4219s

9. Krafft AE, Duncan BW, Bijwaard KE, Taubenberger JK, Lichy JH. Optimization of the Isolation and amplification of RNA from formalinfixed, paraffin-embedded tissuue: the Armed Forces Institute of Pathology experience and literatura review. Mol Diagn 1997;3:21730. 10. Lord RVN, Brabender J., Gandara D, et al. Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small-cell lung cancer Clin Cancer Res 2002;8: 2286 91. 11. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic non-small-cell lung cancer. Oncogene 2003;22:3548 53. 12. Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcitabine versus a cisplatin-based triplet versus nonplatinum sequential doublets in advanced non-small-cell lung cancer: A Spanish Lung Cancer Group phase III randomized trial. J Clin Oncol 2003;21: 320713. 13. Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatintreated advanced non-small cell lung cancer patients. Clin Cancer Res 2004;10:1318 25. 14. Goan, Y-G, Zhou B, Hu E, Mi S, Yen Y. Overexpression of ribonucleotide reductase as a mechanism of resistance to 2,2-difluorodeoxycytidine in the human KB cancer cell line. Cancer Res 1999;59: 4204 7.

15. Martini N, Kris MG, Flehinger BJ, et al. Preoperative chemotherapy for stage IIIa (N2) lung cancer: The Sloan-Kettering experience with 136 patients. Ann Thorac Surg 1993;55:136574. 16. Burkes RL, Ginsberg RJ, Shepherd FA, et al. Induction chemotherapy with mitomycin, vindesine, and cisplatin for stage III unresectable non-small-cell lung cancer: Results of the Toronto phase II trial. J Clin Oncol 1992;10:580 6. 17. Rosell R, Lopez-Cabrerizo MP, Astudillo J. Preoperative chemotherapy for stage IIIA non-small-cell lung cancer. Curr Opin Oncol 1997;9:149 55. 18. Betticher DC, Schmitz SFH, Totsch M, et al. Mediastinal lymph node clearance after docetaxel-cisplatin neoadjuvant chemotherapy is prognostic of survival in patients with stage IIIA pN2 non-smallcell lung cancer: A multicenter phase II trial. J Clin Oncol 2003;21: 17529. 19. Pisters KMW, Kris MG, Gralla RJ, Zaman MB, Heelan RT, Martini N. Pathologic complete response in advanced non-small-cell lung cancer following preoperative chemotherapy: Implications for the design of future non-small-cell lung cancer combined modality trials. J Clin Oncol 1993;11:1757 62. 20. Martin J, Ginsberg RJ, Venkatraman ES, et al. Long-term results of combined-modality therapy in resectable non-small-cell lung cancer. J Clin Oncol 2002;20:1989 95.

Molecular Predictors of Response to Chemotherapy in Lung Cancer

Rafael Rosell, Miquel Taron, Aurelio Ariza, Agusti Barnadas, Jose Luis Mate, Noem Reguart, Mireia Margel, Enriqueta Felip, Pedro Mendez, and Rosario Garca-Campelo
Overall, chemotherapy falls short of the high expectations for improved survival in surgically resected non small cell lung cancer patients and prolonged survival in the metastatic setting. Conventional chemotherapy trials, even those including new cytotoxic drugs or novel targeting approaches, are hampered by a lack of genetic information. Within the global genomic-repair pathway, overexpression of excision repair cross-complementing 1 (ERCC1) has been associated with poor response and survival in cisplatin-treated patients. The lack of DNA adducts in cell nuclei indicates an efcient global genomic repair pathway, which leads to cisplatin resistance. Several xeroderma pigmentosum (XP) genes, including XPD, play an important role in determining the efciency of the transcription-coupled repair pathway. XPD polymorphism has been related to lower DNA repair capacity and enhanced cisplatin sensitivity. Other DNA repair systems are the base excision repair pathway, in which apurinic/apyrimidinic endonuclease 1 (Ape 1) plays a pivotal role, and the onestep repair pathway, where O6 alkylguanine-DNA alkyltransferase (MGMT) has a key function. MGMT methylation can be assessed in serum DNA. By assessing ERCC1 mRNA, cisplatin adducts, XPD polymorphism, Ape 1, and MGMT, we can obtain a complete genetic prole, which can be used in real translational research. Semin Oncol 31 (suppl A):000-000. 2004 Elsevier Inc. All rights reserved.

ISPLATIN is still the scaffolding of combination chemotherapy in nonsmall cell lung cancer (NSCLC). Results tend to be similar whether the partner drug is paclitaxel, docetaxel, or gemcitabine. Similar results are generally obtained with carboplatin,1 although in a randomized study, median survival was 8.2 months in the paclitaxel/carboplatin arm and 9.8 months in the paclitaxel/cisplatin arm (hazard ratio, 1.22; P .01).2 Many cytotoxic drugs induce DNA damage similar to that caused by carcinogens. Covalent binding of the carcinogen or cytotoxic drug results in the formation of a chemically altered base in DNA that is termed an adduct.3 Cisplatin has a rigid structure with two labile chloro and two stable ammine ligands in a cis conguration. Like some alkylating agents, the neutral drug molecule needs to be converted to a reactive form. This occurs nonenzymatically in solution, where displacement reactions result in stepwise exchange of
Seminars in Oncology, Vol 31, No 1, Suppl A (February), 2004: pp 000-000

the labile chloro ligands with water molecules. The charged aquated species are highly reactive, but the chloro-monoaquo species is the most signicant from the perspective of interaction with DNA at physiological pH. In the case of carboplatin, which is a more stable bidentate cyclobutanedicarboxylate ligand, the aquation reaction is much slower. This reduces drug potency, which thereby requires a greater dose for an equivalent antitumor effect.4 As soon as the monoaquated species of cisplatin is formed, it reacts immediately with a DNA base (preferentially N7 of guanine) to form a monofunctional adduct. The remaining chloride ligand linked to platinum in the monoadduct is then hydrolyzed, and the resulting aquated species interacts with a second nucleophilic site to form DNA cross-links. Both 1,2- and 1,3-intrastrand DNA cross-links are formed. 1,2interstrand cross-links between opposite guanine bases are formed preferentially in 5 G-C3 sequences of both strands. However, mounting evidence indicates that intrastrand adducts provide the strongest basis for the cytotoxic action of cisplatin.4 In general, the genetic mechanisms of cancer chemoresistance are difcult to understand. Moreover, from the clinical point of view, the utility of genetic tests is limited because of the scarcity of tumor tissue obtained by bronchoscopy in stage IV NSCLC patients. In early stages, we can benet from the resected tumor specimens that provide a considerable amount of tumor tissue for RNA extraction. With laser-captured microdissection, we can also retrospectively compare tumor cells with

From the Medical Oncology Service, the Pathology Department, Hospital Germans Trias i Pujol, Badalona (Barcelona), Spain; the Medical Oncology Service, Hospital Vall dHebron, Barcelona, Spain; and the Medical Oncology Service, Hospital Juan Canalejo, La Coruna, Spain. Address reprint requests to Rafael Rosell, MD, Medical Oncology Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, Badalona (Barcelona), Spain 08916. 2004 Elsevier Inc. All rights reserved. 0093-7754/04/3101-0A03$30.00/0 doi:10.1053/j.seminoncol.2003.12.011
1

ROSELL ET AL

Fig 1. DNA repair pathways. RNA Pol II, RNA polymerase II; TFIIH, basal transcription factor; ERCC1, excision repair crossingcomplimenting 1; CSA, Cockayne syndrome A; CSB, Cockayne syndrome B; XRCC1, x-ray crossing-complimenting 1; XPA-G, xeroderma pigmentosum A-G; RPA, replication protein A; MGMT, methylguanylmethyltransferase.

cells of the surrounding stroma to analyze loss of heterozygosity. To understand the cisplatin mechanisms of resistance and how to select genetic tests for immediate clinical application, it is mandatory to understand the pathways of cisplatin resistance. In short, the DNA repair pathways are a common denominator for carcinogenesis and cisplatin resistance. Needless to say, cisplatin resistance could be multifaceted, including decreased drug accumulation, enhanced cellular detoxication by elevated levels of glutathione or metallothionein, and enhanced DNA repair.
MECHANISMS OF SCANNING DNA FOR LESIONS AND REPAIR FACTORIES

Nucleotide Excision Repair Subpathways DNA repair is crucial for removing cisplatin adducts. Nucleotide excision repair (NER) is the essential pathway to protect the host from developing lung cancer and, at the same time, to generate cisplatin resistance. Ultraviolet light and cisplatin induce DNA lesions that are effective

blocks to RNA polymerase II and thus block transcription.5 These DNA lesions, including cisplatin adducts, are removed by NER. NER can be subdivided into genetically separable subpathways termed transcription-coupled repair (TCR) and global genomic repair (GGR) (Fig 1). Transcription-coupled repair (or TC-NER) repairs transcription-blocking lesions in transcribed DNA strands of active genes, whereas GGR or (GG-NER) repairs the lesions in the nontranscribed strand of active genes and nontranscribing genome.6-8 To understand the numerous acronyms used in Figs 1 to 3, it is important to clarify that our current knowledge of the NER pathway stems from the study of inherited genetic disorders with decient DNA repair systems. In humans, NER is a major defense against the carcinogenic effects of ultraviolet light from the sun. The severe consequences of inborn defects in this repair pathway are apparent from the rare, autosomal recessive disorder xeroderma pigmentosum (XP). Patients with this disease present with hypersensitivity to sunlight, pigmentary alterations, and premalignant

MOLECULAR PREDICTORS OF RESPONSE

Fig 2. Nucleotide excision repair subpathways. RNA Pol II, RNA polymerase II; CSA, Cockayne syndrome A; CSB, Cockayne syndrome B; XPA-G, xeroderma pigmentosum A-G; TFIIH, basal transcription factor; RPA, replication protein A; ERCC1, excision repair crossing-complimenting 1; XRCC1, x-ray crossing-complimenting 1.

lesions in the sun-exposed area of the skin, and an extremely high incidence of skin cancer. Many patients show accelerated neurodegeneration.9 In terminally differentiated human neurons, GGR is markedly attenuated while procient repair persists in both strands of expressed genes, and the expression of several genes involved in the incision step of NER is upregulated. It has been postulated that GGR is switched off in terminally differentiated cells while TCR is maintained.5 In XP, there are at least seven NER-decient complementation groups: XPA to XPG. These groups are defective in both NER subpathways.9 Loss of heterozygosity has been detected in several of these groups, to a large degree in ovarian cancer and to a lesser degree in colon and lung cancer.10 Cockayne syndrome, another photosensitive disease associated with a NER defect, involves postnatal growth failure, progressive neurologic dysfunction, premature aging, and sun sensitivity, but no cancers. Two complementation groups have been identied: CSA and CSB. Both are

defective in functions involved in the TCR subpathway.9 XP and Cockayne syndrome offer model systems for investigating molecular mechanisms underlying the apoptotic response induced by ultraviolet irradiation and cisplatin.11 The left side of Fig 1 shows the TCR pathway, where RNA polymerase II is the sensor for cisplatin damage.8 When transcribing RNA polymerase II encounters the lesion, two transcription-coupled repair-specic factors, CSA and CSB, are implicated for the activation of the common NER molecular pathway.11,12 The clinical implications of TCR lie in the fact that cisplatin-resistant tumors show an intact TCR system, while tumors are sensitive to cisplatin when the TCR subpathway is decient. Conversely, the novel cytotoxic drug ecteinascidin 743 requires a procient TCR subpathway.13,14 In translational clinical trials, patients could be assigned to receive cisplatin- or non cisplatin-based chemotherapy according to their TCR status. For GGR, the XPC complex is activated. Along

ROSELL ET AL

Fig 3. DNA repair pathways and chemoresistance. MMR, mismatch repair; BER, base excision repair; TC-NER, transcriptioncoupled nucleotide excision repair; GG-NER, global genomic nucleotide excision repair; OSR, one-step repair; RNA Pol II, RNA polymerase II; XPD, xeroderma pigmentosum D; MGMT, methylguanylmethyltransferase; Ape 1, apurinic/apyrimidinic endonuclease 1; IHC, immunohistochemistry; ERCC1, excision repair cross-complimenting 1.

with the basal transcription factor (TFIIH), an XPG binds to the DNA around the lesion. TFIIH contains two helicases, XPB and XPD, which open an approximately 30-bp DNA segment around the damage. This open intermediate is stabilized by replication protein A and XPA. The DNA strand that contains the damaged base(s) is excised by the two NER endonucleases, XPG and XPF/excision repair cross-complementing 1 (ERCC1). XPG cleaves the damaged DNA strand 3 from the lesion, and XPF/ERCC1 cleaves the damaged strand 5 from the DNA lesion. Finally, the resulting gap is lled in by DNA polymerases in the presence of replication factors.12 XPD Polymorphism and DNA Repair Capacity For translational research purposes, XPD is important because it intervenes in both the TCR and the GGR subpathways. Until now, translational research has focused on ERCC1 mRNA overexpression as an element of the GGR related to cisplatin resistance in gastric, ovarian, and lung

cancer (Table 1).15-17 The main obstacle to testing ERCC1 is the scarcity of tumor tissue available for RNA isolation and quantitative polymerase chain reaction from bronchoscopy. Conversely, XPD can be analyzed in constitutional DNA, for example, in DNA isolated from peripheral blood lymphocytes. In addition, XPD polymorphism has been related to lower DNA repair capacity in several studies.18 Approximately half of the population examined have the genotype Lys751Lys and also have Asp312Asp. These patients have a good DNA repair capacity and therefore are presumably resistant to cisplatin.18,19 In an epidemiologic study matching 341 lung cancer cases with 360 smoker control subjects, a host-cell reactivation assay measuring the activity of the chloramphenicol acetyltransferase gene was used in cells transfected with plasmids treated with benzo(a)pyrene diol epoxide. DNA repair capacity was lower in the lung cancer patients than in the controls. The variants Gln751Gln and Asn312Asn had suboptimal DNA repair capacity, with a signicant in-

MOLECULAR PREDICTORS OF RESPONSE

Table 1. ERCC1 as a Predictive Marker in Gastric, Colorectal, and NonSmall Cell Lung Cancer Patients Treated With Cisplatin or Oxaliplatin ERCC1 Cut-off 5.8 5.8 4.9 4.9 6.7 6.7 Survival (mos) NR 5.4 10.9 1.9 15 5

Regimen Cis 100 mg/m2 on day 1 5-FU 200 mg/m2/day 21 days (CI) Oxaliplatin 130/mg/m2 every 21 days 5-FU 200 mg/m2/day 21 days (CI) Gem 1,250 mg/m2 on days 1 and 8 Cis 100 mg/m2 day 1 every 3 weeks

Tumor Gastric cancer15 Colorectal cancer16 NSCLC17

Patients 19 19 40 10 28 28

P Value .03 .001 .04

Abbreviations: NSCLC, nonsmall cell lung cancer; 5-FU, 5-uorouracil; Gem, gemcitabine; Cis, cisplatin; NR, not reported; CI, continuous infusion.

crease in the hazard ratio, in contrast with the wild-type genotypes both in cases and controls, which exhibited the most procient DNA repair capacity.18 The frequency of homozygous variants is 10% for either codon. In an intermediate group with heterozygous polymorphisms, the frequency was 40% at either codon. This leads us to speculate that this group could have an intermediate outcome. The clinical interest of these ndings lies in their potential usefulness in identifying constitutional DNA from lymphocyte polymorphisms associated with suboptimal DNA repair capacity and their potential role in identifying patients with better response to cisplatin chemotherapy. The relationship between DNA repair capacity and survival in NSCLC patients treated with cisplatin-based chemotherapy was recently examined by a host-cell reactivation assay.19 In this study, patients who had received chemotherapy were divided into quartiles according to their DNA repair capacity. Patients in the top quartile (DNA repair capacity 9.2%) had a risk of death that was more than two times greater than that of patients in the bottom quartile (DNA repair capacity 5.8%) (P .01). Median survival was 8.9 months for patients in the top quartile compared with 15.8 months for those in the bottom quartile (P .04). Intriguingly, among the 36 chemotherapy-naive patients who underwent curative surgical resection, there was a slight survival advantage associated with increased DNA repair capacity. This nding could be extremely relevant when interpreting the results of neoadjuvant chemotherapy trials in early NSCLC. The assessment of DNA repair capacity, reecting the GGR subpathway, is

warranted in such trials to identify the subgroup of patients with low DNA repair capacity that could have lower survival when treated with surgery alone and at the same time could benet from neoadjuvant or adjuvant chemotherapy. In contrast, patients with high DNA repair capacity could have better survival when treated with surgery alone and could be refractory to neoadjuvant or adjuvant approaches (Table 2). Cisplatin DNA Adducts The absence of measurable cisplatin DNA adducts, indicating a deciency in the GGR subpathway, has been associated with poor outcome in NSCLC. In one study, multiple tissues, including ovarian tumor, were obtained at autopsy from eight patients who had received either cisplatin or carboplatin chemotherapy. Cisplatin DNA adducts were detected in most of the tissues examined, and DNA adduct levels were similar in the majority of tissues from the same subject, whether taken from the bone marrow, liver, brain, or peripheral nerve.20 The assessment of DNA adduct levels could become a predictive assay for cisplatin and/or radiotherapy. Schaake-Koning et al21 observed an improvement in survival in patients with locally advanced NSCLC treated with daily radiotherapy plus daily cisplatin 6 mg/m2 approximately 1 hour before irradiation (20 administrations for a total of 120 mg/m2) compared with radiotherapy alone. Three-year survival was 16% for concomitant cisplatin-radiotherapy versus 2% for radiotherapy alone. Differences in survival according to cisplatin DNA adduct levels have been observed in patients treated with concomitant cis-

ROSELL ET AL

Table 2. Markers for Customized Cisplatin Therapy in Neoadjuvant or Adjuvant Trials Poor Candidates Good Prognosis Overexpression Overexpression High DRC Absence Good Candidates Poor Prognosis Low expression Low expression To be assessed Presence

Marker ERCC1 Ape 1 DRC Cisplatin adducts

Assay QPCR IHC HCRA IHC

CTR

Abbreviations: CTR, chemoresistance; QPCR, quantitative polymerase chain reaction; IHC, immunohistochemistry; DRC, DNA repair capacity; HCRA, host-cell reactivation assay.

platin-radiotherapy. Dutch investigators22 studied 27 patients treated with daily cisplatin and radiotherapy. For assessing cisplatin DNA adduct levels, buccal cells were collected by wiping the inner cheek with a cotton swab before cisplatin treatment and 1 hour after the fth course of cisplatin. The immunohistochemical method used for cytospins enabled cisplatin DNA adducts to be visualized in nuclei of the buccal cells. Nuclear signal intensity (arbitrary units) ranged from 0.4 to 2.8. Striking differences in survival were observed according to DNA adduct levels. Thirteen patients with low DNA adduct levels ( 1.16) had a median survival of 5.2 months, as compared with 14 patients with high levels ( 1.16) who had a median survival of 30.2 months (P .0001).22 Figures 1 and 223 illustrate the pivotal role of XPD in cisplatin resistance. Elegant experiments show that molecular deciencies (in both GGR and TCR subpathways) in primary broblasts confer marked hypersensitivity to cisplatin compared with normal primary broblasts. These results show that any one deciency in XPA, XPD, XPF, or XPG confers marked hypersensitivity to cisplatin. Therefore, we postulate that XPD genotypes Gln751Gln or heterozygous Lys751Gln or Asn312Asn or Asp312Asn could have an enhanced sensitivity to cisplatin. Base Excision Repair Pathway Figure 3 summarizes the DNA repair pathways in a way that may be applied to patient treatment. In the center of the gure, we speculate that XPD could be a determinant genetic marker, equivalent to ERCC1. Cisplatin adducts could be a good surrogate of the function of GGR. There is also an additional pathway, the base excision repair, in which apurinic/apyrimidinic endonuclease (Ape

1) plays an important role. Ape 1 is a multifunctional enzyme mediating repair of ionizing radiation and alkylating agentinduced DNA damage. Ape 1 acts in base excision repair to hydrolyze abasic sites arising from enzymatic removal of damaged purine and pyrimidine bases. It has a 3 -phosphodiesterase activity that excises deoxyribose fragments and phosphate groups at the 3 terminus of DNA strand breaks caused by ionizing radiation, yielding a 3 -OH substrate for DNA repair synthesis. Nuclear Ape 1 has been related to improved survival in resected NSCLC, which can be explained by the role of effective base excision repair in repairing DNA damage (Table 2).24 Interestingly, immunostaining expression of Ape 1 has been observed in germ cell tumors from testicular cancer patients. The elevation was correlated with resistance to chemotherapy with bleomycin.25 O6-Alkylguanine-DNA Alkyltransferase and OneStep Repair Finally, serum DNA could be useful for methylation assays. The right upper corners of Figs 1 and 3 show the one-step repair pathway as the rst mechanism in detecting DNA damage by alkylating agents. Many tumors exhibit overexpression of the DNA repair enzyme O6 alkylguanine-DNA alkyltransferase (MGMT). In addition, tumors in which MGMT is methylated respond better to BCNU (carmustine). The one-step repair pathway (the direct reversal of DNA damage) targets 2-chloroethylnitrosoureas, such as carmustine and temozolomide, both of which involve alkylation of the O6 site of guanine. One-step repair is performed by the repair protein MGMT through direct removal of an alkyl group from the O6 atom of

MOLECULAR PREDICTORS OF RESPONSE

guanine in the DNA of cells exposed to alkylating agents. With increasing size of the alkyl group ( ethyl), the relative contribution of MGMT to the repair of O6-alkylguanines in DNA decreases, and excision repair steps in as a backup modality.23 This O6-alkylguanine DNA lesion is highly cytotoxic and correlates inversely with the activity of MGMT, which removes the monofunctional O6 adduct from the DNA, limiting response to these cytotoxic drugs. With methylation-specic polymerase chain reaction, 40% of brain tumors showed no methylated MGMT, which correlated with better response and survival in BCNUtreated patients. Anaplastic astrocytomas were also included in this study, and striking differences in median time to progression were observed (21 months for methylated v 8 months for unmethylated gliomas; P .001).26 Similar methylation patterns of p16, DAPK, GSTP1, and MGMT in paired tumor and serum DNA were observed in resected NSCLCs (Table 2).27
CLINICAL IMPLICATIONS

ERCC1 was overexpressed in almost half of the patients. Patients with high ERCC1 levels had signicantly better survival rates than those with lower levels.32 This kind of information is opening the gates to understanding the ineffectiveness of adjuvant chemotherapy because patients with high levels of ERCC1 do not respond to cisplatinbased therapy, yet they have much better survival rates. We can hypothesize that only the subgroup of patients with low levels of ERCC1, who by denition have a worse prognosis, will paradoxically respond to cisplatin-based chemotherapy. Further research is warranted to validate not only the predictive value of ERCC1 but also that of XPD polymorphism, cisplatin adducts, Ape 1, and MGMT methylation.
ACKNOWLEDGMENT
The authors would like to express their gratitude to Drs Giorgio Scagliotti (Bologna, Italy); Alain Depierre (Besancon, France); Karin Mattson (Helsinki, Finland); and Gerold Bepler (Tampa, FL) for generously providing data from their studies, and to Renee OBrate and Lourdes Franquet for assistance with the manuscript.

A study of adjuvant chemotherapy failed to improve survival in comparison with the control arm of surgery plus postoperative radiotherapy in completely resected stage II/IIIA NSCLC. Median survival was 39 months in the control arm and 38 months in the chemotherapy arm (P .56).28 Along the same lines, an Italian study failed to demonstrate an improvement in survival in the chemotherapy arm (P .58).29 No benet was obtained with neoadjuvant chemotherapy in a study of stage I-IIIA NSCLC, where median survival was 36 months in the chemotherapy arm and 26 months in the control arm (P .15).30 However, some data suggest that neoadjuvant chemotherapy could improve survival. In a study of stage IIIA or selected IIIB NSCLC, Mattson et al31 obtained a 21-month median survival in the chemotherapy arm versus 14 months in the control arm (P .0014). In general, it is almost impossible to elucidate the role of chemotherapy based on conventional clinical trials. Genetic markers can and should be used to identify the large subgroup of patients that can be expected to have a good outcome because of their own efcient DNA repair pathways and, moreover, that will have no response to chemotherapy (Table 2). As an example, when ERCC1 was analyzed in fresh tissue from chemotherapy-naive patients with resected NSCLC,

REFERENCES
1. Schiller JH, Harrington D, Belani CP, et al: Comparison of four chemotherapy regimens for advanced nonsmall-cell lung cancer. N Engl J Med 346:92-98, 2002 2. Rosell R, Gatzemeier U, Betticher DC, et al: Phase III randomised trial comparing paclitaxel/carboplatin with paclitaxel/cisplatin in patients with advanced nonsmall-cell lung cancer: A cooperative multinational trial. Ann Oncol 13:15391549, 2002 3. Phillips DH: The formation of DNA adducts, in Alison MR (ed): The Cancer Handbook. London, Nature Publishing Group, 2002, pp 293-307 4. Siddik ZH: Mechanisms of action of cancer chemotherapeutic agents: DNA-interactive alkylating agents and antitumour platinum-based drugs, in Alison MR (ed): The Cancer Handbook. London, Nature Publishing Group, 2002, pp 12951313 5. Hanawalt PC: Controlling the efciency of excision repair. Mut Res 485:3-13, 2001 6. May A, Nairn RS, Okumoto DS, et al: Repair of individual DNA strands in the hamster dihydrofolate reductase gene after treatment with ultraviolet light, alkylating agents, and cisplatin. J Biol Chem 268:1650-1657, 1993 7. McKay BC, Ljungman M, Rainbow AJ: Persistent DNA damage induced by ultraviolet light inhibits p21waf1 and bax expression: implications for DNA repair, UV sensitivity and the induction of apoptosis. Oncogene 17:545-555, 1998 8. Cullinane C, Mazur SJ, Essigmann JM, et al: Inhibition of RNA polymerase II transcription in human cell extracts by cisplatin DNA damage. Biochemistry 38:6204-6212, 1999 9. Conforti G, Nardo T, DIncalci M, et al: Proneness to UV-induced apoptosis in human broblasts defective in tran-

FACTORES DE RESISTENCIA A QUIMIOTERAPIA EN CNCER DE PULMN

Miquel Taron Institut Catal dOncologia Hospital Germans Trias i Pujol Barcelona

Contenido: Resumen de la ponencia Bibliografa Ponencia en PowerPoint

Factores de resistencia a quimioterapia en cncer de pulmn

Miquel Taron
Servicio de Oncologa Mdica Institut Catal dOncologia Hospital Germans Trias i Pujol, Barcelona

l cncer de pulmn de clula no pequea (NSCLC) representa el 80% de los casos de cncer de pulmn. Este tumor es altamente quimiorresistente, metastsico de origen y de mal pronstico con una supervivencia global a los 5 aos inferior al 15% . Estos datos son todava ms dramticos en el grupo de pacientes avanzados (estadios IIIB con efusin pleural y IV), donde la mediana de supervivencia se sita en torno a los 8-10 meses, y sin que exista ninguna combinacin de quimioterapia que demuestre su superioridad frente a otra. Actualmente los estudios dirigidos a la bsqueda de marcadores genticos como factores de resistencia a los distintos agentes de quimioterapia y que permitan la individualizacin de los tratamientos son uno de los objetivos prioritarios de la investigacin aplicada al enfermo oncolgico. Existen diferentes tcnicas basadas en el anlisis de DNA, RNA y protenas que pueden utilizarse para dirigir este objetivo, aunque cabe destacar que en muchos casos el factor limitante es la baja disponibilidad de las muestras tumorales. Por ejemplo, en cncer de pulmn avanzado, nicamente se dispone de material tumoral procedente de biopsia del 60% de los pacientes. Adems, este material suele obtenerse de muestras fijadas en formol e incluidas en parafina y contiene un nmero bajo de clulas tumorales, lo que dificulta todava ms, desde el punto de vista metodolgico, las estrategias tcnicas a desarrollar.

Dentro de los agentes ms utilizados en el tratamiento del NSCLC cabe destacar el cisplatino y carboplatino que son el eje vertebral del tratamiento de quimioterapia en combinacin con agentes antimicrotbulos (taxanos y alcaloides de la vinca) o gemcitabina. Actualmente, muchos de los estudios de marcadores de quimiorresistencia se centran en los factores genticos y epigenticos relacionados con la respuesta a estos frmacos. Por ejemplo, existen diferentes vas de reparacin del DNA entre las que cabe destacar la va Nucleotide Excision Repair (o NER) por su papel fundamental en la capacidad reparadora del DNA (DNA repair capacity o DRC) y por tanto en la eliminacin de los aductos del platino sobre el DNA limitando su actividad. Dentro de esta va los genes ERCC1 y XPD son cruciales en la capacidad de reparacin del DNA y tambin, por tanto, en la respuesta a los tratamientos basados en agentes platinados. As, por ejemplo, el anlisis de expresin de RNA de ERCC1 por PCR Cuantitativa (QPCR) en biopsias previas a quimioterapia de pacientes con NSCLC avanzado tratados con gemcitabina/cisplatino demuestra que los pacientes con niveles elevados de expresin tienen una mediana de supervivencia de 5 meses, que es significativamente menor en relacin a los pacientes con niveles bajos de expresin, con una mediana de supervivencia de 15 meses, siendo adems la expresin de este gen un factor pronstico independiente para la supervivencia en el anlisis multivariado. Estos resultados han sido corroborados en otros dos estudios, lo que demuestra la importancia de los niveles de expresin de este gen en el tratamiento basado en agentes platinados. En base a estos resultados se est desarrollando un ensayo clnico en NSCLC avanzado (en el seno del Grupo Espaol de Cncer de Pulmn-GECP) donde los pacientes son tratados de forma individualizada atendiendo a los valores
Factores de resistencia a quimioterapia en cncer de pulmn 197

de expresin de RNA de ERCC1 analizados por QPCR en tejido tumoral obtenido de la biopsia. En la rama control los pacientes son tratados con taxotere/cisplatino, mientras que en la rama experimental los pacientes con niveles altos de ERCC1 son tratados con gemcitabina/taxotere (es decir, tratamiento sin cisplatino) mientras que los pacientes con niveles bajos de expresin del gen son tratados igual que el grupo control. En la actualidad se han incluido 320 de los 360 pacientes proyectados en este ensayo, y el anlisis interino ha demostrado un beneficio clnico de este tratamiento individualizado y que se traduce tanto en una mejora del tiempo a la progresin como en la supervivencia. Otro gen que puede ser utilizado en un modelo de tratamiento individualizado es ribonucletido reductasa (RR) M1. RR codifica una enzima limitante en la sntesis de DNA y que participa igualmente en los procesos de reparacin del DNA. La subunidad M1 (RRM1) tiene un papel importante en la especificidad del substrato, la actividad enzimtica y en el metabolismo de la gemcitabina. Igual que en el ejemplo anterior, la sobrexpresin de RRM1 analizada por QPCR en biopsias obtenidas previas al tratamiento en pacientes con NSCLC avanzado que han recibido gemcitabina/cisplatino presentan una supervivencia significativamente menor que aquellos pacientes con niveles de expresin bajos. Por ltimo, cabe tambin destacar el papel en cncer de pulmn de la expresin de BRCA1, un gen con mltiples funciones y fundamental en la reparacin del DNA. El anlisis de expresin de este gen en muestras tumorales quirrgicas de pacientes en estadios IIB-IIIA-IIIB tratados con quimioterapia neoadyuvante basada en platino/gemcitabina revela que los pacientes con niveles bajos (cuartil inferior) tienen una supervivencia significativamente superior a aquellos pacientes con niveles elevados de expresin. Existen datos en la literatura que demuestran en modelos in vitro que la elevada expresin de BRCA1 hipersensibiliza las clulas al tratamiento con derivados antimicrotbulos mientras que comporta resistencia a los agentes platinados. De esta forma los pacientes con niveles de expresin de BRCA1 altos y por tanto resistentes a cisplatino, pueden ser tratados con agentes antimiotbulos como taxol o taxotere y, por tanto, el anlisis de expresin de este gen debe igualmente contribuir a una mejora en la seleccin individualizada de los tratamientos de quimioterapia. Tal y como se ha comentado, el principal obstculo en el anlisis de expresin a nivel de RNA es la escasez de tejido tumoral que se dispone de muchos pacientes, y acentuado en los pacientes con NSCLC avanzado. Otras tcnicas como el anlisis de polimorfismos pueden realizarse a partir de DNA de linfocitos y permiten por tanto estudiar nuevos marcadores en todos los pacientes con independencia de su estadio ya que la disponibilidad de muestras en este caso no es limitante. As, el anlisis de polimorfismos (y en concreto de SNPs o single nucleotide polymorphisms) ha emergido como una nueva realidad en la bsqueda de factores de quimiorresistencia. Existen muchos genes polimrficos que han demostrado un importante papel en la respuesta a quimioterapia, como por ejemplo Timidilato sintasa y respuesta a 5-Fluorouracilo, UGT1A1 y toxicidad a CPT11, e incluso que se han relacionado con fenmenos trombticos (p.ej. MTHFR) e incluso el Alzheimer. Adems el anlisis de SNPs supone introducir nuevos marcadores de respuesta o de toxicidad desde el punto de vista de la variabilidad gentica de cada individuo. Por ejemplo, el gen ERCC1 presenta un SNP silente en el codn 118 (C/T) que se ha relacionado con un mayor o menor grado de expresin del gen. As, en pacientes con NSCLC avanzado tratados con taxotere/cisplatino ERCC1-118(C/T) ha demostrado tener un valor predictivo para la supervivencia en el anlisis multivariado: pacientes homocigotos C/C para este gen presentan una mayor supervivencia (no se alcanza la mediana de supervivencia a los 22 meses de seguimiento) en comparacin con los pacientes C/T o T/T en esta posicin (mediana de supervivencia de 9,7 meses) (P = 0.01). Adems, los resultados de un estudio farmacogenmico en 250 pacientes con NSCLC avanzado tratados con gemcitabina/cisplatino demuestra un beneficio opuesto, donde los pacientes con genotipo T/T tienen
198 Cncer de pulmn

en este caso mejor supervivencia que los pacientes homocigotos para el alelo ERCC1-118(C). Estos resultados pueden tener un claro beneficio en la seleccin del tratamiento basado en este caso en taxote/cisplatino o gemcitabina/cisplatino en base al anlisis de ERCC1-118(C/T). Otro gen fundamental en la va de reparacin NER es el gen XPD. Diversos estudios han demostrado que los pacientes portadores de las variantes homocigotas Gln751XPD (aproximadamente el 12% de la poblacin caucsica) presentan un menor tiempo a la progresin y supervivencia en relacin a los portadores del alelo Lys751XPD cuando son tratados con dobletes basados en cisplatino. En base a estos resultados, los pacientes homocigotos para el alelo Gln751XPD deben ser tratados con regmenes que no contengan derivados platinados como por ejemplo gemcitabina/taxotere o taxotere/CPT-11. Obviamente existen miles de genes polimrficos con potencial aplicacin clnica como son EGF, IL6, RRM1, Cox 2, PPAR-, XRCC1, XRCC3, o Ligasa IV entre otros. Al igual que en el caso de los polimorfismos, el anlisis de metilacin aberrante de los genes supresores tumorales supone una nueva aproximacin al anlisis de factores de resistencia a quimioterapia. Adems, estudios de la literatura y de nuestra propia experiencia han demostrado que existe una correlacin entre los patrones de metilacin de mltiples genes analizados en DNA srico y en DNA tumoral obtenido de la biopsia o de la pieza quirrgica del mismo paciente. As, por ejemplo, la metilacin aberrante del gen FANCF se ha relacionado con la sensibilidad al cisplatino en cncer de ovario, y la metilacin del gen 14-3-3 confiere una hipersensibilidad al cisplatino y a la adriamicina. Estudios de nuestro laboratorio en pacientes con NSCLC avanzado tratados con gemcitabina/cisplatino demuestran que los pacientes con metilacin del gen 14-3-3 analizado en DNA srico presentan un mejor pronstico en relacin a los que no presentan metilacin del gen. La prdida de expresin del gen PTEN se ha demostrado que es el resultado de la hipermetilacin en ms del 30% de glioblastomas, tumores gstricos y NSCLC. La prdida de PTTEN activa la va de PI3K/Akt, que se ha asociado a resistencia a distintos agentes citotxicos, y por tanto puede ser un marcador general de quimiorresistencia. Los primeros pasos para la individualizacin de los tratamientos de quimioterapia a travs del anlisis de expresin de distintos genes de reparacin del DNA se ha iniciado con xito, y la implementacin del anlisis de expresin de otros muchos genes ser esencial para discriminar los mecanismos genticos relacionados con la quimiorresistencia. Estos pasos incipientes en la individualizacin de los tratamientos de quimioterapia debern obviamente verse complementados con la inclusin de nuevos marcadores, nuevos mtodos y validarse en estudios prospectivos. De forma similar, estas estrategias debern implementarse en el anlisis de marcadores de respuesta para las nuevas terapias dirigidas a dianas especficas o targeted therapies.

Bibliografa
1. 2. 3. 4. Rosell R, Taron M, Ariza A, et al. Molecular predictors of response to chemotherapy in lung cancer. Semin Oncol 31 (1 Suppl 1), 20-7; 2004. Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B. Nucleotide excision repair pathways involved in cisplatin resistance in non-small cell lung cancer. Cancer Control, 10(4): 297-305; 2003. Sarries C, Haura E, et al Pharmacogenomic strategies for developing customized chemotherapy in non-small cell lung cancer. Pharmacogenomics 3(6); 763-780; 2002. Lord R, Brabender J, Gandara D, et al L et al, Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin. Can. Res; 8; 2286-2291; 2002.
199

Factores de resistencia a quimioterapia en cncer de pulmn

5. 6.

Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic nonsmall-cell lung cancer. Oncogene 2003; 00:1-6. Rosell R, Danenberg K, Alberola V, et al. Ribonucleotide reductase messenger RNA expression and survival in Gemcibatine/Cisplatin-Treated advanced Non-Small Cell Lung Cancer patients. Clin. Can. Res. (10); 1318-1325; 2004. Rosell R, Felip E, Taron M, et al. Gene expression as a predictive marker of outcome in stage IIB-IIIA-IIIB non-small cell lung cancer after induction gemcitabine-based chemotherapy followed by resectional surgery. Clin Cancer Res, Jun 15; 10(12): 4215S-9S; 2004. Isla D, Sarries C, Rosell R, et al. Single nucleotide polymorphisms and outcome in docetaxelcisplatintreated advanced non-small-cell lung cancer. Ann Oncol, 15; 1194-1203, 2004. Taron M, Rosell R, Felip E, et al. BRCA1 mRNA Expression Levels as an Indicator of Chemoresistance in Lung Cancer. Hum Mol Genetics, 2004 (accepted; in press Vol 13, 20). Balaa C, Ramirez JL, Taron M, Roussos Y, Ariza A, Ballester R; Sarries C, Mendez P, Sanchez JJ, Rosell R. MGMT methylation in serum and tumor DNA predicts response to BCNU but not to temozolamide plus cisplatin in glioblastoma multiforme. Clin Cancer Res, 9:1461-1468; 2003. JL Ramrez, C. Srries, P Lopez de Castro, et al. Methylation patterns and k-ras mutations in tumors and paired serum of resected NSCLC patients. Cancer Letters, 193(2): 207-216; 2003.

7.

8. 9. 10.

11.

200

Cncer de pulmn

Factores de resistencia a quimioterapia en cncer de pulmn

201

202

Cncer de pulmn

Factores de resistencia a quimioterapia en cncer de pulmn

203

204

Cncer de pulmn

TERAPIA GNICA
Noem Regart Institut Catal dOncologia Hospital Germans Trias i Pujol Barcelona

Contenido: Resumen de la ponencia Bibliografa Ponencia en PowerPoint

Gene therapy and cancer vaccines for lung cancer

Noem Regart
Medical Oncology Service Institut Catal dOncologia Hospital Germans Trias i Pujol, Barcelona

number of cancer vaccine and gene therapy approaches are being evaluated in patients with lung cancer. Much of the focus on cancer immunotherapy has been in the area of cancer vaccine development.

Gene therapy is a strategy involving the transfer of specific genetic sequences into cells to mitigate disease. The critical components of any cancer gene therapy are indentification of the gene of potential interest, identification of the relevant cell for gene transfer, and finally, identification of the potential vector system for the delivery of the genetic material. Gene transfer vectors include both viral (adenovirus, retrovirus, vaccinia virus, etc) and non-viral (liposomal vectors) agents. Adenoviral vectors are the most common vectors used in gene transfer since are relatively easy to manufacter and have the ability to transduce both dividing and non-dividing cells. The most common gene therapy approaches include gene replacement therapy and gene inhibition therapy in an attempt to reverse a malignant phenotipe, suicide gene therapy to induce tumor cell destruction, immunogene therapy to modify genetically either the tumor cell or a component of the immune system to induce a tumor-specific immune response. The largest human gene therapy experience in lung cancer is with intratumoral gene replacement therapy, predominantly with p53, but such approaches are limited to locoregional disease control. Clinical trials of intratumoral Ad-p53 gene transfer combined with chemotherapy or radiation in advanced NSCLC have been reported and leads to synergistic anti-tumor effects without increasing toxicity(1, 2). Unfortunately intravenous administration of Ad-p53 as a form of systemic therapy of disseminated NSCLC is unlikely to be a viable treatment approach because of the immunogenicity of the adenovirus and life-threatening toxicity. A variant of the p53 gene replacement approach is the use of genetically modified adenoviruses designed to replicate exclusively in tumor cells with impaired p53 function. One example of such approach is ONYX-015(3). A second approach to direct targeting for cancer cells is the suicide gene approach which consists in adenoviral transfer of an encoding prodrug-converting enzyme that transform a systemically administered nontoxic prodrug into a toxic compound that leads to cell death. One example is the herpes simplex thymidine kinase (HSV-tk), that converts a nontoxic nucleoside analog in gancilovir(4, 5). Cancer vaccines incorporate a source of tumor antigens, immunologically relevant, combined with some type of adjuvant to make these tumor antigens more visible to the immune system. In lung cancer, although a number of antigens are expressed/overexpressed in a subset of patients, the relevant immunologically dominant antigens are unknown. Cancer vaccine strategies include GM-CSF (GVAX) gene-modified cancer cells(6, 7), liposomal MUC1 peptide(8), Mage-3 peptide, nonspecific Mycobacterium vaccae(9), and BEC (ganglioside GD3 anti-idiotype), among others. Preliminary human trials have demonstrated immune responses as well as tumor regression in late stage disease and several strategies are moving into late stage clinical development. However, the challenge remains to develop an immune monitoring system that not only evaluate the the sensitivity but that correlates with the relevant clinical effect-tumor shrinkage.
Terapia gnica 207

Bibliografa
1. Schuler, M, Herrmann, R, De Greve, JL, et al. Adenovirus-mediated wild-type p53 gene transfer in patients receiving chemotherapy for advanced non-small-cell lung cancer: results of a multicenter phase II study. J Clin Oncol, 2001; 19(6): 1750-1758. Nemunaitis, J, Swisher, SG, Timmons, T, et al. Adenovirus-mediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small-cell lung cancer. J Clin Oncol, 2000; 18(3): 609-622. Nemunaitis, J, Cunningham, C, Buchanan, A, et al. Intravenous infusion of a replication-selective adenovirus (ONYX-015) in cancer patients: safety, feasibility and biological activity. Gene Ther, 2001; 8(10): 746-759. Sterman, DH, Treat, J, Litzky, LA, et al. Adenovirus-mediated herpes simplex virus thymidine kinase/ganciclovir gene therapy in patients with localized malignancy: results of a phase I clinical trial in malignant mesothelioma. Hum Gene Ther, 1998; 9(7): 1083-1092. Sterman, DH, Molnar-Kimber, K, Iyengar,T, et al. A pilot study of systemic corticosteroid administration in conjunction with intrapleural adenoviral vector administration in patients with malignant pleural mesothelioma. Cancer Gene Ther, 2000; 7(12): 1511-1518. Nemunaitis, J, Sterman, D, Jablons, D, et al. Granulocyte-macrophage colony-stimulating factor genemodified autologous tumor vaccines in non-small-cell lung cancer. J Natl Cancer Inst, 2004; 96(4): 326-331. Salgia, R, Lynch, T, Skarin, A, et al. Vaccination with irradiated autologous tumor cells engineered to secrete granulocyte-macrophage colony-stimulating factor augments antitumor immunity in some patients with metastatic non-small-cell lung carcinoma. J Clin Oncol, 2003; 21(4): 624-630. Palmer, M, Parker, J, Modi, S, et al. Phase I study of the BLP25 (MUC1 peptide) liposomal vaccine for active specific immunotherapy in stage IIIB/IV non-small-cell lung cancer. Clin Lung Cancer, 2001; 3(1): 49-57; discussion 58. O'Brien, ME, Saini, A, Smith, IE, et al. A randomized phase II study of SRL172 (Mycobacterium vaccae) combined with chemotherapy in patients with advanced inoperable non-small-cell lung cancer and mesothelioma. Br J Cancer, 2000; 83(7): 853-857.

2.

3.

4.

5.

6.

7.

8.

9.

208

Cncer de pulmn

Terapia gnica

209

210

Cncer de pulmn

Terapia gnica

211

212

Cncer de pulmn

CUIDADOS DE ENFERMERA EN LAS NUEVAS MODALIDADES TERAPUTICAS

Ana Jimnez Institut Catal dOncologia Hospital Germans Trias i Pujol Barcelona

Contenido: Ponencia en PowerPoint

Cuidados de enfermera en las nuevas modalidades teraputicas

215

216

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

217

218

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

219

220

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

221

222

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

223

224

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

225

226

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

227

228

Cncer de pulmn

Cuidados de enfermera en las nuevas modalidades teraputicas

229

AVANCES EN EL MANEJO MULTIMODAL DEL CNCER DE PULMN NO MICROCTICO

Pilar Garrido Hospital Ramn y Cajal Madrid

Contenido: Resumen de la ponencia Bibliografa Ponencia en PowerPoint

Avances en el tratamiento multimodal del cncer de pulmn

Pilar Garrido
Servicio de oncologa mdica Hospital Ramn y Cajal, Madrid

s de un tercio de los pacientes con cncer de pulmn no microctico (CPNM) debutan con enfermedad localmente avanzada. Aunque se trata de un grupo muy heterogneo, hoy en da sabemos que todos los subgrupos se benefician de un manejo multidisciplinario que incluya quimioterapia (QT) y tratamiento local (ciruga, radioterapia o ambos).1-5 Tradicionalmente, se ha asociado el estadio IIIA con un manejo de QT neoadyuvante seguido de ciruga y el estadio IIIB con un manejo de QT y radioterapia (RT) bien secuencial bien concurrente 6-12. Sin embargo, los lmites son imprecisos existiendo datos que avalan el papel de la ciruga en subgrupos de pacientes con estadio IIIB (sobre todo en pacientes con T4N0-1) as como del papel de la QT/RT concurrente previa a la ciruga en estadio IIIA.

Estadio IIIA La publicacin en los aos 90 de dos estudios fase III que comparaban ciruga frente a quimioterapia basada en cisplatino seguida de ciruga en pacientes con estadio III resecable supuso un cambio en la prctica asistencial, al demostrar un beneficio en supervivencia para los pacientes sometidos al tratamiento combinado13-14. La administracin de QT preoperatoria permite, al menos desde un punto de vista terico, actuar simultneamente sobre el tumor conocido (permitiendo de esa forma testar, adems, su quimiosensibilidad) y, adems, actuar contra la enfermedad micrometastsica que pudiera existir. Por ello, uno de los aspectos claves en los ltimos aos ha sido la bsqueda de las combinaciones de QT ms activas y con menor perfil de toxicidad en este contexto15-20. En general, se han testado las mismas hiptesis que en la enfermedad avanzada (QT basada en platino o no, dobletes con nuevos frmaco, tripletes, etc.) obtenindose resultados muy interesantes. As, la tasa de respuestas objetivas esperable con un esquema de QT de dos frmacos y que incluya cisplatino est alrededor del 6070% y la tasa de resecabilidad supera el 50% en la mayora de las series. En cualquier caso, siempre debe hacerse una lectura muy detallada de las caractersticas de los pacientes incluidos en la serie que se analice dado el peso pronstico tan dispar de algunas de ellas. Actualmente, tambin es materia de debate si debe incluirse radioterapia torcica como parte del tratamiento preoperatorio ya que algunos estudios fase II21-24 utilizando esta estrategia obtienen una elevada tasa de resecciones y de remisiones completas patolgicas, pero a costa de una elevada toxicidad. En este sentido, en ASCO 2004 se presentaron los datos del nico estudio fase III realizado hasta ahora en el que 558 pacientes con estadio III se aleatorizaban entre recibir cisplatino-etopsido seguido de ciruga y luego radioterapia o cisplatino-etopsido seguido de tratamiento concurrente con carboplatino/vindesina y radioterapia fraccionada y luego ciruga25. Las conclusiones del estudio fueron que, con esta combinacin, la asociacin de RT preoperatoria no impacta en supervivencia libre de enfermedad o supervivencia global pero s incrementa significativamente la tasa de esofagitis severa. La eleccin correcta de los pacientes que deben ser sometidos a ciruga tambin es muy debatida. Algunos autores propugnan que solo deben ser intervenidos aquellos que obtengan buena respuesta con el tratamiento de induccin mientras que otros argumentan que la tasa de respuestas radiolgicas
Avances en el manejo multimodal del cncer de pulmn no microctico 233

no es un buen ndice para valorar resecabilidad y que, en ausencia de otras estrategias curativas, no deben ser excluidos de ciruga esos pacientes. En este sentido, un estudio fase III26 que comparaba tratamiento de induccin con QT/RT seguido de ciruga frente a tratamiento solo con QT/RT fue presentado el ao pasado en ASCO y luego en el 10 congreso mundial de pulmn (North American Intergroup Trial 0139). El estudio, realizado sobre 429 pacientes con estadio IIIA N2, demostr mayor supervivencia libre de enfermedad en la rama que inclua ciruga (mediana 14 versus 11 meses, a 3 aos 29% versus 19%) sin diferencia en supervivencia global o patrn de recada y con una mayor tasa de muertes relacionadas con el tratamiento en ese brazo (6,9% versus 1,6%). La conclusin de los autores es que se precisa un mayor seguimiento del estudio para determinar si realmente la ciruga prolonga la supervivencia de estos pacientes frente al tratamiento bimodal con QT/RT. Estadio IIIB Diversos ensayos clnicos randomizados y metaanlisis4-12 han demostrado la superioridad de la quimioterapia basada en cisplatino asociada a radioterapia frente a la radioterapia sola en pacientes con estadio III irresecable y buen estado general. Asimismo, las guas NCCN y ASCO recomiendan tratamiento combinado para esos pacientes2-3. Sin embargo, la estrategia ptima est an por definir y quedan an muchas preguntas por responder (la mejor secuencia de tratamiento, la eleccin de frmacos, el fraccionamiento de radioterapia, etc.). Una vez demostrada la superioridad del tratamiento combinado con QT y RT, la pregunta clave fue si el tratamiento deba ser concurrente o secuencial. En este sentido, tres estudios fase III con diferentes combinaciones de frmacos han sido ya comunicados. El primero de ellos, llevado a cabo en Japn y publicado en 1999 por el West Japan Lung Cancer Group27 aleatoriz 320 pacientes a tratamiento concurrente o secuencial junto con dos ciclos del esquema MVP (mitomicina 8 mg/m2, vindesina 3 mg/m2 y cisplatino 80 mg/m2). La radioterapia concurrente comenzaba el da 2 y se administraban 56 Gy (2 Gy por fraccin, 5 fracciones semanales hasta un total de 14 fracciones seguidas de un periodo de descanso de 10 das y luego el mismo esquema que al principio). El tratamiento con radioterapia secuencial se realizaba al finalizar la QT. La tasa de respuestas objetivas fue 84% en el brazo concurrente y 66.4% en el secuencial (p = 0,0002). La mediana de supervivencia (16,5 vs 13,3 meses) y la supervivencia a largo plazo (17,9% vs 7,1%) tambin fueron superiores en el brazo concurrente as como la toxicidad hematolgica. Probablemente debido a la tcnica de RT empleada, no hubo diferencias significativas en la tasa de toxicidad no hematolgica severa en este estudio. Ms recientemente, se han comunicado los resultados a largo plazo del estudio americano RTOG 941028-29. Seiscientos once pacientes con estadios II- III irresecables fueron aleatorizados en tres brazos. Uno de ellos utilizaba cisplatino y vinblastina secuencial con radioterapia torcica que se iniciaba el da 50, otro reciba el mismo esquema pero de forma concurrente y el ltimo, reciba un esquema concurrente con radioterapia hiperfraccionada junto a cisplatino y etopsido. La toxicidad no hematolgica aguda grado 3-4, como era de esperar, fue significativamente superior con los esquemas concurrentes (30%, 48% y 62%, respectivamente) pero no hubo diferencias significativas en las tasas de toxicidad tarda. Los datos de supervivencia, al igual que en el estudio japons, fueron favorables al tratamiento concurrente pero no al brazo con RT hiperfraccionada. Los datos fueron: medianas y supervivencia a 4 aos de 14,6 meses y 12% (secuencial), 17 meses y 21% (concurrente) y 15,2 meses y 17% (concurrente hiperfraccionada). El tercer estudio fase III30, por el contrario, no demuestra ventaja en la supervivencia (medianas de 13,8 versus 15,8 meses) siendo, adems, la diferencia en toxicidad muy significativa (disfagia severa 0%/24% y esofagitis grado 4 0%/28%)
234 Cncer de pulmn

Otros estudios fase II que tambin analizan esquemas concurrentes con distintas asociaciones de QT se han comunicado recientemente. As, el estudio LAMP31 que inclua 258 pacientes y analizaba tres grupos (tratamiento secuencial, tratamiento de induccin seguido de de tratamiento concurrente y tratamiento concurrente seguido de tratamiento de consolidacin) concluye recomendando el tratamiento concomitante seguido de la QT adyuvante utilizando la combinacin paclitaxel y carboplatino. El estudio de Zatloukal32 recomienda la combinacin de vinorelbina y cisplatino concurrente con radioterapia, tras comparar en un estudio fase II randomizado este esquema con el mismo pero administrado secuencialmente. El grupo SWOG33 en su estudio 9594 recomienda cisplatino/etopsido concurrente con radioterapia y seguido de 3 ciclos de consolidacin con docetaxel. Por ltimo, el CALGB34 ha testado diferentes dobletes (cisplatino vinorelbina, paclitaxel carboplatino y cisplatino gemcitabina) con una estrategia de induccin previa al tratamiento concurrente que demuestra la factibilidad de esas combinaciones. En cualquier caso, existen diferentes combinaciones posibles y, si se opta por la estrategia concurrente, es fundamental un estricto control de la toxicidad sobre todo esofgica y pulmonar. Conclusiones El manejo de los pacientes con cncer de pulmn no microctico estadio III est en constante evolucin siendo la premisa fundamental que todos se benefician de un manejo multidisciplinario. Quimioterapia, radioterapia y ciruga son estrategias que deben combinarse para ofrecer a cada paciente la mejor opcin. Sin embargo, la existencia de mltiples aspectos por resolver hace recomendable siempre la inclusin de los pacientes en ensayos clnicos y, por supuesto y de manera ineludible la valoracin individual de cada uno de ellos por un comit multidisciplinario con experiencia en cncer de pulmn.

Bibliografa
1. Paesmans M, Berghmans T, Vallot F et al. Treatment with or without chemotherapy for locally advanced non small cell lung cancer: a systematic review by the European Lung Cancer Working Party. Lung Cancer 2000; 9 (suppl 1): 90 (abstr 293). Pfister D, Johnson D, Azzoli C et al. American Society Of Clinical Oncology.Treatment of unresectable non small cell lung cancer guideline: update 2003. J Clin Oncol 2004; 22: 330-353. Ettinger DS, Cox JD, Ginsberg RJ et al. NCCN non small cell lung cancer practice guidelines. National Comprehensive Cancer Network. Oncology 1996; 10: (suppl) 81-111. Pritchard RS, Anthony SP: Chemotherapy plus radiotherapy compared with radiotherapy alone in the treatment of locally advanced, unresectable non small cell lung cancer. A meta-analysis. Ann Inter Med 1996; 125: 723-729. Non Small Cell Lung Cancer Collaborative Group. Chemotherapy in non small cell lung cancer: a metaanalysis using updated data on individual patients from 52 randomized clinical trials. Br Med J 1995; 311: 899-909. Dillman RO, Seagren SL, Propert KJ et al: A randomized trial of induction chemotherapy plus high dose radiation versus radiation alone in stage III non small cell lung cancer. N Engl J Med 1990; 323: 940-945. Dillman R, Don J, Seagren S et al. Improved survival in stage III non small cell lung cancer: a seven year follow-up of CALGB 8433 trial. J Nat Cancer Inst 1996; 88: 1210-1215.
235

2. 3. 4.

5.

6.

7.

Avances en el manejo multimodal del cncer de pulmn no microctico

8.

Sause WT, Scott C, Taylor S et al: Radiation Therapy Oncology Group (RTOG) 88-08 and Eastern Cooperative Oncology Group (ECOG) 4588: Preliminary results of a phase III trial in regionally advanced, unresectable non small cell lung cancer. J Natl Cancer Inst 1995; 87: 198-205. Sause W, Kolesar P, Taylor S et al. Final results of phase III trial in regionally advanced unresectable non small cell lung cancer. Chest 2000; 117: 358-364. Le Chevalier T, Arriagada R, Quoix E et al: Radiotherapy alone versus combined chemotherapy and radiotherapy in non-resectable non small cell lung cancer: first analysis of a randomized trial in 353 patients. J Natl Cancer Inst 1991; 83: 417-423. Schaake-Koning C, van den Bogaert W, Dalesio O et al: Effect of concomitant cisplatin and radiotherapy on inoperable non small cell lung cancer. N Engl J Med 1992; 326: 524-530. Jeremic B, Shibamoto Y, Acimovic L et al. Hyperfractionated radiation therapy with or without concurrent low-dose daily carboplatin/etoposide for stage III non small cell lung cancer: a randomized study. J Clin Oncol 1996: 14: 1065-1070. Rosell R, Gmez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy plus surgery with surgery alone in patients with non-small cell lung cancer. N Engl J Med 1994; 330: 153-158. Roth J, Fosella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy and surgery with surgery alone in resectable stage IIIA non-Small Cell Lung Cancer. J Natl Cancer Inst 1994; 86: 673-680. Van Zandwijk N, Smit E, Kranmer G et al. Gemcitabine and cisplatin as induction regimen for patients with biopsy-proven stage IIIAN2 Non-Small Cell Lung Cancer: a phase II study of the EORTC lung Cancer Cooperative Group. J Clin Oncol 2000; 18: 2658-2664. Betticher D, Schmitz S, Ttsch M et al. Mediastinal lymph node clearance after docetaxel-cisplatin neoadjuvant chemotherapy is prognostic of survival in patients with stage IIIA pN2 Non-Small Cell Lung Cancer: a multicenter phase II trial. J Clin Oncol 2003; 21:1752-1759. Manegold C, Biesma B, Smit H et al. Docetaxel and cisplatin as induction chemotherapy in stage IIIA N2 non-small cell lung cancer: an EORTC phase II trial (08984). Proc American Soc Clin Oncol 2004, vol 23, 654a (#7166). Gottfried M, Ramlau R, Krzakowski M et al. Vinorelbine-based triplet with ifosfamide and cisplatin as induction chemotherapy to increase resection rate in marginally unresectable non-small cell lung cancer patients. Proc American Soc Clin Oncol 2004, vol 23, 654a, (# 7165). Cappuzzo F, De Marinis F, Nelli F et al. Phase II study of gemcitabine-cisplatin-paclitaxel triplet as induction chemotherapy in inoperable, locally-advanced non-small cell lung cancer. Lung Cancer 2003; 42, 355-361. Garrido P, Moyano A, Lago J et al. Multidisciplinary approach including surgery in stage IIIB non small cell lung cancer. Rev Oncologa 1999; 1 (suppl 2): 61-69. Albain K, Rush V, Crowley J et al. Long term results after concurrent cisplatin/etoposide plus chest radiotherapy followed by surgery in bulky stages IIIA(N2) and IIIB non small cell lung cancer: 6 year outcomes from South West Oncology Group study 8805. Proc Am Soc Clin Oncol 1999; 18: 467 a (1801).
Cncer de pulmn

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

236

22.

Choi N, Carey R, Daly W et al. Potential impact on survival of improved tumor downstaging and resection rate by preoperative twice-daily radiation and concurrent chemotherapy in stage IIIA non small cell lung cancer. J Clin Oncol 1997; 15: 712-717. Eberhardt W, Wilke H, Stamatis M et al. Preoperative chemotherapy followed by concurrent chemoradiation therapy based on hyperfractionated accelerated radiotherapy and definitive surgery in locally advanced non small cell lung cancer: mature results of a phase II trial. J Clin Oncol 1998; 16: 622-634. Thomas M, Rube C, Semik M et al. Impact of preoperative bimodality induction including twicedaily radiation on tumor regression and survival in stage III non small cell lung cancer. J Clin Oncol 1999; 17: 1185-1193. Thomas M, Macha H, Ukena D et al. Cisplatin / etoposide followed by twice-daily chemoradiation versus cisplatin / etoposide alone before surgery in stage III non-small cell lung cancer: a randomized stage III trial of the German Lung Cancer Cooperative Group. Proc American Soc Clin Oncol 2004, vol 23, 616a (#7004). Albain K, Scout C, Rush V et al. Phase III study of concurrent chemotherapy and full course radiotherapy versus CT/RT induction followed by surgical resection for stage IIIA (pN2) nonsmall cell lung cancer: first outcome analysis of North American Intergroup trial 0139 (RTOG 93-09). Lung Cancer 2003; 41: S4. Furuse K, Fukuoka M, Kawahara M et al: Phase III study of concurrent versus sequential thoracic radiotherapy in combination with mitomycin, vindesine and cisplatin in unresectable stage III non small cell lung cancer. J Clin Oncol 1999; 17: 2692-2699. Movsas B, Scott C, Curran W et al. A Quality-adjusted time without symptoms or toxicity (QTWiST) analysis of RTOG 9410. Proc Amer Soc Clin Oncol 2001; 20; 291a (# 1247). Curran W, Scott C, Langer C, et al. Long-term benefit is observed in a phase III comparison of sequential versus concurrent chemoradiation for patients with unresected stage III non small cell lung cancer: Radiation Therapy Oncology Group 9410. Proc Amer Soc Clin Oncol 2003; 22;621 (#2499). Pierre F, Maurice P, Gilles R et al. A randomized phase III trial of sequential chemoradiotherapy versus concurrent chemo-radiotherapy in locally advanced non small cell lung cancer. GLOT-GFPC NPC 9501 study. Proc Amer Soc Clin Oncol 2001; 20: abstr 1246. Bonomi P, Curran W, Choy H et al. Randomized 3-arm phase II study of paclitaxel, carboplatin, and thoracic radiation for patients with stge III NSCLC. Report of Locally Advanced Multimodality Protocol. Lung Cancer 2003; 41 (Suppl 2), S77 (# 0-263). Zatloukal P, Petruzelka L, Zemanova M et al. Concurrent versus sequential radiochemotherapy with vinorelbine plus cisplatin in locally advanced NSCLC. A radomized phase II study. Long-term follow-up data. Lung Cancer 2003; 41 (Suppl 2), S76 (# 0-262). Gandara D, Chansky K, Albain K et al. Consolidation docetaxel after concurrent chemoradiotherapy in stage IIIB non small cell lung cancer: phase II SWOG 9504. J Clin Oncol 2003; 21 (10): 2004-10. Vokes E, Herndon JE, Crawford J et al: Randomized phase II trial of cisplatin with gemcitabine or paclitaxel or vinorelbine as induction chemotherapy followed by concomitant chemoradiotherapy for stage III non small cell lung cancer. J Clin Oncol 2002; 20: 4191-4198.
237

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

Avances en el manejo multimodal del cncer de pulmn no microctico

238

Cncer de pulmn

Avances en el manejo multimodal del cncer de pulmn no microctico

239

240

Cncer de pulmn

Avances en el manejo multimodal del cncer de pulmn no microctico

241

242

Cncer de pulmn

Avances en el manejo multimodal del cncer de pulmn no microctico

243

244

Cncer de pulmn

Avances en el manejo multimodal del cncer de pulmn no microctico

245

246

Cncer de pulmn

ACTUALIZACIN DEL TRATAMIENTO DE CNCER DE PULMN

Jos Miguel Snchez Torres Instituto Cataln de Oncologa Hospital Germans Trias i Pujol Barcelona

Contenido: Resumen de la ponencia Bibliografa

Actualizacin del tratamiento del cncer de pulmn

Jos Miguel Snchez Torres
Servicio de oncologa mdica Instituto Cataln de Oncologa Hospital Germans Trias i Pujol, Badalona (Barcelona)

l cncer de pulmn es la neoplasia ms frecuente y la principal causa de muerte por cncer. Alrededor del 80% pertenecen a la variedad histolgica de cncer de pulmn no microctico (CPNM). De ellos un tercio son resecables en el momento del diagnstico. La reseccin quirrgica es el tratamiento estndar en los estadios iniciales de la enfermedad. Sin embargo, slo el 50% de ellos estar curado a los 5 aos a pesar de la reseccin completa de la enfermedad. La supervivencia en estos estadios precoces disminuye en relacin directa al tamao del tumor y a la afectacin ganglionar. La supervivencia a los 5 aos oscila entre el 67% en estadio IA (pT1N0) y el 39% en estadio pIIB (pT2 N1)(1).

En la actualidad se est evaluando el efecto de la quimioterapia pre y postoperatoria en los estadios iniciales resecables de la enfermedad. La quimioterapia preoperatoria podra aumentar la supervivencia en estadios I y II con respecto a la ciruga sola(2). El papel de la quimioterapia adyuvante en determinados subgrupos de pacientes ha sido establecido con los resultados de los ltimos estudios completados. El Grupo Espaol de Cncer de Pulmn (GECP) tiene en marcha el ensayo NATCH en pacientes con estadios iniciales, los cuales son aleatorizados a una de las tres ramas de tratamiento: ciruga sola, quimioterapia preoperatoria con paclitaxel-carboplatino, o bien quimioterapia postoperatoria. Los resultados preliminares muestran un claro efecto de la quimioterapia neoadyuvante en la reduccin del tamao tumoral. El metaanlisis del ao 1995 concluy que el tratamiento adyuvante con combinaciones basadas en platinos incrementa la supervivencia a 5 aos en un 5% y reduce el riesgo de muerte en un 13% frente a la reseccin quirrgica sola, aunque esta diferencia no alcanzaba la significacin estadstica (HR 0,87, P = 0,08)(3). Estos resultados han sido confirmados por el estudio del grupo IALT (International Adjuvant Lung Cancer Trial) en pacientes con estadios I, II y III(4). La quimioterapia postoperatoria increment la supervivencia a 5 aos de los pacientes en un 4.1% en comparacin con los pacientes tratados nicamente con reseccin quirrgica (44,5% vs 40,4%; P < 0,03). Recientemente, dos estudios aleatorizados demuestran un beneficio estadsticamente significativo de la quimioterapia adyuvante en estadios precoces. El estudio CALGB 9633, en pacientes con estadio IB (T2 N0), report un beneficio de la quimioterapia postoperatoria con paclitaxel y carboplatino tanto en la supervivencia global a los 4 aos (71% vs 59%, P = 0.028), como en la supervivencia libre de recaida (61% vs 50%, P = 0,035)(5). En el estudio canadiense, el tratamiento adyuvante con vinorelbina y cisplatino supuso un incremento del 15% en la supervivencia global (69% vs 54%, P = 0,002), y del 13% en la supervivencia libre de recidiva (61% vs 48%, P = 0,012), ambas a los 5 aos, en pacientes con estadio IB y II(6).
Actualizacin del tratamiento de cncer de pulmn 249

Ahora bien, puesto que sabemos que alrededor de la mitad nunca va a recidivar, un enfoque racional sera el tratamiento adyuvante solo a los pacientes con alto riesgo de recidiva. El anlisis de marcadores pronsticos podra definir el grupo de pacientes resecados con mayor probabilidad de recurrencia. En estos pacientes, la identificacin de marcadores predictivos genticos podra identificar subgrupos quimiorresistentes y quimiosensibles frente a determinados agentes. La enfermedad localmente avanzada o estadio III supone el 20-30% de los pacientes al diagnstico. El estadio IIIA incluye los casos con extensin locorregional T3 N1 y T1-3 N2. A pesar de ser tcnicamente resecables, tienen una supervivencia a los 5 aos del 10-15%. Los principales factores pronsticos son la afectacin ganglionar y la reseccin completa. La quimioterapia neoadyuvante ha demostrado incrementar la supervivencia de estos pacientes(7, 8). El estadio IIIB incluye pacientes clsicamente considerados irresecables, cuya supervivencia a los cinco aos es del 5%. En estos pacientes la radioterapia concomitante con quimioterapia, bien precedida de quimioterapia de induccin, o bien seguida de quimioterapia de consolidacin, es el tratamiento que consigue un mayor beneficio en la supervivencia. El 40-50% de los pacientes tienen una enfermedad en estadio IV o metasttico en el momento del diagnstico. Los platinos (cisplatino y carboplatino) se consideran el elemento imprescindible en el tratamiento de estos tumores. Datos procedentes de ocho ensayos que utilizaron tratamiento con quimioterapia basada en cisplatino mostraron un incremento del 10% en la supervivencia a 1 ao y de 1.5 meses en la mediana de supervivencia(3). Despus de ms de dos dcadas de ensayos clnicos evaluando la eficacia de distintas combinaciones de un platino ms otro agente, se ha llegado a lo que podramos denominar un techo teraputico. Un ensayo llevado a cabo por el Southwest Oncology Group concluy que la mediana en la supervivencia con vinorelbina-cisplatino era similar a la obtenida con paclitaxel/carboplatino: 8,1 y 8,6 meses, respectivamente(9). Ms recientemente, el Eastern Cooperative Oncology Group desarroll un ensayo aleatorizado a cuatro ramas de tratamiento y observ una tasa global de respuestas del 19%, una supervivencia mediana de 7.9 meses, una supervivencia a 1 ao de 33%, y de 11% a los 2 aos(10). No se encontraron diferencias en la eficacia de los cuatro esquemas de quimioterapia basados en platino (cisplatino-paclitaxel, cisplatino-gemcitabina, cisplatino-docetaxel, y carboplatino-paclitaxel). En el Italian Lung Cancer Project, los pacientes eran aleatorizados a recibir gemcitabina/cisplatino o paclitaxel/carboplatino o vinorelbina/cisplatino. De nuevo, no se encontraron diferencias en la tasa de respuestas (30%), tiempo hasta la progresin (4,6 meses), ni en la supervivencia mediana (9,8 meses)(11). En este contexto son necesarios nuevos enfoques en el tratamiento del cncer de pulmn. Uno sera la investigacin de nuevos agentes que actan contra determinadas dianas moleculares, realizando su accin en pasos muy especficos del complejo proceso de proliferacin y diferenciacin celular. Otro sera la identificacin de marcadores genticos predictivos de quimiorresistencia que nos puedan definir subgrupos de pacientes que van a poder beneficiarse del tratamiento con determinadas combinaciones de agentes quimioterpicos. Las vas de reparacin de ADN juegan una importante funcin en la resistencia a la quimioterapia. El anlisis de la expresin de genes que intervienen en la reparacin de ADN puede ayudarnos a individualizar la combinacin ptima de agentes quimioterpicos. Los genes ERCC1 (Excision Repair Cross-Complementing 1), RR (Ribonucleotide Reductase) y BRCA1 (Breast Cancer 1) intervienen de forma crucial en las vas de reparacin de ADN. La sobreexpresin de ERCC1 en tejido tumoral se ha asociado con resistencia a cisplatino en pacientes con CPNM tratados con gemcitabina y cisplatino. La mediana en la supervivencia de los pacientes con bajo nivel de expresin de ERCC1 fue de 15 meses, mientras que en aquellos con alto nivel de expresin fue solo de 5 meses (P = 0,009). El anlisis multivariable identific la expresin de
250 Cncer de pulmn

este gen como factor pronstico de supervivencia junto con la prdida de peso y el Performance Status(12). El GECP est finalizando el reclutamiento de pacientes en un ensayo farmacogenmico aleatorizado en el que el esquema de quimioterapia en la rama experimental depende de la expresin de ERCC1: docetaxel-cisplatino si la expresin es baja, y una combinacin sin platino si sta es alta, docetaxel-gemcitabina. Los datos preliminares indican una mayor eficacia en los pacientes tratados en la rama experimental. RR es una enzima limitante clave en la sntesis de ADN. Adems la subunidad RRM1 interviene en el metabolismo de la gemcitabina y en la reparacin de ADN. La sobreexpresin de RRM1 se ha correlacionado con la resistencia a gemcitabina tanto in vitro como en pacientes con CPNM tratados con cisplatino y gemcitabina. El anlisis en la expresin de RRM1 en biopsias de pacientes italianos tratados dentro de un ensayo aleatorizado(11), revel diferencias estadsticamente significativas en la supervivencia del grupo de pacientes tratados con gemcitabina y cisplatino. La supervivencia mediana fue de 15,5 meses en aquellos con un nivel bajo de RRM1 y de 6,8 meses en aquellos con un nivel alto (P = 0,0028). El tiempo a la progresin tambin result superior en los pacientes con niveles bajos (P = 0,05)(13). Entre 1988 y 2000 el GECP desarroll un ensayo aleatorizado comparando gemcitabinacisplatino versus gemcitabina-cisplatino-vinorelbina versus gemcitabina-vinorelbina seguido de vinorelbinaifosfamida(14). En el grupo asignado a gemcitabina-cisplatino, la supervivencia mediana en los pacientes con baja expresin de RRM1 era superior a la de los que tenan alta expresin en el tejido tumoral: 13,7 meses vs 3,6 meses (P = 0,009), as como el tiempo hasta la progresin: 8,4 meses vs 2,7 meses (P = 0,020)(15). BRCA1 es un gen que juega un papel crucial en varias de las vas de reparacin del ADN. Su expresin se ha relacionado con resistencia a quimio y radioterapia. Estudios preclnicos sugieren que una expresin reducida de BRCA1 incrementa la sensibilidad a agentes que producen un dao en el ADN, como cisplatino, por promover la reparacin del ADN y la supervivencia celular, con inhibicin de la apoptosis. En contraste con este efecto, una expresin elevada de BRCA1 aumenta la sensibilidad de los agentes antimicrotbulos por inducir la apoptosis en respuesta a dichos agentes(16) La expresin reducida de BRCA1 en una lnea celular de cncer de mama determin una gran sensibilidad a cisplatino y etopsido y una gran resistencia a agentes que actan sobre los microtbulos, como paclitaxel y vincristina(17). La reconstitucin del gen BRCA1 result en un incremento en la resistencia a cisplatino y tambin en la sensibilidad a agentes antimicrotbulos(18, 19). En un grupo de 55 pacientes estadios IIB, IIIA y IIIB que fueron resecados despus de recibir quimioterapia neoadyuvante con gemcitabina y cisplatino se realiz una cuantificacin de la expresin de BRCA1 ARNm en tejido tumoral parafinado, y esta expresin gnica se dividi en cuartiles. La supervivencia no se ha alcanzado en los pacientes en el cuartil con menor expresin de BRCA1, es de 37.8 meses en los pacientes incluidos en los dos cuartiles medios, y es de 12,7 meses en aquellos en el cuartil superior, y esta diferencia es estadsticamente significativa (P = 0,01)(20) Los inhibidores de la tirosn kinasa del receptor del factor de crecimiento epidrmico (EGFR) son pequeas molculas que compiten con el ATP en su unin a la tirosn kinasa del EGFR, con lo cual inhiben su autofosforilacin y la posterior activacin en cascada de sealizaciones que conducen a la multiplicacin celular, bloqueando el proceso de proliferacin y metastatizacin. La presencia de mutaciones en el dominio tirosn kinasa del EGFR se ha identificado como el mayor determinante de respuesta a agentes inhibidores de dicha tirosn kinasa. Varios trabajos han descrito estas mutaciones y su correlacin con sensibilidad a inhibidores de EGFR. La mayora de las mutaciones se localizan en los exones 18, 19
Actualizacin del tratamiento de cncer de pulmn 251

y 21, y consisten en delecciones y en sustitucin de aminocidos. Estos estudios muestran una alta frecuencia de mutaciones en pacientes con histologa de adenocarcinoma, mujeres, no fumadores y asiticos. Aquellos pacientes con mutaciones tratados con un inhibidor de EGFR pueden conseguir una inusual larga supervivencia(21, 22, 23, 24). El GECP en su compromiso para mejorar el tratamiento y pronstico de los pacientes con cncer de pulmn, tiene previsto iniciar en los prximos meses varios ensayos clnicos farmacogenmicos con el objetivo de evaluar la expresin de RRM1 y de BRCA1 como potenciales marcadores predictivos de quimiorresistencia, tanto en la enfermedad metastsica como en neoadyuvancia y en adyuvancia. En esta misma lnea se contempla el anlisis de mutaciones en el dominio tirosn kinasa del EGFR en el tejido tumoral de los pacientes con histologa de adenocarcinoma y posterior tratamiento con agentes inhibidores del mismo, como gefitinib o erlotinib. La individualizacin del tratamiento de acuerdo a la expresin de marcadores predictivos de respuesta a agentes quimioterpicos y a inhibidores moleculares de la proliferacin celular podra mejorar de forma significativa el pronstico de los pacientes con cncer de pulmn, y dar lugar a un cambio radical en la prctica clnica habitual

Bibliografa
1. 2. Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997; 111: 17101717. Depierre A, Milleron B, Moro-Sibilot D, et al. Preoperative chemotherapy followed by surgery compared with primary surgery in respectable stage I (except T1N0), II, and IIIa non-small cell lung cancer. J Clin Oncol 2002; 20: 247-253. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Br Med J 1995; 311: 899-909. The International Adjuvant Lung Cancer Trial Collaborative Group. Cisplatin-based Adjuvant Chemotherapy In Patients With Completely Resected NSCLC, N Engl J Med 2004; 350: 351-360. Strauss GM, Maddaus MA, Johnson EA, et al. Randomized clinical trial of adjuvant chemotherapy with paclitaxel and carboplatin following resection in stage IB non-small cell lung cancer. Report of Cancer and Leukemia Group B (CALGB) Protocol 9633. Proc Am Soc Clin Oncol 2004; 23: 7019. Winton TL, Livingston R, Johnson D, et al. A prospective randomized trial of adjuvant vinorelbine and cisplatin in completely resected stage IB and II non-small cell lung cancer (Intergroup Trial JBR. 10). Proc Am Soc Clin Oncol 2004; 23: 7018. Rosell R, Gmez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy plus surgery with surgery alone in patients with non-small cell lung cancer et al. N Engl J Med 1994; 330: 153-158. Roth JA, Fossella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy and surgery with surgery alone in resectable stage IIIA non-small-cell lung cancer. J Natl Cancer Inst 1994; 86: 673-680.
Cncer de pulmn

3.

4. 5.

6.

7.

8.

252

9.

Kelly K, Crowley J, Bunn PA, et al. Randomized phase III trial of paclitaxel plus carboplatin versus vinorelbine plus cisplatin in the treatment of patients with advanced non-small cell lung cancer: a Southwest Oncology Group trial. J Clin Oncol 2001; 19: 3210-8. Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 2002; 346: 92-98. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinumbased doublets in advanced non-small cell lung cancer. J Clin Oncol 2002; 20: 4285-4291. Lord RVN, Brabender J, Gandara D, et al. Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin Cancer Res 2002; 8: 2286-2291. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsias from a three arm randomized trial in metastatic non-small cell lung cancer. Oncogene 2003; 22: 3548-3553. Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcitabine versus a cisplatin-based triplet versus nonplatinum sequential doublets in advanced non-small cell lung cancer: a Spanish Lung Cancer Group Phase III randomized trial. J Clin Oncol 2003; 21: 3207-3213. Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reductase Messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clin Cancer Res 2004; 10: 1318-1325. Kennedy RD, Quinn JE, Mullan PB, et al.The role of BRCA1 in the celular response to chemotherapy. J Natl Cancer Inst 2004; 96: 1659-1668. Lafarge S, Sylvain V, Ferrara M, et al. Inhibition of BRCA1 leads to increased chemoresistance to microtubule-interfering agents, an effect that involves the JNK pathway. Oncogene 2001; 20: 65976606. Mullan PB, Quinn JE, Gilmore PM, et al. BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents. Oncogene 2001; 20: 6123-6131. Quinn JE, Kennedy RD, Mullan PB, et al. BRCA1 functions as a differential modulator of chemotherapy-induced apoptosis. Cancer Res 2003; 63: 6221-6228. Taron M, Rosell R, Felip E, et al. BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer. Hum Mol Genet 2004; 13: 2443-2449. Lynch TJ, Bell DW, Sordilla R, et al. Activating mutations in the epidermal groth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004; 350: 21292139. Paez JG. Jnne PA, Lee JC, et al. EGFR mutations in lung cancer : correlation with clinical response to gefitinib therapy. Science 2004; 304: 1497-1500. Pao W, Miller V, Zukowski M, et al. EGF receptor gene mutations are common in lung cancer from never smokers are associated with sensitivity of tumors to gefitinib and erlotinib. PNAS 2004; 101: 13306-13311. Miguel Taron,Yukito Ichinose, Rafael Rosell, et al. Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor are associated with gefitinib response in chemorefractary lung adenocarcinomas. Clin Cancer Res 2005 (in press).
253

10. 11. 12.

13. 14.

15.

16. 17.

18. 19. 20. 21.

22 23.

24.

Actualizacin del tratamiento de cncer de pulmn

La edicin de esta publicacin ha sido posible gracias a la colaboracin de: