Thesis CF 4

Cystic Fibrosis and the Gastro-Intestinal Tract
Marjan Wouthuyzen-Bakker
The research described in this thesis was carried out at the Department of Pediatrics, Beatrix Childrens Hospital, Center for Liver, Digestive and Metabolic Diseases, University of Groningen, University Medical Center Groningen and was financially supported by the Junior Scientific Masterclass Groningen. The author gratefully acknowledges the financial support for printing this thesis by:
Graduate school for drug exploration
University of Groningen
University Medical Center Groningen
ISBN ISBN
2011 Marjan Wouthuyzen-Bakker All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without permission of the author and the publisher holding the copyrights of the articles. Cover & layout design: Marjan Wouthuyzen-Bakker Printed by: Whrmann Print Service, Zutphen
978-90-367-5090-5 (printed version) 978-90-367-5091-2 (digital version)
Cystic Fibrosis and the Gastro-Intestinal Tract

ter verkrijging van het doctoraat in de Medische Wetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. E. Sterken, in het openbaar te verdedigen op woensdag 12 oktober 2011 om 11.00 uur door Proefschrift
geboren op 7 december 1978 te Delfzijl
Marjan Wouthuyzen-Bakker
Promotor:
Copromotor:
Prof. dr. H.J. Verkade Dr. H.R. de Jonge Prof. dr. E.J. Duiverman Prof. dr. R.O.B. Gans Prof. dr. A.K. Groen
Beoordelingscommissie:
For children, the disease Cystic Fibrosis is a word that is difficult to pronounce. In 1965, a young boy with Cystic Fibrosis overheard his mother talking about the disease on the phone. When she said the words Cystic Fibrosis, he thought she said 65 roses. The mother was touched, because her son saw something beautiful in a disease that can often be quite ugly. Since that time, the term 65 Roses has been used by children of all ages to describe their disease. The phrase is now a registered trademark of the Cystic Fibrosis Foundation, which adopted the rose as its symbol.
Paranimfen:
Farah Klingenberg-Salachova Willemien de Vries
CONTENTS
CHAPTER 1 CHAPTER 2 CHAPTER 3 CHAPTER 4 CHAPTER 5 CHAPTER 6 CHAPTER 7
General introduction to the thesis ......................................................................................................... 7
Energy intake and growth in cystic fibrosis patients with preserved pulmonary function .......................................................................................................................................................... 27 Submitted
Persistent fat malabsorption in cystic fibrosis; lessons from patients and mice .......... 41 Journal of Cystic Fibrosis 2011; 10(3): 150-8 Antibiotic treatment and fat absorption in cystic fibrosis mice ............................................ 59 Pediatric Research, accepted for publication
Ursodeoxycholic acid modulates bile flow and bile salt pool independently of the cystic fibrosis transmembrane regulatory gene in mice ................................................... 77 Am J Physiol Gastrointestinal Liver Physiol, conditionally accepted for publication Calcium induced anion secretion in gallbladder epithelium of pigs and mice with cystic fibrosis ............................................................................................................................................... 93 Submitted General discussion and summary .....................................................................................................111
APPENDICES
Nederlandse samenvatting ..................................................................................................................126 Dankwoord .................................................................................................................................................130 Biografie.......................................................................................................................................................133
ChapTEr 1
INTRODUCTION TO THE THESIS
M. Wouthuyzen-Bakker
ChapTEr 1 INTrOduCTION
ThE CYSTIC FIBrOSIS TraNSMEMBraNE CONduCTaNCE rEGuLaTOr (CFTr) The human Cftr gene is located on the long arm of chromosome 7 and encodes for the Cystic Fibrosis Transmembrane conductance Regulator (CFTR). CFTR is a glycoprotein located at the apical membrane of (primarily) epithelial cells and is a member of the ATP-binding cassette (ABC) transporter family.4 CFTR is mostly expressed in gland-rich organs, e.g. the lungs, pancreas, intestine, gallbladder, intra- and extra-hepatic bile ducts, reproductive tract and sweat-glands.1-2 Recent data showed that CFTR is also localized in non-epithelial cells and other tissues, including lymphocytes, skeletal muscle, smooth muscle, the thyroid gland and neurons.5-13 The most well defined function of CFTR comprises its role as a chloride and bicarbonate channel. However, the knowledge about the function of CFTR has expanded impressively during the last decade. Apart from its role in anion-transport, CFTR also transports hyaluronic acid, regulates the activity of several other (transporter) proteins, is involved in fatty acid metabolism and autophagy and is (indirectly) responsible for the proper function of defensins (proteins with an antimicrobial function).14-20 The secretory and regulatory function of CFTR especially underlines its importance in fluid and electrolyte transport across epithelial tissues. The CFTR protein structure comprises two transmembrane spanning domains, two nucleotide binding domains and one regulatory domain (Figure 1).4 CFTR is (indirectly) activated by an increase of cyclic AMP in the cell (caused by various substances, including secretin). Cyclic AMP increase induces CFTR phosphorylation at the regulatory domain by protein kinase A. The phosphorylation stimulates the binding of ATP at the nucleotide binding domains and consequently results in the opening of the CFTR channel. Subsequently, chloride, but also bicarbonate, can be secreted into the lumen of the particular organ or gland. The secretion of anions generates a transepithelial potential difference (lumen negative) which promotes paracellular 10
INTrOduCTION Cystic Fibrosis (CF) is a complex, potentially fatal disease and affects multiple organs. Respiratory failure due to irreversible destruction of the lungs is the predominant cause of mortality in CF patients.1-2 Gastro-intestinal involvement is the second most severe manifestation of the disease. CF-related pancreatic and intestinal disease results in various problems, including malabsorption of fat and a suboptimal nutritional status. Biliary involvement may contribute to the former and, in addition, may also lead to endstage liver disease in a subset of patients.3 The aim of this thesis was to obtain more detailed pathophysiological insight in CF-related gastro-intestinal disease by evaluating current treatment and by investigating potential future treatment options. First, the normal function of the CFTR protein (Cystic Fibrosis Transmembrane conductance Regulator) will be described. Second, the consequences of CFTR dysfunction in CFdisease in various organs will be outlined, with a particular emphasis on CF-related symptoms in the gastro-intestinal tract and corresponding treatment. In addition, various CF animal models will be discussed as they greatly contribute(d) to the knowledge on CF pathophysiology and related treatments.
sodium secretion and, consequently, osmotically driven fluid secretion. Additionally, CFTR may act itself as a bicarbonate channel or as a chloride shunt for a separate chloride-bicabonate exchanger (Figure 3), resulting in active bicarbonate secretion.4 The cascade of anion and fluid secretion results in a fine water-layer at the epithelial surface which is responsible for the hydration of mucus and in the airways- allows the cilia to clear the mucus in a coordinated manner.21 Hydration of mucus and sufficient mucus clearance prevents the harbouring of (pathogenic) bacteria and toxic/infectious agents to accumulate in the lumen.22 Recently, the importance of bicarbonate release for the expansion of mucins by electrostatic repulsion has become evident.23-26 Thus, bicarbonate might be essential for the formation of a normal gel-forming protective mucus layer. The described cascade of events after CFTR activation clearly shows the important role of CFTR in the protection of the epithelial lining of various glands and organs (Figure 3A). Inactivity or absence of CFTR, caused by various Cftr gene mutations, results in the disease known as: cystic fibrosis.
Figure 1. Protein structure of the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is mainly located in the apical membrane of epithelial cells and consists of two transmembrane spanning domains, two nucleotide binding domains and one regulatory domain.
CYSTIC FIBrOSIS (CF) Cystic Fibrosis (CF) is a potentially fatal, autosomal recessive disease with an incidence of 1:3600 life births in the Caucasian population.1-2 The prevalence of the disease increases due to screening of newborns and increased recognition of patients with a mild(er) CF phenotype.27-28 The prognosis of CF patients greatly improved during the last twenty years. Life expectancy increased from an average of thirty years up to forty years of age (Figure 2). 29 CF can be detected by a positive sweat chloride test, e.g. above 30 mmol/L for infants below six months and above 60 mmol/L for children above six months of age. A second positive chloride test or the identification of two CFTR mutations is confirmative for the diagnosis.30 11
Median predicted survival age, 1985-2007 42

median survival age (years)
40 38 36 34 32 30 28 26 24 1985 1990 1995 2000 2005
CF is caused by absent, reduced or aberrant synthesis of CFTR due to Cftr gene mutations.31 Dysfunctional CFTR results in an impaired secretion of fluid at the epithelial surface and consequently results in the formation of sticky and viscous mucus (which is the reason why CF is also referred to as mucoviscidosis). Viscous mucus obstructs and damages the particular organ and may allow the harbouring of pathogenic bacteria. The cascade of events can induce a chronic state of inflammation in various organs and recurrent (primarily pulmonary) infections.1-2,4
year
Figure 2. Adapted from the Cystic Fibrosis Foundation Registry 2007 Annual Data Report. Bethesda, Maryland. 2009 CF foundation.
One of the classic concepts in CF pathophysiology for the development of viscous mucus is the low volume hypothesis. The low volume hypothesis postulates that sodium hyper-absorption occurs by the loss of inhibition of the sodium channel ENaC, which results in the inability to hydrate the epithelial lining and results in the development of viscous mucus (Figure 3).32-34 This hypothesis has been recently challenged by findings in newborn CF pigs. In the airways of these pigs, no sodium hyper absorption or reduction 12
Figure 3. Simplified scheme of the function of CFTR under physiological and CF conditions. The scheme represents the classic concept of CF pathogenesis in bronchial epithelial cells. Note: (1) In gastrointestinal tissues, sodium transport is not mediated via ENaC, but via Na+/ H+ exchangers (NHEs) or Na+-coupled glucose and aminoacid transporters. (2) In sweat-gland ducts, CFTR serves to absorb chloride, not to secrete it.
in the volume of the periciliary liquid layer (the water-layer at the epithelial surface) was present, but bacterial colonization and inability to clear bacteria was nevertheless observed.35-36 These findings are supported by the fact that not all tissues affected in CF express the epithelial sodium channel ENaC. Sodium absorption in the gastro-intestinal tract (e.g. small intestine, pancreas, liver and gallbladder) is not mediated via ENaC, and despite this, these tissues do exhibit obstruction by viscous mucus. This paradox led Quinton et al. to investigate the importance of bicarbonate in the pathogenesis of viscous mucus. 23-26 They hypothesized that bicarbonate is essential for the expansion of mucins and demonstrated that the absence of bicarbonate, at least under ex-vivo conditions, led to the formation of viscous mucus. Therefore, it is reasonable to speculate that the defect in bicarbonate secretion, aside chloride, is the most important factor contributing to CF-related disease. Unravelling the complex pathogenesis of CFTR dysfunction clearly remains an important challenge in CF research. At present, more than 1800 CFTR mutations have been identified.37 In Europe, the delta F508 mutation is the most common mutation found in CF patients. In the European population, 90% of the CF patients are heterozygous for the delta F508 mutation, while 70% carry the mutation on both alleles.38-39 Most of the mutations can be classified into one of six categories, each classification class with a distinct functional alteration of CFTR (Figure 4).31
Figure 4. Classification of Cftr mutations. Simplified scheme of the different classes of Cftr mutations and their consequences for the functionality of the CFTR protein. Class I mutations are found in ~10% of CF patients and include non-sense and out-frame mutations. In most of these mutations, premature truncation of normal Cftr translation results in the absence of synthesis of CFTR. Class II mutations include the delta F508 mutation (inframe deletion), which is found in ~90% of CF patients. The deletion of phenylalanine (located in the nucleotide binding domain 1) causes an abnormal folding of CFTR, which is recognized by the endoplasmatic reticulum and is subsequently followed by degradation of the protein. Part of the misfolded/immature proteins escape degradation and still reaches the cell surface where residual anion secretion may be present. In class III and IV mutations, the CFTR reaches the cell surface, but the function of the protein is impaired by either abnormal gating of the ion-channel or altered conductance of ion transport respectively. In class V and VI mutations there is a quantitative reduction of CFTR at the cell surface. In class V mutations, reduced CFTR synthesis occurs, while in class VI mutations, there is an increased endocytosis and degradation of CFTR in the lysosomes. 31
13
Although the severity of the disease tends to be highest in mutation class I III and mildest in IV - VI, an apparent genotype-phenotype association in CF patients is not found. Symptoms may even differ in the same family, which indicates that the type of mutation is not solely responsible for the CF phenotype. Modifier genes and environmental factors are suggested to contribute to the disease severity, especially concerning the pulmonary and hepato-biliary phenotype.40-43 Depending on the type of mutation, therapies are currently developed and tested to inhibit premature termination of CFTR synthesis, to correct the misfolded CFTR or to stimulate residual CFTR function in the apical membrane.44 The so called CFTR potentiators may restore gating defects and the correctors may improve CFTR protein folding and plasma membrane trafficking. At present, VX-770, a CFTR potentiator that may be beneficial for patients with the Cftr G551D mutation (class III), is currently tested in a phase 3 study with promising results.45 CLINICaL MaNIFESTaTIONS CF aNd COrrESpONdING TrEaTMENT As described above, the severity and occurrence of clinical symptoms may differ among CF patients. We will outline the most common clinical manifestations in patients with classic or typical CF (diagnosed as described above) and corresponding treatment options. 46
Pancreatic insufficiency Viscous and acidic mucus in the pancreatic ducts due to reduced fluid and bicarbonate secretion, injures and destructs the pancreas. At birth, approximately 70% CF patients suffer from exocrine pancreatic insufficiency. An additional 20% of CF patients will develop pancreatic insufficiency later in childhood.55 Exocrine pancreatic insufficiency is characterized by insufficient production of digestive enzymes, leading to malabsorption of nutrients. The severe reduction in lipase secretion together with a decreased intestinal pH, leads to malabsorption of fat and fat soluble vitamins.1-2 Therefore, failure to thrive and steatorrhoea are one of the first presenting symptoms that may raise suspicion to the diagnosis of CF in areas without a neonatal screening program. The main treatment 14
Respiratory symptoms Respiratory involvement is the first cause of mortality in CF patients.47-48 The accumulation of viscous and thick mucus in the distal airways results in obstruction, inflammation and recurrent pulmonary infections. Chronic and productive cough, dyspnoea, malaise, anorexia and weight loss often occurs, depending on the stage of the disease.1-2 Aggressive pulmonary intervention improved the nutritional status and survival of CF patients.49-53 Inhalation with bronchodilators, mucolytics and hypertonic saline may reduce the severity of symptoms and, inhalation with antibiotics may partly prevent pulmonary infections. As the disease progresses, irreversible pulmonary damage with a gradual decline in pulmonary functions occurs. When pulmonary function is severely declined (FEV1 <30%) despite maximized medical therapy, CF patients could become eligible for lung transplantation.54
Hepatobiliary involvement CFTR is expressed in the gallbladder and intra- and extra-hepatic bile ducts.69 A broad spectrum of hepato-biliary manifestations due to CFTR dysfunction has been identified and may include the occurrence of gallbladder cysts, micro-gallbladder, cholelithiasis and cholestasis.3 Only a subset of patients (~30%) develops CF liver disease (CFLD) characterized by focal biliary cirrhosis, from which the course is subclinical in one-third of these patients.70-73 Autopsy data have indicated that, 70% of CF patients have evidence of focal biliary cirrhosis. Although the definition of CFLD may vary between CF care centers, CFLD has been commonly defined by positive liver histology for cirrhosis or the presence of at least two of the following parameters: hepatomegaly, two abnormal serum liver enzymes or ultrasound abnormalities other than hepatomegaly (e.g. increased echogenicity, nodularity, irregular margins, splenomegaly).70 The cascade of decreased bile flow, bile duct plugging, inflammation and focal biliary cirrhosis may ultimately progress to multilobar cirrhosis with portal hypertension in ~8% of CF patients. 71 In addition, increased bile toxicity and an altered bile salt metabolism are suggested to contribute to the bile duct damage.74-76 At present, end-stage CFLD accounts for approximately the third leading cause of death in CF patients after pulmonary disease and complications of lung transplantation.70 A peak incidence of CFLD occurs around the age of ten. It is unclear why some patients do and some patients do not develop CFLD. Unlike a clear genotype-phenotype relation for pancreatic involvement, a relation between genotype and liver disease is not so apparent. Modifier genes and 15
Gastro-intestinal abnormalities Compared to healthy peers, symptoms of gastroesophageal reflux disease are more described in CF patients and are mostly related to transient relaxation of the lower esophageal sphincter.58-59 Intestinal obstruction syndromes are a common problem in CF patients. Around 10-20% of CF newborns present with meconium ileus at birth, a condition in which the meconium (the first stool of the infant) is thickened and can severely obstruct the intestine, particularly at the level of the distal small intestine. Meconium ileus is often the first sign for CF. 60-61 Reversely, around 50% of infants with meconium ileus are diagnosed with CF.62 In older children, episodes of bowel obstruction (also known as distal ileal obstruction syndrome) and constipation may occur. Intestinal obstruction can be treated with oral laxatives and/or intestinal lavage, or if very severe, with surgical intervention. 60-61 Several secondary changes in the small intestine, like chronic intestinal inflammation, mucus accumulation, prolonged intestinal transit time and small intestinal bacterial overgrowth are also described in the CF intestine and may contribute to malnutrition. 63-68
of pancreatic insufficiency involves supplementation with pancreatic enzymes and fat soluble vitamins and a high caloric diet. Pancreatic sufficient CF patients are more prone to the development of episodes of acute and chronic pancreatitis.56-57 In roughly one-third of adult patients with CF, the endocrine pancreas becomes also affected and results in CF-related diabetes mellitus.47
NuTrITIONaL STaTuS Most children with CF have a suboptimal nutritional status. Since an impaired nutritional status is correlated with morbidity and mortality, optimizing the nutritional status has become an essential part of treatment in CF patients.82-85 The main factors contributing to the suboptimal nutritional status are malabsorption of nutrients, inadequate energy intake and, high energy expenditures (mainly due to recurrent pulmonary infections). Accordingly, cornerstones in the nutritional treatment of CF are Pancreatic Enzyme Replacement Therapy (PERT) for pancreas insufficiency, dietary energy intakes of 120-150% of the Recommended Dietary Allowance (RDA) and the prevention and early treatment of pulmonary infections.85 Most CF infants fail to thrive at birth. After establishing the diagnosis of CF, supplementation with pancreatic enzymes will usually induce catch-up growth, but this growth spurt is often not sufficient for complete normalization. On average, children with CF grow between the 20th and 30th percentile on the growth chart compared to healthy peers, and decline when pulmonary disease progresses.86-88 The implementation of neonatal screening for CF may prevent the first decline in nutritional status directly after birth due to the early start of nutritional intervention. Because fat malabsorption persists in around 25-50% of CF patients despite optimal treatment with PERT,3 increased insight into the pathophysiology of CF related fat malabsorption is necessary to investigate new treatment strategies. Proton pomp inhibiters may improve the process of fat digestion and absorption in some individuals by reducing the duodenal acidic environment.89 16
Other Since CFTR is expressed in various cell types, several other CF-related symptoms are described.1-2 CF patients often suffer from nasal polyps and chronic sinusitis. Especially when children with CF are frequently treated with corticosteroids, osteoporosis and delayed puberty may occur. Male patients with CF are infertile due to obstruction of the vas deferens. Female patients may have problems with fertility when the cervix is severely obstructed with viscous mucus.
environmental factors are thought to play a dominant role in the development of CFLD. The male gender, the presence of meconium ileus at birth, pancreatic insufficiency, age of diagnosis and ethnic background have been identified as risk factors for CFLD, but have not been confirmed in other studies. At present, only the 1-antitrypsin Z-allele as modifier gene has been associated with the presence CLFD, with an odds ratio of 4.2.70,77 Ursodeoxycholic acid (UDCA) is the common medical treatment for CFLD. Although routinely applied in CF patients with increased levels of biochemical liver function tests, the therapeutic action of UDCA in CF conditions remains unclear. It has been hypothesized that UDCA is beneficial by its choleretic activity and/or its capacity to correct aberrant bile salt metabolism.78-80 No beneficial effect on survival has been documented, but it has been shown to improve biochemical abnormalities.81
CYSTIC FIBrOSIS aNIMaL MOdELS The development of several CF animal models has led to an increased understanding regarding the pathophysiology of CF. Until recently, CF mouse models were the only available animal model to study CF-related disease. CF mice proved to be very suitable to study intestinal disease and to evaluate novel therapeutic strategies to correct or potentiate defective CFTR. An important limitation of the CF mice, however, is that they tend to have a relatively mild CF phenotype, apart from the intestine.90-91 Most CF mouse models are pancreas sufficient and do not exhibit CF lung or liver disease. The mild to absent phenotype in the organs of CF mice is in contrast to that in CF humans, and this has stimulated the development of other CF models in other species. Recently, the development of the CF pig and the CF ferret has opened a new era in CF research to investigate CF related pancreatic, liver and lung disease.92-95
CF mice Complete Cftr knockout mice and mice with the homozygous delta F508 mutation have been developed by several research groups.90-91 Intestinal disease is the most prominent feature in CF mice. Most of the developed Cftr knockout mice have severe intestinal obstruction at birth, comparable to meconium ileus in the CF infant. The mortality rate in these mice is as high as 95%, and, dependent on the genetic background, Cftr knockout mice only survive on a liquid diet. The homozygous delta F508 mice still have residual anion secretion and therefore, exhibit a very mild intestinal phenotype. Both CF mouse models have impairments in the absorption of fat and increased fecal loss of bile salts compared to wild type littermates, but only the Cftr knockout mice also have a reduced body weight.96 Because CF mice are pancreas sufficient, the CF mouse models are especially suited to gain insight into the mechanisms of pancreatic independent fat malabsorption. CF pigs Cftr knockout pigs and homozygous delta F508 pigs are born with meconium ileus, exocrine pancreas obstruction and focal biliary cirrhosis.93-95 Due to the severe intestinal obstruction at birth, all piglets require surgical intervention (e.g. temporarily ileostoma) for survival beyond neonatal age. Both CF-pig models have a micro-gallbladder, a condition which is also observed in approximately 30% of CF patients.3 Although the body weight at birth is the same as in wild type littermates, newborn Cftr knockout piglets fail to thrive shortly after birth, similar as seen in CF infants. No pulmonary abnormalities (cellular inflammation, infection or dilated or plugged submucosal glands) are described at birth, but characteristic features of lung disease do develop spontaneously with time. 93-95 CF ferrets Cftr knockout ferrets display many disease characteristics similar to the pathology observed in CF patients, including a predisposition to pulmonary infections during the postnatal period, meconium ileus at birth, pancreatic insufficiency and biochemical 17
signs of liver disease.92 The biochemical parameters for liver disease (increased serum transaminases and bilirubin) normalize in these animals after UDCA treatment. Around 50% of Cftr knockout ferrets with meconium ileus die after birth from intestinal obstruction and subsequent perforation. Additionally, even the pups without meconium ileus fail to thrive and die a couple of days after birth, probably because of severe malabsorption of nutrients. Due to the high mortality rate accompanying the very severe intestinal obstruction at birth, a gut corrected ferret model was developed by incorporating human Cftr cDNA in the intestine. Although not sufficient to completely escape the severe intestinal phenotype, one out of four of these transgenic ferrets passed normal stools and escaped meconium ileus. This gut corrected ferret will be used to expand the (recently developed) CF ferret line.92
Table 1. Organ involvement CF patients, pigs, ferrets and mice. Percentages given are estimates of the fraction of all CF patients/CF animals in which the pathology is manifest. The degree at which organs are affected may vary between animals of the same genotype. *Data on Cftr knockout mice are mainly based on observations in Cftr tm1Cam and Cftrtm1Unc knockout mice. Homozygous F508 mice display a very mild phenotype with none of the above described abnormalities, except the occurrence of diet-dependent intestinal obstruction. - : not (explicitly) reported in literature.
ThE rOLE OF aLTErNaTIVE ChLOrIdE ChaNNELS It has been speculated, that the marked difference in phenotypic characteristics between CF patients, pigs, ferrets and mice (Table 1) may be due to differences in alternative chloride transport.97-99 Various studies investigated the occurrence and relevance of several apically located alternative chloride channels in CF conditions. 97-99 Calcium 18
induced chloride channels have been considered as the most important candidate for alternative chloride transport in epithelial cells.100 Because the molecular identity of calcium induced chloride channels were unknown for quite some time, it was not possible to further explore and characterize their functionality in different organs. Due to the recent identification of TMEM16 as a new family of chloride channels, alternative chloride transport regained interest in the CF field.101-105 Alternative chloride channels may serve as potential rescue channel in CF conditions and could be of interest in therapeutic strategy to prevent or mitigate the CF phenotype.100
SCOpE aNd OuTLINE OF ThE ThESIS We ultimately aim to improve the prognosis of CF by treatment of the several intestinal and hepato-biliary manifestations of CF disease. In this thesis we address various aspects of the gastro-intestinal manifestations of CF disease by evaluating current treatment and investigating potential future treatment options. In Chapter 2, we evaluated the necessity of a high caloric diet in CF patients with a preserved pulmonary function. Especially during the last decades much emphasis has been placed on a high caloric diet in CF patients in order to improve nutritional status. We wondered whether this approach is necessary in all CF patients, especially those who are in a relatively mild state of disease. In retrospect, we cross-sectionally and longitudinally analyzed energy intake in this subgroup of CF patients and its relation to nutritional status and growth. Chapter 3 provides an overview of literature on several aspects, other than pancreatic insufficiency, that might contribute to persistent fat malabsorption in CF patients. We reviewed intervention studies in CF patients and CF mice and their clinical implications. As antibiotic treatment has been shown to improve body weight in CF mice with small intestinal bacterial overgrowth, we tested the hypothesis (Chapter 4), that this might be due to improved fat absorption. We treated homozygous delta F508, Cftr knockout mice and wild type littermates, with broad-spectrum antibiotics and evaluated fat absorption. We analyzed small intestinal bacterial flora and bile salt composition, as these could be influenced by antibiotic treatment and may provide mechanistic information on possible changes in fat absorption. In Chapter 5, we addressed the therapeutic efficacy of ursodeoxycholate (UDCA) in CF conditions. UDCA is presently the only medical treatment option for CF-related liver disease, but the therapeutic action of UDCA in CF conditions is unclear. The postulated effect of UDCA could be mediated via its choleretic activity or its effect on bile salt metabolism. In Cftr knockout mice and wild type littermates, we evaluated these options by determining several parameters of bile salt metabolism and bile flow after UDCA treatment. Finally, we hypothesized that the severe gallbladder phenotype in CF pigs, in contrast to the near absence of a gallbladder phenotype in CF mice, is due to the differential expression and/or activity of alternative calcium activated chloride channels, in particular TMEM16A (Chapter 6). This hypothesis was tested experimentally by measuring trans-epithelial anion currents in gallbladder samples of CF mice, CF pigs and wild type littermates, following stimulation with CFTR-or CaCC-specific agonists, and by monitoring expression levels of TMEM16A by immunocytochemistry and real-time PCR. Identifying putative rescue 19
channels in CF might lead to a therapeutic strategy to prevent or mitigate the CF phenotype in patients. In Chapter 7 a summary of the most relevant findings will be discussed, including suggestions for further research.
1. 2.
rEFErENCES
3.
Rowe SM, Miller S, Sorscher EJ. Cystic Fibrosis. N Eng J Med 2005;352:1992-2001. OSullivian BP, Freedman SD. Cystic Fibrosis. Lancet 2009;373:1891-904.
5.
4. 6. 7.
Gadsby DC, Vergani P, Csanady L. The ABC protein turned chloride channel whose failure causes cystic fibrosis. Nature 2006;440:477-483. McDonals TV, Nghiem PT, Gardner P et al. Human lymphocytes transcribe the cystic fibrosis transmembrane conductance regulator gene and exhibit CF-defective cAMP-regulated chloride current. J Biol Chem 1992;267(5):3242-48. Lamhonwah AM, Bear CE, Huan LJ et al. Cystic fibrosis transmembrane conductance regulator in human muscle: dysfunction causes abnormal metabolic recovery in exercise. Ann Neurol 2010;67(6):802-8. Li H, Ganta S, Fong P. Altered ion transport by thyroid epithelia from CFTR -/- pigs suggests mechanisms for hypothyroidism in cystic fibrosis. Exp Physiol 2010;95(12):1132-44.
Borowitz D, Durie PR, Lane LC et al. Gastrointestinal outcomes and confounders in cystic fibrosis. J Ped Gastroenterol Nutr 2005;41:273-85.
20
9.
8.
10. 12. 13. 14. 16. 15. 17. 11.
Guo Y, Su M, McNutt MA et al. Expression and distribution of cystic fibrosis transmembrane conductance regulator in neurons of the human brain. J Histochem Cytochem 2009;57(12):1113-20. Su M, Guo Y, Zhao Y et al. Expression of cystic fibrosis transmembrane conductance regulator in paracervical ganglia. Biochem Cell Biol 2010;88(4):747-55. Pan P, Guo Y, Gu J et al. Expression of cystic fibrosis transmembrane conductance regulator in ganglion cells of the hearts. Neurosci Lett 2008;441(1):35-8. Michoud MC, Robert R, Hassan M et al. Role of the cystic fibrosis transmembrane conductance channel in human airway smooth muscle. Am J Respir Cell Mol Biol 2009;40(2):217-22. Dif F, Wu YZ, Burgel PR et al. Critical role of cytosolic phospholipase A2 in bronchial mucus hypersecretion in CFTR-deficient mice. Eur Respir J 2010;36(5):1120-30.
Guo Y, Su M, McNutt MA. Expression and distribution of cystic fibrosis transmembrane conductance regulator in neurons of the spinal cord. J Neurosci Res 2009;87(16):3611-9. Mulberg AE, Weyler RT, Altschuler SM et al. Cystic fibrosis transmembrane conductance regulator expression in human hypothalamus. Neuroreport 1998;9(1):141-4. Luciani A. Villella VR, Esposito S et al. Defective CFTR induces aggresome formation and lung inflammation in cystic fibrosis through ROS-mediated autophagy inhibition. Nat Cell Biol 2010;12(9):863-75. Strandvik B. Fatty acid metabolism in cystic fibrosis. 2010;83(3):121-9. Schulz T, Schumacher U, Prante C et al. Cystic fibrosis transmembrane conductance regulator can export hyaluronan. Pathobiology 2010;77(4):200-9. Ollero M, Janaidi O, Zaman MM et al. Decreased expression of peroxisome proliferator activated receptor gamma in Cftr -/- mice. J Cell Physiol 2004;200(2):235-44. Harmon GS, Dumlao DS, Ng DT et al. Pharmacological correction of a defect in PPAR-gamma signaling ameliorates disease severity in Cftr-deficient mice. Nat Med 2010;16(3):313-8.
18. 19. 20.
21. 22. 23. 25. 24.
Goldman MJ, Anderson GM, Stolzenberg ED et al. Human beta-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell 1997;88(4):553-60. Matsui H, Randell SH, Peretti SW et al. Coordinated clearance of peiciliary liquid and mucus from airway surfaces. J Clin Invest 1998;102(6):1125-31. Houtmeyers E, Gosselink R, Gayan-Ramirez G et al. Regulation of mucociliary clearance in health and disease. Eur Resp J 1999;13(5):1177-88. Garcia MA, Yang N and Quinton PM. Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. J Clin Invest 2009;119(9):2613-22.
26.
Quinton PM. Role of epithelial HCO3- transport in mucin secretion: lessons from cystic fibrosis. Am J Physiol Cell Physiol 2010;299(6):C1222-33. Quinton PM. Birth of mucus. Am J Physiol Lung Cell Mol Physiol 2010;298(1):L13-4. Rock MJ. Newborn screening for cystic fibrosis. Clin Chest Med 2007;28:297-305.
27.
Quinton PM. Cystic fibrosis: impaired bicarbonate secretion and mucoviscidosis. Lancet 2008;372:415-17.
21
30. 31. 33. 32. 34. 35.
29.
28.
Cystic Fibrosis Foundation. Patient Registry Annual Report 2007. Bethesda, MD: Cystic Fibrosis Foundation; 2007. Matsui H, Grubb BR, Tarran R et al. Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airway disease. Cell 1998;95:1005-15. Boucher RC. Airway surface dehydration in cystic fibrosis: pathogenesis and therapy. .Annu Rev Med 2007;58:157-70. Farrell PM, Rosenstein BJ, White TB et al. Guidelines for diagnosis of cystic fibrosis in newborns through older adults: Cystic Fibrosis Foundation Consensus report. J Pediatr 2008;153:S414. Rowntree RK, Harris A. The phenotypic consequences of CFTR mutations. Ann Hum Genet 2003;67:471-485.
Strausbaugh SD, Davis PB. Cystic fibrosis: a review of epidemiology and pathobiology. Clin Chest Med 2007;28:279-88.
Matsui H, Wagner VE, Hill DB et al. A physical linkage between cystic fibrosis airway surface dehydration and Pseudomonas aeruginosa biofims. Proc Natl Acad Sci USA 2006;103:1813136. Chen JH, Stoltz DA, Karp PH et al. Loss of anion transport without increased sodium absorption characterizes newborn porcine cystic fibrosis airway epithelia. Cell 2010;143(6):911-23. Cystic fibrosis: an ion transport issue? Nat Med 2011;17(2):166-67. Estivill X, Bancells C, Ramos C. Geographic distribution and regional origin of 272 cystic fibrosis mutations in European populations. Human Mutat 1997;10:135-54.
36. 37. 38. 39. 40.
Cystic fibrosis genetic analysis consortium. Cystic fibrosis mutation database. Available at: http://www.genet.sickkids.on.ca /cftr/StatisticsPage.html. Bartlett JR, Friedman KJ, Ling SC et al. Genetic modifiers of liver disease in cystic fibrosis. JAMA 2009;302(10):1076-83. Merlo CA, Boyle MP. Modifier genes in cystic fibrosis lung disease. J Lab Clin Med 2003;141(4):237-41. Sloane PA, Rowe SM. Cystic fibrosis transmembrane conductance regulator protein repair as a therapeutic strategy in cystic fibrosis. Curr Opin Pulm Med 2010;16:591-97. Cutting GR. Modifier genes in Mendelian disorders: the example of cystic fibrosis. Ann N Y Acad Sci 2010;1214:57-69.
41. 42. 43. 44. 46. 47. 45.
Farrell PM. The prevalence of cystic fibrosis in the European Union. J Cyst Fibros. 2008:7:45053.
Collaco JM, Cutting GR. Update on gene modifiers in cystic fibrosis. Curr Opin Pulm Med 2008;14(6):559-66. Accurso FJ, Rowe SM, Clancy JP et al. Effect of VX-770 in persons with cystic fibrosis and the G551D-CFTR mutation. N Engl J Med 2010;363(21):1991-2003. De Boeck K, Wilschanski M, Catellani C et al. Cystic fibrosis: terminology and diagnostic algorithms. Thorax 2006;61:627-35. Anon. 2006 Annual data report to the center directors. Bethesda, MD: Cystic fibrosis foundation patient registry, 2007.
22
49.
48. 50.
Dodge JA, Lewis PA, Stanton M et al. Cystic fibrosis mortality and survival in the UK: 19472003. Eur Respir J 2007; 29:522-26.
51. 52. 53. 54. 55. 56. 57. 58. 59. 60.
Cohen-Cymberknoh M, Shosesov D, Kerem E. Managing cystic fibrosis: strategies that increase life expectancy and improve quality of life. Am J Respir Crit Care Med 2011; in press. Padman R, McColley SA, Miller DP et al. Infant care patterns at epidemiologic study of cystic fibrosis sites that achieve superior childhood lung function. Pediatrics 2007;119:E531-37. Johnson C, Butler SM, Konstan MW et al. Factors influencing outcomes in cystic fibrosis: a center-based analysis. Chest 2003;123:20-27. Szaff M, Hoiby N, Flensborg EW. Frequent antibiotic therapy improves survival of cystic fibrosis patients with chronic Pseudomonas Aeruginosa infection. Acta Paediatr Scand 1983;72:651-57.
Regelmann WE, Elliot GR, Warwick WJ et al. Reduction of sputum Pseudomonas Aeruginosa density by antibiotics improves lung function in cystic fibrosis more than do bronchodilators and chest physiotherapy alone. Am Rev Respir Dis 1990;141:914-21. Augarten, A, Ben Tov, A, Madgar, I, et al. The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype. Eur J Gastroenterol Hepatol 2008; 20:164. De Boeck, K, Weren, M, Proesmans, M, et al. Pancreatitis among patients with cystic fibrosis: correlation with pancreatic status and genotype. Pediatrics 2005; 115:e463.
Aurora P, Spencer H, Moreno-Galdo. Lung transplantation in children with cystic fibrosis: a view from Europe. Am J Respir Crit Care Med 2008;177:935-36. Couper RT, Corey M, Moore DJ et al. Decline of exocrine pancreatic function in cystic fibrosis patients with pancreatic sufficiency. Pediatr Res 1992;32:179-82.
Malfroot A, Dab I. New insights on gastro-oesophageal reflux in cystic fibrosis by longitudinal follow up. Arch Dis Child. 1991;66(11):1339-45.
van der Doef HP, Arets HG, Froeling SP et al. Gastric acid inhibition for fat malabsorption or gastroesophageal reflux disease in cystic fibrosis: longitudinal effect on bacterial colonization and pulmonary function. J Pediatr. 2009;155(5):629-33. Raia V, Fuiano L, Staiano A. Defining DIOS and constipation in cystic fibrosis with a multicentre study on the incidence, characteristics and treatment of DIOS. J Pediatr Gastroenterol Nutr. 2010;50(1):38-42.
62. 63.
61.
Houwen RH, van der Doef HP, Sermet I et al. Intestinal obstruction syndromes in cystic fibrosis: meconium ileus, distal intestinal obstruction syndrome and constipation. Curr Gastroenterol Rep 2011, in press.
64.
Gorter RR, Karimi A, Sleeboom C. Clinical and genetic characteristics of meconium ileus in newborns with and without cystic fibrosis. J Ped Gastroenterol Nutr 2010;50(5):569-72.
Lewindon PJ, Robb TA, Moore DJ et al. Bowel dysfunction in cystic fibrosis: importance of breath testing. Journal of Paediatrics and Child Health 1998;34(1):79-82.
Lisowska A, Wjtowicz J, Walkowiak J. Small intestine bacterial overgrowth is frequent in cystic fibrosis: combined hydrogen and methane measurements are required for its detection. Acta Biochimica Polonica 2009;56(4):631-34.
23
66. 68. 67.
65.
69. 70. 72. 71. 73. 74. 76. 78. 79. 80. 81. 82.
Smyth RL, Croft NM, OHea U et al. Intestinal inflammation in cystic fibrosis. Arch of Dis in Child 2000;82(5):394-99. Colombo C, Battezzati PM, Crosignani A, et al. Liver disease in cystic fibrosis: A prospective study on incidence, risk factors, and outcome. Hepatology 2002;36:1374-1382. Colombo C, Battezzati PM. Liver involvement in cystic fibrosis: primary organ damage or innocent bystander? J Hepatol 2004;41:1041-44.
Cohn JA, Strong TV, Picciotto MR, et al. Localization of the cystic fibrosis transmembrane conductance regulator in human bile duct epithelial cells. Gastroenterology 1993;105:18571864. Herrmann U, Dockter G, Lammert F. Cystic fibrosis-associated liver disease. Best Pract Res Clin Gastroenterol 2010;24:585-92. Lindblad A, Hultcrantz R, Strandvik B. Bile-duct destruction and collagen deposition: a prominent ultrastructural feature of the liver in cystic fibrosis. Hepatology 1992;16:372-81. Freudenberg F, Broderick AL, Yu BB et al. Pathophysiological basis of liver disease in cystic fibrosis employing a deltaF508 mouse model. J Physiol Gastrointest Liver Physiol 2008;294:G1411-20. Smith JL, Lewindon PJ, Hoskins AC et al. Endogenous ursodeoxycholic acid and cholic acid in liver disease due to cystic fibrosis. Hepatology 2004;39:1673-82. Nash KL, Allison ME, McKeon D, et al. A single centre experience of liver disease in adults with cystic fibrosis 1995-2006. J.Cyst.Fibros. 2008;7:252-257.
Sbarbati A, Bertini M, Catassi C et al. Ultrastructural lesions in the small bowel of patients with cystic fibrosis. Pediatric Research 1998;43(2):234-39.
Bruzzese ER, Raia V, Gaudiello G et al. Intestinal inflammation is a frequent feature of cystic fibrosis and is reduced by probiotic administration. Alimentary Pharmacology and Therapeutics 2004;20(7):813-19.
Raia V, Maiuri L, de Ritis G et al. Evidence of chronic inflammation in morphologically normal small intestine of cystic fibrosis patients. Pediatric Research 2000;47(3):344-50.
75. 77.
Wilschanski M, Rivlin J, Cohen S et al. Clinical and genetic risk factors for cystic fibrosisrelated liver disease. Pediatrics 1999;103:52-7. Fiorotto R, Spirli C, Fabris L, et al. Ursodeoxycholic acid stimulates cholangiocyte fluid secretion in mice via CFTR-dependent ATP secretion. Gastroenterology 2007;133:1603-1613. Shimokura GH, McGill JM, Schlenker T, et al. Ursodeoxycholate increases cytosolic calcium concentration and activates Cl- currents in a biliary cell line. Gastroenterology 1995;109:965972. Gurantz D,.Hofmann AF. Influence of bile acid structure on bile flow and biliary lipid secretion in the hamster. Am.J.Physiol 1984;247:G736-G748. Sinaasappel M, Stern M, Littlewood J et al. Nutrition in patients with cystic fibrosis: a European Consensus. J Cyst Fibros 2002;1(2):51-75.
Cheng K, Ashby D, Smyth R. Ursodeoxycholic acid for cystic fibrosis-related liver disease. Cochrane Database Syst Rev 2000;(2):CD000222.
24
84. 85. 86. 88. 90. 91. 93. 92. 94. 89. 87.
83.
Beker LT, Russek-Cohen E, Fink RJ. Stature as a prognostic factor in cystic fibrosis survival. J Am Diet Assoc 2001;101(4):438-442. Corey M, McLaughlin FJ, Williams M, et al. A comparison of survival, growth, and pulmonary function in patients with cystic fibrosis in Boston and Toronto. J Clin Epidemiol 1988; 41(6):583-591 Sinaasappel M, Stern M, Littlewood J, et al. Nutrition in patients with cystic fibrosis: a European Consensus. J Cyst Fibros 2002;1(2):51-75. Haeusler G, Frisch H, Waldhor T et al. Perspectives of longitudinal growth in cystic fibrosis from birth to adult age. Eur J Pediatr 1994;153(3):158-163.
Jones A. Drug therapies for reducing gastric acidity in people with cystic fibrosis. The Cochrane collaboration 2003;2:1-16. Guibalt C, Saeed Z, Downey GP, Radzioch D. Cystic fibrosis mouse models. Am J Respir Cell Mol Biol 2007;36:1-7. Meyerholz DK, Stoltz DA, Pezzulo AA, Welsh MJ. Pathology of gastro-intestinal organs in a porcine model of cystic fibrosis. Am J Path 2010;176(3):1-13. Scholte BJ, Davidson DJ, Wilke M, De Jonge HR. Animal models of cystic fibrosis. J Cyst Fibr 2004;3:183-190. Sun X, Sui H, Fisher JT et al. Disease phenotype of a ferret CFTR-knockout model of cystic fibrosis. J Clin Invest 2010;120(9):3149-60. Rogers CS, Stoltz DA, Meyerholz DK et al. Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs. Science 2008;321:1837-40.
Patel L, Dixon M, David TJ. Growth and growth charts in cystic fibrosis. J R Soc Med 2003;96 Suppl 43:35-41. Stettler N, Kawchak DA, Boyle LL et al. Prospective evaluation of growth, nutritional status, and body composition in children with cystic fibrosis. Am J Clin Nutr 2000;72(2):407-413.
97. 98.
96.
95.
Bijvelds MJ, Bronsveld I, Havinga R, et al. Fat absorption in cystic fibrosis mice is impeded by defective lipolysis and post-lipolytic events. Am J Physiol Gastrointest Liver Physiol 2005;288:G646-G653. Zdebik AA, Cuffe JE, Bertog M et al. Additional disruption of the ClC-2 Cl- channel does not exacerbate the cystic fibrosis phenotype of cystic fibrosis transmembrane conductance regulator mouse models. J Biol Chem 2004;279(21):22276-83. Jentsch TJ. CLC chloride channels and transporters: from genes to protein structure, pathology and physiology. Crit Rev Biochem Mol Biol 2008;43(1):3-36. Bijvelds MJ, Bot AG, Escher JC et al. Activation of intestinal Cl- secretion by lubiprostone requires the cystic fibrosis transmembrane conductance regulator. Gastroenterol 2009;137(3):97685.
Ostedgaard LS, Meyerholz DK, Chen JH et al. The F508 mutation causes CFTR misprocessing and cystic fibrosis-like disease in pigs. Sci Transl Med 2011; in press.
99.
100. Verkman AS, Galietta LJV. Chloride channels as drug targets. Nat Rev 2009;8:153-68.
101. Yang YD, Cho H, Koo JY et al. TMEM16A confers receptor-activated calcium-dependent chloride conductance. Nature 2008;435:1210-1216.
25
102. Schroeder BC, Cheng T, Jan YN et al. Expression cloning of TMEM16A as a calcium-activated chloride subunit. Cell 2008;134:1019-1029.
105. Caputo A, Caci E, Ferrera L, et al. TMEM16A, a membrane protein associated with calcium dependent chloride channel activity. Science 2008;322:590-593.
103. Huang F, Rock JR, Harfe BD, et al. Studies on expression and function of the TMEM16A calciumactivated chloride channel. Proc Natl Acad Sci U.S.A. 2009;106:21413-18.
104. Galietta LJV. The TMEM16A protein family: a new class of chloride channels. Biophys J 2009;97:3047-3053.
26
ChapTEr 2
ENERGY INTAKE AND GROWTH IN CYSTIC FIBROSIS PATIENTS WITH PRESERVED PULMONARY FUNCTION
M. Wouthuyzen-Bakker1 C.K. van der Ent2 J.W. Woestenenk3 M. Zwolsman1 H.J. Verkade1 F.A.J.A. Bodewes1
Pediatric Gastroenterology, Department of Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands. 2 Department of Pediatrics, University Medical Center Utrecht, Utrecht, the Netherlands 3 Julius Centre for Health Sciences and Primary Care, Department of Dietetics and Nutritional Science, University Medical Center Utrecht, Utrecht, the Netherlands
1
Submitted
ChapTEr 2 INTaKE aNd GrOWTh
aBSTraCT Improving the nutritional status remains an important challenge in pediatric cystic fibrosis (CF) patients. The effect of a high energy intake on the nutritional status in relatively healthy pediatric CF patients is not well described. We investigated the relation between energy intake, nutritional status and growth in school-age CF patients with preserved pulmonary function. In a cohort of Dutch CF patients, we analyzed data of 81 children with FEV1-values >80%. Patients below 6 and above 9 years were excluded to avoid inaccurate spirometric outcomes and growth interference during puberty respectively. We cross-sectionally assessed the relation between energy intake, nutritional status and growth (multiple-regression) and longitudinally evaluated the effect of changes in energy intake on weight (paired t-test). The nutritional status was slightly below average compared to the healthy reference population (z-score weight:-0.61.8, BMI:-0.10.7). Upon cross-sectional analysis, we found no positive relation between energy intake and nutritional status or growth. Upon longitudinal analysis, 19 patients increased their energy intake (10.29.8 kcal/kg/bw) in the year after the initial assessment, but the z-score for weight improved (0.180.16) in only 20% of the 19 patients. The positive effect of energy intake on weight was irrespective from the initial z-score for weight or the initial energy intake. Conclusion. The relation between energy intake, nutritional status and growth is weak in school-age CF patients with preserved pulmonary function. The results emphasize the need for individualized nutritional treatment, but simultaneously underline the difficulty to design nutritional trials with sufficient statistical power in this subgroup of CF patients.
28
INTrOduCTION Cystic Fibrosis (CF) is an autosomal recessive disease and is caused by a mutation on the Cftr gene located on chromosome 7, which encodes for a chloride and bicarbonate channel in, particularly, epithelial cells. A defective CFTR protein results in the formation of viscous and sticky mucus with bacterial colonization, inflammation and eventually damage to different glands and gland rich organs. Intestinal malabsorption of nutrients (mainly due to pancreatic insufficiency), inadequate energy intake and increased energy expenditure due to recurrent pulmonary infections all contribute to a suboptimal nutritional status in CF patients. 28 Since nutritional status is related to morbidity and mortality in CF, improving the nutritional status remains one of the important challenges in CF care.
However, many children with CF have difficulties to meet the dietary recommendations. 24,25 This phenomenon often creates a burden for CF children, parents and health care providers in their attempt to comply to the general recommendation. Nowadays, several studies report on adverse social and psychological consequences for CF patients and their families aiming to achieve high energy intakes, like family stress and feeding difficulties.7, 16, 23, 39 Since there are no conclusive studies which exclusively substantiated the potential beneficial effects of a high dietary energy intake in CF patients with preserved pulmonary function, we aimed to investigate the relation between dietary energy intake and nutritional status and growth in this subgroup of patients.
The well known epidemiological study in Boston and Toronto of Corey et. al. in the late 80s, introduced a major shift in the nutritional treatment of CF. The formerly restricted fat diet adviced for CF patients, was changed into a high fat diet. Another major change comprised more aggressive pulmonary treatment and prevention of weight loss during infections. This renewed approach resulted in an improved nutritional status and overall survival of CF patients.2, 6, 8, 26 Consequently, the current general CF dietetic recommendations comprises high dietary energy intakes ranging from 110-200% of the Recommended Daily Allowance (RDA) in patients with pancreatic insufficiency, in which energy derived from fat should be approximately 40%.28,29
paTIENTS aNd METhOdS We retrospectively evaluated data of pediatric CF patients who were under medical control on the 1st of January 2008 in the University Medical Centers in Utrecht and Groningen in the Netherlands. Both centers are specialized regional CF care centers. Patients visited the CF Center, at least annually, for a complete check up, consisting of a 72 hours fecal fat balance test, lung function test and a sputum culture test (if obtained). Children with FEV1 values above 80% were included in the study. Patients below 6 and above 9 were excluded to avoid inaccurate spirometry outcomes.10, 20, 37 and to 29
avoid pubertal growth effects respectively. For our cross-sectional analysis (n=81), the first recorded measurement for each child was used. In order to evaluate the effect of energy intake on weight (longitudinally), children from which complete datasets of at least two time points were available were included in the study (n=44) (Figure 1). The excluded children (n=37) had similar patient characteristics (parameters nutritional status, mutation class, co-morbidity etc) as the included children (data not shown). This study was deemed exempt by the University Medical Center Groningen and Utrecht Institutional Review Board.
dataset 1999-2008 n = 268 657 measurements
FEV1 > 80% 440 measurements n = 183
FEV1 < 80% 217 measurements n = 108
6-9 years 150 measurements n = 81
6-9 years 43 measurements n = 31
2 measurements per child: n = 44
Figure 1. Flow chart. Flow chart for the retrospective analysis in pediatric CF patients between the age of 6-9 years with preserved pulmonary function (FEV1>80%). For the cross-sectional analysis, the first measurement of each child was used (n=81). For the longitudinal analysis, data available with at least two time points per child was used. The first two measurements per time point were selected (n=44). FEV1: Forced Expiratory Volume in 1 second.
Assessment of nutritional status Weight (kg), length (cm) and BMI measurements of every child were collected. Annual growth velocity for length and weight were calculated using the charts of Tanner and Whitehouse. 35 Growth velocity was defined as the increment in the childs length (cm/ yr) and weight (kg/yr) divided by the time interval between the two measurements (with a minimum of 9 months and a maximum of 18 months). All growth parameters were converted into age-corrected z-scores based on Dutch national growth studies using Growth analyzer 3 software of the Dutch Growth Foundation. 9 Assessment of energy intake A three-day dietary diary was used to determine dietary intake of total energy. The dietary diaries contained three day prospective recorded household measurements with detailed information on macronutrient intake. We assumed that the dietary diary reflected the average daily dietary energy intake in the preceding year. All dietary diaries were manually processed by experienced specialized CF dieticians. The dietary 30
energy intake of each child was expressed as a percentage of the RDA for gender and age14 and as kilocalories per kilogram body weight (kcal/kg/bw). Because energy intake expressed as a percentage of the RDA was age dependent (Figure 2A) and energy intake expressed as kilocalories per kilogram body weight was age independent (Figure 2B), we used the amount of kilocalories per kilogram body weight in our analysis as parameter for energy intake.
Figure 2. Sub-analysis energy intake at different ages. A) Energy intake expressed as RDA (Recommended Daily Allowance). B) Energy intake expressed as kilocalories per kilogram body weight (kcal/kg/bw). Values are depicted as mean SEM. ** = p<0.01 (compared to age 6, 7 and 8).
Relation between energy intake, nutritional status and growth Cross-sectional analysis. Based on the first available measurement of each child in the age group 6-9 years, we cross-sectionally evaluated energy intake in relation to the z-scores of weight, length, BMI, weight gain and length growth. Apart from energy intake, several other factors, like fat absorption, Cftr mutation, age and gender are expected to influence nutritional status and growth. Therefore, we evaluated these parameters as additional patient factors for analysis. The coefficient of fat absorption was calculated as: (fat intake loss of fecal fat) / fat intake * 100%. Cftr gene mutations were divided in five classes based on their demonstrated or presumed molecular consequences [19]. Longitudinal analysis. We evaluated the effect of an increased or decreased energy on the z-score for weight. For this purpose we calculated the difference between the energy intake and the z-score for weight between two time points; the first measurement per child was called time point 0 (T0) and the second measurement was called time point 1 (T1). The mean time interval between the two time points was 1.2 0.4 years. In order to specifically conclude about the effect of energy intake in patients with a suboptimal nutritional status, we made the comparison between patients with initial (i.e. at T0) z-scores for weight below or above 0. In addition, we evaluated whether the effect of an increased or decreased energy intake on weight was dependent upon the initial amount of energy intake. 31
Statistical analysis Statistical analysis was performed using SPSS 16.0 (SPSS Inc., Chicago, IL). Cross-sectional analysis. The relation between energy intake and nutritional status and growth was cross-sectionally assessed by linear regression analysis. A stepwise multiple regression analysis was performed to correct for confounding effects on nutritional status and growth. The analysis included z-scores for weight, length, BMI, weight gain and length growth as dependent variables and were tested for normal distribution. Total energy intake, fat absorption (%), mutation class, age and gender were used as independent variables. We repeated the analysis and replaced the variable total energy intake for the variable energy intake of fat. The different Cftr mutation classes were included in the multiple regression analysis by transforming them into dummies and by using the enter method. Longitudinal analysis. We longitudinally evaluated the effect of an increased or decreased energy intake (compared to the previous year) on the z-score for weight by using the paired student t-test. All data are reported as means the standard deviation (SD). P-values < 0.05 were considered as statistically significant. rESuLTS Characteristics study group Table 1 shows the patient characteristics for the cross-sectional as the longitudinal analysis for several parameters. Parameters were similar between the cross-sectional and the longitudinal data. All patients within our cohort were pancreas insufficient and were treated with pancreatic enzymes. The overall nutritional status was slightly below average compared to the healthy reference population according to length, weight and BMI. Growth velocity scores were above average for length as well as weight. The mean total energy intake and the percentual energy intake derived from fat in our cohort of pediatric CF patients was comparable to the general CF nutritional recommendations of 120-150% [28]. Except for meconium ileus, with a higher incidence in males, gender was equally distributed among the other parameters.
Relation between energy intake and nutritional status (cross-sectional analysis) Although the mean z-scores for nutritional status in our cohort of patients was slightly below average compared to the healthy reference population (Table 1), the z-score for weight was below zero in 78% of patients (Figure 3). We found no relation between total energy intake or fat intake and z-scores for weight, length, BMI, weight gain and length growth (Figure 3). A weak negative association was found between total energy intake and the z-score for weight (R=0.27, p=0.02). The multiple regression analysis, that included several potential confounding factors on nutritional status or growth (fat absorption, mutation class, age and gender), showed no dependency on these results. The z-score for BMI was positive associated with age (R = 0.22, p=0.03). 32
Table 1. Patient characteristics. Baseline characteristics of cross-sectional and longitudinal data of pediatric cystic fibrosis patients with preserved pulmonary function (defined as FEV1 values > 80%). Z-scores for weight and length are depicted as z-scores for age. Cross-sectional and longitudinal values for all parameters were not statistically different from each other. Ursodeoxy-cholate was prescribed because of suspicion of CF related liver disease, based on persistent increased serum trans-aminases, hepato-megaly and/or hepatic ultrasound abnormalities (40-41). CFTR gene mutations were divided in five classes based on their demonstrated or presumed molecular consequences (19). FEV1: Forced Expiratory Volume in 1 second. RDA: Recommended Daily Allowance. Kcal/kg/bw: kilocalories per kilogram body weight. Parameters are reported as a percentage or as mean SD.
33
Figure 3. Relation between energy intake and nutritional status (cross-sectional analysis). Upper panel: relation between total energy intake and z-scores for weight (A), BMI (B), and weight gain (C). Lower panel: relation between fat intake and z-scores for weight (D), BMI (E), and weight gain (F). kcal/kg/bw: kilocalories per kilogram body weight. R: correlation coefficient.
The effect of an increased or decreased energy intake on z-score weight (longitudinal analysis) In correspondence with the cross-sectional results, we found no relation between energy intake and the z-score for weight in the longitudinal analysis (Figure 4). Out of the 44 patients, 17 increased their energy intake in the year after the initial assessment (mean increase 10.29.8 kcal/kg/bw), but only 4 of these patients showed a corresponding improvement in the z-score for weight (right upper quadrant in Figure 4A), while the majority of patients showed a stabilization or decrease in the z-score for weight (right lower quadrant in Figure 4A). A decrease in energy intake in the year after the initial assessment (mean decrease 13.39.5 kcal/kg/bw) in 27 of patients, resulted in a corresponding decrease in the z-score for weight in roughly 50% of these patients, while the other 50% of patients showed an improvement (left lower and upper quadrant in Figure 4A, respectively).
34
Figure 4. Relation between delta energy intake and delta z-score for weight (longitudinal analysis). A) Relation between the difference () in annual energy intake and the corresponding annual difference in z-score for weight. B) Percent distribution of patients with increased or decreased energy intake after a year of the initial assessment and the corresponding effect on the z-score for weight. kc/kg/bw: kilocalories per kilogram body weight. R: correlation coefficient. : increased, : decreased, : not changed.
To examine these results in more detail, we additionally investigated whether the effect of an increased or decreased energy intake on weight after a year of the initial assessment, depended on the initial z-score for weight or on the initial amount of energy intake. We subdivided patients with initial z-scores for weight above or below 0. The subdivision did not affect the longitudinal relation between energy intake and z-score for weight (Figure 5). We found a decrease in z-score for weight in patients with initial high z-scores for weight during increased energy intake (n=5; Figure 5B). When subdividing patients with initial energy intakes above and below 90 kilocalories per kilogram body weight, we neither found a difference between an increased or a decreased energy intake concerning the effect on the z-score for weight (data not shown).
35
Figure 5. The effect of an increased or decreased energy intake on z-score weight. In order to conclude about the effect of an increased (A-B) or decreased (C-D) energy intake in relation to the initial nutritional status of CF patients, patients were categorized according to their initial z-score of weight (below or above 0) at time point 0 (T0). Figures A and C depicts the actual increase or decrease in energy intake in kilocalories per kilogram body weight (kcal/kg/bw) in the following year (T1) . Figures B and D depicts the effect of the increased or decreased energy intake on z-score weight in the following year (T1). Values are depicted as mean SD. * : p-value < 0.05 (comparing T0 with T1).
Until now, most studies evaluated the relation between energy intake and either nutritional status or growth in pediatric CF patients who already are in a more advanced stage of disease 1, 4, 13, 15, 18-19, 22, 27, 30-33, 36, 38 (e.g. patients with impaired pulmonary function and/or patients who are more severely malnourished). From retrospective studies we learned that, in this group of CF patients, a weak correlation (R <0.55) existed between energy intake and nutritional status.1, 4, 13, 18 A more pronounced effect of dietary energy intake on nutritional status and growth is often reported in nutritional intervention studies.12, 27, 36, 38 It is also shown that only a small beneficial effect on nutritional status occurs in CF patients who were in a better nutritional condition.33 This observation is in agreement with the data from Shepherd et al. indicating that a significant correlation existed between initial underweight and subsequent weight gain after nutritional intervention in CF patients during pulmonary exacerbation.27 In addition, most nutritional intervention studies are performed in patient groups with initial low dietary energy intakes ( 120% of the RDA19, 22, 30-31, 38). Constantini et al. showed that when dietary energy intake is equal to or higher than 95% of the RDA wasting does not occur [5]. Based these observations, in our present study, we subdivided our patients according to their initial z-score for weight and initial energy intake. However, this subdivision did not affect the observed lack of correlation between energy intake and either nutritional status or growth. We do realize that our present data should be interpreted in light of some limitations. First, a three day dietary diary can not be expected to completely represent the actual average daily dietary energy intake over the previous year, but, at best, constitutes a rough estimate. The obtained results may be biased by over- or underestimation in the report of the three-day registration period (for example during weekend registrations). Also, detailed information on some of the nutrients in the diaries may be absent. This limitation can lead to inaccuracies in the calculation of the absolute quantity of caloric intake. Although we realize that our study can be affected by these factors, it should be underlined that the reported dietary energy intakes were comparable to those obtained in other studies.11-12, 21, 34 Previous retrospective studies, in more severely affected CF patients, also used three-day dietary diaries as measurement for energy intake.1, 4, 13, 18 A second limitation of our study is the absence of data on energy expenditure or other parameters for nutritional status (for example fat free mass). As growth is influenced by a complex interaction between energy demand and energy expenditure, the absence of these data may bias our results. However, we did evaluate a relatively homogenous 36
dISCuSSION Our study is the first which exclusively investigated the relation between energy intake and nutritional status and growth in school-age pediatric CF patients with a preserved pulmonary function. We found that approximately 80% of CF children have a z-score for weight below zero, despite preservation of pulmonary function. However, retrospective evaluation, in a cross-sectional and longitudinal setting, showed no relation between energy intake and nutritional status or growth.
subgroup of patients; all of our patients were pre-pubertal, had preserved pulmonary function and suffered from pancreatic insufficiency. Each of these factors might have a major influence on resting energy expenditure and growth40, but it seems reasonable to expect that these parameters were comparable between patients. In addition, we analyzed for possible influence of several other parameters on the observed correlations in our multiple regression analysis (e.g. gender, age, mutation class). Yet, neither of these parameters seemed to affect our results. Since the CF nutritional recommendations still comprises high energy intakes for all pediatric CF patients, our data support the concept that sub-analysis of different groups of CF patients is necessary to categorize or even individualize the dietary advices. We believe it is important to investigate the relatively healthy CF patients with preserved pulmonary function, to conclude whether the actual beneficial effects on nutritional status or growth outweigh the possible adverse physiological consequences in our strive to achieve high dietary energy intakes. Our retrospective analysis in school-age CF patients with preserved pulmonary function indicates no straight-forward relation between energy intake and nutritional status or growth. We do believe that our data supports the need for prospective nutritional studies in this subgroup of CF patients, but our results simultaneously underline the difficulty to design such nutritional trials with sufficient statistical power. rEFErENCES
2.
1.
3. 4.
Anthony H, Bines J, Phelan P, Paxton S (1998) Relation between dietary intake and nutritional status in cystic fibrosis. Arch Dis Child 78: 443-447 Beker LT, Russek-Cohen E, Fink RJ (2001) Stature as a prognostic factor in cystic fibrosis survival. J Am Diet Assoc 101(4):438-442 Cheng K, Ashby D, Smyth R (2000). Ursodeoxycholic acid for cystic fibrosis-related liver disease. Cochrane Database Syst Rev (2):CD000222 Collins CE, OLoughlin EV, Henry RL (1997) Fat gram target to achieve high energy intake in cystic fibrosis. J Paediatr Child Health 31:142-147
5. 6. 7.
Constantini D, Padoan R, Curcio L, Giunta A (1988) The management of enzymatic therapy in cystic fibrosis patients by an individualized approach. J Pediatr Gastro Enterol Nutr 7 (suppl):S36-S39 Duff AJ, Wolfe SP, Dickson C, Conway SP, Brownlee KG (2003) Feeding behavior problems in children with cystic fibrosis in the UK: prevalence and comparison with healthy controls. J Pediatr Gastroenterol Nutr 36(4):443-7 Durie PR, Pencharz PB (1992) Cystic fibrosis: nutrition. Br Med Bull 48(4):823-846 Corey M, McLaughlin FJ, Williams M, Levison H (1988) A comparison of survival, growth, and pulmonary function in patients with cystic fibrosis in Boston and Toronto. J Clin Epidemiol 41(6):583-591
8.
37
9.
10. 11.
13.
12. 14. 15.
Haeusler G, Frisch H, Waldhor T, Gtz M (1994) Perspectives of longitudinal growth in cystic fibrosis from birth to adult age. Eur J Pediatr 153(3):158-163
Hanning RM, Blimkie CJR, Bar-Or O, Lands RC, Mos LA, Wilson WM (1993) Relationships among nutritional status and skeletal and respiratory muscle function in cystic fibrosis: does early dietary supplementation make a difference? Am J Clin Nutr 57:580-587 Jelalian E, Stark LJ, Reynolds L, Seifer R (1998) Nutrition intervention for weight gain in cystic fibrosis: a meta analysis. J Pediatr 132(3 Pt 1):486-492.
Groeneweg M, Tan S, Boot AM, de Jongste JC, Bouquet J, Sinaasappel M (2002) Assessment of nutritional status in children with cystic fibrosis: conventional anthropometry and bioelectrical impedance analysis. A cross-sectional study in Dutch patients. J Cyst Fibros 1(4):276-280
Gangell CL, Hall GL, Stick SM, Sly PD (2010) Lung function testing in preschool-aged children with cystic fibrosis in the clinical setting. Pediatr Pulmonol 45:419-433
Dutch Growth Foundation, growth and development in children. A programme for pediatricians and researchers, by pediatricians and researchers. The Netherlands 6 A.D.; 2000-2006.
16.
Health Council of the Netherlands (2001). Dietary Reference Intakes: Energy, Proteins, Fats, and Digestible Carbohydrates Publication No. June 2002. Council of the Netherlands: The Hague, ISBN-10: 90-5549-384-8. Kindstedt-Arfwidson K, Strandvik B (1988) Food intake in patients with cystic fibrosis on an ordinary diet. Scand J Gastroenterol Suppl 143:160-162 Lenaerts C, Lapierre C, Patriquin H, Bureau N, Lepage G, Harel F et al (2003) Surveillance for cystic fibrosis-associated hepatobiliary disease: early ultrasound changes and predisposing factors. J Pediatr 143(3):343-350 Mayer OH, Jawad AF, McDonough J, Allen J (2008) Lung function in 3-5 year old children with cystic fibrosis. Pediatr Pulmonol 43:1214-1223 Patel L, Dixon M, David TJ (2003) Growth and growth charts in cystic fibrosis. J R Soc Med 96 Suppl 43:35-41 Powers SW, Byars KC, Mitchell MJ (2003) A randomized pilot study of behavorial treatment to increase calorie intake in toddlers with cystic fibrosis. Child Health Care 32(4):297-311
17.
18. 19. 20. 21. 22. 23. 24. 25.
Lloyd-Still JD, Smith AE, Wessel HU (1989) Fat intake is low in cystic fibrosis despite unrestricted dietary practices. J Parenter Enteral Nutr 13:296-298 Luder E, Kattan M, Thornton JC, Koehler KM, Bonforte RJ (1989) Efficacy of a nonrestricted fat diet in patients with cystic fibrosis. Am J Dis Child 143:458-464
Powers SW, Mitchell MJ, Patton SR, Byars KC, Jelalian E, Mulvihill MM, et al (2005) Mealtime behaviors in families of infants and toddlers with cystic fibrosis. J Cyst Fibros 4(3):175-82
26.
Powers SW, Patton SR, Byars KC, Mitchell MJ, Jelalian E, Mulvihill MM, et al (2002) Caloric intake and eating behavior in infants and toddlers with cystic fibrosis. Pediatrics 109(5):E75 Ramsey BW, Farrell PM, Pencharz P (1992) Nutritional assessment and management in cystic fibrosis: a consensus report. The Consensus Committee. Am J Clin Nutr 55(1):108-116 Powers SW, Patton SR (2003) A comparison of nutrient intake between infants and toddlers with and without cystic fibrosis. J Am Diet Assoc 103(12):1620-1625
38
28. 29.
27.
30.
33. 34. 35. 37. 38. 40. 41. 36.
32.
31.
Stallings VA, Stark LJ, Robinson MS, Feranchak AP, Quinton H (2008) Evidence-based practice recommendations for nutrition-related management of children and adults with cystic fibrosis and pancreatic insufficiency: Results of a systematic review. J Am Diet Assoc 108: 832-839 Stark LJ, Bowen AM, Tyc VL, Evans S, Passero MA (1990) A behavorial approach to increasing calorie consumption in children with cystic fibrosis. J Pediatr Psychol 15(3):309-326
Shepherd RW, Holt TL, Cleghorn G, Ward LC, Isles A et al (1988) Short-term nutritional supplementation during management of pulmonary exacerbation in cystic fibrosis: a controlled study, including effects of protein turnover. Am J Clin Nutr 48:235-239 Sinaasappel M, Stern M, Littlewood J, Wolfe S, Steinkamp G, Heijerman HG, et al (2002) Nutrition in patients with cystic fibrosis: a European Consensus. J Cyst Fibros 1(2):51-75
Stark LJ, Knapp LG, Bowen AM, Powers SW, Jelalian E et al (1993) Increasing calorie consumption in children with cystic fibrosis: replication with 2-year follow up. J App Beh Anal 26: 435-450
Stark LJ, Opipari LC, Spieth LE, Jelalian E, Quittner AL et al (2003) Contribution of behaviour therapy to dietary treatment in cystic fibrosis: a randomized controlled study with 2-year follow-up. Behavior Therapy 34:237-258
teinkamp G, Demmelmair H, Rhl-Bagheri I, von der Hardt, H, Koletzko, B (2000) Energy supplements rich in linoleic acid improve body weight and essential fatty acid status of cystic fibrosis patients. J Pediatr Gastro Enterol Nutr 31:418-423 Stettler N, Kawchak DA, Boyle LL, Propert KJ, Scanlin TF, Stallings VA et al (2000) Prospective evaluation of growth, nutritional status, and body composition in children with cystic fibrosis. Am J Clin Nutr 72(2):407-413 Tanner JM (1976) Clinical longitudinal standards for height, weight, height velocity, weight velocity, and stages of puberty. Arch Dis Child 51(3):170-179
Vaisman N, Clarke C, Pencharz PB (1991) Nutritional rehabilitation increases resting energy expenditure without affecting protein turnover in patients with cystic fibrosis. J Pediatr Gastroenterol Nutr 13:383-390 Ward C, Massie J, Glazner J, Sheehan J, Canterford L, Armstrong D et al (2009) Problem behaviours and parenting in preschool children with cystic fibrosis. Arch Dis Child 94:341347 Wiskin AE, Davies JH, Wootton SA, Beattie RM (2010) Energy expenditure, nutrition and growth. Arch Dis Child 1-6 Vilozni D, Bentur L, Efrati O, Minuskin T, Barak A, Szeinberg A, et al (2007) Spirometry in early childhood in cystic fibrosis patients. Chest 131:356-361 Walkowiak J, Przyslawski J (2003) Five year prospective analysis of dietary intake and clinical status in malnourished cystic fibrosis patients. J Hum Nutr Dietet 16:225-231
39.
Zielenski J, Tsui LC (1995) Cystic Fibrosis: Genotypic and phenotypic variations. Annu Rev Genet 29: 777-807.
39
ChapTEr 3
PERSISTENT FAT MALABSORPTION IN CYSTIC FIBROSIS; LESSONS FROM PATIENTS AND MICE
M. Wouthuyzen-Bakker1 F.A.J.A. Bodewes1 H.J. Verkade1
Pediatric Gastroenterology, Department of Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands.
Journal of Cystic Fibrosis 2011; 10(3): 150-8
ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS
aBSTraCT Fat malabsorption in pancreatic insufficient cystic fibrosis (CF) patients is classically treated with pancreatic enzyme replacement therapy (PERT). Despite PERT, intestinal fat absorption remains insufficient in most CF patients. Several factors have been suggested to contribute to the persistent fat malabsorption in CF (CFPFM). We reviewed the current insights concerning the proposed causes of CFPFM and the corresponding intervention studies. Most data are obtained from studies in CF patients and CF mice. Based on the reviewed literature, we conclude that alterations in intestinal pH and intestinal mucosal abnormalities are most likely to contribute to CFPFM. The presently available data indicate that acid suppressive drugs and broad spectrum antibiotics could be helpful in individual CF patients for optimizing fat absorption and/or nutritional status.
42
Despite optimizing and maximizing PERT, fat malabsorption in most CF patients persist (CFPFM). Rather than the physiological absorption above 95%, most CF patients show a decreased intestinal fat absorption of 85-90% of dietary fat intake.4,5 It is reasonable to assume that at least part of the failure to approach a physiological degree of fat absorption could still be attributed to inefficiency and inaccurate dosing of PERT. Also, a non-synchronous entrance of PERT with dietary energy intake into the duodenum may play a role in CFPFM.6 However, besides PERT related issues, other factors have been implied to be involved in CFPFM.7,8
INTrOduCTION Most patients with cystic fibrosis (CF) have a suboptimal nutritional status. In order to minimize morbidity and mortality, obtaining and maintaining a good nutritional status remains one of the important challenges in CF.1-3 Next to preventing and controlling pulmonary infections, a high dietary energy intake diet combined with pancreatic enzyme replacement therapy (PERT) are classic cornerstones in CF care.
During the last decades, several of these potential contributing factors to CFPFM have been addressed and investigated in patient studies as well as animal studies. In this review, we will provide an overview of the different mechanisms that have been implied to contribute to CFPFM and describe the results of corresponding interventional studies on fat absorption and/or nutritional status. We will mainly describe studies performed in CF patients and CF mice. CF mice are especially suitable to exclusively investigate CFPFM, as most CF mouse models do not suffer from pancreatic insufficiency but do exhibit impaired absorption of fat.9 Based on the reviewed literature, we will conclude our review with clinical implications and suggestions for further research. In order to fully recognize and understand the CF-related factors that might be involved in CFPFM, we start to describe the physiological process of fat digestion and absorption.
phYSIOLOGY OF FaT dIGESTION aNd aBSOrpTION Dietary fat intake mainly consists of long-, medium- and short-chain triglycerides. The mechanism of digestion and absorption of these lipids can be dissected into several sequential steps. In contrast to long-chain triglycerides, medium- and short-chain triglycerides are known to circumvent several steps in lipid digestion and absorption. For example, unlike long-chain triglycerides, medium- and short chain triglycerides are less dependent upon solubilization, escape the re-esterification into triglycerides and are directly absorbed into the portal system without being assembled into chylomicrons.10 Since the majority of dietary fat and energy intake consists of longchain triglycerides (92-96%), we exclusively focused on their mechanism of intestinal digestion and absorption. The mechanism of digestion and absorption of long-chain triglycerides can be dissected into several sequential processes (figure 1A). 43
1) Emulsification. Emulsification of triglycerides is a process in which (water-insoluble) fat droplets are suspended in an aqueous environment. Emulsification can be achieved by mechanical as well as chemical means. Mechanical emulsification is attained by chewing and forcing dietary fat with high pressure through a small opening (e.g. the pylorus) and dispersing large fat droplets into smaller droplets. Chemical emulsification is attained by the action of bile and prevents the emulsion from re-coalescing. Emulsification results in a fine, relatively stable oil-in-water emulsion with an increased surface area. The water soluble digestive / lipolytic enzymes are active at the site of the water-oil interface.
3) Solubilization. The process in which fat molecules are dissolved in water in the form of (mixed) micelles is called solubilization. Solubilization enhances the aqueous solubility of fatty acids by several orders of magnitude (100 to 1000 fold).10 Solubilization is necessary for monoglycerides and free fatty acids to efficiently overcome the diffusion barrier of the so called unstirred water layer of the enterocytes.10 The unstirred water layer separates the enterocytes from the luminal contents of the intestine. Solubilization is achieved by the formation of mixed micelles; mainly consisting of phospholipids and bile salts derived from biliary secretion. The diameter of the lipid droplets ranges from 100 1000 nm, whereas that of mixed micelles ranges 3-5 nm. The hydrophobic part of the lipid molecules, such as the acyl-chains, will be oriented inwards, whereas the hydrophilic parts, (such as the carboxylic headgroups) orients towards the aqueous outside of the micelle. Saturated fatty acids are more dependent on solubilization than unsaturated fatty acids, due to the higher hydrophobicity of the former. The difference 44
2) Lipolysis. During lipolysis, the breakdown (hydrolysis) of lipids into smaller particles is continued. Around 10-30% of the triglycerides are hydrolyzed in the stomach into diglycerides and free fatty acids, catalyzed by lingual and gastric lipase (a process also known as biochemical/lipolytic emulsification10). Under physiological conditions, pancreatic lipase completes the process in the proximal part of the small intestine, by hydrolyzing the remaining triglycerides and diglycerides into monoglycerides and free fatty acid molecules. Bile salts are amphipathic molecules, i.e. they possess a hydrophilic and a hydrophobic site. Upon exposure to dietary lipid emulsion at the level of the proximal small intestine, the hydrophobic site orients itself towards the hydrophobic lipid droplets, whereas their hydrophilic site exposes itself to the aqueous (water) phase. Lipids droplets whose surface is thus covered bile salts are not accessible to pancreatic lipase. Pancreatic co-lipase allows the anchoring of the pancreas lipase to the oil-water interface and is essential for lipolytic activity. Under physiological conditions, pancreatic lipase is present in vast excess. Thus, in CF, fat maldigestion only occurs during severe pancreatic malfunction.11 During exocrine pancreatic insufficiency when pancreatic lipase is severely reduced, lipolysis is more dependent upon the activity of lingual and gastric lipase. In CF conditions, lingual lipase remains fully active in the intestine, where it accounts for more than 90% of lipase activity, even when the intestinal pH drop below the optimal level for bile salt dependent lipolysis.80
in bile salt dependency can be derived from absorption studies in rats with chronic bile diversion: in such an intestinal bile deficient condition, absorption of saturated fatty acids is below 30% of the ingested amount, while the absorption of unsaturated fatty acids is relatively maintained (~80%).13 Just like the digestion of fat, the process of micelle formation is also pH sensitive. Low intestinal pH levels can severely inhibit micelle formation or induce premature release of lipolytic products out of micelles.10
B
CF patients 1. 2. 3. 4. 5. 6. Emulsification Lipolysis Solubilization Translocation Intracellular processing Chylomicron production + + + CFTr knockout mice + + ND ND homozygous delta F508 mice + ND ND
Figure 1. Simplified scheme of fat digestion and absorption in health and in CF conditions. A) Simplified representation of the process of long-chain triglyceride digestion and absorption in health as described in the text. B) Overview of the various steps in fat digestion and absorption in relation to findings in CF patients and CF mice. +; disturbed, -; not disturbed, +/-; likely to be disturbed. ND: not determined. References are described in the text.
45
5) Intracellular processing. After being absorbed into the enterocytes, the lipolytic products migrate to the endoplasmic reticulum, possibly mediated via the fatty acid binding proteins.14-15 At the cytoplasmic surface of the endoplasmic reticulum, the fatty acids and monoglycerides are re-esterified into triglycerides. Under physiological conditions, re-esterification mainly occurs via the monoacylglycerol pathway, i.e. the sequential acylation of monoacylglycerol by acyl-CoA.10
4) Translocation. Once the mixed micelles diffuse through the unstirred water layer and arrive at the proximity of the (apical) enterocyte membrane, the free fatty acids and monoglycerides dissociate from the micelles. It has been postulated that the acidic microclimate near the apical membrane of intestinal mucosal cells, induces micelle- disintegration and favours the translocation of fatty acid molecules across the enterocyte membrane.10 It has remained unclear whether intestinal membrane transporters are essential for the translocation of fatty acids and monoglycerides. It is suggested that free fatty acid uptake is concentration-dependent, in which a high intraluminal concentration drives passive diffusion. Two putative intestinal transporters have been proposed to be involved fatty acid uptake; the fatty acid binding protein (FABP) and the fatty acid translocase / cluster determinant 36 (FAT/CD36).14 However, both transporters are not likely to be involved in fatty acid uptake into the enterocytes. FABP is only expressed in a small area of the crypt-villus of the intestine and knockout mice for FABP and CD36 do not exhibit impairments in fatty acid uptake.15-17
6) Chylomicron production. Newly synthesized triglycerides are transferred into the smooth endoplasmic reticulum and are assembled into lipoprotein particles called chylomicrons. Intestinal phospholipids are required for chylomicron production in order to prevent accumulation in the enterocyte.18-19 Maturation of chylomicrons (i.e. assembly of fat particles with a phospholipid-cholesterol-apolipoprotein surface) takes place in the Golgi apparatus. Chylomicron formation is followed by exocytosis via the secretory pathway at the basolateral surface of the enterocyte. The chylomicrons are released into the circulation via the mesenteric lymph system, via the thoracic duct into the venous system, after which their contents are systemically delivered.
FaCTOrS prOpOSEd TO BE aSSOCIaTEd WITh pErSISTENT FaT MaLaBSOrpTION IN CF Several factors have been proposed to contribute to CFPFM. For each of these factors we will describe;1 how these factors are affected in CF conditions;2 what is known about the relation of these factors with CFPFM; and,3 what the result of intervention studies are in CF patients and CF mice when improving or altering these factors.
46
2) Relation with CFPFM. A normal intestinal pH is essential for adequate digestion and absorption of fat.10 Recently, Quinton et al. showed that adequate bicarbonate secretion is essential for mucin expansion in the intestine.24-25 When mucin expansion is disturbed by inadequate release of bicarbonate in CF conditions, viscous and sticky mucus might impair translocation of lipids to the enterocyte. A strong relation has been described between postprandial duodenal pH levels and the degree of fat malabsorption in CF patients treated with pancreatic enzymes.26 These data indicate that interventions to increase intestinal pH values might improve CFPFM. 3) Intervention studies. Two double-blind crossover studies evaluated fat absorption in pediatric and adult CF patients after the addition of bicarbonate to enteric coated pancreatic enzymes. In the first study, the average fat absorption increased from 75% to 82% of the ingested amount.27 In this study, a beneficial effect on fat absorption was observed in seventy-five percent of the patients. In the second study, the average fat absorption did not increase, but fifty percent of patients did show an improvement in fat absorption (>5%) after bicarbonate supplementation.28 Due to the overall minimal observed changes in fat absorption, pancreatic enzymes buffered with bicarbonate are not implemented in CF care.
1) CF conditions. CFTR dysfunction reduces pancreatic and duodenal bicarbonate secretion.20-21 Gastric bicarbonate secretion in CF patients is not affected.22 Hence, the duodenal pH is (on average) 1-2 units lower in CF patients compared with healthy controls. Also, CF patients have significantly longer periods (postprandial) in which the duodenal pH drops below 4.23 The pH values in jejunal and ileal contents from CF patients vary from lower to similar pH values compared with healthy controls.23 CFTRtm1Cam knockout mice have adequate pancreatic bicarbonate secretion, but probably do have reduced secretions of duodenal bicarbonate.9 This might explain the observation in CFTRtm1Unc knockout mice , where duodenal pH is only minimally reduced (~0.25).21
3.1
Intestinal pH
In a systematic review, Jones A. evaluated the effect of acid suppressant therapy on fat absorption and/or faecal fat excretion and nutritional status.29 While multiple studies reported improved fat absorption or reduced faecal fat excretion after acid suppressive therapy, other studies reported no improvements. Improved fat absorption was not accompanied with an improvement in nutritional status. The performed studies showed high variability in the used dosage of pancreatic enzymes, choice of acidic suppressive medication and differed in the inclusion criteria for the degree of fat malabsorption. Due to these large inter-study differences, it remains difficult to draw an overall definite conclusion about the effectiveness of acid suppressive drugs. Evaluating individual data in these intervention studies, a subgroup of patients clearly showed improved fat absorption. The results indicate that some CF patients do benefit from acid suppressive therapy. Why some patients respond, but others show no improvement in fat absorption, 47
illustrates that an altered pH is not the only factor responsible CFPFM. Next to this, it is known that acid suppressive drugs can induce small intestinal bacterial overgrowth (SIBO) and can alter bile salt metabolism, with a potentially negative effect on fat absorption.30 Therefore, acid suppressive therapy should be imposed with caution, especially in CF patients who are relatively more prone to SIBO. A trial of proton pump inhibitors might be useful to evaluate its effectiveness in the individual CF patient. Bijvelds et al. investigated the effect of the acidic suppressive drug omeprazole on lipolysis and uptake of lipolytic products in CFTRtm1CAM knockout mice by using radioisotope labelled triglycerides and fatty acids. The researchers showed that lipolytic activity and lipid absorption improved after omeprazole treatment.9 It is likely that increasing the intestinal pH has a general positive effect on intestinal fat absorption, since lipolytic and post-lipolytic activity also partially improved in the omeprazole treated wild type mice.9 3.2 Intra-luminal bile salts
1) CF conditions. CF patients have an increased loss of faecal bile salts.31,32 It is speculated that the loss of bile salts is due to impaired bile salt uptake by intestinal mucosal alterations; like thickening of the mucus barrier and/or SIBO.33 Because the biosynthesis of taurine is limited in humans, the faecal loss of bile salts induces an increased glycine/ taurine ratio of conjugated bile salts in CF patients.34 In addition, CF patients have an altered bile salt composition in gallbladder bile. Due to a quantitative increase in biliary cholate, the percent contribution of cholate is higher, and the percent contribution of chenodeoxycholate and deoxycholate is lower in the bile of CF patients.35 2) Relation with CFPFM. It has been proposed that excessive faecal loss of bile salts diminishes the bile salt pool in CF patients and consequently impairs fat absorption by reducing the solubilization capacity of bile.31 However, a subsequent study indicated that the amount of faecal bile salt excretion was not related to the degree of fat malabsorption in CF patients.32 Strandvik et al. showed that adult CF patients have normal to large bile salt pool sizes and similar amounts of duodenal bile salts as healthy controls.35 Bile salt synthesis was normal or even increased, indicating that CF patients adequately compensate for the faecal bile salt loss. We confirmed in CF mouse models that faecal loss of bile salts does not influence the absorption of fat.9 Homozygous F508 mice and CFTRtm1CAM knockout mice both exhibit, to the same extent, an increased faecal loss of bile salts, but only the CFTRtm1CAM knockout mice had fat malabsorption.9 In conclusion, bile salt malabsorption in itself, at the levels observed in CF patients and CF mice, does not seem to contribute to CFPFM. Theoretically, the increased glycine/taurine ratio may impair fat absorption in an acidic intestinal lumen. Due to the higher pKa of glycine, glycine conjugated bile salts are less able to remain in micellar solution.36 In addition, part of the glycoconjuates are 48
Deoxycholate and chenodeoxycholate are relatively hydrophobic in comparison to other bile salts. Therefore, a reduction in these bile salts may theoretically impair fat absorption by diminishing the solubilization capacity of bile. In general, the percent contribution, and not the quantitative amount, of deoxycholate and of chenodeoxycholate is diminished in CF patients. Thus, the altered bile salt composition is not likely to contribute to CFPFM. This hypothesis is supported by the fact that both homozygous F508 mice and CFTR tm1CAM knockout mice show these alterations, while only the CFTR tm1CAM knockout mice exhibit fat malabsorption.9 3) Intervention studies. Multiple studies showed that taurine supplementation reduces faecal fat excretion and improves the nutritional status of CF patients, particularly in patients with severe steatorrhoea.39-41 However, the beneficial effect of taurine supplementation on fat absorption is not unequivocally demonstrated.42-45 Furthermore, the degree of fat absorption did not relate to changes in the serum glycine/taurine ratio in CF children.45 Altogether, the use of taurine supplementation remains controversial and is not implemented in nutritional CF care. 3.3 1) CF conditions. Several intestinal mucosal abnormalities are described in CF patients. These abnormalities include accumulation of viscous and sticky mucus, SIBO, ileal hyperthrophy and villous atrophy, increased intestinal permeability and (chronic) inflammation of the small intestine.46-53 Intestinal mucosal abnormalities
passively absorbed in the in the proximal part of the intestine and are, in comparison to tauroconjugates, less resistant to bacterial degradation.37-38
2) Relation with CFPFM. All the above mentioned factors may theoretically contribute to fat malabsorption in CF patients, as they might impair adequate translocation of fatty acids in(to) the enterocyte. In addition, SIBO might impair micelle formation by the bacterial deconjugation of bile salts.54 However, no studies evaluated the actual contribution of intestinal mucosal abnormalities to CFPFM.
3) Intervention studies. The group of De Lisle et al. evaluated the effect of antibiotic treatment on intestinal inflammation, mucus accumulation and SIBO in CFTRtm1Unc knockout mice.55 CFTRtm1Unc knockout mice display a phenotype of SIBO with a 400 fold increase in small intestinal bacterial content compared to wild type littermates.56 Broad spectrum antibiotic treatment with ciprofloxacine and metronidazole did not only reduce the bacterial load in the small intestine, but also decreased intestinal mucus accumulation and inflammation. More importantly, three weeks of treatment substantially improved the body weight of these mice. The same effect on the bacterial load, intestinal mucus accumulation, inflammation and body weight was observed after laxative treatment.57 It remains to be elucidated whether the growth benefit was due to 49
1) CF conditions. No studies exclusively investigated small intestinal transit in CF patients, but several groups have evaluated the oro-cecal transit time (OCTT).23 The lactulose/hydrogen breath test was most commonly applied to for determination of the OCTT. Eighty five percent of CF patients had a prolonged OCTT (at least +50%) in the fasted state.60-61 Another method to evaluate intestinal activity is by measuring the intestinal muscle activity during the inter-digestive state, also known as the migrating motor complex. The migrating motor complex indirectly reflects the ability to transit food through the intestine. Hallberg et al. showed that duodenal motility during fasting was normal in 8 out of 10 CF patients.22 This contradiction with transit studies underlines the necessity to evaluate small intestinal transit in CF patients. Especially, since intestinal smooth muscle activity shows an erratic pattern and is unresponsive to cholinergic stimulation in CFTRtm1Unc knockout mice.62 It has been repeatedly shown, that these mice have a slower small intestinal transit time in comparison to wild type littermates on the same diet.57, 64 2) Relation with CFPFM. Fat absorption partly depends on the time fat is in contact with the absorptive epithelium of the intestine. A classical thought is that during fat malabsorption the intestine prolongs the intestinal transit time (as a compensatory mechanism), in order to enhance its ability to absorb fat; a phenomenon also known as the ileal brake.63 It is reasonable to assume that this compensatory mechanism also occurs in CFPFM as intestinal transit time is prolonged in CF. However, prolonged intestinal transit time is also a risk factor for the occurrence of SIBO in CF conditions.8 50
One study evaluated the effect of probiotics on intestinal inflammation in CF patients.49 It has been suggested that probiotics improve intestinal barrier function and modify the immune response.58 Bruzzese et al. reported that a four week treatment with Lactobacillus rhamnosus GG, reduced faecal calprotectin levels (marker for intestinal inflammation) in 8 out of 10 treated CF patients.49 The long term effect of probiotics on intestinal inflammation was not evaluated, nor the effect on fat absorption or nutritional status. We found only one mice study which evaluated fat absorption after probiotics; lactobacillus supplementation increased intestinal absorption of dietary lipids in germfree mice colonized with human baby flora.59 Until now, the clinical value of probiotics and its relation with fat absorption in CF patients is not clear. 3.4 Small intestinal transit time
improved fat absorption, reduced competition for nutrients by intestinal bacteria or due to reduced intestinal inflammation. As OBrien et al. showed that a seven-day treatment with metronidazole reduced faecal fat excretion in four CF patients 32, it is reasonable to assume that the increased weight is due to improved fat absorption Although the effect on fat absorption was not assessed in either of these studies, the results suggest that metronidazole might be a potential therapeutic option for increasing fat absorption or nutritional status in CF patients.
3) Intervention studies. The research group of De Lisle et al. performed several (intervention) studies on gastro-intestinal transit in CFTRtm1Unc knockout mice.57, 62, 64 Oral laxative treatment improved circular smooth muscle function in the small intestine and normalized intestinal transit time.62 Moreover, as earlier described, laxative treatment reduced intestinal mucus accumulation, eradicated overgrowth of bacteria in the small intestine and improved body weight.57 Unfortunately, fat absorption was not evaluated in these studies. It is tempting to speculate that laxative treatment may also improve the nutritional status in CF patients, but before recommendations could be made, more clinical data are needed.
Therefore, one might ask, if prolonged intestinal transit time might actually induce or worsen CFPFM. The relation between intestinal transit time and CFPFM is not yet evaluated.
Table 1. Factors that are suggested to contribute to fat malabsorption in cystic fibrosis (CF). Table presents an overview of the described alterations observed in CF patients and CF mice and, interventional studies that evaluated fat absorption and/or nutritional status. : not affected, : increased, : decreased . The described data on CF mice are mainly based on studies in CFTR knockout mice. References are described in the text. SIBO: small intestinal bacterial overgrowth. LA: linoleic acid. DHA: cervonic acid. AA: arachidonic acid.
1) CF conditions. Despite high fat diets and PERT, CF patients can still have a deficiency in essential fatty acids (EFA).14 In general, many CF patients have subnormal levels of serum and tissue linoleic acid (LA) and cervonic acid (DHA), often with increased 51
3.5
Essential fatty acid deficiency
2) Relation with CFPFM. In relation to fat malabsorption, the EFA content in the intestine is very important. EFAs provide fluidity and flexibility to a cell membrane and play an important role in the maintenance of cell membrane functionality of the enterocyte. EFA deficiency in itself can cause fat malabsorption by affecting the absorption capacity of the intestine.74 Apart from reduced LA and DHA levels, increased levels of AA in the CF intestine could also (indirectly) affect fat absorption, by contributing to intestinal inflammation, mucus secretion and intestinal smooth muscle relaxation.79 It has been shown that EFA deficiency affects both the intra-luminal and intra-cellular process of fat absorption, as exemplified in (non-CF) animal models.69 While the degree of EFA deficiency in CF patients is generally mild, we cannot exclude the possibility that it might interact with fat absorption. Especially since serum EFA levels do not necessarily correlate with EFA levels in the intestine.75-76 Ex vivo experiments on intestinal biopsies from CF patients indicated that abnormal intracellular lipid processing occurs in the enterocyte.75 A low incorporation of 14C palmitic acid in triglycerides was found in cultures of duodenal biopsies after 18 hours of incubation. The secretion of triglyceriderich chylomicrons was reduced in comparison to intestinal biopsies from healthy controls.75 Whether this impaired lipid transport is due to EFA deficiency, to aberrant CFTR itself or to a complex relation between the two, requires further investigation.77,78 To what extent reduced intestinal EFA levels in CF patients interfere with the actual percent absorption of dietary fat intake is unknown. An association has been described between the degree of EFA deficiency and the nutritional status of CF patients80, but EFA deficiency can also be present in well nourished CF patients.81 Thus, the clinical relevance of the reduced EFA levels in CF patients on fat malabsorption remains to be determined. 3) Intervention studies. Despite the abundance of (intervention) studies66, 82-85, no study determined the effect of EFA supplementation on CFPFM. Improved DHA levels in duodenal mucosa of CF patients after 70 mg of DHA/kg body weight for six weeks has 52
levels of arachidonic acid (AA).14, 65-66 The reduction in EFA levels is, apart from fat malabsorption, due to many other CF-related factors. The exact mechanism behind the alterations in EFAs still requires further exploration, but increased lipid turnover in cellular membranes and increased oxidation of EFAs are considered to play the most prominent role.14, 67-70). The prevalence of EFA deficiency in CF patients strongly depends on which biochemical marker is applied as diagnostic criterion. Magbool et al. recently demonstrated that the LA status in serum phospholipids is more relevant than the triene/tetraene ratio as clinical indicator for EFA deficiency in CF patients.71 When serum LA values are applied as a diagnostic criterion for EFA-deficiency, around forty percent of pediatric CF patients are classified as EFA deficient.71 The literature is not consistent on the occurrence of EFA deficiency in CF mice. Werner et al. reported that the LA and DHA content in serum and jejunum was not altered in CFTRtm1Cam knockout mice and homozygous delta F508 mice.72 while Freedman et al. reported decreased levels of DHA in the ileum of CFTRtm1Unc knock-out mice.73
been reported66, but whether this improved fat absorption or nutritional status was not described. Reviews on omega 3 fatty acid supplementation or DHA supplementation alone, conclude that there is still insufficient evidence for the therapeutic effect of omega 3 fatty acids to recommend the routine use in CF patients.82, 85 Other studies showed that energy supplements rich in LA improved the body weight in CF patients, but it is hard to differentiate between the effects of LA from that of a high energy intake.83-84 Accordingly, we do not recommend the routine use of EFA supplements in CF for reasons to enhance fat absorption, but it could be considered to improve nutritional status in individual cases.
SuMMarY, CLINICaL IMpLICaTIONS aNd FuTurE pErSpECTIVES Several factors have been proposed to contribute to CFPFM (table 1). Based on the available data we consider it not likely that bile salt alterations do contribute to CFPFM. The quantitative contribution of intestinal mucosal abnormalities, small intestinal transit time and EFA deficiency to CFPFM remains to be determined. Based on the findings in CF mouse models, CF patients with signs of small bacterial overgrowth might benefit from treatment with broad-spectrum antibiotics. Antibiotic treatment should preferably be evaluated with changes in nutritional status or fat absorption, using three day fat balances. However, we should realize that three day fat balances show high intra-individual variability, which exemplifies the need for novel methodologies to assess fat absorption in CF patients. So far, the influence of reduced duodenal pH levels seems most convincingly demonstrated to play a role in CFPFM. Although not necessarily beneficial in all CF patients, a trial of acid suppressive drugs might be helpful to optimize fat absorption in individual cases. rEFErENCES
Corey M, McLaughlin FJ, Williams M, Levison H. A comparison of survival, growth, and pulmonary function in patients with cystic fibrosis in Boston and Toronto. Journal of Clinical Epidemiology 1988;41(6):583-91. Beker LT, Russek-Cohen E, Fink RJ. Stature as a prognostic factor in cystic fibrosis survival. Journal of the American Dietetic Association 2001;101(4):438-42. Pencharz PB, Durie PR. Pathogenesis of malnutrition in cystic fibrosis, and its treatment. Clinical Nutrition 2000;19(6): 387-94.
2. 3. 4. 5. 6.
1.
Littlewood JM, Wolfe SP, Conway SP. Diagnosis and treatment of intestinal malabsorption in cystic fibrosis. Pediatric Pulmonology 2006;41(1):35-49.
FitzSimmons SC, Burkhart GA, Borowitz D et al. High-dose pancreatic-enzyme supplements and fibrosing colonopathy in children with cystic fibrosis. New England Journal of Medicine 1997;336(18):1283-89. Taylor CJ, Hillel P, Ghosal S et al. Gastric emptying and intestinal transit of pancreatic enzyme supplements in cystic fibrosis. Archives of Disease in Childhood 1999;80(2):149-52.
53
8. 9.
7.
Kalivianakis M, Minich DM, Bijleveld CM et al. Fat malabsorption in cystic fibrosis patients receiving enzyme replacement therapy is due to impaired intestinal uptake of long-chain fatty acids. American Journal of Clinical Nutrition 1999;69(1):127-34. Borowitz D, Durie PR, Clarke LL et al. Gastrointestinal outcomes and confounders in cystic fibrosis. Journal of Pediatric Gastroenterology and Nutrition 2005;41(3):273-85.
11.
10. 12. 13.
Bijvelds MJ, Bronsveld I, Havinga R, Sinaasappel M, de Jonge HR, Verkade HJ. Fat absorption in cystic fibrosis mice is impeded by defective lipolysis and post-lipolytic events. American Journal of Physiology: Gastrointestinal and Liver Physiology 2005; 288(4):G646-53. Zoppi G, Andreotti G, Pajo-Ferrara F, Njai DM, Gaburro D. Exocrine pancreatic function in premature and full-term neonates. Pediatric Research 1972;6:880-86.
Verkade H, Tso P. Biophysics of intestinal luminal lipids. In: Mansbach C, Tso P, Kuksis A, editors. Intestinal lipid metabolism. Kluwer Academic / Plenum Publishers; chapter 1;1-18,2001. Abrams CK, Hamosh M, Hubbard van S, Dutta SK, Hamosh P. Lingual lipase in cystic fibrosis. Quantitation of enzyme activity in the upper small intestine of patients with exocrine pancreatic insufficiency. Journal of Clinical Investigation 1984;73:374-82. Minich DM, Kalivianakis M, Havinga R et al. Bile diversion in rats leads to a decreased plasma concentration of linoleic acid which is not due to decreased net intestinal absorption of dietary linoleic acid. Biochimica et Biophysica Acta 1999;1438(1):111-19.
15.
14.
Peretti N, Marcil V, Drouin E, Levy E. Mechanisms of lipid malabsorption in Cystic Fibrosis: the impact of essential fatty acids deficiency. Nutrition and Metabolism 2005;2(1):11. Levy E, Mnard D, Delvin E et al. Localization, function and regulation of the two intestinal fatty acid-binding protein types. Histochemistry and Cell Biology 2009;132:351-67.
16. 17. 18.
Vassileva G, Huwyler L, Poirier K, Agellon LB, Toth MJ. The intestinal fatty acid binding protein is not essential for dietary fat absorption in mice. The Journal of Federation of American Societies for Experimental Biology 2000;13:2040-46.
19. 20.
Cassidy MM, Lightfoot FG, Grau L, Satchitanandum S, Vahouny GV. Lipid accumulation in jejunal and colonic mucosa following chronic cholestyramine (Questran) feeding. Digestive Diseases and Sciences 1985;30(5):468-67. Tang L, Fatehi M, Linsdell P. Mechanism of direct bicarbonate transport by the CFTR anion channel. Journal of Cystic Fibrosis. 2009;8(2):115-21.
Goudriaan JR, Dahlmans VE, Febbraio M et al. Intestinal lipid absorption is not affected affected in CD36 deficient mice. Molecular and cellular biochemistry 2002;239(1-2):199202.
21.
Werner A, Havinga R, Perton F, Kuipers F, Verkade HJ. Lymphatic chylomicron size is inversely related to biliary phospholipid secretion in mice. American Journal of Physiology, Gastrointestinal and Liver Physiology. 2006;290(6):G1177-85. Kauer S, Norkina O, Ziemer D, Samuelson LC, De Lisle RC. Acidic duodenal pH alters gene expression in the cystic fibrosis mouse pancreas. American Journal of Physiology: Gastrointestinal and Liver Physiology 2004; 287(4):G480-90.
54
23. 24. 25. 27.
22.
26. 28.
Garcia MA, Yang N, Quinton PM et al. Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. Journal of Clinical Investigation 2009;119(9):2613-22. Kalnins D, Garson JL, Krug SK et al. An enteric-coated high-buffered pancreas lipase reduces steatorrhea in patients with cystic fibrosis: a prospective, randomized study. Journal of the American Dietetic Association 2006;106(8):1181-86. Kalnins D, Ellis L, Corey M et al. Enteric-coated pancreatic enzyme with bicarbonate is equal to standard enteric-coated enzyme in treating malabsorption in cystic fibrosis. Journal of Pediatric Gastroenterology and Nutrition 2006;42(3):256-61.
Hallberg K, Abrahamsson H, Dalenbck J, Fndriks, Strandvik B. Gastric secretion in cystic fibrosis in relation to the migrating motor complex. Scandinavian Journal of Gastroenterology 2001; 36:121-27. Gregory PC. Gastrointestinal pH, motility/transit and permeability in cystic fibrosis. Journal of Pediatric Gastroenterology and Nutrition 1996;23(5):513-23.
Quinton PM. Birth of mucus. American Journal of Physiology Lung Cellular and Molecular Physiology 2010;298(1):L13-14.
Robinson PJ, Smith AL, Sly PD et al. Duodenal pH in cystic fibrosis and its relationship to fat malabsorption. Digestive Diseases and Sciences 1990;35(10):1299-304.
30.
29.
31. 32. 33. 34. 35. 36. 37. 38.
Jones A. Drug therapies for reducing gastric acidity in people with cystic fibrosis. The Cochrane collaboration 2003;2:1-16. Shindo K, Machida M, Fukumura M, Koide K, Yamazaki R. Omeprazole induces altered bile acid metabolism. Gut 1998;42:266-71. Fondacaro JD, Heubi JE, Kellogg FW. Intestinal bile acid malabsorption in cystic fibrosis: a primary mucosal cell defect. Pediatric Research 1982;16:494-98 Roy CC, Weber AM, Morin CL et al. Abnormal biliary lipid composition in cystic fibrosis. Effect of pancreatic enzymes. New England Journal of Medicine 1977;297(24):1301-05.
Weber AM, Roy CC, Chartrand L et al. Relationship between bile acid malabsorption and pancreatic insufficiency in cystic fibrosis. Gut 1976;17(4):295-99. OBrien S, Mulcahy H, Fenlon H et al. Intestinal bile acid malabsorption in cystic fibrosis. Gut 1993;34:1137-41.
Strandvik B, Einarsson K, Lindblad A, Angelin B. Bile acid kinetics and biliary lipid composition in cystic fibrosis. Journal of Hepatology 1996;25(1):43-48. Regan. PT, Malagelada JR, Dimagno EP, Go VLM. Reduced intraluminal bile acid concentrations and fat maldigestino in pancreatic insufficiency: correction by treatment. Gastroenterology 1979;77:285-89. Krag E, Philips SF. Active and passive bile acids absorption in man. Journal of Clinical Investigation 1974;53:1686-94.
Hepner GW, Sturman JA, Hofmann AF, Thomas PJ. Metabolism of steroid and amino acid moieties of conjugated bile acids in man. III Cholyltaurine (taurocholic acid). Journal of Clinical Investigation 1973;52:433-40.
55
39.
40. 41.
42. 43. 44.
Smith LJ, Lacaille F, Lepage G, Ronco N, Lamarre A, Roy CC. Taurine decreases fecal fatty acid and sterol excretion in cystic fibrosis. A randomized double-blind trial. American Journal of Diseases of Children 1991;145(12):1401-04. De Curtis M, Santamaria F, Ercolini P et al. Effect of taurine supplementation on fat and energy absorption in cystic fibrosis. Archives of Disease in Childhood 1992; 67(9):1082-85.
Belli DC, Levy E, Darling P et al. Taurine improves the absorption of a fat meal in patients with cystic fibrosis. Pediatrics 1987;80(4):517-23.
Darling PB, Lepage G, Leroy C, Masson P, Roy CC. Effect of taurine supplements on fat absorption in cystic fibrosis. Pediatric Research 1985;19(6):578-82.
Colombo C, Arlati S, Curcio L et al. Effect of taurine supplementation on fat and bile acid absorption in patients with cystic fibrosis. Scandinavian Journal of Gastroenterology 1988;23(s143):151-56. Merli M, Bertasi S, Servi R et al. Effect of a medium dose of ursodeoxycholic acid with or without taurine supplementation on the nutritional status of patients with cystic fibrosis: a randomized, placebo-controlled, crossover trial. Journal of Pediatric Gastroenterology and Nutrition 1994;19(2):198-203. Thompson GN, Robb TA, Davidson GP. Taurine supplementation, fat absorption, and growth in cystic fibrosis. The Journal of Pediatrics 1987;111(4):501-06. van Elburg RM, Uil JJ, van Aalderen WM, Mulder CJ, Heymans HS. Intestinal permeability in exocrine pancreatic insufficiency due to cystic fibrosis or chronic pancreatitis. Pediatric Research 1996;39(6):985-91.
45. 46. 47. 48.
Lewindon PJ, Robb TA, Moore DJ, Davidson GP, Martin AJ. Bowel dysfunction in cystic fibrosis: importance of breath testing. Journal of Paediatrics and Child Health 1998;34(1):79-82. Bruzzese ER, Raia V, Gaudiello G et al. Intestinal inflammation is a frequent feature of cystic fibrosis and is reduced by probiotic administration. Alimentary Pharmacology and Therapeutics 2004;20(7):813-19. Lisowska A, Wjtowicz J, Walkowiak J.. Small intestine bacterial overgrowth is frequent in cystic fibrosis: combined hydrogen and methane measurements are required for its detection. Acta Biochimica Polonica 2009;56(4):631-34.
52. 53. 54.
51.
50.
49.
Sbarbati A, Bertini M, Catassi C, Gagliardini R, Osculati F. Ultrastructural lesions in the small bowel of patients with cystic fibrosis. Pediatric Research 1998;43(2):234-39. Smyth RL, Croft NM, OHea U, Marshall TG, Ferguson A.. Intestinal inflammation in cystic fibrosis. Archives of Disease in Childhood 2000;82(5):394-99. Quigley EMM, Quera R. Small intestinal bacterial overgrowth: roles of antibiotics, prebiotics and probiotics. Gastroenterology 2006;130:S78-90. Martin FPJ, Dumas ME, Wang Y et al. A top-down systems biology view of microbiome mammalian metabolic interactions in a mouse model. Molecular System Biology 2007;112(3):1-16.
Raia V, Maiuri L, de Ritis G et al. Evidence of chronic inflammation in morphologically normal small intestine of cystic fibrosis patients. Pediatric Research 2000;47(3):344-50.
56
55.
58. 59.
57.
56.
De Lisle RC, Roach E, Jansson K. Effects of laxative and N-acetylcysteine on mucus accumulation, bacterial load, transit, and inflammation in the cystic fibrosis mouse small intestine. American Journal of Physiology: Gastrointestinal and Liver Physiology 2007;293(3):G577-84. Perdigon G, Fuller R, Raya R. Lactic acid bacteria and their effect on the immune stystem. Current Issues of Intestinal Microbiology 2001;1:27-42.
Norkina O, Burnett TG, De Lisle RC. Bacterial overgrowth in the cystic fibrosis transmembrane conductance regulator null mouse small intestine. Infection and Immunity 2004;72(10):604049.
De Lisle RC, Sewell R, Meldi L. Eradication of small intestinal bacterial overgrowth in the cystic fibrosis mouse reduces mucus accumulation. Journal of Pediatric Gastroenterology and Nutrition 2006;42(1):46-52.
60.
61. 62. 63. 64. 65. 66. 67.
Martin FPJ, Wang Y, Sprenger N et al. Probiotic modulation of symbiotic gut microbial-host metabolic interactions in a humanized micrbiome mouse model. Molecular Systems Biology 2008; 157(4):1-14. De Lisle RC. Enteric circular muscle dysfunction in the cystic fibrosis mouse small intestine. Neurogastroenterology and Motility 2010;22(3):341-e87.
Dalzell AM, Freestone NS, Billington D, Heaf DP. Small intestinal permeability and orocaecal transit time in cystic fibrosis. Archives of Diseases in Childhood 1990; 65:585-88. Bali A, Stableforth DE, Asquith P. Prolonged small-intestinal transit time in cystic fibrosis. British Medical Journal 1983;287:1011-13. Citters van GW, Lin HC. Ileal brake: neuropeptidergic control of intestinal transit. Current Gastroenterology Reports 2006;8(5):367-73.
De Lisle RC. Altered transit and bacterial overgrowth in the cystic fibrosis mouse small intestine. American Journal of Physiology: Gastrointestinal and Liver Physiology 2007;293(1):G10411. Freedman SD, Blanco PG, Zaman MM et al. Association of Cystic Fibrosis with Abnormalities in Fatty Acid Metabolism. New England Journal of Medicine 2004; 350(6):560-69. Jumpsen JA, Brown NE, Thomson ABR et al. Fatty acids in blood and intestine following docosahexaenoic acid supplementation in adults with cystic fibrosis. Journal of Cystic Fibrosis 2006;5(2):77-84.
68. 69. 70.
Andersson C, Al-Turkmani MR, Savaille JE et al. Cell culture models demonstrate that CFTR dysfunction leads to defective fatty acid compostion and metabolism. Journal of Lipid Research 2008;49:1692-1700. Strandvik B. Fatty acid metabolism in cystic fibrosis. Prostaglandins Leukotrienes and Essential Fatty Acids 2010;7:1-9.
Levy E, Garofalo C, Thibault L et al. Intraluminal and intracellular phases of fat absorption are impaired in essential fatty acid deficiency. American Journal of Physiology 1992;262:G31926. Rogiers V, Dab I, Michotte Y, Vercruysse A, Crokaert R, Vis HL. Abnormal fatty acid turnover in the phospholipids of the red blood cell membranes of cystic fibrosis patients. Pediatric Research 1984;18:704-09.
57
72. 73. 74. 75. 76. 77. 78. 80. 79.
71.
Maqbool A, Schall JI, Garcia-Espana JF, Zemel BS, Strandvik B, Stallings VA. Serum linoleic acid status as a clinical indicator of essential fatty acid status in children with cystic fibrosis. Journal of Pediatric Gastroenterology and Nutrition 2008;47(5):635-44. Werner A, Bongers MEJ, Bijvelds MJ, de Jonge HR, Verkade HJ. No indications for altered fatty acid metabolism in two murine models for cystic fibrosis. Journal of Lipid Research 2004;45(12):2277-86. Freedman SD, Katz MH, Parker EM, Laposota M, Urman MY, Alvarez JG. A membrane lipid imbalance plays a role in the phenotypic expression of cystic fibrosis in cftr(-/-) mice. Proceedings of the National Academy of Sciences of the United States of America 1999;96:13995-14000. Snipes RL. The effects of essential fatty acid deficiency on the ultrastructure and functional capacity of the jejunal epithelium. Laboratory Investigation 1968;18(2):179-89. Peretti N, Roy CC, Drouin E et al. Abnormal intracellular lipid processing contributes to fat malabsorption in cystic fibrosis patients. American Journal of Physiology: Gastrointestinal and Liver physiology 2005;290:G609-15. Korotkova M, Strandvik B. Essential fatty acid deficiency affects the fatty acid composition of the rat small intestinal and colonic mucosa differently. Biochimica et Biophysica Acta 2000;1487:319-325.
Mailhot G, Ravid Z, Barchi S, Moreau A, Rabasa-Lhoret R, Levy E. CFTR knockdown stimulates lipid synthesis and transport in intestinal Caco-2/15 cells. American Journal of Physiology: Gastrointestinal and Liver Physiology 2009;297(12):G1239-49. Mailhot G, Rabasa-Lhoret R, Moreau A, Berthiaume Y, Levy E. CFTR depletion results in changes in fatty acid composition and promotes lipogenesis in intestinal Caco 2/15 cells. PloS One 2010;5(5):e10446. De Lisle RC, Meldi L, Flynn M, Jansson K. Altered eicosanoid metabolism in the cystic fibrosis mouse small intestine. Journal of Pediatric Gastroenterology and Nutrition. 2008;47:406-16.
81. 83. 82.
84.
Steinkamp G, Demmelmair H, Rhl-Bagheri I, von der Hardt H, Koletzko B. Energy supplements rich in linoleic acid improve body weight and essential fatty acid status of cystic fibrosis patients. Journal of Pediatric Gastroenterology and Nutrition 2000;31(4):418-23.
Van Biervliet SVB, Van Biervliet JP, Robberecht E, Christophe A. Docosahexaenoic acid trials in cystic fibrosis: a review of the rationale behind the clinical trials. Journal of Cystic Fibrosis 2005;4(1):27-34.
Shoff SM, Ahn HY, Davis L, Lai H; Wisconsin CF Neonatal Screening Group. Temporal associations among energy intake, plasma linoleic acid, and growth improvement in response to treatment initiation after diagnosis of cystic fibrosis. Pediatrics 2006;117(2):391-400. Roulet M, Frascarolo P, Rappaz I, Pilet M. Essential fatty acid deficiency in well nourished young cystic fibrosis patients. European Journal of Pediatrics 1997;156(12):952-56.
85.
van Egmond AW, Kosorok MR, Koscik R, Laxova A, Farrell PM. Effect of linoleic acid intake on growth of infants with cystic fibrosis. The American Journal of Clinical Nutrition 1996;63(5):746-52.
Coste TC, Armand M, Lebacq et al. An overview of monitoring and supplementation of omega 3 fatty acids in cystic fibrosis. Clinical Biochemistry 2007;40:511-20.
58
ChapTEr 4
ANTIBIOTIC TREATMENT AND FAT ABSORPTION IN CYSTIC FIBROSIS MICE
M. Wouthuyzen-Bakker1 M.J.C. Bijvelds2 H.R. de Jonge2 R.C. De Lisle3 JGM Burgerhof4 H.J. Verkade1
Pediatric Gastroenterology, Department of Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands. 2 Laboratory of Gastroenterology & Hepatology, Erasmus University Medical Center Rotterdam, Rotterdam, The Netherlands. 3 Department of Anatomy and Cell Biology, University of Kansas School of Medicine, Kansas City, United States of America 4 Department of Epidemiology, Unit Medical Statistics, University Medical Center Groningen, Groningen, 9700 RB, The Netherlands.
1
pediatric research, accepted for publication
ChapTEr 4 aNTIBIOTICS aNd FaT aBSOrpTION
aBSTraCT Improving fat absorption remains a challenge in Cystic Fibrosis (CF). Antibiotic treatment (AB) has been shown to improve body weight of CF mice. The mechanism may include improved fat absorption. We aimed to determine the effect of AB on fat absorption in two CF mouse models. For 3 weeks, we administered oral AB (ciprofloxacin/metronidazole) or control treatment to homozygous F508 (/), CFTR knockout (-/-), and wildtype mice and quantified fat absorption with a 72-hour fat balance test. In / mice, we assessed fat absorption kinetics by determining plasma appearance of stable isotopelabelled fats, originating from intragastrically administered tri-1-13C-palmitin and 1-13C-stearate. We quantified biliary and fecal bile salts (gas chromatography) and small intestinal bacteria (quantitative polymerase-chain-reaction). AB did not improve total fat absorption. Interestingly, AB accelerated absorption of isotope-labelled fats, both in / and wildtype mice. The described changes were not related to the solubilization capacity of bile or to changes in small intestinal bacteria. AB reduced the fecal excretion of cholate by ~50% (p<0.05) in both CF mouse models, indicating improved intestinal bile salt absorption. In conclusion, AB does not improve total fat absorption in CF mice, but decreases fecal loss of bile salts and accelerates long-chain fatty acid absorption.
60
INTrOduCTION The classic phenotype of Cystic Fibrosis (CF) in the digestive system includes malabsorption of fats. Fat malabsorption can result in a suboptimal nutritional status and consequently, contribute to recurrent pulmonary infections in CF patients.1 Therefore, improving fat absorption is an important key-feature in CF care. Pancreatic insufficiency is the main cause of fat malabsorption in the majority of CF patients. Although pancreatic enzyme replacement therapy greatly improves fat absorption, fat absorption still remains 10-30% lower than normal in a substantial fraction of CF patients.2 The remaining fat malabsorption may be due to a decrease in intestinal pH, intestinal mucosal abnormalities (like small intestinal bacterial overgrowth (SIBO), viscous mucus or intestinal inflammation) or changes in biliary bile salt composition and/or the enterohepatic circulation of bile salts.2 Treatment strategies, other than pancreatic enzyme substitution, should be developed to further improve fat absorption in CF patients. Two previous studies indicated a positive effect of antibiotic (AB) treatment on the nutritional status in CF conditions. CF patients have shown an improvement in body weight and body mass index after six months of treatment with azitromycin, irrespective of changes in pulmonary function.3,4 It is unclear whether this effect is the result of the anti-microbial or, rather, of the antiinflammatory properties of azitromycin. CFTR knockout mice increased in body weight after a three-week treatment with broad-spectrum antibiotics compared with controls.5, which may be related to treatment of SIBO. SIBO is a common feature in CF conditions.2 and is effectively treated by AB in CFTR knockout mice.5 Since intestinal bacteria are able to deconjugate bile salts, they could impair the solubilization capacity of bile.6 and therefore, might contribute to the remaining fat malabsorption in CF patients. CF mice are generally pancreas sufficient, but do show problems with the absorption of fat.7 Therefore, CF mice mimick the condition in CF patients who are treated with pancreatic enzymes and thus, serve as an excellent model to study fat malabsorption as a consequence of (exclusively) the intestinal CF phenotype. CFTR knockout mice have a severe intestinal phenotype and have lower fat absorption percentages in comparison to wild types. The CFTR homozygous F508 mice, the model for the most common mutation found in CF patients, display a milder intestinal phenotype. These CF mice have a delayed intestinal absorption of fatty acids, as we previously demonstrated by absorption kinetics with isotope-labelled fats.7 We aimed to determine the effect of broad-spectrum AB treatment on fat absorption in both CFTR knockout mice and homozygous F508 mice. We additionally analyzed small intestinal bacterial flora and bile salt composition, as these could be influenced by AB treatment and provide mechanistic information on possible changes in fat absorption. 61
MaTErIaL aNd METhOdS Mice and diet CFTRtm1Unc knockout mice with a C57BL/6 genetic background (n=17) and wild type littermates (n=17) were reared in an environmentally controlled free facility at the University of Kansas Medical Center. From the age of 10 days, these mice were maintained on a complete elemental liquid diet to prevent lethal intestinal obstruction (Peptamen; Nestl, Deerfield, IL). The liquid diet contained 33% energy derived from fat, composed of 23% of medium chain triglycerides (MCT) and 10% of long-chain triglycerides (LCT). Long-chain fatty acid (LCFA) composition: 16.4 mol% palmitic acid, 6.7 mol% stearic acid, 22.2 mol% oleic acid, 43.6 mol% linoleic acid, 4.6 mol% alpha-linolenic acid, 0.1 mol% arachidonic acid and 0.06 mol% docosahexaenoic acid. The experiment was performed with mice starting at 3 weeks of age as previously described.5 Except for the CFTR knockout mice in the control-treated group (male, n=4), both sexes were equally randomized. Except for body weight, no gender related differences between parameters were observed. CFTRtm1Eur homozygous F508 mice with an FVB/129 genetic background (n=8) and wild type littermates (n=8) were reared in an environmentally controlled facility at the Erasmus MC (Rotterdam, the Netherlands). The mice had free access to water and a standard semi-synthetic chow diet (Hope Farms, Woerden, the Netherlands). The diet contained 13% energy derived from fat, with the following LCFA composition: 18.2 mol% palmitic acid, 7.0 mol% stearic acid, 25.8 mol% oleic acid, 39.1 mol% linoleic acid, 3.5 mol% alpha-linolenic acid, 0.3 mol% arachidonic acid and 0.05 mol% docosahexaenoic acid. The experiment was performed with mice between 8-11 weeks of age. Both sexes were equally randomized over the experimental and control group. Except for body weight, no gender related differences between parameters were observed. Experimental protocols were approved by the University of Kansas Medical Center Institutional Animal Care and Use Committee and by the Ethical Committee for Animal Experiments of the Erasmus MC in Rotterdam. The design was specifically selected in order to allow comparison of the results with previously published data in the two genotypes.5,7 Experimental procedures
AB treatment The CF mice and their respective wild type littermates were individually housed. The experimental group received a three-week (broad-spectrum) AB treatment (ciprofloxacin, 50 mg/kg/day and metronidazole, 100 mg/kg/day) as previously described.5 AB was administered to the liquid diet of the CFTR knockout mice and wild type littermates. For the homozygous F508 mice and wild type littermates, AB was administered to the drinking water that was refreshed on a daily basis. Because of the 62
Fat balance study After 3 weeks of AB treatment, a 72-hour fat balance test was performed. During the last 3 days of treatment, the amount of dietary intake was noted and feces collected. Fecal pellets were freeze-dried and mechanically homogenized. Lipids were extracted, hydrolyzed and methylated according to Muskiet et al.8 Resulting fatty acid methyl esters were analyzed by gas chromatography to calculate ingestion and fecal excretion of LCFA. Fatty acids were quantified using heptadecanoic acid as internal standard. The fat absorption coefficient (%) was calculated by substracting the fecal fat output (g/ day) from the fat intake (g/day), divided by the fat intake (g/day) multiplied by 100%.
light sensitivity of ciprofloxacin, the drinking bottles were covered with aluminium foil. Prior to the administration of AB, the daily intake of liquid diet and water per mouse was measured. Subsequently, the additive dose of AB per mouse was calculated, to ensure an, on average, equal AB dose between the mice. Addition of AB did not affect the drinking behaviour of the mice.
Kinetics of fat absorption The rate of intestinal uptake of triglycerides and fatty acids, labelled with stable isotopes was determined in the homozygous F508 mice and wild type littermates. After 3 weeks of AB or control treatment (e.g. after finishing the 3-day fecal collection for the fat balance), the mice were intraperitoneally injected with 1 mg/kg poloxamer 407 to block lipoprotein lipase dependent lipolysis (11). Subsequently, a 100 l bolus composed of olive oil (25%) and medium chain triglyceride oil (75%) was intragastrically administered. This bolus contained 2 mg 13C-labelled tripalmitin and 2 mg 13C-labelled stearate per 30 gram body weight. After the administration of the bolus, the mice were deprived of food. Blood samples of ~75 l were taken from the lateral tail vein before and at 2, 4 and 6 hours after bolus administration, using heparin-coated microhematocrit tubes. The mice were sacrificed by heart puncture. Plasma and erythrocytes were separated by centrifugation (2000 rpm,10 min at 4C). The plasma samples were derivatized to their -bromo-pentafluorobenzyl esters and 13C-enrichment of 1-13C-palmitin and 1-13C-stearate was measured by gas chromatography combustion isotope ratio mass spectrometry (Delta S/GC Finnigan MAT, Bremen, Germany). 13C-enrichment in plasma was calculated from the fatty acid concentration and expressed as the percentage of the 63
Bile salt analysis The total bile salt concentration was measured in an aliquot of feces (collected for the 3-day fat balance) and, for homozygous F508 mice and their wild type littermates in gallbladder bile. After the deconjugation of bile salts, bile salt profiles were determined by extracting the bile salts with commercially available Sep-Pak-C18 cartridges and converting them to their methylester/ trimethylsilyl derivatives.9 Bile salt profiles were analyzed by capillary gas chromatography. Hydrophobicity of bile salts in gallbladder bile was calculated using the Heuman index, corresponding to the ability of bile salts to solubilize lipids.10
administered dose per ml plasma (%dose/ml). Total plasma triglyceride concentrations were determined by using commercially available kits (Roche Diagnostics, Mannheim, Germany).
Bacterial load small intestine After sacrificing the mice, the small intestine was flushed with phosphate-buffered saline containing 10 mM dithiothreitol (DTT) as mucolytic agent. The eluant was centrifuged at 5000 rpm for 45 minutes to pellet bacteria. Bacterial genomic DNA was isolated using the Qiagen DNA stool kit. Quantitative polymerase-chain-reaction with a SYBR Green detection system (Bio-Rad MyIQ) was performed, using both group-specific and kingdom-specific primers.12,13 Kingdom-specific primers for 16S rDNA were used for the amplification of the total bacterial load, while group-specific primers were used for the quantification of each bacterial group. Each primer set was evaluated against reference bacterial strains for primer efficiency and specificity (Table 1).
Group Bac 338 Eubacteria Bac303 Bacteroides Erec E.rectale / C.coccoides Labnew Lactobacillus / Enterococcus Reference Strain E. Coli Primers UniF340-ACTCCTACGGGAGGCAGCAGT UniR514-ATTACCGCGGCTGCTGGC BactF285-GGTTCTGAGAGGAGGTCCC UniversalR338-GCTGCCTCCCGTAGGAGT UniversalF338-ACTCCTACGGGAGGCAGC CcocR491GCTTCTTAGTCAGGTACCGTCAT LABF362-AGCAGTAGGGAATCTTCCA LABR677-CACCGCTACACATGGAG Product length 175
Bacteroides fragilis (DSM 2151) Ruminococcus productus DSM 2950 Lactobaccillus acidophilus NIZO B228
75
139
315
Table 1. Bacterial-specific primers. 16S rDNA group-specific and kingdom-specific primers for quantitative polymerase-chain-reaction (12-13).
mRNA expression small intestine Total RNA was isolated from the whole small intestine with TriReagent (Sigma, St. Louis, MO), washed with a RNA clean-up kit (RNeasy MinElute Cleanup kit, Qiagen) and quantified using NanoDrop ND100 spectrophotometer (NanoDrop Technologies Inc. Wilmington, DE). Relative mRNA expression for mucin 2 was performed with 5 l cDNA. Primers for mucin 2 were kindly provided by dr. I. Renes and PCR was carried out as previously described.14 PCR products were loaded on a 1% agarose gel and electrophoresed in a 1x TAE buffer in the presence of ethidium bromide. GAPDH was used as an internal control. 64
Statistical analysis Statistical analysis was performed using SPSS 16.0 inc. (SPSS Inc., Chicago, IL). We calculated, with an anticipated coefficient of variation of 10%, a required sample size of 4 per group to demonstrate a 30% decrease in fat malabsorption compared to wild type animals. Differences between experimental and control groups were calculated using the Mann Whitney test. Data are reported as meansstandard deviation (standard error of the mean in figures) or as median (range) if data were not equally distributed. P-values below 0.05 were considered statistically significant. To exclude possible gender-related differences in treatment effect, we additionally performed a multiple regression analysis. Parameters for fat absorption, fecal bile salt excretion and weight were included as dependent variables, whereas genotype, treatment and gender were included as independent variables. Gender * treatment was included as dependent interaction variable. rESuLTS AB treatment improved body weight in CFTR knockout mice, but not in homozygous F508 mice. Table 2 shows the nutritional data of homozygous F508 mice (/), CFTR knockout mice (-/-) and their wild type littermates (+/+) after AB or control treatment. AB treatment did not improved body weight in / mice. Similarly to a previous study5, body weight increased in the male -/- mice compared to untreated controls (+24%, p=0.02). In the current work, there were not enough female -/- mice for this analysis. The multiple regression analysis showed that AB had a beneficial effect on body weight in the male mice of both genetic backgrounds irrespective of the CF phenotype (C57BL/6 mice: r2=0.7, p=0.02, FVB/129 mice: r2=0.9, p=0.01). Parameters for fat absorption and fecal bile salt excretion were not dependent on gender (Table 3).
Table 2. Mice characteristics. Nutritional data of homozygous F508 mice (/) (FVB/129 genetic background), CFTR knockout mice (-/-) (C57Bl/6/129 genetic background) and wild type littermates (+/+) after AB or control treatment. Except for body weight in the AB treated -/- mice, no differences were observed between the AB and control treated mice of the same genetic background (Mann-Whitney test). The ingested amount of AB was similar between all groups (Kruskal-Wallis test). Values are depicted as mean standard deviation. M: Metronidazole. C: Ciprofloxacine. * p < 0.05.
65
Table 3. Multiple regression analysis in CFTR knockout mice and WT littermates. B: unstandardized beta coefficient. R2: regression correlation coefficient. *statistically significantinteraction variable.
Table 4. Multiple regression analysis in homozygous F508 mice and WT littermates. B: unstandardized beta coefficient. R2: regression correlation coefficient. *statistically significant
66
AB treatment did not result in major improvements in fat absorption. In accordance with previous studies7, the total absorption of dietary fat was quantitatively similar in / mice and +/+ mice and did not increase by AB (Table 2). Total fat absorption was ~4% lower in the -/- mice in comparison to the +/+ mice, but did not improve after AB (Fig. 1A). Detailed analysis showed minor changes in the absorption of saturated fatty acids. In the / mice, AB increased the absorption of saturated fatty acids by ~4% (p=0.06) and by ~3% in the -/- mice (p=0.07) (Fig. 1B-C). In both CF mouse models, AB did not improve the absorption of unsaturated fatty acids (control treated / mice: 92%1% versus AB treated / mice: 93%1%, p=0.4 and control treated -/- mice: 99%1% versus AB treated -/- mice: 98%1%, p=0.6).
Figure 1. Fat absorption. Total fat absorption and absorption of the two major saturated fatty acids in: (AC) homozygous F508 mice (/), (D-E) CFTR knockout mice (-/-) and respective wild type littermates (+/+) after AB or control treatment. C16:0: palmitic acid. C18:0: stearic acid. Values are depicted as meanSEM. *p-value<0.05. **p-value<0.01.
AB treatment accelerated the absorption of fatty acids in homozygous F508 and wild type mice. Since / mice have a delayed fatty acid uptake7, we additionally assessed the effect of AB on the kinetics of fat absorption (Fig. 2). A trend towards higher uptake in the / mice after AB treatment was observed compared to +/+ mice. Interestingly, total plasma appearance (area under the curve) of 1-13C-palmitatic acid and 1-13C-stearic 67
acid was higher in AB-treated / and +/+ mice (p=0.04), compatible with an AB effect independent from the CF phenotype (Table 4). The ratio of 1-13C-palmitic acid / 1-13C-stearic acid was similar among groups for all time points, indicating that the accelerated absorption was attributable to LCFA uptake and not to accelerated lipolysis. Total plasma triglycerides were similar between groups (data not shown).
Figure 2. Fatty acid kinetics. 13 C-enrichment in plasma after an intragastric dosage of stable isotope labelled tri-1-13C-palmitin (A) and 1-13C-stearate (B) in AB treated homozygous F508 mice () and wild type littermates () or control treated homozygous F508 mice () and wild type littermates (). Data are expressed as the median percentage of the administered dose.
area under the curve 1-13C palmitic acid

antibiotics / +/+ 167 (91-242) 138 (128-198) p = 0.96 Control 82 (47-129) 94 (90-132) p = 0.29 p = 0.36 p = 0.08 p = 0.03 (AB vs control) Table 4. Area under the curve fatty acid kinetics. Area under the curve of 13C-enrichment in plasma after an intragastric dosage of stable isotope labelled tri-1-13C-palmitin (upper panel) and 1-13C-stearate (lower panel) in homozygous F508 mice (/) and wild type littermates (+/+) after AB or control treatment. Data are expressed as median values (range).
area under the curve 1-13C palmitic acid

antibiotics / +/+ 198 (145-158) 172 (134-200) p = 0.64 Control 111 (43-158) 122 (105-121) p = 0.63 p = 0.12 p = 0.29 p = 0.03 (AB vs control)
68
Homozygous F508 mice do not exhibit bacterial overgrowth of the small intestine. As previously reported, the -/- mice showed SIBO, and these bacteria were markedly reduced after AB (5) (data not shown). We analyzed whether the / mice also had SIBO. We found that the total bacterial load in the small intestine of the / and +/+ mice was similar and did not change after AB (Fig. 3). Since certain bacterial species can modulate bile acid metabolism and influence fat absorption15 and the bacterial composition might change after three weeks of oral AB, we additionally analyzed different subgroups of bacteria (Table 1). We did not find a change in bacterial composition in / nor in +/+ mice after AB. As previously reported in AB treated mice16, AB significantly increased cecum weight in / and +/+ mice (control: 29699 mg, AB: 489190 mg, p=0.03) and cecum length (control: 2.80.3 cm, AB: 3.60.7 cm, p=0.02) (Fig. 4).
Figure 3. Bacterial load small intestine. Number of copies of the bacterial load of the small intestine in homozygous F508 mice (/) and wild type littermates (+/+) after AB or control treatment. Categories bacterial groups: Bac338: total bacterial load (A), Labnew: Lactobacillus species (B), Bac303: Bacteroides species (C), Erec: E. Rectale and C.coccoides (D) (Table 1). Each box plot represents the median and the 25th and 50th centiles. The whiskers represent the lowest and the highest values of the bacterial load.
AB treatment tended to normalize bile salt composition in gallbladders of homozygous F508 mice. We analyzed the bile salts in gallbladder bile of the / and +/+ mice, to determine whether the accelerated absorption of fatty acids after AB might be due to an improved solubilization capacity of bile. In agreement with previous studies17, the contribution of the primary bile salt cholic acid (CA) in gallbladder bile was higher in 69
Figure 4. Colon. The colon of AB treated homozygous F508 mice (D) and wild type littermates (B) or control treated homozygous F508 mice (C) and wild type littermates (A).
the / mice (/: 68%3%, +/+: 44%1%, p=0.04) (Fig. 5). AB reduced the percent contribution of CA and increased the percent contribution of -muricholic acid, which resulted in a more hydrophilic bile salt composition in the AB treated / mice (Heuman index: -0.280.1 for AB treated versus -0.590.09 for control treated / mice, p=0.03). Since hydrophobic bile salts are more capable in solubilizing lipids than hydrophilic bile salts, the change in bile salt composition cannot explain the accelerated fatty acid uptake. AB treatment reduced fecal bile salt excretion in homozygous F508 and CFTR knockout mice. CF mice as well as CF patients have an increased fecal bile salt excretion (2, 18). AB reduced the fecal excretion of total bile salts in / and -/- mice, although the results were not statistically significant (-40% in both CF mouse models, p=0.06). In comparison to control, AB reduced the fecal excretion of CA by ~50% in / and -/mice (p = 0.04; Fig.6). In all AB-treated mice, the fecal excretion of the classic secondary bile salts deoxycholic acid and -muricholic acid reduced, but the fecal excretion of hyodeoxycholic acid increased.
Figure 5. Biliary bile salt composition. Biliary bile salt composition in the gallbladder of AB treated homozygous F508 mice () and wild type littermates () or control treated homozygous F508 mice () and wild type littermates (). Bile salts representing less than 2% of total bile salts are not depicted. CA: cholic acid. MCA: muricholic acid.
70

Figure 6. Fecal bile salt excretion. (A) Fecal bile salt excretion AB treated homozygous F508 mice () and wild type littermates () or control treated homozygous F508 mice () and wild type littermates (). (B) Fecal bile salt excretion AB treated CFTR knockout mice () and wild type littermates () or control treated CFTR knockout mice () and wild type littermates (). CA: cholic acid. MCA: muricholic acid. DCA: deoxycholic acid. HDCA: hyoxydeoxycholic acid. Values are depicted as meanSEM. *p-value<0.05, **p-value<0.01.
AB treatment reduced mRNA expression of Muc2 in the small intestine of homozygous F508 mice. A reduction in mRNA expression of mucin 2 was observed after AB treatment in / mice (AB treated: 0.510.06 versus 0.960.30 control treated, p=0.02, Fig. 7).
Figure 7. Muc2 mRNA expression small intestine. Muc2 expression of AB or control treated homozygous F508 mice and wild type littermates.
dISCuSSION It was previously shown, that AB treatment eradicates SIBO and increases body weight in the CFTR knockout mice.5 Our study adds that the positive effect of AB on body weight is not mediated by increasing the absorption of LCT. AB treatment of homozygous F508 mice, without SIBO, neither augmented body weight nor increased fat absorption. Collectively, the data indicate that the positive effect of AB on body weight of the CFTR knockout mice may involve the treatment of SIBO, but not via enhancing the absorption of LCT. 71
The improved nutritional status that was observed in the CFTR knockout mice could possibly be explained by other AB-related effects. Previously reported AB effects on the small intestine of CFTR knockout mouse (reduction in bacterial load, inflammation and mucus) can decrease the energy demand and thereby improve the nutritional status.19-21 Since these intestinal mucosal abnormalities may also (theoretically) impair the uptake of proteins and carbohydrates, we cannot exclude the possibility that the absorption of these macronutrients improved. However, we do not have indications that their absorption is suboptimal in CF mice. Durie et al. demonstrated that malabsorption of MCT is almost completely corrected after pancreatic enzyme replacement therapy in CF patients.22 Therefore, malabsorption of MCT is not likely to contribute to the fat malabsorption of the pancreatic sufficient CF mice in our study. Thus, a decrease in energy requirement is the most likely explanation for the improved body weight. To what extent the previous reported effects of AB on the intestine decreased the energy demand and whether these are inversely related to body weight remains to be evaluated. In veterinary medicine, several antibiotics are used as growth promoters, most likely mediated via suppression of gram positive intestinal bacteria.23 Interestingly, our multiple regression analysis revealed a gender-related growth effect of AB, but none of the other parameters (e.g. bacterial classes small intestine [data not shown] fat absorption, changes in fecal bile salts) were gender related and does not provide a mechanistic support for the observed effect. AB accelerated LCFA uptake in both homozygous F508 and wild type mice. It remains unclear what the mechanism is by which AB increased the plasma appearance of orally administered fat. Since AB did not alter the gallbladder bile salt composition in wild type mice or the major subclasses of bacteria in the small intestine, these factors probably do not contribute to changed fat absorption kinetics. Since accelerated fatty acid uptake was observed in both CF and wild type mice, it suggests an aspecific treatment effect on intestinal physiology, for example on intestinal transit time, on mucus composition, or on the unstirred water layer. It was previously shown that AB prolonged the small intestinal transit time in wild type mice.20 The authors of the study hypothesized that normal micro-flora might play an important role in the regulation of intestinal transit time.20 Since homozygous F508 mice have the same intestinal flora as wild types, it is possible that intestinal transit is also prolonged in these mice, enhancing intestinal fatty acid uptake. In addition, AB-induced bile flow is described with certain AB and should be considered as underlying mechanism.24 The biological significance for the changes in fatty acid kinetics remains to be determined. One could speculate that a reduced speed of fatty acid absorption indicates a more rate-limiting milieu in the small intestinal lumen, and a more gradual appearance of the dietary fat into the circulation. Whereas for carbohydrates the rate of appearance into the circulation has clear metabolic effects (slow and rapid carbohydrates), this is still rather unexplored for fat. In the homozygous delta F508 mice, the decreased rate of uptake is adequately compensated for by the absorption capacity of the small intestine resulting in a normal overall fat absorption. The compensatory capacity may be insufficient in CF patients where other 72
phenomena also contribute to fat malabsorption (e.g. impaired lipolysis by pancreatic insufficiency) or where a more overt fat malabsorption is present. This concept is especially interesting since AB treatment increased fat absorption by approximately 20% in premature (non-CF) infants with overt fat malabsorption.25 Future studies should be performed to develop a better understanding of the exact role of AB in the absorption kinetics and/or absorption of fat. AB treatment decreased fecal bile salt excretion in both CF mouse models. The present observation corresponds to a previous report in CF patients, where a seven-day treatment with metronidazole reduced fecal bile salt excretion by ~30% in three out of four CF patients.18 Some studies have suggested a possible inhibitory role of AB on bile salt synthesis in the liver26,27, which raises the question whether the decrease in fecal bile salts is not merely due to a reduced synthesis. Although we found a decrease in the percent contribution of CA in the bile of AB-treated homozygous F508 mice, this effect was not observed in wild types. Therefore, we consider it more likely that the decrease in biliary CA is explained by a reduced synthesis of CA secondary to increased intestinal absorption. That AB probably increased the intestinal absorption of bile salts is supported by a study of Eklund et al.28 The authors evaluated the fecal excretion of orally administered 24-[14C] CA after AB treatment in CF patients. Although not significant, fecal excretion of 24-[14C] CA was reduced after AB treatment, suggesting an improved enterohepatic circulation of bile salts. Although we did not perform histology on the small intestine, we found a reduced mRNA expression of Muc2, a structural component of the intestinal mucus layer, in accordance with previous studies in CFTR knockout mice.19 We consider it unlikely that intestinal transit time serves as an explanation for the observed changes in fecal bile salt excretion. The fecal excretion of CA in CFTR knockout mice reduced to the same extent as in the homozygous F508 mice, while, as previously indicated, AB did not change intestinal transit in the CFTR knockout.20 We found that the classic secondary bile salts, e.g. deoxycholic acid and -muricholic acid reduced in the AB treated animals. Interestingly, however, hyodeoxycholic acid (formed by 7-hydroxylation) increased. Since only certain strains of bacteria are capable of 7-hydroxylation, it seems reasonable to assume that this shift in secondary bile salt formation is due to AB induced changes in bacterial colonization in the colon.15 In conclusion, we showed that the growth-enhancing effect of AB treatment in CFTR knockout mice is not due to increased fat absorption. AB treatment accelerates fatty acid absorption in both homozygous F508 and wild type mice and partially corrects the increased fecal excretion of bile salts in both CF mouse models. The potential therapeutic AB effect on these parameters needs to be further explored, both in CF and in non-CF conditions. aCKNOWLEdGEMENTS We thank H. Jorna, T. Boer, I. Martini, R. Boverhof and SC Beijer-Liefers for their technical assistance in our study. 73
ChapTEr 4 aNTIBIOTICS aNd FaT aBSOrpTION 1. 2.
rEFErENCES
Sinaasappel M, Stern M, Littlewood J, Wolfe S, Steinkamp G, Heijerman HG, Robberecht E, Dring G 2002 Nutrition in patients with cystic fibrosis: a European Consensus. J Cyst Fibros 1:51-75
3.
Borowitz D, Durie PR, Clarke LL, Werlin SL, Taylor CJ, Semler J, De Lisle RC, Lewindon P, Lichtman SM, Sinaasappel M, Baker RD, Baker SS, Verkade HJ, Lowe ME, Stallings VA, Janghorbani M, Butler R, Heubi J 2005 Gastrointestinal outcomes and confounders in cystic fibrosis. J Pediatr Gastroenterol Nutr 41:273-285
4.
Saiman L, Anstead M, Mayer-Hamblett N, Lands LC, Kloster M, Hocevar-Trnka J, Goss CH, Rose LM, Burns JL, Marshall BC, Ratjen F 2010 Effect of azithromycin on pulmonary function in patients with cystic fibrosis uninfected with Pseudomonas aeruginosa: a randomized controlled trial. JAMA 303:1707-1715
5. 6. 7. 8. 9.
Saiman L, Marshall BC, Mayer-Hamblett N, Burns JL, Quittner AL, Cibene DA, Coquillette S, Fieberg AY, Accurso FJ, Campbell PW 2003 Azithromycin in patients with cystic fibrosis chronically infected with pseudomonas aeruginosa. JAMA 290:1749-1756 Rana SV, Bhardwa B 2008 Small intestinal bacterial overgrowth. Scand J Gastroenterol 43:1 43:1030-1037
Norkina O, Burnett TG, De Lisle RC 2004 Bacterial overgrowth in the cystic fibrosis transmembrane conductance regulator null mouse small intestine. Infect Immun 72:60406049 Bijvelds MJ, Bronsveld I, Havinga R, Sinaasappel M, de Jonge HR, Verkade HJ 2005 Fat absorption in cystic fibrosis mice is impeded by defective lipolysis and post-lipolytic events. Am J Physiol Gastrointest Liver Physiol 288:G646-G653 Setchell KD, Worthington J 1982 A rapid method for the quantitative extraction of bile acids and their conjugates from serum using commercially available reverse-phase octadecylsilane bonded silica cartridges. Clin Chim Acta 125:135-144 Heuman DM 1989 Quantitative estimation of the hydrophilic-hydrophobic balance of mixed bile salt solutions. J Lipid Res 30:719-730
Muskiet FA, van Doormaal JJ, Martini IA, Wolthers BG, van der Slik W 1983 Capillary gas chromatographic profiling of total long-chain fatty acids and cholesterol in biological materials. J Chromatogr 278:231-244
10. 11. 12.
13.
Millar JS, Cromley DA, McCoy MG, Rader DJ, Billheimer JT 2005 Determining hepatic triglyceride production in mice: comparison of poloxamer 407 with Triton WR-1339. J Lipid Res 46:2023-2028
Barman M, Unold D, Shifley K, Amir E, Hung K, Bos N, Salzman N 2008 Enteric salmonellosis disrupts the microbial ecology of the murine gastrointestinal tract. Infect Immun 76:907-915 van der Sluis M, Melis MH, Jonckheere N, Ducourouble MP, Bller HA, Renes I, Einerhand AW, Van Seuningen I 2004 The murine Muc2 mucin gene is transcriptionally regulated by the zinc-finger GATA-4 transcription factor in intestinal cells. Biochem Biophys Res Commun 325: 952-960 Salzman NH, de Jong H, Paterson Y, Harmsen HJ, Welling GW, Bos NA 2002 Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria. Microbiology 148:3651-3660
14.
74
15.
16.
18. 19. 20. 22. 21.
17.
Martin FPJ, Dumas ME, Wang Y, Legido-Quigley C, Yap IK, Tang H, Zirah S, Murphy GM, Cloarec O, Lindon JC, Sprenger N, Fay LB, Kochhar S, van Bladeren P, Holmes E, Nicholson JK 2007 A top-down systems biology view of microbiome mammalian metabolic interactions in a mouse model. Mol Syst Biol 112:1-16 OBrien S, Mulcahy H, Fenlon H, OBroin A, Casey M, Burke A, FitzGerald MX, Hegarty JE 1993 Intestinal bile acid malabsorption in cystic fibrosis. Gut 34:1137-1141
Savage DC, Dubos R 1968 Alterations in the mouse cecum and its flora produced by antibacterial drugs. J Exp Med 128:97-110
Strandvik B, Einarsson K, Lindblad A, Angelin B 1996 Bile acid kinetics and biliary lipid composition in cystic fibrosis. J Hepatology 25:43-48
De Lisle RC, Roach EA, Norkina O 2006 Eradication of small intestinal bacterial overgrowth in the cystic fibrosis mouse reduces mucus accumulation. J Pediatr Gastroenterol Nutr 42:4652 Durie PR, Newth CJ, Forstner GG, Gall DG 1980 Malabsorption of medium-chain triglycerides in infants with cystic fibrosis: Correction with pancreatic enzyme supplements. J Pediatr 96:862-64. De Lisle RC 2007 Altered transit and bacterial overgrowth in the cystic fibrosis mouse small intestine. Am J Physiol Gastrointest Liver Physiol 293:G104-G111
Norkina O, Kaur S, Ziemer D, De Lisle RC 2004 Inflammation of the cystic fibrosis mouse small intestine. Am J Physiol Gastrointest Liver Physiol 286:G1032-G1041
23. 25. 26. 27. 28.
24.
Somer P de, Eyssen H, Evrard E 1963 The influence of antibiotics on fecal fat in chicks In Frazer AC (ed) Biochemical problems of lipids. Elsevier. Amsterdam 84-90. Gonzlez J, Fernndez C, Mario E, Morales A, Jimnez R 1989 Biliary excretion and choleretic effect of cefmetazole in rats. Antimicrob Agents Chemother 33:1970-4. Verkade HJ, van Asselt WA, Vonk RJ, Bijleveld CM, Fernandes J, de Jong H, Fidler V, Okken A 1989 Fat absorption in premature infants: the effect of lard and antibiotics. Eur J Pediatr 149:126-129
Le Dafniet M, Pessayre D, Le Quernec L, Erlinger S 1981 Effects of troleandomycin administration on cholesterol 7 alpha-hydroxylase activity and bile secretion in rats J Pharmacol Exp Ther 219:558-562 Eklund A, Norman A, Strandvik B 1980 Excretion of bile acids in healthy children and children with cystic fibrosis. Scan J Clin Lab Invest 40:595-608
Toda T, Ohi K, Kudo T, Yoshida T, Ikarashi N, Ito K, Sugiyama K 2009 Ciprofloxacin suppresses Cyp3a in mouse liver by reducing lithocholic acid-producing intestinal flora. Drug Metab Pharmacokinet 24:201-208
75
ChapTEr 5
URSODEOXYCHOLIC ACID MODULATES BILE FLOW AND BILE SALT POOL INDEPENDENTLY OF THE CYSTIC FIBROSIS TRANSMEMBRANE REGULATORY GENE IN MICE
F.A.J.A. Bodewes1 M. Wouthuyzen-Bakker1 M. J. Bijvelds2 R. Havinga1 H.R. de Jonge2 H.J. Verkade1
Pediatric Gastroenterology, Department of Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands. 2 Laboratory of Gastroenterology & Hepatology, Erasmus University Medical Center Rotterdam, Rotterdam, The Netherlands.
1
Manuscript conditionally accepted in am J physiol Gastrointestinal Liver physiol
ChapTEr 5 urSOdEOXYChOLIC aCId
aBSTraCT Introduction. Cystic fibrosis liver disease (CFLD) is treated with ursodeoxycholate (UDCA). Our aim was to evaluate, in Cftr-/- mice and wild type controls, if the supposed therapeutic action of UDCA is mediated via choleretic activity or effects on bile salt metabolism. Material and methods. Cftr-/- mice and controls, under general anesthesia, were IV infused with TUDCA in increasing dosage or were fed either standard or UDCA enriched chow (0.5%wt/wt) for 3 weeks. Bile flow and bile composition were characterized. In chow fed mice, we analyzed bile salt synthesis and pool size of cholate (CA). Results. In both Cftr-/- and controls IV TUDCA stimulated bile flow by ~250% and dietary UDCA by ~500%, compared with untreated animals (p<0.05). In non-UDCA treated Cftr-/- mice, the proportion of CA in bile was higher compared to controls (614% vs. 464%, resp.; p<0.05), accompanied by an increased CA synthesis (161 vs. 102 mol/hour/100gramBW resp.; p<0.05) and CA pool size (283 vs. 191 mol/100gramBW, resp.; p<0.05). In both Cftr-/- and controls UDCA treatment drastically reduced the proportion of CA in bile below 5% and diminished CA synthesis (2.30.3 vs. 2.20.4 mol/hour/100gramBW, resp.; NS) and CA pool size (3.60.6 vs. 1.50.3 mol/100gramsBW, resp.; p<0.05). Conclusion. Acute TUDCA infusion and chronic UDCA treatment both stimulate bile flow in CF conditions independently from Cftr function. Chronic UDCA treatment reduces the hydrophobicity of the bile salt pool in Cftr-/- mice. These results support a potential beneficial effect of UDCA on bile flow and bile salt metabolism in CF conditions.
78
Shimokura et al. demonstrated in biliary cells that UDCA, in pharmacological concentrations, increased intracellular calcium and induced chloride efflux. These scientists speculated that UDCA increased bile flow by direct stimulation of ductular secretion, what could be of therapeutic benefit for patients with CF who have impaired cyclic AMP-dependent biliary secretion.36 However, Fiorotto et al. suggested that UDCA induced bile flow in a Cftr dependent manner.11 They showed that UDCA stimulated cholangiocytic fluid secretion in vitro in bile duct units and in isolated perfused livers from wild type, but not from Cftr knockout mice. UDCA induced a Cftr-dependent ATP release, which,by activating the purinergic signaling pathway, induced cholangiocyte secretion by stimulation of calcium-activated chloride channels. These in vitro and ex vivo observations clearly supported the concept that UDCA-induced fluid secretion is Cftr dependent and that, in CF conditions, UDCA induced cholangiocytic choleresis cant be achieved.
INTrOduCTION Cystic Fibrosis (CF) is caused by mutations in the Cystic Fibrosis Transmembrane conductance Regulator (Cftr) gene which result in dysfunction of the CFTR protein.7, 20 CFTR is a cAMP activated chloride channel and is present in the apical membrane of various epithelial and non-epithelial tissues.23, 24, 41 Cystic Fibrosis Liver Disease (CFLD) develops in ~5-10% of CF patients and is the second leading cause of mortality in CF patients.10, 25, 32 Absence of functional CFTR in biliary epithelium is thought to initiate abnormal secretin/cAMP-stimulated chloride and bicarbonate secretion, leading to decreased bile flow and bile duct plugging by thickened secretions. Secondary cholangiocyte and hepatocyte injury can ultimately lead to the development of cirrhosis.12 Treatment with ursodeoxycholate (UDCA) is applied for different cholangiopathies, including CFLD. Although routinely applied in CF patients with increased levels of liver function parameters in serum, the therapeutic action of UDCA in CF conditions remains unclear. It has been hypothesized that UDCA is beneficial by its choleretic activity and/ or its capacity to correct aberrant bile salt metabolism.18 Indeed, it has been shown that UDCA stimulates biliary secretion of bile acids in patients with primary biliary cirrhosis and primary sclerosing cholangitis.26, 27 However, there are only a few trials assessing the efficacy of UDCA for the treatment of CFLD and currently, there is insufficient evidence to justify the routine use of UDCA in CF.5
An alternative beneficial effect of UDCA in CF conditions could be related to changes in bile salt metabolism. It is known, that the size and composition of the bile salt pool is critical for adequate bile formation.15 In addition, a more hydrophobic bile salt composition is suggested to be toxic to the hepatobiliary tract and might contribute to the development of CFLD.1 Different effects are published on the influence of UDCA on bile salt metabolism. Frenkiel et al. reported that UDCA reduced the cholate pool size and cholate synthesis rate in patients with gallstones and decreased the hydrophobicity of bile (13). In contrast, Beuers et al. described that UDCA did not decrease the bile 79
We have reasoned that insights in the effects of UDCA on bile production, cholate biosynthesis rate and cholate pool size under controlled in vivo CF conditions have been lacking. In the present study we aimed to overcome this knowledge gap by exploiting recently developed techniques allowing the study of these parameters in small experimental animals.19, 35 We determined the effect of UDCA on bile flow and bile salt metabolism in Cftr knockout mice and wild type littermates during acute intravenous tauroursodeoxycholate (TUDCA) infusion and after chronic dietary administration of UDCA. This CF mouse model does not exhibit CF related gallbladder or liver abnormalities.34 The lack of hepatobiliary abnormalities allows us to exclusively investigate the action UDCA under complete Cftr null conditions, without the secondary interference of cholestasis on biliary parameters. MaTErIaL aNd METhOdS
salt pool size in patients with cholestatic liver disease.2 In UDCA treated patients with CFLD, duodenal bile became enriched with the conjugated species of UDCA (accounting for 12% to 3% of the total biliary bile salts), indicating an increased hydrophilic bile composition.9 Thus far, the effect of UDCA on bile salt metabolism under CF conditions has not been conclusive.
Experimental procedures To evaluate the effect of UDCA on bile production and bile composition, we used a mouse bile duct cannulation experimental model. This model provides the option to measure bile production over an extended period of time. The animals were placed in a temperature and humidity controlled incubator. Bile was collected after surgical ligation of the common bile duct and cannulation of the gallbladder using polyethylene tubing under intraperitoneal anesthesia with hypnorm (fentanyl/fluanisone 1 l/gBW) and diazepam (10 g/gram BW), as previously described.22 Bile secretions were collected in 15 minute fractions during the stepwise dose increase phase and in 10 minutes fraction 80
Animals and diets C57Bl/6;129 Cftr-/- tm1CAM mice and Cftr+/+tm1CAM littermates were bred and accommodated at the Animal Experimental Center of the Erasmus Medical Center in Rotterdam, The Netherlands. Southern blotting of tail-clip DNA was performed to verify the genotype of individual animals.34 In accordance with previous studies, the Cftr-/- mice did not exhibit CF liver or gallbladder abnormalities (data not shown). Mice were housed in a light-controlled (lights on 6 AM to 6 PM) and temperature-controlled (21oC) facility, and were allowed access to tap water and a semi-synthetic chow diet (SRM-A; Hope Farms BV Woerden, The Netherlands) from the time of weaning. All experiments were performed on female and male animals of 10-20 weeks of age. Group size varied per experiment from 5-9 animals per genotype. Experimental protocols were approved by the Ethical Committee for Animal Experiments of the Erasmus Medical Center.
Acute intravenous TUDCA administration We performed an acute bile salt infusion experiment to evaluate the dose-response effect of acute UDCA supplementation on bile flow and bile salt composition in Cftr/- and control mice. Acute TUDCA administration provides the possibility to measure the direct choleretic effects of bile salts without the possible interfering effects of adaptations to long-term bile salt administration. We infused taurine-conjugated UDCA (TUDCA) for our acute infusion experiment, to closely mimic the physiological condition in which bile salts are secreted into bile almost exclusively in conjugated form. An intravenous line was placed in the jugular vein and the gallbladder was cannulated. After equilibration of the bile flow for 5-10 minutes, spontaneous bile production was assessed for 30 minutes, i.e. without TUDCA infusion. Subsequently, TUDCA solution (43 mM dissolved in phosphate-buffered saline, pH 7.4) was administered using an IV pump.42 The TUDCA dosage was increased every 30 minutes in a stepwise manner (dosage steps 150, 300, 450 and 600 nmol/min). The maximal dosage was given for 60 minutes. During TUDCA infusion, bile was collected in 15 minute- fractions. Chronic dietary UDCA administration In CF patients, UDCA supplementation is given chronically via the enteral route.8 Analogous to the human situation, we evaluated the effect of chronic enteral (dietary) UDCA treatment in Cftr-/- and control mice compared to untreated animals. Mice were fed either a control diet consisting of standard chow or the same diet enriched with UDCA (0.5% wt/wt) for 3 weeks. After gallbladder cannulation, spontaneous bile production was determined by bile collection for 30 minutes. We additionally determined cholate synthesis and pool size, using a previously developed and validated stable isotope dilution technique.19 In short, 3.0 mg of [2H4]-cholate in a solution of 0.5% NaHCO3 in phosphate-buffered saline was slowly injected via the penile vein during isoflurane anesthesia. Blood samples were taken before injection and at 12, 24, 36, 48, 60, and 72 h after injection. Blood samples (100 l) were collected by tail bleeding. Blood was collected in EDTA tubes and centrifuged to obtain plasma. After centrifuging (3,000 rpm for 10 min at 4C), plasma was stored at 20C until analysis. At the last day of the experiment (72 h), mice were anesthetized and equipped with a catheter in the bile duct as described above. Subsequently, bile was collected for 30 min, after an initial equilibration period of 5-10 min. Animals were euthanized by heart puncture. Analytic procedures Biliary bile salt concentrations were determined by an enzymatic fluorimetric assay.29 Biliary bile salt composition was determined by capillary gas chromatography.21 The hydrophobicity of bile salts in bile was calculated according to the Heuman index based on the fractional contribution of the major murine bile salt species cholate, 81
at the highest dose (600 nmol.min-1) for 60 minutes. Bile samples were used for bile salt composition analysis. Bile flow rate was assessed gravimetrically, assuming a density of 1g/ml.
chenodeoxycholate, deoxycholate, ursodeoxcholate, -muricholate and -muricholate.14 Plasma and bile samples were prepared for GLC-MS analysis on a Finnigan SSQ7000 Quadrupole GC-MS machine as described previously by Stellaard et al.39 Shortly, enrichment of 2H4-cholate in plasma was determined as the increase of the M4-/M0cholate, relative to baseline measurements and was expressed as the natural logarithm of atom percent excess (ln APE). From the decay curve of ln APE (calculated by linear regression analysis), daily fractional turnover rate (FTR; equals the slope of the regression line) and pool size ([administered amount of label x isotopic purity x 100] / intercept of the y-axis of the ln APE curve) of cholate were calculated. Subsequently, cholate synthesis rate was calculated by multiplying pool size and FTR.19 Statistical analysis Statistical analysis was performed using SPSS version 16.0 for Windows (SPSS Inc., Chicago, IL). All results are reported as meansSEM. Differences between genotypes or diet groups were evaluated using the Mann-Whitney U test. The level of significance was set at a P value of less than 0.05.
TUDCA administration increased bile flow equally in Cftr-/- and control mice in a dosedependent manner. Infusions with TUDCA increased bile flow to a similar extend in Cftr/- mice and controls (+ ~250%; Fig. 1A). The results indicate that TUDCA is capable of generating a bile salt induced bile flow independent of the expression of CFTR. The biliary bile salt concentration increased in parallel to the infused bile salt dosage (Fig. 1B). The bile salt secretion rates, i.e. the product of flow (panel 1A) and concentration (panel 1B), increased in equal pace with an increased TUDCA IV dosage and was not different between Cftr-/- and control mice (Fig. 1C). To determine the choleretic capacity of TUDCA in both Cftr-/- and control mice we related the bile flow to the bile salt secretion rate (Fig. 1D.) The choleretic capacity of TUDCA was similar in Cftr/- and control mice, as was the estimated bile salt dependent bile flow, based on the Y-intercepts (4.6 vs. 5.3 l/min/100gram BW, respectively, NS). The increase in bile flow was linearly related to the bile salt output (control: R2 0.9, slope 0.003 mol/nmol; Cftr/- R2 0.9, slope 0.003 mol/nmol). 82
rESuLTS The physiological state of the enterohepatic circulation in Cftr-/- mice. We evaluated bile production during the first 30 min after acute interruption of the enterohepatic circulation, i.e. closely reflecting the physiological state (represented by time points 15 and 30 minutes in Fig. 1A-C). We found that bile flow (4.50.6 vs. 4.00.4 l/ min/100gram BW, NS), biliary bile salt concentration (6712 vs. 545 mM, NS) and biliary bile salt output (31372 vs. 20825 nmol/min/100gram BW, NS) were similar in Cftr-/- and control mice respectively, indicating no quantitative differences in the choleretic capacity between Cftr-/- mice and their controls at baseline.
Figure 1. Biliary parameters during acute intravenous TUDCA administration. Biliary bile flow (A), bile salt concentration (B), bile salt secretion rate (C) and relationship between bile salt secretion rate and bile flow (D) in Cftr knockout mice (Cftr-/-) and control littermates (Cftr+/+) during acute intravenous infusion with TUDCA. The dosage of TUDCA was increased at indicated intervals. The grey symbols in Fig. D represent baseline values without TUDCA infusion. Data are presented as means SEM of N=5 mice per group.
UDCA treatment increased bile flow equally in Cftr-/- and control mice. Chronic UDCA treatment for 3 weeks increased bile flow with ~500% when compared to untreated mice (p<0.05). This increase was comparable for Cftr-/- and control mice (29.02.6 vs. 31.01.9 l/min/100gram BW, resp.; NS; Fig. 2A). Chronic UDCA treatment decreased the total biliary bile salt concentration in both genotypes, but to a lower extent in Cftr-/mice, resulting in significantly higher BS concentration (423 vs. 263 mM in controls; resp., p<0.05, Fig. 2B). The bile salt output was significantly higher in Cftr-/- mice compared with controls during chronic UDCA treatment (Cftr-/-, 1232147 vs. control, 827113 mol/min/100gram BW, resp.; p<0.05, Fig. 2C). Increased hydrophobic bile salt composition of Cftr-/- mice compared to control mice. In non-UDCA treated Cftr-/- mice, the fractional biliary cholate content was higher compared with control mice (61.41.5% vs. 46.53.8%, resp.; p<0.05; Table 1.) The natural biliary UDCA enrichment was ~50% lower in Cftr-/- mice compared with controls (2.70.4 vs. 6.00.5% resp.; p<0.05; Fig. 2A). In non UDCA treated mice -muricholate is the major hydrophilic bile salt in bile of Cftr-/- mice and of controls (423,2 vs. 331,6% resp.; NS). Based on the fractional contribution of the bile salt we 83
Figure 2. Biliary parameters after chronic dietary UDCA administration. Biliary bile flow (A), bile salt secretion (B) and bile salt secretion rate (C) in Cftr knockout mice (Cftr-/-) and control littermates (Cftr+/+) after a normal or 0.5%-UDCA chow diet for 3 weeks. Data are presented as means SEM of N=5-6 mice per group. *P-value<0.05.
calculated the biliary hydrophobicity index, according to Heuman et al (14). The bile salt composition of non-UDCA treated Cftr-/- mice was significantly more hydrophobic than the control mice (0.050.002 vs. -0.070.005 resp.; p<0.01; Fig. 3B).
Non-UDCA treatment Cftr+/+ % Cftr-/% 61.5 1.5* 2.1 0.3 0.7 0.4 2.7 0.4* 0.0 33.0 1.6 UDCA treatment Cftr+/+ % 0.0# 2.7 0.9
# #
Cftr-/4.0 1.3# 82.0 1.9# 2.5 0.3# 8.7 1.6# 1.3 0.2* 0.0# %
C
CDC DC UDCA -M -M
46.5 3.8 3.4 0.4 1.7 0.4 6.0 0.5 0.0 42.0 3.2
2.8 0.5
83.0 2.7 3.3 0.3
N = 5-6 mice per group Means SEM MannWhitney U test * P<0.05 difference between genotype (Cftr+/+ vs. Cftr-/-) # P<0.05 difference between treatment group (non-UDCA vs. UDCA)
6.5 1.8#
Table 1. Biliary bile salt profile. Biliary bile salt composition of the major bile salt species (cholate, chenodeoxycholate, deoxycholate, urso-deoxycholate, -muricholate and -muricholate) in Cftr knockout mice (Cftr-/-) and control littermates (Cftr+/+) after a normal or 0.5%UDCA chow diet for 3 weeks. N= 4-6 mice per group, means SEM, *P<0.05 difference between genotype (Cftr+/+ vs. Cftr-/-) and #P<0.05 difference between treatment group (non-UDCA vs. UDCA).
UDCA treatment decreased the biliary hydrophobicity of Cftr-/- mice. After UDCA treatment, the biliary bile salt composition changes extensively (Table 1.) After treatment the bile salt composition consisted for more than ~80% of UDCA in both Cftr84
/- mice and controls (Figure 3A). UDCA treatment drastically reduced the fraction of cholate in the bile to below 5% in both Cftr-/- mice and controls. However, the fraction of -muricholate was also reduced in Cftr-/- and controls mice compared to the untreated animals (6.51.8 vs. 8.71.6% resp.; NS) Taken together, UDCA treatment decreased the bile salt hydrophobicity index of Cftr-/- mice to wild type levels (-0.080.003 vs. -0.080.002 resp.; NS; Fig. 3B).
Figure 3. Bile salt composition after chronic dietary UDCA administration. (A) Percent contribution of the bile salts cholate, ursodeoxcholate and others (chenodeoxycholate, deoxycholate, -muri cholate and -muricholate) in bile Cftr knockout mice (Cftr-/-) and control littermates (Cftr+/+) after a normal or 0.5%UDCA chow diet for 3 weeks. (B) Heuman index of total bile salts in bile representing the hydrophobicity of bile salts. Data are presented as means SEM of 4-9 mice per group. *P-value<0.05.
UDCA treatment decreased cholate synthesis and pool size in Cftr-/- and control mice. Non-UDCA treated Cftr-/- mice had a higher cholate synthesis rate (161 vs. 102 mol/hour/100 gram BW resp.; p<0.05) and larger cholate pool size (283 vs. 191 mol/100 gram BW, resp.; p<0.05) compared to controls (Fig. 4). Chronic UDCA treatment reduced the cholate pool size by ~90% in both Cftr-/- and control mice (p<0.05). Nevertheless, the pool size of Cftr-/- mice remained higher compared with controls (3.60.6 vs. 1.50.3 mol/100 grams BW, resp.; p<0.05). UDCA treatment decreased the cholate synthesis rate by ~85% in both Cftr-/- mice and controls compared to untreated mice (p<0.05; Fig. 4B). Interestingly, UDCA treatment straightened out the difference in synthesis rate between Cftr-/- and control mice (2.30.3 vs. 2.20.4 mol/hour/100 gram BW, resp.; NS).
85
Figure 4. Cholate pool size and cholate synthesis after chronic dietary UDCA administration. Cftr knockout mice (Cftr-/-) and control littermates (Cftr+/+) were intravenously injected with 2H4-cholate after a normal or 0.5%-UDCA chow diet for 3 weeks Enrichment of the administered 2H4-cholate was determined in plasma until 72 hours after the administered label. From the plasma decay curve, cholate pool size (A) and cholate synthesis rate (B) were calculated, as detailed in the Materials and Methods. Data are presented as means SEM of 4-6 mice per group. *P-value<0.05.
Figure 5. Schematic representation of Cftr dependent effects of UDCA treatment on bile salt kinetics. Schematic representation of the enterohepatic circulation of the primary bile salt cholate in Cftr knockout mice (Cftr-/-) and control littermates, either untreated (top) or treated for 3 weeks with a 0.5%-UDCA chow diet for 3 weeks. Cholate undergoes enterohepatic cycling (dotted lines). In the liver bile salts are excreted via the bile into the intestine and almost completely reabsorbed at the level of the terminal ileum. Under steady state conditions the fecal cholate loss is compensated for by de novo cholate synthesis of the liver, maintaining the total cholate poolsize in equilibrium (represented by black arrows). The diameters of the gray circles represent the magnitude of the pool size (mol/100 gram BW) and the size of the black arrows represent the magnitude of the synthesis rate (mol/hour/100 gram BW ). Cholate synthesis rate and pool size are determined as detailed in the Materials and Methods. Data are presented as means SEM of 4-6 mice per group.
86
Our present in vivo results are in contrast with in vitro and ex vivo studies, which report on the interaction between Cftr and bile salt stimulated biliary secretion.11, 36 In these studies, an important role is ascribed to the function of calcium induced chloride channels in UDCA stimulated bile flow, through the induction of purinergic signaling via Cftr dependent ATP release. There can be several possibilities underlying the divergence of our in vivo results from the in vitro and ex vivo reported studies. First, the choleretic effect found in our in vivo studies probably predominantly reflects an osmotic, bile salt induced canalicular bile flow, rather than a major ductular bile flow. The canalicular bile flow may thereby predominate the Cftr dependent secretion effect of UDCA at the level of the cholangiocytes. Second, the activation of Cftr independent routes may differ between the in vitro and in vivo conditions. In vivo, UDCA may stimulate hepatocytes to secrete ATP into bile in a CFTR-independent manner and subsequently induce bicarbonate secretion via paracrine purinergic pathways linked to calcium-activated chloride channels (CaCC) in the cholangiocytes.30 CaCCs have been suggested to play a more prominent role in epithelial fluid secretion in mice than in other species, including pigs.6 This might therefore explain the relatively mild phenotype in CF mouse models.28 Recently, Beuers et al. postulated the bicarbonate umbrella hypothesis, by suggesting that biliary bicarbonate secretion in humans serves to maintain an alkaline pH near the apical surface of hepatocytes and cholangiocytes in order to prevent the uncontrolled membrane permeation of protonated glycine-conjugated bile.3 In this concept, the bile acid receptor TGR5 (GPBAR-1), localized on the tip of the cilia of apical cholangiocyte membranes in mice and humans could trigger a Cftr independent signaling cascade resulting in cholangiocyte secretion. Notwithstanding the observed similarities between CF and control mice during acute or chronic UDCA administration, a CF biliary phenotype consistently became apparent: an increased bile salt secretion rate (Figure 1C, trend BSSR higher in Cftr-/- compared to controls with minimal P values at 4th and 7th time point of P=0.06 and Fig. 2C, p<0.05). The underlying mechanism of this paradoxical feature is unknown but seems related to an increased biliary BS concentration in CF mice. It therefore seems logical to assume 87
dISCuSSION The major physiologic effect of UDCA is its capacity to increase bile flow. This property supports the therapeutic use of UDCA in a variety of cholangiopathies, including CFLD.33 In vitro and ex vivo studies indicated that the stimulatory of UDCA on cholangiocyte secretion depends on the presence of CFTR.11, 36 In the present study, we demonstrated that UDCA, in vivo, either during acute or chronic administration, induced a significant Cftr independent increase of bile flow in mice. Therefore, our results indicate that a positive choleretic effect of UDCA can also to be expected in CF conditions. UDCA treatment reduced the relative hydrophobic biliary bile salt composition in Cftr-/- mice by replacing the high percent contribution of the bile salt cholate by UDCA and by the quantitative reduction of the cholate pool size. These properties could contribute to the assumed beneficial effects of UDCA in CFLD.
Although differences exist in bile salt metabolism between mice and man17, we found clear similarities between CF patients and Cftr-/- mice in bile composition. Untreated Cftr-/- mice (i.e. without UDCA treatment) have a more hydrophobic bile salt pool composition and an increased cholate synthesis rate and pool size compared to control mice. Similar results have been found in CF patients: Strandvik et al. reported an increased proportion of primary bile salts in serum and bile of CF, which has been attributed to an enhanced bile salt biosynthesis in response to increased fecal bile salt disposal.40 The Cftr-/- mice used in the present study are therefore comparable to human CF patients in this respect. The relatively hydrophobic bile salt composition in CF has been implied in the development of liver disease in CF conditions, but definitive proof for this concept is (still) lacking.38 Nevertheless, chronic UDCA treatment is apparently capable to partially correct the hydrophobic bile salt profile in CF mice. We investigated the effect of UDCA under CF conditions in the absence of CF-related liver disease (CLFD). The advantage of this approach is the ability to exclusively examine UDCA effects on several bile salt parameters during CFTR deficient conditions, without possible interference of secondary changes due to liver disease. The major induction of bile flow and alterations in bile salt composition could contribute to a preventive role of UDCA on the development of CLFD. It is unclear whether effects on bile flow and bile salt composition can be found under conditions of CFLD. Nakagawa et. al. evaluated duodenal bile salt composition after a two month UDCA-treatment in nine CF patients with CFLD.31 Similar to our results, the percent contribution of UDCA increased, resulting in a more hydrophilic bile salt pool. The contribution of UDCA was not as high as in our study (25%, compared with ~80% in the present study), possibly due to the relatively low dosage of UDCA that was used (10-15 mg/kg/BW/day). In patients with primary sclerosing cholangitis UDCA treatment dosage of 25-30 mg/kg/day resulted in UDCA comprising 74% or the bile salt pool, with a corresponding cholate reduction from 29% to 6%.37 In addition, a reduction in cholate pool size and cholate synthesis is also described in gallstone patients treated with 750 mg UDCA.16 Therefore, regarding the effect of UDCA on bile composition, we have no indication that the observed effects 88
that the total amount of bile salts in the enterohepatic circulation is increased in CF mice. Indeed, this explanation seems to be supported by the ~50% higher cholate pool size in CF mice fed a normal diet (Figure 5). During bile salt treatment, however, CF and control mice were administered the same, supraphysiological dosages of TUDCA and UDCA in the acute and chronic experiment, respectively. We previously reported an increased fecal loss of bile salts in the Cftr-/- mice.4 Therefore, our results suggest a different bile salt kinetic steady state in CF mice, in which overcompensation of bile salt synthesis results in an enlargement of the bile salt pool. Since the higher bile salt secretion rate in CF mice was seen most prominently during chronic treatment, we speculate that CFTR is involved in adaptation of the enterohepatic circulation to chronic bile salt treatment, either at the level of the intestine, of the liver, or both.
will be absent during CF-related cholestasis or other signs of CFLD.
In conclusion, our results in mice in vivo indicate that UDCA exerts a choleretic effect and influences the bile salt profile and synthesis, independent of the presence of functional CFTR. When extrapolated to the human situation, this might imply that UDCA treatment results both in CF and in non-CF individuals in increased choleresis, reduced bile salt synthesis and a more hydrophilic bile salt pool. The outcome of this study therefore provides a firm experimental basis to explain the beneficial effects of UDCA observed in CF patients.
1. 2. 3. 4.
rEFErENCES
Benedetti A, Alvaro D, Bassotti C, Gigliozzi A, Ferretti G, La Rosa T, Di Sario A, Baiocchi L and Jezequel AM. Cytotoxicity of bile salts against biliary epithelium: a study in isolated bile ductule fragments and isolated perfused rat liver. Hepatology 26: 1: 9-21, 1997. Beuers U, Spengler U, Zwiebel FM, Pauletzki J, Fischer S and Paumgartner G. Effect of ursodeoxycholic acid on the kinetics of the major hydrophobic bile acids in health and in chronic cholestatic liver disease. Hepatology 15: 4: 603-608, 1992. Beuers U, Hohenester S, de Buy Wenniger LJM, Kremer AE, Jansen PLM and Elferink RPJO. The biliary HCO3? umbrella: A unifying hypothesis on pathogenetic and therapeutic aspects of fibrosing cholangiopathies. Hepatology 52: 4: 1489-1496, 2010.
5. 6. 7. 8. 9. 10.
Bijvelds MJC, Bronsveld I, Havinga R, Sinaasappel M, de Jonge HR and Verkade HJ. Fat absorption in cystic fibrosis mice is impeded by defective lipolysis and post-lipolytic events. 288: 4: G646-G653, 2005. Clarke LL, Grubb BR, Yankaskas JR, Cotton CU, McKenzie A and Boucher RC. Relationship of a non-cystic fibrosis transmembrane conductance regulator-mediated chloride conductance to organ-level disease in Cftr(-/-) mice. Proc.Natl.Acad.Sci.U.S.A. 91: 2: 479-483, 1994. Colombo C, Setchell KDR, Podda M, Crosignani A and Roda A. Effects of ursodeoxycholic acid therapy for liver disease associated with cystic fibrosis*. J.Pediatr. 117: 3: 482-489, 1990. Colombo C, Setchell KDR, Podda M, Crosignani A and Roda A. Effects of ursodeoxycholic acid therapy for liver disease associated with cystic fibrosis*. J.Pediatr. 117: 3: 482-489, 1990.
Cheng K, Ashby D and Smyth R. Ursodeoxycholic acid for cystic fibrosis-related liver disease. Cochrane Database Syst.Rev. 2: CD000222, 2000. Collins FS. Cystic fibrosis: molecular biology and therapeutic implications. Science 256: 774779, 1992. Colombo C, Battezzati PM, Crosignani A, Morabito A, Costantini D, Padoan R and Giunta A. Liver disease in cystic fibrosis: A prospective study on incidence, risk factors, and outcome. Hepatology 36: 6: 1374-1382, 2002.
11.
Fiorotto R, Spirli C, Fabris L, Cadamuro M, Okolicsanyi L and Strazzabosco M. Ursodeoxycholic acid stimulates cholangiocyte fluid secretion in mice via CFTR-dependent ATP secretion. Gastroenterology 133: 1603-1613, 2007.
89
12. 13. 14. 15. 17. 16. 18. 19. 20. 21. 22. 23.
Fitz JG, Basavappa S, McGill J, Melhus O and Cohn JA. Regulation of membrane chloride currents in rat bile duct epithelial cells. J.Clin.Invest. 91: 319-328, 1993.
Frenkiel PG, Lee D, Cohen H, Gilmore C, Resser K, Bonorris G, Marks J and Schoenfield L. The effect of diet on bile acid kinetics and biliary lipid secretion in gallstone patients treated with ursodeoxycholic acid. Am.J.Clin.Nutr. 43: 2: 239, 1986. Hofmann AF. Chemistry and enterohepatic circulation of bile acids. Hepatology 4: S2: 4S-14S, 1984. Hofmann AF. Biliary secretion and excretion in health and disease: current concepts. Ann. Hepatol. 6: 15-27, 2007.
Hofmann AF. Medical treatment of cholesterol gallstones by bile desaturating agents. Hepatology 4: S2: 199S-208S, 1984.
Heuman D, Hylemon P and Vlahcevic Z. Regulation of bile acid synthesis. III. Correlation between biliary bile salt hydrophobicity index and the activities of enzymes regulating cholesterol and bile acid synthesis in the rat. J.Lipid Res. 30: 8: 1161, 1989.
Hofmann AF, Hagey LR and Krasowski MD. Bile salts of vertebrates: structural variation and possible evolutionary significance. J.Lipid Res. 51: 2: 226, 2010.
Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, Tanaka H, Mierau I, Sauer PJJ and Kuipers F. Measurement of parameters of cholic acid kinetics in plasma using a microscale stable isotope dilution technique: application to rodents and humans. J.Lipid Res. 42: 11: 1923, 2001. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon LB, Stellaard F, Shan B, Schwarz M and Kuipers F. Enterohepatic circulation of bile salts in FXR-deficient mice: Efficient intestinal bile salt absorption in the absence of ileal bile acid-binding protein (Ibabp). J.Biol.Chem. 278: 43: 41930-41937, 2003.
Kerem B, Rommens JM, Buchanan JA, Markiewicz D, Cox TK, Chakravarti A, Buchwald M and Tsui LC. Identification of the cystic fibrosis gene: genetic analysis. Science 245: 1073-1080, 1989. Kuipers F, Van Ree J, Hofker MH, Wolters H, Veld G, Havinga R, Vonk RJ, Princen H and Havekes LM. Altered lipid metabolism in apolipoprotein Edeficient mice does not affect cholesterol balance across the liver. Hepatology 24: 1: 241-247, 1996. Li H, Ganta S and Fong P. Altered ion transport by thyroid epithelia from CFTR/ pigs suggests mechanisms for hypothyroidism in cystic fibrosis. Exp.Physiol. 95: 12: 1132-1144, 2010.
24. 25. 26.
Lamhonwah AM, Bear CE, Huan LJ, Chiaw PK, Ackerley CA and Tein I. Cystic fibrosis transmembrane conductance regulator in human muscle: Dysfunction causes abnormal metabolic recovery in exercise. Ann.Neurol. 67: 6: 802-808, 2010.
Lindblad A, Hultcrantz R and Strandvik B. Bile-duct destruction and collagen deposition: a prominent ultrastructural feature of the liver in cystic fibrosis. Hepatology 16: 2: 372-381, 1992. Lindor K, Jorgensen R, Anderson M, Gores G, Hofmann A and LaRusso N. Ursodeoxycholic acid and methotrexate for primary sclerosing cholangitis: a pilot study. Am.J.Gastroenterol. 91: 3: 511-515, 1996.
90
28. 29.
27.
Lindor K, Therneau T, Jorgensen R, Malinchoc M and Dickson E. Effects of ursodeoxycholic acid on survival in patients with primary biliary cirrhosis. Gastroenterology 110: 5: 15151518, 1996. Liu X, Luo M, Zhang L, Ding W, Yan Z and Engelhardt JF. Bioelectric properties of chloride channels in human, pig, ferret, and mouse airway epithelia. 36: 3: 313, 2007. Mashige F, Imai K and Osuga T. A simple and sensitive assay of total serum bile acids. Clin. Chim.Acta 70: 79-86, 1976. Nakagawa M, Colombo C and Setchell KDR. Comprehensive study of the biliary bile acid composition of patients with cystic fibrosis and associated liver disease before and after UDCA administration. Hepatology 12: 2: 322-334, 1990. Minagawa N, Nagata J, Shibao K, Masyuk AI, Gomes DA, Rodrigues MA, Lesage G, Akiba Y, Kaunitz JD and Ehrlich BE. Cyclic AMP regulates bicarbonate secretion in cholangiocytes through release of ATP into bile. Gastroenterology 133: 5: 1592-1602, 2007. Nash KL, Allison ME, McKeon D, Lomas DJ, Haworth CS, Bilton D and Alexander GJ. A single centre experience of liver disease in adults with cystic fibrosis 1995-2006. J.Cyst.Fibros. 7: 252-257, 2008. Paumgartner G and Beuers U. Ursodeoxycholic acid in cholestatic liver disease: mechanisms of action and therapeutic use revisited. Hepatology 36: 3: 525-531, 2002. Ratcliff R, Evans MJ, Cuthbert AW, MacVinish LJ, Foster D, Anderson JR and Colledge WH. Production of a severe cystic fibrosis mutation in mice by gene targeting. Nat.Genet. 4: 35-41, 1993. Scholte BJ, Davidson DJ, Wilke M and de Jonge HR. Animal models of cystic fibrosis. J.Cyst. Fibros. 3 Suppl 2: 183-190, 2004. Sinakos E, Marschall HU, Kowdley KV, Befeler A, Keach J and Lindor K. Bile acid changes after high-dose ursodeoxycholic acid treatment in primary sclerosing cholangitis: Relation to disease progression. Hepatology 52: 1: 197-203, 2010. Smith JL, Lewindon PJ, Hoskins AC, Pereira TN, Setchell KDR, OConnell NC, Shepherd RW and Ramm GA. Endogenous ursodeoxycholic acid and cholic acid in liver disease due to cystic fibrosis. Hepatology 39: 6: 1673-1682, 2004.
30. 31. 32.
33. 34. 35. 36. 37. 38. 39. 40. 41.
Shimokura GH, McGill JM, Schlenker T and Fitz JG. Ursodeoxycholate increases cytosolic calcium concentration and activates Cl- currents in a biliary cell line. Gastroenterology 109: 965-972, 1995.
42.
Stutts MJ, Canessa CM, Olsen JC, Hamrick M, Cohn JA, Rossier BC and Boucher RC. CFTR as a cAMP-dependent regulator of sodium channels. Science 269: 847-850, 1995.
39. Stellaard F, Langelaar S, Kok R and Jakobs C. Determination of plasma bile acids by capillary gas-liquid chromatography-electron capture negative chemical ionization mass fragmentography. J.Lipid Res. 30: 10: 1647, 1989.
Verkade HJ, Havinga R, Shields DJ, Wolters H, Bloks VW, Kuipers F, Vance DE and Agellon LB. The phosphatidylethanolamine N-methyltransferase pathway is quantitatively not essential for biliary phosphatidylcholine secretion. J.Lipid Res. 48: 2058-2064, 2007.
Strandvik B, Einarsson K, Lindblad A and Angelin B. Bile acid kinetics and biliary lipid composition in cystic fibrosis. J.Hepatol. 25: 1: 43-48, 1996.
91
ChapTEr 6
CALCIUM INDUCED ANION SECRETION IN GALLBLADDER EPITHELIUM OF PIGS AND MICE WITH CYSTIC FIBROSIS
Marjan Wouthuyzen-Bakker1 Jeng-Haur Chen2 Alice Bot3 Sarah E. Ernst2 Henkjan J. Verkade1 Hugo R. de Jonge4
1Department of Pediatrics, Pediatric Gastroenterology, Beatrix Childrens Hospital - University Medical Center Groningen, The Netherlands 2Department of Internal Medicine, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, Iowa City 3Department of Biochemistry, 4Laboratory of Gastroenterology & Hepatology, Erasmus Medical Center Rotterdam, The Netherlands.
Submitted
ChapTEr 6 CaLCIuM aCTIVaTEd ChLOrIdE ChaNNELS
aBSTraCT The severity of the cystic fibrosis (CF) phenotype is species dependent, as exemplified by the CF lung and gallbladder pathophysiology (severe in pigs, nearly absent in mice). Mouse-human differences in the activity of compensatory chloride channels, in particular calcium-activated chloride channels (CaCCs), may explain why CF mice do not develop human-like CF lung disease. To investigate whether similar differences in CaCC activity could contribute to the mouse-pig difference in CF gallbladder pathology, we performed Ussing chamber measurements of trans-epithelial currents in gallbladders from CF pigs and CF mice (CFTR-homozygous F508 [/], CFTR-knockout [-/-]) and respective wild type (WT) controls. CFTR- and CaCC-dependent anion secretion was assessed by stimulation with the cAMP agonist forskolin and the muscarinic agonist carbachol respectively. Expression of the CaCC TMEM16A was determined by QRTPCR and immunohistochemistry. The forskolin-induced current was quantitatively similar in WT pigs and WT mice, and reduced in the CF gallbladders. In contrast, the carbachol-induced anion secretion was considerably lower in WT pigs compared with WT mice (1512 vs 11633 Amp/cm2, resp., p<0.05). While the carbachol-induced anion secretion was further increased in the CF condition, the carbachol-induced anion secretion in CF pigs remained strongly reduced in comparison with WT pigs. TMEM16A immunostaining was positive for all species, but differed in intensity (mouse@ human>pig). The ~45% decrease in total (forskolin+carbachol) induced anion secretion in CF pigs was accompanied by a 60-90% reduction in mRNA expression of TMEM16A (p<0.05). Conclusion: the absence of a morphological gallbladder phenotype in CF mice corresponds with a prominent capacity for calcium-induced anion secretion. Our data strengthen the basis for exploiting pharmacological activation of CaCCs as a therapeutic strategy to prevent or mitigate the CF phenotype.
94
Interestingly, CF animal models differ rather dramatically in the severity of the CF phenotype. Disruption of CFTR results in a relatively mild phenotype in the lung, liver, and gallbladder of mice, but in a very severe CF phenotype in pigs and, at least in the airways, in ferrets.3-7 In analogy to previous models attributing the mouse-human differences in the severity of CF lung and pancreatic disease to differences in expression and function of compensatory chloride channels, we postulated that differential expression of non-CFTR chloride channels may also underlie the differences in the severity of CF liver and gallbladder disease among mice, pigs and ferrets. Supportive data for this concept may greatly strengthen the basis for exploiting pharmacological activation of these alternative chloride channels as a therapeutic strategy to prevent or mitigate the CF phenotype. Previous studies have investigated the occurrence and relevance of alternative chloride channels in CF conditions.8-10 A prime candidate, ClC-2, has been recently disqualified as a compensatory chloride secretory channel in the gastrointestinal tract in view of its basolateral rather than apical localization and its inability to rescue the CF phenotype at the intestinal level.8 In contrast, calcium-induced chloride channels (CaCCs) have been considered as important candidates for alternative chloride transport in gastrointestinal tissues, including the bile and pancreatic ducts11-14 Until shortly, however, detailed studies of gene expression and function of CaCCs were hampered by the lack of information about the molecular identity of these channels. The recent identification of TMEM16/ anoctamins as a new family of chloride channels has revitalized such studies.15-21 Several members of the TMEM16 family show distinctive characteristics of CaCCs and are involved in numerous physiological processes, including smooth muscle contraction and trans-epithelial anion secretion. TMEM16A (ANO1) is localized in the apical membrane of epithelial cells and the plasma membrane of smooth muscle and Cajjar cells.22 Its functional importance is exemplified by the phenotype of TMEM16A knockout mice, showing strongly reduced transepithelial chloride secretion in the airways and severe tracheomalacia, reminiscent of the phenotype of CFTR knockout mice, CFTR knockout pigs and CF patients.23-24 95
INTrOduCTION Cystic Fibrosis (CF) is a severe inherited autosomal recessive disease with an incidence of 1:3600 live births in the Caucasian population. CF is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator protein (CFTR). Depending on the type of CFTR mutation, CF disease results in a reduced production, impaired processing, reduced activity, or impaired stability of CFTR. CFTR is a phosphorylation-regulated anion channel and is predominantly located in the apical membrane of epithelial cells. Reduced expression or functionality of CFTR leads to a phenotype of mucus plugging, chronic inflammation, infections and eventually irreversible damage in several organs. Consequently, CF patients predominantly suffer from pulmonary, pancreatic, intestinal and hepatobiliary disease. The CF phenotype underlines the crucial function of CFTR in electrolyte and fluid transport in the human body.1,2
One of the most prominent differences in phenotypic severity between CF mice and CF pigs is seen in the gallbladder.4,6 CFTRtm1Cam knockout and CFTRtm1Eur homozygous F508 mice (carrying the most common mutation in CF patients) show no morphological or histological gallbladder abnormalities. On the other hand, 100% of the CFTR knockout and homozygous F508 pigs are born with micro-gallbladders and show luminal obstruction caused by accumulation of thickened mucus. In this study we aimed to explore the hypothesis that the phenotypic difference in gallbladders of CF mice and CF pigs are due, at least in part, to a difference in the expression and activity of CaCCs, in particular TMEM16A. EXpErIMENTaL prOCEdurES Materials All chemicals used in this study were purchased from Sigma-Aldrich (St. Louis, MO, USA)
Patients and animals CFTRtm1Cam knockout (-/-) mice with a C57Bl/6/129 genetic background and CFTRtm1Eur homozygous F508 (/) mice with a FVB/129 genetic background and their respective littermate controls (+/+) were reared in an environmentally controlled facility at the Erasmus Medical Center in Rotterdam, the Netherlands. Animals had free access to water and a standard chow diet (Hope Farms, Woerden, the Netherlands). Gallbladders were collected from mice between the age of 12-20 weeks. CFTR-/- and heterozygous /+ pigs were generated by using adeno-associated virus-mediated gene targeting and somatic cell nuclear transfer, as previously described.25 To generate the / mutation in pigs, the nucleotides C-TT in exon 10 were deleted, which is identical to the human mutation.5 Gallbladders of CFTR-/- pigs and CFTR / pigs were collected from neonatal animals between the age of 8-24 hours. Littermates were obtained from Exemplar Genetics (Sioux Center, IA). Gallbladders of adult CFTR+/+ pigs were obtained from the Department of Experimental Cardiology, Erasmus Medical Center. Human gallbladders were obtained from patients who underwent cholecystectomy for gallstones. All studies were approved by the Medical Ethical Committee for Patient and Animals Experiments of the Erasmus Medical Center and the University of Iowa Animal Care and Use Committee. Transepithelial bioelectrics gallbladder mucosa Gallbladders were gently removed from anaesthetized animals, immediately transferred to ice-cold saline and thoroughly rinsed to remove bile and excess mucus. The gallbladder mucosa was separated from the smooth muscle layer by blunt dissection and the mucosa was placed in an Ussing chamber (Physiologic Instruments, San Diego; exposed area, 0.2 cm2). Tissue was bathed in modified Meyler solution: (mmol/L) 128 NaCl, 4.7 KCl, 1.3 CaCl2, 1.0 MgCl2, 0.3 Na2HPO4, 20 NaHCO3, 10 HEPES, gassed with humidified O2/CO2 (95%/5%), pH 7.3 at 37C. Prior to the bioelectric measurements, 96
glucose (10 mmol/L) and indomethacin (20 mol/L) was added to the serosal bath. The transepithelial potential difference was clamped at 0 mV using a DVC-1000 dual voltage clamp (World Precision Instruments, Sarasota, FL). The resulting short-circuit current (Isc), reflecting transepithelial electrogenic ion transport, was recorded with a Digidata 1320 analog-to-digital signal converter and Axoscope software (Axon Instruments, Foster City, CA). Gallbladder epithelium was pre-incubated for 60 minutes and bath fluid was repetitively refreshed, secretagogues were added when stable baseline currents were reached. The Ca2+-linked agonist carbachol (0.2 mM) was added at the serosal side to induce calcium activated anion secretion. In addition, ionomycin (5 M) and ATP (0.1 mM) were applied at the serosal and mucosal side respectively to induce CaCC secretion. After reaching a steady state, the cAMP-linked agonist forskolin (10 M) was added at the serosal side to induce CFTR dependent anion secretion. GlyH101 (20 M) was applied to the apical side as CFTR inhibitor.
mRNA expression TMEM16A Total RNA was isolated from the gallbladder with TRI-reagent according to the manufacturers protocol (Sigma, St. Louis, MO) and quantified using NanoDrop ND100 spectrophotometer (NanoDrop Technologies Inc. Wilmington, DE). RNA (20 ng) was converted to single stranded cDNA by a reverse transcription procedure according to the protocol of the manufacturer using random primers (Invitrogen). The relative mRNA expression of genes was determined by real-time quantitative reverse transcription-PCR (QRT-PCR) by using an Applied Biosystems 7900HT detector according to the manufacturers instructions. Expression levels were normalized for 18S as a housekeeping gene. Sequences for TMEM16A primers and probe are depicted in Table 1. Immunostaining TMEM16A and CFTR Gallbladders were excised and embedded in 4% paraformaldehyde. Sections of 4 m thickness were placed on microscope glass slides and incubated overnight at 60C. Deparaffinization with xylene and rehydration with sequential ethanol steps was followed by antigen retrieval performed by heating sections in EDTA buffer (1 mM, pH 8.0). Sections were incubated for 30 minutes with 2% H2O2 in PBS to block endogenous peroxidase and aspecific binding of antibodies was reduced by incubating section with 4% goat serum for 20 minutes. TMEM16A was stained using a mouse polyclonal antibody in a 1:800 dilution with 1% BSA/PBS. This primary antibody was raised against residues 451 to 466 of human TMEM16A and was kindly provided by prof. Uhtaek Oh (15). CFTR was stained using the affinity-purified MD1314 polyclonal antibody raised against the13-aminoacid COOH terminal peptide sequence of rodent CFTR (aminoacids 13771480, conjugated to bovine thyroglobulin (26). Primary antibodies were incubated for 2 hours at room temperature. After washing in PBS, sections were incubated for 30 minutes with 1:60 diluted goat-anti-rabbit secondary antibodies (DAKO, Denmark). The immunostaining was performed with diamino benzidin (DAB kit, Vector) followed by counterstaining with hematoxylin. As negative controls primary antibodies were 97
replaced by non-immune IgG fraction from rabbit in the same concentrations (DAKO, Denmark). For mouse TMEM16A, an additional negative control was obtained by staining TMEM16A in tracheal sections of TMEM16A knockout mice, kindly provided by Prof. Karl Kunzelmann.27
rESuLTS Forskolin-induced anion secretion in pig and mouse gallbladders. To induce CFTR dependent secretion of Cl- and HCO3- ions, the cAMP agonist forskolin was added to the gallbladders at the serosal side of the Ussing chamber (Fig.1A). As shown in Figs. 1C-D, forskolin induced a rapid rise in short circuit current (Isc) in the gallbladders of CFTR+/+ piglets and mice, indicative for active anion secretion. The Isc reached a plateau phase which was maintained for at least 10 minutes. Subsequent addition of the CFTR inhibitor GlyH101 (20 M) reduced the Isc by ~60%, indicating that a large fraction of the Isc response was CFTR-mediated (Suppl. Fig.S1A). , No quantitative differences in forskolin-induced currents were observed between CFTR+/+ pigs and CFTR+/+ mice (Fig.2A). In both CFTR/ mice and CFTR-/- mice, the forskolin-induced current was strongly reduced (both down to ~30% of CFTR+/+ mice, p=0.01), indicating that (i) the processing defect of DF508-CFTR in mouse gall bladder is severe, resulting in the near absence of residual CFTR activity (in line with the lack of CFTR immunostaining in CFTRD/D and CFTR-/- gallbladders; Suppl. Fig.S2]); and (ii) a considerable portion of the forskolin-induced anion secretion in mouse gallbladder (~30%) is CFTR-independent and mediated through non-CFTR anion channels, possibly CaCCs (Fig.1A)11
Statistical analysis Statistical analysis was performed using SPSS 16.0 inc. (SPSS Inc. Headquarters, 233 S. Wacker Drive Chicago, Illinois 60606). Differences between study categories were calculated using the Mann Whitney or student t-test if data were normally distributed. P-values<0.05 were considered significant.
Figure S2. CFTR immunostaining in gallbladders from CFTR+/+, /, and -/- mice. The lack of immunostained CFTR in CFTR-/ gallbladder corresponds with the absence of residual CFTR anion transport function revealed by transepithelial current measurements (Fig. 2A).
98
In contrast, as illustrated in Fig.1E-G and quantified in Fig.2A, CFTR / pigs showed only a modest reduction in anion secretion (down to ~60% of CFTR+/+ pigs, p=0.04) in comparison with CFTR-/- pigs (down to ~18% of CFTR+/+ pigs; p=0.03). These results indicate that the residual CFTR anion transport function in the gallbladder of CFTR/ pigs, but not of F508 mice, is substantial (~60% of CFTR+/+) but nonetheless still insufficient to rescue the CF phenotype.5 As is evident from a comparison between the current tracings in Fig. 1C-E, the slope of the forskolin-induced Isc response in CFTRD/D gallbladder was reduced in comparison with CFTR+/+ gallbladder, in line with the notion that CFTRD/D epithelia have a reduced sensitivity to cAMP-dependent stimulation of Cl- transport.5
99

Figure 1. A) Simplified scheme of apical and basolateral ion and fluid secretion in gallbladder epithelium. In our experiments, forskolin was added to the basolateral/serosal side of the gallbladder epithelium. Forskolin directly binds to AC and induces a rise in cAMP levels, triggering protein kinase-dependent phosphorylation and opening of the CFTR channel, which allows chloride, and bicarbonate via AE, to be secreted into the lumen of the gallbladder. The increase in intracellular cAMP also inhibits NHE3 in the apical membrane and stimulates the basolateral NKCC for cellular influx of sodium, potassium and chloride. GlyH-101 added to the apical/luminal side of the gallbladder epithelium directly binds and inhibits CFTR activity. Carbachol added to the basolateral/ serosal side of the gallbladder epithelium binds to the mACh receptor. This binding releases inositol trisphosphate (InsP3) from phospholipids in the plasma membrane which subsequently binds to the InsP3-receptor in the endoplasmic reticulum (ER) and releases calcium into the cytosol. The elevation of cytosolic Ca2+ activates basolateral potassium channels as well as CaCCs in the apical membrane (including TMEM16A), resulting in chloride secretion. The secretion of potassium by apical Ca2+--sensitive K+ channels is prominent in piglets but nearly absent in adult pigs and mice. Not known for gallbladder epithelium, but shown in many other CFTRexpressing cell types including porcine bronchial submucosal glands, is the mobilization of intracellular Ca2+ by cAMP, which may stimulate CaCC activity.40 In addition, as shown in-vitro in human bronchial epithelial cells, an intracellular increase of Ca2+ may increase cAMP levels and therefore stimulate CFTR activity.43 AC: adenylyl cylase. K: potassium channel. mACh: muscarinic acetylcholine receptor. NKCC: Sodium Potassium Chloride cotransporter. CFTR: Cystic Fibrosis Transmembrane Conductance Regulator. AE: Anion Exchanger P2Y: Purinergic receptor, presumably the P2Y6 subtype.28 CaCC: Calcium dependent Chloride Channel. NHE3: Sodium Hydrogen Exchanger type 3. B-H) Ussing chamber measurements of trans-epithelial anion currents in gallbladder mucosa of pigs and mice. The depicted currents serve as a representative of multiple measurements in both wild type and CF species. Aggregate data are summarized in Figure 3. Calcium dependent, CaCC-mediated anion secretion was triggered by the muscarinic agonist carbachol. CFTR dependent anion secretion was provoked by the cAMP agonist forskolin. +/+: wild type littermates, /: CFTR homozygous deltaF508, -/-: CFTR knockout.
Carbachol-induced anion secretion in pig and mouse gallbladders. Activation of CaCCmediated anion secretion could be achieved by three different stimuli: carbachol, acting through muscarinic receptors; ATP, acting by binding to P2Y 6 receptors in the apical membrane28; and ionomycin, a Ca2+ ionophore (Fig.1A). Because of its physiological relevance we choose to use carbachol as the prime stimulus of CaCC-mediated anion secretion in this study. However, the maximal current responses to ionomycin or mucosal ATP tested in a subset of pig and mouse gallbladders were quantitatively similar to the peak responses obtained with serosally added carbachol (Suppl. Fig.S1B).
Figure S1. Ussing chamber measurements. Trans-epithelial anion currents in gallbladder mucosa of wild type pigs after addition of the CFTR inhibitor GlyH101 (A) or after triggering of CaCC-induced anion secretion with ionomycin (B). The depicted currents serve as a representative of multiple measurements.
100
In pig gallbladders, the electrical response to carbachol showed a biphasic pattern (Fig.1C,E,G). The initial fast downward Isc response most plausibly represents apical potassium secretion 29, whereas the subsequent upward Isc response represents apical anion secretion.30 The initial carbachol-induced downward Isc response was absent in adult mice (Fig.1D) and in adult pigs (Fig.1B), suggesting that the K+ secretory capacity is very prominent in newborn animals but is lost in adults. In contrast to the forskolininduced anion secretion, the initial phase of the carbachol-induced anion secretion was fast and transient in both species (lasting ~2 minutes). The maximal value of carbacholinduced anion secretion was strikingly lower in piglets (by ~85%; Fig.1C,2B) and adult pigs (by ~95%; Fig.1B) as compared with adult mice (Fig.1D,2B). This relative insensitivity to carbachol was not due to a major difference in the expression or function of muscarinic receptors, because the response to serosal ionomycin (bypassing the need for receptor activation) was also greatly diminished in pig gallbladders (Suppl. Fig.S1B). The maximal CaCC-mediated anion secretion in pig gallbladders remained below ~25% of the value obtained for CFTR-mediated anion secretion (Fig.2B vs. 2A), indicating that anion secretion in pig gallbladder is predominantly dependent on CFTR rather than on CaCCs. In contrast, the CaCC-mediated anion secretion in mouse gallbladders amounted to ~130% of the CFTR-mediated anion secretion. Moreover, calcium-induced anion secretion in pig gallbladder remained unaltered by the CF condition, whereas a trend towards higher Isc responses was observed in CF mice (+29% for CFTR-/- mice; p=0.1; Fig.3B).
Figure 2. Forskolin (A), carbachol (B) and total (C) induced anion secretion in gallbladder mucosa of pigs and mice. Summary of data as depicted in Figure 2. Transepithelial anion currents (Isc) were measured under short-circuit conditions in Ussing chambers. CaCC-mediated anion currents were measured as the peak Isc response to carbachol, whereas CFTR-mediated anion currents were measured as the plateau phase of the Isc response to forskolin. . +/+: wild type littermates, /: CFTR homozygous deltaF508, -/-: CFTR knockout. Data are presented as means SEM.
101
The maximal secretory capacity for anions in pig and mouse gallbladders The maximal secretory capacity for Cl- and HCO3- ions, defined as the summation of the peak responses to carbachol+forskolin, was not different between CF mice and CFTR+/+ mice (Fig.2C), indicating adequate compensation for the loss of CFTR function. In contrast, the total peak response in CF pigs (both CFTR/ and CFTR-/-), as compared with gallbladders of WT pigs, was reduced by ~45% (p=0.05) and reached only ~1525% of the value observed in CF mice (Fig.2C). Importantly, the severity of gallbladder disease was also very similar in CFTR/ and CFTR-/- pigs.5 Expression of TMEM16A in gallbladders of mice, pigs and humans We performed immunohistochemistry on the gallbladders of pigs, mice and humans using a TMEM16A mouse polyclonal antibody.15 The specificity of TMEM16A immunostaining was verified in mouse tracheal epithelium, showing a complete loss of immunostaining in the trachea of TMEM16A-/- mice (Fig.3D).
Figure 3. TMEM16A expression in gallbladder epithelium of pigs, mice and humans and in tracheal epithelium from TMEM16A-/- mice. Immunohistochemistry of TMEM16A, counter-stained with hematoxylin on gallbladders of pigs, mice and human (A-C). Except for human gallbladder, the depicted pictures serve as a representative of multiple measurements Primary antibodies were replaced by non-immune IgG fraction from rabbit in the same concentrations as negative controls. As a similar counter section of homozygous F508 pigs and mice was available, negative controls of these sections were depicted. Figure 3D shows the complete absence of immunoreactivity in the trachea of a TMEM16A-/- mouse. +/+: wild type littermates, /: CFTR homozygous deltaF508, -/-: CFTR knockout. Magnification: 40x.
102
TMEM16A was expressed in the gallbladder epithelium lining the mucosal folds and in the intracellular compartment of the epithelial cells lining the gallbladder lumen of all species examined (Fig.3A-C). In general, TMEM16A staining of the luminal membrane appeared much stronger in mice and humans as compared with pigs. Unfortunately we were not able to perform western blotting on TMEM16A due to the present lack of a suitable TMEM16A-specific antibody. TMEM16A expression in mouse and pig gallbladder was also examined at the transcript level using QRT-PCR. Surprisingly, the transcript level of TMEM16A was reduced by 58% and 94% in CFTR/ and CFTR-/- pigs respectively, in comparison with CFTR+/+ pigs (Fig.4). In contrast, the level in CFTR/ and CFTR-/- mice did not differ significantly from CFTR+/+ mice, although a trend towards a partial loss of expression was observed in CFTR-/- gallbladder (Fig.4). Therefore the reduction in TMEM16A mRNA expression in CF gallbladder epithelium appears species-specific, being very pronounced in CF pigs but much less prominent in CF mice.
Figure 4. mRNA expression levels of TMEM16A in gallbladders of pigs, mice and humans. Expression levels were normalized for 18S as a house keeping gene. +/+: wild type littermates, /: CFTR homozygous deltaF508, -/-: CFTR knockout. Data are presented as means SEM.
dISCuSSION The gallbladder of newborn CF pigs shows a very severe CF phenotype characterized by a micro-gallbladder and luminal obstruction caused by accumulation of thickened mucus (3-4). This study shows that the maintenance of luminal fluidity in pig gallbladders, compared with mice, is more critically dependent on CFTR-dependent chloride and bicarbonate secretion. A major alternative pathway for anion secretion involving apical CaCCs, is highly active in the gallbladder of wild type (WT) and CF mice, but contributes only to a minor extent (~25%) to the anion secretory capacity of gallbladders freshly isolated from WT and CF pigs. The concept that CaCCs may serve as compensatory channels in gallbladders is supported by our finding that the total secretory capacity for anions is not reduced in CF mice. The dominant contribution of calcium-induced anion secretion in combination with the preservation of total anion secretion in CF mice, may explain the lack of pathology in their gallbladder epithelium. In contrast, in gallbladders of CF pigs even a modest reduction in CFTR-dependent transepithelial anion secretion, 103
as observed in the CFTR/ pig (~40%) results in a comparable reduction in total anion secretory capacity (~45%) and is associated with a severe gallbladder phenotype. As previously reported for airway epithelium, the reduction in anion secretion in the gallbladder of the CFTR/ pig may be more dramatic under physiological conditions, considering the intrinsically diminished responsiveness of the DF508-CFTR chloride channel to submaximal cAMP-linked secretagogues.5
For a long time the molecular identity of CaCCs in epithelial cells remained an enigma. However, the recent discovery of TMEM16A as a major CaCC species in the apical membrane of numerous epithelia including bile ducts, prompted us to examine the expression of this particular type of CaCC in mouse, pig and human gallbladder. The level of mRNA for TMEM16A was strongly reduced in the gallbladder of CF pigs, but not significantly in the gallbladder of CF mice. Whether the difference is related to the proinflammatory condition of the pig micro-gallbladder,4,5 or to other species differences is presently unknown. Since the CFTR-/- mice also showed an average reduction of 50% in TMEM16A mRNA expression levels, we consider it less likely that the decreased levels are secondary to changes in gallbladder morphology. Moreover, histochemical examination did not reveal major changes in morphology of the CF pig gallbladder epithelia. Immunocytochemical staining using a TMEM16A-specific antibody showed pronounced differences in staining intensity of the luminal membrane in WT animals (mouse@human>>pig), but no clear difference in apical immunostaining between CFTR+/+ and CFTR-/- animals. A comparison of TMEM16A immunostaining intensity between mouse, pig and human gallbladder is justified considering the nearly 100% aminoacid sequence identity between all three species in the region targeted by the antibody (residues 451-466). The outcome is in line with the functional data, pointing 104
Pig gallbladders may be more prone to CF disease in comparison with mouse gallbladders for several reasons: (i) the total capacity for anion secretion of WT pig gallbladder is less than half the capacity of mouse gallbladders, implying that a further reduction by the CF condition is more critical than in mice; (ii) bicarbonate secretion may be more affected in CF pigs than in CF mice and may contribute to the severe mucus plugging observed in CF pigs. In cholangiocytes of rodents, a large part of the cAMP-induced, CFTR-dependent bicarbonate secretion depends on apical release of ATP, stimulation of apical purinergic receptors, and activation of CaCCs.11,12 If a similar pathway is operative in the gallbladder, bicarbonate secretion is predicted to be much less prominent in the pig gallbladder in which the activity of CaCCs is only marginal in comparison with the mouse. Recent studies by Quinton et al. have clearly demonstrated the importance of CFTR-dependent bicarbonate secretion in the formation of normal mucus.31-33 Since CF pigs show severe mucus plugging in bile ducts and excessive mucus accumulation in gallbladders, a CF defect in bicarbonate secretion rather than an impairment in chloride secretion may underlie the severe pathology observed in the gallbladder of the CF pig. This concept is supported by the observation that 70% of forskolin-induced anion secretion in mouse gallbladders consist of bicarbonate.34
to a strongly reduced activity of CaCC-mediated anion secretion in pig vs. mouse gallbladders, and a lack of significant changes in this activity between CFTR-/- pigs and CFTR+/+ pigs. Unfortunately however, the present limited availability of highly specific inhibitors of TMEM16A35, its variable pharmacological properties with coexoression of other TMEM16 proteins22, the short survival time of native gallbladder epithelium ex vivo hampering efficient knockdown of TMEM16A by siRNA, and the technical difficulties of mounting mini gallbladders from newborn TMEM16A-/- mice in Ussing chambers, prevented us of determining the contribution of TMEM16A to CaCC-mediated anion secretion in this organ in a more quantitative manner.
The reason for the apparent discrepancy between the strongly reduced TMEM16A transcript levels in CF gallbladders and the absence of apparent changes in TMEM16A immunostaining or CaCC-mediated anion secretion revealed by this study is unclear but may involve; (i) the existence of non-epithelial pools of TMEM16A mRNA in the gallbladder tissue with less efficient translation; (ii) species differences in translation efficacy or stability of TMEM16A protein (mouse>>pig) or TMEM16A mRNA (pig>>mouse); (iii) the possibility that carbachol-induced anion secretory currents are limited by the activity of anion importers or Ca2+-activated K+ channels in the basolateral membrane rather than by CaCCs in the apical membrane. Unfortunately our attempts to measure apical CaCC activity more directly by nystatin-permeabilization of the basolateral membrane in the presence of an apical-to-basolateral Cl- gradient were unsuccessful because of an unacceptable large variability in carbachol-induced Cl- currents in comparison with non-permeabilized tissue; (iv) a contribution of CaCC channels different from TMEM16A to the carbachol-induced anion secretion. The latter possibility became more plausible by the recent finding that the contribution of TMEM16A to CaCC activity in human bronchial epithelial cells from CF patients is relatively modest 37 in comparison with mouse airways.36 Although the lack of sufficient CaCC activity may readily explain the more severe gallbladder phenotype of CF pigs, a true causative relationship is difficult to prove. The crossing of CFTR-/- mice with TMEM16A-/- mice in order to demonstrate a crucial role for TMEM16A in the gallbladder phenotype is not feasible, since TMEM16A-/mice decease almost directly after birth.27 Moreover, transgenic over-expression of TMEM16A in the CF pig is also a technical challenge. Awaiting future advances, such as the generation of conditional TMEM16A-/- mice, we cannot exclude the possibility that other compensatory processes prevent pathological changes in gallbladders of CF mice, or that CFTR is more critical for normal development and functioning of pig gallbladders for other reasons aside a shortage of compensatory anion channels. Most plausibly, the CF phenotype of the pig micro-gallbladder may arise from an early fetal obstruction of the bile ducts, as the micro-gallbladder phenotype is already apparent at birth. Because the model of anion secretion used for gallbladder epithelium has many features in common with the known anion secretory pathways and ion transporters in bile ducts, gallbladder epithelium may be considered as a surrogate model for bile 105
Why only a subset (~30%) of CF patients develop CF-related liver disease is unclear. Due to the absent relation between CFTR expression in the intra-hepatic bile ducts and the degree of liver damage in CF patients, it has been suggested that escaping CF-related liver disease might be due to activation of alternative chloride channels.37 However, up-regulation of CaCCs is reported in gallbladders of CF patients with endstage liver disease (38-39). Early Ussing chamber studies of electrogenic anion secretion in the epithelium of native, normal-sized gallbladders from CF patients, have revealed a virtually complete loss of cAMP-induced secretion, parallelled by a ~4-fold up-regulation of ATP/Ca2+-induced secretion (~40 Amp/cm2).38 Quantitatively, this up-regulation is intermediate between the CF pig (~20 Amp/cm2) and the CF mouse (~150 Amp/cm2) gallbladder.37 A similar increase in ATP-induced chloride efflux was observed in human CF micro-gallbladders.39 Although the occurrence of microgallbladders is not linearly related with the occurrence of CF-related liver disease, the data of Dray-Charier et al. did reveal that CF patients with micro-gallbladders required liver transplantation at a younger age (162 years) compared with CF patients with normal size gallbladders (223 years, p=0.02).39 Unfortunately, ion transport studies in gallbladders from CF patients without CF liver disease are presently lacking, and therefore, a direct comparison between the level of CaCC activity and the occurrence of CF liver disease cannot yet be made for human CF patients.
duct epithelium. Therefore, the lack of compensatory anion channels observed in pig gallbladders is likely to extend to the intra-hepatic ducts and in this way aggravate the CF phenotype of the gallbladder observed in newborn pigs.
aCKNOWLEdGMENTS We thank Lynda Ostedgaard (Department of Internal Medicine, University of Iowa) and Inge Lankhuizen and Maaike te Lintel Hekkert (Department of Experimental Cardiology, Erasmus Medical Center) for collecting gallbladder tissue of neonatal and adult pigs, respectively. We are thankful to Fjodor Sluijs for designing TMEM16A primers and probes and Juul Baller for excellent technical assistance in gallbladder histology (Laboratory for liver, digestive and metabolic diseases, University Medical Center Groningen). We thank Prof. Uhtaek Oh for providing mouse polyclonal TMEM16A antibodies15 and Prof. Karl Kunzelmann for providing tracheal sections of TMEM16A knockout mice.27
In conclusion, the severity of the gallbladder pathology in different species with CF (pig>human>mouse) is inversely related to the activity of CaCCs (mouse>human>pig). The comparative ion transport data do support the concept that CaCCs may serve as rescue channels in CF gallbladder disease.
106
ChapTEr 6 CaLCIuM aCTIVaTEd ChLOrIdE ChaNNELS 1. 4. 5. 2. 3.
rEFErENCES
Rogers CS, Stoltz DA, Meyerholz DK, Ostedgaard LS, Rokhlina T, Taft PJ et al. Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs. Science 2008;321:1837-1841. Meyerholz DK, Stoltz DA, Pezzulo AA, Welsh MJ. Pathology of gastrointestinal organs in a porcine model of cystic fibrosis. Am J Pathol 2010;176(3):1377-1389. Ostedgaard LS, Meyerholz DK, Chen JH, Pezzulo AA, Karp PH, Rokhlina T et al. The F508 mutation causes CFTR misprocessing and cystic fibrosis-like disease in pigs. Sci Transl Med 2011;3(74):74ra24. Scholte BJ, Davidson DJ, Wilke M, de Jonge HR. Animal models of cystic fibrosis. J Cyst Fibros 2004;3:183-190. Sun X, Sui H, Fisher JT, Yan Z, Liu X, Cho HJ et al. Disease phenotype of a ferret CFTR-knockout model of cystic fibrosis. J Clin Invest 2010;120(9):3149-3160. Bijvelds MJ, Bot AG, Escher JC, de Jonge HR. Activation of intestinal Cl- secretion by lubiprostone requires the cystic fibrosis transmembrane conductance regulator. Gastroenterol 2009;137(3):976-985. Jentsch TJ. CLC chloride channels and transporters: from genes to protein structure, pathology and physiology. Crit Rev Biochem Mol Biol 2008;43(1):3-36.
OSullivian BP, Freedman SD. Cystic Fibrosis. Lancet 2009;373:1891-1904.
Rowe SM, Miller S, Sorscher EJ. Cystic Fibrosis. N Eng J Med 2005;352:1992-2001.
6. 7. 8. 9.
Zdebik AA, Cuffe JE, Bertog M, Korbmachers C, Jenthsch TJ. Additional disruption of the ClC-2 Cl- channel does not exacerbate the cystic fibrosis phenotype of cystic fibrosis transmembrane conductance regulator mouse models. J Biol Chem 2004;279(21):22276-22283.
10. 11. 12. 13. 15. 14. 16. 17. 18.
Minagawa N, Nagata J, Shibao K, Masvuk AI, Gomes DA, Rodrigues MA et al. Cyclic AMP regulates bicarbonate secretion in cholangiocytes through release of ATP into bile. Gastroenterol 2007;133(5):1592-1602. Fiorotto R, Spirli C, Fabris L, Cadamuro M, Okolicsanvi L, Strazzabosco M. Ursodeoxycholic acid stimulates cholangiocte fluid secretion in mice via CFTR-dependent ATP secretion. Gastroenterol 2007;133(5):1603-1613. Feranchak AP, Fitz JG. Thinking outside the cell: the role of extracellular adenosine triphosphate in bile formation. Gastroenterol 2007;133(5):1726-1728. Schroeder BC, Cheng T, Jan YN, Jan LY. Expression cloning of TMEM16A as a calcium-activated chloride subunit. Cell 2008;134:1019-1029.
Steward MC, Ishiguro H, Case RM. Mechanisms of bicarbonate secretion in the pancreatic duct. Annu Rev Physiol 2005;67:377-409.
Yang YD, Cho H, Koo JY, Tak MH, Cho Y, Shim WS et al. TMEM16A confers receptor-activated calcium-dependent chloride conductance. Nature 2008;435:1210-1216.
Huang F, Rock JR, Harfe BD, Cheng T, Huang X, Jan YN et al. Studies on expression and function of the TMEM16A calcium-activated chloride channel. Proc Natl Acad Sci U.S.A. 2009;106:21413-21418. Galietta LJV. The TMEM16A protein family: a new class of chloride channels. Biophys J 2009;97:3047-3053.
107
20. 22. 23. 24. 25. 26. 21.
19.
Dutta AK, Khimji A, Kresge C, Bugde A, Dougherty M, Esser V et al. Identification and functional characterization of TMEM16A, a Ca2+-activated Clchannel activated by extracellular nucleotides, in biliary epithelium. J Biol Chem 2011;286(1):766-776.
Caputo A, Caci E, Ferrera L, Pedemonte N, Barsanti C, Sondo E et al. TMEM16A, a membrane protein associated with calcium dependent chloride channel activity. Science 2008;322:590593. Schreiber R, Uliyakina I, Kongsuphol P, Warth R, Mirza M, Martins JR et al. Expression and function of epithelial anoctamins. J Biol Chem 2010;285(10):7838-7845.
Kunzelmann K, Kongsuphol P, Chootip K, Toledo C, Martins JR, Almaca J et al. Role of the Ca2+ - activated Clchannels bestrophin and anoctamin in epithelial cells. Biol Chem 2011;392(12):125-134. Bonvin E, Le Rouzic P, Bernaudin JF, Cottart CH, Vandebrouck C, Cri A et al. Congenital tracheal malformation in cystic fibrosis transmembrane conductance regulator-deficient mice. J Physiol 2008;586(13):3231-3243. Roger CS, Hao Y, Rokhlina T, Samuel M, Stolz DA, Li Y et al. Production of CFTR null and F508 heterozygous pigs by AVV-mediated gene targeting and somatic cell nuclear transfer. J Clin Invest 2008;118(4):1571-1577. Bronckers A, Kalogeraki L, Jorna HJN, Wilke M, Bervoets TJ, Lyaruu DM, et al. The cystic fibrosis transmembrane conductance regulator is expressed in maturation stage ameloblasts, odontoblasts and bone cells. Bone 2010;46:1188-1196. Meyerholz DK, Stoltz DA, Namati E, Ramachandran S, Pezzulo AA, Smith AR et al. Loss of cystic fibrosis transmembrane conductance regulator function produces abnormalities in tracheal development in neonatal pigs and young children. Am J Respir Crit Med 2010;182(10):12511261.
27.
28.
Almaca J, Tian Y, Aldehni F, Ousingsawat J, Kongsuphol P, Rock JR et al. TMEM16 proteins produce volume-regulated chloride currents that are reduced in mice lacking TMEM16A. J Biol Chem 2009;284(42):28571-28578. DuVall MD, OGrady SM. Regulation of K secretion across the porcine gallbladder epithelium. Am J Physiol 1993;264(6):C1542-1549.
29. 30.
Lazarowski ER, Rochelle LG, ONeal WK, Ribeiro CM, Grubb BR, Zhang V, et al. Cloning and functional characterization of two murine uridine nucleotide receptors reveal a potential target for correcting ion transport deficiency in cystic fibrosis gallbladder. J Pharmacol Exp Ther 2001;297:43-49.
31. 33. 32.
Peters RH, van Doorninck JH, French PJ, Ratcliff R, Evans MJ, Colledge WH et al. Cystic fibrosis transmembrane conductance regulator mediates the cyclic adenosine monophosphateinduced fluid secretion but the inhibition of resorption in mouse gallbladder epithelium. Hepatology 1997;25(2):270-277. Quinton PM. Role of epithelial HCO3- transport in mucin secretion: lessons from cystic fibrosis. Am J Physiol Cell Physiol 2010;299(6):C1222-33. Quinton PM. Birth of mucus. Am J Physiol Lung Cell Mol Physiol 2010;298(1):L13-14.
Garcia MA, Yang N, Quinton PM. Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. J Clin Invest 2009;119(9):26132622.
108
35. 36. 37.
34.
Martin LC, Hickman ME, Curtis CM, MacVinish LJ, Cuthbert AW. Electrogenic bicarbonate secretion in mouse gallbladder. Am J Physiol 1998;274(37):G1045-52.
Namkung W, Phuan PW and Verkman AS. TMEM16A inhibitors reveal TMEM16A as a minor component of calcium-actived chloride channel conductance in airway and intestinal cells. Biol Chem 2011;286(3):2365-74.
OusingsawatJ, Martins JR, Schreiber R, Rock JR, Harfe BD, Kunzelmann K. Loss of TMEM16A causes a defect in epithelial Ca2+-dependent chloride transport. J Biol Chem 2009;284:2869828703. Kinnman N, Lindblad A, Housset C, Buentke E, Scheynius A, Strandvik et al. Expression of cystic fibrosis transmembrane conductance regulator in liver tissue from patients with cystic fibrosis. Hepatology 2000;32(2):334-340. Chinet T, Fouassier L, Dray-Charier N, Iman-Ghalli M, Morel H, Mergey M et al. Regulation of electrogenic anion secretion in normal and cystic fibrosis gallbladder mucosa. Hepatology 1999;29(1):5-13. Dray-Charier N, Paul A, Scoazec J, Veissire D, Mergey M, Capeau J, et al. Expression of delta F508 cystic fibrosis transmembrane conductance regulator protein and related chloride transport properties in the gallbladder epithelium from cystic fibrosis patients. Hepatology 1999;29(6):1624-1634. Namkung W, Finkbeiner WE, Verkman AS. CFTR-adenyl cyclase 1 association responsible for UTP activation of CFTR in well-differentiated primary human brochial cell cultures. Mol Biol Cell 2010;21:2639-2648.
38. 39. 40. 41.
Lee RJ, Foskett JK. Mechanisms of Ca2+ - stimulated fluid secretion by porcine bronchial submucosal gland serous acinar cells. Am J Physiol Lung Cell Mol Physiol 2009;298:L210231.
109
ChapTEr 7
GENERAL DISCUSSION AND SUMMARY
M. Wouthuyzen-Bakker
ChapTEr 7 GENEraL dISCuSSION aNd SuMMarY
NuTrITIONaL STaTuS IN CYSTIC FIBrOSIS Most patients with CF have a suboptimal nutritional status due to increased energy expenditure (mostly as the result of recurrent pulmonary infections and/or chronic inflammation), insufficient energy intake, and fat malabsorption.1 Since the nutritional status and the pulmonary function of CF patients are inversely related,2-4 the degree of malnutrition (often defined as z-scores for weight or BMI < -2) is closely related to morbidity and mortality.5-6 CF children with malnutrition often show a rapid decline in pulmonary function, which consequently results in a further worsening of the nutritional status and pulmonary function.2-3 An optimal nutritional status should therefore be maintained to avoid the vicious cycle of pulmonary deterioration. The definition of an optimal nutritional status that should be achieved in CF conditions remains debatable. Z-scores for weight, length and BMI for age are all shown to be associated with pulmonary function.3 From the CF foundation patient registry data, it has been shown that a z-score for BMI above zero is necessary to maintain a nearly normal pulmonary function; e.g. FEV1 values above 80% of predicted.4 Therefore, the American CF foundation recommends to maintain z-scores for BMI above zero in CF patients between two and twenty years of age.7 Based on these observations, a nutritional classification scoring system has been developed to screen and classify patients according to their nutritional risk. Patients with a z-score for BMI below zero are classified into a higher risk category and are more eligible for nutritional intervention compared to patients with higher z-scores.7 In contrast with these reports, we showed, in our population of pre-school CF patients with preserved pulmonary function (FEV1>80%), that 50% of this cohort of patients have a z-score for BMI below zero (Chapter 2). Thus, our data indicate that a z-score for BMI above zero is not essential to maintain a nearly normal pulmonary function in pre-school CF patients. In agreement with our data, McDonald 112
CYSTIC FIBrOSIS aNd ThE GaSTrO-INTESTINaL TraCT Gastro-intestinal disease is, after pulmonary manifestation, the second most severe expression of cystic fibrosis (CF) and includes pancreatic insufficiency, intestinal abnormalities and hepatobiliary disease. The aim of this thesis was to address various aspects of the gastro-intestinal tract in CF disease by evaluating current treatment and investigating potential future treatment options. We evaluated the effect of a high dietary energy intake on the nutritional status in CF patients with preserved pulmonary function (Chapter 2), we reviewed potential factors that may contribute to persistent fat malabsorption and we evaluated several treatments options to improve fat absorption and/or nutritional status in CF conditions (Chapter 3 & 4). In Chapter 5, we investigated in mice in vivo the choleretic properties of ursodeoxycholic acid (which is the current medical treatment for CF-related liver disease) under CFTR deficient conditions. Finally, we tested the hypothesis that the severe gallbladder phenotype in CF pigs, compared with CF mice, is due to reduced activity of calcium activated chloride channels (in particular TMEM16A) (Chapter 6) which may strengthen the basis for exploiting pharmacological activation of these channels in CF patients.
Improving a suboptimal nutritional status in CF patients remains an important and difficult challenge in CF care. Since the nutritional status of CF patients is determined by multiple factors affecting the balance between energy requirements and energy expenditure, several targets for optimizing the nutritional status should be addressed. The nutritional status is likely to improve by aggressive pulmonary treatment, by high dietary energy intakes and by improving the fat absorption.2-3 In regard to the gastrointestinal tract, pancreatic enzyme replacement therapy in case of pancreas insufficiency and a high energy diet are classic corner stones in the nutritional care for CF patients.
et al. suggested that z-scores for BMI below zero are justified in young CF patients and a more stringent cut-off value for BMI levels are necessary for older children (above 15 years) in order to maintain a good pulmonary function. 7 In addition to the z-scores for BMI, Konstan et al. showed that only z-scores for weight for age below minus two at three years of age are associated with a deteriorated pulmonary function at the age of six.3 In our cohort of pre-school CF patients with preserved pulmonary function, only five percent of patients exhibit z-scores for weight below minus two (Chapter 2). Thus, only a small fraction of young CF patients with preserved pulmonary function would require nutritional intervention to optimize their nutritional status. For CF patients that do exhibit impairments in pulmonary function, a more stringent approach to improve nutritional status would be necessary. In contrast to CF patients with mild pulmonary disease who would be expected to catch-up in growth rapidly after a pulmonary exacerbation, patients with impaired pulmonary function often have difficulties to regain weight after a pulmonary exacerbation.1
Dietary energy intake In the late eighties, Corey et al. studied the survival of CF patients in two different CF clinics and observed a better survival in the clinic where a non-restricted, instead of restricted, fat diet was applied (together with a more aggressive strategy towards indications for pulmonary infections). 8 This study has led to a major shift in the nutritional care for CF patients. Instead of a restricted fat diet, a high energy diet with ~40% fat became generally advised to CF patients.2-3 Despite the reported beneficial effects on nutritional status, the dietary approach also resulted in negative psychological consequences for CF patients and their families to apply to the dietary advice.9-11 Several studies indicated that most CF patients are not able to meet the nutritional recommendations.12 We therefore questioned whether a less stringent dietary advice might be justified in relatively healthy CF patients. In Chapter 2, we retrospectively analyzed the relation between energy intake and several parameters for nutritional status and growth in a relatively homogeneous subgroup of 81 pediatric CF patients between six and nine years of age with a preserved pulmonary function (FEV1% > 80%). Cross-sectional analysis revealed a lack of correlation between total energy intake or the intake of fat, expressed as the amount of kilocalories intake per kilogram body weight, and several parameters for nutritional status and growth. 113
Fat absorption The physiological process of fat absorption involves various sequential steps. Each step requires a specific environmental condition - e.g. sufficient amount of digestive enzymes and bile salts, adequate bicarbonate secretion and a healthy intestinal mucosa - to ensure adequate fat digestion and absorption (Chapter 3).27 The major contributor to fat malabsorption in CF patients is the insufficient production of the digestive enzyme pancreatic lipase due to pancreatic insufficiency. Treatment with pancreatic enzyme supplements greatly improves fat absorption in CF patients, but in approximately 50% of CF patients fat malabsorption persists.28 The persistent fat malabsorption may be attributed to insufficient use of pancreatic enzyme supplements, but can also be attributed to several other CF-related gastro-intestinal tract abnormalities. Insight into the contribution of these abnormalities to fat malabsorption in CF conditions is 114
Most studies reported a relation between energy intake and nutritional status in malnourished patients (e.g. z-scores for nutritional status < -2), in patients with impaired pulmonary function (FEV1% < 80%), and in patients with initial energy intakes below 100% of the recommended daily allowance for healthy peers.13-26 The results of these studies suggest that only CF patients who are in a more advanced stage of disease and with dietary intakes that are clearly below the general advice, even for the healthy reference population, quantitatively benefit from high energy intakes. We additionally analyzed the relation between energy intake and weight gain in a longitudinal setting and categorized patients according to their initial nutritional status and energy intake. We found that only a small percentage (9%) of patients who increased the energy intake in the year after the initial assessment, showed a corresponding increase in the z-score for body weight. In contrast, 26% of patients showed, despite a decrease in energy intake, an increase in the z-score for body weight. These results were irrespective of the initial nutritional status or energy intake. We cannot exclude that the increase in energy intake was not high enough to measure a quantitative beneficial effect on weight. Nevertheless, our data do accentuate that energy intake and growth are not always linearly related in CF patients due to the multiple factors which are involved in the maintenance of adequate growth, especially in patients without overt malnutrition. We do realize that our results are based on a retrospective longitudinal analysis, with the risk of bias and with the limitation of three-day dietary diaries as a measurement of energy intake. Our data certainly justifies the need for prospective clinical trials in this subgroup of patients. There are no prospective studies that evaluated the quantitative effect of energy intake on the nutritional status in a subset of patients which are in a relatively healthy state of CF lung disease. These studies should preferably be carried out with the inclusion of energy expenditure measurements and other parameters for nutritional status that were not assessed in our study, like fat mass and fat free mass. These studies are important to conclude whether the actual beneficial effects on nutritional status or growth outweigh the possible adverse psychological consequences in the strive to achieve high dietary energy intakes.
Antibiotic treatment has shown to improve the body weight of CFTR knockout mice.30To determine whether the improved body weight could be attributed to increased absorption of fat, we treated CFTR knockout and CFTR homozygous delta F508 mice with oral antibiotics (metronidazole and ciprofloxacin). After treatment, we determined fat absorption by a 72-hour fecal fat test and determined fatty acid kinetics by intragastrically administration of stable isotope-labelled fats (Chapter 4). Because the CF mouse models used are pancreas sufficient, these mice are especially suited to study persistent fat malabsorption (mimicking the condition of CF patients with persistent fat malabsorption despite optimal treatment with pancreatic enzyme supplements). We confirmed that the CFTR knockout mice, with a severe intestinal phenotype and small intestinal bacterial overgrowth, improved in body weight after antibiotic treatment, but we also demonstrated that the mechanism is not based on enhancing the fat absorption. The CFTR homozygous delta F508 mice, with a milder intestinal phenotype without small intestinal bacterial overgrowth, showed no improvement in body weight and no quantitatively relevant improvement in the absorption of fat. These results indicate
33
In Chapter 3, we reviewed several factors that have been proposed in the literature to contribute to CF-related fat malabsorption and the corresponding intervention studies in CF patients and CF mice. We found that a reduced intestinal pH due to decreased pancreatic and duodenal bicarbonate secretion may contribute to persistent fat malabsorption in individual CF patients and that therefore, fat absorption may improve during treatment with acidic suppressive drugs.29 Treatment of intestinal mucus accumulation, chronic inflammation and bacterial overgrowth of the small intestine by broad-spectrum antibiotics and oral laxatives improved the body weight of CFTR knockout mice.30-33 Whether a similar beneficial effect of these treatments on body weight can be expected in CF patients remains to be determined, especially considering the fact that CFTR knockout mice have a more severe intestinal phenotype compared to CF patients. However, small intestinal bacterial overgrowth has been reported in approximately 40% of CF patients, although the definitive diagnosis has remained a challenge34-35 Nevertheless, patients with signs compatible wth small bacterial overgrowth (like diarrhoea, bowel gas and weight loss) could benefit from an empirical treatment with broad-spectrum antibiotics. Alterations in essential fatty acids and intestinal transit time are described in CF patients and may theoretically contribute to fat malabsorption36-37, but the clinical relevance of these factors still needs to be determined. EFA supplements could be considered to improve nutritional status in CF patients, as they have shown to improve body weight in individual cases. Whether the improvement is due to the EFA itself or to a quantitatively higher energy intake in patients using supplements is not clear from the reviewed studies.38-39 Results from patients as well as animal studies clearly indicated that increased fecal loss of bile salts and alterations in bile salt composition do not contribute to fat malabsorption in CF.40-43
necessary to ultimately implement new treatment strategies and improve the nutritional status of CF patients.
115
that the increased body weight in the CFTR knockout mice may be explained by a decrease in energy requirements by treating the intestinal mucosal abnormalities and/ or by improving the absorption of other macro-nutrients. A drawback of the CF mouse models is that they exhibit a relatively mild fat malabsorption. It is possible that when fat malabsorption is more pronounced, for example by treating CF mice with a high fat diet or by the use of the CF ferret or CF pig with more severe fat malabsorption, the effect of antibiotic treatment on fat absorption could be more pronounced. This concept is especially interesting since we observed an accelerated fatty acid uptake and decreased fecal loss of bile salts in antibiotic-treated CF mice. These changes were not related to alterations in bile salt composition in gallbladder bile nor to changes in bacterial composition of the small intestine. The accelerated fat absorption was observed in both wild type and CF mice, suggesting a beneficial effect of antibiotics on the intestinal mucosa. This suggestion is supported by an interesting finding in premature non-CF infants with overt fat malabsorption in the late eighties.44 Verkade et al. found that parenterally antibiotic treatment increased the absorption of fat by approximately 20% in these infants. hEpaTOBILIarY aSpECTS IN CYSTIC FIBrOSIS Various hepatobiliary manifestations are described in CF patients.45 Approximately one-third of CF patients develop biochemical indications of liver disease (CFLD). Histologically CFLD is characterized by focal biliary cirrhosis. In a minority of cases (5-10%), focal biliary cirrhosis can progress to multilobar cirrhosis with portal hypertension and eventually end stage liver disease. Currently, ursodeoxycholic acid (UDCA) is the general clinical therapy that is applied for patients with CFLD. UDCA has shown to improve hepatobiliary symptoms and reduce serum transaminases in CF patients. At present, no effective therapy is available to cure, slow the progression, or prevent the onset of CFLD.
Ursodeoxycholic acid (UDCA) In several cholangiopathies UDCA is beneficial by its choleretic activity and by reducing the hepatotoxicity of bile salts. While treatment with UDCA is applied for different cholangiopathies, including CFLD, the therapeutic action of UDCA in CF conditions remains unclear.,46-47 In-vitro and ex-vivo studies indicated that the therapeutic effects depended on functional CFTR.48 To test the choleretic activity of UDCA in CF conditions, we treated CFTR knockout and control mice with UDCA by acute intravenous infusion and by a chronic UDCA enriched diet (Chapter 5). We assessed bile flow and bile composition after gallbladder cannulation and the synthesis and pool size of cholate by using a micro scale stable isotope dilution technique. We found that UDCA administration stimulated bile flow up to ~500% and increased the hydrophilicity of the bile salt pool by biliary UDCA enrichment (80%) in both CFTR knockout and control mice. The high quantitative contribution of UDCA to the total bile salt pool was accompanied by a major decrease in cholate synthesis. These data indicate that the choleretic effects of 116
Hepatotoxicity of bile is determined by the concentration and hydrophobicity of bile salts (toxic) and by the presence of biliary phospholipids and bicarbonate (protective).50-51 It has been suggested that the relative hydrophobic bile salt pool in CF patients contributes to the pathogenesis of CFLD.51 Therefore, the UDCA-induced increase in the hydrophilicity of bile and the corresponding decrease of the hydrophobic bile salts in CFTR knockout mice is encouraging (Chapter 5). Previous studies indicate, that the phospholipid to bile salt ratio is not decreased in CF conditions. Furthermore, it has not been reported that UDCA does influence the phospholipid to bile salt ratio.46-47 Whether UDCA also stimulates bicarbonate secretion in CFTR deficient conditions remains to be determined. It has been shown that activation of CaCCs does induce bicarbonate secretion in human CF bile-ductular cells.52 In comparison with UDCA, norUDCA, a homologue of UDCA with one methyl group less in its side-chain, is expected to induce a more bicarbonate-rich hypercholeresis by cholehepatic shunting. The protective role of the so called bicarbonate umbrella has been investigated in vivo in CFTR deficient conditions. In CFTR knockout mice, norUDCA indeed induced bicarbonate secretion and stimulated bile flow two to three fold. 53 Although the effect of UDCA on bile flow was preserved in CFTR knockout mice, its effect on an injured hepatobiliary tract in CF conditions remains to be determined. The recently generated CF pig may offer a highly useful model for such studies. In addition, randomized control trials with a long-term follow-up are necessary in CF patients to evaluate the therapeutic and/or preventive effect of UDCA on CFLD. Calcium activated chloride channels (CaCC) A marked difference in the severity of the CF phenotype exists between mice and pigs with CF, i.e. severe in pigs but relatively mild in mice. This phenotypic difference is especially prominent in the gallbladder. CF pigs display a micro-gallbladder at birth, while CF mice have no gallbladder abnormalities.54-57 We postulated that this difference might be due to activity of compensatory, non-CFTR chloride channels. In Ussing chambers, we measured transepithelial currents (representing anion secretion 117
A major portion of UDCA-stimulated bile flow in CFTR deficient conditions is most likely related to the activation of calcium activated chloride channels (CaCC). By performing bioelectric experiments in Ussing chambers we demonstrated that the calcium agonists carbachol, ionomycin and (mucosal) ATP all acted as major stimuli of transepithelial Cland HCO3- secretion currents in gallbladders of both normal and CF mice (Chapter 6), indicating that CaCCs play a prominent role in secretagogue-induced fluid secretion in this tissue. The activity of CaCCs in gallbladders of humans is reduced in comparison with the activity observed in mice, but CaCCs can be upregulated in CF patients with severe liver disease.49 Therefore, UDCA may potentially induce bile flow in CF patients through the stimulation of CaCCs rather than CFTR.
UDCA is independent from the presence of functional CFTR in mice in vivo, in contrast to previous in vitro en ex vivo indications.
[Cl- and HCO3-]) in gallbladders from CF pigs, CF mice and their respective wild type controls. We found that the activity of calcium activated chloride channels (CaCC) indeed corresponded with the CF gallbladder phenotype (Chapter 6). Induction of CaCC secretion by calcium-linked secretagogues was nearly absent in pigs, but very prominent in mice. Carbachol-induced anion secretion was upregulated under CF conditions in mice, resulting in wild type levels of total anion secretion (the sum of CFTR and CaCC induced secretions). However, it should be noted that the carbachol-induced anion secretion, in contrast to CFTR activity, is a relatively short and transient event. Moreover, the relative contribution of Cl- and HCO3- ions to the anion secretion was not addressed in our study. Therefore, we recommend for future studies to investigate (1) whether the CaCC-mediated anion secretion, in view of its transient nature, still has a sufficient impact on osmotically driven fluid secretion; (2) what proportion of the anion current is carried by bicarbonate. Recent reports highlight the importance of bicarbonate secretion in the formation of normal mucus58-60 and thus, this is of special interest in CF conditions where impaired bicarbonate secretion is present.
Previous study suggested that the CaCC TMEM16A is the most important CaCC in the apical membrane of epithelial tissues.61 Immunostaining of TMEM16A, showed a pronounced staining intensity in the mouse gallbladder epithelium and a relatively weak staining intensity in the pig gallbladder, matching the functional data on anion secretion (Chapter 6). The TMEM16A mRNA expression levels did not match the functional data and unfortunately, sufficient TMEM16A antibodies for western blotting, to quantitate protein expression levels more accurately, were lacking. Since TMEM16A knockout mice die shortly after birth,62 a gallbladder TMEM16A knockout, or crossings of this KO with CFTR-/- mice, should be developed to investigate whether the loss of TMEM16A anion channels alone (or in combination with CFTR deficiency) is sufficient to develop a micro-gallbladder and other hepatobiliary abnormalities present in CF patients. Another option for future studies includes the use of specific TMEM16A inhibitors in CF and wild type mice and the use of TMEM16A activators in CF pigs to test whether the hepatobiliary phenotype will deteriorate or improve respectively. The activation of CaCCs may potentially migitate the hepatobiliary phenotype in CF patients, by compensating for the loss in CFTR function and thereby providing an alternative for targeting defective CFTR. In comparison with CFTR correctors or potentiators, an important theoretical advantage of the development of CaCC-activators is that they are expected to be applicable universally in all CF mutation classes and thus, its treatment will not be restricted to subsets of CF patients. CaCC activation also has disadvantages in comparison to CFTR correctors or potentiators. First, CFTR function comprises much more than only fluid transport and thus, the other regulatory functions of CFTR will not be accounted for when stimulating CaCCs. Second, as mentioned earlier, channel activity of CaCC is characterized by a transient channel opening, while CFTR is characterized by a a more stable opening of the channel (hours rather than minutes). Third, CaCCs are not equally expressed in all epithelial tissues that are affected in CF 118
SuMMarY aNd OVEraLL CONCLuSION The aim of our thesis was to address various aspects of the gastro-intestinal tract in CF disease by evaluating current treatment and investigating potential future treatment options. Optimizing nutritional status is a classic cornerstone in treating CF patients. The definition of an optimal nutritional status in school-aged CF patients with preserved pulmonary function may, to our understanding, be less stringent than currently applied. Our data indicate that the current strive for z-scores for BMI above zero to maintain a good pulmonary function (FEV1 >80%) is not necessary, as 50% of our patient population have a preserved pulmonary function despite z-scores for BMI below zero. In addition, we recommend to re-evaluate the strive for high dietary energy intakes in relatively healthy CF patients. Our retrospective cross-sectional and longitudinal analysis revealed a very weak relation between energy intake and parameters for nutritional status and growth in patients with preserved pulmonary function. Prospective clinical trials are indicated in this patient group to investigate the exact quantitative contributory effect of high energy intakes on nutritional status and growth. Clarity in this patient group is important, in order to determine whether the (beneficial) effects on nutritional status outweigh the potentially negative psychological burden for CF patients to comply to the nutritional advice. Another therapeutic target to improve nutritional status includes the correction of (persistent) fat malabsorption in CF patients. Acid suppressive drugs may improve fat absorption in individual CF patients. Broad-spectrum antibiotic therapy improves the nutritional status of CFTR knockout mice with small intestinal bacterial overgrowth, but not via improving the absorption of fat. Antibiotic treatment did accelerate the absorption of fat, which raises the question whether changes in fat absorption may be observed in CF patients or CF animal models with more overt fat malabsorption (e.g. the CF ferret or CF pig) than the CF mice. The contribution of essential fatty acid deficiency and prolonged transit time on fat malabsorption in CF patients remains to be determined, although we have not found indications that these factors profoundly interfere with fat absorption in CF patients. We demonstrated that the beneficial effects of UDCA on bile flow and bile composition are maintained under CF deficient conditions, indicating that these effects are CFTR-independent. These results encourage the need to investigate the therapeutic and/or preventive effect of UDCA in CF-related liver disease in prospective randomized clinical trials. Finally, the absent gallbladder phenotype in CF mice, associated with a pronounced capacity of calcium induced anion secretion across non-CFTR anion channels, strengthens the basis for exploiting pharmacological activation of calcium activated chloride channels as a therapeutic strategy to prevent or mitigate the CF phenotype. 119
patients. For example, CaCCs are not expressed in the intestine (what could contribute to the severe intestinal phenotype of most CF mouse models).63 Finally, TMEM16A and other CaCCs are expressed too in non-epithelial tissues, e.g. smooth muscle cells and Cajjar cells61, implying that pharmacological CaCC activators may exert unwanted sideeffects that may restrict their use as oral or IV medication.
ChapTEr 7 GENEraL dISCuSSION aNd SuMMarY 1.
rEFErENCES
2. 3.
Durie PR, Pencharz PB. A rational approach to the nutritional care of patients with cystic fibrosis. J Roy Soc Med 1989;82:11-20. Steinkamp G, Wiederman B. Relationship between nutritional status and lung function in cystic fibrosis: cross sectional and longitudinal analysis from the German CF quality assurance (CFQA) project. Thorax 2002;57:596-601. Konstan MW, Butler SM, Wohl MEB et al. Growth and nutritional indexes in early life predict pulmonary function in cystic fibrosis. J Pediatr 2003;142:624-30.
5. 6. 7. 8. 9.
4.
Cystic Fibrosis Foundation. Patient Registry 2005 Annual Report. Cystic Fibrosis Foundation: Bethesda, MD;2006. McDonals CM. Validation of a nutrition risk screening tool for children and adolescents with cystic fibrosis ages 2-20 years. J Ped Gastroenterol Nutr 2008;46:438-446.
Sinaasappel M, Stern M, Littlewood J, et al. Nutrition in patients with cystic fibrosis: a European Consensus. J Cyst Fibros 2002;1(2):51-75. Ramsey BW, Farrell PM, Pencharz P. Nutritional assessment and management in cystic fibrosis: a consensus report. The Consensus Committee. Am J Clin Nutr 1992;55(1):108-116. Corey M, McLaughlin FJ, Williams M, et al. A comparison of survival, growth, and pulmonary function in patients with cystic fibrosis in Boston and Toronto. J Clin Epidemiol 1988;41(6):583-591. Duff AJ, Wolfe SP, Dickson C, et al. Feeding behavior problems in children with cystic fibrosis in the UK: prevalence and comparison with healthy controls. J Pediatr Gastroenterol Nutr 2003;36(4):443-7.
11. 13. 12.
10.
14. 15. 16. 17. 18.
Hanning RM, Blimkie CJR, Bar-Or O, et al. Relationships among nutritional status and skeletal and respiratory muscle function in cystic fibrosis: does early dietary supplementation make a difference? Am J Clin Nutr 1993;57:580-587. Luder E, Kattan M, Thornton JC, et al. Efficacy of a nonrestricted fat diet in patients with cystic fibrosis. Am J Dis Child 1989;143:458-464.
Anthony H, Bines J, Phelan P, et al. Relation between dietary intake and nutritional status in cystic fibrosis. Arch Dis Child 1998;78: 443-447. Collins CE, OLoughlin EV, Henry RL. Fat gram target to achieve high energy intake in cystic fibrosis. J Paediatr Child Health 1997;31:142-147.
Powers SW, Patton SR, Byars KC, et al. Caloric intake and eating behavior in infants and toddlers with cystic fibrosis. Pediatrics 2002;109(5):E75.
Powers SW, Patton SR. A comparison of nutrient intake between infants and toddlers with and without cystic fibrosis. J Am Diet Assoc 2003;103(12):1620-1625
Powers SW, Mitchell MJ, Patton SR, et al. Mealtime behaviors in families of infants and toddlers with cystic fibrosis. J Cyst Fibros 2005;4(3):175-82.
Jelalian E, Stark LJ, Reynolds L, et al. Nutrition intervention for weight gain in cystic fibrosis: a meta analysis. J Pediatr 1998;132(3 Pt 1):486-492. Lloyd-Still JD, Smith AE, Wessel HU. Fat intake is low in cystic fibrosis despite unrestricted dietary practices. J Parenter Enteral Nutr 1989;13:296-298.
120
20. 21.
19.
Powers SW, Byars KC, Mitchell MJ. A randomized pilot study of behavorial treatment to increase calorie intake in toddlers with cystic fibrosis. Child Health Care 2003;32(4):297311. Shepherd RW, Holt TL, Cleghorn G, et al. Short-term nutritional supplementation during management of pulmonary exacerbation in cystic fibrosis: a controlled study, including effects of protein turnover. Am J Clin Nutr 1988;48:235-239. Stark LJ, Bowen AM, Tyc VL, et al. A behavorial approach to increasing calorie consumption in children with cystic fibrosis. J Pediatr Psychol 1990;15(3):309-32.
22. 23. 24.
Stark LJ, Knapp LG, Bowen AM, et al. Increasing calorie consumption in children with cystic fibrosis: replication with 2-year follow up. J App Beh Anal 1993;26: 435-450. Steinkamp G, Demmelmair H, Rhl-Bagheri I, et al. Energy supplements rich in linoleic acid improve body weight and essential fatty acid status of cystic fibrosis patients. J Pediatr Gastro Enterol Nutr 2000;31:418-423. Vaisman N, Clarke C, Pencharz PB. Nutritional rehabilitation increases resting energy expenditure without affecting protein turnover in patients with cystic fibrosis. J Pediatr Gastroenterol Nutr 1991;13:383-390. Walkowiak J, Przyslawski J. Five year prospective analysis of dietary intake and clinical status in malnourished cystic fibrosis patients. J Hum Nutr Dietet 2003;16:225-231.
Stark LJ, Opipari LC, Spieth LE, et al. Contribution of behaviour therapy to dietary treatment in cystic fibrosis: a randomized controlled study with 2-year follow-up. Behav Ther 2003;34:237-258.
25. 26. 27. 29. 30. 31. 32.
28.
Verkade H, Tso P. Bophysics of intestinal luminal lipids. In: Mansbach C, Tso P, Kuksis A, editors. Intestinal lipid metabolism. Kluwer Academic / Plenum Publishers; chapter 1; 1-18, 2001. Borowitz D, Durie PR, Clarke LL et al. Gastrointestinal outcomes and confounders in cystic fibrosis. J Pediatr Gastroenterol Nutr 2005;41(3):273-85.
Jones A. Drug therapies for reducing gastric acidity in people with cystic fibrosis. The Cochrane collaboration 2003; 2:1-16. De Lisle RC, Sewell R, Meldi L. Eradication of small intestinal bacterial overgrowth in the cystic fibrosis mouse reduces mucus accumulation. J Pediatr Gastroenterol Nutr 2006; 42(1):46-52. De Lisle RC. Altered transit and bacterial overgrowth in the cystic fibrosis mouse small intestine. Am J Physiol Gastrointest Liver Physiol 2007; 293(1):G104-G111.
33. 35. 34.
Lisowska A, Wjtowicz J, Walkowiak J. Small intestine bacterial overgrowth is frequent in cystic fibrosis: combined hydrogen and methane measurements are required for its detection. Acta Biochimica Polonica 2009;56(4):631-4.
Lewindon PJ, Robb TA, Moore DJ, et al. Bowel dysfunction in cystic fibrosis: importance of breath testing. J Paediatr Child Health 1998;34(1):79-82.
De Lisle RC, Roach E, Jansson K. Effects of laxative and N-acetylcysteine on mucus accumulation, bacterial load, transit, and inflammation in the cystic fibrosis mouse small intestine. Am J Physiol Gastrointest Liver Physiol 2007; 293(3):G577-G584. Norkina O, Burnett TG, De Lisle RC. Bacterial overgrowth in the cystic fibrosis transmembrane conductance regulator null mouse small intestine. Infect Immun 2004;72(10):6040-9.
121
37. 38. 39. 40. 41. 43. 42.
36.
Citters van GW, Lin HC. Ileal brake: neuropeptidergic control of intestinal transit. Curr Gastroenterol Rep 2006; 8(5):367-373. Steinkamp G, Demmelmair H, Rhl-Bagheri I et al. Energy supplements rich in linoleic acid improve body weight and essential fatty acid status of cystic fibrosis patients. J Ped Gastroenterol Nutr 2000;31(4):418-23. Regan. PT, Malagelada JR, Dimagno EP et al. Reduced intraluminal bile acid concentrations and fat maldigestion in pancreatic insufficiency: correction by treatment. Gastroenterol 1979;77:285-89.
Snipes RL. The effects of essential fatty acid deficiency on the ultrastructure and functional capacity of the jejunal epithelium. Lab Invest 1968;18(2):179-89. Egmond van AW, Kosorok MR, Koscik R et al. Effect of linoleic acid intake on growth of infants with cystic fibrosis. Am J Clin Nutr 1996;63(5):746-52. Strandvik B, Einarsson K, Lindblad A, et al. Bile acid kinetics and biliary lipid composition in cystic fibrosis. J Hepatol 1996;25(1):43-48.
Krag E, Philips SF. Active and passive bile acids absorption in man. J Clin Invest 1974;53:168694. Bijvelds MJ, Bronsveld I, Havinga R, et al. Fat absorption in cystic fibrosis mice is impeded by defective lipolysis and post-lipolytic events. Am J Physiol Gastrointest Liver Physiol 2005; 288(4):G646-53. Verkade HJ, van Asselt WA, Vonk RJ, et al. Fat absorption in premature infants: the effect of lard and antibiotics. Eur J Pediatr 1989;149(2):126-129.
44.
47. 49. 51. 52. 48.
46.
45.
Borowitz D, Durie PR, Lane LC et al. Gastrointestinal outcomes and confounders in cystic fibrosis. J Ped Gastroenterol Nutr 2005;41:273-85. Paumgartner G, Beuers U. Ursodeoxycholic acid in cholestatic liver disease: mechanisms of action and therapeutic use revisited. Hepatology 2002;36(3):525-31.
50.
Fiorotto R, Spirli C, Fabris L, et al. Ursodeoxycholic acid stimulates cholangiocyte fluid secretion in mice via CFTR-dependent ATP secretion. Gastroenterology 2007;133:1603-1613. Chinet T, Fouassier L, Dray-Charier N, et al. Regulation of electrogenic anion secretion in normal and cystic fibrosis gallbladder mucosa. Hepatology 1999;29(1):5-13. Trauner M, Fickert P, Halibasic E et al. Lessons from the toxic bile concept for the pathogenesis and treatment of cholestatic liver diseases. Wien Med Wochenschr 2008;158(19-20):542-8. Cheng K, Ashby D, Smyth R. Ursodeoxycholic acid in cystic fibrosis-related liver disease: a systematic review. J R Soc Med 1997;90(Suppl 31):6-12. Zsembery A, Jessner W, Sitter G et al. Correction of CFTR malfunction and stimulation of Ca2+-activated Clchannels restore HCO3- secretion in cystic fibrosis bile ductular cells. Hepatology 2002;35:95-104.
Lazaridis KN, Gores GJ, Lindor KD. Ursodeoxycholic acid mechanisms of action and clinical use in hepatobiliary disorders. J Hepatol 2001;35:134-46.
53.
Halibasic E, Fiorotto R, Fickert P et al. Side chain structure determines unique physiologic and therapeutic properties of norUrsodexocholic acid in Mdr2-/- mice. Hepatology 2009;49:197281.
122
54.
55. 56.
Rogers CS, Stoltz DA, Meyerholz DK, et al. Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs. Science 2008;321:1837-1841. Meyerholz DK, Stoltz DA, Pezzulo et al. Pathology of gastrointestinal organs in a porcine model of cystic fibrosis. Am J Pathol 2010;176(3):1377-89.
57. 58. 60. 59.
Ostedgaard LS, Meyerholz DK, Chen JH, et al. The F508 mutation causes CFTR misprocessing and cystic fibrosis-like disease in pigs. Sci Transl Med 2011;3(74):74ra24.
Scholte BJ, Davidson DJ, Wilke et ak. Animal models of cystic fibrosis. J Cyst Fibros 2004;3:183190. Quinton PM. Role of epithelial HCO3- transport in mucin secretion: lessons from cystic fibrosis. Am J Physiol Cell Physiol 2010;299(6):C1222-33. Quinton PM. Birth of mucus. Am J Physiol Lung Cell Mol Physiol 2010;298(1):L13-4. Garcia MA, Yang N and Quinton PM. Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. J Clin Invest 2009;119(9):2613-22.
61.
62.
63.
Kunzelmann K, Kongsuphol P, Chootip K, et al. Role of the Ca2+ - activated Clchannels bestrophin and anoctamin in epithelial cells. Biol Chem 2011;392(1-2):125-34. Amaral MD, Kunzelmann K. Molecular targeting of CFTR as a therapeutic approach to cystic fibrosis. Trends Pharmacol Sci 2007;28:334-341.
Almaca J, Tian Y, Aldehni F, et al. TMEM16 proteins produce volume-regulated chloride currents that are reduced in mice lacking TMEM16A. J Biol Chem 2009;284(42):28571-8.
123
appENdICES
NEdErLaNdSE SaMENVaTTING
Cystische Fibrose (CF), ook wel taaislijmziekte genoemd, is een ernstige, (potentieel) levensbedreigende aandoening. CF is een erfelijke ziekte en wordt veroorzaakt door een mutatie in het zogenaamde CFTR gen. Dit gen is verantwoordelijk voor het aanmaken van het CFTR eiwit, een eiwit dat met name functioneert als kanaal voor chloride en bicarbonaat in de celwand van o.a. epitheelcellen. Epitheelcellen zijn cellen die de holte van vele organen en klieren bekleden, waaronder de longen, de alvleesklier, de galwegen en de darmen. Een afwezige of verstoorde aanmaak van het CFTR eiwit, resulteert in een verstoord transport van chloride, bicarbonaat en water over de celwand naar de holte van de desbetreffende organen. Dit heeft als gevolg dat taai slijm ontstaat die de organen obstrueren en beschadigen. In de longen leidt dit tot irreversibele longschade en het geleidelijk achteruit gaan van de longfunctie. Longschade is daarmee ook de grootste oorzaak van sterfte in patinten met CF. Daarnaast kunnen diverse problemen in het maagdarmkanaal / gastro-intestinale systeem optreden. Schade aan de alvleesklier en de darmen leidt o.a. tot een verstoorde opname van vetten en daarmee tot een slechte voedingsstatus in CF patinten. Een slechte voedingsstatus leidt op zijn beurt weer tot progressieve verslechtering van de longfunctie, doordat het lichaam vatbaarder wordt voor longontstekingen. Obstructie van de galwegen kan leiden tot galweg schade en in enkele gevallen tot het ontstaan van eindstadium leverfalen. Het doel van dit proefschrift was om huidige CF therapien voor het gastro-intestinale systeem te evalueren en om potentieel toekomstige behandelopties te onderzoeken. In hoofdstuk 2 onderzochten wij het effect van een hoog-energie dieet op de voedingsstatus en groei van kinderen met CF. Het optimaliseren van de voedingsstatus in kinderen met CF is belangrijk om het achteruitgaan van de longfunctie zoveel mogelijk tegen te gaan. Dit kan bereikt worden door patinten te behandelen met (alvleesklier) enzymen die de voedingsvetten verteren en daarmee de vetabsorptie verbeteren, maar ook door patinten zo veel mogelijk vet/calorien te laten eten. Ondanks het gunstige effect op de voedingsstatus, heeft deze aanpak echter ook nadelige consequenties. Het continue benadrukken en adviseren om meer te eten, kan leiden tot negatieve psychische gevolgen en stress, niet alleen voor de CF patinten zelf, maar ook voor de ouders van kinderen met CF. Wij onderzochten of een hoog-energie dieet nodig is in relatief gezonde CF patinten om een goede voedingsstatus (lengte, gewicht en BMI) te bereiken. In retrospect, onderzochten wij de relatie tussen een hoog calorisch dieet en de voedingsstatus in een relatief homogene groep van 81 CF kinderen zonder gestoorde longfunctie. Kinderen met een betere voedingsstatus hadden geen hogere energie intake in vergelijking met de kinderen met een slechtere voedingsstatus. Deze data illustreren dat een hoge energie inname niet noodzakelijk is voor alle kinderen met CF om een goede voedingsstatus te bereiken of te handhaven. Prospectief gerandomiseerd onderzoek met aanvullende parameters zoals: vet (vrije) massa en energie verbruik is aan te bevelen in deze patinten categorie om te komen tot een individueel dieetadvies 126
In CF is een verminderde uitscheiding van verteringsenzymen door een beschadigde alvleesklier de voornaamste oorzaak van de gestoorde vetabsorptie door de darm. Echter, een groot deel (~50%) van de CF patinten behoudt een suboptimale absorptie van vetten, ondanks adequate behandeling met het alvleesklier enzym lipase, dat de vetten afbreekt. hoofdstuk 3 beschrijft een literatuuronderzoek omtrent verschillende CF-gerelateerde gastro-intestinale afwijkingen die, los van een beschadigde alvleesklier, een bijdrage zouden kunnen leveren aan de gestoorde absorptie van vet. Vooralsnog wordt de belangrijkste rol toegekend aan een verminderde uitscheiding van bicarbonaat door de alvleesklier en de twaalfvingere darm. Een verminderde uitscheiding van bicarbonaat leidt to een zuur milieu in de darm, dat zowel het afbreken van vetten (digestie/hydrolyse) als het water oplosbaar maken van vet in de darm (solubilisatie) verstoord. Het toedienen van medicatie om de zuurproductie te remmen kan daarom baat hebben in individuele CF patinten om de vetabsorptie te verbeteren. Daarnaast hebben studies met CF muizen aangetoond dat het behandelen van het taaie slijm, de chronische ontsteking en de bacterile overgroei van de dunne darm, het gewicht van de muizen verbetert. Of dit ook in CF patinten het geval is, vereist nader onderzoek. Veranderingen in essentile vetzuren en in de passagetijd van voedsel door de darm zijn beschreven in CF patinten, maar de relatie van deze factoren met de absorptie van vet is nog niet duidelijk. Het toevoegen van supplementen met essentile vetzuren aan de voeding zou wel de voedingsstatus van individuele CF patinten kunnen verbeteren. Beschreven galzoutverliezen via de ontlasting en veranderingen in het metabolisme van galzouten in CF is uitgebreid onderzocht, maar lijkt geen bijdrage te leveren aan verstoringen in vet absorptie.
in deze groep kinderen.
Eerdere studies tonen aan dat antibiotica het gewicht van CF muizen verbetert. Wij onderzochten in hoofdstuk 4, of deze verbetering toe te schrijven valt aan een verbetering van de vetabsorptie. Wij behandelden twee verschillende CF muismodellen voor drie weken met een breed spectrum antibiotica (metronidazol en ciprofloxacine). En muismodel betreft een zogenaamde CF muis die geen CFTR eiwit heeft en wordt daarom CFTR knockout muis genoemd. Het andere muismodel betreft een CF muis die de mutatie draagt die de meeste CF patinten dragen; de delta F508 mutatie. De delta F508 muizen hebben nog enige restactiviteit van het CFTR eiwit en zijn om deze reden minder ziek en hebben een betere vetabsorptie dan de CFTR knockout muizen. Omdat beide muismodellen geen schade hebben aan de alvleesklier, zijn ze een uitstekend model om alleen de invloed van een verstoorde vetabsorptie in de CF darm te onderzoeken. De CFTR knockout muizen lieten, zoals aangetoond in een eerdere studie, een toename in het gewicht zien na antibiotica behandeling. Echter, de vetabsorptie verbeterde niet. De toename in gewicht is om deze reden waarschijnlijk toe te schrijven aan een afname in energieverbruik doordat antibiotica in voorgaande studies, een gunstig effect liet zien op de behandeling van bacterile overgroei, ontsteking en slijmophoping in de dunne darm. De delta F508 muizen, maar ook de controle muizen zonder CF, hadden 127
een snellere vetabsorptie (gemeten met stabiel isotoop gelabelde vetten) na antibiotica behandeling in vergelijking met de muizen die geen antibiotica behandeling hadden ondergaan. Een onderliggend mechanisme die deze versnelde vetabsorptie zou kunnen verklaren, zoals behandeling of verandering in de hoeveelheid bacterin in de dunne darm of veranderingen in galzoutsamenstelling, werd in deze muizen niet aangetoond. In tegenstelling tot de CFTR knockout muizen, was het gewicht van de delta F508 muizen na antibiotica behandeling niet verbeterd. De waarde van een versnelde vetabsorptie moet in toekomstige studies nog worden onderzocht.
In hoofdstuk 5, evalueerden wij de werking van het galzout ursodeoxycholzuur (UDCA) in CF condities. UDCA is een galzout dat als behandeling fungeert bij verschillende ziekten van de galwegen en de lever, waaronder CF gerelateerde leverziekte. UDCA is therapeutisch werkzaam doordat het de doorstroming van gal door de galwegen stimuleert en de toxiciteit van schadelijke galzouten op de galwegen vermindert. Ondanks dat UDCA standaard wordt ingezet bij CF gerelateerde leverziekte, is de werkzaamheid in CF condities niet onomstreden, mede omdat verscheidene studies suggereren dat UDCA alleen werkzaam is via het CFTR eiwit. Om deze reden, onderzochten wij de invloed van UDCA op de galdoorstroming, galzoutsynthese en galzoutsamenstelling in CFTR knockout muizen. Wij behandelden CFTR knockout en controle muizen (d.w.z. muizen zonder CF), met een acute veneuze infusie van UDCA of met een chronisch (3 weken) UDCA-verrijkt of normaal dieet. Onze resultaten lieten zien dat UDCA in zowel het acute als chronische experiment de galdoorstroming in zowel de CFTR knockout als in de controle muizen zonder CF stimuleerde tot wel 500% in vergelijking met de controle groep zonder UDCA. Tevens verminderde UDCA de hydrofobiciteit (toxisch) van de gal, door de synthese van het galzout cholaat te verminderen en de galzouten in de gal bijna volledig te vervangen voor het hydrofiele (beschermende) galzout UDCA. Wij concluderen dat in muizen, de stimulerende werking van UDCA op de galdoorstroming en de door UDCA genduceerde veranderingen in galzoutsamenstelling blijft bestaan in afwezigheid van CFTR. In hoeverre het gemeten effect in dezelfde orde van grote verwacht kan worden in CF patinten vereist nader onderzoek. In hoofdstuk 6, onderzochten wij de rol van door calcium geactiveerde chloride kanalen (CaCCs) in CF muizen en CF varkens. CF muizen, in vergelijking met CF varkens, hebben een zeer milde vorm van CF. CF muizen hebben voornamelijk darmproblemen, maar nauwelijks tot geen schade aan de longen, de alvleesklier en de lever en galwegen. CF varkens daarentegen hebben forse schade in al de voornoemde organen. En uitgesproken verschil is dat alle CF varkens geboren worden met een microgalblaas; een zeer kleine, niet functionerende galblaas die volledig geobstrueerd raakt met taai slijm. In de CF muizen worden geen afwijkingen aan de galblaas gevonden. Wij onderzochten of dit verschil te verklaren valt door de activiteit van door CaCCs, in het bijzonder van het recent ontdekte chloride kanaal: TMEM16A. Recent onderzoek heeft aangetoond dat TMEM16A het meest prominent aanwezige CaCC is in de celwand van epitheelcellen. In zogenaamde Ussing Chambers, stimuleerden wij CFTR en CaCCs in galblazen van CF 128
muizen, CF varkens en controle dieren zonder CF en wij maten de ontstane elektrische stroom van anionen (chloride en bicarbonaat) door deze kanalen. De muizen hadden, in vergelijking met de varkens, een zeer hoge activiteit van CaCCs, terwijl de activiteit van CFTR gelijk waren tussen beide dieren. Het CaCC TMEM16A, kleurde (middels immunohistochemie) sterker aan in de muizen galblazen in vergelijking met de varkens galblazen, in overeenstemming met de gemeten anion stroom. Echter, de RNA expressie van TMEM16A, dat aan de synthese van het TMEM16A eiwit vooraf gaat, correleerde niet met de resultaten van de Ussing Chamber. Wij concluderen dat de ernstige galblaas afwijkingen in de CF varkens, in vergelijking met de CF muizen, gepaard gaan met een verminderde activiteit van CaCCs. Echter, of het hiervoor verantwoordelijke eiwit het CaCC TMEM16A is, valt uit deze data niet te concluderen en vereist nader onderzoek. Het stimuleren van alternatieve chloride kanalen, anders dan CFTR, zou in de toekomst wellicht uitkomst kunnen bieden om orgaan schade in CF patinten te beperken.
129
daNKWOOrd
daNKWOOrd
Bij het aanmaken van het documentje dankwoord, begint het langzaam door te dringen dat het toch ECHT gelukt is. Ik kan met veel plezier op een geweldige en leerzame onderzoeksperiode terug kijken. Als geneeskunde student heb ik kennis gemaakt met het doen van wetenschappelijk onderzoek via de Junior Scientific Masterclass. Toen ik daar aangaf dat ik op het laboratorium van de kindergeneeskunde onderzoek wilde gaan doen, was de reactie: Ik heb nog nooit iemand gekend die daar onderzoek heeft gedaan en niet begon te stralen! Dit kan ik inmiddels beamen. Ik heb echt genoten van de sfeer bij de kindergeneeskunde, te danken aan alle mensen met wie ik heb mogen samenwerken. Om deze reden wil ik al mijn collegas bedanken voor de geweldige tijd die ik mede dankzij hen, heb mogen ervaren. Ik zou graag enkele collegas, vrienden en familie in het bijzonder willen bedanken.
Mijn promotor prof. dr. H.J. Verkade. Beste Henkjan, ik ben zeer dankbaar dat jij mijn promotor bent geweest. Ik heb op vele vlakken van jou mogen leren, niet alleen op wetenschappelijk, maar ook op persoonlijk vlak. Ik heb jou leren kennen als iemand met een onuitputtelijke (!) passie voor wetenschap, een oprechte compassie voor mensen en een (voortdurend aanwezige) positieve en integere houding. Ik wil jou bedanken voor het voorbeeld dat jij afgelopen jaren voor mij bent geweest. Mijn co-promotor dr. H.R. de Jonge. Beste Hugo, ik wil jou bedanken voor jouw eindeloze geduld en tijd die jij hebt genomen om mijn vele vragen, over met name ion transport, te beantwoorden. Ik wil mijn waardering uitspreken voor de moeite die je hebt genomen om mij (altijd) snelle, duidelijke en uitgebreide antwoorden te geven. De leescommissie, prof. dr. E.J. Duiverman, prof. dr. R.O.B. Gans en prof. dr. A.K. Groen voor het beoordelen van mijn proefschrift. Lieve Els, dank voor alle afspraken, jouw scherpe oog om het hele traject vlekkeloos te laten verlopen en jouw warme persoonlijkheid en oprechte interesse.
Frank, bedankt voor de leuke en leerzame samenwerking. Ondanks de drukte in de kliniek, kon ik altijd bij jou aankloppen. Dankzij jouw kritische blik op de review (nog niet opsturen!) is er een mooi gezamenlijk stuk uit gekomen. Uitgaande van een 4-jarig promotietraject, lig jij, volgens mijn berekeningen (rekening houdend met 4 onderzoeksmaanden per jaar) aardig op schema. Nog even doorzetten! Rotterdam, Marcel en Huub, bedankt voor jullie hulp tijdens het antibiotica experiment, zonder jullie had ik het niet kunnen doen (Huub, extra dank voor het eindeloos verzamelen van de galblazen!). Kansas, prof. De Lisle, I would like to give you a special thanks. I really appreciate your effort for always answering my questions and for your collaboration on the fat absorption experiment. It was nice to meet you personally in Baltimore. Iowa, Prof. dr. Welsh, Lynnda, Jeng-Haur and Sarah, I would like to thank you for the opportunity to collaborate with you on the CF piglets. Thank you for your input and hard work. 130
Aan al mijn collegas van het lab. Als ik alle namen ga noemen ben ik bang dat ik mensen zal vergeten. Ik wil daarom iedereen bedanken voor de positieve en gezellige sfeer op het lab en ieders bereidheid om vragen te beantwoorden en hulp te bieden waar nodig. Dankzij jullie heb ik een bijzondere tijd gehad die voorbij is gevlogen! Prof. Groen, Bert, ik wil jou bedanken voor de goede tijd die ik heb gehad op het lab en voor alle prikkelende en leerzame vragen tijdens de transport meetingen. Jij hebt mij geleerd dat stressen geen zin heeft en dat het bovenal belangrijk is te genieten van de dingen die je leert. Renze (met name dank voor de eyeopener bij het antibiotica experiment), Henk (dank dat je mij kennis hebt laten maken met de bijzondere wereld van het blotten, het leek even of ik de smaak te pakken had, maar helaas is het (nog niet) mijn favoriete hobby geworden), Juul (dank voor je hulp bij de immunohistochemie en je openheid om altijd een praatje te maken), Ingrid (veel dank voor je hulp bij het analyseren van de pieken, nog steeds indrukwekkend hoe snel jij hier door heen vliegt), Theo Boer (veel dank voor de isotopen metingen; ondanks de vele vertragingen en technische uitdagingen!), Frans Stellaard (dankzij jou ben ik (iets) wijzer geworden wat betreft galzoutkinetiek. Dank, dat je altijd in alle rust mij uitleg wilde geven en ondanks dat ik herhaaldelijk zei dat het echt de laatste vraag van de dag was, je altijd mijn aanvullende vragen ook wilde beantwoorden!) en Fjodor (dankzij jou is het allemaal goed gekomen met de primers en probes voor de sus scrofa, veel dank voor jouw inzet). Speciale dank voor de spijsgirls. Onze performance op het oratiefeest van the very smart professor doctor Rings was toch wel n van de hoogtepunten van onze tijd samen. Mientje, paranimfje, samen begonnen, samen klaar. Ik wil jou met name bedanken voor jouw altijd luisterend oor in de tijd dat het niet zo goed ging met mijn moeder, dat heeft mij erg goed gedaan, thanks. An, zonnestraaltje, ik heb genoten van jouw vrolijkheid en natuurlijk van onze gezamenlijke spin uurtjes (het zweten gaat steeds beter!). Mjet, jij hebt mij aan het begin (bijna) letterlijk aan de hand genomen toen ik mijn eerste experiment moest voorbereiden. Dank dat jij mij hierin hebt gesteund en geholpen. Mgot, altijd in voor een goed gesprek. Bedankt voor de tijd in Veldhoven en het nog even veranderen en oefenen van mijn presentatie. Ondanks dat een ieder van jullie blijft plakken bij de kindergeneeskunde, hoop ik dat we elkaar niet uit het oog verliezen. Snel weer even daten! Lieve Anouk en Niek. Als ik aan jullie twee denk krijg ik altijd een glimlach op mijn gezicht. Jullie telefoongesprekjes gedurende de dag zal ik wel missen. Ondanks dat ik door Niek altijd gestimuleerd ben om op het lab te gaan staan, ben ik met name blij dat ik jullie heb leren kennen buiten het lab. Tot slot wil ik al mijn vrienden en familie bedanken. Ondanks dat het voor sommigen misschien een raadsel is geweest waar ik mee bezig ben, bedankt voor jullie steun, bemoedigingen en interesse! Lieve Farah, misschien overbodig om te zeggen, maar ik ben super blij met onze vriendschap en onze artsenuurtjes. Je bent altijd een inspiratie 131
daNKWOOrd
voor mij. Lieve Viggo, ik wil jou in het bijzonder bedanken dat je fotomodel wilde zijn voor tante Jan. Je hebt heel erg goed je best gedaan, want het was best moeilijk om de roos goed vast te houden n in de camera te kijken n ook nog te glimlachen! Dankzij jou is het boekje super mooi geworden. Lieve Petra en Jeroen, ik wil jullie hier ook voor bedanken, met name dat jullie de twijfels die ik nog had over de voorkant van het proefschrift, hebben weg genomen. Lieve paps en mams, dank dat jullie trots op mij zijn en mij er altijd aan herinneren dat ik ook moet uitrusten en maar n ding tegelijk kan doen. Mijn lieve man, die mij altijd weer met twee benen op de grond laat staan (als het niet lukt, kun je altijd nog onderbroeken verkopen bij de HEMA), jij bent de grootste schat in mijn leven.
daNKWOOrd
Marjan
132
BIOGraFIE
BIOGraFIE
Marjan Wouthuyzen-Bakker werd geboren op 7 december 1978, te Delfzijl. Nadat ze haar MAVO diploma behaalde, volgde ze een MBO opleiding om schoonheidsspecialiste te worden. Na een jaar fulltime als schoonheidsspecialiste werkzaam te zijn geweest, hakte Marjan de knoop door om haar carrire voort te zetten in de gezondheidszorg. Ze volgde de HBO opleiding tot verpleegkundige en werd, na een colloquium doctum in de scheikunde en natuurkunde te hebben behaald, in 2002 ingeloot voor de studie geneeskunde aan de Rijksuniversiteit te Groningen. Vanaf haar vierde studiejaar geneeskunde, startte Marjan met het doen van wetenschappelijk onderzoek via de Junior Scientific Masterclass. Bij de afdeling maag-darm-leverziekten van de Beatrix Kinderkliniek in het Universitair Medisch Centrum in Groningen, werkte ze, onder leiding van prof. dr. H.J. Verkade, aan een project over de invloed van voeding op de groei van kinderen met Cystische Fibrose (CF). Dit project mondde uit in een MD-PhD traject, waar ze met name dierexperimenteel onderzoek heeft verricht naar verschillende aspecten van CF in het intestinale en hepato-biliaire systeem, zoals beschreven in dit proefschrift. Vanaf mei 2011 is Marjan gestart aan de internisten opleiding onder supervisie van prof. dr. R.O.B Gans in het Universitair Medisch Centrum Groningen. Marjan is getrouwd met Willem Wouthuyzen en samen zijn zij woonachtig in Groningen.
133

Thesis CF 4

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Thesis CF 4

Uploaded by

Copyright:

Available Formats

Cystic Fibrosis and the Gastro-Intestinal Tract

Graduate school for drug exploration

University Medical Center Groningen

978-90-367-5090-5 (printed version) 978-90-367-5091-2 (digital version)

Cystic Fibrosis and the Gastro-Intestinal Tract

geboren op 7 december 1978 te Delfzijl

Farah Klingenberg-Salachova Willemien de Vries

Median predicted survival age, 1985-2007 42

40 38 36 34 32 30 28 26 24 1985 1990 1995 2000 2005

10. 12. 13. 14. 16. 15. 17. 11.

18. 19. 20.

21. 22. 23. 25. 24.

30. 31. 33. 32. 34. 35.

36. 37. 38. 39. 40.

41. 42. 43. 44. 46. 47. 45.

66. 68. 67.

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

FEV1 > 80% 440 measurements n = 183

FEV1 < 80% 217 measurements n = 108

6-9 years 150 measurements n = 81

6-9 years 43 measurements n = 31

2 measurements per child: n = 44

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

ChapTEr 2 INTaKE aNd GrOWTh

12. 14. 15.

ChapTEr 2 INTaKE aNd GrOWTh

18. 19. 20. 21. 22. 23. 24. 25.

33. 34. 35. 37. 38. 40. 41. 36.

ChapTEr 2 INTaKE aNd GrOWTh

M. Wouthuyzen-Bakker1 F.A.J.A. Bodewes1 H.J. Verkade1

Journal of Cystic Fibrosis 2011; 10(3): 150-8

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

Essential fatty acid deficiency

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

10. 12. 13.

16. 17. 18.

23. 24. 25. 27.

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

31. 32. 33. 34. 35. 36. 37. 38.

42. 43. 44.

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS

45. 46. 47. 48.

52. 53. 54.

ChapTEr 3 FaT MaLaBSOrpTION IN CYSTIC FIBrOSIS