You are on page 1of 57

FACULTAD DE MEDICINA HUMANA

Gua de prcticas BIOLOGA CELULAR Y MOLECULAR 2012-II


Responsable Profesores
Blgo Lezama Vigo, Hlmer, MSc Blgo. Loayza Estrada, Carolina. (Coordinador) Blgo. Nolasco Crdenas, Oscar, MSc. Blgo. Alata Linares, Vicky, Mg Blgo. Quintana Cceda, Milagros, MSc. Blgo. Vadillo Glvez, Giovana, Mg Q.F. Ramrez Rojas, Luisa. Blgo. Becerra Gutirrez, Lizzie, Dr. Blgo. Abanto Daz, Carlos, Mg. Blgo. Rodrguez Alayo, Nstor, Mg Blgo. Guzmn Vigo, Csar, Mg Md. Ruiz Velazco, Mara Blgo. Murrugarra Bringas, Victoria. Blgo. Morales Ramos, Jorge. Md. Snchez Castillo, Jampieer.

APELLIDOS, NOMBRES:_________________________________________ GRUPO:___________ DIA:____________ PROFESOR:______________


1

INTRODUCCIN

La biologa es la ciencia de la vida que estudia la estructura y funcin de los organismos vivos y sus componentes. Las aplicaciones de la investigacin bsica en biologa molecular son numerosas, desde la tecnologa para trasplantar corazones, manipular genes, disear frmacos contra microorganismos patgenos hasta actividades como incrementar la produccin mundial de alimentos. La gua de prcticas del curso de Biologa Celular y Molecular tiene como objetivo entrenar al estudiante en los procedimientos de laboratorio y desarrollar su pensamiento cientfico, de manera que lo lleve a comprender los trminos bsicos de la Biologa Molecular. El estudiante debe emplear esta gua en cada prctica de laboratorio y estar informado sobre la prctica que se llevar a cabo en cada sesin, anticipadamente. La gua se ha dividido en tres partes de acuerdo a cada evaluacin parcial. La primera parte comprende la clula y componentes celulares. La segunda parte incluye procesos celulares como respiracin, permeabilidad, divisin celular y la visualizacin de organelas. En la tercera parte se analizara el proceso de meiosis, comprensin del cdigo gentico y tcnicas de manipulacin de cidos nucleicos. El alumno debe cumplir con los objetivos planteados al final de cada prctica. As mismo debe presentar su gua de prctica terminada la misma, con las actividades requeridas en la sesin de prctica, debidamente desarrolladas.

PROGRAMACIN DE CONTENIDO

N
1

CONTENIDO
Introduccin y organizacin de grupos de prctica. Bioseguridad Microscopa tcnicas de manipulacin y enfoque de muestras

3 4 5

Tcnicas de coloracin y observacin de clulas Procariotas Observacin de clulas Eucariotas Demostracin experimental del fenmeno de difusin. Permeabilidad celular Observacin de movimientos celulares: Ciclosis. Observacin de organelas celulares. Mitocondria, Cloroplasto, Vacuolas PRACTICA CALIFICADA SEMANA DE LA MEDICINA Actividad enzimtica Fermentacin Mitosis. Meiosis

7 8

9
10 11

12 13 14

Fecundacin Extraccin de DNA. Electroforesis Cdigo Gentico y Traduccin de Protenas

15

Estudio de Rasgos Genticos en el Hombre

16

PRACTICA CALIFICADA FINAL

17

Examenes Finales

PRCTICA N 1
BIOSEGURIDAD
El trabajo en el Laboratorio requiere de la observacin de una serie de normas de seguridad que eviten posibles accidentes debido al desconocimiento de lo que se est haciendo o a una posible negligencia de los alumnos que estn en un momento dado, trabajando en el Laboratorio. A continuacin se enumeran una serie de medidas e indicaciones de seguridad que deben tomarse durante las prcticas de laboratorio.

NORMAS PERSONALES 1. Lea con atencin, antes de cada prctica, las indicaciones de su gua. Siga todas las instrucciones a menos que el profesor realice alguna modificacin. 2. Cada grupo de prcticas se responsabilizar de su zona de trabajo y de su material. Se trabajar con cuidado y de manera organizada. As mismo se mantendr cada mesa de trabajo limpia, seca y ordenada. 3. Es obligatorio la utilizacin de mandil que le cubra brazos, piernas, torso y pies. Estn prohibidos el uso de sandalias, pantalones cortos, faldas, polos cortos, etc. en el laboratorio. La persona inapropiadamente vestida para trabajar en el laboratorio no podr ingresar. 4. No se debe llevar las manos a la boca ni a la cara pues pueden estar contaminadas. 5. Si tienes el pelo largo, deber estar recogido. 6. Est terminantemente prohibido fumar, tomar bebidas y comer. 7. En caso de derrame, accidente o dao avise inmediatamente al profesor. 8. Al trmino de cada prctica limpiar el rea de trabajo y lavar los materiales utilizados con agua de cao. Lavarse las manos meticulosamente con agua y jabn. Finalmente cerciorarse que las llaves de gas y agua estn cerradas.

REACTIVOS QUIMICOS 1. Usar lentes de seguridad cuando trabaje con reactivos qumicos peligrosos que puedan salpicar o derramarse. 2. Antes de utilizar un compuesto, asegurarse bien de su necesidad, fijarse bien en el rtulo. 3. Como regla general, no coger ningn producto qumico. El profesor o profesora te lo proporcionar. 4. Nunca devuelva los sobrantes de los productos a los frascos de origen sin consultar con el profesor. 5. Es muy importante que cuando los productos qumicos de desecho se viertan en la pila de desage, aunque estn debidamente neutralizados, debe dejarse que circule por la misma, abundante agua. 6. No tocar con las manos y menos con la boca, los productos qumicos. 7. No pipetear con la boca. Utilizar una bombilla de succin. 8. Los cidos requieren un cuidado especial. Cuando queramos diluirlos, siempre echaremos el cido sobre agua.

9. Los productos inflamables (gases, alcohol, ter, etc.) deben estar lejos de fuentes de calor. Si hay que calentar tubos con estos productos, se har al bao Mara, nunca directamente a la llama. 10.Manipule con precaucin los solventes voltiles e inflamables como el ter, acetona y metanol. Nunca evapore estos solventes en una hornilla al abierto. Utilice siempre un sistema de condensacin eficiente. 11.Si se vierte sobre ti cualquier cido o producto corrosivo, lvate inmediatamente con mucha agua y avisa al profesor. 12.Al preparar cualquier disolucin se colocar en un frasco limpio y rotulado convenientemente. 13.Encienda fuego en el laboratorio solo si no existen solventes inflamables en la vecindad. La persona que encienda el fuego debe primero verificar que no exista otra persona que este trabajando con solventes inflamables en el laboratorio.

MATERIAL DE VIDRIO 1 Use material de vidrio limpio y no rajado. 2 El vidrio caliente no se diferencia a simple vista del vidrio fro. Para evitar quemaduras use guantes o trapos. 3 Si tienes que calentar a la llama el contenido de un tubo de ensayo, observa cuidadosamente estas dos normas: -Ten sumo cuidado y cercirate que la boca del tubo de ensayo no apunte a ningn compaero. Puede hervir el lquido y salir disparado, por lo que podras ocasionar un accidente. -Calienta por la pared lateral del tubo de ensayo, nunca por el fondo; agita suavemente (mira la figura).

EQUIPOS ELCTRICOS 1 Manipule cualquier equipo elctrico con las manos secas y asegrese que el rea de trabajo tambin este seca. 2 Ningn cordn elctrico debe colgar fuera de la mesa de trabajo. 3 Cuando desconecte algn equipo del tomacorriente, jlelo por el enchufe y no por el cordn.

UTILIZACION DE BALANZAS

1 Cuando se determinan masas de productos qumicos con balanza, se colocar papel sobre los platos de la misma y si el producto fuera corrosivo, se utilizar una luna de reloj. 2 Se debe evitar cualquier perturbacin que conduzca a un error, como vibraciones debidas a golpes, aparatos en funcionamiento, soplar sobre los platos de la balanza, etc.

MANIPULACIN DE ESPECMENES

1 Manipule los microorganismos crecidos en una placa petri o tubo de cultivo con cuidado extremo. 2 Nunca llevar a la boca plantas o partes de ellas como semillas, frutos y hojas. NIVELES DE RIESGO BIOLOGICO EN UN LABORATORIO
Clasificacin de microorganismos por grupos de riesgo para el trabajo de laboratorio: Grupo de riesgo 1 (riesgo individual y poblacional escaso o nulo) Microorganismos que tienen pocas probabilidades de provocar enfermedades en el ser humano o los animales. Grupo de riesgo 2 (riesgo individual moderado, riesgo poblacional bajo) Agentes patgenos que pueden provocar enfermedades humanas o animales pero que tienen pocas probabilidades de entraar un riesgo grave para el personal de laboratorio, la poblacin, el ganado o el medio ambiente. La exposicin en el laboratorio puede provocar una infeccin grave, pero existen medidas preventivas y teraputicas eficaces y el riesgo de propagacin es limitado. Grupo de riesgo 3 (riesgo individual elevado, riesgo poblacional bajo) Agentes patgenos que suelen provocar enfermedades humanas o animales graves, pero que de ordinario no se propagan de un individuo a otro. Existen medidas preventivas y teraputicas eficaces. Grupo de riesgo 4 (riesgo individual y poblacional elevado) Agentes patgenos que suelen provocar enfermedades graves en el ser humano o los animales y que se transmiten fcilmente de un individuo a otro, directa o indirectamente. Normalmente no existen medidas preventivas y teraputicas eficaces. BARRERAS DE CONTENCION Los laboratorios presentan diversas barreras de contencin que previenen el escape y dispersin de agentes biolgicos de riesgo. Barrera primaria: Es aquella que protege al personal y al ambiente inmediato del agente de riesgo (vestimenta de uso exclusivo, cabina de bioseguridad y equipos provistos de dispositivos de seguridad). Barrera secundaria: Es aquella que protege el ambiente externo contra los agentes de riesgo (diseo del laboratorio e implementacin de equipos de seguridad de acuerdo al nivel de Bioseguridad). Barrera microbiolgica: Es un dispositivo o sistema que evita o limita la migracin de microorganismos entre los espacios situados a ambos lados del mismo y permite controlar la concentracin de microorganismos en el ambiente, dentro de lmites prefijados. Tiene como objetivo proteger al operador o al operador y al proceso. Barrera microbiolgica parcial: Es un dispositivo o sistema que limita la migracin de microorganismos entre los ambientes situados a ambos lados del mismo. En este tipo de barrera se recomiendan Prefiltros, Filtros HEPA (Filtros de alta eficiencia para el control de partculas en suspensin) as como cabinas de bioseguridad clase I o II, lo cual depender del tipo de trabajo que se efecta en un determinado laboratorio. Barrera microbiolgica absoluta: Es un dispositivo o sistema hermtico, a prueba de filtraciones de aire o gas, que evita en forma total la migracin de microorganismos entre el ambiente confinado por la barrera y el ambiente exterior de la misma. La barrera microbiolgica absoluta puede confinar al producto o proceso, dejando al operador fuera de la misma o viceversa. En este caso se recomienda una cabina de bioseguridad de tipo III. Barrera qumica: Son dispositivos o sistemas que protegen al operador del contacto con substancias irritantes, nocivas, txicas, corrosivas, lquidos inflamables, sustancias productoras de fuego, agentes oxidantes y sustancias explosivas. En este caso se recomiendan una cabina de seguridad qumica. Siempre utilice tcnicas de esterilidad (a la llama del mechero, guantes, palillos estriles, etc.).

Barrera fsica: Son dispositivos o sistemas de proteccin individual o colectiva que protegen contra las radiaciones ionizantes, no ionizantes, ruidos, carga calrica, quemaduras y vibraciones excesivas.

NIVELES DE BIOSEGURIDAD
De acuerdo con el nivel de riesgo, el tipo de laboratorio, la barrera de contencin requerida, los procedimientos y tcnicas a usar, se han establecido los siguientes niveles de Bioseguridad. Nivel de Bioseguridad I: Es aquel que corresponde a las actividades desarrolladas en un laboratorio bsico, por personal adiestrado en los procedimientos que se ejecutan en l. En este nivel se trabaja con agentes clasificados en el Grupo de riesgo I por presentar un peligro mnimo para el personal del laboratorio y para el ambiente. En el nivel de Bioseguridad I no se requiere equipo especial ni un diseo especfico de las instalaciones. El personal de estos laboratorios es generalmente supervisado por un cientfico con entrenamiento en microbiologa. Nivel de Bioseguridad II: Es aquel que corresponde a las actividades desarrolladas en un laboratorio bsico, por personal adiestrado en el manejo de agentes de riesgo del grupo II. Es similar al nivel I y en l se manejan agentes de peligro moderado hacia el personal y el ambiente, pero difiere del nivel I en las siguientes caractersticas: 1. El personal de laboratorio tiene entrenamiento especfico en el manejo de agentes patgenos. 2. El acceso al laboratorio es restringido cuando se est realizando algn trabajo. 3. Se toman precauciones extremas con instrumentos punzo cortantes contaminados. 4. Ciertos procedimientos en los cuales pueden salpicar los agentes o aerosoles se llevan a cabo en cabinas de trabajo microbiolgico. Nivel de Bioseguridad III: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de contencin. El personal debe contar con adiestramiento especfico para el manejo de agentes de alto riesgo clasificados en el grupo de riesgo III. En el laboratorio se realiza trabajo con agentes que pueden causar un dao serio y potencialmente mortal como resultado de la inhalacin o exposicin a los mismos. El laboratorio cuenta con un diseo y caractersticas especiales tendientes a proteger al operador y al ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de proteccin siguiendo protocolos rigurosos. Los laboratorios se mantienen con una presin de aire negativa, lo cual ayuda a impedir que los agentes nocivos escapen al ambiente. Nivel de Bioseguridad IV: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de contencin mxima. Este nivel es el que se utiliza para trabajar con agentes biolgicos clasificados en el grupo de riesgo IV por representar un alto riesgo individual de contagio y que adems son un riesgo para la vida. Los agentes nuevos que presentan caractersticas antignicas, patognicas u otras similares a agentes de nivel III y IV son confinados a nivel IV hasta que exista suficiente informacin cientfica para establecer a cual grupo de riesgo pertenecen. El personal que trabaja en los laboratorios de nivel IV tiene entrenamiento especfico y extensivo en el manejo de agentes infecciosos, y cuenta con entrenamiento para trabajar en el ambiente estril y controlado. El laboratorio cuenta con un diseo y caractersticas especiales tendientes a proteger al operador y al ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de proteccin de caractersticas superiores a las exigidas para el trabajo en un laboratorio de nivel III. Los trajes estn diseados para cubrir la totalidad del cuerpo, presentan un sistema de respiracin individual asociado y una leve sobrepresin interna para evitar as la entrada accidental de partculas infecciosas. Los laboratorios se mantienen con una presin de aire negativa, lo cual ayuda a impedir que los agentes nocivos

escapen al ambiente.

TIPOS DE LABORATORIOS
En relacin con el grado de riesgo los laboratorios combinan las caractersticas de diseo, construccin, medios de contencin, equipo, prcticas y procedimientos de operacin necesarios para trabajar con agentes patgenos de los distintos grupos de riesgo. De esta manera los laboratorios se clasifican en 3 categoras: Laboratorio bsico: Dividido en dos grupos, el de nivel de bioseguridad 1;y el de nivel de bioseguridad 2; Laboratorio de contencin: con nivel de bioseguridad 3, y 7

Laboratorio de contencin mxima: con nivel de bioseguridad 4.

TRABAJO GUIADO
1.-Complete los nombres de los distintos smbolos de bioseguridad que se presentan a continuacin.

1.- complete el recuadro :


NIVEL DE BIOSEGURIDAD CARACTERISTICAS EJEMPLOS DE PATOGENOS

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 2
9

MICROSCOPA Y ENFOQUE DE MUESTRAS

I.

FUNDAMENTO

La invencin del microscopio se atribuye a Johannes y Zacharias Jansen (1590) y el descubrimiento de la estructura celular de los organismos a Robert Hooke (1665). Posteriormente, en 1683 y con un microscopio muy rudimentario Leeuwenhoek descubri un universo enmarcado slo por decenas de micrmetros. Desde aquel entonces, el perfeccionamiento continuo al microscopio ha permitido a la Ciencia profundizar cada vez ms en el conocimiento de la ultraestructura celular y de las relaciones intercelulares. MICROSCOPIO COMPUESTO El microscopio es un instrumento ptico que se compone de una serie de lentes para conseguir imgenes aumentadas de objetos diminutos que por su extrema pequeez no son visibles al ojo humano. El microscopio compuesto est constituido de un SISTEMA OPTICO destinado a obtener una imagen aumentada del objeto, un SISTEMA MECANICO que sostiene los distintos elementos pticos y los objetos que se van a examinar y un SISTEMA DE ILUMINACIN. CARACTERISTICAS DEL MICROSCOPIO Dado que la imagen del microscopio no es real sino virtual, se han determinado algunos trminos de medida microscpica: En cualquier microscopio el poder de resolucin define su rendimiento ptico, porque es su capacidad para ver como separados dos puntos que realmente lo estn pero que nuestro ojo slo puede ver como una entidad nica (es decir es su capacidad de entregar imgenes bien ntidas). El mximo poder de resolucin del microscopio ptico es de 0,2 micrmetros(0,2 m), debido a que la longitud de onda de la luz utilizada (400-700 m) es un factor limitante. El ojo humano tiene un poder de resolucin de aproximadamente 100 micrmetros. El lmite de resolucin puede definirse como la distancia mnima que debe existir entre dos puntos para que se puedan distinguir como separados. El lmite de resolucin se puede calcular a partir de la siguiente ecuacin: K L.R. = --------------A.N = longitud de onda de luz AN = apertura numrica de cada lente objetivo es su capacidad para captar la mxima cantidad de la luz difractada por el objeto. Depende del ndice de refraccin del medio. Recuerda: A menor lmite de resolucin mayor ser el poder de resolucin Resolucin y magnificacin Mximas Instrumento ptico Resolucin Magnificacin Ojo humano 0,1 mm Microscopio ptico 0,2 u 2500 Microscopio electrnico 0,1 nm 1000 000 II. OBJETIVOS Reconocer las partes del microscopio ptico. -Conocer su utilizacin para la observacin de distintas muestras biolgicas. K = constante = 0.61

10

III. MATERIALES Y MTODOS En el laboratorio encontrars: - Microscopio compuesto - Aceite de inmersin - muestras fijadas IV. PROCEDIMIENTO. Se reconocern las partes de un microscopio ptico. Sealar las partes del mismo en el dibujo adjunto. 1. SISTEMA OPTICO. El sistema ptico est constituido por: Objetivos: sistema de lentes convergentes que acta como una lente que se encuentran montados en el revolver. Lo usual es que cada microscopio tenga cuatro objetivos de diferentes aumentos ( 4x, 10x, 40x, 100x) los que se clasifican en: Objetivos en seco: en los que el aire se interpone entre la lente y la preparacin. Objetivos de inmersin: en el cual un lquido ( aceite) se interpone entre la lente y la preparacin. Ocular: El ocular es una lente convergente que recoge la imagen intermedia producida por el objetivo y forma una nueva imagen virtual, derecha, y amplificada un cierto nmero de veces (X veces, segn se indica en el propio ocular). Los aumentos ms comunes son 10X y 16X. 2.-SISTEMA DE ILUMINACIN. Condensador: Sistemas de lentes convergentes que concentra el haz de luz sobre la preparacin. Diafragma: Sirve para regular la cantidad de luz que llega a la preparacin. Fuente de luz: Puede ser natural o artificial (ampolleta). Portafiltro: Opcional, sirve para colocar filtro de distintos colores para mejorar el contraste. 3.-SISTEMA MECANICO Tubo ptico: Cilndrico ahuecado destinado a llevar el ocular en su extremo superior y los objetivos montados en el revlver en su extremo inferior. La longitud del tubo debe ser siempre precisa. Revlver: Pieza metlica situada en la parte inferior del tubo que por rotacin sita los diferentes objetivos en posicin de trabajo. Platina: Superficie plana con una perforacin central para permitir el paso de la luz hacia preparacin. Posee un carro que sostiene la preparacin y que puede desplazarla hacia delante y hacia el lado izquierdo o hacia el lado derecho. Tornillo Macromtrico: Mecanismo de enfoque de avance rpido. Tornillo Micromtrico: Mecanismo de enfoque con precisin o ajuste fino. Base o Pie: Estructura slida y pesada que sostiene y da estabilidad a todo el instrumento. Columna: Vstago vertical que se articula con la base y con el tubo del microscopio y lleva el mecanismo de

11

movimiento del mismo. NOTA IMPORTANTE. Presta mucha atencin al manejo del microscopio que tienes a tu cargo. Debes hacerlo cuidadosamente porque son aparatos muy delicados y dejars a consigna tu documento de identificacin.

MANEJO DEL MICROSCOPIO PTICO


1 Colocar el objetivo de menor aumento en posicin de empleo y bajar la platina completamente. 2 Colocar la preparacin sobre la platina sujetndola con las pinzas metlicas. 3 Comenzar la observacin con objetivo de menor aumento. Si la preparacin es de bacterias emplear el objetivo de mayor aumento (objetivo de inmersin, ver punto 6). 4 Para realizar el enfoque: a. Acercar al mximo la lente del objetivo a la preparacin, empleando el tornillo macromtrico. Esto debe hacerse mirando directamente y no a travs del ocular, ya que se corre el riesgo de incrustar el objetivo en la preparacin pudindose daar alguno de ellos o ambos. b. Mirando, ahora s, a travs de los oculares, ir separando lentamente el objetivo de la preparacin con el macromtrico y, cuando se observe algo ntido la muestra, girar el micromtrico hasta obtener un enfoque fino. 5. Pasar al siguiente objetivo. La imagen debera estar ya casi enfocada y suele ser suficiente con mover un poco el micromtrico para lograr el enfoque fino. 6 El empleo del objetivo de inmersin es siempre utilizando aceite de inmersin.

TRABAJO GUIADO
1.- Indique todas las partes del microscopio

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

12

PRACTICA N 3
PRIMERA PARTE: TECNICAS DE COLORACION. PREPARACION DE MUESTRAS
I. FUNDAMENTOS La coloracin implica la penetracin del colorante por fenmeno osmtico y su fijacin se debe a fenmenos de absorcin de partculas o iones. Qumicamente la coloracin es la unin de las molculas del colorante con los elementos constituyentes de la clula. Algunas regiones celulares tienen pH alcalino y se tien con los colorantes cidos; otros tienen pH cido y se tien con colorantes bsicos. Sin embargo es necesario sealar que tanto el ncleo como el citoplasma tienen caractersticas anftericas de manera que se pueden teir, el ncleo con algunos colorantes cidos y el citoplasma con algunos colorantes bsicos. El mecanismo de coloracin de las muestras biolgicas pueden ser afectados por: Pureza del colorante Concentracin del colorante pH de la solucin del colorante Temperatura del medio ambiente Sustancias adicionales (mordientes) Tiempo de coloracin.

Los preparados microscpicos, constituyen una serie de preparados rutinarios de laboratorios que tienen por objeto identificar en forma rpida el contenido de un determinado tipo de muestra, con la con la finalidad de resolver algn problema de inters particular. Los preparados microscpicos ms frecuentes en Biologa son: Preparados en fresco Preparados en seco Los preparados en Fresco son preparaciones microscpicas acuosas, que se caracterizan por que la sustancia examen, no est adherida de un modo fijo a la superficie de la lmina portaobjeto y por lo tanto, al ser manipulada sta en diferentes posiciones se corre el riesgo de perder u estropear el preparado. Los preparados en seco son aquellos que sufren un procesamiento previo (extensin, fijacin y coloracin), y se caracterizan porque la sustancia examen se halla adherida a la superficie de la lmina portaobjeto y por lo tanto, al ser manipulada sta en diferentes posiciones no se estropea o pierde la muestra. Es importante ejercitar al estudiante en el manejo y aplicacin de estos factores que inciden bsicamente en la complementacin del aprendizaje del estudio de estructuras celulares, identificacin de tejidos y microorganismo.

II. OBJETIVO. 1. Diferenciar y explicar el fundamento de las distintas coloraciones 2. Realizar coloraciones con muestras biolgicas III. MATERIALES

13

Encontrars en el laboratorio. - Microscopio ptico - Pipetas pasteur - Goteros - Agua destilada - Mechero - Azul de metileno - Giemsa IV. PROCEDIMIENTO

- Safranina - Eosina - Violeta de genciana - Wright - Fucsina - Verde de Janus - Hematoxilina

PREPARADOS EN FRESCO 1. Colocar una gota de agua estancada en una lamina 2. colocar una laminilla cubreobjetos 3. observar PREPARADOS EN SECO 1. Colocar la muestra en la lamina 2. Realizar la coloracin respectiva 3. Secar al medio ambiente 4. observa la microscopio

PARTE 2: OBSERVACIN Y RECONOCIMIENTO DE CLULAS PROCARIOTES,


I. FUNDAMENTO La principal caracterstica de la clula procariota es que carece de ncleo celular. Las bacterias, los organismos procariotes ms representativos, comprenden por una parte, especies de importancia mdica puesto que producen una serie de infecciones y padecimientos en el hombre y en los animales pero, por otra parte, una gran mayora representa beneficios para la agricultura, la industria y la salud humana y animal. Para observar este tipo de clulas se utiliza la Tincin Gram, tcnica diseada por el mdico dans Hans Christian Gram. Esta consiste en poner en contacto las clulas bacterianas con colorantes bsicos como violeta de genciana, utilizando la solucin de lugol como mordiente. Esto forma un compuesto yodado que se fija fuertemente en determinadas bacterias. Segn la coloracin que adquieran, las bacterias se clasifican en: GRAM POSITIVAS: se tien fuertemente con violeta de genciana y adquieren una coloracin violeta. GRAM NEGATIVAS: se tien muy superficialmente por lo que fcilmente se decoloran con solventes orgnicos. Se utiliza adicionalmente la safranina o fucsina, que se emplea como colorante de contraste, adquierendo una coloracin rosada. La diferente tincin de bacterias se debe a la composicin diferencial de sus paredes bacterianas. Las bacterias Gram positivas poseen una pared celular con mureina y cido teitoico. En cambio, las Gram negativas tienen una pared mucho ms compleja que contiene, adems del peptidoglucano, una asociacin de protenas lpidos y lipopolisacridos Adems de la coloracin esta tcnica nos permite distinguir en las bacterias: a) morfologa: cocos, bacilos, espirilos, cocobacilos, vibrios, etc) b) agrupacin: pares, cadenas ttradas, racimos, sarcina A: forma de caa o bacilos B: Redondos en lneas: estreptococos

14

C: redondos en cmulos: estafilococos D: Redondos en pares: diplococos E: Forma de espirales: espirilos F: En forma de coma: vibrios

II. OBJETIVOS Reconocer los distintos tipos de bacterias segn se tian o no con la Tincin Gram.

III. MATERIALES Encontrars en el laboratorio: Microscopio ptico - Alcohol acetona Soluciones para la tincin: - Fucsina o safranina - Violeta de genciana - Aceite de inmersin - Lugol - Mechero de alcohol

IV. PROCEDIMIENTO La tincin Gram se realizar sobre las muestras de yogur, sarro dentario y vinagre que los alumnos traern. Bacterias del yogurt El yogur es un producto lcteo producido por la fermentacin natural de la leche. A escala industrial se realiza la fermentacin aadiendo a la leche dosis del 3-4% de una asociacin de dos cepas bacterianas: el Streptococcus termophilus, poco productor de cido, pero muy aromtico, y el Lactobacillus bulgaricus, muy acidificante. En esta preparacin se podrn, por tanto, observar dos morfologas bacterianas distintas (cocos y bacilos) y un tipo de agrupacin (estreptococos, cocos en cadenas arrosariadas). Adems, el tamao del lactobacilo (unos 30m de longitud) facilita la observacin aunque no se tenga mucha prctica con el enfoque del microscopio. Bacterias del vinagre El vinagre es una solucin acuosa rica en cido actico resultante de la fermentacin espontnea del vino o de bebidas alcohlicas de baja graduacin. La acetificacin del vino es producida por bacterias aerbicas del cido actico, principalmente Acetobacter aceti, aunque tambin Gluconobacter. Se trata de bacilos rectos con flagelos polares. Bacterias del sarro dental El sarro dental es un depsito consistente y adherente localizado sobre el esmalte de los dientes. Est constituido principalmente por restos proteicos, sales minerales y bacterias junto con sus productos metablicos. La flora bacteriana de la cavidad bucal es muy variable dependiendo de las condiciones que se den en el momento de hacer la preparacin, pero suelen abundar bacterias saprfitas, pudindose observar gran variedad de morfologas: espiroquetas, cocobacilos, diplococos y bacilos. Realizar los siguientes pasos para la tincin Gram de cada una de las 3 muestras indicadas. 1 2 3 4 5 6 Realizar una extensin de la muestra de cultivo bacteriano sobre un portaobjetos Secar ante un mechero. Cubrir el preparado con violeta de genciana por 1 minuto. Enjuagar la lmina con agua destilada Aadir lugol por 1 minuto. Lavar con agua destilada y decolorar con alcohol acetona. 15

7 Aadir fucsina o safranina y dejar que acte por 1 minuto. 8 Lavar con agua corriente, secar 9 Coloque una gota de aceite de inmersin encima de la lmina cubreobjetos y observar al microscopio con el objetivo de inmersin.

PARTE PRACTICA
1.- completar el grafico

2.-Dibuje todas las muestras observadas en la prctica

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

16

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

17

PRACTICA N4
OBSERVACIN DE CLULAS EUCARIOTES

I. FUNDAMENTO En 1939, en base a observaciones realizadas por los cientficos alemanes Schleiden y Schwan, se plasm la teora celular, la cual produjo un cambio radical en las ciencias biolgicas. Esta teora postula que los cuerpos de todos los animales y vegetales estn formados de clulas y que solo pueden aparecer nuevas clulas por divisin de las clulas preexistentes. De ah que los organismos por muy sencillos que sean estn constituidos por unidades vivas denominadas clulas. La clula eucariota es ms compleja que la clula procariota y contiene, a diferencia de esta ltima, ncleo celular. Los organismos ms simples (protozoarios) estn constituidos de una sola clula eucariota mientras que los ms complejos o multicelulares estn formados por un gran nmero de clulas eucariota que se hallan organizadas en tejidos, rganos y sistemas. II. OBJETIVOS

Observar y caracterizar clulas eucariotas de tipo vegetal (epidermis de cebolla y mucosa bucal).
Observar y caracterizar clulas eucariotas de tipo animal (epitelio bucal, tejido adiposo y sangre). III. MATERIALES Encontrars en el laboratorio Microscopio ptico Cubeta de tincin Lugol Frasco lavador Mechero de Alcohol Alcohol absoluto Lanceta estril Cebolla Hisopos Tocino Agua estancada en frasco oscuro Materiales de diseccin: tijera, pinza, estilete.

Hematoxilina Formol Eosina Sudan III

Cubeta de tincin

Lminas portaobjeto y cubreobjeto Gotero Bistur u hoja de afeitar Levadura de pan

IV. PROCEDIMIENTO 4.1. Observacin de clulas vegetales (Clulas epiteliales de Allium cepa) 18

Las clulas de la epidermis de las hojas internas del bulbo de la cebolla, son de forma alargada y bastante grande. La pared celular celulsica se destaca muy clara teida por el colorante. Los ncleos son grandes y muy visibles. En el citoplasma se distinguen algunas vacuolas grandes dbilmente coloreadas. 1 Separe una de las capas del bulbo de la cebolla. Con ayuda de una pinza desprenda la membrana epidrmica que cubre la parte interna de la cebolla y extindala en el portaobjetos. 2 Utilizando una hoja de afeitar obtenga una porcin de medio centmetro cuadrado, cbrala con una gota de lugol, coloque cuidadosamente el cubreobjeto y observe en el microscopio. 3 Reconozca las partes de la clula vegetal. 4.2. Observacin de organismos unicelulares 1 2 3 4 Coloque una gota de agua estancada sobre un porta objeto y cubran con una laminilla. Observe con el objetivo de menor aumento. Ajuste el diafragma para incrementar el contraste. Observe la forma, tamao y movimiento de los organismos unicelulares (ver figura adjunta).

4.3. Observacin de levaduras del pan

1 Diluya un trocito de levadura de pan (Saccharomyces cerevisiae) con agua destilada, en un tubo de
2 3 4 ensayo. Observe con el objetivo de mayor aumento. Ajuste el diafragma para incrementar el contraste. Observe la forma y tamao de estos organismos.

4.4. Observacin de clulas animales (Epitelio bucal) El azul de metileno tie intensamente el ncleo y con menos color el citoplasma de las clulas. ste suele ser algo granuloso. 1 2 3 4 5 6 Con un hisopo limpio extraiga suavemente la mucosidad de la cavidad bucal. Deposite la mucosidad extrada en el centro de una lmina portaobjetos y extindalo con un frotis. Agregue unas gotas de AZUL de metileno y espere 3 minutos. Elimine el exceso de colorante utilizando agua y coloque un cubreobjetos. Observe la muestra a menor aumento y localice: clulas asociadas y dobladas. Luego visualice a mayor aumento y reconozca los componentes celulares.

4.5.

Observacin de clulas animales (Tejido adiposo)

El Sudan III es un compuesto que tie lpidos de color rojo intenso. En el tejido adiposo, que contiene gran cantidad de grasas, se observarn los adipocitos teidos por el Sudan III. 1 2 3 4 5 Con ayuda de un bistur, cortar una fina capa de grasa de tocino Colocarla en un portaobjetos y cubrirla con unas gotas de formol. Dejar actuar 4 minutos. Lavar la muestra con agua y cubrirla con unas gotas de Sudn III. Dejar actuar unos 5 minutos. Volver a lavar la preparacin con agua, cubrirla con un cubreobjetos Observar al microscopio.

4.6. Observacin de clulas animales (Sangre) Al microscopio las clulas sanguneas se vern predominantemente los glbulos rojos, hemates o eritrocitos teidos de color rojo por la eosina. No tienen ncleo y son ms delgados por el centro que por los bordes. Los glbulos blancos o leucocitos se identifican fcilmente por la presencia de ncleo,

19

teido de morado por la hematoxilina. Hay varias clases de leucocitos: Linfocitos: de tamao aproximado al de los glbulos rojos, tienen un solo ncleo que ocupa casi todo el glbulo. -Monocitos: son los leucocitos mayores, poco frecuentes normalmente, ncleo grande, redondo, son los ms mviles y su funcin principal es la fagocitosis. -Polimorfonucleares: ncleo fragmentado o arrosariado. Pueden ser eosinfilos, con abundantes granulaciones teidas de rojo por la eosina, neutrfilos y basfilos.

Los eosinfilos, con granulaciones abundantes de color rojizo y el ncleo teido de color azul marino.
Estos glbulos aumentan su nmero en caso de parasitosis o procesos alrgicos.

Los basfilos presentan un ncleo teido de rojo y las granulaciones del citoplasma de color muy oscuro.
-Las plaquetas no son visibles ya que precisan una tcnica especial de tincin. Efecta los siguientes pasos para ambas coloraciones, Wright y Hematoxilina-Eosina:

1 2 3

Con ayuda de una lanceta desechable, realice una puncin del pulpejo del dedo anular de la mano izquierda, previa desinfeccin con algodn y alcohol. Tome una gota de sangre y haga un frotis fino sobre el portaobjeto Colocar el frotis extendido ya seco, sobre una base plana en posicin totalmente horizontal.

Para la coloracin de Wright:

1
2 3 4

5
6

Coloree con unas gotas de colorante Wright, inmediatamente agregar sobre el colorante el mismo numero de gotas de agua destilada y mezclar rpidamente, soplando suavemente hasta que se forme una capa plateada . Dejar reposar la mezcla por 8 - 10 minutos, observando la intensidad de color. Lave con agua corriente y dejar secar al medio ambiente, si es posible con la lamina en forma vertical. Observe al microscopio. Utilice el objetivo de 100X para la observacin de las clulas y ncleos. Diferencie las diferentes formas de ncleo en los neutrfilos, basfilos , eosinfilos, monocitos y linfocitos. Dibuje cada forma de ncleo.

Para la coloracin de Hematoxilina-Eosina: 1 Colocar el frotis de sangre sobre la cubeta de tincin y aadir unas gotas de alcohol absoluto y dejar que el alcohol se evapore para fijar la preparacin. 2 Cubrir con unas gotas de hematoxilina y dejar actuar durante 15 minutos. Evitar la desecacin del colorante agregando ms lquido. 3 Lavar la preparacin y aadir unas gotas de eosina dejndola actuar 1 minuto. 4 Volver a lavar hasta que no queden restos de colorante. 5 Dejar secar aireando el porta o bien al calor muy lento de la llama del mechero. 6 Observar al microscopio. Utilice el objetivo de 100X para la observacin de las clulas y ncleos.

DESARROLLO
1.- Por qu los eritrocitos se tien con Eosina y los Leucocitos con Hematoxilina? ______________________________________________________________________ ______________________________________________________________________ ______________________________ 2.-para qu sirve el FORMOL en la coloracin de adipositos? ________________________________________________________________________________
20

__________________________

3. Dibuje las distintas muestras observadas en la prctica

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

21

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 5
OBSERVACIN DE PERMEABILIDAD CELULAR
I. FUNDAMENTO

La membrana celular permite el transporte de sustancias de manera selectiva. Muchas sustancias, adems del agua, entran a la clula y salen de ella por efecto de los gradientes de concentracin, aunque slo unas cuantas (CO2 y O2) puedan hacerlo tan fcilmente como el agua. Si una membrana celular se deja atravesar por una sustancia, se dice que es permeable a dicha sustancia.

El volumen celular cambia cuando el agua penetra o sale de la clula por un proceso denominado osmosis. En trminos osmticos las soluciones o medios separados por una membrana se pueden clasificar como hipertnicas, isotnicas e hipotnicas; se dice que un medio es hipertnico, cuando la concentracin del soluto en la solucin es mayor en relacin con otro medio de solucin. Por ejemplo, si tenemos dos soluciones, la solucin 1 con agua destilada y la solucin 2 con una solucin de azcar al 10%, se dice que la solucin 2 de azcar es hipertnica en relacin a la solucin 1. Por el contrario, la solucin 1 es hipotnica en relacin a la solucin 2 azucarada, es decir que la concentracin del soluto es menor en relacin con el otro medio. Y una solucin isotnica, se cuando la concentracin de soluto es igual a la concentracin de soluto de la otra solucin.

22

II. OBJETIVO. 2.1 Observar y describir los fenmenos de difusin y smosis y su importancia en el intercambio de sustancias en la clula. III. MATERIALES Encontrars en el laboratorio. - Microscopio ptico - Agua destilada - Tubos de ensayo - Algodn - Gradillas - Marcador de vidrio - Solucin hipotnica NaCl 0.065 M - Ligadura - Solucin hipertnica NaCl al 2% - Alcohol corriente -Azul de metileno - Solucin isotnica de NaCl al 0.9% (suero fisiolgico) IV. PROCEDIMIENTO

Parte A
1 En tres tubos de ensayo numerados coloque: -1 ml. de solucin hipotnica NaCl 0.01 % -1 ml. de solucin isotnica de NaCl al 0.9% (suero fisiolgico) -1 ml. de solucin de hipertnica NaCl al 2%.

2 Obtener 2ml de sangre venosa con la lanceta hematolgica en un tubo limpio con heparina
3 4 5 6 Dejar caer 5 gotas de sangre en cada uno de los tubos con un gotero. Agite los tubos y dejar en reposo durante 2 3 minutos. Con un gotero coloque en una lmina portaobjeto una gota de cada uno de los tres tubos. Luego examine en el microscopio su aspecto. Observar qu efecto ha tenido las distintas soluciones sobre la morfologa del eritrocito y explicar por qu.

Parte B
1. Colocar los tres huevos en un vaso de precipitacin de 1 litro y verter el vinagre hasta cubrir completamente los huevos. Debe realizarse este proceso 48 horas antes de la prctica. 2. Al momento de la prctica lavar con mucho cuidado con agua de cao. 3. Frotar cuidadosamente con los dedos para sacar la cscara por el lado de cmara de aire. Realizar este proceso hasta tener casi un tercio del huevo libre de cscara. 4. Coloquen agua de cao en uno de los vasos de precipitacin de 100ml y ubiquen all uno de los huevos. El agua debe cubrir al huevo. 5. En otro vaso de precipitacin colocar un huevo en la mezcla muy concentrada de sal en agua y colocar all otro de los huevos. 6. Llenar el tercer vaso con agua destilada y poner all el tercer huevo. 7. en cada frasco se adicion unas gotas de agua de metileno 8. Dejar por una hora y observar membrana y el contenido interno del huevo. NOTA: En todos los vasos de precipitacin, los huevos deben quedar sumergidos en el lquido.

DESARROLLO
1. Mencione y dibuje las diferencias encontradas en cada uno de los huevos sometidos a cada proceso. TABLA: Observacin de resultados

23

Solucin de Sal Huevo

Agua de cao

Agua destilada

2. Dibujar todas muestras observadas en la prctica

Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloracin:_______ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

24

PRACTICA N 6
PRIMERA PARTE: OBSERVACIN DE MOVIMIENTO CELULAR. CICLOSIS
I. FUNDAMENTO El citoplasma celular esta formado por el hialoplasma y el morfoplasma. El hialoplasma es un medio acuoso, con un 85% de agua en el cual esta disuelta gran cantidad de molculas formando una solucin coloidal; prtidos (AA, enzimas, protenas estructurales), lpidos, glcidos (polisacridos, metabolitos), cidos nucleicos (nucletidos, nuclesidos, ADN, ARN, ARNt, ARNr) sales e iones. El hialoplasma es un medio dinmico, ya que puede pasar del estado de sol a gel acumulando molculas que establecen enlaces entre si y aumentando la viscosidad; pueden invertirse el proceso pasando el hialoplasma a sol al diluirse hasta que se separan las molculas, esto permite la creacin de corrientes internas o Ciclosis y algunas clulas pueden emitir prolongaciones del citoplasma o SEUDOPODOS como rganos de desplazamiento. II. OBJETIVOS 2.1. Explicar los movimientos citoplasmticos III. MATERIALES Encontraras en el laboratorio - microscopio compuesto - Lugol - Hoja de Elodea IV. PROCEDIMIENTO 4.1. Movimientos Citoplasmticos: Ciclosis 1. Colocar una hoja de Elodea sobre una lamina portaobjetos 2. Agregar una gota de agua y colocar la laminilla 3. A menor y mayor aumento observar las clulas e identificar los cloroplastos 4. Con abundante luz observar los desplazamientos del citoplasma conjuntamente con los Cloroplastos

SEGUNDA

PARTE:

OBSERVACIN DE CITOPLASMATICA

ORGANELAS

INCLUSIONES

I. FUNDAMENTO Todas las funciones intracelulares (sntesis de protenas, replicacin de DNA y rutas metablicas en general) son realizadas gracias una compleja organizacin de las organelas. Una clula eucariota tpica contiene organelas membranosas (retculo endoplasmtico, aparato de golgi, peroxisomas, mitocondrias, etc.) y organelas no membranosas (ribosomas, proteosomas, etc.). Todas ellas efectan una funcin puntual en la clula que le permite su supervivencia y replicacin. La supervivencia de la clula depende, entre otros factores, de la obtencin de energa neta. Dicho proceso est a cargo de las mitocondrias y/o de los cloroplastos. Las mitocondrias se encuentran en mayor nmero en clulas animales pero tambin pueden presentarse en clulas vegetales, mientras que los

cloroplastos son exclusivos de clulas vegetales y algunas bacterias fotosintticas. Las mitocondrias oxidan molculas orgnicas utilizando oxgeno del aire como aceptor de electrones y forman ATP. Los cloroplastos capturan energa de la luz y la transforman en ATP mediante el proceso denominado fotosntesis. II. OBJETIVOS 2.1Observar y diferenciar orgnulos de clulas vegetales: cromoplastos y cloroplastos. -Reconocer y diferenciar mitocondrias. III. MATERIALES Encontrars en el laboratorio: - Microscopio ptico - Verde de Janus - Agua destilada - Lugol - Gotero IV. PROCEDIMIENTO 4.1. Observacin de cromoplastos en clulas de pulpa de tomate La pulpa del tomate nos muestra las clulas generalmente bastante sueltas unas de otras. En el citoplasma se percibe una serie de grnulos rojizos-anaranjados que son los cromoplastos. El ncleo puede llegar a observarse por su tpico aspecto y tamao. Es frecuente la presencia de grnulos de almidn de forma arrionada. En las clulas menos alteradas por la compresin se ven grandes vacuolas incoloras. 1 Cortar con el bistur un pequeo trozo de uno o dos milmetros de grosor, de la parte pulposa del tomate. 2 Llevarlo sobre un porta, sin poner agua. 3 Poner el cubre-objeto y comprimir suavemente la preparacin. 4 Observar al microscopio 4.2. Observacin de cloroplastos en clulas de Elodea

1 En un portaobjetos coloque una porcin pequea de hoja de Elodea y agregue una gota de agua.
2 3 Cubrir la muestra con una lmina portaobjetos. Aprecie la forma de los cloroplastos y el movimiento de estos.

4.3. Observacin de mitocondrias en clulas epiteliales humanas 1 2 3 4 5 Preparar un frotis de epitelio bucal con un hisopo. Secar al medio ambiente. Agregar unas gotas de Verde de Janus y dejar reposar por 3 minutos. Elimine el exceso del colorante con agua destilada. Observe al microscopio y describa la forma de las mitocondrias en la clula.

PARTE PRACTICA
1. Dibuje y coloree las distintas muestras observadas en la prctica. Mencionando el aumento total.

Coloracin:_______ Aumento:________

Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________ Coloracin:_______

Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 7
ACTIVIDAD ENZIMTICA PRIMERA PARTE: CATALASA
I. FUNDAMENTO Las enzimas son protenas cuya funcin es acelerar (catalizar) reacciones qumicas que ocurren dentro de la clula y que en ausencia de ellas no se llevaran a cabo o de lo contrario tomaran muchsimo tiempo. Como se aprecia en la siguiente figura, las enzimas son especficas para sus sustratos, los cuales quedan unidos complementariamente al sitio de unin de la enzima donde son modificados enzimticamente, liberndose al final de la reaccin los productos respectivos.

La catalasa es una enzima que se encuentra en las clulas de los tejidos animales y vegetales. La funcin de esta enzima en los tejidos es necesaria porque durante el metabolismo celular, se forma una molcula txica que es el perxido de hidrgeno, H2O2 (agua oxigenada). Esta enzima, la catalasa, lo descompone en agua y oxgeno, por lo que se soluciona el problema. La reaccin de la catalasa sobre el H2O2, es la siguiente:

La existencia de catalasa en los tejidos animales, se aprovecha para utilizar el agua oxigenada como desinfectante cuando se echa sobre una herida. Como muchas de las bacterias patgenas son anaerobias (no pueden vivir con oxgeno), mueren con el desprendimiento de oxgeno que se produce cuando la catalasa de los tejidos acta sobre el agua oxigenada.
II. OBJETIVO. 2.1 Detectar la presencia de la enzima catalasa en un tejido animal. III. MATERIALES Encontrars en el laboratorio - Gradillas - Pipetas-tubos de ensayo Debers traer de casa - Hgado de pollo - Agua oxigenada

IV. MTODOS 1 Colocar en un tubo de ensayo unos trocitos de hgado. 2 Aadir 5 mililitros de agua oxigenada. 3 Se observar un intenso burbujeo debido al desprendimiento de oxgeno. 4 Discutir la formacin de burbujas en distintas mesas, relacionndolo con la concentracin de catalasa.

SEGUNDA PARTE: HIDROLISIS DE LA AMILASA


I. FUNDAMENTO

Mediante esta experiencia vamos a ver la actividad de otra enzima, la amilasa o ptialina, presente en la saliva. Esta enzima acta sobre el polisacrido almidn, hidrolizando el enlace O-glicosdico, por lo que el almidn se terminar por transformar en unidades de glucosa. Es importante que recuerdes las reacciones caractersticas de glcidos para comprender esta experiencia. II. OBJETIVOS. Comprobar que slo bajo ciertas condiciones las enzimas funcionan ptimamente catalizando una reaccin enzimtica con su sustrato. III. MATERIALES Encontrars en el laboratorio. - tubos de ensayo -gradillas -solucin diluida de almidn y sacarosa IV. MTODOS 1. 2. 3. 4. Poner en una gradilla cuatro tubos de ensayo, numerados del 1 al 4. Proceder a llenar los tubos como lo indica la figura. Agregar 3 gotas de lugol a cada tubo Aparecern diferencias entre los 4 tubos dependiendo de si hay o no almidn en el medio. Recuerda: reaccin positiva, color violeta, hay almidn. Reaccin negativa, no cambia color, no hay almidn. - Bao mara - Vaso de precipitados - Lugol

Nota: Para ayudarte y formar ms saliva, piensa en un limn o en algo que te apetezca mucho comer... As favoreces que se forme ms saliva.

DESARROLLO
1.-En qu parte de las clulas encontramos la enzima catalasa y cul es la funcin de dicha enzima?. _____________________________________________________________________________________ ___________________________________________________________________________________ 2.- Qu factores, adems de la temperatura, podran afectar la actividad de una enzima?. _____________________________________________________________________________________ ___________________________________________________________________________________

5. Dibuje las reacciones observadas en la prctica. e incluya alguna observacin a sus resultados

________________________ ________________________ ________________________

________________________ __________________________ __________________________ __________________________ __________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 8
METABOLISMO ANAEROBIO: FERMENTACIN ALCOHLICA

I. FUNDAMENTO La respiracin celular es el proceso mediante el cual se oxidan molculas energticas (glucosa, principalmente), empleando al oxgeno como aceptor final de electrones, y obteniendo gran cantidad de energa para la realizacin de las funciones celulares bsicas. La fermentacin, por el contrario, es un proceso anaerbio que implica la ruptura de alimentos por un proceso de degradacin qumica que no requiere oxgeno. Los alimentos no son degradados completamente hasta CO2 y H2O (como ocurre en la respiracin), sino hasta compuestos intermedios tales como cido lctico (fermentacin lctica) o alcohol (fermentacin alcohlica). Esta ruptura incompleta de los alimentos significa que menos energa es disponible durante la fermentacin que el liberado durante la respiracin. Ambos procesos pueden tomar lugar en las clulas a la vez. Adems, los primeros pasos en la ruptura de la glucosa en la respiracin, son anaerbicos. Anaerbica Glucosa Aerbica Glucosa CO2 + H2O cido lctico

Ciertas bacterias y hongos derivan todo sino parte de su energa de la fermentacin y los productos finales son frecuentemente el alcohol y CO2, el proceso en este caso es denominado fermentacin alcohlica. Las levaduras y bacterias, las cuales conducen a la fermentacin son capaces de emplear sus sistemas enzimticos para liberar energa anaerbicamente a partir de carbohidratos, particularmente almidn y azcar.

DESTINO DE LA GLUCOSA EN CONDICIONES AEROBIAS (RESPIRACIN) O ANAERBIAS (FERMENTACIN)


ADP ADP ATP + P P ATP

GLUCOSA

1 ETANOL

II. OBJETIVOS

2.1 Comprobar que ante la presencia de oxgeno, el azcar es oxidado hasta CO2 y agua. 2.2 Comprobar que en ausencia de oxgeno, el azcar es convertido en etanol y CO2 por las
2.3 levaduras, mediante el proceso de fermentacin alcohlica. Comparar cualitativamente un proceso fermentativo vs. Respiracin.

III. MATERIALES Encontrars en el laboratorio -Tubos de ensayos -Reactivo de Fehling A y B - Gradillas - Bao Maria - Probetas -Algodn -Tiras de medidas de pH -Dicromato de potasio -Soluciones al 2% de fructosa, glucosa, almidn y sacarosa -Acido sulfrico diluido IV. MTODOS Fermentacin alcohlica 1. Preparar los tubos como lo indica la tabla: REACTIVO Agua Destilada Sol. de levadura 1mL Solucin de Glucosa Sol. Sacarosa Sol. Almidn Sol. Fructosa Sol. Glucosa 1 .... 1mL 2 .... 1mL 2mL 2mL 2mL 2mL 2mL 3 .... 1mL 4 ..... 1mL 5 .... 1mL 6 .... 1mL

2. La muestra con glucosa sola nos servir para realizar la reaccin de Fehling y comprobar que es glucosa por su poder reductor. 3. Para colocar la levadura en el tubo, previamente se tiene que disolver una punta de esptula de la cepa de panificacin de Sacharomyces cerevisae en un poco de agua. 4. Llenar los tubos cuidando que no queden burbujas de aire, para conseguir un ambiente de anaerobiosis. Colocar un globo en la boca de los tubos para que el sistema quede cerrado hermticamente. 5. Llevar todos los tubos a 37C por 30 min. 6. Anotar la formacin de CO2 para cada tubo (La fermentacin se evidenciar por la presencia de burbujas en el tubo y el globo hinchando, debido a la produccin de CO2. 7. Detectar la presencia de glucosa aplicando reactivo de Fehling A y B, llevando a Bao Maria por 8 minutos 8. Medir el pH del medio. 9. Opcionalmente, el profesor del grupo detectar cuidadosamente la presencia de etanol en las muestras. Hay que tener mucho cuidado porque hay que manipular cido sulfrico y puede ser peligroso el manejarlo. Se tomarn 2 ml. de la solucin del tubo hermticamente cerrado y la ponemos en otro tubo de ensayo. Aadimos unos cristalitos de dicromato potsico y a continuacin 2 ml. de acido sulfrico diluido. Al calentar al bao Mara debe formarse un compuesto aromtico caracterstico, y se pone de manifiesto porque cambia de color de amarillento a verdoso. Es una reaccin que nos indica que existe etanol. 10. Observar, comparar y discutir los resultados de los experimentos planteados.

DESARROLLO
1.- Complete el dibujo y la tabla. .

CO2 glucos a pH etanol

_______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _____________________________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 9
DIVISIN CELULAR: MITOSIS y MEIOSIS PARTE I MITOSIS
I. FUNDAMENTO El ciclo celular es un proceso que consiste en la replicacin de material gentico y formacin de clulas hijas. Compromete dos etapas: La primera llamada interfase, donde no ocurre divisin celular propiamente dicha y la segunda de divisin celular (ver figura). Dependiendo del tipo de clulas donde se lleve a cabo, la divisin celular toma el nombre de Mitosis (si ocurre en clulas somticas) o Meiosis (si ocurre en clulas germinales). La mitosis implica cuatro etapas: Profase, Metafase, Anafase y Telofase. En las dos primeras ocurre la condensacin y ordenamiento de los cromosomas y en las dos ltimas se lleva a cabo la distribucin de los cromosomas. El resultado final son dos clulas hijas diploides (2n).

II. OBJETIVOS Reconocer las distintas fases del ciclo celular en clulas somticas de raz de cebolla. III. MATERIALES Encontrars en el laboratorio - Placa Petri - Orcena actica - Pinza de madera - Microscopio

- Mechero de alcohol - Acido Actico - Etanol 0 IV. PROCEDIMIENTO Con 8 das de anticipacin a la prctica preparar el cultivo de cebolla de la siguiente manera: En un vaso con agua, de preferencia de borde oscuro, colocar una cebolla mediana de tal manera que haga contacto la parte terminal de la cebolla con el agua y dejar en lugar semioscuro.

Preparacin de la Muestra

1 Disponer de gran nmero de races de cebolla, haciendo cortes de la parte terminal (aproximadamente
de 0.5cm.) y depositar en una placa Petri.

2 Colorear con orcena por 10 minutos: contiene orcena A que interrumpe el proceso si se est dando en
3 4 5 6 ese momento y reblandece la unin de las clulas muertas, as como orcena B que tie la cromatina o material hereditario. Luego calentar la muestra slo hasta que emane vapores por 2 veces consecutivas con intervalos de enfriamiento. Trasladar las races a diferentes portaobjetos, separar solo el pice (parte terminal de la raz) y agregar una gotita de orcena y cubrir con el cubreobjeto. Apretar la muestra suavemente con la yema de los dedos. Secar el exceso de colorante con papel secante y llevar al microscopio para su observacin a menor y mayor aumento.

Interfase

Profase Temprana

Profase Tarda

Metafase

Anafase Temprana

Anafase Tarda

Telofase Temprana

Telofase Tarda

Citocinesis

DESARROLLO
1.- dibuje las muestras observadas.

Coloracin:_______ Aumento:________

Muestra:_________ Muestra:_________ Coloracin:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________ Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

PARTE II. - MEIOSIS


I. INTRODUCCIN La meiosis es un proceso celular, ligado a la reproduccin sexual, por el cual, la clula madre de naturaleza diploide, da origen a los gametos de naturaleza haploide, de tal manera que en la fecundacin se reestablece el nmero diploide de cromosomas. As, mientras la mitosis es un proceso de divisin celular con formacin de dos ncleos hijos con el mismo nmero de cromosomas que la clula original, en la meiosis en cambio hay dos divisiones celulares con reduccin del nmero de cromosomas a la mitad. La meiosis es un proceso citolgico que comprende dos divisiones celulares. En la primera divisin meitica ocurre una serie de intercambios de material gentico entre los cromosomas homlogos. Este fenmeno es un proceso complejo que comprende una larga profase en la que, para su mejor estudio y comprensin, se distinguen los estadios: Leptoteno, Cigoteno, Paquiteno, Diploteno y Diacinesis. Entre la telofase I y el comienzo de la segunda divisin meitica, a diferencia con la mitosis, no hay un perodo de sntesis y duplicacin del ADN, por lo dems la divisin meitica II, tiene lugar como la mitosis normal en cada una de las clulas haploides (meiocitos de segundo orden), resultantes de la divisin meitica I. II. OBJETIVOS: Al finalizar la presente prctica los alumnos estarn capacitados para: 2.1 Reconocer y diferenciar los estados fisiolgicos por los que atraviesan los cromosomas durante el proceso meitico en clulas animales. III. MATERIALES Y METODOS Un excelente material para la observacin de los procesos de divisin celular lo constituyen insectos de la especie Grillos asimilis grillo domestico y Laplatacris sp langosta. En los individuos machos debe recuperarse el testculo despus de la diseccin en el que se estudiar la meiosis en clulas de maduracin (espermatocitos) de la zona proximal al canal deferente. El material a usar en el presente ejercicio es el siguiente: Microscopio Mechero de alcohol Cloroformo Carmn actico Carnoy Solucin salina 0.7% Placas petri Laminas, laminilla Algodn Papel filtro Estilete de punta fina

IV: PROCEDIMIENTO Anasteciar los animales en las placas petri, colocando dentro de un pedazo de algodn embebido en cloroformo. Disecar el animal con la ayuda del estereomicroscopio o lupas, colocndolo en posicin dorsal. Separar los testculos adicionndoles la solucin salina procurando no exponer los rganos al aire para evitar posibles desecaciones. Seccionar los testculos en partes pequeas de 2 a 3 mm y colocarlos en un vial con fijador carnoy por espacio de 30 min. Traspasar los fragmentos a una luna de reloj que contiene carmn actico y lleve al calor del mechero hasta que entre en ebullicin por espacio de 15 segundos de 5 a 7 veces. Retire el fragmento del testculo con una pinza de punta fina y colquela sobre un portaobjetos y agrguela una gota de carmn actico.

Tape la preparacin con una laminilla cubre objetos y sobre esta ponga un papel absorbente. Presione el cubre objetos con la yema del dedo pulgar y luego con la extremidad plana de un lpiz presionar un poco mas fuerte hasta convertir el material del porta objetos en una capa delgada (squash). Al realizar esta operacin, tenga cuidado para no romper el cubre objetos. Limpie el exceso de colorante del porta objetos con papel higinico y lleve el preparado al microscopio para su observacin a menor y mayor aumento. Observar y esquematizar.

1.- Dibuje las muestras observadas.


Muestra:_________ Muestra:_________ Coloracin:_______ Aumento:________

Coloracin:_______

Aumento:________

Muestra:_________

Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________ Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________ Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRCTICA N10
FECUNDACIN
I. FUNDAMENTO La fecundacin es el proceso de unin del vulo y el espermatozoide, y en virtud de la cual se origina el cigoto o clula huevo. La fecundacin en la especie humana es interna, pues se lleva a cabo en el interior del aparato reproductor de la hembra, concretamente en las trompas de Falopio.

En esta prctica se observar el proceso de fecundacin entre un gameto masculino (espermatozoides) y un gameto femenino (ovulo), en erizo de mar. Se podrn observar los gametos o Clulas reproductoras masculina y femenina, cuyo ncleo slo contiene un cromosoma de cada par. El vulo es una clula redonda de gran tamao. Posee un ncleo donde se alojan los cromosomas portadores de la informacin gentica materna, y un citoplasma que posee sustancias nutritivas para alimentar al embrin en sus primeras etapas, en el caso de que ocurra la fecundacin. El espermatozoide, o gameto masculino, es una clula pequea con capacidad de movimiento para poder alcanzar al vulo.

Segn donde se encuentren el espermatozoide y el vulo, existen dos tipos de fecundacin: a) Fecundacin EXTERNA, cuando tanto el macho como la hembra liberan sus gametos al medio externo, que es el agua, de manera que los espermatozoides nadan en el agua hasta encontrar a los vulos. Es lo tpico de todos los animales invertebrados acuticos, y en los vertebrados se da en los peces y en los anfibios. b) Fecundacin INTERNA, cuando el macho deposita sus espermatozoides en el interior de la hembra, y se mueven por el organismo de la hembra hasta encontrar al vulo. En el erizo de mar no hay dimorfismo sexual de modo que externamente no se les puede diferenciar a las hembras de los machos. Las gnadas femeninas son de color rojo vinoso y las gnadas masculinas son de color amarillo grisceo. En ambos casos se encuentran en las zonas interambulacrales (celoma) ubicado en el interior del hemisferio superior. A travs de las glndulas genitales (5), las gnadas se comunican al

exterior mediante el poro genital, por donde son derramados los huevos. La fecundacin es externa porque los gametos se encuentran fuera de la cavidad genital y el vulo se fecunda externamente.

II.

OBJETIVOS - Identificar gametos masculinos y femeninos en erizo de mar. - Evidenciar el proceso de la fecundacin.

III.

MATERIALES Encontrars en el laboratorio - Microscopio - Placa Petri - Pipeta - Bagueta Traer el alumno - Portaobjetos - Cubreobjetos - Goteros - Materiales de diseccin: tijera, pinza,estilete. - Erizos de mar VIVOS en baldes con tapa y con agua de mar IV. PROCEDIMIENTO 4.1. Obtencin de vulos y Espermatozoides 1. Usando el material de diseccin, cortar las pas del erizo a nivel del ecuador todo el contorno radial e introducir la punta de la tijera para perforar y cortar transversalmente el caparazn por la zona cortical, obteniendo 2 mitades: el aboral y el ventral; en el aboral (lado superior) en las placas interradiales (5) del celoma es donde se encuentra las gnadas en sus respectivas masas genitales de color crema para los MACHOS y rojo vinoso para las HEMBRAS. 2. Luego echar las gnadas en un petri con agua de mar y con la ayuda de una bagueta se trozan los ovarios para liberar los vulos. En otro cristalizador, se hacen exactamente lo mismo con los testculos 4.2. Montaje y observacin de gametos 1. Colocar en un portaobjeto, una gota de la muestra con vulos y observar su forma y color 2. Colocar en un portaobjeto, una gota de la muestra con espermatozoides y observar su forma, tamao, flagelo, etc.

3. Despus de observar esta preparacin coloque una gota del colorante cristal violeta sobre los gametos masculinos y observe nuevamente 4. Observar a mayor aumento ambos gametos. 4.3 Fecundacin 1. De las muestras obtenidas, coloque en un portaobjeto una gota con vulos y otra con espermatozoides y mezclar. 2. Observar a mayor y menor aumento 3. Observar con detenimiento los cambios que sufre el vulo una vez fecundado.

DESARROLLO
1. Dibuje y coloree las distintas muestras observadas en la prctica. Mencionando el aumento total.

Muestra:_________ Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

Muestra:_________ Muestra:_________ Coloracin:_______ Coloracin:_______ Aumento:________ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 11

PRIMERA PARTE: EXTRACCIN DE ADN


I. FUNDAMENTO El ADN es un polmero de desoxiribonucletidos, que en eucariotes es el componente de la cromatina o material gentico. En la cromatina el ADN se encuentra asociado a protenas conocidas como nucleoprotenas de tipo histonas, protaminas y en menor proporcin con protenas de tipo cidas. Para extraer el ADN sin arrastrar sus protenas asociadas se podra emplear soluciones cidas. Sin embargo, stas soluciones podran daar la estructura de la hebra, de modo que se prefiere emplear solventes orgnicos como cloroformo, el cual extrae protenas dejando insoluble al ADN.

La extraccin de ADN de una muestra celular se basa en el hecho de que los iones salinos son atrados hacia las cargas negativas del ADN, permitiendo su disolucin y posterior extraccin de la clula. Se empieza por lisar (romper) las clulas mediante un detergente, vacindose su contenido molecular en una disolucin tampn en la que se disuelve el ADN. En ese momento, el tampn contiene ADN y todo un surtido de restos moleculares: ARN, carbohidratos, protenas y otras sustancias en menor proporcin. Las protenas asociadas al ADN, de gran longitud, se habrn fraccionado en cadenas ms pequeas y separadas de l por accin del detergente. Slo queda, por tanto, extraer el ADN de esa mezcla de tampn y detergente. La secuencia general de extraccin es la siguiente: 1 Liberacin del ADN en forma soluble por medio de la destruccin de los sistemas membranosos de los tejidos (membrana celular y nuclear). 2 Separacin de los complejos de nucleoprotena por denaturacin de la parte proteica. 3 Separacin del ADN de las otras macromolculas por solubilidad diferencial.

4 Precipitacin del ADN por insolubilidad en alcohol y bajas temperaturas. II. OBJETIVOS 1 El objetivo fundamental de esta prctica es utilizar unas sencillas tcnicas para poder extraer el ADN de un tejido animal y por el aspecto que presenta, confirmar su estructura fibrilar. 2 A partir de la longitud enorme de las fibras tambin se confirma que en el ncleo el ADN se encuentra replegado. III. MATERIALES Encontrars en el laboratorio: 1 - 2 Tubos de prueba de 20 ml 2 - 5 Baguetas 3 - 1 embudo 4 - Etanol helado 1 - 5 Pipetas de 10ml 2 - Bao Mara 0 - Mortero con piln 1 - Gasa esteril IV. PROCEDIMIENTO Para la extraccin DE ADN del manto de choro, con etanol, seguiremos los siguientes pasos. 4.1. Homogenizacin del Tejido El mtodo para desintegrar el tejido debe estar adaptado a las caractersticas de ste. Para grandes volmenes de tejidos blandos, suelen usarse licuadoras esencialmente iguales a las licuadoras domsticas. Para volmenes menores, en general es suficiente un MORTERO y un piln. Tejidos ms resistentes, como por ejemplo hueso o diente, necesitan tratamientos mecnicos especiales. Aquellos tejidos con clulas cuya pared celular es resistente, como por ejemplo vegetales, hongos o bacterias, requieren tambin condiciones drsticas. Uno de los mtodos ms utilizados consiste en congelar la muestra en nitrgeno lquido y, mantenindola congelada, pulverizarla con un mortero. As, adems de desintegrar la muestra, se logra que sta se mantenga a muy baja temperatura durante el tratamiento, con lo cual se evita la accin de enzimas endgenas que pudieran degradar el material de inters. En esta prctica se emplear un mtodo de ruptura con mortero (sin congelamiento). La principal ventaja de este mtodo es que se adapta bastante bien a tejidos muy diversos. Asimismo, dado que se opera a temperatura ambiente, las ribonucleasas celulares pueden degradar parcialmente las molculas de ARN. Para ayudar a la solubilizacin de los componentes celulares, a la ruptura de membranas y de complejos proticos, la solucin de lisis contendr un detergente inico (dodecilsulfato de sodio, SDS). Este detergente dispersa los componentes de las membranas y desnaturaliza las protenas. La solucin de lisis contiene adems el agente quelante de cationes divalentes, EDTA. Esto impide la accin de las ADNasas (dependientes de Mg2+ ), aunque no tiene efectos sobre la mayor parte de las ribonucleasas. Seguir los siguientes pasos: - Vaso de precipitacin de 500ml. - Medio de homogenizacin: - Lauril Sulfato de Sodio (SDS o -Hielo SLS) 50 g - Cloruro de Sodio 8. 770 g - Citrato de Sodio 4.110 g - EDTA 0.292 g

1 Las clulas se homogenizarn en un mortero empleando el medio de homogenizacin. ES


OBLIGATORIO el uso de guantes en todo momento para evitar la contaminacin de la muestra con DNAasa proveniente del sudor de las manos que pueda degradar nuestras muestras de ADN. Se lisarn las clulas agregando 10 ml de la solucin de homogenizacin por cada gramo de tejido con que se inici el proceso. Los componentes como el SDS, permitir por una parte la separacin de las protenas asociadas a la cromatina y por otra parte la ruptura de membranas. El NaCl produce el estallido de los ncleos para liberar as las fibras de cromatina. El EDTA es un agente quelante que inactiva a las DNAasas. Incubar la mezcla en un Bao Mara a 60C por 15 minutos exactos. El calor ablandar el tejido permitiendo que los componentes de la solucin homogenizadora ingrese a la clula. Adems, esta temperatura denatura muchas enzimas que interfieren con el procedimiento. Filtrar el homogenizado empleando la gasa esteril Enfriar rpidamente la preparacin filtrada en una cubeta con hielo, por 10 minutos a fin de detener cualquier proceso degradativo del ADN.

3 4 5

4.2. Precipitacin del ADN La precipitacin de los cidos nucleicos permite su purificacin y concentracin. Se basa en la simultnea neutralizacin de las cargas negativas y deshidratacin de la molcula, lo cual posibilita su agregacin y precipitacin. La precipitacin es un fenmeno reversible (mediante la resuspensin en soluciones acuosas) y no debe ser confundido ni con la desnaturalizacin (potencialmente reversible) ni con la degradacin (irreversible) de los mismos. Efectuar los siguientes pasos: 1 Lentamente, agregar etanol helado por el borde interno del recipiente hasta que comience a aparecer una consistencia blanca que significa que el ADN ha precipitado. 2 Suavemente, a medida que se agrega el etanol helado, girar enrollando a la vez con una bagueta de vidrio. 3 Reconoce 3 fases en tu solucin: la del alcohol (que flota en agua), la de tu tejido triturado (abajo del todo) y la interfase entre los 2 que contiene ADN precipitado. 4 Poco a poco haciendo estos movimientos en una sola direccin, se lograr apreciar el ADN en la bagueta, asemejando una madeja de un hilo sumamente fino o como copos de algodn. Nota importante. El producto filamentoso obtenido de esta extraccin no es ADN puro ya que, entremezclado con l, hay fragmentos de ARN. Una extraccin "profesional" se realiza aadiendo enzimas que fragmentan las molculas de ARN e impiden que se unan al ADN (protocolos de PURIFICACIN de ADN).

SEGUNTA PARTE: ELECTROFORESIS


I. FUNDAMENTO El problema de realizar separaciones de biomolculas grandes es enfrentado frecuentemente en las ciencias de la vida, tanto para anlisis cuali- como cuantitativos de mezclas o de preparaciones individuales. En la mayora de casos es deseable causar el mnimo de dao a las molculas de manera que sus propiedades no cambien de manera significativa. Los mtodos actuales para la separacin de biomolculas descansan por lo tanto en procesos fsicos que causan el mnimo de desnaturalizacin, lo cual resulta en la mxima retencin de cualquier actividad biolgica. Un gran grupo de mtodos de separacin estn basados en algunas propiedades qumicas o biolgicas, o en interacciones de la molcula que

se investiga, y algunas otras estn basadas en diferencias en pesos moleculares o cargas netas, o a veces una combinacin de las dos propiedades. Los mtodos electroforticos pueden disear se para explotar cualquiera de los dos, o ambos parmetros, aunque las diferencias en tamao son las principales en el caso de las separaciones de cidos nucleicos. La electroforesis en geles de agarosa es una tcnica comn en los laboratorios de Biologa Molecular. El proceso consiste en la aplicacin de una diferencia de voltaje a una muestra de ADN que se encuentra inmersa en un gel de agarosa, y esta a su vez en baada por un buffer determinado. La generacin de polos opuestos provoca la migracin del ADN del polo cargado negativamente (Ctodo) al polo cargado positivamente (Anodo), debido a que el ADN tiene una carga neta negativa. Los geles de agarosa son el medio ms popular para separaciones electroforticas de cidos nucleicos de mediano y gran tamao. Las concentraciones ms tpicas de agarosa van de 0.3 hasta 2.5 %, y esta concentracin depende de los tamaos de los cidos nucleicos a separar. Aunque los geles de agarosa carecen de fuerza mecnica (especialmente los ms diluidos), la manipulacin se facilita por el uso de geles horizontales, los cuales pueden ser soportados por lmina de vidrio o de plstico El gel resultante es fotografiado en un aparato llamado transiluminador, presencia de bromuro de etidio, para poner en evidencia los fragmentos de ADN en el gel. En la presente prctica analizaremos la fotografa de un gel de agarosa y observaremos las distintas bandas de ADN que en l aparecen, discutiendo la razn por las que unas aparecen ms arriba que otras. Realizaremos un anlisis como el que se hace en ensayos de diagnstico molecular y de clonacin.

II. OBJETIVOS -Comprobar la movilidad del ADN en un gel de agarosa -Analizar la utilidad de esta tcnica en ensayos de biologa molecular aplicada III. MATERIALES Y MTODOS Analizaremos la siguiente Lmina de un gel de agarosa y discutiremos cul es el significado y la interpretacin de esas bandas en el gel.

DESARROLLO
1.- Dibuje sus resultados

2.-Discuta y resuelva los siguientes enunciados

En el gel aparecen 3 carriles o calles, cada uno con una muestra distinta (M, 1 y 2). Los pocillos son hechos en el gel para introducir ah la muestra de ADN.

1 qu hay en el primer carril?


____________________________________________________________________________________ 2 en la muestra 1, qu tamao aproximado tienen las bandas de ADN? _______________________________________________________________________________ 3 por qu aparece RNA en algunas nuestras y por qu aparece tan abajo, comparado al ADN? _______________________________________________________________________________ 4 qu significado tiene que algunas bandas sean ms gruesas que otras? _______________________________________________________________________________ 5 qu hubiera esperado encontrar si corra un gel con su ADN recin extrado? Dibujelo. ______________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

FIRMA/ SELLO PROFESOR

PRACTICA N 12
CDIGO GENTICO Y TRADUCCIN DE PROTENAS

I. FUNDAMENTO El proceso de traduccin, es decir, sntesis de novo de protenas, ocurre en el citoplasma, especficamente en los ribosomas del retculo endoplasmtico rugoso (en humanos). La sntesis de una protena requiere que previamente el ARNm de ese gen haya sido transcrito en el ncleo y exportado al citoplasma. Aqu el ARNm, que contiene la informacin gentica necesaria para codificar la protena, se asociar a los ribosomas del RER y con la intervencin de una compleja maquinaria proteica as como de los ARNt especficos para cada aminocido, se llevar a cabo la traduccin.

El ARNm porta los codones, tripletes de nucletidos, que codifican para un aminocido. Mientras que los ARNt portan los anticodones, que le indican qu aminocido van a portar y llevar hasta el complejo ARNm-ribosomas-enzimas. El cdigo gentico es la combinacin de tripletes que tienen la informacin necesaria para codificar un aminocido. Existen 64 codones en el cdigo gentico, que codifican para los 20 aminocidos que forman las protenas y que adems contiene 1 codn de inicio de la traduccin y 3 codones de finalizacin de la misma. En esta prctica analizaremos la degeneracin del cdigo gentico, discutiremos por qu no es realmente universal y realizaremos la traduccin de algunos genes en sus respectivas secuencias de aminocidos. II. OBJETIVOS - Reconocer los codones y anticodones posibles para los aminocidos que forman las protenas. - Analizar posibles mutaciones en los codones que alteren la secuencia de una protena y con ello su funcin. III. MATERIALES - Lmina de la tabla del Cdigo Gentico - Lmina de la tabla de las alteraciones del Cdigo Gentico en mitocondrias y otros organismos.

IV. MTODOS 4.1. Antes de solucionar los problemas planteados, determine: a. nmero de codones de inicio ____________________________ b. nmero de codones de finalizacin _______________________ c. aminocidos codificados por 1 slo codn __________________ d. aminocidos codificados por 2 codones ____________________ e. aminocidos codificados por ms de 3 codones ____________________________ f. qu cambios se han producido en el cdigo gentico de mitocondrias en humanos? ____________________________________________________________________________________ ____________________________________________________________________________________ g. Lista de aminocidos esenciales y no esenciales

____________________________________________________________________________________ ____________________________________________________________________________________ 4.2. Discuta con su profesor y responda: Por qu algunos aminocidos son codificados por 1 slo codn mientras que otros son codificados por 2 o ms codones? ____________________________________________________________________________________ ____________________________________________________________________________________ 4.3. Los siguientes problemas debern ser solucionados en clase con ayuda del profesor: Primer problema: Transcripcin y traduccin Se tiene la siguiente secuencia de ADN (cadena codante) que es parte del gen de transferrina. 5 ATGGCATCCTACGATCAGTATCCTATACGC 3 (EL GEN CONTINA) Determine: 1. la secuencia no codante del respectivo trozo del gen ___________________________________________________________________________________ 2. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen ___________________________________________________________________________________ 3. Utilizando la tabla del cdigo gentico, deduzca la secuencia de aminocidos que codificar dicha cadena (considerando que se incub el ADN en un extracto crudo de clulas de reticulocitos de conejo que contena los respectivo ARNt, enzimas, ATP, GTP, etc.) ___________________________________________________________________________________ ___________________________________________________________________________________ Segundo problema. Mutaciones en la secuencia de nucletidos La secuencia de ADN del gen de transferrina, del problema 1, ha sufrido mutaciones por el efecto de radiaciones UV. Se secuenci el gen mutado y la secuencia obtenida fue la siguiente: 5 ATGGCATCGTACGAACAGTAGCCTATACGC 3 ..(EL GEN CONTINA) Determine: 1. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen ____________________________________________________________________________________ 2. la secuencia de aminocidos que, tras esas mutaciones, se codifica ____________________________________________________________________________________ 3. qu mutaciones han sido conservativas y cuales no. ____________________________________________________________________________________ Tercer problema. Traduccin en mitocondrias Se cuenta con parte de la secuencia del gen de la protena de Fe-S, que participa en la cadena transportadora de electrones en la mitocondria, y que es codificada dentro de la misma. La secuencia es de la cadena de ADN codante: . 5 CCGTCAGAACTCGAAGCTCCGGACTTAGCT 3 Determine: 1. la secuencia de aminocidos codificada en la mitocondria, a partir de dicha cadena nucleotdica __________________________________________________________________

2. cul seran los aminocidos cambiados si dicho gen se codificara en el citoplasma? __________________________________________________________________

PRACTICA N 13
ESTUDIO DE RASGOS GENTICOS EN EL HOMBRE

I. FUNDAMENTO Las caractersticas de un organismo son el resultado de la herencia y de la interaccin de los genes. Los principios de la gentica establecidos por Mendel y Morgan y otros investigadores se aplican a todos los organismos vivientes, incluido el hombre. De la misma manera que en otros, algunos rasgos humanos son determinados por genes dominantes y otros por genes recesivos. Lo rasgos dominantes generalmente se encuentran con mayor frecuencia que los que se deben a genes recesivos. En la transmisin de la mayora de los caracteres hereditarios, estn involucrados varios genes, pero a menudo la variacin de un solo gen, produce la variacin de una sola caracterstica lo que da lugar a dos formas distintas de expresin. Algunos genes (y su manifestacin) estn ligados al sexo, es decir que la caracterstica respectiva slo se expresa en uno de los sexos. Frecuentemente el masculino (hemofilia por ejemplo). En este caso el gen en cuestin se encuentra localizado en el cromosoma X (el cromosoma Y se considera genticamente vaco). En otros casos la manifestacin genotpica es influenciada por el otro sexo (p.e. calvicie, es dominante en el varn y recesivo en la mujer). En este caso los genes respectivos estn localizados en un cromosoma autosmico, pero su expresin esta condicionada a la accin secundaria de genes ubicados en el cromosoma X. II. OBJETIVOS 1. Determinar el fenotipo (expresin de las caractersticas) y su probable genotipo (Informacin gentica en el cromosoma respectivo) tanto como sea posible. 2. Estimar la distribucin de los genes dominantes y recesivos para cada rasgo gentico observado en el grupo. III. MATERIAL Debers traer de casa. -Espejo -Lupa IV. PROCEDIMIENTO 1. Con la ayuda de un espejo o de un compaero determine un fenotipo para cada uno de los rasgos genticos descritos a continuacin. Haga sus anotaciones en su cuaderno de trabajo. 2. Cuando se trata de una caracterstica dominante, no es posible determinar con certeza el genotipo, pues pueden estar presentes dos genes dominantes para esta caracterstica (homocigosis) o un gen dominante y uno recesivo (heterocigosis). En consecuencia utilizaremos un guin (-) para representar el alelo desconocido. En cuanto al carcter recesivo, no hay dificultad en establecer el genotipo, los dos genes alelomrficos son recesivos. Anote su genotipo en la hoja de trabajo.

3. Tabule en la hoja de trabajo el nmero de alumnos con cada rasgo gentico estudiado DONDE SE INCLUYA: rasgo estudiado, genes involucrados, dominancia o recesin, estado del gen expresado (homocigoto o heterocigoto), etc. RASGOS GENETICOS A SER ESTUDIADOS INDEPENDIENTES DEL SEXO 1. Enrollar la lengua: algunas personas tienen la aptitud de enrollar la lengua en forma de U. Esto es causado por un gen dominante (E). La gente que no posee este gen slo puede curvar la lengua ligeramente hacia abajo. 2. Lbulos separados: un gen dominante (L) determina que los lbulos de la oreja estn separados, es decir que no estn adheridos directamente a la cabeza. En otras personas los lbulos de las orejas estn adheridos directamente al costado de la cabeza. 3. Pico de viuda: algunas personas muestran la caracterstica de que la lnea de pelo baja hasta un punto definido en la mitad de la frente. Esto se conoce como pico de viuda, este rasgo resulta de un gen dominante (V). El gen recesivo determina la caracterstica de una lnea contina en el pelo. 4. Meique doblado hacia adentro: Un gen dominante (B) hace que la ltima falange del meique se flexione hacia el dedo anular. Descanse ambas manos tendidas sobre la mesa, relaje los msculos y observe si su meique est flexionado o recto. 5. Iris pigmentado: Cuando una persona es homocigota para cierto gen recesivo (p) no hay pigmento en la parte anterior de los ojos y en cambio se muestra una capa azul detrs del iris. Esto determina que los ojos sean azules. Un alelo dominante de este gen (P) hace que el pigmento se deposite en la capa anterior del iris y enmascara el color azul en grado variable. Otros genes determinan la naturaleza y densidad exactas de este pigmento, originando los ojos pardos, violeta, verde y otros colores. Nota: Algunas veces la capa detrs del iris es gris y esto deber considerarse como no pigmentado. 6. Pelo de la falange media: algunas personas tienen pelo en la segunda falange de la mano mientras otras personas no. La ausencia completa del pelo en todo, se debe a un gen recesivo (m) y su presencia se debe a su alelo dominante (M). Parece que hay un nmero variable de estos alelos que determinan si el pelo debe crecer en uno, dos, tres o cuatro dedos. Este pelo puede ser muy fino y ser necesario usar una lupa y mirar cuidadosamente en todos los dedos, antes de decidir si est ausente en alguno de los dedos. 7. Msculo palmar largo: Cuando una persona es homocigota para cierto gen recesivo (l), presenta un msculo palmar largo, el cual puede ser detectado examinando los tendones que corren en la cara interna del antebrazo (altura de la mueca) cierre el puo fuertemente y doble la mano hacia delante. Palpe los tendones. Si hay tres, usted tiene el msculo palmar largo. Si solo hay dos (el medial ms grande no existe) usted no tiene este msculo. Examine ambas muecas pues a veces est presente en un brazo y no en el otro, a causa de las variaciones en la expresin de los genes. Si lo encuentra en uno o ambos brazos, posee dos genes recesivos. Si no est presente en ambas muecas tiene el gen dominante (L). 8. Forma del cabello: la forma natural del cabello de una persona puede ser lacia, ondulada o crespa, con variantes intermedias. El mecanismo por el cual se origina la forma del cabello es algo complejo, pero puede asumirse que los responsables de esta caracterstica son un par de genes con dominancia incompleta. Asumiendo que la forma de su cabello no ha sido modificada por tratamiento artificial, anote el genotipo respectivo segn el siguiente cdigo: CC= cabello crespo Cc= cabello ondulado cc= cabello lacio. 9. Pulgar desarticulable: algunas personas tienen la habilidad de desarticular las falanges de sus dedos pulgares, a causa de que los ligamentos de esta articulacin son sumamente flojos, caracterstica que es dominante sobre ligamentos firmes. Esta circunstancia permite retirar el dedo pulgar hacia atrs

sacndolo de su articulacin. Ensaye la posibilidad de desarticular el pulgar de cualquiera de sus manos SIN ayuda de la otra mano e identifique su genotipo respectivo as: JJ o Jj = pulgar desarticulable jj = pulgar no desarticulable. 10. Color del cabello: el color del cabello es determinado por la interaccin de un gran nmero de factores; sin embargo, si consideramos solo las mayores categoras de color capilar, estas pueden explicarse por la interaccin de dos pares de genes (herencia dihibrida): (D_) pigmento pardo presente, (dd) pigmento pardo ausente, (rr) pigmento rojo presente. De acuerdo con la ley de la distribucin independiente, un individuo cualquiera puede tener alguna de las siguientes combinaciones de genes y color: DDRR, DDRr, DdRR : cabello oscuro (negro) DdRr, Ddrr, DDrr : cabello castao u oscuro con tintes rojizos ddRr : cabello rubio Dr. : cabello claro (color arena) INFLUENCIADOS POR EL SEXO 11. Segundo dedo ms corto que el cuarto: mantenga sus dedos juntos y ponga sus manos sobre una hoja de papel, de modo que sus dedos descansen en ngulo recto con una lnea horizontal, que usted ha trazado antes sobre el papel. Mueva su mano hacia arriba o hacia abajo hasta que el extremo del cuarto dedo (anular) toque escasamente la lnea. Mire su segundo dedo (Indice) y vea si toca la lnea.si no lo hace el segundo dedo es ms corto que el cuarto. Se cree que este segundo dedo ms corto es el resultado de un gen influenciado por el sexo del individuo. Segn esto el gen es dominante en lo varones y recesivo en las mujeres. Sc para el gen correspondiente al segundo dedo corto Sl para el gen correspondiente para el segundo dedo largo. 12. Voz para el canto: el tono de la voz para el canto es determinado por un solo par de alelos V y v que muestran dominancia incompleta y estn influenciados por el sexo. Clasifique su voz par el canto segn el siguiente cuadro: Genotipos Varn VV Vv vv Bajo Bartono Tenor Fenotipos Mujer Contraalto Meso soprano Soprano

13. Calvicie: esta es otra caracterstica influenciada por el sexo y es controlada tambin por un par de alelos. Aunque esta caracterstica no suele manifestarse antes de los 30 aos, sus posibilidades personales de calvicie pueden presumirse por la presencia o ausencia de esta caracterstica entre los miembros mayores de su familia tanto por la lnea materna o paterna. Establezca su probable genotipo guindose por el siguiente cuadro: Genotipos Varn HH Hh hh calvo calvo normal Fenotipos Mujer calva normal normal

LIGADOS AL SEXO 14. Ceguera para el color (daltonismo): tipo ms comn de daltonismo es heredado como carcter recesivo ligado al sexo. Puesto que el gen es portado solamente por el cromosoma X es necesario indicar el cromosoma al especificar el genotipo. Son posible genotipos y fenotipos: Fenotipos Genotipos Mujer Varn

Normal Daltnico DESARROLLO

XNXn XnXn

XNY XnY

NOMBRE:______________________________ GRUPO:___________ MESA:___________ FECHA:_________ PROFESOR:_____________________________

1.- Anote su genotipo y fenotipo de cada caracterstica evaluada.