You are on page 1of 64

DNA modifying enzymes

Enzymes that modify DNA are useful because they allow the investigator to manipulate DNA in defined ways - Polymerases elongate DNA molecules by adding free nucleotides to the 3’ ends (usually according to an opposite template strand) - Endonucleases cut DNA fragments in the middle of the molecule - Exonucleases degrade DNA from the ends - Ligases join loose ends of DNA together

DNA polymerases
DNA polymerases exonuclease activities: - Activity 3→5 exonuclease. ( proofreading activity) allows the polymerase to correct errors by removing a nucleotide that has been inserted incorrectly. - Activity 5→3 exonuclease activity is possessed by some DNA polymerases.

DNAPI stalls if the incorrect ntd is added . .it can’t add the next ntd in the chain Proof reading activity is slow compared to polymerizing activity. but the stalling of DNAP I after insertion of an incorrect base allows the proofreading activity to catch up with the polymerizing activity and remove the incorrect base.Proof reading activity of the 3’ to 5’ exonuclease.

The types of DNA polymerases used in research: DNA polymerase I: Unmodified E. Use: DNA labeling . coli enzyme .coli DNA polymerase I Use: DNA labeling . Klenow polymerase: Modified version of E.

Arthur Kornberg demonstrated the existence of a DNA polymerase .DNA polymerase I • DNA Polymerase I has THREE different enzymatic activities in a single polypeptide: • a 5’ to 3’ DNA polymerizing activity • a 3’ to 5’ exonuclease activity • a 5’ to 3’ exonuclease activity .The Enzymology of DNA Replication • In 1957.

.Functional domains in the Klenow Fragment (left) and DNA Polymerase I (right).

DNA polymerase I

Nick Translation

Nucleases

Exonucleases .

Prepare single-stranded template with Lambda Exonuclease.Figure 1. .

1 Lambda Exonuclease selectively digests the strand of a PCR product produced using a PCR primer with a 5´-phosphate. . The resulting singlestranded PCR product can be used for SSCP analysis or sequencing.Figure.

Nucleases Endonucleases .

g.Endonucleases I. from many sources . Specific e. Restriction endonucleases. S1 nuclease. Non specific e. from Escherichia coli II.g. from the fungus Aspergillus oryzae And Deoxyribonuclease I (DNaseI).

Non specific .Endonucleases I. from the fungus Aspergillus oryzae Use:Transcript mapping .S1 nuclease (Endonuclease specific for singlestranded DNA and RNA.Deoxyribonuclease I (DNaseI) Endonuclease specific for double stranded DNA and RNA. from Escherichia coli Use:Nuclease footprinting .

.

S1 nuclease protection • digests only single-stranded RNA and DNA Find introns: intron exon 1 exon 2 genomic DNA antisense probe exon 1 exon 2 Digest with S1 Run gel .

from many sources Use:Many applications .Endonucleases II. Restriction endonucleases: Sequencespecific DNA endonucleases.g. Specific e.

Recognize. bind to.The double strand breaks can create ends that are: * Blunt. and cleave DNA molecules at specific sequences (usually 4-6 base pairs in length) but there are some that are 5. or longer .Restriction endonuclease Restriction Endonucleases .Also called restriction enzymes . cutting both strands in the same place * Sticky. with overhanging nucleotides on the 5’ or 3’ ends . 8.

Restriction endonuclease Restriction enzymes • Over 10. .000 bacteria species have been screened for restriction enzymes • Over 2.500 restriction enzymes have been found • Over 250 distinct specificities • Occasionally enzymes with novel DNA sequence specificities are still found while most now prove to be duplicates (isoschizomers) of already discovered specificities.

With Types I and III there is no strict control over the position of the cut relative to the specific sequence in the DNA molecule that is recognized by the enzyme.Restriction endonuclease There are three types of restriction enzymes. either within the recognition sequence or very close to it . Type II enzymes do not suffer from this disadvantage because the cut is always at the same place. These enzymes are therefore less useful .

and are most useful for molecular biology research .Type II Restriction enzymes are endonucleases that cut DNA at specific sites.

Restriction enzymes Restriction enzymes are molecular scissors .

Restriction enzymes • Restriction Enzymes scan the DNA code • Find a very specific set of nucleotides • Make a specific cut .

in the genetic code. known as restriction sites.Restriction enzymes Restriction enzymes recognize and make a cut within specific palindromic sequences.or 6 base pair sequence. Picking a palindrome Words that read the same forwards as backwards hannaH Hannah Level Madam leveL madaM . This is usually a 4.

ere. I saw Elba” 5’-GGATCC-3’ Bam H1 site: 3’-CCTAGG-5’ .Restriction enzymes Restriction Enzyme Recognition Sites Restriction sites are general palindromic: “Able was I.

HaeIII HaeIII is a restriction enzyme that searches the DNA molecule until it finds this sequence of four nitrogen bases. 5’ TGACGGGTTCGAGGCCAG 3’ 3’ ACTGCCCAAGGTCCGGTC 5’ 5’ TGACGGGTTCGAGGCCAG 3’ 3’ ACTGCCCAAGGTCCGGTC 5’ .

Once the recognition site was found HaeIII could go to work cutting (cleaving) the DNA 5’ TGACGGGTTCGAGGCCAG 3’ 3’ ACTGCCCAAGGTCCGGTC 5’ .

These cuts produce what scientists call “blunt ends” 5’ TGACGGGTTCGAGG 3’ ACTGCCCAAGGTCC CCAG 3’ GGTC 5’ .

Restriction enzymes Restriction enzymes are named based on the bacteria in which they are isolated in the following example for the enzyme EcoRI: E Escherichia (genus) co coli (species) R RY13 (strain) I First identified Order ID'd in bacterium .

Restriction enzymes Nomenclature of Restriction Enzymes The 1st letter (in capital and italics) = first initial of Genus name (from which the enzyme was isolated • The 2nd and 3rd (in italics) = the first 2 letters of the species name e.g. Hind = Haemophilus influenzae Rd • The roman number followed is given to distinguish different restriction and modification system in the same strain e.g.g. HindIII . Hin = Haemophilus influenzae • The 4th letter (sometimes in italics) = strain or type e.

... W=A or T ....CCWGG GGWCC..EcoRI 5’ G AATTC 3’ 3’ CTTAA G 5’ EcoRII ..

makes a staggered cut and produces a “sticky end” 5’ GAATTC 3’ 3’ CTTAAG 5’ 5’ GAATTC 3’ 3’ CTTAAG 5’ 5’ G 3’ CTTAA AATTC 3’ G 5’ .“blunt ends” and “sticky ends” Remember how HaeIII produced a “blunt end”? EcoRI. for instance.

Restriction enzymes Single stranded “nick” Eco RI Restriction Enzyme .

Some more examples of restriction sites of restriction enzymes with their cut sites: HindIII: 5’ AAGCTT 3’ 3’ TTCGAA 5’ BamHI: 5’ GGATCC 3’ 3’ CCTAGG 5’ AluI: 5’ AGCT 3’ 3’ TCGA 5’ .

(e.) . and so is an isochizomer of Sau3A. two or more different enzymes may recognize identical sites.g.Restriction Enzyme Recognition Sites BglII 5’ A-G-A-T-C-T T-C-T-A-G-A 5’ Sau3A 5’ G-A-T-C C-T-A-G 5’ All these sticky ends are compatible BamHI 5’ G-G-A-T-C-C C-C-T-A-G-G 5’ Isoschizomers: In certain cases. MboI also cleaves at GATC.

com/NEBcutter2/index.neb. which is often does not) BamH1 (GGATCC) cuts (¼)(¼)(¼)(¼)(¼)(¼) = once every ~4Kb HindII (GTPyPuAC) cuts (¼)(¼)(½)(½)(¼)(¼) = once every ~1Kb http://tools.Restriction enzymes Frequency of cutting of recognition enzymes Sau 3A (GATC) cuts (¼)(¼)(¼)(¼) = once every 256 base pairs (assuming G/C = A/T.php .

+ rATP 5’-A-C-G-G-T-A-C-T-A-G-A-A-T-T-C-A-G-C-T-A-C-G-3’ 3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A-G-T-C-G-A-T-G-C-5’ recombinant DNA molecule .Ligation of compatible sticky ends Human DNA cleaved with EcoRI 5’-C-G-G-T-A-C-T-A-G-OH 3’-G-C-C-A-T-G-A-T-C-T-T-A-A-PO4 Corn DNA cleaved with EcoRI + PO4-A-A-T-T-C-A-G-C-T-A-C-G-3’ HO-G-T-C-G-A-T-G-C-5’ Complementary base pairing 5’-A-C-G-G-T-A-C-T-A-G A-A-T-T-C-A-G-C-T-A-C-G-3’ 3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A G-T-C-G-A-T-G-C-5’ + DNA Ligase.

Exercise1 HindIII 1/ 6160 EcoRI 5660 PvuII 5116 Eagl 542 YIP M Apal 2035 PvuII 3547 SmaI 2860 SmaI 5’ ccc ggg 3’ How many base pairs in this plasmid? How mamy fragments will be produced if this plasmid is digested with PvuII? .

Agarose Gel Electrophoresis _ DNA is negatively charged from the phosphate backbone Agarose mesh + Visualize DNA with ethidium bromide – fluoresces orange ONLY when bound to DNA .

Gel Electrophoresis of DNA .

like gelatin • Gel electrophoresis refers to the separation of charged particles located in a gel when an electric current is applied • Charged particles can include DNA. occurring in a solid form. from the Greek = to carry across • A gel is a colloid. etc . a suspension of tiny particles in a medium. amino acids. phoresis.What is Gel Electrophoresis? • Electro = flow of electricity. peptides.

.Gel electrophoresis Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used for the preparation and analysis of DNA. Gel electrophoresis is a procedure that separates molecules on the basis of their rate of movement through a gel under the influence of an electrical field.

for forensic work or for sequencing . for recovering particular pieces of DNA.Why do gel electrophoresis? • When DNA is cut by restriction enzymes.i.e. the result is a mix of pieces of DNA of different lengths • It is useful to be able to separate the pieces .

Gel with molecular weight marker 46 .

Summary • Restriction endonucleases recognize specific sequences in DNA molecules and make cuts in both strands • This allows very specific cutting of DNAs 4-7 • The cuts in the two strands are frequently staggered. so restriction enzymes can create sticky ends that help to link together 2 DNAs to form a recombinant DNA in vitro .

Only one strand is shown . Polylinkers are chemically synthesized and then are inserted into a plasmid vector. for each of the 10 restriction enzymes indicated. indicated by brackets.Exercise Plasmid vectors containing a polylinker (a) Sequence of a polylinker that includes one copy of the recognition site.

2.1. and XbaI . XbaI . SphI . A vector has a polylinker containing restriction sites in the following order: HindIII . . The nucleotide sequence of a polylinker in a particular plasmid vector is GAATTCCCGGGGATCCTCTAGAGTCGACCTGCAGG CATGCThis polylinker contains restriction sites for BamHI . SmaI . . SacI . PstI . and ClaI . Indicate the location of each restriction site in this sequence. BglII . SalI . XhoI . EcoRI .Give a possible nucleotide sequence for the polylinker .

Enzyme BamHI EcoRI PstI SacI SalI SmaI SphI XbaI XmaI Recognition Sequence G¯ GATCC G¯ AATTC CTGCA¯ G GAGCT¯ C G¯ TCGAC CCC¯ GGG GCATG¯ C T¯ CTAGA C¯ CCGGG .

Nucleases What is difference between DNase and RNase? DNase RNases cut DNA cut RNA .

RNases .

Ribonuclease H (RNase H) .

Replacement Synthesis .

The reaction requires energy. which is provided by adding either ATP or NAD to the reaction mixture. depending on the type of ligase that is being used. .DNA ligases DNA fragments that have been generated by treatment with a restriction endonuclease can be joined back together again. by a DNA ligase. or attached to a new partner.

DNA replication requires many enzymes and protein factors Replisome Helicases Topoisomerases DNA-binding proteins Primases DNA ligases .

DNA ligases .

Application of DNA ligase .

Role of Phosphatase in DNA ligation .

Phosphotases & Kinases .

2002. p.Flow of Genetic Information : The Central Dogma of Molecular Biology DNA polymerase Reverse transcriptase Alberts et al. 301 .

.

.g. detection of HCV-Ag) .Reverse transcriptase .The produced DNA called complementry DNA (cDNA) * Present in retro virus & other RNA viruses * Application: Used in RT-PCR (e.An enzyme that catalyses the synthesis of a DNA strand from an RNA template.

Reverse transcriptase .