‫الخبر الوراثي ‪:‬‬

‫مفهومه‪،‬طبيعته‬
‫و آلية تعبيره‬

‫لحظ هاذين التوأمين ؟‬

‫فسر ملحظاتك؟‬

‫‪ +1‬صف سلوك الصبغيات؟‬
‫‪ +2‬قارن طريقة النقسام بين نوعي الخليا ؟‬

‫المرحلة التمهيدية ‪ : Prophase‬مدتها تقريبا ‪ 40‬دقيقة‬
‫و انتظامه على شكل خييطات تسمىالصبغينتتميز في بدايتها بتكاثف‬
‫الصبغيات كل صبغي مكون من صبيغيين مرتبطين على مستوى الجزيء‬
‫المركزي‪ ،‬في نهاية هذه المرحلة يتلشى الغشاء النووي و النويات و تتكون‬
‫ألياف قطبية بين الكمتين القطبيتين و يبدأ تشكل اللياف الصبغية انطلقا من‬
‫‪.‬الجزيء المركزي‬
‫المرحلة الستوائية ‪ :Metaphase‬مدتها تقارب ‪ 5‬دقائق‬
‫تصبح الصبغيات أكثر وضوحا و تتموضع على المستوى الستوائي للخلية‬
‫‪.‬مكونة الصفيحة الستوائية و يكتمل تشكل مغزل النقسام‬
‫‪ ‬‬
‫المرحلة النفصالية ‪ :anaphase‬مدتها تقارب دقيقتين‬
‫تتميز بانشطار الجزيء المركزي و انفصال صبيغيي كل صبغي و هجرة كل‬
‫مجموعة نحو أحد قطبي الخلية نتيجة تقصير اللياف الصبغية إنها الهجرة‬
‫‪.‬القطبية‬
‫‪ ‬‬
‫المرحلة النهائية ‪ : Telophase‬مدتها تقارب ‪ 10‬دقائق‬
‫تتجمع الصبغيات و تتشابك و تفقد فرديتها و تتحول إلى صبغين و يتكون‬
‫الغشاء النووي و النويات و يختفي مغزل النقسام و يتكون جدار أولي‬
‫للغشاء السيليلوزي يفصل بين خليتين بنتين تتوفران على نفس عدد‬
‫‪.‬الصبغيات‬
‫‪ ‬‬

cycle cellulaire.swf

‫ت‬

‫‪  ‬‬

‫آلية التحول البكتيري‬

virus cycle.swf

dna1s[1].swf

des_chromos omes_a_ladn[1].swf

‫‪ )1‬حلل هذه الخرائط الصبغية ؟‬
‫‪ )2‬حدد الفرق بين الذكر والنثى ؟‬
‫‪ )3‬اكتب الصيغة الصبغية لكل منهما؟‬

 meselson ‫تجربة‬
exp meselson.swf

semi-conservatif.exe

Taylor.exe

interpret.exe

replication[1].swf
dna-rna2[1].swf

duplication.swf

Hb A

Hb S

‫أمثلة لبعض الطفرات‬

ADN_ARN[m].swf

transcription[1].swf

ADN_ARN[m].swf

_protein_synthesis[1].swf

Tradu.swf

‫تمثل الوثيقة التالية جزء من الخييط الغير مستنسخ لـ ‪ ADN‬مورثة‪ .‬‬
‫‪ ATGCCCTGTGCCATCAAGTAA‬‬
‫‪1‬ـ اعط متتالية الحماض المينية المطابقة للبروتين الذي تتحكم في‬
‫تركيبه هذه المورثة‪ .‬‬
‫‪2‬ـ حدد نتيجة استبدال النيكليوتيد ‪ C‬رقم ‪ 10‬من اللولب المستنسخ‬
‫بالنيكليوتيد ‪.A‬‬
‫)‬
‫للجابة‬
‫انقر‬
‫(‬
‫‪ ‬‬
‫‪1‬ـ الخييط المستنسخ لـ ‪ adn‬المكمل للخييط الغير مستنسخ‬
‫هو‪TACGGGACACGGTAGTTCATT :‬‬
‫‪ ‬خييط ‪ ARNm‬هو ‪ AUGCCCUGUGCCAUCAAGUAA :‬‬
‫متتالية الحماض المينية المطابقة للبروتين المترجم هي ‪:‬‬
‫‪ Met- Pro- Cys-Ala-ILe-Lys‬‬
‫‪2‬ـ ستستبدل الثلثية ‪ CGG‬بـ ‪ AGG‬و من تم ستصبح الثلثية في ‪ ARNm‬كما‬
‫يلي ‪C UCC‬التي تترجم إلى حمض أميني ‪ Ser‬عوض ‪Ala‬‬
‫‪ ‬‬

ÇäÞÓÇã ÇÎÊÒÇáí.swf

meiosis[1].swf

‫‪   ‬‬

‫‪1‬ـ النقسام المنصف‬

‫‪-   ‬أ مراحل‬

‫النقسام الختزالي‪:‬‬

‫‪2    ‬ـ النقسام التعادلي‬

‫التمهيدية ‪: I‬‬
‫اقتران الصبغيات المتماثلة لتشكل أزواجا‬
‫تسمى الرباعيات ‪ ،‬اختفاء الغشاء النووي و‬
‫النويات‬

‫التمهيدية ‪II‬‬
‫قصيرة جدا تبتدئ مباشرة بعد النهائية‬
‫‪ I‬تبقى الصبغيات منشطرة طوليا ما‬
‫عدا الجزيء المركزي و يظهر المغزل‬
‫الللوني من جديد‬

‫الستوائية‪I‬‬
‫‪ :‬تتموضع الصبغيات المتماثلة من جهتي خط‬
‫الستواء ‪.‬‬

‫الستوائية ‪II‬‬
‫تتموضع الصبغيات لكل خلية في المستوى‬
‫الستوائي مشكلة الصفيحة الستوائية‪.‬‬
‫‪ ‬‬

‫النفصالية‪ I‬‬
‫نفصال الصبغيات المتماثلة و هجرتها نحو‬
‫القطب الخلوي القريب منها دون انقسام‬
‫الجزيء المركزي‬

‫لنفصالية ‪II‬‬
‫انشطار الجزيء المركزي و انفصال‬
‫صبيغيات الصبغي الواحد و هجرة كل‬
‫مجموعة نحو أحد أقطاب الخلية‪.‬‬

‫النهائية ‪I‬‬
‫يتجمع نصف عدد الصبغيات في كل‬
‫قطب و يحدث انقسام السيتوبلسم‬
‫للحصول على خليتين بنتين أحاديتي‬
‫الصيغة الصبغية ‪n‬‬

‫النهائية ‪II‬‬
‫تتجمع الصبغيات في كل قطب و يزال تلولبها و‬
‫يتشكل الغشاء النووي و ينقسم السيتوبلسم و‬
‫تعط ي كل خلية خليتين بنتين فتكون النتيجة‬
‫الحصول على ‪ 4‬خليا أحادية الصيغة الصبغية‬
‫‪n‬‬

‫التخليط الضمصبغي‬

‫التخليط البيصبغي‬

‫دورة الحياة والدورة الصبغية‬

‫دورة أحادية الصيغة الصبغية‬

‫دورة ثنائية الصيغة الصبغية‬

‫دورة أحادية ثنائية الصيغة الصبغية‬

‫تخليط ضمصبغي‬

‫الحماض المينية‬
Pro
Ser

Lys
Leu

Arg
Met

Met

Met
Met
Met

Pro
Pro
Pro

‫لبيبتيد‬

Pro

Arg
Arg
Arg

Arg

Leu
Leu

‫عديد ا‬

Leu

Lys
Lys

Lys

Ser

Ser

GCC AUG CCU CGA CUG AAG UCA UAA AAA ARNm
‫منحى القراءة‬

Sign up to vote on this title
UsefulNot useful