You are on page 1of 189

.T.. 11.

Endstriyel Kirlenme Kontrol Sempozyumu


11-13 Haziran 2008



Amoksisilinin Anaerobik Artlabilirlii
Hakan elebi ve Delya Sponza
Dokuz Eyll niversitesi, evre Mhendislii Blm, Buca, 35160, zmir.
E-posta: hakan.celebi@ deu.edu.tr

z: Kanalizasyon, tbbi atklar, ila endstrisi, gda retimi, iftlik hayvanlarnn retimi gibi
faaliyetler antibiyotiklerin kaynaklarn oluturmaktadr. -Laktam grubu antibiyotikler insan ve
veterinerlikte ok geni bir kullanm aralna sahiptir. zellikle Amoksisilin geni spektrumlu
bir etkiye sahiptir. Antibiyotiklerin anaerobik koullarda artlabilirlii ile yaplm ok az
sayda alma bulunmaktadr. Bu almada veterinerlikte ve insan tedavisinde youn bir
ekilde kullanlan -Laktam grubu antibiyotiklerden biri olan Amoksisilinin ok Kademeli
anaerobik Yatak Reaktrde (KAYR) anaerobik artlabilirlii incelenecek, seilen amoksisilin
dozunda anaerobik reaktr verim zellikleri (KOI giderimleri, toplam ve metan gaz retimleri,
spesifik metanojenik aktivite deerleri, HCO
3
alkalinitesi ile TUYA konsantrasyonlarnn
deiimleri) incelenecektir.
Anahtar Kelimeler amoksisilin; anaerobik artm; anaerobik ok kademeli yatak reaktr; KO;
TUYA/HCO
3
1. Giri
Antibiyotikler, etkilerine ve kimyasal yaplarna gre -Laktamlar, Tetrasiklinler, Makrolidler,
Aminoglikozidler, Quinolonlar, Linkosamidler, Oksazolidler, Slfa antibiyotikler olarak
snflandrlrlar (Demirden, 2005). -Laktam antibiyotikler geni spektrumlu olup, gram pozitif
ve negatif organizmalardan kaynaklanan enfeksiyonlarn tedavisinde youn bir ekilde
kullanlmaktadr (Baeere ve di., 2005; Cass ve di., 2003).

ekil 1.1. Amoksisilinin kimyasal yaps.
Antibiyotikler biyolojik paralanmaya dayankl olmalar nedeniyle deiik ortamlarda
birikirler. Yksek organik yke sahip olan antibiyotik atksularnn bu nedenle evreye
boaltlmadan nce kesinlikle artlmas gerekmektedir. la endstrisinin anaerobik koullarda
artlabilirlii ile yaplm ok az sayda alma yer almaktadr (Arkan ve di., 2006; Kim ve
di., 2007; Lallai ve di., 2002; Nandy ve di., 2001). Anaerobik ok kademeli yatak reaktrler
ile ilgili literatr aratrmalarnda pek fazla almaya rastlanmamtr. zellikle asidik
356 H. elebi, D. Sponza


petrokimya endstrisi atksularnn artm iin bu tip reaktr tercih edilmitir (Patel ve
Madamvar, 2001). AKYR de hazne-1de anaerobik artmann hidroliz ve asidleme faz dier
haznelerde ise metanlama metanojenler tarafndan gerekletirilmektedir. Bu almada
veterinerlikte ve insan tedavisinde youn bir ekilde kullanlan -Laktam grubu
antibiyotiklerden biri olan Amoksisilinin anaerobik ok kademeli yatak reaktrde anaerobik
artlabilirlii incelenecektir. Bu almada bir aklimasyon sresi (start-up) olmadan 150 mg/L
amoksisilin antibiyotiinin anaerobik reaktr verim zelliklerine ( KOI giderimleri, toplam ve
metan gaz retimleri, spesifik metanojenik aktivite deerleri, HCO
3
alkalinitesi ile TUYA
konsantrasyonlarnn deiimleri) incelenecektir.
2. Materyal ve Metot
2.1. Anaerobik ok Kademeli Yatak Reaktr ve Deney Dzenei
150 mg/L Amoksisilin, 3400 mg/L KOyi veren melas, Vanderbilt mineral ortam, NaHCO
3
ve
0,5 mg/L Sodyum tiyoglukolat ieren sentetik atksu ile reaktr 10 gn boyunca iletilmitir.
150 mg/L Amoksilinin KO edeeri 100 mg/L olduundan giri atksuyunun toplam KO
konsantrasyonu 3500 mg/L civarnda olmutur.
Tablo 2.1. Anaerobik ok kademeli yatak reaktr iin iletme koullar.
letme Parametreleri Birim AKYR
Hidrolik Alkonma Sresi (HRT)
Debi
Organik Ykleme Hz (OLR)
Amoksisilin Konsantrasyonu
F/M Oran
Scaklk
Giri KO
Gn
L/gn
g.KO/L.gn
mg/L
g.KO/g.UAKM.gn
0
C
mg/L
1,15
4,00
2,70
150
0,046
37 1
3500
Sistemde asidojen ve metanojenlerin dengeli bymesi ve faz ayrm iin iki farkl trde destek
materyali farkl haznelerde kullanlmtr. Hazne-1 ierisinde asidojen-lerin bymesini
hzlandrmak iin 300 g pomza ta, hazne-2de 315 g olacak ekilde pomza ta+kmrlemi
kemik ve hazne-3te ise 330 g kmrlemi kemik sisteme yerletirilmitir. AKYR reaktor
beslemek iin reaktrn %20sini dolduracak kadar, zmir Pakmaya iletme-sinden asidojenik
ve metanojenik nitelikte ksmi granllemi anaerobik amur alnmtr. almada kullanlan
reaktr sistemin ekli 2.1.de verilmitir. Reaktrn tm hacmi 4,5 L olup haznelerin hacimleri
1,5 Ldir. Sentetik atksu 150 mg/L Amoksisilin, 3500 mg/L KOyi veren melas, Vanderbilt
mineral ortam, 5000 mg/L NaHCO
3
ve 0,5 mg/L Sodyum tiyoglukat iermektedir.
2.2. Analitik yntemler
2.2.1. Gaz lmleri
Gaz retimleri svlarn yer deitirmesi yntemi ile llmtr. Toplam gaz 2% (v/v) H2SO4
ve 10% (w/v) NaCl ieren svdan geirilerek llmtr. Metan gaz; oluan gazn % 3lk
NaOH ieren svdan geirilmesi ile bulunmutur (Beydilli ve di., 1998; Razo-Flores ve di.,
1997). Metan gaz yzdesi ise; Drger PacEx methane gaz analiz cihaz ile llmtr.
Amoksisilinin Anaerobik Artlabilirlii 357



ekil 2.1. Anaerobik ok kademeli yatak reaktr
2.2.2. Anaerobik toksisite ve spesifik metanojenik aktivite (SMA) deneyleri
3,5 ml anaerobik amur ieren 0,35 ml Vanderbilt mineral ortaml serum ielerine karbon
kayna olarak 3500 mg/L KOyi verecek melas, pH iin NaHCO
3
, ideal ortam koullar iin
Sodyumtiyoglukat konulmu ve 10-350 mg/Llik Amoksisilin dozlar ilave edilmitir. 37,5
0
C 1
gn sreli inkbasyon sonucu oluan metan gaznn antibiyotik iermeyen numunelerde oluan
metan gazna kyaslanmas sonucu % aktivite; (Owen ve di., 1979; Donlon ve di. 1995) e
gre hesaplanm ve izilen grafikten de IC
50
(% 50'sini inhibe eden antibiyotik konsantrasyonu)
deeri bulunmutur. SMA testi anaerobik koullarda ATA testinde olduu gibi 35
0
Cde
yaplmtr. 1 g KOnin giderimine 35
0
Cde 3,96 ml CH
4
retimi edeerdir (Speece, 1996).
2.2.3. KO, BO
5
, UAKM, TUYA, HCO
3
alkalinitesi, pH ve scaklk lmleri
WTW Oxi Top IS 12 sistem kullanlarak BO
5
llmtr. KO ise kapal reflux kolorimetrik
yntemi ile hesaplanmtr (APHA-AWWA, 1992). APHA-AWWA, (1992)ye gre UAKM
miktar hesaplanmtr. Anderson ve Yang, (1992) tarafndan titrimetrik metot kullanlarak
UYA ve HCO
3
alkalinitesi llmtr. lk olarak numunenin pH deeri belirlenip 5,1 ve 3,5
pH seviyelerine ulancaya kadar titrasyon yaplr ve sonular bilgisayar program ile
hesaplanr.WWT pH 330 tipi pH metre ile sistemdeki pH ve scaklk deerleri llmtr.
2.2.4. Amoksisilin lm
HPLC kullanlarak Amoksisilinin analizleri; C
18
ters kolon, (150 mm x 4,5 mm, 5m,) Mobil
Faz (75:25/25:75) (v/v) metanol/su+ fosfat, Ak Hz 1 ml/min, enjeksiyon hacmi 12-l ve 287
nmde UV dedektr kullanlmtr (Hsu ve Hsu, 1992).
3. Sonular ve Deerlendirme
Metan gaz; oluan gazn % 3lk NaOH ieren svdan geirilmesi ile bulunmutur (Beydilli ve
di., 1998; Razo-Flores ve di., 1997). Metan gaz yzdesi ise; Drger PacEx methane gaz
analiz cihaz ile llmtr.
ekil 3.1.de anaerobik amur iin Amoksisilinin artan deriimleri ile % aktivite azalma
deerleri arasnda izilen grafik verilmektedir. ekil 3.1.den Amoksisilin iin IC
50
deerinin
358 H. elebi, D. Sponza


195 mg/L olduu grlmektedir. IC
50
deerinin yksek olmas anaerobik amurun antibiyotiin
toksisitesine daha direnli olduunu gstermektedir. Gartiser ve di. (2007) tarafndan yaplan
inhibisyon testleri sonucunda Amoksisilin ile ilgili etkileyici konsantrasyon deerlerinin
EC
10
=12,3 mg/L, EC
20
=95,9 mg/L ve EC
50
=2721 mg/L olarak deitii saptanmtr.
S.leopoliensis (siyanobakter) ve S.capricornutum (yeil alg) kltrlerinin bymesini
engelleyici bir almada Lindberg ve di. (2007), 96 saatte EC
50
deerlerinin Amoksisilin iin
0,78 g/L ve Eritromisin iin 10,3 g/L olduunu bulmulardr. Lalumera ve di. (2004),
talyada su kltrlerinde antibiyotiklerin etkileri zerine yaptklar almada Amoksisilin,
Okisitetrasiklin, Flumeguin ve Tiyamfenicol gibi nemli antibiyotik grubunun EC
50
deerlerini
121139 mg/L olarak bulmulardr. Bu almada kullanlan ksmi granllemi amur iin
amoksisilinin IC
50
deeri yukarda verilen almalarda saptanan deerlerden ok daha yksek
olduunu gstermitir. Bu durum bu almada a olarak kullanlan ksmi granllemi
amurun amoksisiline direnli olduunu gstermektedir. SMA testi, anaerobik amurun
metanojenik aktivitesinin bir gstergesidir. ekil 3.2.de SMA deeri Amoksisilin iin 0,12-1,05
gCH
4
-KO/g-UAKM.gn aralnda olup antibiyotik konsantrasyonu arttka azalmaktadr.
Anaerobik amurun metan kapasitesini lmek iin kullanlan SMA testi, reaktrn iletme
dnemlerinde sistemde tutulmas gereken UAKMnin belirlenmesini ve sisteme
uygulanabilecek optimum organik yklemenin ve artlacak antibiyotik dozlarnn
hesaplanmasn salayarak, sistemlerin iletmeye alma srecini ksaltmaktadr. Yaplan SMA
analizleri daha sonraki almalarda anaerobik reaktrlerde artlmas iin kullanlacak
antibiyotik konsantrasyonunu da tayin etmeye yarar. Literatrde yaplan almalarda dorudan
amoksisilin antibiyotiinin anaerobik artlmas ile ilgili almalardan SMA deerini ieren bir
almaya rastlanmamtr. Bu nedenle baz antibiyotikleri ieren atksulardaki SMA deerleri
derlenmitir. ktem ve di. (2007) ila sanayi atksularnn artm iin alternatif hibrid UASB
reaktr kullanmlar ve antibiyotik ieren ila sanayi atksularnn SMA deerini 0,5 gCH
4
-
KO/g.UAKM.gn olarak saptamlardr. Ayrca 8 kg COD/m
3
gnlk organik yklemede KO
giderim verimini %72 olarak bulmulardr.UASB reaktrde antibiyotik artm ile ilgili bir
almada Wollenberger ve di. (2000) oksitetrasiklin iin SMA deerini 0,425 gCH
4
-
KO/g.UAKM.gn olarak bulmulardr.
3.2. Artlabilirlik almalar
AYRnin anaerobik koullarda beslemesi ve bakteri populasyonun dengelenmesi iin
adaptasyon sreci ok nemli olmaktadr. Bu nedenle sistemin kararl hal koullarna gelmesi
iin belli bir srete iletilmesi gerekmektedir (anaerobik kararl hal koullar yaklak 15
gnlk bir periyotta k suyu KO giderimi ile oluan gazn metan yzdesinde %10luk bir
deiiklik olmal).Ancak bu almada byle yaplmam olup aklimasyon safhas olmadan
amoksisilin antibiyotii ile beraber reaktr beslenerek anaerobik AYR reaktrn verim
zellikleri incelenmitir. ATA testinde elde edilen IC
50
deeri (195 mg/l) dikkate alnanark bu
deerin altnda amoksisilin konsantrasyonu (150 mg/l) seilmitir.
3.2.1. AYR reaktrde KO giderimleri ve metan retimi
ekil 3.3. ile ekil 3.4.te AYRnin ilk iletim aamasnda KO giderimi ve KO
konsantrasyonundaki deiimler ile metan gaz deiim miktarlar srasyla yer almaktadr.
letmeye alndktan sonra anaerobik ok kademeli yatak reaktrde 7. ve 8. gnler iin KO
giderim verimleri ve metan gaz retim deerleri %70 ile %50 olarak bulunmutur. Literatrde
Amoksisilinin Anaerobik Artlabilirlii 359



ekil 3.1. ATA testi ( IC50 = 195 mg/L) ekil. 3.2. Amoksisilinin SMA deiimleri.
amoksisilinin anaerobik artlabilirlii ile ilgili almalara pek rastlanmamtr. Chelliapan ve
di., (2006); makrolid grubu antibiyotikleri ieren ila sanayi atksularnn anaerobik artlarda
organik yklemenin 0.43 kg/m
3
.gnden 3.73 kg/m
3
.gne karlmasnda KO giderim
veriminin %70e dtn, %85 KO giderim verimi iin 4 gnlk alkonma sresinde ideal
organik yklemenin 1.86 kg/m
3
.gn olduu ve oluan gazn %85inin metan olduu
belirtmilerdir. Mohan ve di. (2001) tarafndan yaplan bir almada antibiyotik ieren ila
endstrisi atk sularnn anaerobik koullarda organik yklemenin 0,25 kg/m
3
.gn den 2,5
kg/m
3
.gne karlmasnn KOI giderim verimini %60a drdn, %80 KOI giderme
verimi iin uygun organik yklemenin 1,25 kgKO/m
3
.gn olduu, oluan gazn %80inin
metan olduu saptanmtr. ktem ve di. (2006) tam karml anaerobik asidojenik reaktrde
optimum iletme koullarnda antibiyok ieren atksularn alkonma sresi, pH, organik
ykleme deerleri kriter alnarak bir alma yapmlardr. alma sonucunda pH 5-6,3,
organik ykleme 13 kg KO/m
3
gn ve KO giderimi maksimum %44 bulunmutur. Ayrca
reaktrde baskn uucu asitlerin asetik, probiynik ve n-btrik asidler olduunu belirlemilerdir.
Buitron ve di., (2002) ardk kesikli biyofiltrede anaerobik/aerobik koullarda 8-24 saatlik
antibiyotik ieren atksularn artm ile ilgili almalarnda %95-97 KO giderimi elde
etmilerdir. Sridhar ve di. (2001) kesikli tip anaerobik reaktrde ila sanayi atksulartnn
artmn yapmlardr. alma sonucunda 1,9 kg KO/m
3
gn organik yklemede %83 ve 5,8 kg
/m
3
organik yklemede ise %45 KO giderimleri bulunmutur. Sponza ve di., (2006) yaptklar
almada anaerobik srekli UASB/CSTR sistemde slfamerazinin artmn gerekletirmiler-
dir. Farkl slfamerazin konsantrasyonlarnda srasyla %76, %97 KO giderimi llmtr.
Farkl iletme koullarnda antibiyotik ieren atksular yukar akl anaerobik filtrede
artlmtr. ktem ve di., (2007) ila sanayi atksularnn artm iin alternatif hibrid UASB
reaktr kullanmlar ve antibiyotik ieren ila sanayi atksularnn 3 kg COD/m
3
gn organik
ykleme ve 2 gnlk alkonma sresinde KO giderim verimleri %96, %91, %85 olarak
bulunmutur. Amoksisilin deriimi 150 mg/L ve melas edeeri KO konsantrasyonu 3500
mg/L olduunda anaerobik amurda gaz retimleri ve metan gaz yzdesi ekil 3.5.te
verilmitir. Kmlatif gnlk toplam ve metan gazlar ile metan yzdesi ilk gn srasyla 31680
ml/gn, 4800 ml/gn ve %18 olarak kaydedilmitir. Maksimum toplam gaz, metan gaz
retimleri ve metan yzdesi 108000 ml/gn, 10145 ml/gn ve %50 olarak belirlenmitir.
Amoksisilin deriimi 150 mg/L ve melas edeeri KO konsantrasyonu 3500 mg/L olduunda
anaerobik amurda gaz retimleri ve metan gaz yzdesi ekil 3.5.te verilmitir. Kmlatif
gnlk toplam ve metan gazlar ile metan yzdesi ilk gn srasyla 31680 ml/gn, 4800 ml/gn
ve %18 olarak kaydedilmitir. Maksimum toplam gaz, metan gaz retimleri ve metan yzdesi
108000 ml/gn, 10145 ml/gn ve %50 olarak belirlenmitir.
y = -0,2097x + 95,457
R
2
= 0,9914
0
20
40
60
80
100
120
0 100 200 300 400
Amoksisilin Konsantrasyonu
(mg/L)
%

M
e
t
a
n

r
e
t
i
m
i
0
0,2
0,4
0,6
0,8
1
1,2
0 35 70 105 140 175 210 245 280 315 350 385
Amoksisilin Konsantrasyonu mg/L
S
M
A


g
C
H
4
-
K
O

/
g
U
A
K
M
-
g

n
360 H. elebi, D. Sponza


3.2.2. AKYRde TUYA deiimleri
Anaerobik ok kademeli yatak reaktrde 150 mg/l olarak amoksisilinin konsantrasyonu KO de
dikkate alnarak 8 gnlk bir iletme sreci iin KO giderimleri ve TUYA retimleri
sistemdeki her blmede gzlenmitir (ekil 3.6.). TUYA konsantrasyonlarnn 5., 7., ve 8.
gnlerde 1. haznede 300-500 mg/L cvarnda llmtr. nk 1. hazne anaerobik artmada
asitleme kademesi olarak kullanlyor.

ekil 3.3. AYRde KO deiimleri ekil 3.4. AYRde metan gaz
deiimleri
AYR reaktrn 3.haznesinde ve kta UYA konsantrasyonlarnn salnm gsterdii
gzlenmitir. Ancak KOnin % 70e yaklaan bir verimle ve oluan gazn metan yzdesinin
yksek olduu 6. ve 8. gnlerde k rneklerindeki TUYA konsantrasyonlarnn dt
gzlenmitir ekil 3.7de AYRde uygun iletme zamannda pH deiim miktarlar verilmitir.
3.2.3. AKYRde pH, HCO3 alkalinitesi , TUYA/HCO3 oranlarndaki deiimler
Metanojenlerin verimli artm iin optimum pH aral yaklak olarak 6,5-7,6 olmaktadr

ekil 3.5. AYRde toplam metan ekil 3.6. AYRde TUYA deiimleri
retimleri ve metan yzdesi deiimleri
Genellikle 1. haznede pHn daha dk olduunu (6,98), k numunelerinde ise pHn daha
yksek (7,55) olduu gzlenmitir. Anaerobik sistemlerde dier zayf asitlerle, CO
2
art yeterli
HCO
3
alkalinitesine bal olmaktadr. Asit konsantrasyonlarnda (HCO
3
ve TUYA) alkalinitenin
0
500
1000
1500
2000
2500
3000
3500
4000
1 2 3 4 5 6 7 8
Gnler
K
O


K
o
n
s
a
n
t
r
a
s
y
o
n
l
a
r


(
m
g
/
L
)
0
10
20
30
40
50
60
70
80
K
O


G
i
d
e
r
i
m
i

(
%
)
k ( mg/L) Giri (mg/L) KO Giderimi (%)
0
3000
6000
9000
1 2 3 4 5 6 7
Gnler
M
e
t
a
n

r
e
t
i
m
i

(

m
l
/
g

n
)
0
10
20
30
40
50
M
e
t
a
n

Y

z
d
e
s
i

(
%
)
Metan retimi (ml/gn) Metan Yzdesi (%)
0
20000
40000
60000
80000
100000
120000
1 2 3 4 5 6 7 8 9 10
Gnler
T
o
p
l
a
m

v
e

M
e
t
a
n

G
a
z

r
e
t
i
m
i

(
m
l
/
g

n
)
0
10
20
30
40
50
60
M
e
t
a
n

Y

z
d
e
s
i

(
%
)
Toplam Gaz retimi (ml/gn)
Metan Gaz retimi (ml/gn)
Metan Yzdesi (%)
0
100
200
300
400
500
600
1 2 3 4 5 6 7 8
Gnler
T
U
Y
A

(
m
g
/
L
)
Hazne-1 Hazne-2 Hazne-3 k
Amoksisilinin Anaerobik Artlabilirlii 361


artmas reaktrde bozunmalara, baz mikrobiyal aktivitelerin zellikle metanojenlerin inhibe
olmasna yol amaktadr (Speece, 1996). Anaerobik ok kademeli yatak reaktrn knda
HCO
3
alkalinitesi konsantrasyonlar 569874 mg/L arasnda hesaplanmtr (ekil 3.8.).
Bikarbonat alkanitesi konsantrasyonu ilk haznede dier haznelere gre yksek derecededir.
TUYA/HCO
3
Alkalinitesi oran 0,8den dk ise reaktr bir dereceye kadar kararl ya da
kararsz durumdadr (Behling ve di., 1997). ekil 3.9da TUYA/HCO
3
oran 1. ve 2.
haznelerde 0,3-0,5 arasnda llmtr. 3. haznede ve kta llen 0,15 ve 0,38 deerleri
nda AYRde sistem kararl denilebilir nk; TUYA/HCO
3
Alkalinitesi oranlar k ve
dier blmelerde 0,4den dktr.

ekil 3.7. AYRde pH Deiimleri ekil 3.8. AYRde HCO
3
Alkalinitesi
3.2.4. Anaerobik ok kademeli yatak reaktrde amoksisilin giderimleri
lk 7-8 gnlk iletme srecinden sonra sisteme yaplan antibiyotik dozlamas 150 mg/L
Amoksisilin konsantrasyonu olacak ekilde yaplmtr.

ekil 3.9. AKYRde TUYA/HCO
3
ekil 3.10. AYRde amoksisilin giderimi
deiim miktarlar
Amoksisilin gnlk anaerobik iletme sonunda 150 mg/Lden 70 mg/Lye derek % 65
orannda giderilmitir (ekil 3.10). Kim ve Burgess (2002) yaptklar almada fosfat ve
sodyum azid ieren bir ortamda anaerobik koullarda amoksisilin antibiyotiinin 2 gn iinde
140 mg/Lden 43 mg/Lye derek %52 orannda azaldn gzlemilerdir. Bu alma farkl
besiyeri bileimleri kullanlmasna ramen mevcut almamz ile ayn oranda amoksisilin
giderimi vermektedir.150 mg/L amoksisilin ieren atk suyun balang ve 20 gnlk anaerobik
artma sonras ayrabilirlikleri incelenmitir. Buna gre Amoksisilin ieren anaerobik reaktrn
6,60
6,80
7,00
7,20
7,40
7,60
1 2 3 4 5 6 7 8
Gnler
p
H
Hazne-1 Hazne-2 Hazne-3 k
0
200
400
600
800
1000
1200
1400
1 2 3 4 5 6 7 8
Gnler
B
i
k
a
r
b
o
n
a
t

A
l
k
a
l
i
n
i
t
e
s
i

(
m
g
/
L
)
Hazne-1 Hazne-2 Hazne-3 k
0,00
0,20
0,40
0,60
0,80
1 2 3 4 5 6 7 8
Gnl er
T
U
Y
A
/
H
C
O
3

A
l
k
a
n
i
t
e
s
i

O
r
a
n

Hazne-1 Hazne-2 Hazne-3 k


0
20
40
60
80
100
120
140
160
180
1 3 5 7 9 11 13 15 17 19
Gnler
A
m
o
k
s
i
s
i
l
i
n

k
o
n
s
a
n
t
r
a
s
y
o
n
u

(
m
g
/
L
)
amoksisilin (mg/L)
362 H. elebi, D. Sponza


balang BO
5
/KO oran 0,05 olup (zor ayrabilir) 20 gn sonunda 0,25e (kolay
ayrabilir)(veriler verilmemitir) ulamtr. Uzun iletme srelerinde srekli anaerobik
reaktrlerde biyolojik ayrabilirlik daha da arttrlacaktr.
4. Tartma
Beta laktam gurubu bir antibiyotik olan amoksisilinin BO
5
/KO oranlar dk olduundan, 20
gnlk aklimasyonsuz olarak AYR reaktrde artlarak biyolojik ayrabilirlii arttrlmtr.
Amoksisilin ieren anaerobik reaktrde BO
5
/KO oran 0.05den 0.25e karlmtr. Bu
almada amoksisilinin IC
50
deeri 195 mg/l olmasna ramen AYR reaktre kararl hal
koullarna ulamadan dorudan ilave edilen 150 mg/l amoksisilin 20 gnlk iletme sonunda
%65 artma verimi ile giderilmitir. Melas KOsi ve 150 mg/l amoksisilin ieren atk suyun 9
gn sonunda KO giderimi 70%, toplam gazn metan yzdesi 50% olmutur. Ksa srede elde
edilen yksek KO, antibiyotik giderimleri ile yksek metan ieriine sahip toplam gaz oluumu
AYR n kademeli 3 ayr hazneden olumas ve ksmi granllemi amurun a olarak
kullanlmas ile aklanabilir. AYR de 1. haznenin asidojenik olarak almas KOnin
kolaylkla hidrolizine ve asitlemesine neden olmaktadr. Kolay ayran KO ile birlikte
amoksisilin de besin kayna olarak alnmakta ve son haznede metanlama olmaktadr.
Bylelikle anaerobik artmann farkl kademelerde olmas ile asit ve metan bakterilerinin
aktivitelerinde olumsuz etkilerin olmad sonucuna varlabilir. Amoksisilin dozlar 10
mg/Lden 350 mg/Lye doru kademeli artmasna ramen SMA deerlerinin Amoksisilin iin
1,05 gCH
4
-KO/g-UAKM.gn deerinden 0,12 gCH
4
-KO/g-UAKM.gn deerine dt
gzlenmitir. Yani doz kademeli olarak 20, 30 kez artmasna ramen SMA deeri 1/3 orannda
azalmtr. Bu durum da ayrca Amoksisilinin kesikli beslemeli dzende anaerobik
artlabilirliini gstermektedir. AYRde UYA/HCO
3
Alkalinitesi oranlarnn k ve dier
blmelerde 0,4den dk olmas sistemin kararl olduunu gstermektedir.
Teekkr
106 Y 306 numaral proje ile bu aratrmay ksmen destekleyen TBTAKa teekkr ederiz.
Kaynaklar
Anderson, G.K., Yang, G. (1992). Determination of bicarbonate and total volatile acid concentration in anaerobic
digesters using a simple titration. Water Environment Research, 64, 53-59.
APHA-AWWA, (1992). Standard Methods for the Examination of Water and Wastewater, 17th edition. American
Public Health Association/American Water Works Association/Water Environment Federation, Washington DC,
USA.
Arkan, O.A., J.Sikora, L., Mulbry, W., Khan, S.U., Rice, C., & Foster G.D. (2006). The fate and effect of
oxytetracycline during the anaerobic digestion of manure from therapeutically treated calves. Process
Biochemistry, 41, 1637-1643.
Beydilli, M.I., Pavlosathis, S.G., & Tincher, W.C. (1998). Decolorization and toxicity screening of selected reactive
azo dyes under methanogenic conditions. Water Science and Technology, 38 (4-5), 225-232.
Buitron G, Melgoza R:M, Jimenez L (2002). Pharmaceuticals wastewater treatment using an anaerobic/aerobic
sequencing batch biofilter, 5th specialized conference on small water and wastewater treatment systems, stanbul
Turkey, 24-26 September 2002 stanbul
Cass, Q.B., Gomes, R.F., Calafatti, S.A., & Pedrazolli Jr. J. (2003). Determination of amoxycillin in human plasma
by direct injection and coupled-column high-performance liquid chromatography. J Chromatography A, 987,
235-241.
Amoksisilinin Anaerobik Artlabilirlii 363


Chelliapan, S., Wilby, T., Sallis, P.J. (2006). Performance of an up-flow anaerobic stage reactor (UASR) in the
treatment of pharmaceutical watewater containing macrolide antibiotics. Water Research, 40, 507516.
Donlon, B.A., Razo-Flores, E., Field, J.A., & Lettinga G. (1995). Toxicity of N-substrated aromatics to acetolastic
methanogenic activity in granular sludge. Applied and Environmental Microbiology, 61, 3889-3893.
Gartiser, S., Urich, E., Alexy, R., Kmmerer, K. (2007). Anaerobic inhibition and biodegradation of antibiotics in
ISO test schemes, Chemosphere 66, 18391848.
Kim, Y., Choi, K., Jung, J., Park, S. Kim, P.G., Park, J. (2007). Aquatic toxicity of acetaminophen, carbamazepine,
cimetidine, diltiazem and six major sulfonamides, and their potential ecological risks in Korea, Environment
International, 33, 370375.
Kim, H., Burgess, D.J. (2002). Effect of drug stability on the analysis of release data from controlled release
microspheres. Journal Microencapsulation, 19, 631-640.
Lallai, A., Mura, G., Onnis, N. (2002). The effects of certain antibiotics on biogas production in the anaerobic
digestion of pig waste slurry. Bioresource Technology, 82, 205-208.
Lindberg, R.H., Bjorkloundb, K., Johanssond, P.R., Tysklinda, M., Anderssona, M.B.A.V. (2007). Environmental
risk assessment of antibiotics in the Swedish environment with emphasis on sewage treatment plants. Water
Research, 41, 613 619.
Mohan S.V Prakasham R.S Satyavathi B, Annapurna S.V Ramakrishna S. (2001) Biotreatability studies of
pharmaceuticals wastewater using an anaerobic suspended film contact reactor. Wat Sci.Tech., 43(2), 271-276.
Nandy, T., Kaul, S. N. (2001). Anaerobic pre-treatment of herbal-based pharmaceutical wastewater using fixed-film
reactor with recourse to energy recovery. Water Research, 35, 351-362.
Owen, W.F., Stuckey, D.C., Healy, J.B., Young, JR. L.Y., & McCarty, P. L. (1979). Bioassay for monitoring
biochemical methane potential and anaerobic toxicity, Water Research, 13, 485-492.
ktem, Y.A., nce, O., Sallis, P., Donnelly, T., nce B.K. (2007). Anaerobic treatment of a chemical synthesis-based
pharmaceutical wastewater in a hybrid upflow anaerobic sludge blanket reactor. Bioresource Technology, 99,
1089-1096.
Razo-Flores, E., Luijten, M., Donlon, B.A., Lettinga, G., & Field, J.A. (1997). Complete biodegradation azo dye
Azodisalicylate under anaerobic conditions. Environmental Science and Technology, 31(7), 2098-2103.
Speece, R.E., (1996). Anaerobic biotechnology for industrial wastewaters. Archae Pres, USA, 114-115.
Wollenberger, L., Halling-Sorensen, B., Kus, K.O. (2000). Acute and chronic toxicity of veterinary antibiotics to
Daphnia Manga. Chemosphere, 40, 723730.
Srithar, S., Khan, S.T., Akella, V.R., & Anjaneyulu, Y. (2001). Batch studies to evaluate the treatabiliy of
pharmaceutical wastes by anaerobic digestion.
ktem, Y.A., nce, O., Sallis, P., Donnelly, T., nce B.K. (2006). Determination of optimum operating conditions of
an acidification reactor treating a chemical synthesis-based pharmaceutical wastewater. Process Biochemistry, 41,
2258-2263.
Behling, E., Diaz, A., Colina, G., Herrera, M., Gutierrez, E., Chacin, E., (1997). Domestic wastewater treatment using
a UASB reactor. Biores. Technol., 61, 239-245.
Patel, H., & Madamvar, D. (2001). Single and multichamber fixed film anaerobic reactors for biomethanation of
acidic petrochemical watewater-systems performance. Process Biochemistry, 36, 613-619.
Lalumera, G.M., Calamari, D., Galli, P., Castigloni, S., Crosa, G., Fanelli, R., (2004). Preliminary investigation on
the environmental occurrence and effects of antibiotics used in aquaculture in Italy. Chemosphere, 54, 661-668.
Sponza, D.T., Demirden, P. (2006). Treatability of sulfamerazine in sequential upflow anaerobic sludge blanket
reactor (UASB)/completely stirred tank reactor (CSTR) processes. Separation and Purification Technology 56 ,
108117.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Tekstil Endstrisi Atksuyunun Ardk Kesikli Biyoreaktr le
Optimum artlarda Artlmas in Yaplan Laboratuar Ve
Gerek lekli Tesis almalarnn Karlatrlmas
Yasemin Damar, Recep leri
Sakarya niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 54187 Esentepe
Kamps, Adapazar.
E-posta: yasemindamar@hotmail.com

z Bu almada, tekstil endstrisi atksuyunun ardk kesikli biyoreaktr ile optimum artlarda
artlmas iin yaplan tam lekli ve laboratuar lekli tesis almalarnn karlatrlmas
yaplmtr. Bu amala Ardk Kesikli Biyoreaktrlerin (AKR) optimum iletme artlar
incelenerek, her iki tesisin performanslar karlatrlmtr. Tam lekli tesis, boyutlar belli bir
oranda kltlerek ortak alma koullarnda laboratuar lekli tesis kurulmu ve her iki tesis
iinde benzer artma almalar yaplmtr. Hem laboratuar lekli, hem de tam lekli tekstil
atksu artma tesisi iin yaplan almalar sonucunda; 0,5 saat doldurma, 1,5 saat havalandrma
(reaksiyon), 1,5 saat kelme ve 0,5 saat boaltma-devreye alma srelerinde en uygun artma
(optimum) verimi elde edilmitir. allan laboratuar lekli tekstil endstrisine ait Ardk
Kesikli Biyoreaktrn KO cinsinden ortalama artma verimi %63 iken (alma koullarna
bal olarak; minimum=%37, maksimum=%94), allan tam lekli tesise ait KO cinsinden
ortalama artma verimi ise %85 olduu tespit edilmitir.
Anahtar Kelimeler ardk kesikli biyoreaktr; atksu; laboratuar lekli tesis; optimum artla;
tam lekli tesis; tekstil endstrisi
1. Giri
Ardk Kesikli Biyoreaktr (SBR, AKR), gerek endstriyel ve gerekse evsel atksularn
artlmasnda kullanlan ve son zamanlarda yaygnlaan, havalandrma (reaksiyon) ve kelme
ileminin tek tank iersinde yapld biyolojik artma sistemidir. Ardk Kesikli Biyoreaktr
sistemi; be farkl admda tanmlanabilmektedirler. Bunlar srasyla doldurma/reaksiyon,
reaksiyon, kelme, boaltma ve tekrar sisteme almadr. Her bir periyodun sresi, deneyimli
operatrler tarafndan ayrntl pilot tesis almalar ve tecrbeleri temelinde belirlenmektedir.
kelme ve boaltma periyotlarnn srelerinin sabitlenmesine karlk yeterli olarak kontrol
edilen reaksiyon sresi verimi gelitirilebilir. Farkl atksularn kendilerine ait karakteristikleri
yznden uygun iletme parametrelerini semek nemli ve gereklidir (Tsang, 2007; leri ve
Damar, 2008). Ardk kesikli Biyoreaktr (SBR), organik ve besi maddelerinin uzaklatrlmas
iin uygundur. Ardk Kesikli Biyoreaktr (SBR) son yllarda endstriyel atksularn artlmas
iin de gelitirilmitir (Droste, 1997). Endstriyel atksularn artlmas iin kullanlabilen
Ardk Kesikli Biyoreaktr uygulamalar her geen gn artmakta olup, Almanyadaki atksu
artma teknolojileri arasndaki ardk kesikli reaktr uygulanmas oran % 1.3 civarndadr
(Teichgraber, 2001). Ardk Kesikli Biyoreaktr (AKR, SBR), bir aktif amur biyolojik artma
prosesidir. Ardk kesikli Biyoreaktr sistemleri, srekli (plug flow) ve tam karml (complete
mixed) sistem zellikleri gsteren melez (hybrid) sistemlerdir. Fakat bunlardan farkl zellikler
366 Y. Damar, R. leri


gsterdikleri de literatrde ifade edilmektedir. Ardk kesikli reaktr sistemi, klasik aktif amur
reaktrnden farkl olup, havalandrma ve kelme fonksiyonlarnn tek tankta gerekletii bir
sistemdir (Tchobanoglous, 1991; Droste, 1997; Novak et al, 1997; Kula, 1997; EPA, 2000; Lee
ve Lin, 2000; Lin, 2001). Tekstil endstrisi atksular ardk kesikli biyoreaktr ile biyolojik
olarak artlabilir, fakat atksuyun pH ve scakl dikkatli bir ekilde gzlenmelidir. Ardk
kesikli biyoreaktrlerin tekstil endstrisi atksularnn artmndaki verimi ve artmdaki etkisi
giri besin konsantrasyonunun, giri amur konsantrasyonunun, reaksiyon sresinin ve kelme
sresinin kontrol ile salanr (Jamrah ve Abu-Ghunmi, 2001).
Bu almada, tekstil endstrisi atksuyunun Ardk Kesikli Biyoreaktr ile optimum artlarda
artlmas iin yaplan tam lekli ve laboratuar lekli tesis almalarnn karlatrlmas
yaplmtr.
2. Materyal ve Metot
2.1.Gerek lekli Tesis
allan tekstil endstrisi atksu artma tesisi Sakarya li, Akyaz ilesinde yer almaktadr.
Tekstil endstrisine ait biyolojik atksu artma tesisinin akm emas ekil 1de gsterilmitir.
Tekstil endstrisi atksu artma tesisi giri konsantrasyonlar; KO=3505000 mg/l (aritmetik
ortalama=1417 mg/l), AKM=1050 mg/l, pH=4-12, scaklk 40
0
Cdir. Artma tesisinin optimum
artlarda iletilmesi; 0.5 saat doldurma, 1.5 saat havalandrma (reaksiyon), 1.5 saat kelme ve
0.5 saat boaltma-devreye alma sresi eklindedir. Dolaysyla bir devir (seans) iin toplam 4
saat gerekmektedir. Gnde 6 seans yaplmaktadr. Artma tesisine, endstriyel (900-1900
m
3
/gn) ve evsel (40-100 m
3
/gn) atksular gelmektedir. Fabrikada, adet ardk kesikli
biyoreaktr mevcut olup, ihtiyaca (siparilere) gre altrlmaktadr. Bir adet ardk kesikli
biyoreaktrde, her seansta 160 m
3
olmak zere, toplam gnde 960 m
3
atksu artlmaktadr [leri,
2005] Gerek lekli Ardk Kesikli Biyoreaktr (AKR)den aritmetik ortalama k
konsantrasyonlar 2005, 2006 ve 2007 yllarna ait ( yllk, n=52) atksu artma tesisi k
Kimyasal Oksijen htiyac (KO) ve pH deerleri tespit edilmitir.


















Tekstil Endstrisi Atksuyunun Ardk Kesikli Biyoreaktr le Optimum artlarda Artlmas in
Yaplan Laboratuar Ve Gerek lekli Tesis almalarnn Karlatrlmas
367


Tekstil endstrisinin 2005, 2006, 2007 yllarna ait KO deerleri ekil 2de gsterilmitir. Su
Kirlilii Kontrol Ynetmelii (SKKY)nde Tablo 10.7de KO parametresi iin dearj
standardn aan iki deer grlmektedir. Tekstil endstrisinin 2005, 2006, 2007 yllarna ait pH
deerleri ekil 3de gsterilmitir. Su Kirlilii Kontrol Ynetmelii (SKKY)nde Tablo
10.7de pH parametresi iin standartlar salad grlmektedir.













2.2. Laboratuar lekli Tesis
Tekstil endstrisi atksularna ait artma tesisi 1/100 000 orannda kltlerek laboratuar
lekli tesis oluturulmutur. Laboratuar lekli tesisin akm emas ekil 4de gsterilmitir.











ekil 4. Laboratuar lekli Tesisin Akm emas




ARDIIK KESKL
BYOREAKTR
GR
IKI
1 7
2
5 4 3
6
1 1- -DENGELEME TANKI VE DENGELEME TANKI VE
NUMUNE ALMA YER NUMUNE ALMA YER
2 2- -PER PER STALT STALT K POMPA K POMPA
3 3- - pHMETRE pHMETRE
4 4- -SICAKLIK SICAKLIK L L ER ER
5 5- -OKS OKS JEN JEN L L ER ER
6 6- -KARI KARI TIRICI TIRICI
7 7- -NUMUNE ALMA YER NUMUNE ALMA YER
KO
SICAKLIK
AKM
pH
LETKENLK
BULANIKLIK
ZNM OKSJEN
KO
SICAKLIK
AKM
pH
LETKENLK
BULANIKLIK
ZNM OKSJEN

368 Y. Damar, R. leri


Uygulanan Ardk Kesikli Biyoreaktr (AKR) sisteminde deneysel almalar iin gerekli olan
atksu numunesi tekstil endstrisine ait atksu artma tesisi Ardk Kesikli Biyoreaktr nitesi
giriinden alnmtr.
Laboratuar lekli atksu artma tesisinin 2007 ylna ait giri KO deerleri ekil 5de
gsterilmitir. Laboratuar lekli atksu artma tesisinin 2007 ylna ait giri pH deerleri ekil
6da gsterilmitir.










Laboratuar lekli Atksu Artma Tesisinin 2007 Ylna Ait giri AKM Deerleri ekil 7de
gsterilmitir.










ekil 7. Laboratuar lekli Atksu Artma Tesisinin 2007 Ylna Ait Giri AKM
Deerleri




K
i
m
y
a
s
a
l

O
k
s
i
j
e
n

h
t
i
y
a
c


(
K
O

)


D
e

e
r
l
e
r
i
,

m
g
/
L


p
H

D
e

e
r
l
e
r
i




ekil 5. Laboratuar lekli Atksu
Artma Tesisinin 2007 Ylna Ait Giri
KO Deerleri

ekil 6. Laboratuar lekli Atksu
Artma Tesisinin 2007 Ylna Ait Giri
pH Deerleri



A
s
k

d
a

K
a
t


M
a
d
d
e

(
A
K
M
)

D
e

e
r
l
e
r
i
,

m
g
/
L


Tekstil Endstrisi Atksuyunun Ardk Kesikli Biyoreaktr le Optimum artlarda Artlmas in
Yaplan Laboratuar Ve Gerek lekli Tesis almalarnn Karlatrlmas
369


3. Sonular ve Tartma
Laboratuar lekli pilot tesiste KO giderme kinetii (kelme sresi 90 dakika ve ntrient (re)
ilavesi 25 mg/L) ekil 8 de verilmitir.










ekil 8. Laboratuar lekli pilot tesiste KO giderme kinetii (kelme sresi 90 dakika
ve ntrient (re) ilavesi 25 mg/L)
Laboratuar lekli biyolojik tesise giren ham atksuyun karakteristii ile, gerek lekli
biyolojik tesise giren atksu karakteri ile ayndr. almalar Su Kirlilii Kontrol Ynetmelii
(SKKY) esas alnarak yapldndan Kimyasal Oksijen htiyac (KO) parametresine
dayandrlmtr. Tam lekli tesis boyutlar belli bir oranda kltlerek (1 / 100 000) ortak
alma koullarnda laboratuar lekli tesis kurulmu ve her iki tesis iinde benzer artma
almalar yaplmtr.
Tekstil endstrisi atksu artma tesisi giri konsantrasyonlar; KO=350-5000 mg/L (aritmetik
ortalama=1417 mg/L), AKM=10-50 mg/L, pH=4-12, scaklk 40
0
Cdir.Tam lekli Ardk
Kesikli Biyoreaktr (AKR)den aritmetik ortalama k konsantrasyonlar 2005, 2006 ve 2007
yllarna ait ( yllk, n=52) atksu artma tesisi k Kimyasal Oksijen htiyac (KO) ve pH
deerleri tespit edilmitir. Gerek lekli Ardk Kesikli Biyoreaktr (AKR)den aritmetik
ortalama k konsantrasyonlar KO=114-440 mg/L (n=52, aritmetik ortalama=210 mg/L),
pH=6.7-7.5 (n=52, aritmetik ortalama=7.17) olarak llmtr.
Laboratuar lekli tekstil endstrisine ait Ardk Kesikli Biyoreaktr prensibine gre alan
atksu artma tesisi ham atksuyun giri konsantrasyonlar (2007 yl iin); KO= 5001000
mg/L (n=5, aritmetik ortalama=755 mg/L), AKM= 10-50 mg/L ((n=5, aritmetik ortalama=24
mg/l), pH= 7-9 dur. Laboratuar lekli tekstil endstrisine ait Ardk Kesikli Biyoreaktr
(AKR)e ait ortalama k konsantrasyonlar; KO=52468 mg/L (n=8, aritmetik
ortalama=282mg/L), pH=7.968.65 (n=8, aritmetik ortalama=8.13), AKM=2-80 mg/L (n=24,
aritmetik ortalama=21 mg/L) olarak llmtr. k numuneleri keltme sonras stte kalan
artlm k suyundan alnmtr.
Laboratuar lekli Atksu Artma Tesisinin 2007 Ylna k KO Deerleri ekil 9da
gsterilmitir. Su Kirlilii Kontrol Ynetmelii (SKKY)nde Tablo 10.7de KO parametresi

0
100
200
300
400
500
600
700
800
0 1 2 3 4 5 6
Reaksiyon Sresi (t
R
), saat
K
i
m
y
a
s
a
l

O
k
s
i
j
e
n

h
t
i
y
a
c


(
K
O

)


D
e

e
r
l
e
r
i
,

m
g
/
L


370 Y. Damar, R. leri


iin dearj standardn aan iki deer grlmektedir. Laboratuar lekli Atksu Artma Tesisinin
2007 Ylna k pH Deerleri ekil 10da gsterilmitir. Su Kirlilii Kontrol Ynetmelii
(SKKY)nde Tablo 10.7de pH parametresi iin standartlar salad grlmektedir.













Laboratuar lekli Atksu Artma Tesisinin 2007 Ylna k AKM Deerleri ekil 11 da
gsterilmitir.









ekil 11. Laboratuar lekli Atksu Artma Tesisinin 2007 Ylna Ait k AKM
Deerleri
Laboratuar lekli pilot tesiste ntrient (re) dozunun belirlenmesi iin yaplan deneylerin
sonular Tablo 1 de gsterilmitir.


A
s
k

d
a

K
a
t


M
a
d
d
e

(
A
K
M
)

D
e

e
r
l
e
r
i
,

m
g
/
L





p
H

D
e

e
r
l
e
r
i



ekil 10. Laboratuar lekli Atksu
Artma Tesisinin 2007 Ylna Ait k pH
Deerleri



K
i
m
y
a
s
a
l

O
k
s
i
j
e
n

h
t
i
y
a
c


(
K
O

)


D
e

e
r
l
e
r
i
,

m
g
/
L


ekil 9. Laboratuar lekli Atksu Artma
Tesisinin 2007 Ylna Ait k KO
Deerleri

SKKY
SKKY
SKKY
Tekstil Endstrisi Atksuyunun Ardk Kesikli Biyoreaktr le Optimum artlarda Artlmas in
Yaplan Laboratuar Ve Gerek lekli Tesis almalarnn Karlatrlmas
371


Tablo 1. Laboratuar lekli Pilot Tesiste Ntrient (re) Dozunun Belirlenmesi in
Yaplan Deneylerin Sonular
Nutrient (re)
Dozu (mg/L)
k KO, mg/L,
S
0
=830 mg/L
k Bulanklk,
NTU
k AKM,
mg/L
0 232 25.4 60
5 143 27.8 30
10 73 13.6 20
15 122 10.5 10
20 26 9.76 30
25 52 8.45 20
30 30 8.40 10
35 134 9.74 3
40 110 7.30 5
45 90 8.05 2
50 97 8.09 7
Hem laboratuar lekli, hem de tam lekli tekstil atksu artma tesisi iin yaplan almalar
sonucunda; 0,5 saat doldurma, 1,5 saat havalandrma, 1,5 saat kelme ve 0,5 saat boaltma-
devreye alma srelerinde en uygun artma (optimum) verimi elde edilmitir.
Hem laboratuar lekli, hem de tam lekli tekstil atksu artma tesisi iin yaplan almalar
sonucunda; optimum kartrma hz; laboratuar lekli tesiste 200 devir/dakika iken, tam
lekli tesiste ise 65 devir/dakika olduu tespit edilmitir. Kartrc cinsinin ve yeterliliinin
artma veriminde etkili olaca dnlmektedir.
Hem laboratuar lekli, hem de tam lekli tekstil atksu artma tesisi iin atksuya ntrient
ilavesi etkisinin aratrlmas iin yaplan almalar sonucunda (Tablo 1); her iki tesis iin de
25 mg/L re katlmasnn optimum artma verimine olumlu katksnn olduu tespit edilmitir.
Ntrient (re) ilavesiz artma verimi %72 iken, ntrient (re) ilaveli (optimum ve ekonomik
miktar: 25 mg re/L) %94 artma verimi elde edilmitir. Ntrient (re) ilavesinin artma
verimine %31lik olumlu katks olduu tespit edilmitir.
Ortalama artma verimi hesaplar; ortalama girdi ve ortalama kt deerleri esas alnarak
hesaplanmtr. Laboratuar lekli tekstil endstrisine ait Ardk Kesikli Biyoreaktrn KO
cinsinden ortalama artma verimi %63 iken (alma koullarna bal olarak; minimum=%37,
maksimum=%94) allan tam lekli tekstil endstrisine ait Ardk Kesikli Biyoreaktrn
KO cinsinden ortalama artma verimi %85 (alma koullarna bal olarak; minimum=%69,
maksimum=%91) olduu grlmtr.
Ardk Kesikli Biyoreaktr sisteminin, tekstil fabrikas atksularnn artlmas iin baar ile
kullanlabilecei grlmektedir.
Kaynaklar
Droste, R.L. (1997). Theory and Practice of Water and Wastewater Treatment, John Wiley&Sons, Inc., New York,
USA.
EPA, (2000), Wastewater Technology Fact Sheet, Washington, Package Plants, USA.
Ileri, R., Damar, Y. (2005). Experimental and theoritical studies of treatment of industrial wastewaters by a
sequencing batch reactor, Fresenius Environmental Bulletin, 14 (7), 550-558.
Ileri, R., Damar, Y., (2008). Simulation Study on Treatment Efficiency for Textile Wastewater by Full-Scale
Sequencing Batch Reactor, International Journal of Environment and Pollution, Baskda.
Jamrah, I. Ahmad and Abu-Ghunmi, N. Lina, (2001). Biological treatment of textile wastewater using sequencing
batch reactor technology, Water Science & Technology, 44 (5), 85-92.
372 Y. Damar, R. leri


Kulac, S. (1997). Kesikli Biyolojik Artma Tesisinde Optimum Koullarn Aratrlmas, Yksek Lisans Tezi, Kimya,
Sakarya niversitesi, Fen Bilimleri Enstits, Adapazar.
Lee, C.C., Lin, S.D., (2000). Handbook of Environmental Engineering Calculations, McGraw Hill, New York, USA.
Lin, S.D., (2001). Water and Wastewater Calculations Manuel, McGraw Hill, New York, USA.
Novak, L., Goronzy, M.C., Wanner, J., (1997). Dynamic mathematical modelling of sequencing batch reactor with
aerated and mixed filling period. Wat. Sci. Tech., 35 (1), 105-112.
Su Kirlilii ve Kontrol Ynetmelii, (SKKY), (2004). 31/12/2004 tarihli ve 25687 sayl Resm Gazete.
Tchobanoglous, G., (1991). Wastewater Engineering: Treatment, Disposal, Reuse, Metcalf&Eddy, Inc., New York,
USA.
Teichgraber, B., Screff, D., Ekkrlein, C., Wilderer, P.A. (2001). Sequencing Batch Reactor Technology in Germany-
in Overview. Wat. Sci. Tech., 43 (3), 323-330.
Tsang Y.F., Hua F.L., Chua H., Sin S.N., Wang Y.J., (2007). Optimization of biological treatment of paper mill
effluent in a sequencing batch reactor, Biochemical Engineering Journal 34, 193-199.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Remazol Brillant Blue Royal ve Drimaren Blue CL-BRnin
Beyaz rkl Funguslar Tarafndan Renk Gideriminin
Aratrlmas
Emrah A. Erkurt, Ali nyayar, Halil Kumbur
Mersin niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 33343 iftlikky, Mersin
E-posta: eaerkurt@mersin.edu.tr

z Bu almada, Pleurotus ostreatus, Coriolus versicolor ve Funalia trogii beyaz rkl
funguslar ile Remazol Brillant Blue R ve Drimaren Blue CL-BRnin renk giderimleri
aratrlmtr. almalar statik koullarda, 30
o
C ve pH 5.0da 48 saat srdrlmtr. Farkl
boyar madde deriimlerinin alld ortamlarda periyodik olarak pH, kuru misel arl, renk
giderimi, lakkaz aktivitesi, peroksidaz aktivitesi, protein miktar analizlenmi, renk
gideriminden sorumlu enzim saptanarak, renk gideriminde kinetik parametreler hesaplanmtr.
Renk giderimi almalarnda tm ortamlar iin pHn 5,0 ile 4,75 arasnda deitii, en yksek
renk giderimi Funalia trogii ile; en dk renk giderimi ise Pleurotus ostreatus ile saptanmtr.
Her iki boyar maddenin allan tm deriimlerinde Pleurotus ostreatus geliimine, Drimaren
Blue CL-BRnin 60 mg/L ve st deriimlerinde Coriolus versicolor geliimi zerine toksik
etkisi olduu saptanmtr. almalarda artan boyar madde deriimine bal olarak lakkaz ve
peroksidaz aktivitelerinde art bulunmutur. En yksek lakkaz aktivitesi Funalia trogii ile
saptanrken en dk lakkaz aktivitesi Pleurotus ostreatus ile saptanmtr. Renk gideriminden
sorumlu olan enzimin saptanmas amacyla Sodyum dodesil slfat poliakrilamid jel
elektroforezi (SDS-PAGE) uygulamas yaplmtr. SDS-PAGE uygulamasndan sonra jellerinin
boyar maddeler ile ykanmas sonucunda yaklak 56 kDa molekl arlna sahip proteinlerin
bulunduu blgelerin renksizletii gzlenmitir. Renksizleen blgelere lakkaz substrat olan
guaikol uygulamas sonucunda bu blgelerde guaikoln lakkaz tarafndan oksitlenmesi sonucu
oluan glkurusu rengin meydana gelmesi renk gideriminden sorumlu olan enzimin lakkaz
olduunu gstermitir. Renk giderim almalar sonunda K
m
ve V
m
kinetik parametreleri
hesaplanmtr. En yksek renk giderimi hz Funalia trogiinin, en dk renk giderim hznn
ise Pleurotus ostreatusun kullanld ortamlarda saptanmtr.
Anahtar Kelimeler beyaz rkl fungus, drimaren blue CL-BR, remazol brillant Blue R, renk
giderimi, SDS-PAGE
1. Giri
Endstriyel atksular arasnda tekstil ve boyar madde retim endstrilerinden kan, boyar
madde ieren atk sular artlmas en g atk sulardan biridir. Bunun sebebi boyar maddelerin
genellikle sentetik kaynakl ve kompleks aromatik molekl yapya sahip olmalar ve bu
yaplarn boyar maddeleri daha kararl ve biyolojik paralanmaya kar daha direnli hale
getirmesidir (Fu, 2001). Atksudaki renk gzle grlebilir olduundan sucul ortamlarda
olumsuz bir grnm yaratt, suyun geirgenliini ve gaz znrln etkiledii
belirtilmektedir. Ayrca, bir ou benzidin ve dier aromatik bileikler gibi kanserojen
maddelerden sentezlendiinden boyar madde ieren atk sularn artlmas gerektii
vurgulanmaktadr (Banat, 1996).
Son yllarda atk sulardaki boyar maddeleri biyolojik paralanma veya biyosorpsiyon yoluyla
giderebilen baz mikroorganizmalar zerinde almalar younlamtr. eitli boyar maddeleri
374 E. A. Erkurt, A. nyayar, H. Kumbur


renksizletirebilen bir ok bakteri (Yu, 2001), alg (Banat, 1996) ve fungus tr (Schliephake,
2000; Mazmanc, 2002; Yesilada, 2002) bilinmektedir.
Boyar maddelerin renk giderim hzlar enzim kaynana ve boyar maddenin kimyasal yapsna
baldr (Nyanhongo, 2002). Boyar maddelerin biyolojik artmlarnn temeli ve anahtar her bir
boyar maddeyi etkili bir ekilde renksizletirecek uygun mikroorganizma trn saptamaktr
(Dong, 2001).
Bu almada, evreye zararl etkileri olan ve tekstil fabrikalarnda yaygn olarak kullanlan
Remazol Brillant Blue Royal (RBBR) ve Drimaren Blue CL-BR (DB) boyar maddelerinin
Funalia trogii (F. trogii), Coriolus versicolor (C. versicolor) ve Pleurotus ostreatus (P.
ostreatus)) beyaz rkl funguslar ile statik koullarda sv fazda renk giderimi
karlatrmal olarak aratrlm, renk gideriminden sorumlu enzim ya da enzimlerin
saptanmas ve renk gideriminde kinetik parametrelerin hesaplanmas allmtr.
2. Materyal ve Metot
almada Basidiomycetes snf yesi F. trogii, C. versicolor ve P. ostreatus beyaz rkl
funguslar kullanlmtr. Kltrler Mersin niversitesi Mhendislik Fakltesi evre
Mhendislii Blmnden salanmtr.
Fungal nkltrlerin hazrlanmasnda, ierii CaCl
2
.2H
2
O; 0,05 g/L, MgSO
4
.7H
2
O; 0,05 g/L,
NH
4
H
2
PO
4
; 0,5 g/L, Glikoz; 5,0 g/L, FeSO
4
; 0,025 g/L,

MnSO
4
; 0,025 g/L olan besiyeri
kullanlmtr. almada ortam pHs 0,1 M fosfat tamponu ile pH 5,0a ayarlanm ve ortam
scakl ise 30
o
Cde (Mazmanc, 2003) tutulmutur. Potato Dextroz Agar besiyerinde retilen
kltrlerden; 30 mL nkltr besiyeri ieren ortamlara, 1 cm
2
byklnde 5 para kesilerek
alama yaplmtr. Alama yaplm ortam 7 gn boyunca 30
o
Cde inkbe edilmitir
(Mazmanci, 2002; Adosinda 2001).
Renk giderimi ortamnn ierii CaCl
2
.2H
2
O; 0,05 g/L, MgSO
4
. 7H
2
O; 0,05 g/L, Glikoz; 2,0 g/L
olarak hazrlanm, pHs 0,1 M fosfat tamponu ile pH 5,0'a ayarlanm ve ortam scakl
30
o
Cde sabit tutulmutur. Hazrlanan nkltrler 13500 rpmde 15 saniye politron
homojenizatrde paralanarak (Mazmanci, 2005) hacmen % 3 misel sspansiyonu olacak
ekilde renk giderimi ortamlarna alanmtr. Renk giderimi ortamlarnda 3 gnlk misel
geliimi salanm ve ardndan boyar maddeler 20, 40, 60, 80, 100 mg/L olacak ekilde
ortamlara eklenmitir. Boyar madde eklemelerinin yapld an inkbasyonun balangc olarak
kabul edilmitir ve inkbasyon srasnda periyodik olarak her alt saatte bir ortamlardan rnekler
alnmtr. Bu rnekler 6000 rpmde 15 dk. sre ile santrifjlenmi ve elde edilen sv ksmda 6
saat ara ile pH, renk, toplam protein ve enzim (lakkaz ve peroksidaz) analizleri, 12 saat
aralklarla kuru misel arl (KMA) analizi yaplmtr. Ayrca inkbasyon sonunda ortamdan
alnan rnekler elektroforez almalarnda kullanlmak zere +4
o
Cde muhafaza edilmitir.
Deneyler 3 paralel olarak tekrarlanmtr.
Ortam pHs Hanna Instruments 8521 ile 48 saatlik inkbasyon sresince her 6 saatte bir
yaplmtr. Boyar maddelerin renklerindeki azal Shimadzu UV160 A spektrofotometrede
boyar maddelerin maksimum absorbsiyon gsterdii dalga boylarndaki absorbans azalyla
saptanmtr (Mazmanci, 2005) ve boyar maddelerin deriimi hazrlanan standart erilerinden
hesaplanmtr. Standart Metod For Examination of Water and Waste Watera gre; KMA
analizi yaplmtr. Lakkaz (EC. 1.10.3.2) ve Peroksidaz (E.C. 1.11.1.7) aktivitelerinin lm
k ve nyayar (1998)n belirttii gibi gerekletirilmitir. Toplam protein miktar, modifiye
Lowry metodu ile saptanmtr (Hartree, 1972).
Remazol Brillant Blue Royal ve Drimaren Blue CL-BRnin Beyaz rkl Funguslar Tarafndan
Renk Gideriminin Aratrlmas
375


almada kullanlan boyar maddeleri ykan enzim ya da enzimlerin molekl arlnn
saptanmas amac ile % 0.1 sodyum dodesil slfat (SDS) ieren %10luk poliakrilamid ile
sodyum dodesil slfat-poliakrilamid jel elektroforezi (SDS-PAGE) gerekletirilmitir
(Laemmli, 1970). rneklerin, iki ayr jele yklenmeden nce konsantre edilmesi amacyla ilk
olarak Sephadex G-50 ile muamele edilmi, ardndan amonyum slfat ile fraksiyonel ktrme
yaplmtr (Erarslan, 2000).
SDS-PAGE ilemi ile elde edilen iki jelden ikinci jel ise iki ksma ayrlarak bir ksmna RBBR
ve dier ksmna DB boyar maddeleri (80 mg/L deriimde) uygulanmtr. Daha sonra jel
zerinde bir renk almas beklenmitir. Renk almasn takiben renk gideriminden sorumlu
olabilecek enzim yada enzimlerin substratlar uygulanarak renk giderimlerinden sorumlu enzim
yada enzimler aratrlmtr (Coral, 2000; Unyayar, 2005). SDS-PAGE ilemleri boyunca her
basamakta fotoraflar ekilmitir.
Renk gideriminde boyar madde deriimlerinin zamana gre deiim grafii oluturulmutur.
Bu grafikte; t = 0 noktasndaki teetin eimi hesaplanarak ilk hz saptanmtr.
Michaelis-Menten sabiti (K
m
) ve Maksimum hz (V
m
)in Hesaplanmasnda Michaelis-Menten
denkleminin lineerletirilmesi ile oluturulan Lineweaver-Burk denklemi ve bu denklem ile
oluturulan diyagramdan hesaplanmtr.
[S] K
.[S] V
V
m
m
+
= . .(Michaelis-Menten Denklemi)
|
|
.
|

\
|
+
|
|
.
|

\
|
|
|
.
|

\
|
=
max max
m
V
1
[S]
1
V
K
V
1
..(Lineweaver-Burk Denklemi)
3. Bulgular ve Tartma
3.1. Renk Giderimi almalarnda pH Deiimi
P. ostreatus, C. versicolor ve F. trogii ile yaplan almalarda boyar madde ieren ortamlarda
inkbasyon sresi sonuna kadar pH deiimi izlenmi ve boyar madde iermeyen kontrol grubu
ile karlatrlmtr. Yaplan pH analizlerinde kontrol gruplar da dahil olmak zere P.
ostreatus ve C. versicolorun tm ortamlarda pHy 4,9-4,75 seviyelerine drd, F. trogii
alanm ortamlarda ise bu dn 5,0-4,85 seviyelerinde kald saptanmtr.
3.2. Boyar Madde eren Ortamlarda Fungal Geliim
Boyar madde eklenen ortamlarda analizlenen KMA deerleri ile boyar madde iermeyen
kontrol gruplarnda elde edilen KMA deerleri karlatrlarak boyar maddelerin fungal
geliime olan etkileri aratrlmtr. almalar sonucunda P. ostreatus geliiminde boyar
maddelerin toksik etkisinin olduu, C. versicolor geliimde RBBRnin toksik etkisinin
olmad, ancak DBnin 60 mg/Lnin zerindeki deriimlerinde toksik etkili olduu
saptanmtr. F. trogii ile yaplan almada ise boyar maddelerin fungus geliimi zerine
etkisinin olmad bulunmutur (ekil 1).
376 E. A. Erkurt, A. nyayar, H. Kumbur


(A)
0 20 40 60 80 100
0.3
0.4
0.5
0.6
Balang Boyar Madde Konsantrasyonu (mg/L)
K
M
A

(
g
/
L
)
(B)
0 20 40 60 80 100
0.3
0.4
0.5
0.6
Balang Boyar Madde Konsantrasyonu (mg/L)
K
M
A

(
g
/
L
)
P. ostraetus C. versicolor F. trogii

ekil 1. Kontrol gruplar, RBBR (A) ve DB (B) eklenen ortamlarda 48 saatlik
inkubasyon sonucu saptanan P. ostreatus, C. versicolor ve F. trogiinin KMA deerleri
3.3. Renk Giderimi ve Lakkaz-Peroksidaz Deiimi
Renk gideriminde en baarl fungusun F. trogii ardndan C. versicolor ve P. ostreatus olduu
saptanmtr. Ayn boyar maddeler kullanlmasna karlk farkl renk giderimi verimlerinin elde
edilmesi fungus trleri arasndaki fizyolojik farkllktan kaynaklandn gstermektedir. Ayrca
yaplan KMA tayinlerine gre DB ve RBBR boyar maddelerinin F. trogii geliimi zerinde
toksik etki gstermemesi ve en yksek renk gideriminin F. trogii ile saptanmas alma
bulgularn desteklemektedir (ekil 2).
Bu almada kullanlan fungus trnde de DB renk gideriminin RBBR renk giderimine gre
daha yksek olduu bulunmutur (ekil 2). Ayn fungus tr ierisinde DB renk gideriminin
RBBR renk giderimine gre daha yksek saptanmas, boyar maddelerin kimyasal yaplarnn
farkl olmalarndan kaynaklandn gstermitir. Her fungus tr iinde boyar madde
eklenen ortamlarda enzim aktivitelerinin boyar madde deriimine bal olarak artt, lakkaz
aktivitelerinin peroksidaz aktivitelerinden yksek olduu ve RBBR eklenen ortamlarda
analizlenen enzim aktivitelerinin DB eklenen ortamlardan daha yksek olduu saptanmtr
(ekil 2). Ancak DB eklenen ortamlarda gerekleen renk gideriminin RBBR eklenen
ortamlardan yksek olmas boyar maddenin kimyasal yapsnn renk gideriminde nemli bir rol
oynadn gstermitir. Ayrca en yksek renk giderimi ile en yksek enzim aktivitelerinin F.
trogii alanm ortamlarda saptanmas renk gideriminin sentezlenen enzim aktiviteleri ile doru
orantl olduunu, RBBR ve DB renk gideriminin funguslar tarafndan sentezlenen hcre d
enzimlerle gerekletiini gstermektedir.
Renk giderimi ile analizlenen enzimlerin ilikilerini aydnlatabilmek amacyla lakkaz ve
peroksidaz enzimleri iin spesifik aktiviteler almada kullanlan her bir ortam iin
hesaplanarak grafikler oluturulmu ve bulgular ekil 2.de verilmitir. Renk giderimi
ortamlarda retilen enzimlerin spesifik aktivitelerinin artmas ile renk gideriminin artmas renk
gideriminden sorumlu olabilecek enzim/enzimlerin lakkaz yada peroksidaz olabilecei fikrini
dourmutur. Antrakinon boyar maddelerin lakkaz substrat olduu buna karlk azo ve indigo
Remazol Brillant Blue Royal ve Drimaren Blue CL-BRnin Beyaz rkl Funguslar Tarafndan
Renk Gideriminin Aratrlmas
377


boyar maddelerin lakkaz substrat olmad belirtilmitir (Fu, 2001). Bu almada kullanlan
boyar maddelerin ikisininde antrakinon yapl olmas renk gideriminden sorumlu olan enzimin
lakkaz olduu fikrini vermektedir. Ancak ortamlarda sentezlenen peroksidaz enziminin de renk
giderminden sorumlu olabilecei etli aratrclar tarafndan rapor edilmitir.
P. osreatus
(A)
20 40 60 80 100
0
20
40
60
80
100
120
140
0
20
40
60
80
100
S
p
e
s
i
f
i
k

A
k
t
i
v
i
t
e

(
C
U
/
m
g
)
P. osreatus
(B)
20 40 60 80 100
0
10
20
30
40
50
0
20
40
60
80
100
R
e
n
k

G
i
d
e
r
i
m
i

(
m
g
/
L
)
C. versicolor
(A)
20 40 60 80 100
0
20
40
60
80
100
120
140
0
20
40
60
80
100
S
p
e
s
i
f
i
k

A
k
t
i
v
i
t
e

(
C
U
/
m
g
)
C. versicolor
(B)
20 40 60 80 100
0
10
20
30
40
50
0
20
40
60
80
100
R
e
n
k

G
i
d
e
r
i
m
i

(
m
g
/
L
)
F. trogii
(B)
20 40 60 80 100
0
10
20
30
40
50
0
20
40
60
80
100
Boyar Madde Konsantrasyonu (mg/L)
R
e
n
k

G
i
d
e
r
i
m
i

(
m
g
/
L
)
F. trogii
(A)
20 40 60 80 100
0
20
40
60
80
100
120
140
0
20
40
60
80
100
Boyar Madde Konsantrasyonu (mg/L)
S
p
e
s
i
f
i
k

A
k
t
i
v
i
t
e

(
C
U
/
m
g
)
Renk giderimi (mg/L) S.Aktivite
(Lakkaz)
S.Aktivite
(Peroksidaz)

ekil 2. Renk giderimi almalar sonunda (48 saat) saptanan spesifik enzim
aktivitelerine kar renk giderim miktarlar arasndaki deiim.

378 E. A. Erkurt, A. nyayar, H. Kumbur


3.4. Elektroforez almalar
Enzim saflatrma ilemlerinde verim, Saflatrma Faktr (SF) kullanlarak ifade edilmektedir
(Erarslan, 2000). SF her fraksiyonda elde edilen spesifik aktivitenin orijinal rnein spesifik
aktivitesine blm olarak hesaplanmakta ve hesaplamada orijinal rnek SF deeri 1,00 olarak
kabul edilmektedir (Tablo 1).
Tablo 1. Elektroforez almas iin iki basamak uygulanarak konsantre etme ilemleri
sonras elde edilen SFler
P. ostreatus C. versicolor F. trogii
RBBR DB RBBR DB RBBR DB
Balang
Lakkaz 1,00 1,00 1,00 1,00 1,00 1,00
Peroksidaz 1,00 1,00 1,00 1,00 1,00 1,00
SG-50 ile
muamele
Lakkaz 19,69 19,61 19,94 20,42 20,07 19,27
Peroksidaz 19,68 19,61 19,92 20,32 20,07 19,29
A. slfat ile
ktrme
Lakkaz 103,65 110,18 100,91 97,68 69,89 81,73
Peroksidaz 86,78 103,92 95,73 91,78 71,89 60,72
SDS-PAGE uygulamas sonras elde edilen bantlarn molekl arlklar hesaplandnda F.
trogii den elde edilen 4 bandn molekl arlklar yukardan aaya doru srasyla 100,8;
71,8; 55,3; 43,0 kDa, C. versicolor den elde edilen 3 bandn molekl arlklar srasyla 94,6;
72,1; 55,4 kDa ve P. ostreatus den elde edilen 2 bandn molekl arlklar ise 71,7 ve 56,4
kDa olarak bulunmutur (ekil 3-A). Protein bantlar oluturulduktan sonra jellerden biri 80
mg/L RBBR dier jel ise 80 mg/L DB ile ykanarak 30 dk, 30
o
Cde inkbasyona tabi
tutulmutur. Bu ilem sonrasnda molekl arlklar F. trogii iin 55,3 kDa; C. versicolor iin
55,4 kDa ve P. ostreatus iin 56,4 kDa olarak nceden saptanm olan bantlar zerinde renk
kaybolmutur (ekil 3-B). Ardndan bantlarn zerine lakkaz substratlarndan biri olan guaikol
(%1lik) zeltisi dklm ve ayn blgelerde glkurusu renk elde edilmitir (ekil 3-C).
Oluan renk guaikoln lakkaz tarafndan 6-methoxycyclohexa-2,4-dienone evrilmesi sonucu
olumaktadr (Das, 2001).


ekil 3. (A) SDS-PAGE ile Proteinlerin ayrm (Mr: Standart molekler arlk
iaretleyici, P.o: P. ostreatus, C.v: C. versicolor, F.t: F. trogii), (B) Jellerin Boyar
Remazol Brillant Blue Royal ve Drimaren Blue CL-BRnin Beyaz rkl Funguslar Tarafndan
Renk Gideriminin Aratrlmas
379


madde ile boyanmas sonucu oluan renksiz blgeler, (C) Guaikol uygulams sonucu
oluan renkli blgeler
Jellere enzim substrat uygulanmas ve bu ekilde enzim tespiti daha nceki almalarda da
yaplmtr (Unyayar, 2005; Deveci, 2004). Ancak dier almalarda uygulanan elektroforez
yntemi SDS-PAGE deil, Native-PAGE olarak adlandrlmaktadr. Kat faz fermantasyonu
(KFF) ile retilen Trametes gallicada lakkaz aktivitesi Nativ-PAGE ile protein bantlarnn
oluturulduu jelin substrat olarak guaikol yerine o-tolidine ile muamele edilmesi ile meydana
gelen Mavi-yeil zon oluumu ile saptand rapor edilmitir (Sun, 2004).
3.5. Kinetik almalar
Renk giderimi almalarnda hesaplanan kinetik parametreler kendi iinde kyaslandnda renk
gideriminde en yksek V
m
her iki boyar madde iinde F. trogiide, en dk V
m
ise P. ostreatus
ile yaplan almalarda saptanmtr. Sonular Tablo 2.de verilmitir.
Tablo 2. Renk giderimi almalar sonras hesaplanan kinetik parametreler.
K
m
(mg/L) V
m
(mg/L.h)
P. ostreatus
RBBR 58,90 1,85
DB 118,60 2,99
C. versicolor
RBBR 142,80 2,94
DB 131,40 3,00
F. trogii
RBBR 216,30 4,98
DB 269,80 5,57
nyayar ve ark. (2005) yapm olduklar bir almada kat faz fermantasyon teknii ile
rettikleri F. trogiiden elde ettikleri enzimler ile Drimaren Blue X3LR renk gideriminden
sorumlu olan enzimin lakkaz olduunu ve boyar madde giderimi almlarnda K
m
i 106 mg/L ve
V
m
i 5,02 mg/Ls olarak saptadklarn rapor etmilerdir.
4. Sonular ve neriler
Bu almada renk gideriminden sorumlu olan enzimin saptanmas amacyla SDS-PAGE
uygulamas yaplmtr ve jellerin boyar maddeler ile ykanmas sonucunda renksizleen
blgelere guaikol uygulamas sonucunda lakkaz enziminin renk gideriminden sorumlu olduu
sonucuna varlmtr.
Tm dnyada, endstriyel alanlarda biyoteknolojik yntemler kullanlarak maliyetin
drlmesi amacyla yaplan almalar hz kazanmtr. Trkiyede biyoteknolojik
almalarn maddi ve manevi ynden daha fazla desteklenmesi ile lke ekonomisine byk
kazanlar salanabilecei gibi ayn zamanda, doal kaynaklarmzn korunmas ve evre kirlilii
kontrol asndan da byk yarar salayaca dlmektedir.


380 E. A. Erkurt, A. nyayar, H. Kumbur


Kaynaklar
Adosinda, M., Martins, M., Ferreira, I.C., Santos, I.M., Queiroz, M.J. and Lima, N., (2001). Biodegradation of
Bioaccessible Textile Azo Dyes by Phanerochaete chrysosporium, J. Biotechnol., 89, 91-98.
Banat, I.M., Nigam, P., Shing, D. and Marchant, R. (1996). Microbial Decolorization of Textile Dye-Containing
Eeffluents: a Review, Bioresource Technol., 58, 217-227.
Chander, M. and Arora D.,S., (2007). Evaluation of Some White-Rot Fungi for Their Potential to Decolourise
Industrial Dyes, Dyes Pigments, 72, 192-198.
Coral, G., (2000). Lipozom Protoplast elektrofzyon Metodu ile Aspergillus niger Kkenli Glukoamilaz Geninin
Saccharomyces cerevisiae Hcrelerine Aktarlmas ve Ekspresyonu. Doktora tezi, .. Fen Bil. Ens., Biy., ABD,
sy: 56-86.
Das, N., Chakraborty, T.K. and Mukherjee, M., (2001). Purification and characterization of a growth-regulating
laccase from Pleurotus florida, J. Basic Microbiol., 41(5), 261267.
Deveci, T., Unyayar, A. and Mazmanci M.A., (2004). Production of Remazol Brillant Blue R Decolourising
Oxyganase from the Culture Filtrate of Funalia trogii ATCC 200800. J. Mol. Catal. B-Enzym., 30, 25-32.
Dong, X.J., Du, Z.I. and Zhu, C. (2001). Decolorization of Direct Black 22 by Aspergillus ficuum, J. Environ. Sci-
China, 13, 472-475.
Erarslan, A., Kazan, D. and ztrk, D., (2000). Enzimlerin Saflatrlmasnda Temel Yntemler, TBTAK,
Marmara Aratrma Merkezi.
Fu, Y. and Viraraghavan, T. (2001). Fungal Decolorization of Dye Wastewaters: a Review, Bioresource Technol., 79,
251-262.
Hartree, E. F., (1972). Determination of Protein. a Modification of Lowry Method that Gives a Linear Photometric
Response. Anal. Biochem., 48, 422-427.
Laemmli, U.K., (1970). Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4.
Nature, 227, 680-685.
Mazmanc, M.A., (2003). Beyaz rkl Fungus Funalia trogii Kullanlarak Diazo Boyar Madde Reaktif Black
5in Renk Giderimi. ME., Fen Bilimleri Enstits, Doktora Tezi, Mersin, 127 s.
Mazmanci, M.A. and nyayar, A., (2005). Decolourisation of Reactive Black 5 by Funalia trogii immobilised on
Luffa cylindrica sponge, Process Biochem., 40, 337342.
Mazmanci, M.A., Unyayar, A. and Ekiz, H.I. (2002). Decolorization of Methylene Blue by White Rot Fungus
Coriolus versicolor. Fresen. Environ. Bull., 11, 1-5.
Novotny, C., Svobodova, K., Erbanova, P., Cajthaml, T., Kasinath, A., Lang, E. and Sasek, V., (2004). Ligninolytic
Fungi in Bioremediation: Extracellular Enzyme Production and Degradation Rate. Soil Biol. Biochem., 36, 1545
1551.
Nyanhongo, G.S., Gomes, J., Gubitz, G.M., Zvauya, R., Read, J. and Steiner, W., (2002). Decolorization of Textile
Dyes by Laccase from a Aewly Isolated Starin of Trametes modesta, Water Res., 36, 1449-1456.
Palmer, T., (1994). Enzim Bilgisi, Bilimsel ve Teknik Yaynlar eviri Vakf, stanbul, 527 s.
Palonen, H., Saloheimo, M., Viikari, L. and Kruus, K., (2003). Purification, Characterization and Sequence Analysis
of a Laccase from the Ascomycete Mauginiella sp.. Enzyme Microb. Tech., 33, 854862.
Schliephake, K., Mainwaring, D.E., Lonergan, G.T., Jones, K.I. and Baker, W.L. (2000). Transformation and
Degradation of the Disazo Dye Chicago Sky Blue by a Purfied Laccase from Pycnoporus cinnabarinus. Enzyme
Microb.Tech., 27, 100-107.
Sk, S. and Unyayar, A., (1998). Phanerochaete chrysosporium and Funalia trogii for the Degradation of Cotton
Stalk and Their Laccase, Peroxidase, Ligninase and Cellulase Enzyme Activities under Semi-solid State
Conditions. J. Biology, 22, 287-298.
Remazol Brillant Blue Royal ve Drimaren Blue CL-BRnin Beyaz rkl Funguslar Tarafndan
Renk Gideriminin Aratrlmas
381


Sun, X., Zhang, R. and Zhang, Y., (2004). Production of Lignocellulolytic Enzymes by Trametes gallica and
Detection of Polysaccharide Hydrolase and Laccase Activities in Polyacrylamide Gels. J. Basic Microbiol. 44(3),
220-231.
Unyayar, A., Mazmanci, M.A., Atacag, H., Erkurt, E.A. and Coral, G. (2005). A Drimaren Blue X3LR Dye
Decolorizing Enzyme from Funalia trogii: One Step Isolation and Identification. Enzyme Microb.Tech., 36, 10
16.
Unyayar, A., Mazmanci, M.A., Erkurt, E.A., Atacag, H. and Gizir, A.M. (2005). Decolorization Kinetics of the Azo
Dye Drimaren Blue X3LR by Laccase. React. Kinet.Catal.L., 86(1), 99-107.
Yesilada, O., Cing, S. and Asma, D. (2002). Decolourisation of the Textile Dye Astrazon Red FBL by Funalia trogii
Pellets. Bioresource Technol., 81, 155-157.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Kt Endstrisi Atksularn Artan Gerek lekli Anaerobik
Kontak Reaktrdeki Mikrobiyal eitliliin Denatran
Gradyan Jel Elektroforezi (DGGE) ile Belirlenmesi
. elikkol
1*
, B. Kasapgil nce
2
, M. Kolukrk
1,3
, Z. eteciolu
1
, Orhan nce
1
1
stanbul Teknik niversitesi, naat Fakltesi, evre Mhendislii Blm, Maslak 34469,
Istanbul, TR
E-posta: celikkolsu@itu.edu.tr
2
Boazii niversitesi, evre Bilimleri Enstits
3
stanbul Teknik niversitesi, Fen-Edebiyat Fakltesi, Molekler Biyoloji ve Genetik Blm

z Bu almada kt endstrisi atksularn artan gerek lekli bir anaerobik kontak
reaktrn 3 farkl yksekliinden 2 farkl zamanda alnan amur numunelerinin mikrobiyal
komnite yaplar denatran gradyan jel elektroforez (DGGE) yntemi kullanlarak
karlatrlmtr. Kontak reaktrn 1.6-1.8 kg KO/m
3
.gn

organik ykleme hz aralnda
KO giderim verimi %47-55, metan retim verimi 0.18-0.20 m
3
CH
4
/kgKO
giderilen
aralnda
deimitir. DGGE analizleri sonucu anaerobik reaktrde arkeyal poplasyona ait 31, bakteriyel
poplasyona ait 57 farkl tr tespit edilmitir. Arkeyal poplasyona ait 3 farkl tr Austos
2005te tespit edilememi, buna karn 6 yeni trn ortaya kt gzlenmitir. Bakteriyel
poplasyonda ise Temmuz 2005 numunesine ait 10 farkl tr tespit edilemezken Austos
2005te anaerobik reaktrde 10 yeni trn varl gzlenmitir. Bu almada, incelenen
reaktre ait asetoklastik metan retim kapasitesi nceki bir almada spesifik metan aktivite
(SMA) test dzenei kullanlarak llm ve potansiyel metan retiminin 2 aylk izleme
srecinde yaklak %45 azald tespit edilmitir. Sistemde bulunan metanojenlerin ve slfat
indirgeyici bakterilerin (SRB) tr ve saylar ise floresanl yerinde hibritleme (FISH)
kullanlarak tespit edilmi ve SMA sonularna paralel olarak Methanosaeta trlerinin
saylarnn azald gzlemlenmitir. Bu almada ise SMA testi ve FISH teknii ile tespit
edilen mikrobiyal komnite deiimi DGGE yntemi ile de dorulanmtr. Elde edilen tm
veriler deerlendirildiinde, 2 aylk izleme dnemi iinde sistemin 2 hafta sreyle bakma
alnm olmasnn aktivite kayplarna ve mikrobiyal kompozisyon deiikliklerine neden
olduu sonucu karlmtr. DGGE yntemi, iki farkl zamanda alnan anaerobik reaktr
numunelerinin mikrobiyal komnite yaplarnn karlatrlmasna olanak salamtr. FISH
yntemi reaktrde mevcut mikrobiyal trlerin miktarlar hakknda bilgi vermektedir. DGGE
yntemi saysal deerlendirmede yetersiz kalmakla birlikte komnite deiimini aka
yanstmaktadr. Bu nedenle anaerobik reaktrlerin mikrobiyal komnite yaplar gerek DGGE
gibi detayl kalitatif sonu veren gerekse FISH gibi mikroskopik sayma dayal sonu veren
kltrden bamsz yntemlerle allmas gerektii sonucuna varlmtr.
Anahtar kelimeler anaerobik kontak reaktr; arkeyal poplasyon; bakteriyel poplasyon;
denatran gradyan jel elektroforezi; kt endstrisi atksular
1. Giri
Endstriyel atksularn anaerobik artm son yllarda giderek yaygnlamaktadr (Lettinga ve
di., 1980). Gerek lekli artma tesislerinde, anaerobik reaktrn fiziksel ve kimyasal iletme
koullar optimum deerler arasnda tutulmasna ramen sistem performansnn ve stabilitesinin
srekliliinin salanmasnda zorluklar yaanabilmektedir. Sistem performansnda ve
384 . elikkol, B.K. nce, M. Kolukrk ve di.


stabilitesinde gzlenen deiimler, fiziksel ve kimyasal iletme parametrelerinin yan sra
mikrobiyal komnite yapsnn ve aktivitesinin de takip edilmesi gerekliliini ortaya karmtr
(Gilbride ve di., 2006). Anaerobik artma, fermentatif, asetojen ve metanojen
mikroorganizmalarn sintrofik ilikilerine dayal olarak gerekleen bir prosestir (Roest ve di.,
2005). Ayrca, slfat varlnda, slfat indirgeyici bakteri (SRB) poplasyonlar anaerobik
sistemlerde asetojenlerle organik asitler ve etanol, metanojenlerle ise H
2
, asetat ve metanol gibi
karbon ve elektron kaynaklar iin yar halindedirler (Stams ve di., 2003). Farkl metabolik
kapasitelere sahip mikrobiyal gruplar arasndaki etkileimin belirlenmesi ve dengede tutulmas,
anaerobik sistem performansnn srekliliinin salanmasnda byk nem arz etmektedir.
Biyoktlenin incelenmesinde kullanlan kltre dayal yntemler, atksu artma sistemlerinde
mevcut zengin mikrobiyal eitlilik sebebiyle yaygn olarak kullanlamamaktadr. Polimeraz
Zincir Reaksiyonu (PCR)na dayal, kltrden bamsz bir molekler yntem olan denatran
gradyan jel elektroforezi (DGGE), mikrobiyal ekolojide, farkl nkleotid dizilimlerine sahip 16S
rDNA genlerinin elektroforetik olarak ayrlmas amacyla kullanlmaktadr. DGGE sonucu
oluan her bant, numunede bulunan bir tr temsil etmekte ve o numuneye zg parmak izini
vermektedir. DGGE ile birok numunenin ayn anda analiz edilebilmesi ve hzl sonu
alnabilmesi sebebiyle zellikle biyoreaktr ve ekosistem gibi zengin biyoeitlilie sahip
ortamlarn incelenmesinde yaygnlaan bir yntemdir (Muyzer ve Smalla, 1998).
Bu almada, kt endstrisi atksularn artan gerek lekli bir anaerobik kontak reaktrn 3
farkl kademesinden (aadan yukar doru 4 m, 8 m ve 12 m) 2 farkl zamanda alnan amur
numunelerinin arkeyal ve bakteriyel komnite yaplar DGGE yntemi ile karlatrlmtr.
DGGE sonular, daha nceki bir almada, SRB ve metanojenik Arke poplasyonlarnn
kompozisyonlarnn, miktarlarnn, ve aktivitelerinin belirlenmesi amacyla uygulanan FISH ve
spesifik metan aktivite (SMA) testi sonular ile karlatrmal olarak deerlendirilmitir.
2. Malzemeler ve Yntem
2.1. Anaerobik Kontak Reaktrn zellikleri
ekil 1de Kt endstrisine ait iki kademeli anaerobik-aerobik biyolojik atksu artma tesisinin
akm emas verilmitir. Tesis, iki kademeli anaerobik-aerobik biyolojik artma sistemine
sahiptir. Anaerobik kontak reaktrn toplam hacmi 10.000 m
3
ve toplam ykseklii 16 mdir.
Atksu girii anaerobik kontak reaktre alttan besleme ile yaplmaktadr. Reaktrdeki scaklk ve
pH srasyla 34-37
0
C ve 6.4-7.5 deerlerinde tutulmaktadr. Alkalinite, 1300-1500 mg l
-1
CaCO
3
, COD:N:P oran 176:5:1, hidrolik bekletme sresi (HBS) 4 gndr.

Kt Endstrisi Atksularn Artan Gerek lekli Anaerobik Kontak Reaktrdeki Mikrobiyal
eitliliin Denatran Gradyan Jel Elektroforezi (DGGE) ile Belirlenmesi
385




ekil 1. Kt endstrisi atksu artma tesisi ak diyagram
2.2. Atksu zellikleri
Kt endstrisi atksu artma tesisine beyaz ve siyah likr olmak zere iki farkl ierikte atksu
gelmektedir. Kt makinelerinden kaynaklanan beyaz likr, 73007900 mg/l aralnda KO
deerine sahiptir. Tesisten 2000 m
3
/gn debiyle kan beyaz likr n ktrmeye maruz
braklmaktadr. Saman kaynakl siyah likrn KO deeri 11700 13300 mg/l aralnda
deimektedir. Siyah likr, 500 m
3
/gn debi ile kmakta ve n ktrmeye tabi
tutulmamaktadr. Dengeleme tanknda kartrlan beyaz ve siyah likrler, 2500 m
3
gn
-1
debi,
8200-9000 mg l
-1
KO, 850-950 mg l
-1
SO
4
2-
ve pH 5.6-6.6 ile anaerobik reaktre verilmektedir.
2.3. Genomik DNA Ekstraksiyonu ve 16S rRNA Genlerinin PCR ile oaltlmas
DNA ekstraksiyonu iin reaktrn 4 m, 8 m and 12 m yksekliklerinden 2 farkl zamanda (3
Temmuz 2005 ve 21 Austos 2005) paralel numune alnm ve -20
0
Cde saklanmtr.
Numune alma tarihleri arasnda iki hafta boyunca reaktr bakm amacyla altrlmamtr.
FastDNA Spin Kit for Soil (Qbiogene Inc., ngiltere) ekstraksiyon kitinin nerdii protokole
uygun olarak 0,2 ml amur numunesinden genomik DNA kartlmtr. kartlan genomik
DNAdan Arke ve Bakterilere zg 16S rDNAlar PCR ile oaltlmtr.
PCRda kullanlan primerler ve balanma scaklklar Tablo 1de verilmitir. Duyarll ve
zgll arttrmak amacyla, arkeyal rnlerin oaltlmasnda yuvalanm PCR
uygulanmtr. Arkeyal 16S rDNA ilk olarak Arch46f ve Arch1017r primerleri ile oaltlmtr.
oalma, 50 l reaksiyon hacminde 200 ng DNA, 10 pmol primer ifti, 10 mM deoksinkleozit
trifosfat, 1,5 mM MgCl
2
, 5 l 10 Taq tampon zeltisi ve 2U Taq DNA polimeraz (Fermentas,
Letonya) olacak ekilde gereklemitir.
Yuvalanm PCRn ikinci aamasnda, ilk turda elde edilen PCR rnleri kalp olarak
kullanm ve arkeyal 16S rDNAnn V3 blgesini hedefleyen Arch344f-Univ522r primer ifti
ile oaltlmtr. Dier PCR bileenlerinde herhangi bir deiiklik yaplmamtr. PCR
amplifikasyonu, Techne TC-412 (Barloworld Scientific Ltd., ngiltere) marka PCR
makinesinde, ilk denatrasyon 94Cde 5 dak olmak zere 30 dng denatrasyon 94Cde 1
dk, balanma 1 dk, uzama 72Cde 1 dk ve son uzama 72Cde 10 dk olacak ekilde
gerekletirilmitir. PCR rnleri, %1 (w/v) agaroz jelin 1 TrisasetatEDTA tampon
Biyogaz

Siyah
Likr
Buhar
retimi
Beyaz
Likr
n
ktrme
Anaerobik
Reaktr
Lamella
Durultucu
Aerobik
Reaktr
Aerobik
Durultucu
Havalandrmal
Lagn
Dearj
386 . elikkol, B.K. nce, M. Kolukrk ve di.


zeltisinde (40 mM Tris, 20 mM asetik asit, 1 mM EDTA; pH 8.0), 7 V cm
-1
de elektroforez
(Thermo-Scientific Ltd., ngiltere) sisteminde yrtlmtr. Etidyum bromr ile boyanm
agaroz jel grntleri Chemi-Smart 3000 jel dkmantasyon sistemi (Vilber Lourmat, Fransa)
kullanlarak kaydedilmitir.
Tablo 6. PCR amplifikasyonunda kullanlan primerler
Primer Hedef Deney aamas Balanma
(C)
Konum
1
Kaynak
Bact341f_GC
2
Bakteriyel
16S rDNA
DGGE 55 341-357 Muyzer ve di., 1993
Bact534r 534-518
Arch46f
Arkeyal
16S rDNA
Yuvalanm
PCRn ilk
aamas
40
46-61 vreas ve di., 1997
Arch1017r 1017-999 Barns ve di., 1994
Arch344f_GC
2

DGGE 53
344-358 Raskin ve di., 1994
Univ522r 522-504 Amann ve di., 1995
1
Escherichia coli numaralama sistemi.
2
Arch344f ve Bact341fe ait 5-GC kuyruklar
(GCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACGGGG).
2.4. Denatran Gradyan Jel Elektroforezi (DGGE)
Arke ve Bakterilere ait komnite profilleri, Arch344f_GC-Univ522r ve Bact341f_GC-Bact534r
primerleri (Muyzer ve di.,1993) kullanlarak oaltlan PCR rnlerinin DGGE analizleri
yaplarak elde edilmitir. 10 l PCR rn, ykleme boyas (distile suda %0,25 bromofenol
mavisi, %0,25 ksilen siyanol FF, %15 Ficoll) ile kartrlarak %10 poliakrilamid jelde
(akrilamidN,N'-metilenbisakrilamid oran 37,5:1) 1x TAE tampon zeltisi iinde (40 mM
Tris, 20 mM asetik asit, 1 mM EDTA; pH 8.0) yrtlmtr. Akrilamid jelde re ve formamid
kullanlarak %30-60 denatran edeeri kimyasal gradyan oluturulmutur (100% denatran 7
M re ve %40 (v/v) formamid iermektedir). Jellerin normalizasyonunu salamak amacyla
arkeyal ve bakteriyel klon ktphanelerinden elde edilmi 16S rDNA karmndan oluan bir
iaretleyici, jelin bana ve sonuna yklenmitir. Elektroforez, D-Code sistemi kullanlarak
(Bio-Rad Laboratories Ltd., ngiltere) 200 V sabit akmda 60Cde 4,5 saat boyunca devam
etmitir. Akrilamid jeller SybrGold (1:10000 seyrelti; Molecular Probes Inc., ngiltere) ile
boyandktan sonra Chemi-Smart 3000 jel dkmantasyon sistemi (Vilber Lourmat, Fransa)
kullanlarak grntlenmitir.
Jel grntleri, Bionumerics 5.0 (Applied Maths, Kortrijk, Belika) program kullanlarak
analiz edilmitir. Bantlar arasndaki benzerlikler (varlk - yokluk ve bant iddeti) Dice katsays
(S
D
) kullanlarak hesaplanmtr. Dice katsays kullanlarak yaplan analizlerde bant konum
tolerans %0,7 olarak uygulanmtr.
3. Sonular ve Deerlendirme
3.1. Anaerobik Kontak Reaktrn Performans
Anaerobik kontak reaktrnn 1.6-1.8 kg KO/m
3
.gn aralnda deien organik ykleme
hznda (OYH) 5 aylk izleme periyodundaki performansndan %47-%55 aralnda deien
KO giderim veriminin ve 0,18 0,20 m
3
CH
4
/kgKO
giderilen
aralndaki metan veriminin
saland grlmektedir. KO giderim verimi, literatrde kt endstrisi atksularn artan
anaerobik kontak reaktrler iin verilen deer aralnn (%40-80) alt snr iinde kalmakla
birlikte (Savant ve di., 2005; Rintala ve di.,1999) metan verimi, kt endstrisi atksularn
artan anaerobik reaktrler iin literatrde verilen deerlerin (0.08-0.16 m
3
CH
4
/kgKO
giderilen
)
Kt Endstrisi Atksularn Artan Gerek lekli Anaerobik Kontak Reaktrdeki Mikrobiyal
eitliliin Denatran Gradyan Jel Elektroforezi (DGGE) ile Belirlenmesi
387


stndedir (Savant ve di., 2005; Rintala ve di., 1999). Anaerobik reaktre uygulanan OYH
aralnn, literatrde kt endstrisi atksularn artan anaerobik kontak reaktrler iin verilen
deer aralnn (0.5-5 kg KO/m
3
.gn) alt snr iinde kalmaktadr (Savant ve di., 2005;
Rintala ve di.,1999). HBS, literatrdeki uygulamalarda 0.5-5 gn aralnda tanmlanmtr
(Savant ve di., 2005; Rintala ve di.,1999). Kontak reaktrn altrld 4 gnlk HBS
literatrdeki baarl uygulamalar iin verilen deer aralndadr. Reaktrde scaklk, pH ve
KO/N/P oran srasyla 34-37
0
C, 6.4-7.5 ve 176:5:1, optimum deer aralklarnda
tutulmaktadr. 0.15-0.17 gKO/g.UAKM.gn olarak uygulanan F/M oran, anaerobik reaktrlere
uygulanan 0.5-1 gKO/g.UAKM.gn aralndaki tipik F/M oranlarnn olduka altndadr
(Speece, 1996). Anaerobik reaktrlerde, F/M orannnn arttrlmasnn metan aktivitesi (Sponza
ve di., 2002) ve KO giderim verimi zerinde olumlu etkileri olduu daha nce rapor edilmitir
(Sponza ve di., 2002; Ince ve di., 1995; Ince ve di., 2004; Baier ve Delavy, 2005).
3.2. Denatran Gradyan Jel Elektroforezi (DGGE) Sonular
Anaerobik kontak reaktrn 3 farkl yksekliinden iki fakl zamanda alnan numunelere ait
genomik DNAlardan Arke ve Bakterilere zg 16S rDNAlar PCR ile oaltlm ve denatran
jelde yrtlmtr. Arke ve Bakterilere ait jel grntleri ekil 2 ve ekil 3te verilmektedir.
Elde edilen grntler Bionumerics 5.0 yazlm (Applied Maths, Kortrijk, Belika) ile
normalize edilmi, Arke ve Bakteri poplasyonlarna ait soy aalar izilmitir.

ekil 1. Arkeyal soy aac ve DGGE jel grnts (rnek: AA: Austos 4 m; AO: Austos
8 m; A, Austos 12 m; TA: Temmuz 4m; TO, Temmuz 8 m; T: Temmuz 12 m)
ekil 2de verilen Arke poplasyonuna ait soy aac, Temmuz ve Austos aynda alnan
numunelerin %50 benzerlikte olduunu yani iki dnem arasnda komnitede nemli bir
deiiklik olduunu gstermektedir. A ve AO numuneleri %88 benzerlikte kmelenirken AA
numunesi A ve AOya %85.7 benzerlikte kmelenmitir. Temmuz aynda da T ve TO
numuneleri %92.3 benzerlik gstermekte, TA numunesi TO ve Tye %91.7 benzerlikte
kmelenmektedir. Deien benzerlik oranlar, hem reaktr ykseklii boyunca hem de numune
alma dnemleri arasnda mikrobiyal komnitede farkllamalar olduunu gstermektedir.
Arkeyal DGGE jelinde tespit edilen 31 farkl bandn varl, reaktrden alnan numunelerde 31
farkl trn olduunu gstermektedir. Bionumerics analizi sonucunda, Temmuz aynda
rastlanan 3 farkl tre Austos aynda rastlanmad, buna karlk, Temmuz aynda tespit
edilemeyen 6 farkl trn Austos aynda tespit edilebildii grlmtr.
ekil 3te Bakteri poplasyonuna ait soy aac, Temmuz ve Austos 2005te alnan
numunelerin %78.3 benzerlikte olduunu gstermektedir. Bu deiim Arke poplasyonuna
oranla daha az olmakla birlikte iki dnem arasnda bakteriyel komnitede nemli bir deiiklik
Dice (Opt:1.00%) (Tol 0.7%-0.7%) (H>0.0% S>0.0%) [0.0%-100.0%]
DGGE
1
0
0
9
5
9
0
8
5
8
0
7
5
7
0
6
5
6
0
DGGE
G@ModKar@dgge5arc2makale.
G@ModKar@dgge5arc2makale.
G@ModKar@dgge5arc2makale.
G@ModKar@dgge5arc2makale.
G@ModKar@dgge5arc2makale.
G@ModKar@dgge5arc2makale.
100
88.0 100
59.3 85.7 100
50.0 56.0 74.1 100
46.2 51.9 62.1 92.3 100
50.0 56.0 66.7 91.7 84.6 100
A
AO
AA
T
TO
TA
388 . elikkol, B.K. nce, M. Kolukrk ve di.


olduunu gstermektedir. Austos aynda, reaktrn st ve orta ksmlarndan alnan A ve AO
numuneleri %89.2 benzerlik gsterirken alt ksmdan alnan AA numunesi A ve AOya %81.8
benzerlikte kmelenmitir. Temmuz ay rneklerinde ise alt ve st seviyelerden alnan TA ve
T numuneleri %90.7 benzerlik gstermekte, orta seviyeden alnan TO numunesi TA ve T ile
%86.5 benzerlikte kmelenmektedir. Arkeyal komnitede olduu gibi bakteriyel komnite
yapsnda da reaktr boyunca ve numune alma zamanlar arasnda farkllklar gzlenmitir.
Bakteriyel DGGE jelinde toplam 57 farkl tr temsil eden 57 farkl bant tespit edilmitir.
Temmuz aynda rastlanan 10 farkl tre Austos aynda rastlanmam, buna karlk, Austos
aynda 10 farkl tr tespit edilmitir. Bant saylar karlatrldnda, Bakteri poplasyonundaki
eitliliin Arke poplasyonundaki eitlilikten daha fazla olduu grlmektedir. Bununla
birlikte, Austos 2005te Bakteri poplasyonunda tespit edilemeyen tr saysnn Arke
poplasyonunda tespit edilemeyen tr saysndan fazla olmas, bakteriyel trlerin deien
iletme koullarna daha duyarl olduu sonucuna varlabilir. Benzer sonular daha nceki
almalarda da elde edilmitir (Buzzini ve di., 2006).

ekil 2. Bakteriyel soy aac ve DGGE jel grnts (rnek: AA: Austos 4 m; AO:
Austos 8 m; A, Austos 12 m; TA: Temmuz 4m; TO: Temmuz 8 m; T: Temmuz 12 m)
nce ve di. (2007)ne ait nceki bir almada, anaerobik kontak reaktre ait numunelerde
potansiyel metan retim (PM) hzlar Temmuz numuneleri iin 280 ml CH
4
/g UAKM.gn,
Austos numuneleri iin ortalama 160 ml CH
4
/g UAKM.gn olarak bulunmutur. Ayn
rneklerde, FISH uygulanarak elde edilen hcre saymlar, numune alma ykseklii arttka
amurun PM hznn ve asetoklastik metanojenlerin toplam komnite ierisindeki miktarnn
paralel olarak azaldn gstermektedir (nce ve di., 2007). Buna bal olarak, Temmuz aynda
reaktrde bulunup Austos aynda kaybolan trlerin yksek metan retim potansiyeline sahip
olduu sylenebilir. Benzer ekilde, Temmuz aynda reaktrde olmayp Austos aynda
gzlenen trler dk aktiviteyle ilgili trler olabilir.
Bu almada, SMA testi ve FISH teknii ile tespit edilen mikrobiyal komnite deiimi DGGE
yntemi kullanlarak dorulanmtr. DGGE yntemi, yksek ve dk aktiviteye sahip
mikrobiyal komnitelerin karlatrlmasna olanak salamtr. FISH yntemi reaktrde
mevcut aktif mikrobiyal trlerin miktarlar hakknda bilgi vermesine ramen, kompozisyondaki
deiimi tespit etmede yeterli deildir. Bununla birlikte, DGGE yntemi komnite
bileenlerinin saysal deiimini yanstmakta yetersiz kalmaktadr. Bu nedenle anaerobik
reaktrlerin mikrobiyal komnite yaplarnn gerek DGGE gibi detayl kalitatif sonu veren
gerekse FISH gibi mikroskopik sayma dayal sonu veren kltrden bamsz yntemlerle
birlikte allmas gerektii sonucuna varlmtr.
Dice (Opt:1.00%) (Tol 0.7%-0.7%) (H>0.0% S>0.0%) [0.0%-100.0%]
DGGE
1
0
0
9
5
9
0
8
5
8
0
DGGE
G@ModKar@bac9neg-pro.
G@ModKar@bac9neg-pro.
G@ModKar@bac9neg-pro.
G@ModKar@bac9neg-pro.
G@ModKar@bac9neg-pro.
G@ModKar@bac9neg-pro.
100
89.2 100
81.8 86.6 100
78.3 71.4 84.5 100
77.1 78.9 75.0 90.7 100
79.4 75.4 80.0 87.7 86.5 100
A
AO
AA
T
TO
TA
Kt Endstrisi Atksularn Artan Gerek lekli Anaerobik Kontak Reaktrdeki Mikrobiyal
eitliliin Denatran Gradyan Jel Elektroforezi (DGGE) ile Belirlenmesi
389


Bu almann devamnda, arkeyal ve bakteriyel DGGE jellerindeki baskn bantlarn kesilerek
dizi analizlerinin yaplmas, yksek ve dk aktiviteye sahip mikrobiyal komniteye zg
trlerin tespit edilmesine olanak salayacaktr. Ayrca, anaerobik kontak reaktrdeki baskn
trlerin ortaya karlmas, bu trlerin metabolizmalar hakknda bilgi sahibi olunmasn
salayacaktr. Bylece, reaktrn ileyi mekanizmas ksmen zmlenmi olacak ve aktivite
ile ilgili trlerin belirlenmesine olanak tannacaktr.
Teekkr
Orhan nce ve Bahar Kasapgil nce srasyla T Bilimsel Aratrma Projeleri
tarafndan desteklenen 11_04_241 ve 844 ve B Bilimsel Aratrma Projeleri
tarafndan desteklenen 04Y105 ve 02Y103D kodlu projelere teekkr ederler. Ayrca
Modern Karton A.. ve Arbiogaz evre Teknolojileri A..ye gsterdikleri ibirlii iin
teekkr ederiz.
Kaynaklar
Amann, R.I., Ludwig, W., Schleifer, K.H. (1995). Phylogenetic identification and in situ detection of individual
microbial cells without cultivation. Microbiol. Rev. 59,143169.
Baier, U. ve Delavy, P. (2005). UASB treatment of liquid residues from grass bioraffination. Water Sci.&Tech., 52,
405-411.
Barns, S.M., Fundyga R.E., Jefferies MW. (1994). Remarkable archaeal diversity detected in a Yellowstone-national-
park hot-spring environment. Proc. Natl. Acad. Sci USA, 91, 1609-1613.
Buzzini, A.P., Sakamoto, I.K., Varesche, M.B. and Pires, E.C. (2006). Evaluation of the microbial diversity in an
UASB reactor treating wastewater from an unbleached pulp plant. Process Biochemistry, 41, 168176.
Gilbride, K.A., Lee, D.-Y. and Beaudette, L.A., (2006). Review: Molecular techniques in wastewater: Understanding
microbial communities, detecting pathogens, and real-time process control. Journal of Microbiological Methods,
66, 120.
Ince, O., Andersen G.K., Kasapgil, B. (1995). Control of organic loading rate using the specific methanogenic
activity test during start-up of an anaerobic digestion system. Water Research, 29 (1), 345-355.
Ince, O., Kolukirik, M., Ayman Oz, N., Kasapgil Ince, B. (2004). Comparative evaluation of full-scale UASB
reactors treating alcohol distillery wastewaters in terms of perfprmance and methanogenic activity. Journal of
Chemical Technology and Biotechnology, 80 (2), 138-144.
Ince, O., Kolukirik, M., Cetecioglu, Z., Eyice, O., Tamerler, C., Kasapgil Ince, B. (2007). Methanogenic and sulphate
reducing bacterial population levels in a full-scale anaerobic reactor treating pulp and paper industry wastewater
using fluorescence in situ hybridisation. Water Sci Technol. 55 (10),183-191.
Muyzer, G. ve Smalla, K. (1998). Application of denaturing gradient gel electrophoresis (DGGE) and temperature
gradient gel electrophoresis (TGGE) in microbial ecology. Antonie van Leeuwenhoek, 73, 127141.
Muyzer, G., De Waal, E.C. and Uitierlinden, A.G. (1993). Profiling of complex microbial populations by denaturing
gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied
and Environmental Microbiology, 59 (3), 695-700.
vres, L., Forney, L., Daae, F.L., Torsvik, V. 1997. Distribution of bacterioplankton in meromictic lake
Saelenvannet as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding
for 16S rRNA. Appl. Environ. Microbiol. 63, 33673373.
Raskin L., Stromley J.M., Rittmann B.E., Stahl D.A. (1994). Group-specific 16S rRNA hybridization probes to
describe natural communities of methanogens. Appl. Env. Microbiol,. 60, 1232-1240.
Rincn B., Raposo, F., Borja, R., Gonzalez, J.M., Portillo, M.C., and Saiz-Jimenez, C. (2006). Performance and
microbial communities of a continuous stirred tank anaerobic reactor treating two-phases olive mill solid wastes
at low organic loading rates. Journal of Biotechnology, 121 (4), 534-543.
390 . elikkol, B.K. nce, M. Kolukrk ve di.


Rintala, J.A., Jain, V.K., Kettunen, R.H. (1999). Comparative status of the world-wide commercially available
anaerobic technologies adopted for biomethanation of pulp and paper mills effluents, 4
th
International
Exhibition&Conference on Pulp&Paper Industry, Hindistan, Szl sunum.
Roest, K., Heilig, H.G.H.J., Smidt, H., de Vos, W.M., Stams, A.J.M., and Akkermans, A.D.L. (2005). Community
analysis of a full-scale anaerobic bioreactor treating paper mill wastewater. Systematic and Applied Microbiology,
28, 175185.
Savant, D.V., Abdul-Rahman, R. ve Ranade, D.R., 2006. Anaerobic degradation of adsorbable organic halides
(AOX) from pulp and paper industry wastewater. Bioresource Technology, 97 (9), 1092-1104.
Speece, R.E. (1996). Anaerobic Biotechnology for Industrial Wastewaters. Archae Press, Nashville, TN.
Sponza, D. T. (2002). Tetrachloroethylene (TCE) removal during anaerobic granulation in an upflow anaerobic
sludge blanket (UASB) reactor. Journal of Environmental Science and Health. Part A, Toxic/Hazardous
Substances & Environmental Engineering, 37, 213-236
Stams, A.J.M, Elferink, S.J.W.H.O., Westerman, P. (2003). Metabolic interactions between methanogenic consortia
and anaerobic respiring bacteria. Adv. in Biochem. Eng., 81, 31-56.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Bira Atksuyunun Anaerobik Artmnda Asetoklastik
Metanojenik Aktivite ve Kantitatif Metan Arkeyal Deiimleri
B. Kasapgil nce
1
, Leyla imek, Nilgn z
1
, Erkin Gzdereliler
1
, Afar lgen
2
ve Orhan
nce
3

1
Bogazii niversitesi, evre Bilimleri Enstits, 34342, Bebek, stanbul, Trkiye
E-posta: bahar.ince@boun.edu.tr
2
TUBORG Bira ve Malt San A.., zmir, Trkiye
3
stanbul Teknik niversitesi, evre Mhendislii Blm, 34469, stanbul, Trkiye

z Bu almada bira atksularn artan gerek lekli geniletilmi bir anaerobik amur yata
reaktrnden (EGSB) 3 aylk dnemde alnan amur numunelerinin, asetoklastik metan retim
kapasitesi spesifik metan aktivite (SMA) test dzenei ile, sistemde bulunan metanojenlerin tr
ve saylar ise floresanl yerinde hibritleme (FISH) teknii kullanlarak tespit edilmitir. 2005-
2007 yllar arasnda, EGSB reaktrnn 15 kgKO/m
3
.gn organik ykleme hznda (OYH)
ortalama KO giderim verimi %80-90 aralnda deimitir. Yrtlen SMA testleri sonucunda
EGSB reaktr amurunun maksimum asetoklastik metan aktivitesi 457 mlCH
4
/gUAKM.gn
olarak bulunmutur. FISH sonular, EGSB reaktr amurundaki toplam poplasyonun yaklak
%43-46sn arkeyal poplasyonun oluturduunu gstermitir. Bu dnemdeki arkeyal
poplasyonun srasyla %37 ve %18lik ksmn Methanosaeta trleri ve Methanosarcina trleri
oluturmaktadr. Toplam poplasyon iinde asetoklastik metanojenlerin oranlarnda bir azalma
gzlemlenirken hidrojenotrofik metanojenlerin saysnda art meydana gelmitir.
Anahtar Kelimeler bira atksuyu; floresanl yerinde hibritleme teknii; geniletilmi
anaerobik amur yata reaktr; spesifik metanojenik aktivite
1. Giri
Anaerobik artma sistemleri, iki endstrisi atksular gibi yksek organik kirletici ieren
atksularn artmnda geni bir uygulama alan bulmutur. Alkoll iki endstrisinde su ve
atksu ynetimi evresel ve ekonomik adan nemli problemlere yol amaktadr. Bu tipteki
atksularn artmnda akkan yatakl biyoreaktrler (Ochieng ve di., 2002), yukar akl
anaerobik amur yata (UASB) reaktr (Parawira ve di., 2005) ve anaerobik filtreler (Leal
ve di., 1998) sklkla kullanlmaktadr. Son yllarda, anaerobik granler amur yata (EGSB)
reaktrleri, iki endstrisi atksularnn artmnda tercih edilmektedirler (Zoutberg ve di.,
1996). Bu tipteki reaktrler, atksuyun daha yksek bir yukar ak hz ile granler amur
yatandan gemesine olanak tanyan UASB reaktr trevleridir (Zoutberg ve Frankin, 1996).
Yksek ak hz, k suyu resirklasyonunu salayarak veya ykseklik/ap orann byk
tutmak suretiyle (ya da her ikisi birlikte kullanlarak) salanmaktadr. Bylece granler amur
yatann genilemesi ve atksu-amur temasnn artmas mmkn olmaktadr. Granl amurun
boyutu, aktivitesi ve mikrobiyal yaps EGSB reaktrlerin performans ve stabilitesinde nemli
bir rol oynamaktadr (Seghezzo, 1997).
Reaktr performans genellikle KO, BO, gaz verimi ve kompozisyonu, uucu ya asitleri, pH,
alkanite vb. gibi klasik parametrelerle izlenmektedir. Ancak bu parametreler sistemin sadece o
392 B. nce, L. imek, N. z ve di.


anki durumu hakknda bilgi vermektedirler. Anaerobik artma sistemlerinin iletilmesi srasnda
yklemeler belli bir temele dayandrlmadan, bir baka deyile metan arkelerinin potansiyel
metan retim kapasitesi hesaplanmadan uygulandndan dolay sistemlerde stabilite sorunu
yaanabilmektedir. Bu nedenle bu tip reaktrlerde, anaerobik granler amurun aktivitesini ve
biyolojik eitlilii belirleyerek sistem performans ile ilikilendirmek bu sistemlerden daha
etkin verim salamak asndan nem tamaktadr. Anaerobik amurun asetoklastik metan
kapasitesini lmek iin kullanlan SMA testi, iletme srasnda olumsuz iletme artlar
nedeniyle asetoklastik metanojenik aktivitede meydana gelen deiimleri belirlenmesinde,
sistem performansnn artrlmasnda ve sistem stabilitesinin srekliliinin salanmasnda bir
kontrol parametresi olarak kullanlabilmektedir (nce ve di., 2005). Ayrca, biyolojik
sistemlerde mikrobiyal trlerin dalmn ve kompozisyonunu etkileyen faktrlerin
belirlenmesi ile bu sistemlerin daha iyi anlalmas mmkn olabilir. Bu nedenle son
zamanlarda artma kapasitesi ile biyolojik artma tesislerinde etkin olan trlerin etkileimlerinin
belirlenmesi nem kazanmtr (Curtis ve di., 2003). Anaerobik reaktrlerdeki mikrobiyal
poplasyonlar tam olarak aklayabilmek ve biyoreaktrlerde mevcut olan kompleks bakteriyal
ve arkeyal poplasyonlar hakknda detayl bilgi edinmek iin nkleik asit problaryla floresanl
yerinde hibritleme (FISH) gibi rRNA bazl teknikler dier genetik analizlerle birlikte nemli
bir yer tutmaktadr. FISH tekniinin avantajlar arasnda rRNA hedefli nkleik asit problarnn
metabolik olarak aktif hcrelerin tanmlanmas, nemli poplasyonlarn morfolojilerinin
belirlenmesi, filogenetik olarak tanmlanmas ve kantitatif analizlerinin yaplmasna olanak
salamas saylabilir. (Amann ve di., 1990).
Bu almada iki atksularn artan bir EGSB reaktrnden Nisan, Mays ve Haziran 2007
tarihlerinde alnan numunelerin metanojenik aktiviteleri spesifik metan aktivite (SMA) testi ile
belirlenmitir. Mikrobiyal poplasyon dinamikleri, floresanl yerinde hibritleme (FISH) teknii
kullanlarak belirlenmitir. Ayrca, EGSB reaktrnn arkeyal kompozisyonlar ile ilikili olan
performans ve metanojenik aktivite verileri numune alma dnemi boyunca tartlmtr.
2. Materyal ve Metod
2.1. Anaerobik Granler amur Yata (EGSB) Reaktrnn zellikleri
Bira atksuyu iki aamal biyolojik anaerobik-aerobik artma tabii tutulmaktadr. Anaerobik
artma safhasnda kullanlan gerek lekli EGSB reaktrnn toplam hacmi 2280 m
3
tr.
Anaerobik reaktrn ap 14 m. ve toplam ykseklii 15.5 mdir. Reaktrn hacimsel ykleme
hz 15 kg KO/ m
3
.gndr.
2.2. Atksu zellikleri
Bira yapmnda, ncelikle malt tlr ve su ile kartrlarak belirli scaklkta kat-sv
karm halinde ra denilen ara rn elde edilir. ra szlerek, kaynatma ilemine tabi tutulur.
Kaynatma ileminde biraya karakteristik olarak aclk ve aromatik tad zelliini veren
erbetiotu ilavesi yaplarak, 8C' ye soutulup maya eklenir. Fermentasyon tanklarna alnan
bira, bu ilemden sonra soukta dinlendirilerek zel filtrelerden geirilerek ie ve flara
doldurulur. Bira atksularnn kimyasal zellikleri Tablo 1de verilmitir.



Bira Atksuyunun Anaerobik Artmnda Asetoklastik Metanojenik Aktivite ve Kantitatif Metan Arkeyal
Deiimleri
393


Tablo 1. Bira atksularnn kimyasal zellikleri
Parametre Konsantrasyon (mg/l)
KO 5500-10500
BO
5
3000-4000
Toplam-N 100-130
Toplam-P 28-47
pH* 5-7
* birimsiz
2.3. Analitik Metodlar
Anaerobik EGSB reaktrnn iletilmesi srasnda scaklk, pH, KO, AKM ve metan retimi
gibi parametreler izlenmitir. Reaktrden alnan amur numunelerinde toplam kat madde
(TKM), toplam uucu kat madde (TUKM), SMA testlerinde ise AKM, uucu askda kat
madde (UAKM) konsantrasyonlar belirlenmitir. Gaz kompozisyonlar HP 6850 model termal
kondaktivite detektrl bir gaz kromotograf (HP Plot Kolon 30 m x 0,53 mm) cihaz
kullanlarak belirlenmitir. Yrtlen deneyler Standart Metoda gre yaplmtr (APHA, 1997).


2.4. Spesifik Metan Aktivite Test Dzenei
Bu almada asetoklastik metan aktivitesini belirleyebilmek iin Spesifik Metan Aktivite
(SMA) test dzenei kullanlmtr (Monteggia, 1991; Ince 1995). SMA testi 8 adet 2 litre
hacimli anaerobik reaktrlerden olumaktadr. Bu anaerobik reaktrler scakl otomatik olarak
kontrol edilen manyetik kartrcl bir su banyosunun ierisine yerletirilmitir. SMA test
dzeneinin detayl anlatm, deneysel prosedr ve hesaplama yntemi daha nce yaynlanan
makalelerde verilmitir (nce ve di, 1995, nce ve di. 2005). Her bir SMA test sonucu 3 kez
tekrar edilerek dorulamas yaplmtr. %5lik sapmalar kabul edilmi, daha byk sapmalarn
olduu testler tekrar edilmitir.
2.5. A amuru ve Besleme zeltisi
SMA testlerinde besleme zeltisi olarak asetat kullanlmtr. Kompleks substratn anaerobik
ayrmas srasnda oluan metan gaznn yaklak %72si asetik asitten gelmektedir (de Zeeuw,
1984). Aktivite testlerinde maksimum aktivitenin gerekletii konsantrasyonu belirlemek iin
eitli asetat konsantrasyonlar denenmi ve maksimum aktivitenin gzlendii konstrasyon
deeri 2000 mg/l asetat olarak bulunmutur. Gerek lekli EGSB reaktrn en alt seviyesinden
3 farkl zamanda alnan amur numunelerinin UAKM konsantrasyonu 2000 mg/l olacak ekilde
mineral stok solsyon (nce vd. 1994) ile seyreltilmitir.
2.6. Floresanl Yerinde Hibritleme (FISH)
Numuneler alnr alnmaz %100luk etanol (1:1, v/v) eklenerek laboratuvara +4Cde souk
zincirle getirilmi ve -20Cde saklanmtr. Kullanlan deney prosedr, problar, hedef gruplar
ve prob dizilimleri daha nce yaynlanan bir makalede verilmitir (Kolukrk ve di, 2007).





394 B. nce, L. imek, N. z ve di.


3. Sonular ve Deerlendirme
3.1. Gerek lekli Anerobik EGSB Reaktrnn Performans
15 kg KO m
-3
gn
-1
organik ykleme hznda iletilen anaerobik EGSB reaktrnn, numune
alma dnemlerindeki ortalama KO giderimi %75 olarak belirlenmitir. Daha nceki
almalarda iki atksularn artan anaerobik EGSB reaktrlerinin 10-20 kg KO m
-3
gn
-1

organik ykleme hznda (OYH) yaklak %90-98 KO giderim verimleri ile etkili bir ekilde
iletildikleri rapor edilmitir (Zoutberg ve di., 1996). ekil 1den grld gibi anaerobik
EGSB reaktrnde 2005-2006 yllar arasnda stabil bir sistem performans gzlemlenmitir. Bu
dnemde iki aamal anaerobik-aerobik artma tesisinin k KOleri 80-100 mg/l arasnda
deiim gstermitir. Ancak Eyll 2006 tarihinden sonra anaerobik reaktr performans
bozulmutur. ekil 1den grld zere Kasm 2006 ve Haziran 2007 arasnda anaerobik
EGSB reaktr, performans ve stabilitesini korumada eitli problemlerle karlamtr.

ekil 1. ki aamal anaerobik-aerobik biyolojik artma tesisi k KO
konsantrasyonlar
3.2. Metanojenik Aktivite Test Sonular
3 aylk numune alma dnemi boyunca EGSB reaktrnn alt seviyesinden alnan anaerobik
granler amurun potansiyel metan retim (PM) kapasitesi ve optimum iletme koullar SMA
testleri ile belirlenmitir. Maksimum asetoklastik metan aktivitesi 457 ml CH
4
/g UAKM.gn
(2000 mg/l asetat) olarak Nisan numunesinde bulunmutur. Literatrde %100 asetoklastik
metanojenlerle yaplan saf kltr almalarnda PM deeri maksimum 1000 ml
CH
4
/gUAKM.gn verilmitir (Valcke and Verstraete, 1983). Bu nedenle, EGSB reaktrndeki
anaerobik biyolojik amurun yaklak olarak %46snn asetoklatik metanojenlerden olutuu
sylenebilir. ekil 2den grld zere 3 aylk alma srecinde anaerobik amurun PM
kapasitesinde nemli olmayan fakat takip edilmesi gereken dler gzlenmitir (ekil 2).
Literatrde, 300 mlCH
4
/gUAKM.gnden yksek PM deerlerine sahip amurlarn iyi
kalitede amur olduklar rapor edilmitir (Ince ve di. 1995, 2005); alkoll iki fabrikasna ait
bir UASB reaktrnden alnan rnekte asetoklastik metan aktivitesi 389 mlCH
4
/gUAKM.gn
(Doan, 2005); laboratuvar lekli bir anaerobik tam karml tank reaktr amurunun
asetoklastik metan aktivitesi 440 ml CH
4
/g UAKM.gn olarak bulunmutur (z ve di., 2004).

0
100
200
300
400
500
O
c
a
.0
6
M
a
r
.
0
6
M
a
y
.
0
6
T
e
m
.
0
6
E
y
l
.
0
6
K
a
s
.
0
6
O
c
a
.0
7
M
a
r
.
0
7
M
a
y
.
0
7
zaman (ay)
K
O


(
m
g
/
l
)
Bira Atksuyunun Anaerobik Artmnda Asetoklastik Metanojenik Aktivite ve Kantitatif Metan Arkeyal
Deiimleri
395



ekil 2. Aktivite test sonular (asetat)
3.3. FISH Sonular
Anaerobik EGSB reaktrnde etkin olan metan arkeyal trleri FISH teknii ile belirlenmi, elde
edilen sonular Tablo 2de verilmitir. Nisan, Mays ve Haziran numune alma dnemlerinde
Univ1392 oligonkleotid probuyla iaretlenen ve pozitif sinyal veren mikroorganizmalarn oran
srasyla %75%1.3, %86%1.6 ve %90%1.3 olarak belirlenmitir. Bu sonular toplam
mikrobiyal topluluk iindeki aktif mikroorganizmalarn orann vermektedir. Nisan, Mays ve
Haziran 2007de EGSB reaktrden alnan amur numunelerinin srasyla %45.7%0.3,
%43.2%1.1 ve %44%0.6lik ksmn arkeyal poplasyonu oluturmaktadr. Nisan 2007
amur numunesindeki arkeyal poplasyonun %41.3%1.3n Methanosaeta trleri.,
%20.03%0.2sini Methanosarcina trleri., %15.7%0.5ni Methanococcales,
%10.5%%1.1ni Methanobacteriales ve %12%0.5ni Methanogenium akrabalar
oluturmaktadr. Mays 2007 amur numunesinde arkeyal poplasyonun %38.09%1.3n
Methanosaeta trleri., %17.4%0.2sini Methanosarcina trleri., %19.8%0.5ni
Methanococcales, %13.4%%1.1ni Methanobacteriales ve %11.9%0.6ni Methanogenium
akrabalar oluturmaktadr. Haziran 2007 amur numunesinde arkeyal poplasyonun
%32.08%1.3n Methanosaeta trleri., %18.6%0.3sini Methanosarcina trleri.,
%22.3%0.7ni Methanococcales, %13.04%%1.1ni Methanobacteriales ve %13.4%0.8ni
Methanogenium akrabalar oluturmaktadr.
0
100
200
300
400
500
S
M
A

(
m
l
C
H
4
/
g
U
A
K
M
.
g

n
)
Nisan 343 457 445 398
Mays 339 452 440 360
Haziran 350 447 430 330
1000 mg/l asetat 2000 mg/l asetat 3000 mg/l asetat 4000 mg/l asetat
396 B. nce, L. imek, N. z ve di.


Tablo 2. Anaerobik reaktr amurunda FISH saym sonular
Nisan 2007 (%) Mays 2007 (%) Haziran 2007 (%)
Aktif hcreler 751.3 861.6 901.3
Archaea 45.70.3 43.21.1 440.6
Methanosaeta* 41.31.3 38.091.3 32.080.5
Methanosarcina* 20.030.2 17.40.2 18.60.3
Methanobacteriales* 10.051.1 13.41.1 13.041.1
Methanococcales* 15.70.5 19.80.5 22.30.7
Methanogenium* 120.5 11.90.6 13. 40.8
*Arke poplasyonu iindeki oran
UASB ve EGSB tipi anaerobik reaktrlerde metan Arkeleri iinde Methanosaeta trlerinin
saysal olarak baskn olduu daha nceki almalarda rapor edilmitir (Sekiguchi ve di.,
1999); gerek lekli bir UASB reaktr amurunda arkeyal poplasyonun %59%2.6sn
Methanosaeta trleri. ve %40 %2.6sn Methanobacteriales oluturduu rapor edilmitir
(Kolukirik, 2004). u ana kadar tanmlanan metan arkelerinden sadece Methanosaeta ve
Methanosarcina cinslerinin asetat sbstrat olarak kullanabildii bilinmektedir (Zinder, 1993).
Bu iki cinsin anaerobik reaktr amurlarnda ok nemli bir yere sahip olduu daha nceki
almalarda gsterilmitir (de Zeeuw, 1984). Genellikle Methanosaeta trlerinin granl
oluumunu arttrd ve daha stabil bir reaktr performansnn olumasn salad kabul
grmektedir. Methanosarcina trleri, asetatn yannda, metanol, metilamin, hidrojen ve
karbondioksiti substurat olarak kullanabilmektedir. Methanosaeta trlerinin byme hz
Methanosarcina trlerinin byme hzndan ok daha yava olmasna ramen, asetata kar
afinitesi Methanosarcina trlerine gre 5-10 kat daha fazladr (Jetten ve di., 1992).
FISH sonularndan grld gibi, 3 aylk alma srecinde EGSB reaktrnde asetoklastik
metanojenlerin (Methanosaeta trleri) basknl hidrojenotrofik metanojenlere
(Methanococcales ve Methanobacteriales) kayma eilimi gstermitir. Methanococcales
akrabalarnn, Methanobacteriales akrabalarna oranla daha fazla olduu gzlemlenmitir.
Hidrojenotrofik metanojenlerin arasndaki substurat iin rekabetleri, asetoklastik metanojenlerde
olduu kadar allmadndan Methanococcales akrabalarnn basknln aklamak mevcut
bilgiler ile mmkn deildir.
Teekkr
Bahar Kasapgil nce ve Orhan nce srasyla 06Y102D kodlu Boazii niversitesi Bilimsel
Aratrma Projesi ve 106Y241 kodlu TBTAK projesine teekkr eder. Ayrca TUBORG Bira
ve Malt San A.. yetkililerine veri ve numune salamak hususunda gsterdikleri ibirlii iin
teekkr ederiz.
Kaynaklar
Amman, R. I., Binder, B. J., Olson, R. J., Chisholm, S. W., Devereux, R. and Stahl, D. A. (1990). Combination of
16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations.
Applied and Environmental Microbiology, 56:1919-1925.
APHA, AWWA, WPCF, Standard Methods for the Examination of Water and Wastewater, 18
th
ed., American Public
Health Association, Washington, DC 20005, 1997.
de Zeeuw, W. J. (1984). Acclimatization of anaerobic sludge for UASB-reactor start-up. Ph.D. thesis. Agricultural
University of Wageningen, Wageningen, The Netherlands.
Bira Atksuyunun Anaerobik Artmnda Asetoklastik Metanojenik Aktivite ve Kantitatif Metan Arkeyal
Deiimleri
397


Dogan T, Ince O., Oz N.A., Ince B. K. (2005). Inhibition of volatile fatty acid production in granular sludge from a
UASB reactor. Journal of Environmental Science and Health, 40: 633-644.
Ince, O., Anderson, GK and Kasapgil, B. (1995). Control of Organic Loading Rate Using the Specific Methanogenic
Activity Test During Start-Up of an Anaerobic Digestion System. Water Research, 29: 349-355.
Ince O., Kolukrk M, Ayman N., Ince B. (2005). Comparative evaluation of full-scale UASB reactors treating
alcohol distillery wastewaters in terms of performance and methanogenic activity. J Chm Technol Biotechnol.,
80: 138-144.
Jetten, M. S. M., Stams, A. J. M., and Zehnder, A. J. B. (1992). Methanogenesis from acetate: a comparison of the
acetate metabolism in Methanothrix soehngenii and Methanosarcina spp. FEMS Microbiol. Rev. 88:181198.
Kolukrk, M, Ince, O., Ince, B.K. (2007) Methanogenic community change in a full-scale UASB reactor operated at
a low F/M ratio Journal of Environmental Science and Health Part A, 42, 903910.
Leal, K., E. Chacin, E. Behling, E. Gutierez, N. Fernandez and C.F. Forster, (1998). A mesophilic digestion of
brewery wastewater in an unheated anaerobic filter, Bioresource Technology, 65 (12), pp. 5155.
Monteggia, L., (1991). The Use of a Specific Methanogenic Activity Test Controlling Anaerobic Reactors. PhD
Thesis, The University of Newcastle upon Tyne, 1991.
Ochieng, A., T. Ogada, W. Sisenda and P. Wambua, (2002). Brewery wastewater treatment in a fluidised bed
bioreactor, Journal of Hazardous Materials 90 (3,29), pp. 311321.
z, N. A., Ince, O., Ince and B. K. (2004). Effect Of Wastewater Composition On Methanogenic Activity In An
Anaerobic Reactor, Journal of Environmental Science and Health, Part A., 39 (11-12), 2941-53.
Parawira, W., Kudita, I., Nyandoroh and R. Zvauya, M.G. (2005). A study of industrial anaerobic treatment of
opaque beer brewery wastewater in a tropical climate using a full-scale UASB reactor seeded with activated
sludge, Process Biochemistry 40, (2), pp. 593599.
Seghezzo, L. (1997). Kinetics and structure of anaerobic granular sludge from EGSB reactors. MSc thesis,
Wageningen Agricultural University, Wageningen, The Netherlands.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A. and Harada, H. (1999). Fluorescence in situ hybridization
using 16S rRNA-targeted oligonucleotides reveals localization of methanogens and selected uncultured bacteria
in mesophilic and thermophilic sludge granules. Appl. Environ. Microbiol. 65: 12801288.
Valcke D. and Verstraete W. (1983). A Practical Method To Estimate the Acetoclastic Methanogenic Biomass in
Anaerobic Reactors. J. WPCF, 55: 1191-1195.
Zinder, S. H. (1993). Physiological ecology of methanogens, p. 128206. In J. G. Ferry (ed.), Methanogenesis:
ecology, physiology, biochemistry and genetics. Chapman & Hall, New York, N.Y.
Zoutberg, G.R., Frankin, R. (1996). Anaerobic treatment of chemical and brewery wastewater with a new type of
anaerobic reactor: the Biobed EGSB reactor. Water Science and Technology, 34 (5-6), 375381.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Gerek lekli Anaerobik Biyolojik Atksu Artma Tesisinde
Arke Topluluu 16S rRNA Sekanslarnn SSCP ile
Deerlendirilmesi
N. Altnay Perendeci
1
, F. Yeim Ekinci
2
, Jean Jaques Godon
3
1
Akdeniz niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 07058 Antalya
E-posta: aperendeci@akdeniz.edu.tr
2
Yeditepe niversitesi, Mh. ve Mimarlk Fakltesi, Gda Mhendislii Blm, 34755 stanbul
3
INRA, Laboratoire de Biotechnologie de lenvironnement (LBE), Avenue des Etangs 11100
Narbonne

z Bu almada; eker retimi aamasnda oluan atksularn artld gerek lekli anaerobik
kontakt prosesten alnan anaerobik amur numunelerinde Arke topluluunun deiim profili
16S rRNA analizleri ve SSCP teknii kullanlarak belirlenmi ve Arkeal topluluk stabilitesi
anaerobik artm sistem performans stabilitesi ile birlikte deerlendirilmitir. Anaerobik kontakt
proses 0.17 3.35 kgKOI/m
3
.gn aralnda, ortalama 1.82 kg KOI/m
3
.gn organik ykleme
hz ile altrlm ve sistemden % 96 KOI giderim verimi elde edilmitir. Hidroliz tank,
anaerobik tank ve plakal dekantrden alnan amur numunelerindeki Arke SSCP profillerine ait
temel bileen analizi (PCA) % 92.39luk bir deiimle aklanmtr. Elde edilen sonu
anaerobik tankn Arke profili asndan kararlln ortaya koymaktadr. Ayrca, her tanktan
alnan numunelerdeki Arke profilleri PCA analizine gre genel anlamda iki farkl kmelenme
sergilemitir. zellikle anaerobik tank ile plakal dekantrden alnan numuneler ayn bileen
kmesinde toplanrken, hidroliz tankndan alnan numuneler ayr bir bileen kmesinde
toplanmtr. Bu durum hidroliz ve anaerobik tankn proses koullarna uygun olarak
altrldn ve faz ayrm asndan fonksiyonel olduklarn dorulamaktadr.
Anahtar Kelimeler anaerobik artm; arkeal topluluk; molekler tanmlama; sistem performans
1. Giri
eker fabrikalarndan dearj edilen atksularn, alc ortamda termal kirlenmeye, dipte sediment
birikimine sebep olarak alc ortamn hidrolik koullarnn bozulmasna ve kirletilmi
ortamlarda mikrobiyolojik aktivite sonucu organik maddelerin znm oksijeni tketerek
canl yaamnn tehlikeye girmesine neden olduu bildirilmitir (engl, 1991). Artlmam
eker fabrikas atksuyu tipik olarak 4000-7000 mg/L Biyolojik Oksijen htiyac (BO
5
), 10000
mg/Lden yksek Kimyasal Oksijen htiyac (KO), 5000 mg/Lden yksek Askda Kat Madde
(AKM), ve yksek miktarda amonyum azotu iermektedir (Worldbank Guideline, 2007).
Yksek organik yke sahip olan bu atksularn alc ortama dearj edilmeden nce artlmalar
gerekmektedir.
Atksularn artmnda kullanlan eski proseslerden biri olan anaerobik paralanma (AP), metan
gaz retimi nedeniyle enerji verimli ve fiyat avantajl bir prosestir. Anaerobik paralanma,
bakteriyel populasyonlar arasnda sinerjik ilikiye dayanan ve reaktr iletimi ile fiziko-
kimyasal koullardan etkilenen non-linear bir proses olarak kabul edilmektedir. Anaerobik
400 N. A. Perendeci, F. Y. Ekinci, J. J. Godon


ekosistemde bulunan populasyonlar genellikle fermantatif, asidojenik, asetojenik ve
metanojenik olmak zere drt tropik grupta incelenmektedir. Biyolojik dnm
gerekletiren anaerobik mikroorganizmalarn tr ve cins zelliklerinin bilinmesi, populasyon
dinamiklerinin tespit edilmesi, sistem ve artm performansna ynelik dier verilerle
desteklenmesi atksu artm tesisi performansnn toplam olarak deerlendirilmesinde nem
tamaktadr.
eitlilik almalar iin anaerobik reaktrlerden Arkelerin izolasyonunda kullanlan kltr
temelli almalarn snrlamalarndan dolay bu organizmalar hakkndaki bilgiler snrl
kalmtr. Ancak gnmzde 16S ribozomal ribo nkleik asit (16S rRNA) klonlama analizleri
kullanlarak anaerobik reaktrlerde bulunan birok metanojenik Arke, sintrofik, slfat
indirgeyen, heterotrofik bakteri ve daha birok bilinmeyen populasyon saptanmtr (Amann ve
di., 1995; Godon ve di., 1997; Sekiguchi ve di., 1998, 1999). Bu nedenle 16 S rRNA gen
sralamasn temel alan anaerobik amurun mikrobiyal topluluk yapsal analizi, anaerobik
biyoreaktrlerdeki mikrobiyal populasyonun tespit edilmesinde gl yntem olarak karmza
kmaktadr. Son yllarda 16S rRNA analizleri, Denatre Gradyant Jel Elektroforezi (DGGE),
Termal Gradyant Jel Elektroforezi (TGGE), Tek Zincir Konformasyon Polimorfizmi (SSCP)
gibi PCR tabanl molekler metodlarn gelimesi ile mikrobiyal ekosistemin tanmlanmas daha
etkin hale gelmitir (Chan ve di., 2001). Bu teknikler, farkl fakat benzer DNA fragmanlarnn
uzunluklarnn belirlenmesinde ok hassas lmler vererek kompleks mikrobiyolojik gruplarn
hzl bir ekilde tanmlanmasn salamaktadrlar. Laboratuvar lekli anaerobik reaktrlerde
mevcut mikrobiyal topluluun tanmlanmasnda 16S rRNA klonlama analizleri geni lekte
kullanlmasna ramen, endstriyel lekte alan anaerobik reaktrlerde mikrobiyal
topluluun tanmlanmas ve sistem performans ile birlikte deerlendirilmesi konusundaki
almalar snrldr (Leclerc ve di., 2004; Roest ve di., 2005; Akarsuba ve di., 2006;
Keysera ve di., 2006).
Bu almada; eker retimi aamasnda oluan atksularn artld gerek lekli anaerobik
kontakt prosesten oniki hafta sresince alnan anaerobik amur numunelerinde Arkeal
topluluun 16S r RNA analizleri ve SSCP teknii kullanlarak deiiminin atksu artm sistem
performans ile ilikili olarak belirlenmesi ve topluluk stabilitesinin anaerobik artm sistem
performans stabilitesi ile birlikte deerlendirilmesi amalanmtr.
2. Materyal ve Metod
2.1. Atksu Artma Tesisi
TFAye ait Ereli eker Fabrikasnda bulunan atksu artma tesisi anaerobik ve
denitrifikasyon ve nitrifikasyon nitelerinden olumaktadr. Anaerobik nite s deitiriciler,
hidroliz tank, anaerobik tank, degazifikasyon ve plakal dekantr iermektedir.
Is deitiriciler: Atksu, kampanya sresince fabrikadan gelen barometrik kondense suyu ve
scak su yardm ile s deitiricilerde 37Cye stlarak hidroliz tankna gnderilmektedir.
Hidroliz tank: Anaerobik paralanmann ilk aamasnn gerekletii hidroliz tank tam
izolasyonlu ve 1170 m
3
hacme sahip kapal bir tanktr. Tankta karmn salanmas iin tek
pervaneli bir kartrc bulunmaktadr.
Anaerobik tank: Anaerobik paralanmann gerekletii ve biyogazn retildii anaerobik tank,
tam izolasyonlu ve 8000 m
3
hacme sahip kapal bir tanktr. Tankta karmn salanmas iin iki
pervaneli bir kartrc bulunmaktadr. Anaerobik tankta pH, scaklk, su seviyesi ve gaz basnc
kontrolleri mevcuttur. Takan vastasyla su, anaerobik tanktan plakal dekantre gemektedir.
Gerek lekli Anaerobik Biyolojik Atksu Artma Tesisinde Arke Topluluu 16S rRNA Sekanslarnn
SSCP ile Deerlendirilmesi
401


Plakal dekantrde ktrlen amurun bir ksm geri dng hatt yardmyla anaerobik tanka
alnmaktadr. retilen biyogaz, gaz fan yardmyla ekilmektedir. Gaz hattnda; gaz debisi, gaz
basnc ve gaz bileenleri llmektedir.
Degazifikasyon ve plakal dekantr: Anaerobik tank takanndan gelen su, plakal dekantre
girmeden nce gazszlatrma balonuna gelmektedir. Atksu iinde bulunan gaz mevcut bir fan
yardm ile gazszlatrma balonunun yukarsndan ekilerek nitrifikasyon tankna gnderil-
mektedir. Gazszlatrlan atksu floklasyon nitesine gemektedir. amur, floklasyon
nitesinin altndaki aklk yardm ile kelme blgesine girmektedir. ken amur tabandaki
syrc yardmyla merkezde toplanmakta ve bir ksm anaerobik tanka geri dndrlmektedir.
Plakal dekantrde durultulan su, takan savaklarndan azot giderimi iin denitrifikasyon &
nitrifikasyon nitesine girmektedir. Anaerobik proses ak diyagram ekil 1de verilmitir.
Otomasyon kontrol sistemi: Tesis kontrol iin PLC (Programmable Logic Control,
Programlanabilir Mantksal Kontrolc) ve PLC verilerinin deerlendirilmesi iin TEOS32
SCADA denetim gzlem program kullanlmaktadr.


ekil 1. Anaerobik proses ak diyagram
2.2. Atksu Analizleri
Kimyasal oksijen ihtiyac (KOI), uucu organik asit (UOA), toplam alkalite (TA), askda kat
madde (AKM) ve uucu askda kat madde (UAKM) analizleri standart metotlara (APHA,
1995) gre yaplmtr.
pH ve TC on-line olarak llmtr. Gaz debisi, Bailey Fischer Porter vortex debimetre ile
on-line llm ve biyogaz iindeki gaz bileenleri on-line Varian CP 2003 Mikro Gaz
Kromatografisi ile tespit edilmitir. Atksu ak hzlar ise Danfoss elektromanyetik
debimetreler ile on-line llmtr.
pH, TC, atksu ak hzlar, gaz debisi ve biyogaz iindeki gaz bileenleri parametrelerinin
lm sonular denetim gzlem programndan alnmtr.


Anaerobik Tank


Degazifikasyon ve Plakal
Dekantr
Atksu
Atksu
Biyogaz
amur Geri Devir Hatt

Fazla amur
Hidroliz Tank Plakal Is Deitirici
Artlm Su
402 N. A. Perendeci, F. Y. Ekinci, J. J. Godon


2.3. Molekler Analizler iin amur Numunelerinin Alnmas
Molekler topluluk analizleri iin oniki hafta sresince hidroliz tank, anaerobik tank ve plakal
dekantrden amur numuneleri alnmtr. Hidroliz tankn drt seviyesinden ve anaerobik tankn
sekiz seviyesinden alnan anaerobik amur rneklerinin her iki tank koullarn tam temsil
edilebilmeleri iin kompozit numuneleri hazrlanmtr. Kompozit numuneler santrifj
edildikten (17500 g, 4C, 10 dk.) sonra spernatant uzaklatrlarak elde edilen pellet -80 Cde
saklanmtr. Analiz ncesi pelletler 2 mL 4 M guanidine thiocyanate, 0.1 M Tris-HCl pH 7.5, ve
600 L 10% N-lauroyl sarcosine ilavesiyle suspend edilmi ve drt adet mikrosantrifj tplerine
ayrlarak -20Cde saklanmtr.
2.4. Molekler Analizler
DNA izolasyonu QIAmp DNA STOOL kiti kullanlarak retici firmann protokol
dorultusunda baz modifikasyonlar ile yaplmtr. amur rneklerinde Arke topluluunun
tesbiti iin 16S rRNA blgesinin amplifikasyonu Universal 42 (W02), Archaea 13 (W17),
Archaea (W116) ve Universal 9 (W104) primerlar kullanlarak nested PCR ile yaplmtr.
PCR ile amplifiye edilen Arkeler arasndaki farkllklar ABI 310 genetik analiz aleti (Applied
Biosystems) ile donatlm SSCP kapileri elektroforezi kullanlarak belirlenmitir. SSCP
elektroforezi DNA fragmanlarnn ikincil yapsna gre ayrm yapmaktadr (Hebenbrock ve
di., 1995). Her bir mikroorganizma trnn V3 blgesinde farkl nkleotit dizilimine sahip
olduu dnldnden, bu teknik topluluktaki btn mikrobiyal poplasyonlar ayrmaktadr
(Lee ve di., 1996; Schwieger ve Tebbe 1998; Zumstein ve di., 2000). Mikrobiyal topluluu
temsil eden patternler olarak sonular pikler halinde grlmekte ve her bir pik topluluktaki
dominant trlere karlk gelmektedir. SSCP elektroforezi, konvansiyonel jel elektroforezi
tekniine gre daha iyi band ayrm salamakta ve numunenin fluorescent standart (GeneScan-
400 Rox, Applied Biosystems) ile kartrlmas her bir numunedeki migrasyon patternlerinin
gvenle karlatrlmasna olanak tanmaktadr (Dabert ve di., 2005).
Elde edilen SSCP profillerinin deerlendirilmesi Principal Component Analysis, Temel Bileen
Analizi (PCA), MATLAB (Ver. 6.5) program altnda alan Statistical Analysis of
Fingerprints (SAFUM) (Ver 1.0) (Zemb ve di., 2007) program kullanlarak yaplmtr.
3. Sonular ve Tartma
3.1. Anaerobik nite Performans
2005-2006 atksu artm dneminde; anaerobik kontakt proses organik ykleme hz, % KOI
giderim verimi, UOA/TA oran ve retilen biyogazn zamanla deiimi srasyla ekil 2 (a), (b),
(c) ve (d)de verilmitir. Anaerobik kontakt proses 0.17 3.35 kgKOI/m
3
.gn aralnda,
ortalama 1.82 kg KOI/m
3
.gn organik ykleme hz ile altrlm ve sistemden % 96 KOI
giderim verimi elde edilmitir. Kampanya ortalama organik ykleme hz, anaerobik tank
dizayn organik ykleme deeri (4.69 kgKOI/m
3
.gn) ile karlatrldnda sistemin dk
organik ykleme hznda altrld belirlenmitir.
Anaerobik nitede UOA miktarnn artmas gibi bir problemle karlalmam ve UOA/TA
oran kampanya sresince 0.1 deerinin altnda kalmtr. Anaerobik tankta kampanya
ortalamas UOA/TA oran 0.008 olarak hesaplanmtr. Dk UOA/TA oran da sistemin
dk KOI ykleme deerlerinde altrldn ortaya koymaktadr.
Gerek lekli Anaerobik Biyolojik Atksu Artma Tesisinde Arke Topluluu 16S rRNA Sekanslarnn
SSCP ile Deerlendirilmesi
403


Otomasyon kontrol sisteminden elde edilen verilere gre, atksu artm dneminde ortalama
8537 m
3
biyogaz/gn ve toplam 973166 m
3
biyogaz/atksu artm dnemi (yaklak % 66 CH
4
)
retilerek buhar kazannda yaklmtr.
2005/2006 atksu artm dneminde PLCden alnan veriler incelendiinde; hidroliz tank
scaklnn ortalama 39.75C ve anaerobik tank scaklnn ise ortalama 37.82C olduu tespit
edilmitir. Ayrca, atksu artm dnemince giri atksuyu, hidroliz tank ve anaerobik tank
ortalama pH'lar srasyla 6.14, 6.09 ve 7.15 olarak llmtr.

ekil 2. Anaerobik kontakt proses organik ykleme hz (a), % KOI giderim verimi (b),
UOA/TA oran (c) ve retilen biyogazn (d) zamanla deiimi
3.2. Arkeal Topluluk Profili
rneklerdeki toplam Arke miktarn bulmak iin Nested PCR metodu kullanlmtr. Nested
PCR metodunda iki farkl primer seti kullanlarak numunelerdeki Arkelerin amplifike olma
ans artrlmtr. ekil 3den grld zere anaerobik tank ve plakal dekantrde II. PCR
sonunda amplifiye edilen DNA miktar fazla olmasna ramen, hidroliz tankndan alnan
rneklerde dk Arke miktar nedeniyle bantlar zayf yada hi grlmemitir.
PCR amplifikasyonu sonrasnda seyreltilen hidroliz, anaerobik tank ve plakal dekantr
rneklerinin PCR rnleri SSCP kapileri elektroforezi kullanlarak Arkeler arasndaki
farkllklar belirlenmitir. ekil 4de oniki hafta sresince anaerobik tanktan haftalk alnan
anaerobik amurda tespit edilen Arke trlerinin profilleri verilmitir.

404 N. A. Perendeci, F. Y. Ekinci, J. J. Godon



ekil 3. Hidroliz tank, anaerobik tank ve plakal dekantrden alnan numunelerin
Nested PCR II sonular

ekil 4. Anaerobik tanktan haftalk alnan anaerobik amurda tespit edilen Arke
trlerinin profilleri
ekil 4den grlecei zere kampanya sresince anaerobik tanktan alnan amur rneklerinde
dokuz nemli tr belirlenmi ve bunlardan drt adetinin dominant olduu gzlenmitir. PCA
analiz sonularna gre hidroliz tank, anaerobik tank ve plakal dekantrden alnan
numunelerdeki Arke SSCP spektrumlar, ok kararl bir yap sergilemektedir. Bu, Arkeler
asndan prosesin kararl koullarda altrld sonucunu ortaya karmaktadr. ekil 5de
hidroliz tank, anaerobik tank ve plakal dekantrden alnan numunelerdeki Arke SSCP
spektrumlarnn PCA analiz sonucu verilmitir.
Hidroliz tank, anaerobik tank ve plakal dekantrden alnan numunelerdeki Arke SSCP
profillerine ait temel bileen analizi % 92.39luk bir deiimle aklanmtr. Elde edilen sonu
sistemin Arke profili asndan kararlln ortaya koymaktadr. Ayrca, her tanktan alnan
numunelerdeki Arke profilleri PCA analizine gre genel anlamda iki farkl kmelenme
sergilemektedir. zellikle anaerobik tank ile plakal dekantrden alnan numuneler ayn bileen
0
0.005
0.01
0.015
0.02
0.025
0.03
0.035
0.04
0.045
1 24 47 70 93 116 139 162 185 208 231 254 277 300 323 346 369 392 415 438 461 484 507 530 553 576 599 622 645 668 691 714
A1 A2 A3 A4 A5 A6
A7 A8 A9 A10 A11 A12
1
2
3
4
5
6
7
8
9
A20 L20 H27 A27 L27 H05 A05 L05 H17 A17 L17 A20-04
H14 A14 L14 H22 A22 L22 H28 A28 L28 H06 A06 L06 H20



Gerek lekli Anaerobik Biyolojik Atksu Artma Tesisinde Arke Topluluu 16S rRNA Sekanslarnn
SSCP ile Deerlendirilmesi
405


kmesinde toplanrken, hidroliz tankndan alnan numuneler ise ayr bir bileen kmesinde
toplanmtr. Ortaya kan bu durum hidroliz ile anaerobik tankn proses koullarna uygun
olarak altrldn ve faz ayrm asndan fonksiyonel olduklarn dorulamaktadr.
Sonu olarak proses verileri dikkate alndnda, sistem dk organik ykte altrlm
olmasna ramen proses stabilitesindeki kararllk molekler analizlerle elde edilen sonularla
da tutarldr. zellikle Arke tr stabilitesi proses kararlln net bir ekilde ortaya koymaktadr.












ekil 5. Hidroliz tank, anaerobik tank ve plakal dekantrden alnan numunelerdeki
Arke SSCP spektrumlarnn PCA analiz sonucu
Teekkr
Bu alma 2003K121020/9 nolu DPT projesi kapsamnda yaplmtr. Trkiye eker
Fabrikalar A.ne ve Ereli eker Fabrikasna atksu artm tesisini proje iin atklar ve
verilerini paylatklar iin teekkr ederiz. Ayrca, INRA- Laboratoire de Biotechnologie de
lenvironnement (LBE)ye molekler analizlerin yaplmasnda verdikleri desteklerden dolay
teekkr ederiz.
Kaynaklar
Akarsuba, A.T., Ince, O., Oz, N.A., Krdar, B., Ince, B.K. (2006). Evaluation of performance, acetoclastic
methanogenic activity and archaeal composition of full-scale UASB reactors treating alcohol distillery
wastewaters, Process Biochemistry, 41, 2835.
Amann, R.I., Ludwig, H., Schleifer, K.H. (1995). Phylogenetic identification and in situ detection of individual
microbial cells without cultivation, Microbiological Reviews, 59(1), 143-169.
APHA, AWWA, WEF. (1995). Standard Methods for the Examination of Water and Wastewater. 19
th
Ed., APHA,
Washington.
Chan, O.C., Liu, W.T., Fang, H.H.P. (2001). Study of microbial community of brewery treating granular sludge by
denaturing gradient gel electropheresis of 16S rRNA gene, Water Science and Technology, 43(1), 77-82.
Dabert, P., Delgens, J.P., Godon, J.J. (2005). Monitoring the impact of bioaugmentation on the start up of biological
phosphorus removal in a laboratory scale activated sludge ecosystem, Appl. Microbiol. Biotechnol, 66, 575588.
406 N. A. Perendeci, F. Y. Ekinci, J. J. Godon


Environmental Health and Safety Guidelines for Sugar Manufacturing. (2007). World Bank Group Environmental
Health and Safety Guidelines, The World Bank Group, Washington, D.C.
Godon, J.J., Zumstein, E., Dabert, P., Habouzit, F.D., Moletta, R. (1997). Molecular microbial diversity of an
anaerobic digestor as determined by small-subunit rDNA sequence analysis, Applied and Environmental
Microbiology, 63(7), 28022813.
Hebenbrock, K., Williams, P., Karger, B. (1995). Single strand conformational polymorphism using capillary
electrophoresis with two-dye laser-induced fluorescence detection, Electrophoresis, 16, 14291436.
Keysera, M., Witthuhna, R.C., Lamprechta, C., Coetzeeb, M.P.A., Britz, T.J. (2006). PCR-based DGGE
fingerprinting and identification of methanogens detected in three different types of UASB granules, Systematic
and Applied Microbiology, 29, 7784.
Leclerc, M., Delgnes, J.P., Godon, J.J. (2004). Diversity of the archaeal community in 44 anaerobic digesters as
determined by single strand conformation polymorphism analysis and 16S rDNA sequencing, Environmental
Microbiology, 6 (8), 809819.
Lee, D.H., Zo, Y.G., Kim, S.J. (1996). Non-radioactive method to study genetic profiles of natural bacterial
communities by PCR single- strand-conformation polymorphism, Appl. Environ. Microbiol., 62, 31123120.
Roest, K., Heilig, H.G.H.J., Smidt, H., Vos, W.M., Stams, A.J.M., Akkermans, A.D.L. (2005). Community analysis
of a full-scale anaerobic bioreactor treating papermill wastewater, Systematic and Applied Microbiology, 28,
175185.
Schwieger, F., Tebbe, C.C. (1998). A new approach to utilize PCR single- strand-conformation polymorphism for
16S rRNA gene based microbial community analysis, Appl. Environ. Microbiol., 64, 48704876.
Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., Nakamura, K. (1998). Phylogenetic diversity of
mesophilic and thermophilic granular sludges determined by 16S rRNA gene analysis, Microbiology, 144, 2655
2665.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., Harada, H. (1999). Fluorescence in situ hybridization using
16S rRNA targeted oligonucleotides reveals localization of methanogens and selected uncultured bacteria in
mesophilic and thermophilic sludge granules, Applied and Environmental Microbiology, 65(3), 12801288.
engl, F. (1991). Endstriyel Atksularn zellikleri ve Artlmas, DE Mh. Mim.Fak. Basm nitesi, zmir, p.
64-72.
Zemb, O., Haegeman, B., Delgenes, J.P., Lebaron, P., Godon, J.J. (2007). Safum: Statistical analysis of SSCP
fingerprints using PCA projections, dendrograms and diversity estimators, Molecular Ecology Notes, 7, 767770.
Zumstein, E., Godon, J.J., Moletta, R. (2000). Examination of two years of community dynamics in an anaerobic
bioreactor using fluorescence polymerase chain reaction (PCR) single-strand conformation polymorphism
analysis, Environ. Microbiol., 2, 69 78.










POSTER SUNUMLAR





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Trkiyede ED Uygulamalar ve Sektrel Olarak Deiimi
Ayla Bilgin
Hacettepe niversitesi, evre Mhendislii Blm, Beytepe, Ankara.
E-posta: ayla.bilgin@gmail.com

z evreye duyarlln artmas, endstriyel ve teknolojik faaliyetlerde evreye etkisinin
deerlendirilmesi amacyla evre ve Orman Bakanl tarafndan her atk faaliyeti konusunda o
faaliyete zg kanunlar ve ynetmelikler karlmaktadr. Teknoloji ve sanayilemenin artmas
sz konusu faaliyetlere zg atklar da beraberinde getirmektedir. Bu alma ile 1993 ylndan
gnmze evre ve Orman Bakanl tarafndan sektrel faaliyetler iin verilen 1405 ED
karar, 2003 yl evresel Etki Deerlendirme Ynetmeliinin getirdikleri ile birlikte sektrel
bazda lkemizdeki gelimeyi grmek amacyla yaplmtr. alma kapsamnda, 1993 ve 2007
yllar arasnda evre ve Orman Bakanl tarafndan enerji, atk-kimya, sanayi yatrmlar,
petrol-madencilik, turizm-konut, tarm-gda ve ulam- ky sektr baznda alnan evresel Etki
Deerlendirme Raporlar kararlar verileri esas alnarak deerlendirilmitir. Ayrca; ED
olumlu ve olumsuz karar verilen faaliyetler, bu faaliyetlerin bulunduu il ve yl baznda
deerlendirmeler yaplmtr. Trkiyedeki sektrel geliim ve deiim de evre duyarll ile
birlikte irdelenmitir. Zaman ve teknolojik sre deiimi atk ve sektr baznda
deerlendirilmitir.
Anahtar Kelimeler evresel etki deerlendirme; sektrel deiim
1. Giri
Hzl nfus art beraberinde retim ve tketim deki art da getirmektedir. retim sanayi
yatrmlar ve teknolojik gelimelerle meydana gelir. Tketimlerimizdeki art ve sektrlerin
doaya verdii atklar sonucunda evre kavram giderek daha nem kazanmtr. Teknoloji ve
sanayilemenin artmas kendine zg atklar da beraberinde getirmektedir Sz konusu atklarn
evreye verdii etkiler gndeme gelmitir. Atklarn uygun teknolojilerle geri kazanm ve
uygun artlar salayarak doaya bertaraf edilmeleri konusu her geen gn nemini
artrmaktadr.
evresel etki deerlendirmesi (ED), evre sorunlarna yol aabilecek faaliyetlerin planlama
aamasndan balayarak, faaliyetin inaat-iletme aamasnda ve faaliyetin sona erdirilmesinden
sonra meydana gelebilecek etkilerin, proje yapm karar alnmadan nce bilimsel yntem ve
tekniklerle incelenmesi, varsa olumsuz etkilerin nlenmesi, gerekli nlemlerin belirlenmesi,
projenin tm uygulama aamalarnda bu etkilerin ve nlemlerin izlenmesi ve denetlenmesidir.
Bu tanmdan da anlalaca gibi, ED; nerilen bir faaliyetin doabilecek tm evresel ve
sosyal etkilerin deerlendirilmesinde kullanlan idari ve teknik bir sretir.
lkemizde evre sorunlarnn giderek artmas ve gndeme gelmesi nedeniyle, ED, 1983
ylnda yrrle giren evre Kanununun 10.maddesi ile yasal statye oturtulmu, 7 ubat
1993 tarihinde ynetmelik olarak uygulamaya geilmitir (Bykgngr, 2001).




410 A. Bilgin


2. almann Amac
lkemizde evresel Etki Deerlendirme Ynetmelii uygulamalarn sektrel bazda
deerlendirmek ve sz konusu (1993, 1997, 2002 ve 2003 yllar) ynetmeliklerin kapsamnn
deitirilmesi ile evre ve Orman Bakanl tarafndan alnan ED kararlarnn deiimini
belirlemektir.
3. Aratrma Yntemi
almada aratrma konular olarak; 1993 ve 2007 yllar arasnda evre ve Orman Bakanl
tarafndan enerji, atk-kimya, sanayi yatrmlar, petrol-madencilik, turizm-konut, tarm-gda ve
ulam- ky sektr baznda alnan evresel Etki Deerlendirme Raporlar kararlar verileri
esas alnarak deerlendirilmitir. 1993 ve 2007 ylnda Bakanlk tarafndan toplam 1405 ED
karar (http://www.cedgm.gov.tr) ierisinde; ED olumlu ve olumsuz karar verilen faaliyetler,
bu faaliyetlerin bulunduu il ve yl baznda deerlendirmeler yaplmtr. Veriler SPSS 15
istatiksel program vastas ile frequency ve crostab testleri uygulanarak deerlendirilmitir.
4. Deerlendirme
lkemizde ED uygulamalarn 1993 ED Ynetmelii ncesi ve sonras olarak iki ayr
blmde incelemek uygun olacaktr. Ynetmelik kmadan nce lkemizde evresel adan
projelerde ya ED hi hazrlatlmam ya da ED ad altnda kapsam fazla geni olmayan ve
bugn iin dnyada uygulanmakta olan ve bilimsel anlamda ED ieriine uymayan raporlar
hazrlatlmtr. 1993 ED ynetmeliinin kmasndan sonraki dnemde ED raporlar yeni
tartmalara neden olmutur. Bu tartmalar ED prosedrnn uygun olup olmad, ED
raporunu kimlerin hazrlamas, sresi gibi konular kapsamaktadr ( Trkman, 1995). 1993 ED
ynetmeliindeki eksiklikler gz nne alnarak ynetmelik 1997 tarihinde tekrardan
dzenlenmitir. Ancak, bu ynetmelikteki ED kararndaki sre uzunluu ve AB direktifleri
dorultusunda 2002 ylnda revize edilmi ve en son olarak 16 Aralk 2003 ylnda u an
uygulanmakta olan ED ynetmelii yrrle konmutur. Sz konusu ynetmelik ile; 2002
ylndaki ED karar sresi 117 i gn iken, 2003 ylnda 38 i gnne indirilmitir. gn
sresindeki deiikliin faaliyetlerde evre ve Orman Bakanl tarafndan verilen ED rapor
karar saysna yansd grlmektedir (Tablo 1). lkemizde 16 yl ierisinde bakanlk
tarafndan 1405 faaliyetin uygulanmas iin bakanlk tarafndan ED olumlu veya olumsuz
karar alnmtr (ekil 1).
Trkiyedeki sektrel uygulamalarn byk ounluunu evre ve Orman Bakanl tarafndan
alnan sektrel faaliyetlerin uygulanabilmesi iin ED kararlar dorultusunda incelenirse;
birinci srada petrol ve madencilik (% 25,7) , ikinci olarak atk ve kimya (%17,6) nc olarak
sanayi yatrmlar (%15) ve dier faaliyetler gelmektedir. Yine 16 yl ierisinde; toplam 1405
faaliyet ierisinde 26 adet faaliyete ED olumsuz karar bakanlk tarafndan verilmitir. ED
olumsuz karar verilen faaliyetler en fazla petrol ve madencilik faaliyetleri olurken, atk kimya
ve sanayi yatrmlar alanndaki faaliyetlere de olumsuz karar kmtr. ED uygulamalarnn
1993-2007 yllar arasnda sektrel deiimi Tablo 1. de verilmektedir. Tablo 1.de verilen
veriler deerlendirildiinde;
1) Ynetmelik deiikliklerinin etkisi: 1993 Ynetmeliinin yrrlkten kaldrlp 1997 yl
ED ynetmeliinin yrrle getirilmesine kadar geen 4 yllk sre ierisinde toplam 171,
1997 yl ED ynetmelii ile 2002 yl ED ynetmelii arasnda 5 yllk sre ieresinde 512,
2003 ylnda en son kan ynetmelik ile 2007 yl arasnda ki 5 yllk srede 604 ED karar
Trkiyede ED Uygulamalar ve Sektrel Olarak Deiimi 411


verilmitir. 1993-1996 yllarnda ok az sayda ED yaplmasnn bir nedeni olarak
ynetmelikteki eksiklikler ve ED srecindeki belirsizliklerin bunda etkili olduu sylenebilir.

ekil 1. 1993-2007 yllar arasnda sektrel deiim ve ED olumlu ve olumsuz
kararlar.
Tablo 1. ED Uygulamalarnn 1993-2007 yllar arasnda Sektrel Deiimi.
YIL
SEKTR GRUBU
Sanayi
Yatrmlar
Atk ve
Kmya
Turzm
Konut
Petrol
Maden Enerji
Tarm
Gda
Ulasm ve Ky
Yatrmlar Toplam
1993 1 0 0 0 0 0 0 1
1994 2 2 7 6 3 2 2 24
1995 13 6 6 18 3 0 4 50
1996 18 7 8 45 1 8 9 96
1997 17 13 22 73 3 8 8 144
1998 20 8 13 23 4 5 5 78
1999 15 4 8 8 13 4 6 58
2000 13 6 22 33 23 5 6 108
2001 23 27 18 23 23 6 4 124
2002 24 24 18 24 17 5 6 118
2003 5 24 1 18 14 6 12 80
2004 3 23 5 17 18 8 12 86
2005 9 27 14 14 17 6 15 102
2006 14 42 11 22 17 3 16 125
2007 34 35 19 39 41 14 29 211
Toplam 211 248 172 363 197 80 134 1405
2) Yl baznda deerlendirme yapldnda;
a) Atk depolama ve atk geri kazanm faaliyetleri konularnda bakanlk tarafndan kartlan
Atk Yalarn Kontrol Ynetmelii (2004), Atk Pil ve Akmlatrlerin Kontrol Ynetmelii
(2004), Tbbi Atklarn Kontrol Ynetmelii (2005) vb., ynetmeliklerinin getirdikleri ile
birlikte 2001- 2005 yllarna oranla, 2006 ylnda ortalama % 68 orannda sz konusu alanlarda
faaliyetlerin artt bakanlk tarafndan verilen ED kararlar sonucu kmaktadr.
80 (%5,7)
0
132 ( %9,5)
2 (%8)
170 ( %12,2)
2 (%8)
196 (%14)
1 (%4)
206 (%15)
5 (%19)
242 (% 17,6)
4 (%15)
351 (% 25,7)
12 (%46)
0 50 100 150 200 250 300 350 400
Karar says
Tarm-Gda
Ulam ve Ky Yatrmlar
Turizm -Konut
Enerji
Sanayi Yatrmlar
Atk ve Kimya
Petrol ve Madencilik
Olumsuz
Olumlu
412 A. Bilgin


b) Hzl nfus art, sanayileme ve teknolojik faaliyetlerin artmasna paralel olarak her geen
gn enerji ihtiyacmz da artmtr. Bu durum zellikle 2007 ylnda enerji alanndaki
faaliyetlerin artnn; 1999-2006 yllarna gre ortalama % 78 olmas ile karmza kmaktadr.
c) Dier nemli bir durum ise; 1999 ylnda yaanan ekonomik krizin o dnemde ki ED
karar saysna yansd grlmektedir. ED karar says da 1998 ylna gre % 25 orannda
dm, bir sonraki yl olan 2000 ylnda ise % 100 orannda artmtr.
Sektrel faaliyetlerin hangi illerde ve hangi faaliyetler konusunda daha fazla yer aldn
deerlendirmek amac ile bakanlk tarafndan alnan ED kararlar verileri ile deerlendirilme
yaplmtr. lk 5 srada ED faaliyeti yaplan iller deerlendirildi (Tablo 2) ve en fazla zmir
ilinde, ikinci srada Antalya, nc srada stanbul ilinde faaliyet yapld grlmektedir.
zmir ilinde Petrol ve madencilik konusunda, Antalya ve stanbul ilinde ise turizm -konut
faaliyetleri iin ED kararlar alnmtr.
Tablo 2. 1993-2007 yllar arasnda l baznda sektrel deiim.
L
Sanayi
Yatrmlar
Atk ve
Kimya
Turizm
Konut
Petrol
Maden Enerji
Tarm
Gda
Ulasm ve Ky
Yatrmlar Toplam
Izmr 21 15 12 24 6 11 12 101
Antalya 1 17 60 4 8 4 1 95
Istanbul 14 13 20 16 9 1 15 88
Ankara 6 15 10 27 6 3 3 70
Kocael 11 28 3 13 4 0 10 69
5. Sonu
Bu aratrma ile; 1993 ylndan 2007 ylna kadar Trkiyede evresel Etki Deerlendirme
kararlar dorultusunda il baznda endstriyel ve teknolojik faaliyetlerdeki deiim
belirlenmitir. Bu alma ayn zamanda Trkiyedeki sektrel deiimi de gstermektedir.
evre duyarlln artmas ve evre ve Orman Bakanl tarafndan karlan ynetmeliklerle
beraber evre Etki Deerlendirme konusunda faaliyetlerin ynetmeliklere ve mevzuata uygun
bir ekilde daha ayrntl olarak uyguland grlmektedir. retim ve tketim toplumlar olarak
daha iyi bir evre iin evresel Etki Deerlendirmenin nem ve gereklilii ortaya kmtr
Kaynaklar
Trkman, A. (1995). Trkiyede ve Dnyada ED Uygulamalar, evresel Etki Deerlendirme, TMMOB evre
Mhendisleri Odas zmir ubesi, 225-236, 4-9 Aralk 1995, zmir.
Bykgngr, H. (2001). evre, Atklar ve evre Mevzuat, KMO Eitim Program, 1-18 Samsun.
evresel Etki Deerlendirilmesi Ynetmelii (1993). T.C. evre Bakanl, Resmi Gazete No:21489, 7 ubat 1993.
evresel Etki Deerlendirilmesi Ynetmelii (1997). T.C. evre Bakanl, Resmi Gazete No:23028, 23Haziran
1997.
evresel Etki Deerlendirilmesi Ynetmelii (2002). T.C. evre Bakanl, Resmi Gazete No:24777, 6 Haziran
2002.
evresel Etki Deerlendirilmesi Ynetmelii (2003). T.C. evre Bakanl, Resmi Gazete No:25318, 16 Aralk 2003.
http://www.cedgm.gov.tr/dosya/cedsonuc.htm (10.01.2008)



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Endstriyel Kirlenme Kontrol Kayseri ehri Uygulamas
zgr zdemir
1
, Fazilet Malik
1
, Hakan Ayyldz
1
, Oktay zkan
2
, Mustafa Turan
3

1
Kayseri Su ve Kanalizasyon daresi (KASK) Genel Mdrl, Kayseri
E-posta: ozguro@kaski.gov.tr
2
Erciyes niversitesi, Mhendislik Fakltesi, evre Mh. Blm, Kayseri
3
stanbul Teknik niversitesi, evre Mhendislii Blm, Maslak, 34469, stanbul

z Endstriyel atksularn, ierdikleri yksek kirlilik ykleri sebebiyle kanalizasyon ebekesine
dearj edilmeden nce dearj kriterlerini salayacak ekilde artlmas gerekmektedir. Bu
almada, Kayseride faaliyet gsteren endstriyel atksu kaynaklarnn zellikleri ve kirlilik
yklerinin tespiti amacyla Kayseri Su ve Kanalizasyon daresi (KASK) tarafndan yaplan
izleme ve denetleme almalar deerlendirilmitir. KASK Genel Mdrl, Kayseri ilinde
kanalizasyona dearj yapan byk ve kk sanayilerden kaynaklanan atksularn yeterli artlp
artlmad zerinde kontrol almalar ile endstriyel kirlenmeyi nlemede aktif bir rol
oynamaktadr. Merkezi leri Biyolojik Atksu Artma Tesisinin kurulup, altrlmasyla alc
ortam olan Kzlrmak Nehrine gelecek atksu kirlilii engellenmitir. KASK Laboratuar da
sahip olduu yetkinlii ile, Kayseri ve civarndaki kurululara ait su, atksu, toprak ve artma
amurunun analizlerinde baarl bir hizmet sunmaktadr.
Anahtar Kelimeler dearj ynetmelii; endstriyel kirlenme; kirlilik kontrol
Ksaltmalar
AKDY Atksularn Kanalizasyon ebekesine Dearj Ynetmelii
MBAAT Merkezi leri Biyolojik Atksu Artma Tesisi
KASK Kayseri Su ve Kanalizasyon daresi

1. Giri
Gnmzde lkemizde endstriyel alanda hzl gelimeler grlmektedir. Endstriyel faaliyetler
sonucu oluan atklar, endstrinin tipine bal olarak kendine zg zellikler tar ve gerekli
artm ilemlerine tabi tutulmadan alc ortama braklrsa ekosistemi olumsuz etkilerler (Alta
ve di., 2003). Bu atksular kanalizasyon sistemine dearj edilmeleri halinde; bnyelerinde
bulunan ar metaller, boyarmaddeler ve dier kirleticiler toksik etkilere sebep olmalar
nedeniyle, dearj edilmeden nce mutlaka giderilmelidirler (Hasar ve Cuci, 2000; zdemir,
2007).
Anadolunun hzla byyen ve 900.000ne yaklaan merkez nufusu ile bir sanayi merkezi
haline gelen bykehirlerimizden Kayseri ehri atksularnn artlmas iin 2004 ylnda
Merkezi leri Biyolojik Atksu Artma Tesisi (MBAAT) kurulmutur. Atksu Artma Tesisinin
devreye alnmasyla pek ok ilin snrlar iinden geen ve ayn zamanda bir ok yerleimin
imesuyu kayna olarak kullanlan Kzlrmak Nehrine Kayseriden gelen atksu kirlilii
engellenmitir. MBAATn devreye alnmasndan sonra, tesisin istenilen verimde
altrlabilmesi ve biyolojik prosesin endstriyel atksularn ar kirlilii yznden zarar
414 . zdemir, F. Malik, H. Ayyldz ve di.


grmemesini salamak iin kanalizasyon sistemine dearj yapan sanayi iletmelerinin atksu
dearjlarnn kontrolnn yaplmas gerei domutur.
Bu almada, Kayseri l Merkezinde faaliyet gsteren endstriyel atksu kaynaklarnn
zellikleri ve kirlilik yklerinin aratrlm ve bunun iin Kayseri Su ve Kanalizasyon daresi
(KASK) tarafndan yaplan izleme ve denetleme almalarna ait veriler deerlendirilmitir.
2. Atksularn Kanalizasyona Dearj Denetim Sistemi
Kanalizasyon sistemine dearj eden endstriyel kurulularn denetimi iin 2004 ylnda, KASK
Genel Mdrl bnyesinde Atksu Artma Dairesi Bakanlna bal olarak Atksu Ruhsat
ve Denetim ube Mdrl kurulmu ve Bykehir Belediyesi snrlar iindeki kanalizasyon
ebekesine dearj yapan tm endstriyel atksu kaynaklarnn kontrol grevini stlenmitir.
Bnyesinde ube Mdrnn (Kimya Mhendisi) idareciliinde 1 evre Mhendisi, 2
Kimyager ve 1 Biyolog bulunduran Atksu Ruhsat ve Denetim ube Mdrl almalarn,
grev ve yetkilerini aklayan Atksularn Kanalizasyon ebekesine Dearj Ynetmelii
(KASK, 2006) (AKDY) ve uygulama esaslarn aklayan Atksu Dearj Ynergesi (KASK,
2006)ne gre gerekletirmektedir.
AKDY kapsamnda endstriyel atksu kaynaklarnn sektrlere gre snflandrlmas, analizi
yaplacak parametreler, Atksu Balant Kalite Kontrol Belgesi ile ilgili uygulama esaslar ve
atksularn kanalizasyona dearj limitlerine indiremeyen veya artma tesisi olup da
altrmayan iletmeler iin uygulanacak Kirlilik nlem Pay hesab vb. konular ile ilgili
almalar yaplmaktadr. Kayseri ehri mcavir alan ierisindeki endstriyel atksu kaynaklar
tespit edilmi, bu kaynaklarn retim prosesi ve atksu oluumu hakknda veri toplanmtr.
Ayrca bu birimde, atksularn kanalizasyon ebekesi limitlerinin altna indirmek amacyla n
artma tesisi kurmas gereken endstriyel atksu kaynaklarnn (Fabrikalar, kk ve byk
lekli sanayi blgesi vs.) atksu artma tesisi projeleri onaylanmaktadr. AKDYe gre baz
kirletici maddelerin dearj limitleri Tablo 1de verilmitir.
Tablo 1. AKDY kirletici maddelerin dearj limitleri.
Sra No Parametre Birim Limit deer
1 BO (mg/l) 350
2 KO (mg/l) 800
3 AKM (mg/l) 350
4 TN (mg/l) 60
5 TP (mg/l) 10
6 YA-GRES (mg/l) 100
7 Cr (mg/l) 3
8 Pb (mg/l) 3
9 Ni (mg/l) 3
10 Zn (mg/l) 5
11 Scaklk
0
C 40
12 pH 6,5-10
3. Blgedeki Endstri Profili
Kayseri Organize Sanayi Blgesi (OSB)nde her sektrden irili ufakl pek ok endstri
bulunmaktadr. KASK Genel Mdrl ve OSB arasnda protokol nedeniyle u anda
OSBden kaynaklanan atksular ehrin atksu artma tesisine gelmekte ve artlmaktadr.
Endstriyel Kirlenme KontrolKayseri ehri Uygulamas 415


nmzdeki yllarda ehir ebekesinden ayrlacak Kayseri OSB Mdrl atksular iin ayr
bir endstriyel atksu artma tesisi yapm ile ilgili almalara balamlardr.
Kayseride ayrca Mimarsinan OSB, ncesu OSB ve Serbest Blge bulunmaktadr. Ancak bu
blgelerin atksular KASK kanalizasyonuna bal olmadndan ve alc ortama dearj
yaptklarndan, endstriyel atksularnn kontrol l evre ve Orman Mdrlnn grev ve
yetki snrlar iine girmekte ve kontrol yaplmamaktadr. ehrin kuzeyinde Trkiyenin
nemli sucuk, pastrma retim merkezlerinden Pastrmaclar Sitesi bulunmakta ve fiziksel
artmadan geen atksular kanalizasyon ebekesine dearj edilmektedir.
Kayseri genelinde 50yi akn firma bu kapsamda denetim altna alnmtr. Firmalar; tekstil,
gda, metal, galvanizleme-nikelaj kaplama ve oto st ykama zerine faaliyet gstermektedirler.
Firmalarn arasnda Trkiyenin ve dnyann nde gelen kot kuma reticilerinden olan Orta
Anadolu, yine tekstil sektrnn nclerinden Birlik Mensucat, metal sektrnden elik boru
reticisi Erbosan, Has elik ve kablo reticisi olan Hes Kablo gibi Trkiyenin byk
iletmeleri bulunmaktadr. Firmalarn birounun n artma tesisleri mevcut olup bu sayede
kanalizasyona dearj limitlerini salayabilmektedirler. Kayseri genelinde faaliyet gsteren baz
firmalar Tablo 2de verilmitir.
Tablo 2. Kayseri genelinde faaliyet gsteren baz firmalar.
Sra
No
Firma Ad Artma
Tesisi
Debi,
(m3/gn)
KO,
mg/l
AKM,
mg/l
Ya-
Gres,
mg/l
Top.
Cr
mg/l
Ni
mg/l
1 Orta Anadolu Tic. ve San. l. A.. Var 2000 405 90 13 0,025 -
2 Birlik Mensucat Tic. ve San. l. A.. Var 100 336 91 4,5 1,76 -
3 Has elik ve Halat San. Tic. A.. Var 50 150 122 16 - -
4 Erbosan Erciyas Boru San. ve Tic. A.. Var 20 104 15 1,7 - -
5 Sebat Metal ve Makine Endstrisi A.. Var 15 112 17 2 0,012 0,08
6 Dkm- (Silver) Is Emaye San. Tic. Ltd. ti Var 1 103 74 15 0,231 0,5
7 Hes Haclar Elektrik San. ve Tic. A.. Var 51 160 53 - - -
8 Aksan Ak San. ve Tic. A.. Var 5 27 12 1,5 - 0,12
9 nal Gda ve naat San. Tic. Ltd. ti. Yok 3 283 - 21 - -
10 1009. Ana Tamir Fabrikas Var 85 334 19 14 0,25 -
11 Hava kmal Bakm Merkezi Kom. (Esenyurt) Var 233 272 57 1,4 - 0,01
12 Hava kmal Bakm Merkezi Kom. (Fasbat) Yok 355 194 54 1,7 - 0,002
13 Mavi Ykama Kot Talama Atlyesi Yok 5 644 430 10 0,182 -
14 zdrtler amar Ykama Atlyesi Yok 100 351 28 90 0,224 -
Blgedeki galvanizleme-nikelaj kaplama tesisleri genelde kk iletmeler olup faaliyetleri
sonucu aa kan atksu miktar az olduundan her birinin tek bana artma sistemi kurmas
hem maddi hem de artma tesislerinin allabilirlii ynnden mmkn gzkmemektedir. Bu
endstrilerin atksularnn vidanjr vb. bir arala tama yoluyla toplanarak bir artma tesisinde
artlmas planlanmaktadr. Firmalar birarada bulunabilecekleri bir sanayi sitesine tanacak ve
kurulacak ortak bir artma tesisinin ekonomiklik ve uygulanabilirlik bakmlarndan bir
deerlendirmesi yaplarak uygulamaya konacaktr.
Endstriyel atksu kaynaklarnn denetimleri iin evre laboratuarlarndan hizmet alnmsa da
atksu analizi yapan kimya laboratuarlarnn az oluu, mevcut laboratuarlarn kullanlan cihaz ve
kimyasallar bakmnda yetersizlii, yetimi personel eksiklii ve ayn numunenin analizinin
farkl laboratuarlarda yapldnda birbirinden farkl sonular ortaya kmas nedeniyle ve artan
i younluuna bal olarak Kurum iinde bir laboratuara ihtiya duyulmu ve Genel Mdrlk
416 . zdemir, F. Malik, H. Ayyldz ve di.


bnyesinde evre Analizleri Laboratuar kurulmutur. zel ve kamuya ait kurum, kurulu ve
iletmelerin evre ile ilgili lm ve analizlerinin Bakanlk tarafndan kabul edilebilmesi iin
evre Analizleri Yeterlik Belgesi almas gerekmekte olup bu belgenin alnabilmesi iin
ncelikle laboratuarn ileyiinde TSE EN ISO IEC/17025 standard uygulanmaya balanmtr.
Analizlerin yaplmasnda Standart Metotlar uygulanmaya balanm, gerekli cihaz ve
kimyasallar alnarak deneylerin hassasiyeti ve doruluk orannn artmas salanmtr. Ayrca
numunelerin element baznda analizlerinin en hassas ve standart metotlara uygun olarak
yaplabilmesi iin ICP-OES cihaznn alm yaplmtr. Bu cihaz ile endstriyel atksulardan
ar metal analizleri hassas ve salkl bir ekilde yaplabilmektedir.
Laboratuvar iin evre ve Orman Bakanlndan n Yeterlilik Belgesi almak iin 2005
ylnda bavuruda bulunulmu ve TSE EN ISO IEC/17025 standardna uygun alan
laboratuara Eyll 2006da n Yeterlilik Belgesi alnmtr. Ayrca yaplan analizlerin
uluslararas alanda kabuln salamak amacyla akreditasyon iin TRKAKa (Trk
Akreditasyon Kurumu) bavuru yaplmtr. evre Analizleri Laboratuar, evre ve Orman
Bakanlndan n Yeterlilik Belgesi alm bir laboratuar olarak Kayseri ve civarndaki pek ok
kuruma hizmet verir hale gelmitir. evre Kanununun 5491 sayl Kanunla deiik Ek 2.
maddesi gerei KASK Genel Mdrlne bavuran zel kurulularla numune alma ve analiz
yaplmas konusunda protokoller imzalanmtr. mzalanan protokoller kapsamnda dearj
izinlerinde belirlenen periyotlarda numuneler Genel Mdrlk personeli tarafndan alnmakta ve
analizler laboratuarda yaplarak analiz raporlar kuruluun bal olduu l evre ve Orman
Mdrlne dzenli olarak gnderilmektedir.
4. Sonu
KASK idaresi kuruluundan gnmze kadar Kayserideki endstrilerden kaynaklanan
atksularn kanalizasyona dearjn srekli denetim ve kontrol altnda tutarak endstriyel
kirlenmeyi nlemede aktif bir rol oynamtr. MBAATnin iletmeye alnmas ile alc ortam
Kzlrmak Nehrine gelecek atksu kirlilii engellenmitir. KASK Laboratuar sahip olduu
yetkinlii ile Kayseri ve civarndaki kurululara ait su, atksu, toprak ve artma amurunun
analizlerinde baarl bir hizmet sunmutur.
Blgedeki endstrilerden, galvanizleme-nikelaj kaplama tesisi gibi dk debili endstrilerden
oluacak atksularnn mevcut baka bir endstrinin atksu artma tesisinde tama ile
artlmalarnn daha uygun bir zm olaca belirlenmitir.
Kaynaklar
Alta, L., Grel, L., Bykgngr, H. (2003). Emlsiyon Sv Membran Tekniinin Kurun Gideriminde Ak Sanayi
Atksularna Uygulanabilirliinin ncelenmesi, Trkiyede evre Kirlenmesi ncelikleri Sempozyumu, 129-133,
9-10 Ekim, 2003, Gebze, Kocaeli.
Hasar, H. ve Cuci, Y. (2000). Removal of Cr(VI), Cd(II) and Cu(II) by avtivated carbon prepared from almond husk.,
Environmental Technology, 21 (12), 1337-1342.
Atksularn Kanalizasyon ebekesine Dearj Ynetmelii, Kayseri Su ve Kanalizasyon daresi Genel Mdrl,
Tarih: 26.11.1999, Say: 1999/584.
Atksu Dearj Ynergesi, Kayseri Su ve Kanalizasyon daresi Genel Mdrl, Tarih: 26.11.1999, Say: 1999/584.
zdemir, . (2007) Modifiye edilmi zeolit yatakl reaktrde tekstil endstrisi boyahane atksularndan renk
gidermenin aratrlmas, Doktora tezi, stanbul Teknik niversitesi, Fen Bilimleri Enstits, evre
Mhendislii Ana Bilim Dal, stanbul.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Kat Endstrisi Atksularnn Bentonit le Kimyasal n Artm
Mehmet Ali Kker ve Turgut T. Onay
Boazii niversitesi, evre Bilimleri Enstits, Bebek, 34342, stanbul.
E-posta: mehmetali.kucuker@boun.edu.tr

z Kat endstrisi gerek dnyada gerekse Trkiyede yaygn olan bir endstri daldr. Bu
almann amac; atk kat endstrisi atksularnn biyolojik artm ncesi, fizikokimyasal
yntemlerle ile organik madde giderimine ynelik artabilirliinin deneysel olarak incelenmesi
ve floklant olarak zenginletirilmi bentonitin bu artabilirlikteki rolnn aratrlmasdr. Bu
deneysel almada Jar Testi uygulanarak, optimum artma verimi salayan floklatr trn
(bentonit ve poli alminyum klorr) ve dozajn belirlenmek zere kimyasal artabilirlik
almas yaplmtr. Ham atksuyun pHn deitirmeden ve 2 farkl kimyasal (kire ve
sodyum hidroksit) ile pH s 10 a ayarlanan atksuda, kimyasal oksijen ihtiyac (KO), askda
kat madde (AKM) parametrelerinin analizi yaplarak optimum atksu artma verimini veren
kimyasal madde dozaj belirlenmitir. Yaplan deneysel almalar sonucunda, 500 mg/L katkl
bentonit dozajnda, pHs Ca(OH)
2
ile 10 a ayarlanan ve 5 mg/L anyonik polielektrolit ilavesi
yaplan rnekte en yksek artma verimi elde edilmitir.
Anahtar Kelimeler fizikokimyasal artm, kat endstrisi, organik madde giderimi
1. Giri
lkemizde ekonomik adan nemli bir yeri olan kat endstrisinde birim retim bana su
kullanm, aa kan atksu miktar ve kirlilik yk dier endstri kollarna oranla olduka
fazladr. Kat hamuru ve kat endstrinden kaynaklanan kirlenme, byk lde retimde
kullanlan ham maddeler ve katk maddeleriyle imalat, proses ve teknolojiye baldr. Atk kat
endstrisi atksularnn biyolojik artm ncesi, fizikokimyasal artm yntemleri ile organik
madde giderimine ynelik aratabilirliinin deneysel olarak incelenmesi ve floklant olarak
zenginletirilmi bentonit kullanlmas. Bu amala atk kattan kat reten Halkal Kat
fabrikasndan alnan numunelere laboratuarda kimyasal artlabilirlik uygulamalar yaplmtr.
2. Deneysel Materyal ve Metot
2.1. Atksu Karakteri
Ham atksuda yaplan deneyler sonucunda elde edilen veriler Tablo 1de verilmitir.
Tablo 1. Ham Atksu Numunesinin Karakterizasyonu
pH KO
(mg/L)
AKM
(mg/L)
letkenlik
(ms/cm)
BO
5
(mg/L)
Slfat
(mg/L)
kebilme
(mg/L)
Ham Atksu 6,25 8743 3290 5,31 6060 500 160
2.2. Deneysel Sonular
2.2.1. Bentonit le Fizikokimyasal n Artm Sonular
Ham atksuya belirli dozajlarda Macrofloc 300 katkl bentonit kullanlarak, 5 mg/L dozajnda
anyonik polielektrolit eklenmi ve pH Ca(OH)
2
kullanlarak 10a ayarlanmtr. Alnan
sonular tablo ve grafiksel olarak aada verilmitir.
418 M.A. Kker, T.T. Onay


Tablo 2. Macrofloc 300 katkl bentonit, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve
pH Ca(OH)
2
kullanlarak 10a ayarlanm numune verileri.
MACROFLOC 300 P.E. pH 10
Numune No
Bentonit
(mg/L)
pH

KO
(mg/L)
KO Verim
(%)
AKM
(mg/L)
AKM
Verim(%)
Ham Atksu 0 6,25 8743 - 3290 -
6.1 250 10 6430 26,45 480 85,41
6.2 500 10 5649 35,38 335 89,81
6.3 750 10 5993 31,45 290 91,18
6.4 1000 10 6118 30,02 310 90,57
6.5 1250 10 5993 31,45 365 88,90
6.6 1500 10 6180 29,31 305 90,72

ekil 1. Macrofloc 300 AC, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH
Ca(OH)
2
kullanlarak 10a ayarlanm numunede KO verimi.

ekil 2. Macrofloc 300 AC, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH Ca(OH)
2

kullanlarak 10a ayarlanm numunede AKM verimi.
24
27
30
33
36
0 250 500 750 1000 1250 1500
V
e
r
i
m
(
%
)
Bentonit (mg/L)
KO Verim KO Verim
84
86
88
90
92
0 250 500 750 1000 1250 1500 1750
V
e
r
i
m

(
%
)
Bentonit (mg/L)
AKM Verimi
AKM Verimi
Kat Edstrisi Atksularnn Bentonit le Kimyasal n Artm 419



ekil 3. Macrofloc 300 AC, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH Ca(OH)
2

kullanlarak 10a ayarlanm numuneden jar test grnts.

2.2.2. Poli-Alminyum Klorr le Fizikokimyasal n Artm Sonular
Ham atksuya belirli dozajlarda poli alminyum klorr kullanlarak, 5 mg/L dozajnda anyonik
polielektrolit eklenmi ve pH Ca(OH)
2
kullanlarak 10a ayarlanmtr. Alnan sonular tablo
ve grafiksel olarak aada verilmitir.

Tablo 3. Poli alminyum klorr, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH
Ca(OH)
2
kullanlarak 10a ayarlanm numune verileri.
Poli Alminyum Klorr P.E. pH 10
Numune No
Bentonit
(mg/L)
pH

KO
(mg/L)
KO Verim
(%)
AKM
(mg/L)
AKM
Verim(%)
Ham Atksu 0 6,25 7806 - 3290 -
7.1 100 10 6149 21,22 590 82,06
7.2 200 10 6430 17,62 335 89,81
7.3 300 10 5649 27,63 190 94,22
7.4 400 10 6274 19,62 150 95,44
7.5 500 10 5774 26,03 228 93,06
7.6 600 10 5961 23,63 176 94,65



ekil 4. Poli alminyum klorr, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH
Ca(OH)
2
kullanlarak 10a ayarlanm numunede KO verimi.
15
19
23
27
31
0 100 200 300 400 500 600 700
V
e
r
i
m

(
%
)
Bentonit (mg/L)
KO Verimi
KO Verimi
420 M.A. Kker, T.T. Onay



ekil 5. Poli alminyum klorr, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH
Ca(OH)
2
kullanlarak 10a ayarlanm numunede AKM verimi.


ekil 6. Poli alminyum klorr, 5 mg/L dozajnda anyonik polielektrolit eklenmi ve pH
Ca(OH)
2
kullanlarak 10a ayarlanm numuneden jar test grnts.
Sonular
Yukardaki deneysel alma sonularnda da grld zere atk kattan kat retimi
srasnda oluan atksuyun fizikokimyasal artmnda, floklant olarak katkl bentonit kullanm,
atksuyun KO deerini %35lere varan oranlarda gidermektedir. Kat endstrisinde yaygn
olarak kullanlan poli alminyum klorr floklantna gre katkl bentonit KO giderimin de
stnlk salarken, renk giderimin de yeterli stnl salayamamtr.
Kaynaklar
APHA, (2002). Standart Methods for Examinations of Water and Wastewater, 20th Edition, American Public Health
Association, Washington D.C.
Dilek, F.B., Bese, S., (2001). Treatment of Pulping Efflents by Using Alum and Clay-Colour Removal and Sludge
Characteristics, Middle East Technical University, Ankara.
Erdemli, E., (2004). Biyolojik Olarak Artlm Kat Endstrisi Atksularnda KOnin Kimyasal Oksidasyon
Yntemi le Giderimi. Yksek Lisans Tezi, stanbul Teknik niversitesi Fen Bilimleri Enstits, stanbul.
Melek, T., (1996). Kat Endstrisi Atksuyunun Havasz Biyolojik Artm zerine Bir Aratrma, Yksek Lisans
Tezi, stanbul Teknik niversitesi Fen Bilimleri Enstits, stanbul.
80
85
90
95
100
0 100 200 300 400 500 600 700
V
e
r
i
m

(
%
)
P.AlCl (mg/L)
AKM Verimi
AKM Verimi



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Biyokatalitik Kalsiyum Giderimi ve Etki Eden Faktrler
Levent Alta, Yakup Kurma, Mustafa Ik*
*Aksaray niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 68100 - AKSARAY
E-posta: misik@aksaray.edu.tr

z Endstriler, ksmi veya tam olarak artlm atksularn proses ve kullanma sular olarak
yeniden deerlendirmektedirler. Bu balamda, zellikle atksularnda tortulama kabiliyeti
yksek kalsiyum bulunan endstriler dikkat ekmektedirler. Doada kalsiyum, mikrobiyal
karbonat kelim prosesleri ile kelmektedir. Bu proseslerden bir tanesi re hidrolizi sonucu
ortam pH deeri ve alkalinitesinin art esasna dayanan rolitik mikrobiyal karbonat kelim
prosesidir. Kalsiyum ierii yksek kat fabrikas atksuyunun simule edidii su numunesiyle
kesikli olarak almalar yaplmtr ve proses performansn etkileyen organik madde, re,
kalsiyum, pH ve biyoktle deriimleri gibi evresel artlar incelenmitir.
Anahtar Kelimeler aerobik; kelim; kalsiyum; rolitik
1. Giri
Doal sularda bulunan kalsiyum, insan ve dier canllar iin gerekli olan elementlerden bir
tanesidir. Sularda bulunan kalsiyumun doal artlar altnda mikrobiyal karbonat kelimi olarak
bilinen doal prosesler sonucu kalsiyum karbonat, jips ve kalsiyum fosfat eklinde kt
uzun zamanlardan beri bilinmektedir (Castanier ve di,1999). eker, atk kat geri kazanm,
kemik ileme, sitrik asit retim fabrikalarnn atksular ile gen deponilerde oluan sznt
sularnda 1500 mg Ca
+2
/l gibi yksek deriimler de bulunabilen kalsiyum, s tama
sistemlerinde kelerek s transfer verimini azaltmas ve tama borular, bulak - amar
makinelerinin ksa srede eskimesi gibi deiik problemlere neden olmaktadr (Langerak ve
di., 1997; Langerak ve di., 1998; Hammes ve di., 2003a, Yu ve di., 2001). Yksek
kalsiyum ierii bu endstri atksularnn anaerobik artmnda da eitli artm problemleri
meydana getirmektedir. Reaktr i ve k yaplarnn CaCO
3
kelekleri ile kabuk balamas,
tortular sebebiyle reaktrn etkin hacminin, suyun tamponlama kapasitesinin, bakteriyel
metanojenik aktivitenin azalmas bu problemler arasnda saylabilir (Kennedy ve di., 1988).
Bu almada Endstriyel atksulardan Ca gideriminde rolitik mikrobiyal karbonat kelim
prosesi ve bu prosesi etkileyen parametreler aratrlmtr. rolitik Mikrobiyal Karbonat
kelimi; Ca ierii yksek atksuya eklenen renin, bakterilerin hcre sentezi iin gerekli azot
ihtiyacn karlamak iin reaz enzimi ile hidrolizi sonucu oluturduu amonyan atksuyun
pH deerini artrmas (1), reden ve organik karbonun paralanmas sonucu CO
3
oluumu (2) ve
bakterilerin kelim prosesinin olumas iin ekirdek grevi oluturmas (3) esasna dayanr
(Hammes ve di.2003b). Laboratuvarda retilen reolitik kark kltr bakterilerinin kat
fabrikas atksularn temsil eden sentetik atksudan Ca giderim verimi zerine pH, Biyoktle,
Ca, Organik madde ve re deriimlerinin etkisi aratrlmtr.

422 L. Alta, Y. Kurma, M.Ik


2. Materyal ve Metot
Aksaray ili evsel atksularn artan uzun havalandrmal aktif amur tesisinden alnan
mikroorganizmalar srekli re ile tazelenen ortama alanarak biyoktle retimi
gerekletirilmitir. alkalama hz 150 rpm ve ortam scakl 30Cye ayarlanm inkbatrde
bileimi aada verilen sentetik atksu ve a aktif amurun bulunduu kesikli reaktrlere(500
mllik erlen) ilave edilmitir. re hidroliz eden mikroorganizmalar aerobik ortamda inkbe
edilmitir. Dikkate alnan endstriyel atksularn KO ierii yksek olduundan aerobik
heterotrof mikroorganizma kltrnn hem KO hem de kalsiyum giderimi iin uygun olaca
dnlmtr. st svlar gn ar deitirilerek sentetik ortam yenilenmi, bakterilere taze
karbon, azot, fosfor ve iz elementler salanmtr. Deneylerde kat fabrikas atksuyu ve evsel
atksuyu simule edecek aadaki mineral bileim kullanlmtr (Kim ve di, 2004; Holakoo ve
di. 2007) (mg/l); MgSO
4
.7H
2
O (1540), Na
2
CO
3
(477), NaHCO
3
(378), FeCl
3
.6H
2
O (19),
CuSO
4
.5H
2
O (0.118), NaMoO
4
.2H
2
O (0.210), CaCl
2
(33), MnSO
4
.H
2
O (0123), ZnCl
2
(0.229),
KH
2
PO
4
(132). Bu bileime ilave olarak deneyin amacna uygun bileim ve artlar Tablo 1de
verilmitir. Tm analizler standart yntemlere gre yaplmtr (APHAAWWAWEF, 2005).
Amonyum Merc-Spectroquant kitler ile llmtr.
3. Bulgular ve Tartma
rolitik kalsiyum gideriminde rol alan heterotrofik kltrn azot ihtiyac renin hidrolizi ile
karlanmaktadr. KOI deriimleri arttka aktivite artaca iin re hidroliz hz da artacaktr ve
aa hzl bir ekilde amonyak salnm olacaktr. Ancak fazla KOIde biosentezde ortamdaki
amonyum-azotunun harcanmasna neden olaca iin ortam pHnn dmesine neden olacaktr.
Kalsiyum giderimi iin ortam pH, alkalinite (CO
3
-2
) deriimi ve bioktle deriimi iin en uygun
KOI deriiminin ekil 2de 750 mg/l glikoz-KOIsi olduu grlmektedir.
Tablo 1. Kesikli deneylerde kullanlan bileim ve deney artlar
Bileim ve parametre KO re Kalsiyum pH Biyoktle
Deney sresi, gn 7 7 8 7 7
Etkin hacim, ml 180 450 100 100 100
amur, mg UAKM/l

mg AKM/l


901
1024
500
556
250
224
01600
01818
Glikoz-KO, mg/l

01500 3000 3000 3000 3000
re deriimi, mM 10 064 15 15 15
Ca
+2
deriimi, mM 10 15 02500 600 600
pH 8.1 7 7 410 7
Scaklk, T, C 20 20 20 20 20
alkalama hz, rpm 175 iddetli havalandrma 175 175 175
0 64 mM re deriimleri 15 mM Ca
+2
ieren sentetik atksudan Ca giderimi iin test edilmitir.
re hidrolizi sonucu artan pH ve aa kan inorganik karbon Caun CaCO
3
olarak kmesini
salamtr. 16 mM re deriimi ile optimum Ca giderimi elde edilirken, 32 ve 64 mMlk re
deriimlerinde maksimum Ca giderimi elde edilmitir. Biyokatalitik kalsiyum gideriminde
kullanlan re maliyet girdisi ve azot yknn artmasna sebep olduu iin optimum re
dozunun uygulanmas srecin iletilmesinde nemli parametrelerden biri olmaktadr.


Biyokatalitik Kalsiyum Giderimi ve Etki Eden Faktrler 423


Glikoz-KO (0 - 1500 mg/l) re (0 - 64mM) Kalsiyum (0 - 2500 mg/l)










ekil 1. Glikoz-KOI, re ve kalsiyum etkisi
0 2500 mg/l aras kalsiyum deriimlerinin kalsiyum giderimi zerindeki etkisinin test edildii
almada kalsiyum deriimleri artmas CaCO
3
oluumunu attrd gzlenmitir. CaCO
3

znrlk denklemi gerei bu almadan beklenen bir sonutur. almalarda 2. ve 3. gnn
sonunda Ca gideriminin bir miktar azalmas; KOnin tkenmesi ve amonyumun sentez ve
muhtemel nitrifikasyonla azalmas sonucunda pH ve alkalinite dmesi nedeni ile CaCO
3
n
yeniden znmesinden kaynaklanabilmektedir (Ik, 2008).
Balang 0 1600 mg/l biyoktle deriimlerim ve 4 10 pH deerlerinin kalsiyum giderimi
zerindeki etkisi ekil 3de gsterilmitir. Biyoktle deriiminin dk olmas re hidroliz

7.5
7.6
7.7
7.8
7.9
8.0
8.1
8.2
8.3
8.4
0 1 2 3 4 5 6 7
p
H

7.0
7.5
8.0
8.5
9.0
0 1 2 3 4 5 6 7
p
H

4.0
5.0
6.0
7.0
8.0
0 1 2 3 4 5 6 7 8
p
H

0
5
10
15
20
25
30
35
40
45
50
0 1 2 3 4 5 6 7
a
m
o
n
y
u
m
,

m
g
/
l

0
100
200
300
400
500
600
0 1 2 3 4 5 6 7
a
m
o
n
y
u
m
,

m
g
/
l

0
500
1000
1500
2000
2500
0 1 2 3 4 5 6 7 8
k
a
l
s
i
y
u
m
,

m
g
/
l .
.
.

0
200
400
600
800
1000
0 1 2 3 4 5 6 7
T
O
K
,

m
g
/
l

0.50
0.60
0.70
0.80
0.90
1.00
0 1 2 3 4 5 6 7
U
A
K
M
/
A
K
M

0.50
0.60
0.70
0.80
0.90
1.00
0 1 2 3 4 5 6 7 8
U
A
K
M
/
A
K
M
125
175
225
275
325
375
0 1 2 3 4 5 6 7
k
a
l
s
i
y
u
m
,

m
g
/
l
.
.
.
iletme sresi, gn
0
100
250
500
750
1000
1500

0
100
200
300
400
500
600
0 1 2 3 4 5 6 7
iletme sresi, gn
k
a
l
s
i
y
u
m
,

m
g
/
l .
.
.
0 2 4 8
16 32 64

0
100
200
300
400
500
600
700
800
0 1 2 3 4 5 6 7 8
iletme sresi, gn
g
i
d
e
r
i
l
e
n

C
a
,

m
g
/
L
0 300 600 900
1500 2000 2500
424 L. Alta, Y. Kurma, M.Ik


hzn ve inorganik karbon oluum hzn drdnden deney sresince kalsiyum giderimi
dk elde edilmitir. Yksek pH etkisi balangta Ca giderimini artrmtr. Yksek pH
deerleri CaCO
3
oluumu iin uygundur. Ancak CaCO
3
olutuktan sonra tekrar pH dt iin
inkbasyonun sonuna doru rneklerde pH fark azalmtr.

Biyoktle etkisi (0-1600mg AKM/l) pH etkisi (4-10)








ekil 2.Biyoktle ve pH etkisi

6.0
6.5
7.0
7.5
8.0
8.5
0 1 2 3 4 5 6 7
p
H

4
5
6
7
8
9
10
0 1 2 3 4 5 6 7
p
H

0
50
100
150
200
250
300
350
0 1 2 3 4 5 6 7
a
m
o
n
y
u
m
,

m
g
/
l

0
100
200
300
400
500
0 1 2 3 4 5 6 7
T
N
,

m
g
/
l

0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
0 1 2 3 4 5 6 7
U
A
K
M
/
A
K
M

0.5
0.6
0.7
0.8
0.9
1.0
0 1 2 3 4 5 6 7
U
A
K
M
/
A
K
M

0
100
200
300
400
500
600
0 1 2 3 4 5 6 7
letim sresi, gn
k
a
l
s
i
y
u
m
,

m
g
/
l
0 50 100
200 400 800
1600

0
100
200
300
400
500
600
0 1 2 3 4 5 6 7
iletim sresi, gn
k
a
l
s
i
y
u
m
,

m
g
/
l
4 5 6 7
8 9 10
Biyokatalitik Kalsiyum Giderimi ve Etki Eden Faktrler 425


Teekkr
Bu alma TUBTAK-AYDAG 105Y262 nolu proje ile desteklenmitir.
Kaynaklar
APHAAWWAWEF, (2005). Standard Methods of Examination of Water and Wastewater, 21st ed. American
Public Health Association, Washington DC, USA. Control Fed. 57.
Castanier, S., Metayer-Levrel, G.L. and Perthuisot, J,P. (1999). Cacarbonates precipitation and limestone genesis-the
microbiogeologist point of view. Sediment Geol. 126, 923.
Hammes, F., Seka, A., Hege, K.V., Wiele, T.V., Vanderdeelen, J., Siciliano, S.D., and Verstraete W, (2003a).
Calcium removal from industrial wastewater by bio-catalytic CaCO3 precipitation. J. Chem. Technol. Biotechnol.
78, 670677.
Hammes, F., Seka, A., Knijf, S. ve Verstraete, W. (2003b). A novel approach to calcium removal from calcium-rich
industrial wastewater. Water Res. 37, 699704.
Holakoo, L., Nakhla, G., Bassi, A.S. ve Yanful, E.K.F. (2007). Long term performance of MBR for biological
nitrogen removal from synthetic municipal wastewater. Chemosphere 66, 849857.
Ik M. (2008). Batch investigation of biocatalytic calcium removal from synthetic wastewater. Fresenius
Environmental Bulletin. 17(2), 197-202.
Kennedy, K.J, Hamoda, M.F. ve Guiot, S.G. (1988). Anaerobic treatment of leachate using fixed bed and sludge bed
systems. J. Water Pollut. Control. Fed. 60, 1675-1083.
Kim, Y.H., Yeom, S.H., Ryu, J.Y. ve Song, B.K. (2004). Development of a novel UASB/CO2-stripper system for the
removal of calcium ion in paper wastewater. Process Biochem. 39, 13931399.
Van Langerak, E.P.A., Gonzales-gill, G., Van Aelst, A., Van Lier, J.B., Hamelers, H.V.M. ve Lettinga, G. (1998).
Effect of high calcium concentrations on the development of methanogenic sludge in upflow Anaerobic Sludge
Bed (UASB) reactors. Water Res. 32, 1255-1263.
Van Langerak, E.P.A., Hamelers, H.V.M. and Lettinga, G. (1997). Influent calcium removal by crystallization
reusing anaerobic effluent alkalinity. Water Sci. Tech. 36, 341348.
Yu, H.Q., Tay, J.H. and Fang, H.H. (2001). The roles of calcium in sludge granulation during UASB reactor start-up.
Water Res. 35, 10521060.






.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Entegre Et Ve Et rnleri Endstrisi Atksularnn
Koaglasyon-Floklasyon le Artlabilirliinin ncelenmesi
Fuat zyonar ve Bnyamin Karagzolu
Cumhuriyet Universitesi, evre Mhendislii Blm, 58140, Sivas
E-posta: fozyonar@cumhuriyet.edu.tr

z Bu almada entegre et ve et rnleri endstrisi atksularnn koaglasyon ve floklasyon
prosesiyle artm incelenmitir. Bu amala, alminyum ve demir tuzlarnn kullanld
prosesinde, balang pHn ve koaglant dozajnn; KOI ve trbitide giderme verimi zerine
etkisi aratrlmtr. En yksek KOI giderme verimi %36,91 verim ile alminyum slfat
koaglant maddesi (Al
2
(SO
4
)
3
.18H
2
O) ile gerekletirilmitir. Trbitide gideriminde ise
alminyum slfat ile %89,80 giderme verimi elde edilmitir. Demir slfat koaglant maddesinin
(Fe
2
(SO
4
)
3
.6H
2
O) kullanld deneysel almalarda ise KOI giderme verimi % 27,68 olarak ve
trbitide giderme verimi ise % 85,90 olarak gereklemitir.
Anahtar Kelimeler atksu artm; koaglasyon ve floklasyon; entegre et ve et endstrisi atksular
1. Giri
eitli endstriyel proses ilemleri sonucunda ortaya kan ve kirlenmeye sebep olan atksular
inorganik yada organik kkenli maddeleri iermektedir. Bu endstriyel atksular dearj
edildikleri alc ortamlarda kirlenmelere neden olmakta ve ekolojik dengenin bozulmasna sebep
olmaktadr. Entegre et ve et rnleri endstirisi atksular ierdii yksek miktardaki kirleticiler
sebebiyle dearj ncesi artlmas zorunlu olan bir atksudur. Bu endstriye ait olan atksularn
artlmas iin gerekli fiziksel, kimyasal ve biyolojik artma teknikleri gelitirilmitir (Al-Mutairi
vd., 2004; Aquilar vd., 2003; Aquilar vd., 2005; Aquilar vd., 2003). Ancak bu nitelikteki bir
atksuyu artmak iin baz yntemler tek bana kullanldnda yetersiz kalmakta yada iletme
problemleri ortaya kmaktadr (Nunez vd., 1999; Borja vd., 1998; Del. Pozo v.d., 2000). Bu da
eitli artma alternatiflerinin aratrlmas zorunlu klmaktadr.
Kimyasal artmada yaygn olarak kullanlan koaglasyon ve floklasyon prosesi su ve atksu
artmnda geni bir kirletici grubunun giderilmesinde yaygn bir ekilde kullanlan bir prosestir.
Koaglasyon, kolloidal sspansiyon iindeki ykl partikllerin zt ykl iyonlarla karlkl
arpmas ile ntralize edilip bir araya toplanarak kelmelerin salanmas olaydr.
Floklasyon ise oluan bu yumaklarn daha byk floklar oluturulmas iin yaplan ilemdir.
Bu amala, uygun kimyasal maddeler ilave edilir. Alminyum ve demir tuzlar en ok
kullanlan koaglant maddelerdir. Koaglasyon - floklasyon prosesinde suya kimyasal madde
ilavesiyle, suda bulunan askda ve znm maddelerin yaplarn deitirilerek yada ilave
edilen maddelerin oluturduu fiziksel etkenler ile suda bulunan maddelerin sudan
uzaklatrlmas salanr (Eckenfelder, 1989). Koaglasyon ve floklasyon prosesi ana
blmden meydana gelmektedir. Birincisi koaglant ilavesi ile hzl kartrma, ikincisi
yardmc koaglant madde ilavesi ile yava kartrma ve son olarak oluan yumaklarn
keltilmesi iin kelme ilemlerinden oluur. Hzl kartrma ilemi ile koaglant maddenin
428 F. zyonar, B. Karagzolu


suya hzl bir ekilde homojen olarak dalmas salanr. Bu ilem olduka ksa olmakla birlikte
15 sn-5dk arasnda gerekleebilir. Ancak sre uzadka oluan yumaklarn krlmas sz
konusu olabilir. Bu uygulamada hz 200rpm-300rpm arasnda kullanlabilir. Yava kartrma
ilemi taneciklerin bir araya getirilip yumaklarn daha da byk hale getirilmesi iin yaplr.
Kartrma genellikle 15-45 dk arasnda ve 20-120 rpm arasnda gerekletirilmektedir. Oluan
yumaklarn kelerek uzaklatrlmas iin keltim sresi 30-60 dakika arasnda
gereklemektedir. Bu proseste optimum ve ekonomik koaglant madde dozajnn belirlenmesi
olduka nemli bir aamadr. Yksek koaglant dozu amurun susuzlatrlmasn zorlatrrken,
dk dozlar ise su ierisindeki askdaki maddelerin giderimini azaltr. Dier nemli bir aama
ise optimum pHn seimidir. nk oluan hidroksil radikal trleri pHa bal olarak
olumaktadr. Bir kimyasal kimyasal artma prosesi olarak koaglasyon - floklasyon prosesi
tekstil atksularnn artlmasnda, ar metallarin sudan uzaklatrlmasnda, sznt sularnn
artlmasnda, fosforun ve kat maddelerin giderilmesinde yaygn olarak kullanlmaktadr
(engl ve Kkgl, 1997).
Bu amala bu almada, koaglasyon - floklasyon prosesi ile entegre et ve et rnleri
endstrisi atksularnn artlmas amalanmtr. Yaplan almada, atksulardan kimyasal
oksijen ihtiyac (KOI) ve trbidite giderimi zerine pH ve koaglant dozaj parametrelerinin
etkisi incelenmi ve bir deerlendirme yaplmtr.
2. Materyal ve Metod
2.1. Materyal
almalarda kullanlan atksu, bir entegre et ve et rnleri endstrisi tesisin kndan temin
edilmitir. Bu tesiste oluan atksu tesiste herhangi bir fiziksel, kimyasal ve biyolojik artm
uygulanmadan kanalizasyona dearj edilmektedir. Numune atksuyun kanala girmeden nceki
yapsndan alnmtr. Tablo 1de bu atksuyun karakterizasyonuna ilikin yaplan analiz
sonular verilmitir.
Tablo1. Entegre et endstrisi tesisinin k atksuyunun zellikleri
Parametre Deeri
pH 6,72-7,27
KOI(mg/l) 3337-4150
BOI(mg/l) 1950-2640
AKM(mg/l) 980-1200
Ya-Gres(mg/l) 275-376
letkenlii (S/cm) 1616-2270



Bulanklk(NTU) 265-356
2.2. Deneysel lem
Tm deneysel ilemler oda scaklnda 6l jar testi aparatnda gerekletirilmitir.
Koaglasyon - flokulasyon deneylerinde, atksu artm zerine koaglant dozajnn ve pHnn
etkisi aratrlmtr. Koaglasyonda alminyum ve demir tuzundan oluan 2 farkl koagulant
madde kullanlmtr ( Al
2
(SO
4
)
3
.18H
2
O, Fe
2
(SO
4
)
3
.6H
2
O). Her bir koaglant iin kimyasal
koaglasyon deneylerinde 500 ml atksu alnarak pH ayarlamas yaplm ve daha sonra 200
rpmde 5 dakika hzl kartrma, 45 rpmde 15 dakika yava kartrma ve 1 saat kme
srelerinden sonra filtre katndan szlen numunelerde gerekli (KOI ve trbidite) analizler
Entegre Et Ve Et rnleri Endstrisi Atksularnn Koaglasyon-Floklasyon le Artlabilirliinin
ncelenmesi
429


yaplmtr. Buradan elde edilen veriler deerlendirilerek optimum pHlar tespit edilmitir. Ayn
ekilde optimum pHlarda farkl koaglant dozajlarnda deneyler yaplarak optimum koaglant
dozajlar belirlenmitir.
KOI ve trbidite lmleri standart metodlarda belirtilen analiz yntemlerine (Standard
Methods for Examination of Water and Wastewater) gre yaplmtr. Analizlerde Chebos
marka optimum-one UV-VIS spektrofometre, HF marka MicroTP arazitipi trbidimetre,
Merck marka spectroquant TR320 model termoreaktr, Consort marka C931 Model pH-metre
ve WTW Marka 340 model arazi tipi iletkenlik cihaz kullanlmtr.
3. Tartma ve Sonu
3.1. Balang pHn Etkisi
Entegre et ve et rnleri tesisi atksuyunun kimyasal olarak koaglasyon - floklasyon prosesi
ile artlmasnn incelenmesinde ilk olarak pHn etkisi aratrlmtr. Bu amala baz sabit
artlar seilerek deneyler yaplmtr. Her bir koaglant iin 200 mg Fe
+
/l ve 200 mg Al
+
/l sabit
koaglant dozaj, hzl kartrma iin 5 dakika 200 rpm ve yava kartrma iin 15 dakika 45
rpm kartrma hz ve 60 dakika kelme sresi sabit koullar olarak alnmtr. pH etkisini
incelemek iin atksu balang pH 3-8 aralnda seilerek bu pHlardaki KOI ve trbitide
giderme verimleri incelenmitir.
Al
2
(SO
4
)
3
.18H
2
O koaglantnn % KOI giderme verimi incelendiinde pH arttka verimde bir
art olduu gzlemlenmitir. Bu art pH:7den sonra bir d gstermitir. ekil 1den de
grld gibi KOI ve trbidite giderme veriminin srasyla bu pHdeerinde %36,43 ve
%89,80 gerekletii grlmektedir. Elde edilen sonular deerlendirildiinde en uygun pH
deerinin, atksuyun pHsna da yakn olmas nedeniyle pH: 7 olduuna karar verilmitir.
Koaglant maddesi Fe
2
(SO
4
)
3
.7H
2
Onun kullanld koaglasyon - flokulasyon denemelerinde
ise pH:7de % 27,78 KOI ve % 85,90 Trbidite giderim verimleri elde edilmitir. Sonuta her
iki parametre iin pH:7de en yksek giderme verimleri elde edilmitir. Bu nedenle
Fe2(SO4)3.7H2O iin optimum pH : 7 olarak kabul edilmitir.
0
10
20
30
40
50
2 3 4 5 6 7 8 9
Balang pH
K
O
I

g
i
d
e
r
m
e

v
e
r
i
m
i

(
%
)
Al2(SO4)3.18H2O
Fe2(SO4)3.7H2O

ekil 1. Kimyasal koaglasyonda pHn KOI giderme verimi zerinde etkisi
430 F. zyonar, B. Karagzolu


30
40
50
60
70
80
90
100
2 3 4 5 6 7 8 9
Balang pH
T

r
b
i
d
i
t
e

g
i
d
e
r
m
e

v
e
r
i
m
i

(
%
)
Al2(SO4)3.18H2O
Fe2(SO4)3.7H2O

ekil 2. Kimyasal koaglasyonda pHn trbitide giderme verimi zerine etkisi
Sonu olarak Al
2
(SO
4
)
3
.18H
2
O ve Fe
2
(SO
4
)
3
.7H
2
O iin optimum pH: 7. Ancak her iki
koaglant madde iin % KOI giderim verimlerine bakldnda % 9,46 - 36,76 oranlarda
deitii ve ok fazla bir giderimin salanmad grlmektedir. Ancak trbitide asndan
yksek giderme verimleri elde edilmitir.
3.2. Koaglant Dozajnn Etkisi
Koaglasyon - floklasyon prosesinde, koaglant dozajnn etkisini belirlemek iin pH
deneylerinde belirlenen optimum pH deerleri baz alnmtr. Koaglasyon - floklasyon
prosesinde koaglant dozajnn KOI giderimi zerindeki etkisininin incelendiinde, koaglant
dozaj deiimin KOI gideriminde en yksek deerine, Al
2
(SO
4
)
3
.18H
2
O koaglant ile 200 mg
Al
+3
/ l dozaj deerinde, en yksek giderim verimleri KOI iin % 36,91 ve trbidite iin %
89,80 ve Fe
2
(SO
4
)
3
.7H
2
O koaglantnn kullanld denemelerde 200mg Fe
+3
/l dozaj
deerinde KOI iin % 27,68 ve trbidite iin % 85,90 giderme verimleri elde edilmitir.
0
5
10
15
20
25
30
35
40
0 100 200 300 400 500 600 700 800
Koaglant dozu (mg/)l
K
O
I

g
i
d
e
r
m
e

v
e
r
i
m
i

(
%
)
Al2(SO4)3.18H2O
Fe2(SO4)3.7H2O

ekil 3. Kimyasal koaglasyonda koaglant dozajnn KOI giderme verimi zerine etkisi
Entegre Et Ve Et rnleri Endstrisi Atksularnn Koaglasyon-Floklasyon le Artlabilirliinin
ncelenmesi
431


0
10
20
30
40
50
60
70
80
90
100
0 100 200 300 400 500 600 700 800
Koaglant Dozu
T

r
b
i
d
i
t
e

g
i
d
e
r
m
e

v
e
r
i
m
i

(
%
)
Al2(SO4)3.18H2O
Fe2(SO4)3.7H2O

ekil 4. Kimyasal koaglasyonda koaglant dozajnn trbitide giderme verimi zerine etkisi
4. Sonular
Elde edilen sonular neticesinde entegre et ve et rnleri endstrisi atksularnn 2 farkl
koaglant madde kullanlarak koaglasyon - flokulasyon prosesiyle artlmasn da trbidite
parametresi iin yksek giderme verimleri elde edilmesine ramen KOI parametresinin
giderilmesinde yksek giderme verimleri elde edilememitir. Dolaysyla entegre et ve et
endstrisi atksularnn artmnda zellikle askdaki maddelerin giderilmesinde koaglasyon
floklasyon prosesi etkili bir yntem iken KOI gideriminde etkili bir yntem olmad
grlmtr. Ancak koaglasyon floklasyon prosesi baka proseslerle entegre edilerek
kullanldnda daha yksek giderme verimleri elde edilebilir.
Kaynaklar
Al-Mutairi, N.Z., Hamoda, M.F., Al-Ghusain, I., (2004). Coagulant selection and sludge conditioning in a
slaughterhouse wastewater treatment plant, Bioresource Technolgy, 95, 115-119.
Aquilar, M.I., Saez, J., Llorens, M., Solar, A., Ortuno, J.F., (2003). Microscopic observation of particle reduction in
slaughterhouse wastewater by coagulation-flocculation using ferricsulphate as coagulant and different coagulant
aids, Water Research, 37, 2233-2241.
Aquilar, M.I., Saez, J., Llorens, M., Solar, A., Ortuno, J.F., Meseguer, V., Fuentes, A., (2005). Impronement of
coagulation- flocculation process using anionic polyacrylamide as coagulant, ????, 58, 47-56
Aquilar, M.I., Saez, J., Llorens, M., Solar, A., Ortuno, (2003). Particle size distribution in slaugterhouse wastewater
before and after coagulation-flocculation, Environmental Progress, 22 (3), 183-188.
Borja, R., Banks, C., J., Wang, Z., J., and Mancha, A., (1998). Anaerobic Digestion Of Slaughterhouse Wastewater Using A
Combinaiion Sludge Bianket And Flter Arrangement n A Single Reactor, Bioresource Tech, 65 (1-2), 125-133.
Del Pozo, P., Diez, V., Beltrain, S., (2000). Anaerobic pre-treatment of slaughterhouse wastewater using fixed-film
reactors, Bioresource Technology, 71, 143-149.
Eckenfelder, W. W. Jr., (1989). Industrial Water Poluution Control (Second Edition), McGraw-Hill Internal Editions,
Civil Engineering Series, Printed in Singapore.
Nunez, L.A., Martinez, B., (1999). Anaerobik treatment of slaughterhouse wastewater in an expended granular sludge
bed (EGSB) reactor, Water Sci. Technol. 40, 99-106.
engl, F., ve Kkgl, E.Y., 1997, evre Mhendisliinde Fiziksel- Kimyasal Temel lemler ve Sreler, Dokuz
Eyll ni. Mhendislik Fak. Yaynlar , No: 153, 4. Bask.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Kimyasal Deposition Yntemiyle mmobilize ZnO Hazrlanmas
ve Fotokatalitik Sistemde Test Edilmesi
A. Akyol
1
ve M. Bayramolu
2

1
Gebze Yksek Teknoloji Enstits, evre Mhendislii Blm, 41400 Gebze, Trkiye
E-posta: abdurrahmanakyol@gmail.com
2
Gebze Yksek Teknoloji Enstits, Kimya Mhendislii Blm, 41400 Gebze, Trkiye

z Atksularn artlmasnda zellikle son yllarda ileri oksidasyon proseslerinden heterojen
fotokatalitik degradasyon byk nem kazanmtr. Bu proses UV nn yar iletkenlerle
etkilemesiyle ortaya kan elektron/delik iftlerinin ortamdaki su ve znm oksijen ile
etkileime girerek oluturduu hidroksil radikali, speroksit anyonu ve hidrojen peroksit gibi
kuvvetli oksidantlar organik-inorganik maddeleri ykseltgeyip paralanmas esasna
dayanmaktadr. Yar iletkenlerden zerinde ok durulan TiO
2
ve ZnO gibi fotokatalizrlerin sv
ortamda datlm toz olarak kullanlmasnda, katalizrn zeltiden ayrlmas ve geri
kazanlmasnda teknik zorluklar ve yksek maliyet nedeniyle bir tayc madde zerine tutuk-
lanmas tercih edilmektedir. Tutuklanma ilemi iin eitli yntemler bulunmaktadr. Bunlar
sol-jel, impregnation, termal fiziksel kimyasal buhar deposition, spray pyrolysis, pulse lazer
deposition, anodizing, kimyasal deposition gibi birok yntem bulunmaktadr. Bunlar arasnda
sol-jel en yaygn olarak kullanlan metottur. Sol-jel metodu bir sol hazrlayarak bir tayc
madde zerine dipping, drain coating, spin coating gibi kaplama eklinde uygulanmaktadr.
Bunlar arasnda en yaygn olarak kullanlan. Islatma veya sol-jel metodunda, tayc madde
zerine kaplama bir zelti veya sole daldrma, (dip coating, spin coating) eklinde uygulan-
maktadr. Tayc madde olarak cam plaka, cam kre, alminyum folyo, silika cam madde,
teflon, zeolit, fiber optik, silika jel gibi ok eitli maddeler denenmektedir. Bu almada
katalizr olarak kolay eldesi ve zellikle az allm olmas nedeniyle inko oksit kullanld.
Tayc, inko zeltisi bileimi ve metot seiminde; maliyet, kolay temin edilebilirlik, pratik
uygulanabilirlik gibi kriterler gz nne alnd. Tutuklama yntemi olarak slatma veya
kimyasal deposition metodu seildi. inko oksiti tayc madde zerine tutuklamak iin inkat
zeltilerinden faydalanld. Burada ama, hazrlanmas kolay, pahal organik solventler ve
organik tuzlara ihtiya duymayan ucuz bir daldrma zeltisi kullanmaktr. alma kapsamnda
fotokatalizr performansn deerlendirmek iin ok bilinen bir model bileik olan metil oranj
boyasnn mikro reaktrde renk giderimi takip edilmitir. Fotokatalizr retmek iin tayc tr
ve cinsi, kaplama daldrma says, inkat konsantrasyonu zerinde durulmutur. Krk paralarn
dz yzeylere gre daha aktif performans gsterdii grlmtr. Ayrca 0,2 M inkat
konsantrasyonu ve 10 dipping yaplarak yrtlen almalarda en pozitif sonular alnmtr.
Anahtar Kelimeler amonyum inkat; dekolorizasyon; fotokatalitik degradasyon; kimyasal
depozit; metal oranj; UV k; ZnO
1. Giri
TiO
2
, ZnO gibi yariletkenlerle fotokatalitik atksu artma, ileri oksidasyon yntemleri arasnda
olduka nemli bir yer tutmaktadr. Geni bandgapli (3,2eV) ZnO ucuz bir fotokatalizr olarak
bu alanda zellikle dikkati ekmektedir (Pal ve di. 2002). Toz halde kullanldnda artlm
sudan uzaklatrlmas zorluklar ve yksek ayrma maliyeti nedenleriyle, uygun bir tayc
434 A. Akyol , M. Bayramolu


(destek) zerinde ince film halinde tutuklanm olarak kullanlmasnn daha uygun olaca
dnlmektedir.
Fotokatalitik yntemle atksu artm prosesinin performans ve ekonomisi asndan iin en
uygun destek malzemesinin ve katalizr tutuklama metodunun seimi ncelikli olarak karar
verilmesi gereken hususlardr. Destek malzemesinin ucuz olmas, kolay temini, uygun formda
olmas ve atksu ortamnda inert olmas, katalizrn destek yzeyinde istenilen katalitik
etkinlikte ve salam bir ekilde tutuklanmas istenilen hususlardr. Tutuklama ynteminin ise
basit, ucuz olmas, srekli retime uygun olmas, proses kontrolne yatknl, devaml ayn
kalitede desteklenmi katalizr retmesi seiminde dikkate alnmas gereken noktalardr. inko
oksit film elde etmek iin eitli metotlar nerilmitir: termal oksidasyon, elektron beam
evaporation, spray pyroliz (Badawy ve di. 1997) farkl formlarda sputtering (Stromme ve di.
1996) , CVD (chemical vapor deposition) (Gauthier ve di. 1999), sol-gel ve CD (chemical
deposition) (Mitra ve di. 2006, Shinde ve di. 2007) gibi metotlar uygulanmaktadr. Bunlar
arasnda CD, uygulama kolayl ve greceli olarak daha dk maliyeti nedeniyle vaat edici bir
metot olarak nem kazanmaktadr.
Bu almada yukarda bahsedilen kriterlere uygun destek malzemesi ve tutuklama ynteminin
seimi amalanmaktadr. Destek malzeme olarak porselen ve cam, kriterlerimize uymas
nedeniyle, tercih edilmilerdir. Destek yzeyinin kimyasal yaps, kristal yaps, yzey enerjisi
gibi atomik boyuttaki zellikleri, ZnO kristallerinin koheyon-adhezyon kuvvetleriyle yzeye
balanma derecesini etkileyen nemli hususlardr. Dier taraftan, yzey przll katalizrn
yzey film kalnln ve yzeyde tutuklanma derecesini etkileyebilecek bir mikroskopik
zelliktir. Makroskopik lekte ise, destein geometrik formu, fotokatalitik reaktrde katalizr
yzeyi/reaktr hacmi orann belirlemekte olup incelenmesi gereken baka nemli bir
deikendir. Bu almada tutuklama yntemi, slatma veya kimyasal deposition metodu olarak
amonyum inkat metodunun uygulanmtr.
2. Deneysel Ksm
2.1. Deney Dzenei.
Mikro fotoreaktr deney sistemi kullanlmtr. Reaktrde homojen k ortam oluturmak iin
365nmlik 6 adet UV lamba ile kuatlmtr. Deneylerde reaksiyon sresince yeterli znm
oksijen salamak iin tank ierisine kartrc altna difzr yardmyla hava verilmitir.
Inlanmadan nce adsorpsiyon desorpsiyon dengesini salamak amacyla 30 dak karanlkta
boya zeltisi sikle edilmitir. Deneyler, mikro fotoreaktr sisteminde aadaki tablo 1de
verilen artlarda yrtlmtr:
Tablo 1. Fotokatalitik test sisteminde deney artlar
Parametre Deer
Kuartz mikroreaktr hacmi 55 cm
3

Reaktrde katalizr ktlesi 50 75 g
UV-A Lamba gc 36 Watt
Balang boya konsantrasyonu 20 mg/l
Sistemde toplam boyar madde zeltisi 1500 cm
3

Sv sirklasyon hz 20 cm
3
/min
Aratrmada, model bir organik bileik olarak, bu tr almalarda standart olarak kullanlan ve
tipik bir diazo boyarmadde olan metil oranj kullanlmtr. Bu bileik asit ortamnda krmz baz
Kimyasal Deposition Yntemiyle mmobilize ZnO Hazrlanmas ve Fotokatalitik Sistemde Test
Edilmesi
435


ortamnda ise turuncudur. Boya zeltisi UV-Vis spektrumda 270 nm ve 464 nm de iki
maksimum pik gstermektedir.. Deneyler 2 saat boyunca 6 adet UV lamba ile nlad ve boya
konsantrasyonlar UV/Visible Perkin Elmer lamda 35 spekrofotometresi kullanlarak 464 nm de
fiber optik probu ile srekli olarak (on-line) absorbans izlenerek deneyler gerekletirildi.
almada ZnO tutuklamal iin kimyasal, mekanik ve direnlarinden ayn zamanda dk
maliyetlerinden tr eitli cam ve porselen destekler kullanld. Ayrca kaplama verimini
artrmak iin tayc cam yzeyi kimyasal yntemlerle przlendirildi. Kimyasal yntemle
przlendirme ileminde % 50 NH
2
HF
2
, %10 NH
4
Cl , %20 CaSO
4
%20 NaCl ve %33 HCl
zeltisi bileiminde bir kimyasal karm kullanld.
Tayc madde olarak, dk maliyetli (krk paralar halinde retim artklar olarak maliyetsiz)
ve deiik atksu ortamlarnda inert olmalar nedenleriyle porselen ve cam maddeler boncuk,
krlm halde ve halka eklinde olmak zere deiik formlarda kullanld. Tayclara ait
zellikler tablo 1de zetlenmitir.
Table 2. Destek malzemelere ait genel zellikler
Tayc Simge Sipesifik yzey Yzey / Hacim
(cm
2
/g) (cm
2
/cm
3
)
Przlendirilmi cam boncuk(1 mm) A 24.0 32.7
Orjinal cam boncuk (1 mm) B 24.0 32.7
Przlendirilmi cam boncuk (3 mm) C 8.0 10.9
Orjinal cam boncuk (3 mm) D 8.0 10.9
Cam Halka (6 mm) E 6.6 10.5
Cam Halka (8 mm) F 8.7 8.5
Porselen Halka (6mm) G 5.7 10.5
Porselen Halka (8mm) H 4.5 8.5
Porselen Halka paralar I 4.6 4.1
2.2. Katalizr Hazrlanmas
2.2.1. Amonyum inkat zeltisinin hazrlanmas
Amonyum inkat zeltisinin hazrlanmas srasnda, hazr (ticari) ZnO veya Zn(OH)
2
in
amonyak zeltisinde olduka zor zndnden dolay zeltinin Zn konsantrasyonu ve
pHsnn istenilen deerlerde rahat ayarlanabilmesi iin taze ktrlm Zn(OH)
2
kullanld.
ZnSO
4
+ 2NH
4
OH Zn(OH)
2 +
+ (NH
4
)
2
SO
4
(1)
Zn(OH)
2
+ 2NH
4
OH (NH
4
)
2
ZnO
2
+ H
2
O (2)
2.2.2. Katalizr tutuklamas
Destek malzemesi zerinde kataliz film oluumu, destek yzeyine adhezyonla sv filmin
olutuu dip coating adm ve kurutma ve hidrolizin uyguland termal ilem adm olarak iki
admda gereklemektedir. Zn(OH)
2

in ZnO dnmesi iin 125 C zerinde bir scaklk


gerekmektedir. Standart bir tutuklama ilemi u ekilde gerekletirildi: 50 g tayc paslanmaz
kafese yerletirilerek amonyum inkat zeltisine daldrld. Kafes 1 dakika sresince zelti
iinde dndrlerek karld, askya alnarak 1 dakika zeltinin szmas iin beklenildi. Kafes
436 A. Akyol , M. Bayramolu


frn iinde 150
o
C de 10 dak. sresince kurutuldu. Bu ilem dizisi istenilen kaplama says
kadar tekrarland. Sonuncu ilemde tayc dolu kafes, frnda 200
o
Cde 10 dakika tutuldu.
3. Deney Sonular ve Yorumlanmas
Bu almada en uygun tayc materyal seimi zerine fotokatalitik aktivitesini deerlendirmek
iin reaksiyonun balang hz sabiti kullanlmtr. Bu deerlendirme kriterinin kullanm,
taycnn fotokatalitik testlerini differansiyel tip deneysel mikroreaktrde gerekletirdiimiz
iin dnlmtr. Bu mikroreaktr ile renk dnm dk olduu iin yksek korelasyonlu
lineer regresyon ile absorbans zaman erilerinin eimi balang hzn doru hesaplanmasn
salamaktadr. Ayrca fotokatalitik reaksiyon olaylar kataliz yzeyinde olduu iin tayclarn
aktivitesi, toplam yzey alan iin reaksiyon hz tanmlanarak deerlendirildi. Yzeysel
balang hz(Rs), fotokatalitik aktivite iin destein yzeyinin kullanmnn etkisini
vurgulamaktadr. Yzeysel reksiyon hz,
dt
dC
S
T
.
1
R
S
= mol/m
2
.min (3)
ZnO ince filmin fotokatalitik aktivitesi iin yzeysel temelli balang hzlar ekil 1ada
verilmitir. ekil 1ada cam boncuk, cam halka ve seramik materyal olarak 3 grup taycnn
yzey temelli aktivitelerinin artacak ekilde gruplandrlmtr. Bu ekillerden kan bir dier
sonu, kimyasal matlatrma ilemi ile cam yzeyinde yzeysel przlln oluturulmas baz
pozitif etkiler yaratsada ekstra maliyet getiren matlatrma ilemi iin ok kayda deer bir
katalitik etkinlik oluturmad belirlenmitir. Yap aktivite ilikisi atomik seviyede aratrlma-
ldr. Destek malzemelerinin aktivitesi kataliz yk ile farkl bir analiz ekli olarak deerlendiri-
lebilir. Her ekilde de en yksek aktivite seramik materyal ile krk yada halka (8mm) formunda
grlmektedir. Yzeye dayal aktivitede geometrik formun boyutunun etkisi ok nemlidir.
Tayc materyal
A B C D E F G H I
R
S

(
u
m
o
l
/

m
2
.
m
i
n
)
0.0
0.5
1.0
1.5
2.0
Yzey yk (mg ZnO/cm
2
)


0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40
R
s
(
m
m
o
l
/
m
2
.
m
i
n
)
0.0
0.5
1.0
1.5
2.0
A
B
C
D
E
F
G
H
I

(a) (b)
ekil 1. (a) eitli tayc materyallarn yzeysel balang hzlar (b) destek
malzemelerine tutuklanm ZnO kataliz ykne bal olarak yzeysel balang
hzlarnn deiimi
Sonu olarak yzey ve hacimsel aktivitenin her ikisinde de daha dk maliyetli olan atk
seramik malzemenin daha yksek aktiviteye sahip olduu aka grlmektedir. ZnO ince film
iin tayc material seildikten sonra ikinci adm olarak katalitik aktivite gibi baz amalarla
Kimyasal Deposition Yntemiyle mmobilize ZnO Hazrlanmas ve Fotokatalitik Sistemde Test
Edilmesi
437


proses artlarn maksimize etmek iin optimizasyon admdr. Bu amala inkat konsantrasyonu
ve daldrma- durutma (dipping) says seilmitir. 0.1 M amonyum inkat zeltisi ile 520
dipping yaparak kaplama says aratrld. ekil 2ada 10 dipping says en yksek yzey film
aktivitesi salamak iin yeterli olduu grld. 10 dipping ile ortalama 270 nm film kalnl
saland ve film kalnl ile dipping says arasnda lineer bir ilikinin varl grlmektedir.
Dipping(daldrma- kurutma) says
0 5 10 15 20 25
R
s
(
m
m
o
l
/

m
2
.
m
i
n
)
0.0
0.5
1.0
1.5
2.0
2.5

Dipping(daldrma- kurutma) says
4 6 8 10 12 14 16 18 20 22
F
i
l
m

k
a
l

n
l


(
n
m
)
100
200
300
400
500
600
700

(a) (b)
ekil 2. (a)Dipping(daldrma- kurutma) says ile yzeysel balang hzn deiimi
(b)Dipping(daldrma- kurutma) says ile ZnO ince film kalnlnn deiimi
inkat konsantrasyonu (M)
0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35
R
s
(
m
m
o
l
/

m
2
.
m
i
n
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0

inkat konsantrasyonu (M)
0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35
F
i
l
m

k
a
l

n
l


(
n
m
)
0
200
400
600
800
1000
1200
1400

(a) (b)
ekil 3. (a) inkat konsantrasyonunun balang hzna etkisi (b) inkat
konsantrasyonunun film kalnlna etkisi
Son olarak baz kataliz tutuklama ilemi farkl inkat konsantrasyonlarnda (0.05-0.30 M)
yrtld. ekil 3ada grld gibi, 0.05 M inkat konsantrasyonu tespit edilebilir bir
aktivite elde etmek iin en dk konsantrasyon olarak seilmitir. inkat konsantrasyonunun
0.2 M kadar artmasyla film kalnlnn artt ekil 3bde grlmektedir. 0.2 M zerindeki
konsantrasyonlarda film kalnl artarken katalitik aktivitenin dt grlmektedir. Yksek
inkat konsantrasyonlarnda erken hidroliz nedeniyle dip coating admnda zeltiden Zn(OH)
2

hzl bir ekilde kesine neden olur. Bu durumda oluan film homojen deildir ve dk
ktiviteye sahiptir. Yksek konsantrasyonlarda homojen deposition salamak, daha yksek
pHlarda inkat zeltisinin stabilitesini artrarak gerekleebilir.
438 A. Akyol , M. Bayramolu


4. Sonu
Yksek fotokatalitik aktiviteyle ZnO film oluturmak iin kimyasal deposition metodu
gelitirildi. Metot, destek yzeynde sv film oluturmak iin amonyum inkat zeltisine
daldrma adm ve termal ilem adm olarak iki admda uyguland. Bu metot pahal organic
bileiklerle tutuklama yapmak yerine dk maliyetli inorganik inko bileikleri, amonyak
solsyonu gibi kimyasal maddelerle ve eitli cam ve seramik malzemeler ve zellikle atk
seramik krk paralar ile baaryla uygulandnarak yksek fotokatalitik aktivite gstererek
etkili bir tutuklama metodu olarak tercih nedeni olmaktadr.
Destek
Bu alma TUBITAK-MAG-(104M411) tarafndan finansal adan desteklenmitir. Yazarlar
destekterinden tr TUBITAK tbitak a teekkr eder.
Kaynaklar
Badawy W.A. (1997). Preparation, electrochemical, photoelectrochemical and solid-state characteristics
of indium-incorporated TiO2 thin films for solar cell fabrication, J. Mater. Sci. 32, 49794984.
Bao D, Gu H, Kuang A, (1998). Sol-gel-derived c-axis oriented ZnO thin films, Thin Solid Films 312, 37-39.
Barnes T.M., Leaf J., Fry C., Wolden C.A. (2005). Room temperature chemical vapor deposition of c-
axis ZnO, J. Cryst. Growth 274, 412-417.
Gauthier V., Bourgeosis S., Sibillot P., Maglione M.,Sacillotti M. (1999). Growth and characterization of
AP-MOCVD iron doped titanium dioxide thin films, Thin Solid Films 340, 175-182.
Ghandhi S.K., Field R.J., Shealy J.R. (1980). Highly Oriented Zinc-Oxide Films Grown By The
Oxidation Of Diethylzinc, Appl. Phys. Lett. 37, 449-451.
Jiwei Z, Liangying Z, Xi Y, (2000). The dielectric properties and optical propagation loss of c-axis
oriented ZnO thin films deposited by solgel process, Ceram. Int. 26, 883-885.
Kasuga M., Mochizuki M. (1981). Orientation Relationships Of Zinc-Oxide On Sapphire In Hetero-
Epitaxial Chemical Vapor-Deposition, J. Cryst. Growth 54, 185-194.
King S.L, Gardeniers J.G.E.,. Boyd I.W. (1996). Pulsed-laser deposited ZnO for device applications,
Appl. Surf. Sci. 9698, 811-818.
Lee J.H., Park B.O. (2004). Characteristics of Al-doped ZnO thin films obtained by ultrasonic spray
pyrolysis: effects of Al doping and an annealing treatment, Mater. Sci. Eng. B 106, 242-245.
Mitra P, Khan J, (2006). Chemical deposition of ZnO films from ammonium zincate bath, Mater. Chem.
and Phys. 98, 279-284.
Pal, B. Sharon, M. (2002). Enhanced photocatalytic activity of highlyporous ZnO thin films prepared by
sol-gel process, Mater. Chem. Phys. 76, 82-87
Shinde V.R., Gujar T.P., Lokhanda C.D., (2007) Studies on growth of ZnO thin films by a novel chemical
method, Sol. Energy Mater. Sol. Cells 91, 1055-1061
Stromme M., Gutarra A., Niklasson G.A., Granqvist C.G. (1996). Impedance spectroscopy on lithiated Ti
oxide and Ti oxyfluoride thin films, J. Appl. Phys. 79, 3749-3757
Yamaguchi Y, Yamazaki M, Yoshihara S, Shirakashi T, (1998). Photocatalytic ZnO fims prepared by
anodizing, J. Electroanal. Chem. 442, 1-3.




.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Fenol ve Fenoll Atksularn Artlmas
Handan Ucun, Ergn Yldz ve Alper Nuholu
Atatrk niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, Erzurum
E-mail: hanucun@atauni.edu.tr

z Sanayinin gelimesi ile zellikle son 30 ylda kimyasal ve toksik madde kullanmnda
nemli art olmutur. Birok teknoloji dalnda hammadde ve ara rn olarak bu maddelerin
kullanlmas sonucu retilen atksularn toksik etkileri evreyi ciddi ekilde tehdit etmektedir.
Evsel atksularda ve baz endstriyel atksularda mevcut ou organik bileikler doal orijinlidir
ve aerobik veya anaerobik proseslerdeki yaygn bakterilerle indirgenebilirler. Ancak, imdilerde
genel olarak xenobiyotik bileikler terimi kullanlan 70000 zerinde sentetik organik kimyasal
vardr. Ne yazk ki; bu organik bileiklerin bazlar evre ve insan sal asndan potansiyel
toksisiteye sahip olmalar ve biyolojik indirgenmeye kar gsterdikleri diren yznden atksu
artmndaki yegane problem durumundadr. Fenol ok ynl endstriyel organik
kimyasallardan biridir. Evsel ve endstriyel alanda kullanlan birok rnn balang
noktasdr. Fenoller protoplazmik zehir olduklarndan tm canl hcre trlerine zarar verirler.
Fenol ve homologlarnn hayvansal dokular zerinde yakc etkileri vardr. Fenoller olduka
toksik olmalar ve evrede birikme ihtimallerinden dolay EPAnn (Environmental Protection
Agency) birincil kirletici olarak listeledii kirleticilerdendir. Yksek fenol kirlilii ieren
atksulardan fenol gidermek iin eitli ayrma ilemleri vardr ve ou zaman bu metotlarn
uygulanmas birbiri iine girmektedir. Bu aratrmada, toksik bir bileik olan fenoln literatrde
yer alan artm yntemlerinin ortaya konulmas salanmtr.
Anahtar Kelimeler atksu; biyolojik artm; fenol; kimyasal artm; toksisite
1. Giri
Literatrde basite fenol olarak tarif edilmesine ramen, fenol deyimi polifenoller, klorofenoller
ve fenoksitler ile eitli biimlerde birbirine benzeyen kimyasal bileikleri kapsamaktadr.
Fenol, bu grubun ana bileii olan monohidroksibenzene (C
6
H
5
OH) verilen spesifik bir isimdir
ve ayn trden bileiklerin toplam konsantrasyonu olarak ifade edilmektedir. Fenoller olduka
toksik olmalar ve evrede birikme ihtimallerinden dolay EPAnn (Environmental Protection
Agency) birincil kirletici olarak listeledii kirleticilerdendir. Gnmzde eitli endstriyel
atksularda mevcuttur. Ham petrol ve petrokimya, kmr koklatrma ve fenol retim
endstrisinden dearj edilen yaygn bir kirleticidir. Fenollerin endstride kullanm alan ok
geni olduundan k sularnda fenol ieren dier kaynaklar, ila ve kozmetik sanayi, plastik
ve sentetik reine, kereste retimi, boya, kat hamuru ve kat endstrileri, tekstil ve zeytinya
endstrisi gibi endstrilerden de dearj edilmektedir.
2. Fenol Giderme Yntemleri
Yksek fenol kirlilii ieren atksulardan fenol gidermek iin eitli ayrma ilemleri vardr ve
ou zaman bu metotlarn uygulanmas birbiri iine girmektedir. Hem fizikokimyasal hem de
biyolojik artm yntemleri endstriyel lekli tesislerde baaryla uygulanmakta ve olduka iyi
440 H. Ucun, E. Yldz, A. Nuholu


artm verimlerinin elde edildii bildirilmektedir. Fenoll atksular iin genellikle, biri ykma-
yok etme prosesi prensibine, dieri geri kazanm veya rejenerasyona dayanan iki tip artm
prosesi uygulanmaktadr. Fenoln giderimi iin nerilen baz metotlar;
- Ekstraksiyon,
- Adsorbsiyon,
- Membran ayrma,
- Biyolojik indirgeme,
- Ozonlama,
- Termal bozunma
olarak sralanabilir (Xu et al. 2006).
2.1. Fizikokimyasal Yntemler
Kmr gazlatrma prosesi k sular yksek konsantrasyonlarda fenol iermektedir. 3000
mg/Lden fazla fenol konsantrasyonlar olan k sular mikroorganizmalar iin ldrcdr.
Bu da klasik biyolojik yntemlerle artm imkanszlatrmaktadr. Byle durumlarda, kmr
gazlatrma atksularndaki gibi yksek fenol ierii olan atksular n artma tabi tutulurlar.
Bazen de yksek fenol k olan bu proseslerden fenoln hammadde olarak geri kazanlmas
cazip hale gelmektedir. Ancak geri kazanm olduka pahal bir yntem olmakla birlikte bu
amala en etkili ve en ok kullanlan metot, zc extraksiyonudur. Geri kazanm iin
performans ve ekonomik adan deerli olabilecek deiik zc ekstraktlarn denendii pek
ok alma yaplmaktadr(Li et al. 2004; Ferreira et al. 2005; Xu et al. 2006; Yang et al. 2006).
Fenollerin geri kazanm yerine artm iin kullanlan artm teknolojileri incelendiinde,
fenoll atksularn genellikle biyodegredasyon, termal bozunma ve adsorpsiyonla artld
grlmektedir. Fenol konsantrasyonu dk olduu zaman, kimyasal ve elektrokimyasal
oksidasyon prosesleri de kullanlmaktadr. Termal bozunma 15 000 mg/L kadar yksek fenol
konsantrasyonuna sahip atksularn artm iin kullanlabilir. Fakat yksek enerji ihtiyac
yznden sadece kk lekte kullanlmaktadr. Bu yzden termal artm fenol
indirgenmesinde ekonomik olarak etkili bir metot deildir. Adsorbsiyon seyreltik fenoll
atksularn artm iin etkili bir metottur. Ancak aktif karbon veya kmr kl ve dier
sorbentlerin nispeten yksek maliyetleri nedeniyle yksek fenol ierikli atksularn artmnda
kullanlmamaktadr ((Yener ve Aksu 1999; Gonzalez-Munoz et al. 2003; Li et al. 2004).
Yener ve Aksu (1999), aktif karbon ve kurutulmu aktif amur zerine fenol ve fenol trlerinin
adsorpsiyonunda, 500 mg/L fenol konsantrasyonu iin srasyla %25 ve %21 verim elde
edebilmilerdir. 25 mg/L fenol iin dahi en yksek verimi %76 olarak belirlemilerdir.
zbelge et al. (2002), kauuk ve tekstil endstrisi atksularndan fenolik bileiklerin
gideriminde, fiziko-kimyasal yntemler ile fenoln koaglasyonu iin farkl tipte koaglantlar
kullanarak, en yksek 765 mg/L fenolik bileik ieren besleme atksuyunu %95 verimle
uzaklatrmlardr.
Sv membranla ayrma, kat membranl ekstraksiyon, elektrokimyasal oksidasyon ve ozonlama
gibi deiik ilemler kullanlmasna ramen fenoln artm iin en ok kullanlan yntem
biyolojik artmdr.

Fenol ve Fenoll Atksularn Artlmas 441


2.2. Biyolojik Yntemler
Fenoln biyolojik artm iin aktif amur yntemi, uzun havalandrmal aktif amur sistemleri
ve doal sulama yataklar gibi farkl yntemlerin kullanlmasyla birlikte fenoln toksik
etkisinden dolay son zamanlarda en ok kullanlan reaktr tipleri ardk kesikli reaktrler ve
biyofiltrelerdir. Ancak genel olarak kartrmal tank reaktrlerin kullanm daha yaygndr. Bu
reaktrlerin avantaj, iletim ve hidrolik kal sresini ayarlamann basit olmasdr. Ancak dier
taraftan ok yklemelere ve ykanmaya hassastr ve kararszlnn dzelmesi uzun zaman
almaktadr. Biyolojik artma tesislerine eilimin artmas ile birlikte yksek verimli
teknolojilerde hzla gelimektedir. Fenol giderim oran yk artmasyla hzla dmektedir. Ancak
ykleme ayarlandnda aktif amur tesislerinde fenol tam olarak artmak mmkndr.
Ruiz-Ordaz et al. (2001), yksek oranda fenol ieren atksularn artmn bir maya tr olan C.
tropicalis ile aerobik artlar altnda gerekletirmilerdir. Maya yetitirmek iin ok kademeli
bir gaz-sv kontaktr kullanlm olup almada fenol giderim veriminin %98'den fazla
olduunu belirtmilerdir.
Swapna et al. (2002), denitrifikasyon yapan bakteri kltrleri ile fenoln ve dier fenolik
bileenlerin anoksik ortamda giderimini incelemilerdir. Bu artlar altnda fenoln (>600mg/l)
yksek konsantrasyonlarnn gideriminin baarldn ortaya koymulardr. Tanmlanan kltr 3
yldan daha fazla uygun fenol giderme yeteneiyle kalabilmektedir. Bu nedenle fenol ieren
endstriyel atk sularn anoksik artm uygulamalar iin uygun olduunu ortaya koymulardr.
Sarfaraz et al. (2004), granuler anoksik amur kullanarak yksek fenol konsantrasyonunun
artmn aratrmlardr. Klasik srekli beslemeli reaktrlerden daha avantajl olan ardk
kesikli reaktr tercih ettikleri almalarnda, 6,4 kg KO/m
3
gnlk yk altnda 1050 mg/L
fenol ieriinin 6 saatlik dng periyoduyla fenoln %80ini uzaklatrmlardr.
Atksuda bulunan dier kirleticilere bal olarak anaerobik-aerobik hatta anaerobik-anoksik ve
aerobik fenol artm ardk ekilde yrtlmektedir (Yamagishi et al. 2001; Chakraborty and
Veeramani 2005).
Quan et al. (2004) tayc olarak isel loop tpne yerleik bal-kovanna benzer bir seramik
kolonla air lift biyoreaktr gelitirmiler ve onun mikroorganizma immobilizasyon kapasitesini
ve srekli iletim artlar altnda fenol ve 2,4-DCP birlikte giderimini aratrmlardr. Sonulara
gre saf kltrn taycya kolayca immobilize olduu aklanmtr.
Gonzalez et al. (2001) sspanse ve akkan yatak iki ayr reaktrde yaptklar aratrmada,
akkan yatak ierisinde kalsiyum aljinat bilyeleri ierisine tutuklanm mikroorganizmalardan
yararlanmlar ve sspanse olan kartrmal reaktre gre daha iyi verimler elde etmilerdir.
Her iki tr reaktrde de 1000 mg/L giri fenol deeri ile denemeler yaplmtr.
Gnmzde membran teknolojisi yardmyla biyoreaktr ierisindeki biyoktle miktarnda,
klasik askda artm sistemleri yannda 4-5 kata varan artlar salanmakta, e zamanl enzim
bal membran biyoreaktrler de kullanlmaktadr (Erhan et al. 2002).
3. Sonular
Adsorpsiyon ve zc extraksiyonu kirleticinin bir fazdan dier faza transfer edildii, kimyasal
oksidasyon ise genellikle dnmn yetersiz olduu yntemlerdir. Fenolik bileikleri artmak
iin biyolojik metotlar, fenoln tam mineralizasyonunun gerekletii ve evresel adan kabul
edilir son rnlerin olutuu, nispeten dk maliyetleri ile tercih edilmektedirler. Genellikle
aerobik biyolojik metotlar kullanlmaktadr. Bu sistemlerin yksek enerji ihtiyac ve amur
442 H. Ucun, E. Yldz, A. Nuholu


miktarlar anaerobik biyolojik yntemlerin kullanlmasn doursa da, aerobik
mikroorganizmalar toksik bileikleri indirgemekte anaerobik mikroorganizmalardan daha etkili
olduklar, anaerobik mikroorganizmalardan daha hzl oalp, organik bileikleri inorganik
bileiklere (CO
2
, H
2
O) dntrdkleri iin daha ok tercih edilmektedirler.
Kaynaklar
Xu, J.Q., Duan, W.H., Zhou, X.Z. and Zhou J.Z. (2006). Extraction of phenol in wastewater with annular centrifugal
contactors. Journal of Hazardous Materials B131, 98102.
Li., Z., Wu, M., Jiao, Z., Bao, B. and Lu, S. (2004). Extraction of phenol from wastewater by N-octanoylpyrrolidine.
Journal of Hazardous Materials B114, 111114.
Gonzalez, G., Herrera, M.G., Garcia, M.T., Pena, M.M. (2001). Biodegradation of phenol in a continuous process:
comparative study of stirred tank and Quidized-bed bioreactors. Bioresource Technology 76, 245-251.
Gonzalez-Munoz, M.J., Luque, S., Alvarez, J.R. and Coca, J. (2003). Recovery of phenol from aqueous solutions
using hollow fibre contactors. Journal of Membrane Science 213, 181193.
Erhan, E., Keskinler, B., Akay, G. and Algur, O. F. (2002). Removal of phenol from water by membrane-
immobilized enzymes: Part I Dead-end filtration. J. Membrane Sci., ???.
Quan, X., Shi, H., Zhang, Y., Wang, J. and Qian, Y. (2004). Biodegradation of 2,4-dichlorophenol and phenol in an
airlift inner-loop bioreactor immobilized with Achromobacter sp. Separation and Purification Technology 34,
97103.
Chakraborty, S. and Veeramani, H. (2005). Response of pulse phenol injection on an anaerobicanoxicaerobic
system. Bioresource Technology, 96, 761767.
Yamagishi, T., Leite, J., Ueda, S., Yamaguchi, F. and Suwa, Y. (2001). Simultaneous removal of phenol and
ammonia by an activated sludge process with cross-flow filtration. Water Res., 35 (13), 3089-3096.
Sarfaraz, S., Thomas, S., Tewari, U.K. and Iyengar, L. (2004). Anoxic treatment of phenolic wastewater in
sequencing batch reactor. Water Research 38, 965971.
Swapna, T., Sami, S., Mishra, L.C. and Leela, I. (2002). Degradation of phenol and phenolic compounds by a defined
denitrifying bacterial culture. World Journal of Microbiology and Biotechnology 18 (1), 57-63.
Ruiz-Ordaz, N., Ruiz-Laqunez J., Castanon-Gonzalez J., Hernandez-Manzano E., Cristiani-Urbina E. and Galindez-
Mayer J. (2001). Phenol biodegradation using a repeated batch cultures of Candida tropicalls in a multistage
buble column. Revista Latinoamericana de Microbiologia, 43, 19-25.
zbelge, T.A., zbelge, .H. and Bakaya, S.Z. (2002). Removal of phenolic compounds from rubbertextile
wastewaters by physico-chemical methods. Chemical Engineering and Processing 41, 719730.
Yener, J. ve Aksu, Z. (1999). Atksulardaki fenol ve klorofenollerin aktif karbon ve kurutulmu aktif amura
adsorpsiyonu. Tr. J. of Engineering and Environmental Science 23, 93-104.
Ferreira, F.C., Peeva, L., Boam, A., Zhang, S. and Livingston, A. (2005). Pilot scale application of the Membrane
Aromatic Recovery System (MARS) for recovery of phenol from resin production condensates. Journal of
Membrane Science 257, 120133.
Yang, C., Qian, Y., Zhang, L. and Feng, J. (2006). Solvent extraction process development and on-site trial-plant for
phenol removal from industrial coal-gasification wastewater. Chemical Engineering Journal 117, 179185.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Teknolojinin Getirdii Yeni bir Sorun: Elektronik Atklar (E-
Atk)
Zeynep EREN
Atatrk niversitesi, Mhendislik Fakltesi evre Mhendislii Blm, 25240 Erzurum
E-posta: zeren@atauni.edu.tr

z E-Atk (elektronik atk) elektronik eyalarn kullancs tarafndan kullanm sresini
tamamlamasyla ortaya kartlan atktr. E-atklarn (TV, bilgisayar, yazc, telefon, fax,
fotokopi makineleri, ekranlar, kablolar, MP3, tbbi cihazlar, beyaz eyalar vs) ierdii tehlikeli
maddeler ise: kurun, civa, kadmiyum, krom, alt deerlikli krom, fosfor, baryum, berilyum,
bromlu alev geciktiriciler, klorlu solventler, PVC, plastik malzemeler ve gazdr. erdikleri bu
tehlikeli maddeler nedeniyle e-atklar yakldklarnda veya geri kazanm iin paralandklarnda
evresel adan tehdit oluturmaktadrlar. Gnmz teknoloji dnyasnda poplerliini en hzl
yitiren elektronik eyalar cep telefonlardr. zellikle kiisel bilgisayarlar e-atk pazarnn byk
bir ksmn oluturmaktadr. Bu e-atklarn ou artk p ynlar iine atlmakta veya gelimi
lkelerden evre duyarl az yada olmayan lkelere gnderilmektedir. Gelimi ve gelimekte
olan lkelerde e-atk sorunu ok nemli boyutlara ulamaktadr. E-atklar hem ierdikleri
tehlikeli maddelerden dolay hem de geri dntrlebilen deerli maddelerden dolay nem
kazanmaktadrlar. Bu nedenle bu atklar plerden ayr olarak toplanmaldr. AB byyen e-atk
sorununa zm bulmak iin WEEE (Waste of Electronic and Electrical Equipment) ve RoHS
(Restriction of the Use of Certain Hazardous Substances) direktiflerini yrrle koymutur.
lkemizde ise e-atklar henz tehlikeli atk kapsamnda deerlendirilmektedir.
Anahtar Kelimler E-atk, elektronik atk, e-atk ynetimi, WEEE ve RoHS Direktifleri
1. Giri
E-atk, elektronik cihazlarn eskimesi, bozulmas ve tamir edilemez hale gelmesiyle meydana
gelen atklardr. Bir atk olarak adlandrlmasnn aksine, elektronik cihazlar ierdikleri deerli
materyallerden dolay ikinci derece bir kaynak olarak dnlebilir. E-atklar dzenli bir ekilde
bertaraf edilebilirse deerli materyalleri geri kazanma bakmndan nemlidirler ancak dzenli
olarak bertaraf edilmezlerse toksinlerin ve kanserojen maddelerin kaynadrlar. Teknolojinin
hzla gelimesi, maliyetlerin azalmas ve elektrikli ve elektronik ekipmanlarn ilerleyen
teknoloji karsnda ok abuk deer kaybetmeleri, bu problemin dnya apnda hzla
bymesine neden olmutur. Kontrolsz yakmalar, paralamalar evre ve salk problemleri
oluturmaktadr. Elektronik sektrndeki retim art elektronik atk pazarnn bymesini
doal olarak hzlandrmaktadr ve retim hacmi ile e-atk hacmi arasnda paralellik olmaktadr.
Dnyada e-atk sorunu birka yl nce gelimi lkelerin, eski/hurda/kullanlm kiisel
bilgisayarlar fakir devletlere gndermeye balamasyla, tartlmaya balanmtr. Gelimi
lkelerin birok elektronik at in gibi lkelerde son bulmaktadr. Bu lkeler bu e-atklardan
ok ilkel geri kazanm yntemleriyle bakr, alminyum ve altn geri kazanrken, kurun ve
dier zehirli atklarn toprak ve suya karmasna yol amakta ve halk sal bu ekilde tehdit
edilmektedir (Geri Dnm, 2007). rnein: bir TV katot n tp (CRT) 2-4 kg kurun,
444 Z. Eren


byk TV ekran ondan daha fazla kurun iermektedir (Kaya, 2005). Bir bilgisayar ortalama 4
gram altn ve dier deerli metalleri iermektedir ve bu nedenle elektronik atklarda geri
kazanm byk nem kazanmaktadr (Hilty, 2005).
2. Dnyada ve Trkiyede E-Atk Durumu
IBMin tahminlerine gre nmzdeki 10 ylda dnyadaki bir milyar insan bir trilyon iletiim
arac kullanyor olacak (Hilty, 2005). Dnyada 2 milyar cep telefon kullancs var kaba bir
hesapla 2 milyar cep telefonunun retilip kullanldn gsterir. 2003 ylnda dnya elektronik
eya retimi 1,324 milyon dolar tutarndadr. ABD 286 milyon dolarlk retim ile dnya
birincisi iken Japonya 170 milyon dolar ile ikinci ve in 147 milyon dolarla ncdr.
Amerikan evre Koruma rgtne gre dnyada en fazla e-atk reten lke ABDdir.
ABDde 2000 ylnda 4,6 milyon ton e-atk gmlmtr. Sadece 2003 ylnda, Amerikada 63
milyon kiisel bilgisayar p sahalarna gnderilmitir. Bu rakam her yl katlanarak artmaktadr.
ABDde 1997 ile 2004 yllar arasnda kullanlmaz hale gelen 315 milyon bilgisayar ve
monitrde toplam 545,000 ton kurun bulunmaktadr. Toprak dolgusundaki Pb, Cd, Hg, gibi
ar metallerin %40dan fazlas e-atklardan ileri gelmektedir. Japonyada sadece 2002 ylnda
20 milyon adet beyaz eyann pe atld tahmin edilmekte ve ayn dnemde 450,000 adet
evde kullanlan bilgisayarn pe atld belirtilmektedir. Bu 9,000 ton e-atk demektedir.
Nokia 2001 ylnda dnyada satlan 380 milyon telefonunun yaklak 40,000 - 50,000 ton ata
tekabl ettiini ve her yl tahmini 150 milyon ton elektronik atk olutuunu aklamtr.
Trkiyede DPT verilerine gre 2000 ylnda yaklak 30 milyon TV ve 2003 ylnda 26
milyondan fazla mobil telefon bulunmaktayd. Trkiyede 2001 ylnda 8 milyondan fazla renkli
TV retimi yaplmtr. Trk Telekomnikasyon Kurumu Eyll ay kaytlarna gre Trkiyede
40.4 milyon cep telefon abonesi bulunmaktadr. Trkiyede 2001 ylnda 8 milyondan fazla
renkli TV retimi yaplmtr. Ayrca lkemizde 2005 ylnda toplam bilgisayar satlarnn 1
milyon 427 bin adet olduu belirtilmitir. Bilgisayar satlar 2007 ylnda 3 milyon adete
ulamtr ve 1.8 milyon bilgisayar potansiyel e-atk olarak evremizde dolamaktadr.
Bussiness Communications Company Inc.in 2005-Haziran tarihli Elektronik Atk Kazanma i
Raporuna gre dnya genelinde elektronik atk pazar ortalama yllk byme hz 2004 ylnda
7.2 milyar dolardan 2009da 11 milyar dolara %8.8 hzla artacaktr. 2004-2009 yllar arasnda
kresel E-Atk pazarnda geri dnen metallerin sat 2004te 4236 milyon $dan yllk %8.1
artla 2009da 6245$a artacaktr. Geri dntrlen plastik pazar 2004te 2552 milyon $dan
yllk %10.2 artla 4157 milyon $a artacaktr. Geri dntrlen cam/silika 2004te 41 milyon
$dan yllk %7.5 artla 59 milyon $a kacaktr (Kaya, 2005 ve Eren, 2006).
3. E-Atklarn Bertaraf
1990l yllarda Avrupa lkeleri bu elektronik atklarn p dkm sahalarna atlmasn
yasaklad. Dnyada ilk kez ABDnin Kaliforniya eyaleti, elektronik cihaz reten irketleri
kendi rnlerini geri dntrmeden sorumlu tutmay amalamtr. Bu amala satlan her
bilgisayar ve TVden 10-35 $ lk bir atk bertaraf maliyeti vergi olarak alnmaya balanmtr.
Bu geri dnm paralar devletin tehlikeli elektronik atklar emniyetli bir ekilde yok etme
programnn finansmannda kullanlacaktr. Dnyada ilk elektronik atk geri dnm
uygulamas 1991 ylnda svirede buzdolaplarnn toplanmasyla balamtr. 2005 ylna
gelindiinde ise bu uygulama kanunlatrlp, elektronik atklarn ya sat noktalarndan yada
bedava toplama noktalarndan alnabilmesini mmkn hale getirmitir (Wikipedia, 2008).
Teknolojinin Getirdii Yeni bir Sorun: Elektronik Atklar (E-Atk) 445


Dnyann en byk elektronik atk pl inin gneyindeki Guiyu kentidir. Sanayi
lkelerinden yasad yollarla lkeye sokulan atklar insan saln tehdit etmektedir. Atklarn
iiler iin bir geim kayna olmas hkmetin bu atklarla mcadelesini zorlatrmaktadr.
Kent halk kk atlyelerinde bu elektronik atklarn zerindeki bakr ve altn gibi deerli
madenleri ayrtrarak geinmektedir. Guiyu'da yaayanlarn yzde 88'inin cilt kanseri, sinir,
solunum ve sindirim sistemi gibi rahatszlklara sahip olduu belirtilmektedir (Cnn Trk, 2007).
inde elektronik atklarn akta yaklmasndan dolay kirletilmi bir nehirde balklar zerinde
yaplm bir almada elektronik atklarn sebep olduu BPDE (polibromrl difenil eter)
bileiklerinin balklarda dier blgelerden 1000 kat daha fazla olduu grlmtr (Luo ve di.,
2007). Elektronik atk sorununu azaltmak iin uygulanan en nemli yntemlerden biri
elektronik cihazlarn kaynanda azaltlmasdr. rnein 1900 ylnda retilen cep telefonlar 350
gram arla sahip iken 2005 ylnda bir cep telefonunun arl 80 grama kadar dmtr.
Bu da elektronik atklarn azaltlmas anlamna gelmektedir. (Hilty, 2005)
4. E-Atklarn erdii Tehlikeli Maddeler ve nsan Salna Zararlar
ABnin 2003 ylnda yaynlad WEEE 2002/96/EC (Atk Elektrikli ve Elektronik Ekipmanlar
Ynergesi) direktifine gre elektronik atklarn kapsam aadaki gibidir:
- Byk elektrikli ev aletleri (frn, buzdolab vb.)
- Kk elektrikli ev aletleri (tost makinesi, hava temizleyiciler vb.)
- yerlerinde ve iletiim amal kullanlan ev aletleri (bilgisayarlar, yazclar, telefon,
fax vb.)
- Elence amal kullanlan elektronik aletler (TV, CD alar vb.)
- Iklandrma ekipmanlar (florasan tpler)
- Delme makineleri (matkap), elektrikli im bime makineleri
- Spor ekipmanlar (elektronik oyuncaklar, antrenman aletleri vb.)
- Medikal cihazlar
- Gzetleme ekipmanlar
- Otomatik say sistemleri (bilet makineleri vb) (Wikipedia, 2008).
Bu e-atklarn ierdii tehlikeli maddeler ve insan sal zerine olumsuz etkileri ise yledir:
Kurun (Pb): Pbnin salk zerine olumsuz etkileri iyi bilinmektedir Merkezi sinir sistemini
(bilhassa ocuklarda), bbrekler ve reme sistemlerini bozmakta, ocuklarda beyin hasarna
neden olmaktadr. Youn miktarda kurun alan bnyelerde reaksiyon sresinin uzamas
durumunda, parmaklarda, el ve ayak bileklerinde zayflk, hafza kayb ve kan hastalklar gibi
sorunlar grlmektedir.
Cva (Hg): Dk dozlarda bile zehirlidir. Beyin ve bbreklere zarar verir. Anne style
ocuklara geer. Sinir sistemi civann tm formlarna kar ok duyarldr. Yksek miktarlarda
maruziyet beyinde, bbreklerde ve fetus geliiminde kalc zararlara neden olabilir. Beyin
fonksiyonlarna yapaca etkiyle irritabilite, rkeklik, titreme, grme ve duyma kusurlar ve
bellekte zayflama ortaya kabilir. Ksa sreli ve yksek dzeyde maruziyet durumunda akcier
hasar, bulant, kusma, ishal, tansiyon ykseklii, deri dkntleri ve gzde irritasyon meydana
gelebilir. Yeni doan ve fetusta, civa, beyin geliiminde gerilik, zeka gerilii, krlk ve
446 Z. Eren


konuamamaya neden olabilir. ocukta sinir ve sindirim sistemleriyle bbrekler etkilenir.
Kanserojenler arasnda snflandrlmaktadr. Bir ay kann 70te biri civa bile 80,000 m
2
lik
bir gldeki suyu kirletip yaayan balklarn yenmesini engeller.
Kadminyum (Cd): Havaya karan kadmiyum partiklleri yere ya da sulara dmeden nce ok
uzun mesafeler kat edebilir. Vcutta ok uzun sre kalabilir ve dk dzeyde maruz kalnsa
bile yllar iinde birikebilir. Kadmiyum havadan solunarak, kadmiyum bulam yiyeceklerin
yenmesiyle, kadmiyumla kirlenmi sularn iilmesiyle vcuda alnabilir. Yksek dzeyde
kadmiyumun solunmas akcier hasarna bal olarak lme neden olabilir. ok yksek
dzeyde kadmiyumun yiyeceklerle alnmas kusma ve ishale neden olur. Hava, su ya da besinler
yoluyla dk dzeyde kadmiyuma uzun sre maruziyet sonucunda kadmiyum bbreklerde
birikir ve bbrek hastalklarna neden olabilir. Akcierde hasar ve kemiklerin krlganlnn
artmas dier etkileridir. Hayvan deneylerinde kadmiyumun tansiyon ykselmesine, kandaki
demir dzeyinin dmesine, karacier hastalklarna, sinir sistemi ve beyinde hastalklara neden
olduu gsterilmitir.
Bromlu Alev Geciktiriciler (BFR): Normal gelime iin hormonal fonksiyonlar nemli derecede
etkiler. BFR iyeri ve ofislerdeki bilgisayarlar zerindeki tozlarda bulunmaktadr ve ABD ve
svete anne stnde ok fazla miktarda rastlanmtr.
Krom: Yksek miktarlarda solunmas burun, akcier, mide ve barsaklara zarar verebilir.
Kroma allerjisi olan kiilerde astm krizlerine neden olabilir. Uzun sre yksek ve orta
dzeylerde maruziyet burun kanamas, yaralar, akcier hasar ve kanser dndaki akcier
hastalklarnda arta neden olabilir. Sindirim yoluyla yksek dzeylerde alnrsa mide
ikayetleri ve lsere, konvlsiyonlara, bbrek ve karacier hastalklarna, hatta lme neden
olabilir. Cilde temas durumunda cilt lserleri oluabilir. Ayrca ciltte allerjik reaksiyonlara yol
aabilir. Baz bileikleri kanserojendir.
Baryum (Ba): Ksa sre Ba maruziyeti beyin imesine, kas zayflna, kalp ve karacier
hastalna neden olabilmektedir.
Alt Deerlikli Krom (Cr
+6
): DNA hasar ve astimik bronite sebep olabilir.
Berilyum (Be): Son zamanlarda Be kanserojen olarak snflanmaktadr.
Plastikler: Bir bilgisayarda ortalama 7 kg civarnda PVCde ieren plastik bulunur. Belli
scaklkta yandnda dioksin oluur. PVC en tehlikeli plastiktir. Aratrma sonularna gre,
kanser yapmasnn yannda, sinir, baklk ve reme sistemlerine zarar verebilmekte,
domam bebeklerde bozuk oluumlara, sakatlklara sebep olabilmekte, endokrin sistemini
bozabilmekte ve daha bir ok olumsuz etkiye neden olabilmektedir (Kaya, 2005 ve Eren,
2006).
5. Dnyada ve Trkiyede E-Atk Mevzuat
WEEE Direktifi, elektrikli ve elektronik ekipman atklarnn ayr toplanmasn ve geri
kazanmn zorunlu klmaktadr. Bu balamda, reticilerin rnlerinin mrn tamamlama
aamasndan da sorumlu tutulmalar esasndan hareketle, sz konusu reticilerden rnlerini
geri kazanm, geri dnm ve paralanabilirlik olanaklarn deerlendirerek tasarlamalar
beklenmektedir. Direktif, 13 ubat 2003 tarihinde yrrle girmi olup, ye lkelerden 13
Austos 2004 tarihine kadar Direktife ilikin uygulama yasalarn karmalar talep edilmitir.
Sz konusu sreci takiben, 13 Austos 2005 tarihi itibariyle piyasada yer alacak rnlerin, yeni
kurallara bal olarak snflandrlmas ve etiketlenmesi esas getirilmitir. 31 Aralk 2006 tarihi
Teknolojinin Getirdii Yeni bir Sorun: Elektronik Atklar (E-Atk) 447


itibariyle ise ye lkelerden, bu tr atklar iin toplama, yeniden kullanma, geri dntrme ve
geri kazanm hedeflerini gerekletirmeleri beklenmektedir.
te yandan, WEEE Direktifini tamamlayc nitelikte olan RoHS Direktifi ise elektrikli ve
elektronik ekipmanlarn baz tehlikeli madde ieriklerinin azaltlmasn temin iin
yaynlanmtr. RoHS Direktifine gre elektrikli ve elektronik ekipman atklar ayr toplanm
olsalar dahi ierdikleri tehlikeli maddelerden dolay risk tamaktadrlar. Direktif 13 ubat 2003
tarihinde yrrle girmi olup, ye lkelerden 13 Austos 2004 tarihine kadar Direktife ilikin
uygulama yasalarn karmalar beklenmitir. 1 Temmuz 2006 tarihinden itibaren ise piyasada
yer alacak elektrikli ve elektronik ekipmanlarda kurun, civa, kadmiyum, heksavalent krom,
PBBs ile PBDEs maddelerinin dier maddelerle deitirilmi olmas gerekmektedir.
Dier taraftan, WEEE ve RoHS Direktifleri kapsamnda ABnin alm olduu benzer tedbirler,
dnyann dier blgelerinde de kabul edilmeye balanmtr. Bu lkeler arasnda Japonya nc
konumdadr. ABD ise Ocak 2007 tarihi itibariyle benzer bir uygulamaya gemeyi hedeflemitir.
Bu direktif ile birlikte ye lkeler elektrikli ve elektronik atklar iin unlar garanti
edeceklerdir:
- Son tketiciler ve datclar bu tr atklar cretsiz geri verecektir.
- reticiler ayr veya kolektif toplama sistemlerini kuracak ve ileteceklerdir.
- nsan sal ve gvenlii asndan risk tayan kontamine atklarn alm kabul
edilmeyecektir.
ye lkeler elektrikli ve elektronik ekipman atklarnn yetkilendirilmi kurululara iletilmesini
garanti edecektirler. ye lkeler, elektrikli ve elektronik ekipman atklarnn her yl kii bana
en az ortalama 4 kg ayr toplama orannn gereklemesini garanti edecektirler.
Ekipman bana ekipman bileenlerinin, materyallerinin ve maddelerinin yeniden kullanm ve
geri dnm her bir aletin ortalama arl olarak,
- lambalarn atlmnda en az %80,
- byk ev aletlerinin %75,
- kk ev aletlerinin, aydnlatma ekipmanlarnn, elektrikli ve elektronik aletlerin,
oyuncaklarn, elence - spor aletlerinin ve izleme - kontrol aygtlarnn %50
- bilgi Teknolojileri (IT) - telekomnikasyon ve tketici ekipmanlarnn %65' i orannda
gereklemelidir.
Elektrikli ve elektronik ekipman kullanclar bunlara ait atklarn ayrlmadan belediye
plklerine verilmemesi, ayr toplanmasnn, geri alnmasnn salanmas, tketicilerin bu
atklarn geri kazanlmasndaki rolleri, bu atklarn evreye ve sala olan etkileri ve bu tr
ekipmanlarn paketlerinde bulunan semboln (pe atlmamasn gsterir) anlam ile ilgili
olarak gerekli bilgilere eriebilmelidir. reticiler, 13 Austos 2005 tarihinden sonra piyasada
yer alacak rnlerini ekil 1de gsterilen (pe atlmamasn gsterir) sembol ile
iaretleyeceklerdir.
448 Z. Eren



ekil 1. Atn pe atlmayacan gsteren amblem.
RoHS iin standart bir iaret belirlenmemi olmakla birlikte, her firma kendisine gre bir
amblem semi bulunmaktadr. Baz firmalar kurunsuz anlamnda st izili Pb semboln
kullanrken, baz firmalar da zararl maddelerin yalnzca kurundan ibaret olmadn
vurgulamak adna RoHS kelimesini ieren birtakm semboller kullanmaktadr (ekil 2). (D
Ticaret Mstearl, 2008, stanbul Sanayi Odas, 2007, EU-Environment, 2007).





ekil 2. rnn zararl madde iermediini gsteren amblem.
lkemizde ise elektronik atklarn ynetimi ile ilgili zel bir ynetmelik bulunmamakla beraber
bu atklar Tehlikeli Atklar Ynetmelii (14 Mart 2005 Tarih ve 25755 sayl) kapsamnda
deerlendirilmektedir. evre ve Orman Bakanlnn 2006 ylnda hazrlad AB Entegre evre
Uyum Stratejisi (UES) (2007 - 2023) raporunda ABnin Direktiflerine karlk gelecek yasal
dzenlemelere ihtiya duyulduu belirtilmitir. Bu raporda RoHS ve WEEE ynetmeliinin
mevzuata uyumlatrma ve uygulanma tarihleri 2007 ve 2008 olarak belirlenmitir (evre
Bakanl, 2008).
lkemizde e-atklarla ilgili geri dnm almas sadece zmit'te bulunan Exitcom firmas
tarafndan yaplmaktadr. stanbul'da elektronik atklarn geri dnm iin (Trkiye evre
Koruma ve Yeillendirme Kurumu) TREK, Greenpeace ve Doa Elektronik ibirlii ile bir
toplama noktas oluturulmutur. Kadky'deki bu merkezde toplanan e-atklar Kocaelinde
bulunan Exitcom (Doa Entegre Geri Dnm Endstrisi) firmasna gnderilmektedir. Tesiste
e-atklarn toplanmas, depolanmas, tanmas, gvenlii, deerlendirilmesi, geri
dnm, imhas ve raporlanmas ilemleri yaplmaktadr (Exitcom, 2007).
6. Sonu
Kresel anlamda bilgi ana giren toplumlarn oluturduklar e-atklar ok hzla artmaktadr.
Belediye atklar iinde en hzl byme e-atklarda olmaktadr. Gelimi lkelerde e-atklar kat
atn %1ini olutururken bunun 2010da %2ye kaca tahmin edilmektedir. Dnyada ve
Trkiyede elektronik eya sektr byrken, e-atklarn p iindeki oran hzla artmaktadr.
Gelimekte olan lkelerde ise e-atklar kat atklarn %0.01-%1 arasnda deimektedir. Ancak
in ve dier gelimekte olan lkelerde e-atk miktar gelecek be ylda katna kma
Teknolojinin Getirdii Yeni bir Sorun: Elektronik Atklar (E-Atk) 449


potansiyeli vardr. rnein e-atklar Amerikada plerin %2sini oluturmasna karlk toplam
tehlikeli atklarn %70ine karlk gelmektedir.
Elektronik atklar, tehlikeli-toksik maddeler ve ayrca metal, cam, plastik gibi yeniden
kullanlabilen dier malzemeleri ierdii iin nemlidirler.
Bu nedenle e-atklar hem insan, evre ve doay tehdit eden bir tehlike, hem de yeni i imkan
salayacak ve yksek getiri potansiyeli olan bir sektr olarak grlebilir. E-atklarn insan,
evre ve doay riske sokmadan bertaraf konusunda yeni teknolojilerin gelitirilmesi ve
yatrmlarn yaplmas gerekmektedir.
Kaynaklar
CNN Trk, http://www.cnnturk.com/VIDEO/index.asp?pn=9&vid=188, Giri Tarihi 09.11.2007.
evre ve Orman Bakanl, www.cevreorman.gov.tr/belgeler4/uces_tr.pdf, Giri Tarihi 21.01.2008.
D Ticaret Mstearl, www.dtm.gov.tr/dtmadmin/upload/AB/SanayiSektorDb/wee_rohs.doc, Giri Tarihi
23.01.2008.
Eren, A. (2006). Elektronik Atk Tehlikeli ve Deerlidir. Buday, Ekolojik Yaam Dergisi 35 (www.bugday.org)
Giri Tarihi 18.01.2008.
European Commission Environment, http://ec.europa.eu/environment/waste/weee/legis_en.htm, Giri Tarihi
05.10.2007.
Exitcom-Doa Entegre Geri dnm Endstrisi, http://www.dogaentegre.com/, Giri Tarihi 07.10.2007.
Geri Dnm, http://www.geridonusum.org/genel/dunyanin-e-atik-coplugu-guiyu-cin.html, Giri Tarihi 07.10.2007.
Hilty, L. (2005). Electronic wastean emerging risk? Environmental Impact Assessment Review 25, 431 435.
stanbul Sanayi Odas, http://www.iso.org.tr/tr/Web/StatikSayfalar/Cevre_toplanti_sunumlari2.aspx, Giri Tarihi
23.01.2008.
stanbul Sanayi Odas, http://www.iso.org.tr/tr/Web/StatikSayfalar/Cevre_bilgi_elektrikli.aspx, Giri Tarihi
15.12.2007.
Kaya, M. (2005). Kresel Elektronik Atk (E-Atk) Pazar 2009da 11 Milyar Dolar Geecek ((E-Atklar Hem
nemli Sorun, Hem de Frsat). Ekolojik Yaam Portal (www.ekoses.com) Giri Tarihi 20.01.2008.
Luo, Q., Cai, Z.W., Wong, M.H. (2007). Polybrominated diphenyl ethers in fish and sediment from river polluted by
electronic waste Science of the Total Environment , 383, 115127.
Wikipedia, The Free Encyclopedia, http://en.wikipedia.org/wiki/Electronic_waste, Giri Tarihi 23.01.2008.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Mermer Kesme ve leme Endstrisinden Ortaya kan
Atksularn Artm ve Yeniden Kullanm
Fehiman iner
Pamukkale niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, Knkl 20070,
Denizli.
E-posta: fciner@cumhuriyet.edu.tr

z Atksuyun yeniden kullanm hemen hemen tm endstri alanlarnda mevcuttur. Endstriyel
alanlarda artlm atksuyun yeniden kullanmndaki balca ama; su dearjn minimuma
indirmektir. Temiz su yerine artlm atksularn kullanm sadece su kaynaklarn korumakla
kalmaz ayn zamanda tesisin su maliyetinin de azalmasn salar. Bu almada, mermer kesme
ve ileme tesislerinden kan atksudaki yksek askda kat madde (AKM) ierii ile karakterize
edilen atksularn koaglasyon yntemiyle ok daha ksa srede ve etkili bir ekilde ktrlmesi
ve dk AKM ieren artlm atksuyun geri kazanlma olanaklar aratrlmtr. Tesisten
alnan atksu numunesinde oda scaklnda pH 8.7; AKM konsantrasyonu 9,32 g/L; Absorbans
(550 nmde) 2,510 olarak bulunmutur. Koaglasyon deneylerinde, 25-150 mg/L konsantrasyon
aralnda Alum ve AlCl
3
koaglant maddeleri kullanlmtr. Optimum koaglant dozu Alum
iin 125 mg/L ve AlCl
3
iin 150 mg/L olarak bulunmutur. Alum iin; % 99.9 AKM giderimi, %
98.4 absorbans giderimi AlCl
3
iin; % 99.8 AKM giderimi, % 97.9 absorbans giderimi elde
edilmitir. Optimum giderim verimini salayan koaglant alumdur.

Anahtar Kelimeler askda kat madde; atksularn yeniden kullanm; koaglant
madde;koaglasyon;mermer endstrisi
1. Giri
Dnyann en zengin mermer yataklarna sahip olan Trkiyenin, 5,1 milyar m
3
(13,9 milyar ton)
mermer rezervi ile dnyadaki 15 milyar m
3
lk rezervin % 33ne sahip olduu tahmin
edilmektedir. Sektrde yaklak 800 ocak, 1500 fabrika ve 7000 civarnda atlye faaliyet
gstermektedir (Kahraman, 2006).
Yap sektrnde kullanlan mermer, tesislere bloklar halinde gelmektedir. Mermer kesme ve
silme tesislerinde bu mermer bloklar dilimlerine ayrlmakta ve kesilecek ebatlara gre
tralanmakta, son olarak ise parlatmak iin silme yaplmaktadr. Mermerin ilenmesi srasnda
kesici ve parlatc makineleri soutmak amacyla tesisin ileme kapasitesine bal olarak 40-
1000 m
3
/gn arasnda su kullanlmaktadr. Mermer endstrisindeki sv atklarn ou tesislerin
kesme, silme, cilalama ve har hazrlama ilemleri srasnda olumaktadr. Bu sv atklar
yksek konsantrasyonda askda kat madde (AKM)ye sahiptir(ener ve di., 2007).
nce mermer tanelerini ieren tesis atksuyu, toprak havuzlarda/ktrme havuzlarnda doal
ktrmeye braklmakta ya da zellikle kk lekli tesislerde hi artlmadan dorudan alc
ortama dearj edilmektedir. Artlm atksu ya tesiste yeniden kullanlmakta ya da uygun alc
ortama dearj edilmektedir. nce boyuttaki mermer tozlarnn tamam doal ktrme ile
452 F. iner


giderilememekte ve alc ortama nemli miktarda AKM verilmektedir. Atksuyunu artarak
yeniden kullanan tesislerde askda kalan mermer tanecikleri kesici ve parlatc makinelerin
bak ve disklerinde birikerek hem bunlarn kullanm mrn azaltmakta hem de retilen
rnlerin kalitesini drmektedir(ener ve di., 2007). Bu nedenle, mermer kesme ve ileme
tesislerinden kaynaklanan atksudaki AKMnin koaglasyon metodu ile ksa srede ve etkili bir
ekilde ktrlmesini salamak ve dk AKM ieren artlm atksuyun yeniden kullanlmas
halinde kesici ve parlatc cihazlara zararn minimize etmek hedeflenmitir.
Bu almada, bir mermer kesme ve ileme tesisinden ortaya kan atksularn karakterizasyonu,
koaglasyon yntemiyle artlabilirlik almalar ve atksuyun yeniden kullanm iin uygun bir
artma srecinin nerilmesi amalanmtr.
2. Materyal ve Metod
Deneysel almada Sivas Organize Sanayi Blgesinde faaliyet gsteren bir mermer kesme ve
ileme tesisi atksuyu kullanlmtr. Yaplan koaglasyon deneylerinde Alum ve AlCl
3

kullanlmtr. Tm deneyler 200 mllik atksu hacminde Velp Scientifica FC6S model jar test
cihaz kullanlarak yrtlmtr. Atksu 200 rpmde 1 dak hzl kartrma, ardndan 10 dak 45
rpmde yava kartrma uygulandktan sonra, 45 dak sre ile ktrmeye braklmtr.
keltim sonras st svdan alnan rnekler ile askda kat madde tayini ve spektrofotometrede
550 nmde absorbans lm yaplmtr.
3. Sonular ve Deerlendirme
3.1. Atksu Karakterizasyonu
Tesiste kesme ileminde kullanlan testerenin soutulmas iin gerekli olan su ebekeden temin
edilmektedir. Soutma suyu ihtiyacnn fazla olmas, artlm atksularn yeniden kullanmn
zorunlu hale getirmektedir. Bu kapsamda, mermer kesme ve ileme tesisinden kan atksular
keltim amacyla havuzda bekletilmektedir. Atksu karakterizasyonu Tablo 1de verilmitir.
Tablo 1. Mermer kesme ve ileme tesisi atksuyu karakterizasyonu.
Parametre

Havuzdan Havuz k
Askda Kat Madde(AKM), (mg/L) 9322 79
Bulanklk (NTU) 5500 5.0
EC (S/cm) 610 564
pH 8.7 7.68
3.2. Artlabilirlik almalar
Gerekletirilen artlabilirlik almalar, ncelikle yksek askda kat madde ierii ile
karakterize edilen atksularn yeniden kullanlabilir hale getirilmesini amalamaktadr.
Koaglasyon deneylerinde, atksuyun mevcut pHnda koaglant madde olarak 25-150 mg/L
konsantrasyon aralnda Alum ve AlCl
3
kullanlmtr. Koaglasyon deneylerinde 45 dakikalk
ktrme sresi sonunda st svdan alnan rneklerde AlCl
3
ile yaplan deneysel almann
sonular ekil 1de, alum ile yaplan deneysel almann sonular ise ekil 2de verilmitir.
Mermer Kesme ve leme Endstrisinden Ortaya kan Atksularn Artm
ve Yeniden Kullanm
453



ekil 1. AlCl
3
ile yaplan koaglasyon deneyi sonular.
AlCl
3
ile yaplan almada absorbans cinsinden optimum giderim verimi 150 mg/L AlCl
3

dozunda %97.9 olarak belirlenmitir. Ayn dozda AKM giderim verimi ise % 99.8 olarak
belirlenmitir. Alum

ile yaplan almada absorbans cinsinden optimum giderim verimi 125
mg/L Alum dozunda %98.4 olarak elde edilirken, ayn dozda AKM giderim verimi ise % 99.9
olarak belirlenmitir.

ekil 2. Alum ile yaplan koaglasyon deneyi sonular.
3.3. Proses Atksularnn Yeniden Kullanm
Atksularn yeniden kullanm sadece evresel nitelikleri korumakla kalmayp, temiz su
kaynaklarnn korunmasn ve yzey sularna dearj edilen k sularnn kirliliklerinin
azaltlmasna da imkan salar. Atksuyun yeniden kullanm hemen hemen tm endstri
alanlarnda vardr (Janosova ve di., 2005). Bu kapsamda byk miktarda su kullanan tesisler
iin en gvenilir, en ekonomik ve evresel adan da en doru yaklam, atksularn artlarak
yeniden kullanlmasdr. Bu ilkeler gz nnde bulundurularak gerekletirilen ve sonular
yukarda aktarlan deneysel almalarn sonulandrlmasn takiben, lkemiz koullarnda en
uygun olabilecek bir artma sreci belirlenmeye allmtr. Bu aamada; iletimi kolay ve
95,5
96,0
96,5
97,0
97,5
98,0
98,5
99,0
99,5
100,0
25 50 75 100 125 150
AlCl3 dozu (mg/L)
G
i
d
e
r
i
m

V
e
r
i
m
i

(
%
)
AKM
Absorbans(550 nm)
96,0
96,5
97,0
97,5
98,0
98,5
99,0
99,5
100,0
25 50 75 100 125 150
Alum dozu (mg/L)
G
i
d
e
r
i
m

V
e
r
i
m
i

(
%
)
AKM
Absorbans(550 nm)
454 F. iner


yetimi personel gerektiren sistemlerden kanlarak, Yeti ve di.(1994) tarafndan mermer
atksularnn artm iin nerilen ve ekil 3te verilen sistem seilmitir.

ekil 3. Yeniden kullanm iin nerilen artma sistemi.
4. Sonular ve neriler
Atksuyun oda scaklnda pH 8.7; AKM konsantrasyonu 9,32 g/L; Absorbans (550 nmde)
2,510 olarak bulunmutur. Yaplan koaglasyon deneylerinde Alum ve AlCl
3
kullanlmtr.
Alum ve AlCl
3
n tm koaglant dozlarnda AKM giderim verimi % 99un zerinde elde
edilmitir. Optimum koaglant dozu Alum iin 125 mg/L ve AlCl
3
iin 150 mg/L olarak
bulunmutur. Alum iin; % 99.9 AKM giderimi, % 98.4 absorbans giderimi AlCl
3
iin; % 99.8
AKM giderimi, % 97.9 absorbans giderimi elde edilmitir. Optimum giderim verimini salayan
ve ekonomik olan koaglant alumdur.
Kaynaklar
Janosova, B., Miklankova, J., Hlavinek, P., Wintgens, T. (2005). Drivers for wastewater reuse:regional analysis in the
Czech Republic, Desalination., 187, 103-114.
Kahraman, M. (2006). Avrupa birlii srecinde mesleki eitim ve doalta sektr, MERSEM2006, Trkiye V.
Mermer ve Doalta Sempozyumu, 125-129, 2-3 Mart, Afyonkarahisar.
ener, S., zylmaz, A., St, K. (2007). Mermer kesme ve ileme tesislerinden kan atksuda koaglasyon ile
AKM giderimi ve proses suyunun geri kazanm, Ulusal evre Sempozyumu, 18-21 Nisan, Mersin.
Yeti, ., Src, G., Dilek, F.B., Baaran, A. (1994). Tabii mermer sanayinden ortaya kan atksularn artm, T
4. Endstriyel Kirlenme Sempozyumu, 77-87, 26-28 Eyll, stanbul.
n ktrme


Debi ler

Koaglasyon-
floklasyon
Durultucu

Atksu

kimyasal
Tesis giri
suyu
amur
kurutma
yatana



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Otomotiv Yan Sanayi Atksularndan Fenol Gideriminin
ncelenmesi
Senem stn Kurnaz ve Hanife Bykgngr
Ondokuz Mays niversitesi, evre Mhendislii Blm, Kurupelit, 55139, Samsun.
E-posta: senem@omu.edu.tr

z ou endstri tesislerinin retim ilemleri srasnda fenolik maddeler kullanlmaktadr.
Fenol ve trevleri sentetik, kauuk, eczaclk, ya ve gaz, kt, tekstil, ahap koruma
kimyasallar, demir-elik, boya, zc, aa retimi ve plastik retimi gibi endstrilerin atk
sularnda mevcutturlar. Otomotiv sanayi ve baz yan sanayilerinde fenol ieren hammaddeler
kullanldnda tesis atksuyunda istenmeyen deriimlerde fenole rastlamak mmkndr. Son
yllarda fenol ve ar metal gibi kirleticilerin giderilmesinde eitli trlerdeki mikro-
organizmalarn kurutularak adsorpsiyonda kullanlmas (biyosorpsiyon) yaygnlamtr. Bu
almann amac, retim ilemleri srasnda, fenolik maddeler kullanlan otomotiv yan
sanayinden alnan atksulardan fenoln, eitli yntemlerle n ilemden geirilmi l ve
kurutulmu Aspergillus niger biyoktlesi kullanlarak biyosorpsiyon yntemiyle giderimini
incelemektir. Otomotiv yan sanayi atksuyundan biyosorpsiyon yntemiyle fenol giderimi
almalarndan nce n almalar yaplarak, belirli konsantrasyonda fenol ieren sentetik
zelti ile fenol gideriminin en iyi olduu mikroorganizmann n ilemden geirme yntemi,
giderim zaman, ortamn pH, biyosorbent boyutu ve biyosorbent konsantrasyonu belirlenmitir.
n alma kapsamnda yaplan, biyosorpsiyonla fenol gideriminde balang konsantrasyonu-
nun giderime etkisi almas sonucunda elde edilen verilerle fenol giderimine adsorpsiyon
izotermlerinin uygunluu belirlenerek izoterm sabitleri hesaplanmtr. n almalar sonucunda
belirlenen optimum artlarla otomotiv yan sanayi atksuyundan kesikli sistemde biyosorpsiyon
yntemi ile fenol giderimi ilem yaplmtr. Yaplan almalar sonucunda, Aspergillus niger
mikroorganizmasnn otomotiv yan sanayi atksuyundan fenoln uzaklatrlmasnda baarl bir
biyosorbent olduu grlmtr. 38.12 mg/L balang fenol konsantrasyonuna sahip otomotiv
yan sanayi atksuyunda belirlenen optimum koullar altnda 60 dakikalk artm sonucunda
biyosorbentin fenol biyosorplama kapasitesi 59.76 mg/g olarak belirlenmitir.
Anahtar Kelimeler Aspergillus niger; biyosorpsiyon; fenol; otomotiv yan sanayi
1. Giri
Fenol ve trevleri sentetik, kauuk, eczaclk, ya ve gaz, kt, tekstil, ahap koruma
kimyasallar, demir-elik, boya-zc, aa retimi ve plastik retimi gibi endstrilerin atk
sularnda mevcutturlar. Evsel atksularda da fenolik maddelere rastlanmaktadr. Ayrca baz
yiyeceklerde, insan ve hayvan atklarnda doal olarak bulunurlar (Grel ve Bykgngr,
2004). Fenol kmr katranndan izole edilir fakat gnmzde sentetik olarak da retilmektedir.
Fenol bakteri ve funguslara toksik etki yapar ve dezenfektan olarak kullanlr (EPA, 2000).
Fenol ieren atksular fenoln toksisitesi sebebiyle alc ortamlara artlmadan dearj
edilmemelidir. Fenol konsantrasyonuna ar dzeyde ve uzun sre maruz kalan insanlarda
kronik fenol zehirlenmesinin belirtisi olarak itah kayb, zayflama, ba ars, abuk yorulma ve
uykusuzluk grlmektedir (Denizli ve di., 2005; stn Kurnaz ve Bykgngr, 2007). me
456 S. . Kurnaz, H. Bykgngr


sularnda bulunan fenoln 1 g/L konsantrasyonu bile nemli lde tat ve koku problemi
oluturur (stn Kurnaz ve Bykgngr, 2006). Fenolik bileikler sulardan fiziksel, kimyasal
ve biyolojik yntemlerle giderilebilirler. Fenol gideriminde en ok kullanlan yntemlerin
banda aktif karbonla adsorbsiyon gelmektedir. Aktif karbon ile adsorbsiyon, fenolik
bileiklerin gideriminde olduka etkindir fakat pahal ve rejenerasyonu zor bir yntemdir
(Yldz ve di., 2004). Son yllarda, eitli trdeki kurutulmu mikroorganizmalar sulardaki
kirleticilerin adsorbsiyonunda baarl ekilde kullanlmaktadr (Aksu ve di., 1991). Fenol ve
trevleri yaplarnda yer alan OH
-
ve Cl
-
gruplarnn da yardmyla, kurutularak ve paralanarak
kullanlan mikroorganizma yzeyindeki karbonhidrat, lipit ve protein yaplarna balanabilirler
(Rao ve Viraraghavan, 2002; Bke zko ve Bykgngr, 1994). Bu almann amac,
otomotiv yan sanayinden alnan atksulardan fenoln, eitli yntemlerle n ilemden geirilmi
l ve kurutulmu Aspergillus niger biyoktlesi kullanlarak biyosorpsiyon yntemiyle
giderimini incelemektir.
2. Materyal ve Metotlar
2.1. Optimum Giderim artlarn Belirleme almalar
Otomotiv yan sanayi atksuyundan fenol giderimi almalarndan nce n almalar yaplarak,
belirli konsantrasyonda fenol ieren sentetik zelti ile fenol gideriminin en iyi olduu;
mikroorganizma n ilemden geirme yntemi, giderim zaman, ortam pH, biyosorbent boyutu
ve konsantrasyonu belirlenmitir. Ayrca biyosorpsiyonla fenol gideriminde balang
konsantrasyonunun giderime etkisi almas yaplarak elde edilen verilerle fenol giderimine
adsorpsiyon izotermlerinin uygunluu belirlenerek izoterm sabitleri hesaplanmtr. Fenol
analizi iin Standart Metotta bulunan Direkt Fotometrik Metot kullanlmtr. Bu almada
biyosorbent olarak kullanlan bir fungus tr olan Aspergillus niger (RSHMB-04017) Refik
Saydam Hfzshha Bakanlndan temin edilmitir. A. Niger distile ve deiyonize edilmi suda
dekstroz (20 g/L), pepton (10 g/L) ve maya ekstrakt (3 g/L) ieren bir sv byme ortamna
alanmtr. Canl olan A. Niger biyoktlesi fakl yolla n ilemden geirilerek inaktif hale
getirilmitir. Bu yntemler; a) 121
0
C ve 124 kPada 15 dakika otoklavda bekletilme b) 1 saat
0.1 M H
2
SO
4
zeltisinde ve daha sonra 15 dakika otoklavda bekletilme c) 1 saat 0.1 M NaOH
zeltisinde ve daha sonra 15 dakika otoklavda bekletilme eklinde uygulanmtr. Bu
ilemlerden sonra kurutulmu biyoktleler paralanarak toz haline getirilmitir. Daha sonra
istenen boyutlara uygun eleklerden geirilerek biyosorpsiyon almalar iin kullanlmtr.
2.2. Otomotiv Yan Sanayi Atksuyundan Fenol Giderim almalar
stanbul kitelli Sanayi Blgesinde bulunan otomotiv yan sanayi kuruluundan temin edilen
atksuya ait analiz sonular Tablo 1de verilmitir. Otomotiv yan sanayi atksuyundan fenol
giderimi ilemi 250 mLlik tepkime kaplarnda kesikli sistemde srdrlmtr. Biyosorbent
olarak H
2
SO
4
ile n ilemden geirilmi Aspergillus niger biyosorbenti kullanlmtr.
Tablo 1. Otomotiv yan sanayi atksularna ait analiz sonular.
Parametre Deeri
KO (mg KO/L) 200
letkenlik (mS/cm) 16.55
pH 4.47
Fenol Konsantrasyonu (mg/L) 38.12
Ortamn pHs optimum pH 5e ayarlanmtr. Biyosorbent deriimi optimum doza 0,5 g/L (63
m boyutunda) ayarlanmtr. Deneyler 125 rpm sabit alkalama hznda ve 25
0
C sabit
Otomotiv Yan Sanayi Atksularndan Fenol Gideriminin ncelenmesi 457


scaklkta dner bir alkalaycda srdrlmtr. Belirli zamanlarda alnan rneklerde
adsorplanmadan kalan fenol konsantrasyonlar belirlenmitir.
3. Sonular ve Tartma
3.1. Optimum Giderim artlar ve zoterm almalar
Tablo 2de fenol giderimi iin n almada belirlenen optimum artlar verilmektedir.
Tablo 2. n almalar sonucu fenol giderimde belirlenen optimum parametreler deerleri
Parametre Deeri
pH 5.0
Mik. Org. n lemden Geirme Yntemi H
2
SO
4
ile
Biyosorbent Konsantrasyonu 0.5 g/L
Biyosorbent Boyutu 45-63 m
Denge Zaman 40 dakika
Slfrik asitle n ilemden geirilmi A. niger ile fenol biyosorpsiyonunda balang
konsantrasyonunun giderime etkisi almas yaplarak elde edilen verilerle fenol giderimine
adsorpsiyon izotermlerinin uygunluu belirlenerek izoterm sabitleri hesaplanmtr. Fenol
giderimi iin adsorpsiyon dengesi adsorpsiyon izotermi olarak bilinenen Langmuir ve
Freundlich denklemlerinin linearize edilmi hali kullanlarak ifade edilmitir. Langmuir
denkleminin linearize edilmi hali;
) (
1 1 1
abc a
m
x
+ =
(1)
Burada; x/m birim adsorplayc bana adsorplanan madde miktar (mg g-1), C adsorpsiyondan
sonra zeltide kalan maddenin konsantrasyonu (mg L-1), a adsorpsiyon kapasitesini gsteren,
b ise enerji ile ilgili Lagmuir sabitleridir. Freundlich denkleminin linearize edilmi hali;
( ) ( ) C
n
K
m
x
F
ln
1
ln ln + = |
.
|

\
|
(2)
Burada; x/m ve C Langmuir denklemindeki ayn byklkleri ifade etmektedir. K
F
adsorpsiyon
kapasitesini n ise adsorpsiyon iddetini gsteren sabitlerdir. Fenol biyosorpsiyonunda elde
edilen Langmuir ve Freundlich izotermlerine ait sabitler Tablo 3de verilmitir.
Tablo 3. Freundlich ve Langmuir izoterm modelleri iin izoterm denklemleri ve katsaylar
Langmuir izotermi Freundlich izotermi
Denklem 1/(x/m)=0.4619(1/C)+0.0033 Denklem ln(x/m)=0.5398ln(C)x+2.2557
a 30.30 n 1.85
b 0.07 (mg/g) K
F
(l/mg) 9.54
R
2
0.9963 R
2
0.9542

Tablo 3de grlen R
2
(korelasyon katsays) deerlerine bakldnda fenoln slfrik asitle n
ilemden geirimli A. Niger biyosorbenti ile biyosorpsiyonunun Langmuir izotermine daha
uygun olduu grlmtr.


458 S. . Kurnaz, H. Bykgngr


3.2. Otomotiv Yan Sanayi Atksuyundan Fenol Giderimi Deneysel almalar
Fenol giderimi iin Tablo 2de verilen optimum koullar belirlendikten sonra otomotiv yan
sanayi atksuyundan biyosorpsiyonla fenol giderimi ilemi yaplmtr. ekil 1de fenol
konsantrasyonunun zamana bal olarak deiimi verilmitir.

ekil 1. Otomotiv yan sanayi atksuyunda slfrik asitle n ilemden geirilmi A. Niger
ile fenol biyosorpsiyonunda fenol konsantrasyonunun zamana bal olarak deiimi
Yaplan almalar sonucunda, Aspergillus niger mikroorganizmasnn otomotiv yan sanayi
atksuyundan fenoln uzaklatrlmasnda baarl bir biyosorbent olduu grlmtr. 38,12
mg/L balang fenol konsantrasyonuna sahip atksuda, belirlenen optimum koullar altnda 60
dakikalk artm sonucunda biyosorbentin fenol biyosorplama kapasitesi 59.76 mg/g olarak
belirlenmitir. Bu alma, otomotiv yan sanayi atksular gibi endstriyel atksulardan fenoln
uzaklatrlmasnda biyosorbentlerin verimli ekilde kullanlabileceini gstermektedir.
Kaynaklar
Aksu, Z., Kutsal, T., Gn, S., Hacosmanolu, N. and Gholaminevad, M. (1991). Investigation of Biosorption of
Cu(II), Ni(II) ve Cr(VI) Ions to Activated Sludge Bacteria, Environ. Technol., 12, 915-921.
Bke zko, H. ve Bykgngr, H. (1994). Petrol Atksuyundan Fenoln Aktif amur ve Phenobac Kltr ile
Biyodegredasyonu, II. Ulusal Biyoteknoloji Sempozyumu, Ankara, sf.60.
Denizli, A., Cihangir, N., Tzmen, N. and Alsancak, G. (2005). Removal of Chlorophenols from Aquatic Systems
Using the Dried and Dead Fungus Pleurotus sajor caju, Bioresource Technology, 96, 59-62.
EPA, (2000). Toxicological Review, Phenol, In Support of Summary Information in Integrated Risk Information
System (IRIS), Washington, D.C.
Grel, A.C. and Bykgngr, H. (2004). Phenol Removal Using Phenobac Bactera, Bioremediation of Soils
Contaminated with Aromatic Compounds, NATO ARW, Tartu/Estonia, sf. 27.
Rao, J. R. and Viraraghavan, T. (2002). Biosorption of Phenol from an Aqueous Solution by Aspergillus niger
Biomass, Bioresource Technology, 85, 165-171.
stn Kurnaz, S. ve Bykgngr, H. (2006). Su Ortamnda Aspergillus Niger Biyoktlesi ile Fenol Biyosorpsiyonu,
Trkiyede evre Kirlenmesi ncelikleri Sempozyumu V, Gebze Yksek Teknoloji Enst., Gebze, 286-290.
stn Kurnaz, S. and Bykgngr, H. (2007). Removal of Phenol from Aqueous Solutions Using Various Biomass,
Journal of Biotechnoloy, ECB 13, 13th European Congress on Biotechnology, vol-131 (2), Supplement 1, p. s75.
Yldz, .Y., Bingl, Z., Demirciolu, N. ve rdemez, . (2004). Aktif Karbon Kullanlarak Atksulardan Fenol
Giderimi, I. Ulusal evre Kongresi, 13-15 Ekim 2004, Sivas, 473-478.
0
10
20
30
40
50
60
70
q

(
m
g
/
g
)
zaman (dakika)



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Ar Metal eren Atksularn Elektrokoaglasyon Yntemi le
Artlmas
Selva Camc
1
, Feryal Akbal
1
, Mehtap Yaan
2

1
Ondokuz Mays niversitesi, evre Mhendislii Blm, Kurupelit, Samsun.
2
Ondokuz Mays niversitesi, Kimya Blm, Kurupelit, Samsun.

z Bu almada elektrokoaglasyon yntemi ile metal kaplama atksuyundan nikel, bakr ve
krom giderimi incelenmitir. Elektrokoaglasyon deneylerinde atksu bileimi, elektrot tipi ve
elektroliz sresinin giderim verimine etkisi aratrlmtr. Bu amala demir ve alminyum
elektrotlar kullanlarak farkl konsantrasyonlarda ar metal ieren atksularn
elektrokoaglasyon yntemi ile artm incelenmitir. Bakr (Cu), Krom (Cr) ve Nikel (Ni) ieren
farkl atksuda iletkenlik, pH ve akm younluu deerleri sabit tutularak deneyler
gerekletirilmitir. Her iki elektrot ifti iin enerji tketimleri de hesaplanmtr.
Elektrokoaglasyon ynteminin Cu, Cr ve Ni gideriminde etkili olduu bulunmutur.
Anahtar Kelimeler elektrokoaglasyon; elektroliz;metal kaplama atksuyu
1. Giri
Metal kaplama atksular genellikle izin verilen seviyelerden ok daha yksek metal
konsantrasyonlar ierirler. Yksek toksisiteleri nedeniyle, ar metal ieren atksularn
dearjdan nce artlmas zorunludur. Ar metallerin artm iin ktrme, adsorpsiyon, iyon
deiimi, ters osmoz gibi yntemler kullanlmaktadr [Kurniawan ve di., 2006]. ktrme bu
teknikler arasnda en ekonomik ve uygulanabilir olandr. ktrme pHy ykseltmek zere
kire ve koloidal maddeleri gidermek zere alminyum tuzlarnn kullanld kimyasal
koaglasyona dayanmaktadr. Endstriyel atksularn artlmasnda etkili olmasna ramen,
kimyasal koaglasyon kullanlan kimyasal maddeler nedeniyle, ikincil kirlilie neden
olmaktadr [Adhoum ve di., 2004; Heidman ve Calmano, 2007].
Elektrokoaglasyon koaglant maddenin genellikle demir ya da alminyum anotun elektro-
oksidasyonu sonucunda olutuu basit ve etkili bir yntemdir. Bu yntemde artm herhangi bir
kimyasal koaglant ya da floklant kullanlmakszn yaplr, bu bertaraf edilmesi gereken amur
miktarn azaltr. Elektrokoaglasyon prosesinde uygulanan akm nedeniyle anotun korozyonu
sonucu oluan eitli koaglant trler ve hidroksitler askdaki partiklleri destabilize ve koagle
etmekte ve znm kirleticileri ktrmekte ve adsorplamaktadr [Mollah ve di., 2004;
Heidman ve Calmano, 2007]. Elektrokoaglasyon yntemi ya, boyar madde, askdaki
partikller ieren atksularn, kimyasal ve mekanik parlatma atksularnn, sznt sularnn,
sentetik deterjan atksularnn, maden atksularnn, ar metal ieren atksularn artlmasnda
baaryla uygulanmtr [Mollah ve di., 2001]. Bu almada metal kaplama atksuyunun demir
ve alminyum elektrotlar kullanlarak elektrokoaglasyon yntemi ile artm incelenmi ve
metal konsantrasyonu, elektrot tipi ve elektroliz sresinin metal giderimine etkisi aratrlmtr.


460 S. Camc, F. Akbal, M. Yaan


2. Materyal ve Metot
almada kullanlan atksu bir metal kaplama tesisinden farkl zamanlarda alnmtr. Cu, Cr ve
Ni konsantrasyonlar birinci atksuda srasyla 45, 44,5, 394 mg/L iken ikinci atksuda 155,4,
116,5 ve 452 mg/L ve nc atksuda 334,7 mg/L, 193 mg/L ve 526 mg/L dir.
Elektrokoaglasyon deneyleri 650 ml hacminde reaktre 10 mm aralkla yerletirilmi ve
atksuya daldrlm 6 adet paralel elektrot kullanlarak gerekletirilmitir. Demir ya da
alminyumdan yaplan elektrotlar (75mmx45mmx2mm) bir DC g kaynana (GW-GPC
3060D) balanmtr. Artmn izlenmesi amacyla reaktrden belirli zaman arallaryla 10 ml
atksu numunesi alnm ve elektroliz srasnda oluan amurun ayrlmas iin filtre edilmitir.
Metal konsantrasyonlar atomik absorbsiyon spektrofotometresi (ATI-UNCAM 929) ile tayin
edilmitir.
3. Bulgular ve Deerlendirme
3.1. Metal Kaplama Atksuyunun Demir Elektrotlar le Elektrokoaglasyonu
Demir elektrotlar ile yaplan elektrokoaglasyon deneylerinde 10 mA/cm
2
akm younluunda,
atksuyun kendi pHs olan pH 3 deerinde ve 4 mS/cm iletkenlik deerinde, birinci atksuda 15
dk elektroliz sresinde %99,9 Cu giderim verimi elde edilirken ikinci ve nc atksularda
ayn verim 40 ve 60 dk elektroliz srelerinde elde edilmitir. Bu srelerde enerji tketimleri
srasyla 3,63 kWh/m
3
, 11,92 kWh/m
3
ve 23,65 kWh/m
3
dr. Demir elektrotlar ile Cu giderimi
ekil 1de verilmitir.

ekil 1. Metal kaplama atksuyundan demir elektrotlar ile Cu giderimi
Cr gideriminde %99,9 giderim verimi iin birinci atksuda 5 dk elektroliz sresi yeterli
olmutur. kinci atksuda 15 dk elektroliz sresinde %99,9 Cr giderim verimi elde edilirken
nc atksuda 20 dk sonunda ayn verime ulalmtr. Ni iin ise 20 dk elektroliz sresinde
birinci atksuda %99,9, ikinci atksuda %94,5, nc atksuda %76 giderim verimi
salanmtr. Bu verimlerin elde edildii srede enerji tketimleri srasyla 4,85 kWh/m
3
, 6,06
kWh/m
3
ve 6,37 kWh/m
3
olarak hesaplanmtr. Demir elektrotlar ile Cr ve Ni giderimi ekil 2
ve ekil 3de verilmitir.

0
20
40
60
80
100
0 10 20 30 40 50 60
Zaman (dakika)
C
u

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
45 mg/L
155,4 mg/L
334,7 mg/L
Ar Metal eren Atksularn Elektrokoaglasyon Yntemi le Artlmas 461



ekil 2. Metal kaplama atksuyundan demir elektrotlar ile Cr giderimi

ekil 3. Metal kaplama atksuyundan demir elektrotlar ile Ni giderimi
3.2. Metal Kaplama Atksuyunun Alminyum Elektrotlar le Elektrokoaglasyonu
Alminyum elektrotlar ile yaplan elektrokoaglasyon deneylerinde 10 mA/cm
2
akm
younluunda, atksuyun kendi pHs olan pH 3 deerinde ve 4 mS/cm iletkenlik deerinde, her
atksu 60 dk sreyle elektrolize tabi tutulmutur. Birinci atksuda %99,9 Cu giderim verimi
iin 10 dk yeterli olmutur ve bu srede enerji tketimi 3,18 kWh/m
3
olarak hesaplanmtr.
kinci atksuda %99,9 Cu giderim verimine 60 dk elektroliz sresi sonunda ulalmtr. Ayn
srede nc atksuda %99,7 Cu giderimi salanmtr ve bu sre sonundaki enerji tketimi
21.83 kWh/m
3
dr. Alminyum elektrotlar ile Cu giderimi ekil 4de verilmitir.

ekil 4. Metal kaplama atksuyundan alminyum elektrotlar ile Cu giderimi
Alminyum elektrotlar ile gerekletirilen elektrokoaglasyon ileminde Cr giderimi iin her
atksuda da 20 dk elektroliz sresi yeterli olmutur. Ni giderim verimi birinci atksuda 30 dk
sonunda %99,9, ikinci atksuda 40 dk sonunda %99,8 ve nc atksuda 60 dk elektroliz
0
20
40
60
80
100
0 5 10 15 20
Zaman (dakika)
C
r

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
44,5 mg/L
116,5 mg/L
193 mg/L
0
20
40
60
80
100
0 10 20 30 40 50 60
Zaman (dakika)
N
i

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
394 mg/L
452 mg/L
526 mg/L
0
20
40
60
80
100
0 10 20 30 40 50 60
Zaman (dakika)
C
u

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
45 mg/L
155,4 mg/L
334,7 mg/L
462 S. Camc, F. Akbal, M. Yaan


sresinde %97,9 olarak tespit edilmitir. Bu srelerdeki enerji tketimleri birinci atksu iin 9,85
kWh/m
3
, ikinci atksu iin 22,83 kWh/m
3
, nc atksu iin 21,83 kWh/m
3
olarak
hesaplanmtr. Alminyum elektrotlar ile Cr ve Ni giderimi ekil 5 ve ekil 6da verilmitir.

ekil 5. Metal kaplama atksuyundan alminyum elektrotlar ile Cr giderimi

ekil 6. Metal kaplama atksuyundan alminyum elektrotlar ile Ni giderimi
4. Sonular
Elektrokoaglasyon ynteminin metal kaplama tesisi atksuyundan Cu, Cr ve Ni gideriminde
etkili olduu bulunmutur. Demir ve alminyum elektrotlar ile gerekletirilen deneylerde metal
konsantrasyonunun artna bal olarak giderim veriminin azald ve metal konsantrasyonu
yksek olan atksularda daha yksek elektroliz srelerine ihtiya olduu grlmtr. Metal
konsantrasyonunu artna bal olarak enerji tketiminin de artt gzlenmitir.
Kaynaklar
Ahdoum, N., Monser, L., Bellkahal, N., Belgaied, J-E. (2004). Treatment of electroplating wastewater containing
Cu
+2
, Zn
+2
and Cr(IV) by electrocoagulaton, Journal of Hazardous Materials, B112, 207-213.
Heidmann, I., Calmano, W. Removal of Zn(II), Cu(II), Ni(II), Ag(I) and Cr(VI) present in aqueous solution by
aluminium electrocoagulation, Journal of Hazardous Materials, in press.
Heidmann, I., Calmano, W. (2007). Removal of Cr(IV) from model wastewaters by electrocoagulation with Fe
electrodes, Seperation and Purification Technolgy, 61, 15-21.
Kurniawan, T.A., Chan, Y.S., Lo, W.H., Babel, S. (2006). Physico-Chemical Treatment techniques for wastewater
laden with heavy metals, Chemical Engineering Journal, 118, 83-98.
Mollah, M.Y., Schennach, R., Parga, J.R., Cocke, D.L. (2001). Electrocoagulation (Ec)-science and applications,
Journal of Hazardous Materials, B84, 29-41
Mollah, M.Y., Morkovsky, P., Gomes, J.A.G., Kesmez, M., Parga, J., Cocke, D.L. (2004). Fundamentals present and
future perspectives of electrocoagulation, Journal of Hazardous Materials, B114, P:199-210.
0
20
40
60
80
100
0 5 10 15 20
Zaman (dakika)
C
r

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
44,5 mg/L
116,5 mg/L
193 mg/L
0
20
40
60
80
100
0 10 20 30 40 50 60
Zaman (dakika)
N
i

g
i
d
e
r
i
m

v
e
r
i
m
i

(
%
)
394 mg/L
452 mg/L
526 mg/L



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Sulardan Boyarmaddelerin Alt - Snf Kmr ile Giderilmesi
Eras Eraslan ve Ayegl Latifolu
Hacettepe niversitesi, evre Mhendislii Blm, 06800, Beytepe, Ankara
E-posta:eras@hacettepe.edu.tr; aysegull@hacettepe.edu.tr

z Bu almann amac, alt-snf kmr grubunda yer alan Leonarditin sulardan boyarmadde
giderim potansiyelini aratrmaktr. Organik sedimanter bir kaya olan Leonardit, bitki ve
hayvan kalntlarnn sucul ortamlarda ve bataklklarda kelerek bozunmas sonucunda
olumaktadr. Dk kalorifik deeri nedeni ile enerji amal kullanmlarda verimlilii dk bir
yakttr ve ucuz bir malzeme olarak piyasadan temin edilebilmektedir. Bu almada Elbistan
blgesinden elde edilen Leonardit kullanlmtr. Kaya olarak temin edilen Leonardit
laboratuarda ncelikle krlm, daha sonra elekten geirilerek 0.125-0.180 mm aralnda
partikl boyutlar oluturulmutur. Yaplan karakterizasyon almalar sonucunda birim ktlesi
2.16 g/cm
3
olan Leonardit rneinin nem oran % 5 olarak tespit edilmitir. Humik asit oran %
25dir. Karboksil ve hidroksil gruplarn miktarlar sras ile 4.85 ile 3.52 meq/g olarak
belirlenmitir. Spesifik yzey alan 13 m
2
/g olarak llmtr. Leonarditin sudan kirletici
giderim potansiyeli metilen mavisi boyarmaddesi iin aratrlmtr. Metilen mavisinin giderim
verimlilikleri 90 ile 1011 mg/l balang deriimleri iin incelenmitir. Balang boyarmadde
deriimlerinin sudaki giderim verimliliklerini etkiledii, deriimin fazlalamas ile birlikte
giderimlerin azald belirlenmitir. En dk deriimde, giderim oran % 90 iken bu miktar en
yksek deriimde % 38 olarak tespit edilmitir. Leonarditin metilen mavisi iin doygunluk
kapasitesi 94 mg/g seviyelerinde olduu belirlenmitir.
Anahtar Kelimeler adsorpsiyon; alt-snf kmr; bazik boya; leonardit; metilen mavisi
1. Giri
Endstriyel tesisler, retimleri srasnda yksek miktarlarda zararl kirleticilerin oluumuna
neden olmaktadrlar. Bu kirleticiler arasnda yer alan boyarmaddeler, tekstil ve ila
endstrilerinin balca atklar olarak bilinmektedir. Boyarmaddelerin, dnyada, yz binlerce
tona varabilen yllk retimleri ve buna paralel olarak yksek miktarlardaki endstriyel
kullanmlar, atklar ile ilgili nemli sorunlar da beraberinde getirmektedir. Boyama ilemleri
srasnda oluan ve boyarmadde ieren atksularn dorudan su alc ortamlara verilmesi
canllar zerinde zehirli ve kanserojenik etkilere neden olmaktadr (Willcock ve di., 1992).
Boyarmaddelerin kompleks ve sentetik kimyasal yaplar nedeni ile su ortamnda doal
etkenlerle artlmas zordur. Ayrca, ok farkl kimyasal yaplara sahip olan boyarmaddelerin,
rnein;asidik, bazik, reaktif, dispers ve azo boyarmaddeler gibi, konvansiyonel evsel atksu
artm tesislerinde aerobik koullarda artlmas mmkn olamamaktadr (Willmott ve di.,
1998). Endstriyel atksulardaki ve sucul ortamlardaki boyar maddelerin giderilmesi amac ile
adsorpsiyon, membran filtrasyonu, elektrokinetik koagulasyon, katalitik oksidasyon gibi eitli
fizikokimyasal yntemler aratrlmtr (Robinson ve di., 2001). Aktif karbon
adsorpsiyonunun sulardan boyar maddelerin uzaklatrlmasnda etkili olduu gsterilmitir (
Forgacs ve di., 2004). almalarda, yaygn olarak kmr, odun, petrol koku ve ta
kmrnden retilen ticari aktif karbonun kullanlmasnn yan sra, bitki atklarndan, uucu
464 E. Eraslan, A. Latifolu


kllerden ve kil minerallerinden retilen aktif karbon sulardan boyar madde giderimi iin
aratrlmtr (Gupta ve di., 2004; Guo ve di., 2005, Ravikumar ve di., Tan ve di., 2007;
Chandra ve di., 2007; Tsang ve di., 2007). Ancak, aktivasyon ilemi maliyeti yksek bir
ilemdir. Bu nedenle, eitli doal kaynaklar; zeolit, kil mineralleri, kmr bazl sorbentler ham
adsorban olarak aratrlmaktadr (Meshko ve di., 2001, Choy ve di., 2005; Mohan ve di.,
2005, Karagzoglu ve di., 2007).
Kmr bazl adsorplayclar kapsamnda yer alan Leonardit, bitki ve hayvan kalntlarnn
kelerek milyonlarca ylda paralanp bozunmas, huminifikasyonu ve oksidasyonu sonucu
olumu organik sedimanter bir kayatr. Yksek derecede oksitlenmi kmr olan Leonarditin
stma kapasitesi dktr. Leonardit ok miktarda karboksil, hidroksil ve karbonil fonksiyonel
gruplara sahip humik asit iermektedir (Olivella ve di., 2002). Leonarditin yksek miktarda
humik asit iermesi nedeni ile tarmsal faaliyetlerde gbre ve artlandrc olarak
kullanlmaktadr. Leonarditin sulardan sorpsiyon verimlilii ar metaller (Sole ve di., 2003;
Lao ve di., 2005) ve PAH (Zeledon-Toruna ve di., 2007) iin aratrlm ve etkili bir
adsorbent olduu aklanmtr. Bu almada ham Leonardit bazik boyarmadde giderimi iin
aratrlmtr. Aratrmada, bazik bir boyar madde olan metilen mavisi (MM) kullanlmtr.
2. Materyal ve Metod
Bu almada kullanlan Leonardit, Elbistan Blgesi kmr yataklarlarndan temin edilmitir.
Birim ktlesi 2.16 g/cm
3
olan Leonarditin nem oran % 5 olarak tespit edilmitir. Humik asit
oran % 25dir. Karboksil ve hidroksil gruplarn miktarlar sras ile 4.85 ile 3.52meq/g olarak
belirlenmitir. Leonardit rnei, deneylerde kullanlmadan nce krlarak, 0.125-0.180mm
partikl boyutlar olacak ekilde elekten geirilmitir. Bu boyutlardaki spesifik yzey alan 13
m
2
/g olarak llmtr.
Adsorpsiyon deneyleri tam karml kesikli reaktrlerde gerekletirilmitir. zeltiler
manyetik kartrc ile 360 rpm hzla kartrlmtr. Reaktr iersinde belirli deriimlerde
hazrlanan MM zeltileri stok zeltilerin seyreltilmesi ile oluturulmutur. zeltideki MM
deriimlerinin deiimleri spektrofotometrik olarak tayin edilmitir. Spektrofotometrik
okumalar, MMnin maksimum absorplad 665 nm dalga boyunda yaplmtr. Yaplan
deneylerde boyarmadde zeltilerinin pH deeri 7ye ayarlanmtr. zeltilere ilave edilen
Leonardit dozaj 5 g/ldir. Belirli konsantrasyonlarda boyarmadde ieren zeltilerin pH
ayarlanmas yapldktan sonra Leonardit ilave edilmi ve reaksiyon balatlmtr. Belirli zaman
aralklarnda reaktrden alnan rnekler 4000 rpmde 5 dakika santrifj edilerek partikller
karmdan ayrlmas salanmtr. Daha sonra, rnekler spektofotometrede boyar madde
deriimleri iin analiz edilmitir. rneklerin alnmas ve analizleri sistem dengeye ulancaya
kadar devam etmitir.
3. Sonular
Leonardit ieren zeltilerde MMnin zamana kar deiimi farkl MM deriimleri iin ekil
1de verilmitir. Deneysel sonular, uygulanan btn deriimlerde zeltide kalan MM
deriiminin zamanla azaldn, daha sonra sabitlenerek sistemin dengeye ulatn gstermitir.
Sistemin dengeye ulama sresi boyarmadde deriimi ile birlikte bir miktar fazlalamtr.
Dk deriimde 20 dakika iersinde gerekleen dengelenme, yksek deriimlerde 200
dakikann zerine kmtr. Sudaki MM molekllerinin fazlalamas ile birlikte gzenek
girilerindeki ylmalarn molekllerin hareketini yavalatt dnlmektedir. Dolays ile
deriimin artmas ile birlikte dengeye ulama hzda yavalamtr. Ayrca, artan MM deriimleri
Sulardan Boyarmaddelerin Alt - Snf Kmr ile Giderilmesi 465


ile birlikte sudan MM giderimi azalmtr. MM giderim oranlarnn artan deriimler ile birlikte
% 99larden %38lere dt grlmtr.

ekil 1. Farkl balang deriimlerinde MMnin zamana kar deiimi; pH=7,
[Leonardit]= 5g/l.
Ayn MM deriimler iin, denge koullarnda, birim Leonardit arl zerinde MM tutunma
miktarlar (q
e
) hesaplanm ve sonular Tablo.1de sunulmutur. Boyarmadde deriimi ile
birlikte q
e
nn art gsterdii ancak bu artn yksek deriimlerde yavalad grlmtr.
q
e
nin deeri, 1011 mg/l iin 94 mg/g olarak hesaplanm ve adsorbann doygunluk
kapasitesinin bu seviyelerde olduu belirlenmitir.
Tablo 1. Farkl balang deriimleri iin qe(mg/g) deerleri; pH=7, [Leonardit]= 5g/l.
MM (mg/l) q
e
(mg/g)
89 18
408 80
622 86
1011 94
Leonarditin metilen mavisi iin kapasitesi dier adsorbanlarla karlatrldnda, bitkisel
kaynakl aktif karbon iin 278 mg/g (Tan ve di., 2007), sl veya kimyasal ilem uygulanm
diatomite minerali iin sras ile 19 mg/g (Khraisheh ve di., 2005) ve 64 mg/g (Al-Ghouti ve
di., 2005), Na-doyurulmu kil minerali iin 85mg/g (hajjaji ve di., 2006) olarak aklanmtr.
Teekkr
Yazarlar Leonarditin temin edilmesi ve karakterizasyonu almalar srasnda gstermi
olduklar yardmlardan dolay; Maden Teknik ve Arama Genel Mdrl, Hacettepe
niversitesi Maden Mhendislii Blm, TAEK Sarayky Nkleer Aratrma Merkezi
Uygulama Blmne teekkr ederler.

0
200
400
600
800
1000
1200
0 200 400 600 800
t(dak)
[
M
M
]

(
m
g
/
l
t
)
90mg/lt
408mg/lt
622mg/lt
1011mg/lt
466 E. Eraslan, A. Latifolu


Kaynaklar
Al-Ghouti M., Khraisheh M.A.M.,, Ahmad a, S. Allen. (2005). Thermodynamic behaviour and the effect of
temperature on the removal of dyes from aqueous solution using modified diatomite: A kinetic study. Journal of
Colloid and Interface Science 287, 613.
Chandra T. C., Mirna M.M., Sudaryanto Y., Ismadji S. (2007). Adsorption of basic dye onto activated carbon
prepared from durian shell: Studies of adsorption equilibrium and kinetics, Chemical Engineering Journal 127,
121129.
Choy K. K.H., Allen S. J., Mckay G., (2005). Multicomponent Equilibrium Studies for the Adsorption of Basic Dyes
from Solution on Lignite, Adsorption 11, 255259.
Conxita Lao, Zoraida Zeledon, Xavier Gamisans, Montserrat Sole. (2005). Sorption of Cd(II) and Pb(II) from
aqueous solutions by a low-rank coal (leonardite), Separation and Purification Technology 45, 7985.
Daniel Tsang C. W., Jing Hu, Mei Yi Liu, Weihua Zhang, Keith C. K. Lai, Irene M. C. Lo. (2007). Activated Carbon
Produced from Waste Wood Pallets: Adsorption of Three Classes of Dyes, Water Air Soil Pollut, 184, 141155.
Esther Forgacs, Tibor Cserhati, Gyula Oros, (2004). Removal of synthetic dyes from wastewaters: a review,
Environment International 30, 953 971.
Guo Y., Zhao J., Zhang H., Yang S., Qi J., Wang Z., Xu H., 2005, Use of Rice Husk- Basd Porous Carbon for
Adsorption of Rhodamine B from Aqueous Solutions, Dyes And Pigments, 66, 123-128.
Gupta V.K., Mittal A, Krishnan L, Gajbe V. (2004). Adsorption kinetics and column operations for the removal and
recovery of malachite green from wastewater using bottom ash, Separation and Purification Technology, ????
Hajjaji M., Alami A, El Bouadili A., (2006). Removal of methylene blue from aqueous solution by fibrous clay
minerals, Journal of Hazardous Materials B135, 188-192.
Karagozoglu, B., Tasdemir, M., Demirbas, E., Kobya M. (2007). The adsorption of basic dye (Astrazon Blue FGRL)
from aqueous solutions onto sepiolite, fly ash and apricot shell activated carbon: Kinetic and equilibrium studies,
Journal of Hazardous Materials 147, 297306.
Khraisheh M.A.M., Al-Ghouti M.A., Allen S.J., Ahmad M.N. (2005). Effect of OH and silanol groups in the removal
of dyes from aqueous solution using diatomite, Water Research 39, 922-932.
Meshko, V., Markovska, L., Mncheva M. ve Rodrgues, A. E. (2001). Adsorpton Of Basc Dyes On Granular
Acvated Carbon And Natural Zeolte, Wat. Res. 35, (14), 33573366.
Montserrat Sol, Josep M. Casas And Conxta Lao. (2003). Removal Of Zn From Aqueous Solutons By Low-Rank
Coal, Water, Air, and Soil Pollution 144, 5765.
Olivella M.A., Del Ro J.C., Palacios J., Murthy A. Vairavamurthy, F.X.C. de las Heras, (2002). Characterization of
humic acid from leonardite coal: an integrated study of PY-GC-MS, XPS and XANES techniques, Journal of
Analytical and Applied Pyrolysis 63, 5968.
Ravikumar K., Deebika B., Balu K., (2005). Decolourization of aqueous dye solutions by a novel adsorbent:
Application of statistical designs and surface plots for the optimization and regression analysis, Journal of
Hazardous Materials B122, 7583.
Tan, I.A.W., Hameed, B.H., Ahmad, A.L. (2007). Equilibrium and kinetic studies on basic dye adsorption by oil
palm fibre activated carbon, Chemical Engineering Journal 127, 111119.
Tim Robinson, Geo McMullan, Roger Marchant, Poonam Nigam, (2001). Remediation of dyes in textile e.uent: a
critical review on current treatment technologies with a proposed alternative, Bioresource Technology 77, 247-
255.
Venkata Mohana, S,. Chandrasekhar Rao, N., Karthikeyan J. (2002). Adsorptive removal of direct azo dye from
aqueous phase onto coal based sorbents: a kinetic and mechanistic study, Journal of Hazardous Materials B90,
189204.
Willcock A., Brewster M., Tincher W., American Dye Stuff Reporter (1992). 15_/22.
Willmott, N., Guthrie, J., Nelson, G., (1998). The biotechnology approach to colour removal from textile e.uent.
JSDC 114, 38-41.
Zeledon-Toruno Z. C., Conxita Lao-Luque, F. Xavier C. de las Heras, Montserrat Sole-Sardans (2007). Removal of
PAHs from water using an immature coal (leonardite), Chemosphere 67, 505512.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Elektro-Fenton Prosesi Kullanlarak Kat Atk Sznt Suyundan
Kimyasal Oksijen htiyac Gideriminin ncelenmesi
Merve Oya Orkun ve Aye Kuleyin
Ondokuz Mays niversitesi, evre Mhendislii Blm, Kurupelit , 55139, Samsun.
E-posta: orkunm@omu.edu.tr

z Bu almada, elektrokimyasal yntemle fenton prosesi bir arada uygulanp, kat atk sznt
suyundan kimyasal oksijen ihtiyac (KO) giderimi zerine etkilerinin incelenmesi
amalanmtr. Bu ama iin sisteme dardan deiik konsantrasyonlarda hidrojen peroksit
eklenip, demir elektrotlarn demir iyon kayna olarak kullanlmtr ve KO giderim verimi
zerine etkileri aratrlmtr. Elde edilen verilere gre artan H
2
O
2
konsantrasyonuyla KO
giderim verimi de artmtr. Ayn artlar altnda, H
2
O
2
yokluunda giderim verimi %25 iken;
artan hidrojen peroksit ilavesinde giderim verimi giderek ykselmi ve %66 lara ulamtr.
Elektro-fenton prosesle kat atk sznt suyu ierisindeki organik maddeler iki aamada
oksidasyon ve koaglasyon ile giderilmitir. Fenton Reaksiyonunun etkinlii meydana geldii
ortamda radikallerin olumas ile ortaya kar. ok aktif yaplara sahip olan kimyasal radikaller,
en hzl reaksiyonlar verirler ve organik maddeleri paralarlar. Fenton proseslerin bu
etkilerinden dolay verim ksa srede ok fazla artmtr. Bu sonulardan hareketle;
elektrofenton prosesin deponi sznt suyundan kimyasal oksijen ihtiyac giderimi iin baarl
bir ekilde uygulanabilecei grlmtr.
Anahtar Kelimeler e-fenton prosesi; kimyasal oksijen ihtiyac; sznt suyu
1. Giri
Sznt suyu kat atklarn iinden szlerek bir takm kimyasal, biyolojik ve fiziksel olaylara
maruz kalarak oluur ve sznt suyu toplama sistemleri ile dar alnr (Yldz, 2000). Baka bir
ifadeyle sznt suyu; kat atklardan kaynaklanan znm, askda ve kark materyallerin
uzaklatrlmas sonucunda ortaya kan veya kat atklardan szlerek oluan svlar olarak
tanmlanr (Anonymous, 2003). Kat atklarn iinden szlen sznt suyu, kat atklarn
muhtevasndan kaynaklanan ok saydaki element ve bileii ierir. leri oksidasyon prosesi
olan Fenton Reaksiyonu elektron al veriine dayanan bir redoks tepkimesidir (Kurt ve di.,
2000; Zhang ve di., 2005). Genellikle kuvvetli organik madde ieren atksularn artlmasnda
bir n artm ya da destek artm olarak uygulanmaktadr (Zhang ve di., 2005). Sistemin
etkinlii meydana geldii ortamda radikallerin olumas ile ortaya kar. ok aktif yaplara
sahip olan kimyasal radikaller, en hzl reaksiyonlar verirler. ou metaller katalitik etki ile
oksidasyon olayn hzlandrma ve verimli klma zelliine sahiptir. Demir iyonunun varlnda
H
2
O
2
oksidant, ortama hidroksil radikalleri (OH) vermektedir. Bu radikal, flor gazndan (F
2
)
sonra gelen en kuvvetli oksitleyici zellii tamaktadr (Kurt ve di., 2000). Sucul ortamda
hidroksil radikalinin ortaya kmasna neden olan Fenton Reaksiyonu, genelde sularda bulunabilen
demir iyonlarnn katalitik etkisi ile Eitlik 1deki gibi meydana gelir (Zhang ve di., 2006).
Fe
+2
+ H
2
O
2
Fe
+3
+ OH
-
+ OH (1)
468 M. O. Orkun, A. Kuleyin


Fenton uygulamasnda, hidroksil radikallerinin direkt olarak organik maddelerle Eitlik 2. ve
Eitlik 3.de grld gibi tepkime vermesi istenir.
OH + C
6
H
6
(OH) C
6
H
6
(2)
Organik bileikleri okside edecek olan hidroksil radikalleri doal olarak kendiliinden
olumamaktadr. Bu tr artma prosesi iin laboratuardaki uygulamalarda zincirleme oluan
reaksiyonlarn profili aklayc olabilmektedir. Buna gre tipik bir uygulamada; Eitlik 3.de
gsterilen reaksiyon profiline gre reaksiyonlar cereyan edecektir.
Organik madde Oksitlenmi A ara rn
Oksitlenmi "B" ara rn Oksitlenmi "C" ara rn
Oksitlenmi"D"ara rn Oksitlenmi"E"ara rn CO
2
(3)
Fenton reaksiyonunu etkileyen faktrler arasnda; kirlilik ykne bal olarak Fe
+2
/H
2
O
2
oran,
scaklk, pH, reaksiyon sresi, oksijen, UV nlar vb. saylabilir (Kurt ve di., 2000). Ayrca
fenton oksidasyon reaksiyon hz iki nemli faktrden etkilenmektedir. Bunlar; hidrojen
peroksit dozu ve demir konsantrasyonudur (. Demir konsantrasyonu reaksiyon kinetii
asndan nemli olmasna karn, peroksit dozu da daha iyi bir oksidasyon verimi salanmas
asndan nemlidir (Chamarro ve di., 2001; Aydn ve di., 2002). Fenton oksidasyonu,
reaksiyon esnasnda yksek oksitleme kapasitesine sahip hidroksil radikallerinin (OH)
oluumunu destekleyen ve aadaki denklemle ifade edilen kimyasal mekanizmalar
iermektedir (Chamarro ve di., 2001; Aydn ve di., 2002).
Fe
2+
+ H
2
O
2
Fe
3+
+ OH

+ OH (4)
Ortamdaki Fe
+2
hidroksil radikallerinin dier bir reaksiyonu ile Fe
3+
'e ykseltgenir.
OH +Fe
2+
OH

+ Fe
3+ ...................
(5)
Fe
+3
'n katalitik etkisiyle aada belirtilen hidroksil ve hidroperoksil (HO
2
) radikal oluum
mekanizmalar ile H
2
O
2
bozunur.
Fe
+3
+ H
2
O
2
Fe -OOH
2+
+ H
+
(6)
Fe - OOH
2+
HO
2
+ Fe
2+
(7)
Fe
2+
+ HO
2
Fe
+3
+ HO
2


(8)
Fe
3+
+ HO
2
Fe
2+
+ H
+
+ O
2
(9)
OH + H
2
O
2
H
2
O + HO
2
(10)
Fenton oksidasyonu prosesi genel olarak 4 ana blmde gerekletirilir. Bunlar srasyla; pH
ayarlama, oksidasyon reaksiyonu, ntralizasyon-koaglasyon ve ktrmedir. Bu ekilde
organik maddeler iki aamada oksidasyon ve koaglasyon ile giderilmektedir (Bidga, 1995;
Birgl ve di., 2007). Son yllarda, fenton proseslerle elektrokimyasal metot uygulamalar bir
arada denenmektedir ki bu da elektrofenton (E-fenton) metot olarak adlandrlr. Bu almalar
deiik ekilde uygulanabilirler. Demir ve hidrojen peroksit sisteme dardan ilave edilebilir ya
da hidrojen peroksit dardan eklenip; tkenen demir elektrotlar demir iyon kayna olarak
kullanlabilirler (Zhang ve di., 2006; Lin ve di.,2000). Bununla birlikte yksek elektrofenton
prosesler ok kirli atksularn artmnda da kullanlabilirler (Zhang ve di., 2006; Lin ve
di.,2000; Chou ve di., 1999).
Elektro-Fenton Prosesi Kullanlarak Kat Atk Sznt Suyundan Kimyasal Oksijen htiyac
Gideriminin ncelenmesi
469


2. Materyal - Metot
2.1. Materyal ve Deney Dzenei
Denemelerde Samsun Canik Belediyesi snrlar ierisinde bulunan Ylanldere plnden
temin edilen sznt sular kullanlmtr. Elektro-fenton deneyleri ekil 1de gsterilen deney
dzeneinde gerekletirilmitir. Akm ve voltaj kontroll dijital bir g kayna kullanlmtr.
alma dzenei olarak kullanlan elektrokoaglatr 11*9.8*11 cm boyutlarnda preksiglasdan
yaplm olup, anot ve katot olmak zere toplam alt adet paralel bal elektrotdan
olumutur. Bu elektrotlar sistem ierisine 1cm aralklarla yerletirilmitir. Elektrot materyali
olarak 6.7*4.3*0.2 cm boyutlarnda, 172.86 cm
2
aktif yzey alanna sahip %90 saflkta demir
plakalar kullanlmtr.

ekil 1. Deney dzenei
2.3. Analitik Metot
Elektrotlar reaktre yerletirildikten sonra hcreye 850 ml elektrolit (sznt suyu) konulmu,
g kayna zerinde istenilen akm ve voltaj ayarlamas yaplarak almalar
gerekletirilmitir. Fe elektrotlarla gerekletirilen elektro-fenton prosesi denemelerinde %33
lk H
2
O
2
kullanlmtr. Belirlenen H
2
O
2
dozu elektrolite deneyin balangcnda tek admda
eklenip, elektrolitin pH s 3.5a ayarlanp elektrokoaglasyon ilemine tabi tutulmutur.
Elektrolit scakl 25
0
Cde sabit tutulmaya allmtr. Burada tkenen demir elektrotlarn
demir iyon kayna olarak kullanlmas amalanmtr. lem bittikten sonra pH 10a
ykseltilerek kme salanm ve KO analizleri gerekletirilmitir. Ayrca deney srasnda
tkenen anot ve katot miktarn hesaplamak iin, elektrotlar deneyden nce ve sonra hassas
terazide tartlmtr. Bu denemelerde de KO giderim verimi zerine H
2
O
2
konsantrasyonun ve
elektrokoaglasyon zamannn etkisi aratrlmtr. KO lmleri NOVA 60 marka
termoreaktr ve MERCK TR 620 marka fotometre kullanlarak gerekletirilmitir ve standart
metotlarda belirtildii ekilde, kapal reflux metoduyla kolorimetrik olarak belirlenmitir.
3. Sonular ve Deerlendirme
Bu aamada sisteme dardan deiik konsantrasyonlarda H2O2 eklenip KO giderim verimi
zerine etkisi aratrlmtr. Bunun iin sisteme deney balangcnda tek admda 250, 500, 750,
1000, 3000, 5000 ve 10000 ppm konsantrasyonlarnda H2O2 ilave edilmi, pH 300-4.00
aralna ayarlanm, 20 mA/cm2 akm younluunda 30 dk elektrokoaglasyon uygulanmtr.
Elde edilen sonular ekil 2de gsterilmitir. Buradan grld gibi artan H2O2
konsantrasyonuyla KO giderim verimi de artmtr. Ayn artlar altnda (20 mA/cm
2
, pH 3.00,
470 M. O. Orkun, A. Kuleyin


30 dk), H
2
O
2
yokluunda giderim verimi %25 iken; 250, 500, 750, 1000, 3000, 5000 ppm H
2
O
2

ilavesinde giderim verimi srasyla %35.62, %39.06, %45.62, %46.68, %49.68 ve %66e
ykselmitir, 10000 ppm H
2
O
2
ilavesinde ise verim ok fazla deimemi 5000 ppm ile yaklak
ayn verimler elde edilmitir. Optimum KO giderim verimi 5000 ppm H
2
O
2
ilavesinde %66
olarak elde edilmitir. Bu dozda kg KO/kg Fe ve enerji tketimi deerleri de srasyla 2.011,
0.930dir (ekil 3., ekil 4.).

ekil 2. H
2
O
2
Konsantrasyonun KO Giderim Verimine Etkisi

ekil 3. H
2
O
2
lavesinde Zamanla Demirin KO Giderme Kapasitesindeki Deiim

ekil 4. H
2
O
2
Konsantrasyonun Enerji Tketimine Etkisi
Bu nedenle en uygun H
2
O
2
dozu 5000 ppm olarak belirlenmitir ve bu dozda 15 dk ile 60 dk
arasnda zaman denemeleri yaplmtr. Elde edilen sonular ekil 5. de verilmitir. lk 15
dkda bile %56.25lik bir giderim verimi elde edilmitir ve verim 30 dkda %66, 45 dkda %70,
60 dk da %74.21e ykselmitir. Organik maddeler iki aamada oksidasyon ve koaglasyon ile
giderilmitir.
0
10
20
30
40
50
60
70
80
0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000
H2O2 Miktar (ppm)
K
O


G
i
d
e
r
i
m

V
e
r
i
m
i

(
%
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
0 10 20 30 40 50 60 70
Zaman (dk)
k
g

K
O


/

k
g

F
e
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000
H
2
O
2
miktar (ppm)
K
W
h

/

k
g

K
O

Elektro-Fenton Prosesi Kullanlarak Kat Atk Sznt Suyundan Kimyasal Oksijen htiyac
Gideriminin ncelenmesi
471



ekil 5. Zamann KO Giderme Verimine Etkisi
Demir elektrotlarla 20 mA/cm
2
akm younluunda yaplan elektrokoaglasyon deneyinde en
yksek verim 180 dkda %58.10, enerji tketimi 44.802 kWh/m
3
, kg KO giderimi iin enerji
tketimi 6.120 kWh/kg KO ve demirin KO giderme kapasitesi 0.621 kg KO/kg Fe olarak elde
edilmitir. Tablo 7.36.dan da grlebilecei gibi; 180 dkda elde edilen bu verim deerine ok
yakn bir deere elektrofenton proseste 15 dkda ulalm ve verim giderek ykselerek 60 dkda
%74.21e artmtr. Buna karlk enerji tketimi 20.96 kWh/m
3
e, kg KO giderimi iin enerji
tketimi 1.765 kWh/kg KO dm ve demirin giderim kapasitesi de 1.943 kg KO/kg Fee
ykselmitir (ekil 3.).
4. Sonular
Bu almada sznt suyundan KO giderimi iin daha yksek giderim verimleri elde etmek ve
maliyeti drmek iin elektrokoaglasyon prosesiyle fenton prosesi bir arada uygulanmtr.
Daha yksek KO giderim verimlerine demir elektrotlarla yaplan elektrokoaglasyon prosesi
denemelerinde gerekleen sreden ok daha ksa srelerde ulalmtr. 5000 ppm H
2
O
2
ilavesi
ile verim 1 saatte %74.21e ykselmitir. Buna karlk enerji tketimi demir elektrotta
gerekleen enerji tketiminin sekizde birine dmtr. Yine H
2
O
2
ilavesiyle demir elektrotun
KO giderme kapasitesi 1.943 kg KO/kg Fee ykselmitir. Bu sonulardan; elektrofenton
prosesinin; giderim verimi, enerji tketimleri, elektrotlarn giderim kapasiteleri ve maliyet
dikkate alnarak sznt suyundan KO giderimi iin baaryla uygulanabildii grlmtr.
Kaynaklar
Anonymous (2003). Criteria for Municipal Solid Waste Landfills. The Environmental Protection Agency Code of
Federal Regulations (CFR). 40,I, 258. U.S.A
Aydn, A. F., Sarkaya, H. Z., (2002). Biyolojik proseslerle artlm afyon alkaloidleri endstrisi atksularnn fenton
oksidasyonu ile ileri artm. T Dergisi/D Mhendislik Cilt:1 Say:1.
Bidga, R. J., (1995). Consider fenton's chemistry for wastewater treatment. Chem. Eng. Prog., 91 (12), 62-66.
Birgl, A., Akal Solmaz, S. K. (2007). Tekstil endstrisi atksular zerinde ileri oksidasyon ve kimyasal artma
prosesleri kullanlarak KO ve renk gideriminin aratrlmas. Ekoloji, 15 (62), 72-80.
Chamarro, E., Marco, A. ve Esplugas, S., (2001). Use of fenton reagent to improve organic chemical
biodegradability. Water Research, 35 (4), 1047- 1051.
Chou, S.S., Huang, Y.H., Lee, S.N., Huang G.H., Huang C.P., (1999). Treatment of high strength hexamine-
containing wastewater by electro-Fenton method, Water Research, 33, 751759.
0
10
20
30
40
50
60
70
80
0 10 20 30 40 50 60
Zaman (dk)
K
O


G
i
d
e
r
i
m

V
e
r
i
m
i

(
%
)
472 M. O. Orkun, A. Kuleyin


Kurt, U., Gnll, M. T., (2000). Sznt sularnn fenton reaksiyonu ile artlabilirliinin aratrlmas. I.Ulusal Kat
Atk Kongresi. zmir, 18-21 Nisan 2001, 23-35.
Lin, S.H., Chang, C.C., (2000). Treatment of landfill leachate by combined electro-Fenton oxidation and sequencing
batch reactor method. Water Research, 34, 42434249.
Yldz, ., (2000). Kat Atk Depolama Sahalarnda Oluan p Sznt Sular ve Artlmas. Yksek Lisan Tezi.
Gebze leri Teknoloji Enstits. Mhendislik ve Fen Bilimleri Enstits. Gebze.
Zhang, H. , Zhang, D., Zhou, J., (2006). Removal of COD from landfill leachate by electro-fenton method. Journal of
Hazardous Materials, B135, 106111.
Zhang, H., Choi, H.J., Huang, C. P., (2005). Optimization of fenton process for the treatment of landfill leachate. J.
Hazard. Mater., 125, 166174.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Atksulardaki Ni
2+
ve Cd
2+
yonlarnn Valeks Tanin Reinesi
zerine Adsorpsiyonu
Meral Evci Yurtsever ve . Ayhan engil
Sakarya niversitesi, evre Mhendislii Blm, Esentepe Kamps, 54187, Sakarya.
E-posta: mevci@sakarya.edu.tr

z Bu almada ama, doada hemen hemen tm bitkilerin kk, gvde, kabuk ve/veya
meyvelerinde bol miktarda bulunan tanin maddesinin bazik ortamda formaldehit ile
muamelesiyle gelitirilen bir adsorbent zerinde, Cd
2+
ve Ni
2+
iyonlarnn adsorpsiyon
davranlarn irdelemektir. Valeks tanin reinesi ile yaplan kesikli adsorpsiyon deneylerinde
tanecik boyutu, kartrma hz, ilk pH, scaklk ve metal iyon konsantrasyonu gibi deikenlerin
adsorpsiyona etkileri incelenmitir. Reinenin yapsal zelliklerini aklayabilmek iin, SEM
grnts, FTIR spektrumu, BET yzeyi ve zeta potansiyeli llmtr. Adsorpsiyon
deneyleri sonucunda Cd
2+
ve Ni
2+
iyonlarnn ikisi iin de en uygun pH deerinin 4 civarnda
olduu grlm ve bu iyonlar iin pH 4 deerinde gerekletirilen adsorpsiyon iin izoterm
eitlikleri ve kinetik modeller hesaplamtr. Cd
2+
iyonunun adsorpsiyon dengesi Langmuir, Ni
2+

iyonunun adsorpsiyon dengesi ise Freundlich izotermine uymaktadr. Partikl ii difzyon
modeli, Pseudo birinci mertebe modeli, Pseudo ikinci mertebe modeli, ve Elovich denklemi gibi
kinetik modeller kullanlarak, adsorpsiyon kinetii incelenmitir. Adsorpsiyon kinetiinin, en iyi
ikinci mertebe hz kinetiine uyduu dier kinetik modellerin ise adsorpsiyon kinetiini
tanmlamad grlmtr. Bu almalardan elde edilen sonulara gre, sulu zeltilerdeki
Cd
2+
ve Ni
2+
iyonlarnn valeks tanin reinesi ile giderilebilecei sylenebilir.
Anahtar Kelimeler adsorbent; izoterm; kadmiyum; kinetik; nikel; tanin reine
1. Giri
Toksik etkileri, besin zincirinde birikmesi ve dolaysyla insan vcudunda birikmesinden dolay
ar metal kirlilii ok nemli bir evresel problemdir (Kowalski, 1994). Sulardaki Ni
2+
ve
zellikle Cd
2+
gibi ar metaller de, ekosistemdeki tm canllar iin yksek toksisiteye sahiptir.
Cd genellikle, nikel-kadmiyum pillerde, boya-pigment sanayiinde, alamlarda ve elektronik
malzeme bileenlerinde kullanlr. Nikelin kullanm alanlar ise; metal kaplama endstrisi, pil
sanayii, alamlar, pigmentler, madeni para, kaynak rnleri, mknatslar, elektrotlar, elektrik
fileri, makine paralar ve tbbi protezlerdir (internet). Eser halde Ni, bitkiler ve hayvanlar iin
gerekli temel element zellii tar. Fakat yksek konsantrasyonu, bitkiler ve hayvanlar iin
toksiktir. Ni tuzlar ise kanser yapc olarak bilinir (Pradhan, 2005). Nikel in salk asndan en
yaygn olan kt etkisi; insanlar zerinde alerjik reaksiyonlara sebep olmasdr, nikelin yksek
miktarlar akcier ve nazal sins kanserlerine sebep olur. Kronik olarak yksek seviyelerde Cd
a maruz kalmann; bbrek yetersizlii, kemik yapsnn bozulmas, karacier hasar ve kan
hcrelerinin tahrip olmas gibi sorunlara yol at bilinmektedir. Cd ve Cd bileiklerinin
kanserojen bir madde olduu bir ok salk kuruluu tarafndan aklanmtr (Sheng, 2004).
Sulu ortamlarda bulunan ar metallerin giderilmesinde kullanlan konvansiyonel yntemlerden
bazlar; iyon deitirme, zc ekstraksiyonu, kimyasal ktrme, membran teknolojileri, ters
474 M. E. Yurtsever, . A. engil


osmoz, filtrasyon ve adsorpsiyon eklinde sralanabilir. Kullanlan yntemlerin birok avantaj
olduu gibi, yksek maliyet, etkin giderememe, fazla atk oluumu gibi baz dezavantajlar da
mevcuttur. Gnmze kadar ar metallerin adsorpsiyonla giderilmesi konusunda saysz
adsorbent ile almalar yaplmtr. Bu almalar; ekolojik, ekonomik, beslenme ve salk
konularyla yakndan ilikili olduundan dolay ilgi ekicidir (Lawrance, 1996). Literatrdeki
birok almada; zeolitler, klinoptilolit, bentonit, alunit, perlit, sepiyolit, paligorskit, pirit,
dolomit, illit, hematit, montmorillonit, vollastonit, antrasit, kaolin, feldispat, fosfojips, kum,
ponza ta vs. gibi tabii maddeler adsorbent olarak kullanlmtr. Gnmzde doal veya
sentetik olarak elde edilen birok maddenin adsorbent olarak deerlendirilmesi hakknda eitli
almalar mevcuttur. Materyal maliyetini drmek iin alternatif adsorbent olarak daha dk
maliyetli yer kmr, odun tala, aktif kil, diatome topra, alum amuru, alminyum oksitler,
boksit amuru, artma amuru, odun kl, uucu kl, frn klleri, maden eritme oca crufu ve
ynler zerinde allmtr. Literatrde ayrca; silika jel, aktif almina, polimerler
(poliakrilamidin vs.), turbalar, eitli bitkilerin kabuklar ve/veya ekirdekleri gibi tarmsal ve
orman rnleri atklar, tanin jelleri ve dier biyosorbentler gibi deiik rnekler, alternatif
adsorbentler olarak nerilmektedir. Son zamanlarda biyosorpsiyona, sulu zeltilerden metal
iyonlarn toplayan ve balayan hareketsiz, l mikrobiyal biyoktle tiplerine giderek artan bir
ilgi vardr (Volesky, 1995; Romero-Gonzalez, 2003). Taninler gibi biyoktle maddeleri nispeten
ucuzdur ve dnya apnda bol miktarda bulunmaktadr. Bitki orijinli olan taninler, molekl
yaplarnda byk miktarlarda polifenolik gruplarn bulunmas sayesinde metallerle
kompleksleerek elatlama zellikleri tar (Lima, 1998). Taninler; Cd, Cr, Co ve U gibi
elementler iin yksek ekicilik zellii gsterirler. Taninler adsorbent olarak kullanldnda
immobilize edilmelidir. nk tanin moleklleri suda zlebilir. znmez hale getirilmi
tanin; U, Pb, Cr ve Ag gibi baz metallere kar yksek adsorpsiyon kapasitesi gsterir (Nakano,
2001). Tanin reinelerle Cr
6+
(Nakano, 2000; Nakano, 2001), Au
3+
(Parajuli, 2007; Ogata,
2005), Pd
2+
(Kim, 2004), Am
3+
(Matsumura, 1998), Pb
2+
(Zhan, 2003), U (Nakajima, 1999) ve
VO
2+
, VO
3
-
(Nakajima, 2002), iyonlarnn adsorpsiyon yoluyla giderilmesi almalar
bulunmaktadr. Ayrca, Th(IV) (Liao, 2004a), UO
2
2+
(Liao, 2004b), Cu
2+
(Liao, 2004c), Pt
4+
,
Pd
2+
(Ma, 2006) ve Bi
3+
(Wang, 2006) iyonlarnn adsorpsiyonlar, zerinde tanin reine
sabitlenmi olan membran kullanlarak ok verimli bir ekilde gerekletirilmitir. Biyoktle
maddeleri ile atksular artlabildiinden dolay bu maddeler kirlenmi ortamlardaki evre
kirliliinin nne geilmesinde are niteliinde bir potansiyele sahiptir. Kirlenmi yeralt
sularndan ve atksulardan radyoaktif ve ar metallerin geri kazanlmas iin biyoktle
maddelerinin kullanlmas, arzu edilen iyonlara kar seicilii ve bu maddelerin bolca
bulunmas sebebiyle ucuz ve cazip bir teknolojik alternatiftir (Santana, 2002).
2. Materyal ve Metod
2.1. Tanin Reinesinin Hazrlanmas
Valeks tanini belli bir miktarda tartlarak oda scaklnda nce amonyakla kartrld, daha
sonra formaldehit ile kartrlarak polimerizasyonu saland ve 70
o
C etve konuldu. 3 saat
boyunca etvde kurutulduktan sonra ezildi. 0.1 N HNO
3
zeltisi ile ykandktan szld ve
daha sonra saf su ile de ykanarak safszlklar giderilmesi saland. Tekrar szldkten sonra
105
o
C de etve kondu ve iyice kuruyuncaya kadar bekletildi. Ezildi ve ASTM tipi eleklerde
elenerek 38 m-150 m arasnda 5 farkl tane boyutuna ayrld. Kesikli adsorpsiyon
deneyleriyle; tanecik boyutu, kartrma hz, ilk pH, scaklk ve metal iyon kons. gibi
deikenlerin adsorpsiyon srecine etkileri incelendi.

Atksulardaki Ni
2+
ve Cd
2+
yonlarnn Valeks Tanin Reinesi zerine Adsorpsiyonu 475


2.2. Adsorbent karakterizasyonu
Adsorbentlerin adsorpsiyon ilemi iin ne lde uygun olduunu belirlemek asndan
adsorpsiyon karakterizasyonu yapmak ok nemlidir. Bu amala; valeks tanininin ve valeks
tanin reinesinin, Taramal Elektron mikroskobu (TEM) ile grntleri ekilmitir. Tanin ve
tanin reinelerinin fonksiyonel gruplarndaki titreim frekans deiiklikleri FT-IR kullanlarak
llmtr. BET yzey alanlar ve Zeta potansiyelleri llmtr.



ekil 1. Ham valeks in taramal elektron mikroskobu ile elde edilen grntleri.


ekil 2. 38m-53m tane boyutundaki valeks reinesinin TEM grntleri.
Grntlerden; ham taninin yapsnn, reine haline gelmesiyle deitii ve yzey
przllnn artt anlalmaktadr. IR spektrum sonularna gre, ham tanin ve reinenin
yapsnda fenolik -OH gruplarnn, aromatik ve alifatik C-H gruplarnn varl gzlenmitir.
Valeks tanininden elde edilen reineye ait B.E.T. yzeyi llm ve

B.E.T.-N
2
spesifik yzey
alan 3.821 m
2
/g olarak bulunmutur. Valeks reinesinin izoelektrik noktas pH=2.2
deerindedir. Reine, pH=2 deerinin zerinde negatif bir yzeye sahiptir.
3. Sonu ve neriler
3.1. Tanecik Boyutu, Kartrma Hz, lk pH, Scaklk ve Metal yon Konsantrasyonu
gibi Deikenlerin Adsorpsiyona Etkileri
38-150 m arasnda kalan tane boyutlarndaki 5 farkl reineyle yaplan almalar sonucunda
en iyi verim 38-53 m tane boyutundaki reineyle elde edilmitir. Bundan dolay yaplan dier
almalarn hepsinde bu tane boyutu kullanlmtr. Ayrca 130, 250, 350, 450 ve 800 rpm gibi
5 farkl kartrma hznda yaplan deneyler; kartrma hznn, metal iyonlarnn adsorpsiyonu
zerine fazla etkili olmadn ortaya karmtr. Bundan sonraki almalarda, incelenen metal
iyonlar iin, kartrma hz, ortalama bir deer olarak 350 rpm seilmitir. pH ve scaklk
konusunda yaplan adsorpsiyon almalarndan elde edilen sonulara gre izilen grafikler
476 M. E. Yurtsever, . A. engil


aadaki ekil 3-4 te verilmitir. Scaklk parametresi dnda yaplan tm almalar 20
o
C de
gerekletirilmitir. Farkl balang metal konsantrasyonu konusunda yaplan almalar
sonucunda, zeltinin konsantrasyonu arttka adsorbentin yzeyi doyduu grlmtr ve
adsorpsiyon kinetikleri ve izotermleri hesaplanmtr. ekil 3 te valeks reinesinin Cd
2+
ve
Ni
2+
i pH=4 civarnda iyi adsorplad grlmektedir. ekil 4te grld gibi, valeks
reinesinin zerinde Cd
2+
ve Ni
2+
iyon adsorpsiyonu endotermiktir.

ekil 3. lk pH deiimine gre Cd ve Ni adsorpsiyonu.

ekil 4. Scaklk deiimine gre Cd ve Ni adsorpsiyonu.
3.2. Adsorpsiyon zotermleri
Tablo 1 de, Cd
2+
, iin Langmuir denkleminin korelasyon katsaysnn 0.99 dan byk olduu
yani ok Langmuir e iyi uyduu, Ni
2+
iyonlar iin ise adsorpsiyon dengesinin Freundlich
izotermine uyduu grlmektedir. Cd
2+
adsorpsiyonunun Tempkin izotermine de uyum
salad grlmektedir. Dubinin-Radushkevich izotermi ise iki metale de uymamaktadr.
Tablo 1. Metal adsorpsiyonunda izoterm almalarna ait sonular


Langmuir izotermi Freundlich izo. Tempkin izotermi Dubinin-Radush. izo.

a
L

(L/mg)
K
L

(L/g)
Q
0

(mg/g)
R
2

K
F

(L/g)
n R
2
B
A
(L/g)
R
2

q
m

(mmol/g)

(mmol
2
/j
2
)
R
2

Valeks Cd
2+
0.267 16.920 63.291 0.995 18.793 2.539 0.925 9.029 10.894 0.997 410.141 -3.E-06 0.839
Valeks Ni
2+
0.110 9.200 83.333 0.982 12.691 1.891 0.996 12.914 3.152 0.937 802.154 -1.E-05 0.696

0
2
4
6
8
10
0 30 60 90 120 150 180
Zaman (dakika)
A
d
s
o
r
p
l
a
n
a
n

C
d
2
+

m
i
k
t
a
r


(
m
g
/
g
)















pH=7 pH=6 pH=5
pH=4 pH=3 pH=2
0
2
4
6
8
10
0 30 60 90 120 150 180
Zaman (dakika)
A
d
s
o
r
p
l
a
n
a
n

N
i
2
+

m
i
k
t
a
r


(
m
g
/
g
)



















pH=7 pH=6 pH=5
pH=4 pH=3 pH=2
0
10
20
30
40
50
0 30 60 90 120 150 180
Zaman (dakika)
A
d
s
o
r
p
l
a
n
a
n

C
d
2
+

m
i
k
t
a
r


(
m
g
/
g
)































t=90C
t=70C
t=50C
t=30C
t=20C
0
10
20
30
40
0 30 60 90 120 150 180
Zaman (dakika)
A
d
s
o
r
p
l
a
n
a
n

N
i
2
+

m
i
k
t
a
r


(
m
g
/
g
)



















t=90C
t=70C
t=50C
t=30C
t=20C
Atksulardaki Ni
2+
ve Cd
2+
yonlarnn Valeks Tanin Reinesi zerine Adsorpsiyonu 477


3.3. Adsorpsiyon kinetikleri
Cd
2+
ve Ni
2+
adsorpsiyonunun daha iyi anlalmas iin, partikl ii difzyon modeli, Pseudo 1.
mertebe modeli, Pseudo 2. mertebe modeli, ve Elovich denklemi gibi kinetik modeller
kullanlarak hesaplamalar yaplm ve elde edilen sonular srasyla Tablo 2, 3 te verilmitir.
Tablo 2. Cd
2+
adsorpsiyonunda kinetik parametreler ve R
2
deerleri.
Cd
2+

C
o

(mg/L)
q
e
(mg/g)
Partiklii dif. modeli Pse.1. mert. denk Pse. 2. mert. denk. Elovich denklemi
k
int

(mg/g.dak
1/2
)
R
2

k
1

(1/dak)
R
2

k
2

(g/mg.dak)
R
2


(mg/g.dak)

R
2

(g/dak)
10 9.692 0.3014 0.891 0.0308 0.957 0.0253 0.9980 9.149E+02 1.2583 0.962
25 23.862 0.5713 0.556 0.0297 0.574 0.0454 0.9999 1.684E+04 0.5676 0.821
50 41.934 0.5043 0.909 0.0134 0.923 0.0178 0.9997 2.370E+11 0.7504 0.985
75 49.803 0.8772 0.808 0.0164 0.850 0.0120 0.9994 1.221E+07 0.4143 0.949
100 55.160 1.1457 0.955 0.0302 0.914 0.0049 0.9980 6.450E+06 0.3709 0.821
150 62.179 0.2182 0.883 0.0151 0.907 0.0387 1.0000 7.204E+43 1.7224 0.971
Tablo 3. Ni
2+
adsorpsiyonunda kinetik parametreler ve R
2
deerleri.
Ni
2+

C
o

(mg/L)
q
e
(mg/g)
Partiklii dif. modeli Pse.1. mert. denk Pse. 2. mert. denk. Elovich denklemi
k
int

(mg/g.dak
1/2
)
R
2

k
1

(1/dak)
R
2

k
2

(g/mg.dak)
R
2


(mg/g.dak)

R
2

(g/dak)
10 9.614 0.2922 0.681 0.0296 0.845 0.0616 1 6.571E+02 1.1617 0.917
25 21.858 0.2969 0.904 0.0205 0.685 0.0343 0.9999 6.676E+09 1.2775 0.975
50 39.119 0.1556 0.640 0.009 0.681 0.0408 0.9996 1.216E+39 2.4913 0.661
75 52.909 0.1383 0.624 0.0103 0.590 0.1051 0.9999 1.250E+59 2.6846 0.703
100 63.991 0.1738 0.768 0.0123 0.776 0.0342 0.9999 5.639E+60 2.2989 0.747
150 76.529 0.0829 0.239 0.0091 0.443 0.0903 1 2.367E+141 4.3573 0.285
Tablo 2-3 te Cd
2+
ve Ni
2+
metal iyonlarnn valeks reinesi zerindeki adsorpsiyonunun, pseudo
ikinci mertebe hz kinetiine ok iyi uyduu grlmektedir. Dier kinetik modellerin ise
adsorpsiyon kinetiini tanmlamad grlmektedir.
Bu almalardan elde edilen sonulara gre, sulu zeltilerdeki Cd
2+
ve Ni
2+
iyonlarnn valeks
tanin reinesi ile verimli bir ekilde giderilebilecei sylenebilir. Literatre bakldnda da
tanin reinelerin, ar ve deerli metal gideriminde kullanl bir adsorbent olaca
beklenmektedir. Byle ucuz ve kolay temin edilebilen ve doada bol miktarda bulunan doal
malzemeleri kullanarak alternatif artma tekniklerinin gelitirilmesi yolunda daha fazla
almalar yaplmaldr.

Teekkr
Bu alma, Trkiye Bilimsel ve Teknolojik Aratrma Kurumu (TBTAK) tarafndan
desteklenmitir. Desteklerinden dolay, TBTAK a kranlarmz sunarz.
Kaynaklar
http://www.metalurji.org.tr/dergi/dergi137/d137_4651.pdf
Kim, Y. H., Nakano, Y. (2005). Adsorption mechanism of palladium by redox within condensed-tannin gel, Wat.
Res. 39, 13241330.
478 M. E. Yurtsever, . A. engil


Kowalski, Z., (1994). Treatment of chromic tannery wastes, J. Hazard. Mater. 37 137144.
Lawrence, R., Rayson, G. D. (1996). Anal. Chem., 1, 23.
Liao, X., Li, L., Shi, B. (2004). Adsorption Recovery of thorium(IV) by Myrica rubra tannin and larch tannin
immobilized onto collagen fibres, J.Radioana. Nucl.Chem., 260 (3), 619-625.
Liao, X., Lu, Z., Zhang, M., Liu, X., Shi, B. (2004). Adsorption of Cu(II) from aqueous solutions by tannins
immobilized on collagen, J. Chem Technol Biotechnol, 79:335342.
Liao, X., Ma, H., Wang, R., Shi, B. (2004). Adsorption of UO
2
2+
on tannins immobilized collagen fiber membrane,
Journal of Membrane Science 243, 235241.
Lima, L., Olivares, S., Martinez, F., Torres, J., De La Rosa, D., Sepulveda, C. (1998). Use of immobilized tannin
adsorbent for removal of Cr(VI) from water, J. of Radi. Nuc. Chem., 231, 35-40.
Ma, H.W., Liao, X., Liu, X., Shi, B. (2006). Recovery of platinum(IV) and palladium(II) by bayberry tannin
immobilized collagen fiber membrane from water solution, J. of Membrane Sci., 278: 373380.
Matsumura, T., Usuda, S. (1998). Applicability of insoluble tannin to treatment of waste containing Americium,
Journal of Alloys and Compounds, ???, 244247.
Nakajima, A. (2002). Electron Spin Resonance Study on the Vanadium Adsorption by Persimmon Tanin Gel,
Talanta, 57, 537-544.
Nakajima, A., Sakaguchi, T. (1999). Recovery of uranium from uranium refining waste water by using immobilized
persimmon tannin, Journal of Radioanaly. Nuc.Chem., 242, (3), 623-626.
Nakano, Y., Miyazaki, A., Yamazaki, K. (2001). Recovery of silver from metal scraps bygel/liquid extraction, In:
Sixth World Congress of Chemical Engineering, Melbourne, Australia.
Nakano, Y., Takeshito, K., Tsutsumi, T. (2001). Adsorption Mechanism of Hexavalent Chromium by Redox within
Condensed-Tannin Gel, Wat. Res., 35(2), 496-500.
Nakano, Y., Tanaka, M., Nakamura, Y., Komo, M. (2000). Removal and Recovery System of Hexa. Chromium from
Wastewater by Tannin Gel Particles, J. Chem. Eng. Japan, 33(5), 747-752.
Ogata, T., Nakano, Y. (2005). Mechanisms of gold recovery from aqueous solutions using a novel tannin gel
adsorbent synthesized from natural condensed tannin, Wat. Res., 39, 4281-4286.
Parajuli, D., Kawakita, H., Inoue, K., Ohto, K., Kajiyama K. (2007). Persimmon peel gel for the selective recovery of
gold, Hydrometallurgy, 87, 133-139.
Pradhan, S., Shukla, S.S., Dorris, K.L. (2005). Removal of nickel from aqueous solutions using crab shells, J.
Hazard. Mater., B125 201204.
Romero-Gonzalez, M.E., Williams, C.J., Gardiner, P.H.E., Gurman, S.J., Habesh, S. (2003). Spectroscopic studies of
the biosorption of gold(III) bydealginate d seaweed waste, Environ. Sci. Techn. 37, 41634169.
Santana, J. L., Lima, L., Torres, J., Martinez, F., Olivares, S. (2002). Simultaneous metal adsorption on tannin resins,
J. of Radioanalytical and Nuclear Chem., 251, (3), 467471.
Sheng, P.X., Ting, Y.P., Chen, J.P., Hong, L. (2004). Sorption of lead, copper, cadmium, zinc, and nickel by marine
algal biomass: characterization of biosorptive capacity and investigation of mechanism, J. Colloid Interf. Sci.
275, 131141.
Volesky, B., Holan, Z.R. (1995). Biosorption of heavy metals, Biotechn. Progr. 11, 235250.
Wang, R., Liao, X., Zhao, S., Shi, B. (2006). Adsorption of bismuth(III) by bayberry tannin immobilized on collagen
fiber, J.Chem Technol Biotechno, 81:13011306.
Zhan, X.M., Zhao, X. (2003). Mechanism of lead adsorption from aqueous solutions using an adsorbent synthesized
from natural condensed tanin, Water Research, 37, 3905-3912.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Vine ekirdeinden Elde Edilen Aktif Karbonun Sulu
zeltiden Boyarmadde Gideriminde Kullanlmas
zgl Gerel
1
ve Ferdi Gerel
2

1
evre Mhendislii Blm, Mhendislik Mimarlk Fakltesi, Anadolu niversitesi, Iki Eyll
Kampus 26555, Eskiehir
E-posta: ogercel@anadolu.edu.tr
2
Kimya Mhendislii Blm, Mhendislik Mimarlk Fakltesi, Anadolu niversitesi, Iki Eyll
Kampus 26555, Eskiehir

z Vine ekirdeinden elde edilen aktif karbonun, sulu zeltiden bazik tekstil boyasnn
gideriminde etkinlii aratrlmtr. zelti scaklnn, aktif karbon deriiminin ve
boyarmadde deriiminin yzde giderim zerine olduka etkili olduu grlmtr. Langmuir
izoterm eitlii kullanlarak aktif karbonun adsorpsiyon kapasitesi belirlenmitir.
Anahtar Kelimeler vine ekirdei;aktif karbon;adsorpsiyon
1. Giri
1880li yllarda, gzenekli karbonlar genellikle odunun karbonlatrlmas ile elde edilmekte ve
daha ok tpta, koku giderici olarak ve silah sanayinde kulanlmaktayd. II. Dnya Savandan
sonra sanayilemenin ve benzinli aralarn kullanmnn artmas ile karbon kullanm pekok
alana yaylm ve retimi de artmtr (Marsh ve Rodriguez-Reinoso, 2006). Karbon ieren
pekok madde aktif karbon retimi iin kullanlmaktadr. Ancak retilen karbonun zellikleri,
retildii hammaddeye ve retili yntemine bal olarak deimektedir.
Aktif karbon sv ortamda pekok kullanm alanna sahiptir. Bunlardan bazlar, ime suyundan
tat, koku ve renk veren kirleticilerin giderimi, endstriyel ve evsel atksularn artm, ila
endstrisinde kullanlacak yksek saflkta suyun retilmesi, yiyecek, iecek ve ya
endstrisinde istenmeyen koku ve tat giderimidir.
retilen yaklak 450.000 ton boyann 40.000 tonunun kullanlmadan atksulara dearj edildii
tahmin edilmektedir. Boyar maddeler asidik, bazik, reaktif, direkt, dispers, sulfur ve metalik
boyalar gibi pek ok eite sahiptir. En dk kayp akrilik liflerin boyanmas srasnda (%5) ve
en byk kayp ise reaktif boyalarn kullanm srasnda (%50) olumaktadr (Cooney, 1999).
Aktif karbon adsorpsiyonu ile boyar maddelerin sulardan uzaklatrlmas son yllarda zellikle
zerinde younlalan bir konudur.
Bu almada vine ekirdeklerinden potasyum karbonat kullanlarak gerekletirilen kimyasal
aktivasyonu sonucu elde edilen aktif karbonun sulu zeltiden boyarmadde giderimindeki
etkinlii aratrlmtr. Bu amala bazik boya seilmi ve belirli deriimlerde sulu zeltileri
hazrlanmtr. Boyar madde giderimi zerine adsorban madde deriiminin, balang
boyarmadde deriiminin, scakln etkisi incelenmitir. Ayrca izoterm almas yaplmtr.
Elde edilen sonular, elde edilen karbonun sulu zeltiden bazik boyar madde gideriminde
baar ile kullanlabileceini gstermitir.
480 O.Gerel ve F.Gerel


2. Deneysel almalar
2.1. Aktif Karbonun Hazrlanmas
Aktif karbon hazrlanmasnda hammadde olarak kullanlan vine ekirdekleri Aroma Meyve
Sular ve Gda Sanayi A..den temin edilmitir. ekirdekler distile su ile ykanarak zerinde
bulunan toz ve dier kirlerden temizlendikten sonra etvde kurutulmutur. Kapsllere boaltlan
potasyum karbonatl vine ekirdekleri 850 C frnda karbonlatrlmtr. Aktif karbon
souduktan sonra frndan alnm ve distile su ile ykanarak zerindeki kimyasallar
uzaklatrlmtr. Etvde 24 saat bekletilen aktif karbon eleklerden geirilerek deneylerde
kullanlmak zere hazrlanmtr.
2.2. Kesikli Adsorpsiyon Deneyleri
Kesikli adsorpsiyon deneyleri oklu magnetik kartrclar kullanlarak gerekletirilmitir.
Scaklk, termostatl su banyolar kullanlarak sabit tutulmutur. almada 1000 mg/L
deriimde stok (Bazik Sar 1) boya zeltisi hazrlanm istenilen dier deriimler bu zeltiden
seyreltilerek elde edilmitir. Farkl deriimlerdeki boya zeltileri ve aktif karbon dengeye
ulalncaya kadar kartrlmtr. Santrifj ileminden sonra rnekler UV-
spektrofotometresinde okunarak daha nceden hazrlanm kalibrasyon erisine gre deriimleri
belirlenmitir.
3. Sonular ve Tartma
3.1. Aktif Karbon Deriiminin Bazik Sar 1 Yzde Giderimi zerine Etkisi
Bu almada, vine ekirdeinden kimyasal aktivasyon uygulanarak hazrlanan aktif karbonun
sulu zeltiden bazik boyar madde giderimindeki etkinlii aratrlmtr. Aktif karbon
deriiminin sulu zeltiden boyar madde giderimi zerine etkisinin incelendii bu grup
almalarda 200 mg/L balang Bazik Sar 1 deriimi seilmitir. Aktif karbon deriimi 0.2 ile
1.0 g/L arasnda deitirilerek deneyler yaplmtr. zeltideki son deriim belirlenerek yzde
giderim deerleri hesaplanmtr. Elde edilen veriler ekil 1de grlmektedir.

ekil 1. Aktif karbon deriimi ile Bazik Sar 1 giderim yzdesinin deiimi
3.2. Balang Bazik Sar 1 Deriiminin Yzde Giderim zerine Etkisi
almann bu blmnde Balang Bazik Sar 1 deriiminin giderim yzdesi zerine etkinlii
aratrlmtr. Bu amala balang boyarmadde deriimi 250, 300, 350 ve 400 mg/L olan
0
20
40
60
80
100
0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 1 1,1
G
i
d
e
r
i
m

(
%
)
Aktif Karbon Deriimi (g/L)
Vine ekirdeinden Elde Edilen Aktif Karbonun Sulu zeltiden Boyarmadde Gideriminde
Kullanlmas
481


zeltiler hazrlanm 0.8 g/L aktif karbon deriiminde adsorpsiyon deneyleri
gerekletirilmitir. Elde edilen sonular ekil 2de verilmitir.

ekil 2. Balang Bazik Sar 1 deriimi ile giderim yzdesinin deiimi
ekilden grld gibi Bazik Sar 1 deriiminin artmas, k deriiminin artmasna ve
giderim yzdesinin dmesine sebep olmaktadr. 250 mg/L balang deriminde giderim %80
iken, 400 mg/L deriiminde %52 olmaktadr.
3.3. Scakln Bazik Sar 1 Yzde Giderimi zerine Etkisi
Vine ekirdeinden potasyum karbonat kimyasal aktivasyonu ile elde edilen aktif karbonun
sulu zeltilerden bazik boyar madde giderimi zerindeki etkinliinin aratrld bu almada
scakln Bazik Sar 1 adsorpsiyonu zerine etkinlii de aratrlmtr. Bu amala 350 mg/L
balang Bazik Sar 1 deriimine sahip zelti ve 0.8 g/L karbon deriimi seilmitir. Scakln
etkisi zelti scaklklar 25, 35 ve 45C lerde sabit tutularak incelenmitr. zelti scakl ile
Bazik Sar 1 giderim yzdesinin deiim grafii ekil 3de verilmitir.
ekilden de grld gibi laboratuvar ortamnda elde edilen aktif karbon zerinde Basic
Yelow 1 adsorpsiyonu zelti scaklndaki deiimlerden etkilenmektedir. Scaklk 25Cde
35Cye ykseltildiinde giderim yzdesi %57 den %70e ykselmektedir. Scaklk 25Cde
45Cye ykseltildiinde Basic Yelow 1 k deriimi 148 mg/Lden 93mg/Lye dmektedir.
Giderim yzdesi ise %57 den %73 ykselmektedir. Basic Yelow 1 adsorpsiyonunda zelti
scaklnn 25Cde 35Cye ykseltilmesinin, scakln 35Cde 45Cye ykseltilmesinden
daha etkili olduu grlmektedir.

40
80
120
160
200
200 250 300 350 400 450
Balang Basic Yellow 1 deriimi (mg/L)
k deriimi (mg/L)
Giderim (%)
482 O.Gerel ve F.Gerel



ekil 3. zelti scakl ile Bazik Sar 1 giderim yzdesinin deiimi
3.4. Adsorpsiyon zotermleri
Adsorpsiyon izotermleri adsorpsiyon sisteminin anlalmasna yardmc olan en nemli
verilerdir. Bu almada denge verilerinin Langmuir ve Freundlich izoterm eitliklerine
uygunluklar aratrlmtr.
Langmuir adsorpsiyon izotermi adsorpsiyonun belirli homojen blgelerde gerekletiini
varsaymaktadr. Langmuir izoterm eitliinin lineer hali aadaki gibi verilebilir.
max max
1
e e
e L
C C
q q K q
= + (1)
Burada q
max
denge adsorpsiyon kapasitesi (mg/g), C
e
zeltideki denge boya deriimi (mg/L)ve
K
L
Langmuir adsorpsiyon sabiti (L/mg)dir.
C
e
/q
e
karlk C
e
deerlerinin grafie geirilmesi ile elde edilen dorunun eimi 1/q
max
ve kesim
noktas 1/q
max
K
L
dir. Vine ekirdeinden elde edilmi aktif karbon ile Bazik Sar 1 adsorp-
siyonunda elde edilen grafik ekil 4de verilmitir. Yaplan hesaplamalar sonucunda Langmuir
izoterm parametrelerinden q
max
deeri 263 mg/g ve K
L
deeri 3.1 L/mg olarak bulunmutur.


ekil 4. Langmuir izoterm grafii
40
60
80
100
120
140
160
20 25 30 35 40 45 50
Scaklk (
o
C)
k derimi (mg/L)
Giderim(%)
0
0,2
0,4
0,6
0,8
1
1,2
1,4
1,6
0 100 200 300 400
C
e
/
q
e
(
g
/
L
)
C
e
(mg/L)
Vine ekirdeinden Elde Edilen Aktif Karbonun Sulu zeltiden Boyarmadde Gideriminde
Kullanlmas
483


Freundlich izoterm eitlii ise aadaki ekilde lineer hale getirilebilmektedir.
1
ln ln ln
e F e
q K C
n
= + (2)
burada K
F
(L/g) ve n (boyutsuz) Freundlich adsorpsiyon izoterm sabitleridir. Vine
ekirdeinden elde edilmi aktif karbon ile Bazik Sar 1 adsorpsiyonunda lnq
e
karlk lnC
e

grafii izilerek adsorpsiyon izoterm sabitleri aratrlm ancak bu adsorpsiyon sisteminin
Freundlich izoterm eitliine uymad sonucuna varlmtr.
4. Sonu
Bu almada meyve suyu fabrikas atklarndan, vine ekirdeklerinin aktif karbon retiminde
kullanlabilirlii aratrlmtr. Bu amala potasyum karbonat kullanlarak kimyasal aktivasyon
uygulanan aktif karbon elde edilmitir. Elde edilen aktif karbonun sulu zeltilerdeki etkinlii
bazik boyarmadde kullanlarak aratrlmtr. eitli parametrelerin boya adsorpsiyonuna
etkinlii incelenmitir. Sonu olarak elde edilen karbonun sulu zeltilerden bazik boyar madde
gideriminde kullanlabilecei grlmtr.
Kaynaklar
Marsh, H., Rodriguez-Reinoso, F. (2006). Activated carbon, , Elsevier Science&Technology books.
Cooney, D. O., (1999). Adsorption design for wastewater treatment , Lewis Publishers





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Spesifik Metanojenik Aktivite Testinin Optimizasyonu
S. Semih Salam, S.Yasin zdemir, Mustafa Ik*
*Aksaray niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 68100 Aksaray
E-posta: misik@aksaray.edu.tr

z Son yllarda enerjinin maliyetinin artmas ile atksularn artlmasnda anaerobik artm bata
dk enerji maliyeti olmak zere bir ok avantaj nedeniyle yaygn olarak kullanlmaya
balamtr. Anaerobik reaktrlerin iletilmesinde pH, bikarbonat alkalinitesi, uucu ya asitleri,
metan miktar ve yzdesi gibi parametrelerin yannda spesifik metanojenik aktivite (SMA) testi
ska kullanlan bir testtir. Test iin standardize bir yntem olmamas deiik almalarda elde
edilen deerlerin birbirleri ile karlatrlmasn zorlatrmaktadr. Yukar akl amur yatak
reaktrnden alnan amurun SMA testi iin optimizasyon almas yaplarak elde edilen
sonulardan pratik kullanm olan bir test ilemi nerilmitir. Optimizasyon almasnda
optimum glikoz-KOsi ve NaHCO
3
deriimleri sras ile 15 g/l ve 7.5 g/l bulunmutur.
Anahtar Kelimeler aktivite; anaerobik; metanojenik; optimizasyon
1. Giri
Gnmzde anaerobik artm sistemlerine olan ilgi artmaktadr. Bunun en byk nedeni klasik
aerobik artma sistemlerinde etkin iletme iin gerekli olan oksijenin sisteme verilmesinin
maliyetidir. Anaerobik sistemlerde oksijen kullanlmad gibi, sistemden temiz ve yenilenebilir
enerji kayna olarak metan gaz elde edilerek byk avantaj salanr. Anaerobik artmn son
yllarda tercih edilmesi bu reaktrlerin iletilmesi esnasnda izlenmesi gereken parametrelerde
bir standardizasyonu ihtiya haline gelmitir. Anaerobik sistemlerin kararl bir ekilde
iletilmesi iin srekli ekilde izlenilmesi gerekli parametreler arasnda pH, scaklk, alkalinite,
gaz retimi ve gaz bileimi, organik madde giderimi ile oluan uucu ya asitleri miktar ve
bileimi gelmektedir. Anaerobik reaktrlerde istenen verimi elde etmek iin reaktr ierisindeki
aktif metanojenik bakteri poplasyonu ok byk nem gstermektedir. Anaerobik
mikroorganizmalarn spesifik byme hzlar aerobik mikroorganizmalara nazaran dk
olduundan reaktr ierisinde amur yann byk olmas istenir. Uzun amur alkonma
sreleri reaktr ierisindeki mikroorganizma deriiminin maksimum seviyede tutulmas ile
mmkndr. Mikroorganizma deriiminin fazla olmas reaktrn verimi asndan nemlidir.
amur yann byk olmas reaktr ierisindeki uucu askdaki kat maddenin (UAKM)
yksek olmas ile salanr. Ancak reaktr ierisindeki uucu kat madde her zaman aktif
mikroorganizmay temsil etmemektedir. Giri atksuyundaki organik maddelerde UAKM olarak
llr. Dolaysyla, reaktr ierisinde bulunan birim UAKMnin metanojenik aktivitesi byk
nem tamaktadr (nce ve di., 1995). Birim zamanda birim UAKMnin maksimum rettii
metan veya tkettii metan edeeri kimyasal oksijen ihtiyacna (KO) spesifik metanojenik
aktivite ismi verilmektedir. Burada amurun rettii maksimum metan miktar dikkate
alndndan test maksimum spesifik metanojenik aktivite olarak da isimlendirilmektedir.

486 S. S. Salam, S.Y. zdemir, M. Ik


Bu test gnmze kadar; anaerobik reaktrn Start-up periyodunu balatmak iin uygun a
seimi (James ve di., 1990) (i), potansiyel inhibitr maddelerin etkisini deerlendirilmesi
(Harada ve di., 1994; Perle ve di.,1995) (ii), deiik atksu ve maddelerin paralanabilirliinin
test edilmesi (Stewart et al., 1995) (iii), anaerobik ilem srasnda amur aktivitesindeki
deiimin gzlenmesi (Jawed ve Tare, 1999) (iv), belirli bir anaerobik amura uygulanabilecek
maksimum organik yklemenin tespit edilmesi (nce ve di., 1995) (v) ve kesikli kinetik
parametrelerin belirlenmesi (Jawed ve Tare, 1999) (vi) amalar ile gerekletirilmitir. Test iin
standardize bir yntem olmamas deiik almalarda elde edilen deerlerin birbirleri ile
karlatrlmasn zorlatrmaktadr. Bu almada anaerobik reaktrden alnan amurun SMA
deeri, uygun substrat ve alkalinite deriimini tespit etmek iin nerilen pratik bir test ilemi ile
gerekletirilmitir.
2. SMA Testinin Ak emas, Kullanlan A amuru, Mineral Ortam
Teste balamadan nce glikoz, NaHCO
3
, mineral ortam ve SMA denemesi yaplacak anaerobik
amur iin uygun stok zeltilerinden u bileim tavsiye edilmektedir. Glikoz-KO (20 g/l),
NaHCO
3
(7500 g/l), mineral bileim (mg/l) NH
4
Cl (400); MgSO
4
.7H
2
O (400); KCl (400);
(NH
4
)
2
HPO
4
(80); CaCl
2
.2H
2
O (50); FeCl
2
.4H
2
O (40);CoCl
2
.6H
2
O (10); KI (10); (NaPO
3
)
6
(10);
Cysteine-C
6
H
12
N
2
O
4
S
2
(10); AlCl
3.
6H
2
O (0.5); MnCl
2
.4H
2
O (0.5); CuCl
2
(0.5); ZnCl
2
(0.5);
KH
2
PO
4
(0.5); NH
4
VO
3
(0.5); Na
2
MoO
4
.2H
2
O (0.5); H
3
BO
3
(0.5); NiCl
2
.6H
2
O (0.5);
Na
2
WO
4
.2H
2
O (0.5); Na
2
SeO
3
.5H
2
O (0.5) (Speece, 1996) ve amur (~2 gAKM/l). Stok
zeltilerden istenilen deriimleri elde etmek iin 115 ml hacimli siyah renkli ieler ierisine
etkin sv hacmi 80 ml olacak ekilde gerekli ilaveler yaplmtr. Gaz lmnn salkl
yaplmas iin oluacak biyogazn toplanaca ve dolaysyla gaz lmnn doru bir ekilde
yaplmasna imkn salayacak bir boluk hacmi gerekmektedir. 80 ml etkin sv hacmi olarak
seilmi 35 ml boluk braklmtr. Az boluk brakldnda oluacak metan gaz kapal ie
ortamnda artan miktar nedeni ile fazla basn oluturaca iin sv ierisindeki znrl
artacak ve lmde hata oluacaktr. Eer boluk hacmi lm yaplacak gaza kyasla byk
hacimli ise metan lmnn doruluu ve hassasiyeti azalr (Owen ve di., 1979).Test
bileiminin iine koyulan ieler kauuk tpa ile kapatlr. Kauuk tpa ve kapak kapatldktan
sonra ie ierisindeki oksijen gazn almak iin biri atmasfore ak biri basnl N
2
gaz ya da
%30 CO
2
ve %70 N
2
karml gaz tpne bal rnga inesi yardmyla 3-5 dakika gazdan
geirilir. ieler 1 saat inkbasyon ortamnda (35C) tutulduktan sonra gaz basnc rnga
inesinin kauuk tpaya batrlmas ile atmosfer basncna eit hale getirilir. lm srasnda gaz
basnc yznden gaz szmasnn nne gemek iin gaz lm ie ile atmosfer basnc
arasnda 0.5 atm fark almadan yaplmaldr (Owen ve di., 1979). Gaz lm dzenei ekil
1de verilmektedir. almalarda kullanlan a amuru zmir ilinde bulunan PAKMAYA
fabrikasnn atksularn artan anaerobik reaktrlerden temin edilmitir. amur kullanma kadar
+4C de saklanmtr.
Spesifik Metanojenik Aktivite Tesitinin Optimizasyonu 487



1. inkubasyon iesi (115 ml)
2. amur (~2 g/L)
3. Karml sv (80 ml)
4. Kauuk tpa
5. Delikli kapak
6. rnga inesi
7. Hortum
8. lm zeltisi (Timol mavisi ieren % 10 luk KOH ya da
NaOH zeltisi)
9. lm zeltisi toplama kab
10. Sv yer deitirme sistemi
ekil 1. SMA testinde kullanlan sv yer deitirme dzenei
3. Sonular ve Tartma
3.1. SMA Testi in Uygun Substrat Deriimi
SMA testinin amalarndan biri amurun metan retme potansiyelinin tespit edilmesidir. Bu
nedenle metan retimi iin dier artlarn (scaklk, alkalinite, pH, mineral ortam vs.) optimum
olmas gerekmektedir. Anaerobik mikroorganizmalar iin uygun scaklk olan 35C de, substrat
dnda verilen bileim hazrlanarak test gerekletirilmitir. Optimum KO deriimini tespit
etmek iin Glikoz-KOsi deriimi 0 20 arasnda deien rnekler hazrlanp metan retimleri
izlenmitir. Elde edilen sonular zamana bal kmlatif metan (a) ve SMA sonular (b) olarak
ekil 2de verilmitir. Sonular ideal gaz denklemi kullanlarak 0C ve 1 atm standart koullar
iin dzeltilerek verilmitir.
SMA testlerinde teste kullanlan substrat deriimi iin literatrde genel kabul, substrat
snrlandrmas olmamas iin, spesifik substrat iin yar doygunluk sabiti olan Ks deerinin 10
kat deriimde substrat eklenmesidir. ekil 2de 15 g/l glikoz-KOsi deriiminde SMA deeri
0.446 g CH
4
-KO/ g AKM.gn olarak bulunmutur. 20 g/l deriiminde KO ieren rnekte
balangta dier rneklere kyasla daha fazla metan retimi olmusa da daha sonra metan
retimi azalmtr. Glikozdan oluan uucu ya asitleri ve CO
2
nedeni ile ortam pHnn metan
bakterileri iin ar dnden kaynaklanm olabilir. Bu rneklere sabir olarak verilen
NaHCO
3
, 15 g/L KO den oluan uucu ya asitleri (UYA) ve CO
2
nin neden olduu pH
dn tamponlayabilmitir.









ekil 2. SMA testine glikoz-KO etkisi

0
20
40
60
80
100
120
0 10 20 30 40 50 60 70
nkubasyon sresi, saat
K

l
a
t
i
f

m
e
t
a
n
,

m
l
20 15 10 7.5 5 0
(a)

0.0
0.1
0.2
0.3
0.4
0.5
7 17 22 33 44 56
nkubasyon sresi, s aat
S
M
A
,

g

C
H
4
-
K
O
I
/
g

A
K
M
.
g

n
20 15 10 7.5 5 0
(b)
488 S. S. Salam, S.Y. zdemir, M. Ik


3.2. SMA Testi in Uygun Alkalinite Deriimi
Metan retimi iin uygun pH aral anaerobik reaktrlerde ok nemlidir. Asit reten
asidojenik mikroorganizmalarn
mak
deerleri metan retenlere oranla daha byk olduundan
ortamda UYA ve CO
2
birikir. Ortam pHnn dmesine neden olan bu ara rnlerin kararl bir
ekilde metana dnmesi iin ortamda yeterli sayda metan reten bakterilerin olmas
gereklidir. Bu nedenle reaktrde her iki tr bakteri iin kararl bir denge oluuncaya kadar pHn
tamponlanmas gereklidir. Dolaysyla anaerobik sistemlere bikarbonat alkalinitesi ilavesi
yaplmaktadr. Uygun NaHCO
3
miktarn tespit iin yaplan testte glikoz KOsi 5000 mg/Lde
sabit tutularak farkl NaHCO
3
karlk elde edilen kmlatif metan deerleri ve deiik zaman
dilimlerinde elde edilen SMA deerleri verilmitir. 7500 mg/L NaHCO
3
deerinde (4464 mg
CaCO
3
/l) en byk SMA deeri 0.184 g CH
4
-KO/g AKM.gn bulunduundan bu deriim
en uygun NaHCO
3
deeri olarak kabul edilebilir. Alkalinitenin tamponlayaca CO
2
ve
UYAlerinin miktar da KO deriime bal olduundan uygun alkaliniteden ziyade uygun
B.Alk./KO deeri (0.90 mg CaCO
3
/mgKO) verilmektedir. Speece, (1996) tarafndan bu deer
1.2 mg CaCO
3
/mg KO verilmektedir. Alkalinite NaHCO
3
olarak verildii iin 7.5 g/l den
byk deerlerinde Na toksisitesi SMA deerini drm olabilir. Na iyonu iin orta derecede
inhibisyon deeri 3500-5500 mg/l (Malina ve Pohland, 1992) verilmektedir.










ekil 3. SMA testine NaHCO
3
etkisi
ekil 4te inkubasyon sonras rneklerdeki pH deerleri grlmektedir. Dk NaHCO
3
ve
yksek KO deerlerinde pH deerleri tamponlanamad iin dk elde edilmitir. Fazla H
+

iyonunun metan reten bakterilerin zerinde toksik etki yapt bilinmektedir. Dk KO
deerlerinde ise mikroorganizmalar Monod kinetiine gre dk substrat deerlerinden dolay

maks
deerlerinde almad iin maksimum metan retim hz elde edilememitir. Yksek
NaHCO
3
deerlerinde ise pHn uygun olmasna ramen (6.5<optimum pH<8.2)dk metan
retim hz Na toksisitesine balanabilir.

0
5
10
15
20
25
30
35
0 10 20 30 40 50 60
nkubasyon sresi, saat
K

l
a
t
i
f

m
e
t
a
n
,

m
l
20 15 10 7.5 5 0
(a)

0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
0.16
0.18
0.20
7 17 22 33 44 56
inkubasyon sresi, saat
S
M
A

g

C
H
4
-
K
O
I
/
g

A
K
M
.
g

n
20 15 10 7.5 5 0
(b)
Spesifik Metanojenik Aktivite Tesitinin Optimizasyonu 489



ekil 4. nkbasyon sonras pH deerleri
Teekkr
Bu alma TUBTAK-AYDAG 105Y262 ve DPT- 2006K120880-1 nolu projelerle
desteklenmitir.
Kaynaklar
Harada, H., Uemura S ve Momonoi, K. (1994). Interaction between sulfate-reducing bacteria and methane-producing
bacteria in uasb reactors fed with low strength wastes containing different levels of sulfate. Water Res. 28 (2),
355-367.
Ince, O., Anderson, G.K., Kasapgil B., (1995). Control of organic loading rate using the specific methanogenic
activity test during Start-Up of an anaerobic digestion system. Water Res, 29(1), 349-355.
James, A, Cherncharo C.A.L ve Campos, C.M.M., (1990). The development of a new methodology for the
assessment of specific methanogenic activity. Water Res. 24 (7) 813-825.
Jawed, M. ve Tare V. (1999). Microbial composition assessment of anaerobic biomass through methanogenic activity
tests, Water SA, 25(3), ????.
Malina ,J.F., Pohland, F.G., (1992). Design of anaerobic processes for the treatment of industrial and municipal
wastes., Water Quality Management Library, Volume 7, CRC press, USA.
Owen W.F., Stuckey, D.C, Healy, J.B, Young L.Y., ve McCarty P.L. (1979). Bioassay for monitoring biochemical
methane potential and anaerobic toxicity. Water Res. 13, 485-492
Perle, M., Kimchie, S. ve Shelef, G. (1995). Some biochemical aspects of the anaerobic degradation of dairy
wastewater. Water Res. 29 (6), 1549-1554.
Seghezzo, L., Zeeman, G., van Liel J.B., Hamelers, H.V.M. ve Lettinga G. (1998). A Review: The anaerobc
treatment of sewage in UASB and EGSB reactors, Bioresource Technology, 65, 175-190.
Speece, R.E. (1996). Anaerobic Biotechnology for industrial wastewaters, Nasville, Tennesse, USA.
Stewart, J.M., Bhattacharya S.K., Madura R.L., Mason, S.H. ve Schonberg, J.C. (1995). Anaerobic treatability of
selected organic toxicants in petrochemical wastes. Water Res. 29 (12), 2730-2738.

5
5.5
6
6.5
7
7.5
8
8.5
0 5 10 15 20 25
Glikoz-KOI ve NaHCO
3
deriimi, mg/l
p
H
Glikoz-KOI
NaHCO3
.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Atksularn Artlmasnda Jet Loop Biyoreaktrler
Handan Ucun, Ergn Yldz ve Alper Nuholu
Atatrk niversitesi, evre Mhendislii Blm, 25240, Erzurum
E-posta: hanucun@atauni.edu.tr

z Evsel ve endstriyel atksu artmnda uzun yllardan beri kullanlmakta olan klasik artma
sistemleri, artk istenilen miktarda ve verimde ktle transferine olanak salayamamaktadr. Son
yllarda zellikle biyoreaksiyon mhendisliinde gelitirilen yeni ve modern reaktrler daha
etkin ve dk maliyette atksu artm salamaktadr. Yeni gelitirilen biyoreaktrler ve giderek
ok daha yaygn olarak kullanlmaya balanan membran teknolojisi sayesinde, birok temel
ilem ve prosesi gerektiren klasik artma sistemleri yerine, ok daha az yer kaplayan, daha az
enerji tketen, otomasyonu basit ve kolaylkla genileyebilir sistemler yaplmaktadr. Kimya ve
biyoteknoloji endstrisinde pek ok proseste katlarn ve gazlarn srekli sirklasyonu ve
homojen dalm gereklidir (rnein heterojen kataliz, mikroorganizmalarn immobilizasyonu).
Loop (evrim) reaktrler zerindeki ilgi zellikle fermantasyon, biyoteknoloji ve atksu artm
sistemleri alanlarnda olduka artmtr. Loop reaktrlerin farkl bir tipi olan jet loop reaktrler
performanslar artrlm loop reaktrlerdir. Jet loop reaktrler yksek ktle transfer
performans, iyi dispersiyon etkisi ve nispeten dk enerji gereksinimiyle kimya ve
biyokimyasal proseslerde yaygn ekilde kullanlmaktadr.
Anahtar Kelimeler atksu; artm; biyoreaktr; jet loop biyoreaktr
1. Giri
Biyoreaktrler; mikroorganizmalarn veya enzimlerin rol ald biyolojik reaksiyonlarla
hammaddelerin, son rnlere dntrld sistemler olarak tanmlanabilir. Biyolojik artmda
kullanlan biyoreaktr tipleri, mekanik olarak kartrlan, hava ile kartrlan (kabarck
kolonlar, hava kaldrmal reaktrler, jet loop reaktrler) ve kartrlmayan (paket yatak, akkan
yatak, membran reaktrler) biyoreaktrlerdir (Sajc et al. 2000). Biyolojik dnmn srekli
olmas iin mikroorganizmalarn ihtiya duyduu besin maddelerinin, scaklk, pH gibi evre
artlarnn iyi ayarlanmas gerekmektedir. Ayrca biyoreaktrde oluturulan biyoktlenin
ortamda kal sresi de kontrol altna alnmas gereken nemli bir parametredir. Biyoreaktrler
arasnda mukayese yaplmak istendiinde; sistemlerin ktle transfer katsaylarna baklmas
gerekir. Bunun yannda gelien modellerin daha avantajl olmalar sadece ktle transfer
katsaylar ile deil, daha az alan kaplamalar, modler olmalar ve dk enerji tketmeleri ile
de salanmaktadr (Schgerl 1991).
2. Biyoreaktr Tipleri
Askda sistemler iin modern biyoreaktrlerin gze arpanlar hava kaldrmal (airlift) ve
kompakt reaktrler olarak bilinen jet loop reaktrlerdir. Bu reaktrlerin kabarck (bubble)
kolonlar ile balayan geliimleri; gaz sirklasyon reaktrleri, hava kaldrmal ve aa veya
yukar akl jet loop reaktrler ile devam etmektedir. Kabarck kolonlar, gnmzde hali
hazrda kullanlan ince kabarckl havalandrma sistemleri gibi, reaktrn altndan hava
492 H. Ucun, E. Yldz, A. Nuholu


verilmek suretiyle, hem oksijen transferinin hem de karmn saland reaktrlerdir (Sajc et
al. 2000; Dhotre et al. 2004). Hava kaldrmal reaktrler, kabarck kolonlarn bir sonraki
admdr. Hava kaldrmal reaktrler yksek kirlilik ieren kentsel ve endstriyel atksu
artmnda ve biyoteknoloji endstrisinde olduka fazla dizayn avantajlarna sahiptirler (Quan et
al. 2004; Kermanshahi pour et al. 2005). Yeni tip reaktrlerin nc versiyonunu jet loop
reaktrler oluturmaktadr. Bu reaktrlerin hava kaldrmal reaktrlerden en nemli fark,
sisteme verilen enerjinin svnn kinetik enerjisinden salanmasdr.
2.1. Jet Loop Reaktrler
Jet loop reaktrlerin kare veya dairesel yaplar yannda su knn alttan veya stten olduu
farkl modifikasyonlar mevcuttur. Ancak en yaygn olan dairesel kesitli, emme tpl,
pskrtme balnn reaktrn stne yerletirildii ve kn yine stten yapld tipleridir
(Fakeeha et al. 1999; Farizoglu et al. 2004; Fadavi and Chisti 2005; Flores-Cotera and Garcia-
Salas 2005; Yildiz et al. 2005).
Kimya sanayinde zellikle ktle transferini artrmak ve kimyasal dnmleri verimli ekilde
gerekletirebilmek iin jet loop reaktrler kullanlmtr.
Mller et al. (1999), metanoln olefine dnm iin jet loop reaktr kullanmlar (sv jeti) ve
bu ilem iin kullanlan dier reaktrlerle sonular karlatrmlardr. Jet loop reaktrlerin,
sabit yatak reaktrlerin aksine kinetik deneylere olduka uygun ortam saladn
gstermilerdir.
Meier et al. (1997), polimer dispersiyonunda uucu organik maddelerin ktle transferini
modelledikleri almalarnda jet loop reaktr kullanmlardr. Bu reaktr, iyi bir karmn
saland kararl bir reaktr olmas sebebiyle kullanmlardr. Elde ettikleri sonulara gre
yeterli bir syrma prosesinin zellikle hidrodinamik zeliklere ve operasyon artlarna bal
olduunu ortaya koymulardr.
Kimya sanayi gibi biyoteknoloji endstrisinde de pek ok proseste katlarn ve gazlarn srekli
sirklasyonu ve homojen dalmn salama yeteneine sahip jet loop reaktrler kullanlmtr.
Salehi et al. (2005) kat-sv enzim reaksiyonuna bir rnek olarak immobilize glukoz izomeraz
ile glukozun fruktoza izomerizasyonunu aa akl jet loop reaktrde almlar ve kesikli bir
reaktrde elde edilen sonularla karlatrmlardr. Jet loop reaktrn performansnn
geleneksel reaktrlerden olduka yksek olduunu gstermilerdir.
Kimya ve biyoteknoloji sanayisinde son yllarda kullanlan jet loop reaktrler (JLR), klasik
kartrmal reaktrlerle karlatrldnda byk avantajlar salamaktadr. Bu avantajlar, basit
inaat, dk yatrm ve iletme maliyetleri, ayn enerji girdisiyle klasik reaktrlere gre daha
fazla sirklasyon, ok iyi seviyede gaz dispersiyonu,mekanik kartrc kullanlmadan, byk
spesifik ara yzey alanlar ve yksek ktle ve s transferi salanabilmesi reaktr ierisinde
hareketli hibir parann bulunmamas ve pilot tesis lekten endstriyel lee rahat gei
olarak sralanabilmektedir (Schgerl 1991; Prasad and Ramanujam 1995; Yldz 1999; Fadavi
and Chisti 2005). Bu avantajlar salamalar nedeniyle atksu artmnda kullanlmaya balanm
ve gelitirilmilerdir.
JLBler membran prosesleri yardmyla elde edilen biyoktlenin, kartrma ve oksijen ihtiyacn
fazlasyla karlayabilecek konumdadr. JLBlerde, reaktre aktarlan gce bal olarak rnein
5 kw/m
3
g tketimi ile 500 saat
-1
gibi yksek K
L
a deerleri elde edilebilmektedir (Yldz
1999). Bu deer klasik havalandrma sistemlerinde 12 saat
-1
civarndadr. Endstriyel atksu
Atksularn Artlmasnda Jet Loop Biyoreaktrler 493


artmnda halihazrda kullanlan yksek performansl reaktrlerin ve kullanldklar lkelerin
listesi Tablo 1de verilmektedir (Vogelpohl 2000).
Tablo 1. Endstriyel atksu artmnda kullanlan yksek performansl reaktrler
Endstri Atksu
Konsantrasyon
(mg/L)
Yk
(kg/gn)
Reaktr
Hacmi
lke
KO BO
5
KO BO
5
(m
3
)
Gda St 1200 1100 33,0 - 1 Almanya
Gda St 3700 2000 55,0 30 0,5 Almanya
Gda Maya 11 000 8000 1,80 1,5 25+10 Almanya
Cam Proses 11 000 2,65 25 Almanya
Evsel Evsel 600 300 720 360 25 Almanya
Bask Tesisleri Boya 30 000 12 000 450 12 Almanya
Et Proses 2250 1500 15 000 5x40 Almanya
Kat Proses 2500 8,8 5x30 Almanya
Kimyasal Proses 4200 600 33 12 1 Norve
Gda Ya 4000 2000 550 270 5x3 talya
Gda Ya 4000 2000 550 270 3x3 talya
p alan Sznt Sular 3500 1720 970 480 3x10 Almanya
Kat Proses 14 000 35 2x250 Norve
Kat Proses 1900 850 12 5,3 300 Kanada
Kat Proses 3600 11,5 2x150 Fransa
Evsel Kark 450 220 4x1000 in
iftlik Hayvan Gbresi 5000 2750 200 40 Gney Kore
Tablo 1den yeni nesil reaktrlerin zellikle yksek miktarda KO yk ieren atksulara
uygulandklar grlmektedir. Biyolojik atksu artmnda organik yklerin karlanabilmesi iin
oksijen transfer kapasiteleri yksek reaktrlerin kullanlmas zorunludur. Dolaysyla JLBler
yksek ktle transfer zelliklerinden dolay endstriyel atksularn artlmasnda rahatlkla
kullanlabilmektedir (Yenkie et al. 1992; Bloor et al. 1995; Lbbecke et al. 1995).
3. Sonular
Jet loop membran biyoreaktrlerde klasik sistemlere gre ok yksek mikroorganizma deriimi
ve K
L
a deerlerine ulamak mmkndr. Jet loop reaktrler yksek ktle transfer yetenekleri ile
gnmzde iddetli kirli atksularn artlmasnda kullanm potansiyeli giderek artan bir
konumdadr. zellikle membran ayrma prosesleri ile birlikte kullanldklarnda reaktr
ierisinde 40 g/Lye kadar mikroorganizma konsantrasyonu salanabilmekte ve bu durum
yksek oranda organik yklere ramen baarl bir ekilde biyolojik artm gerekletirmeye
olanak tanmaktadr (Yenkie et al. 1992; Bloor et al. 1995; Lbbecke et al. 1995; Yldz 1999;
Petruccioli et al. 2002).
494 H. Ucun, E. Yldz, A. Nuholu


Kaynaklar
Bakopoulos, A. (2006). Multiphase fluidization in large-scale slurry jet loop bubble columns for methanol and or
dimethyl ether production. Chemical Engineering Science 61, 538 557.
Bloor, C.J., Anderson, G. and Willey, A.R. (1995). High rate aerobic treatment of brewery wastewater using the jet
loop reactor. Wat. Res., 29 (5), 1217-1223.
Dhotre, M.T., Ekambara, K. and Joshi, J.B. (2004). CFD simulation of sparger design and height to diameter ratio on
gas hold-up profiles in bubble column reactors. Experimental Thermal and Fluid Science 28, 407-421.
Fadavi, A. and Chisti, Y. (2005). Gasliquid mass transfer in a novel forced circulation loop reactor. Chemical
Engineering Journal 112, 7380.
Fakeeha, A.h., Jibril, B.Y., Ibrahim, G. and Abasaeed, A.E. (1999). Medium effects on oxygen mass transfer in a
plunging jet loop reactor with a downcomer. Chemical Engineering and Processing, 38, 259-265.
Farizoglu, B., Keskinler B., Yildiz E. and Nuhoglu A. (2004). Cheese whey treatment performance of an aerobic jet
loop membrane bioreactor. Process Biochemistry 39, 22832291.
Flores-Cotera, L.B. and Garcia-Salas, S. (2005). Gas holdup, foaming and oxygen transfer in a jet loop bioreactor
with artificial foaming media and yeast culture. Journal of Biotechnology 116, 387396.
Kermanshahi pour, A., Karamanev, D. and Margaritis, A. (2005). Biodegradation of petroleum hydrocarbons in an
immobilized cell airlift bioreactor. Water Research 39, 37043714.
Lbbecke, S., Vogelpohl, A. and Dewjanin, W. (1995). Wastewater treatment in a biological high performance
system with high biomass concentration. Wat. Res., 29 (3), 793-802.
Meier, D., Warnecke and H.J., Prss, J. (1997). Modelling of mass transfer of volatile organic compounds in polymer
dispersions. Chemical Engineering Journal 67, 4553.
Mller, K.P., Bhringer, W., Schnitzler, A.E. and Van Steen, E., OConnor, C.T. (1999). The use of a jet loop reactor
to study the eVect of crystal size and the co-feeding of olefins and water on the conversion of methanol over
HZSM-5. Microporous and Mesoporous Materials 29, 127144.
Petruccioli, M., Duarte J.C., Eusebio, A. and Federici, F. (2002). Aerobic treatment of winery wastewater using a jet
loop activated sludge reactor. Process Biochemistry, 37 (8), 821-829
Prasad, K.Y. and Ramanujam, T.K. (1995). Gas holdup overall volumetric mass transfer coefficient in a modified
reversed flow jet loop reactor. J. Canadian Chem. Eng., 73, 190-195.
Sajc, L., Grubisic, D. and Vunjak-Novakovic, G. (2000). Bioreactors for plant engineering: an outlook for further
research. Biochem. Eng. Journal 4, 8999.
Salehi, Z., Sohrabi, M., Kaghazchi, T. and Bonakdarpour, B. (2005). Application of down flow jet loop bioreactors in
implementation and kinetic determination of solidliquid enzyme reactions. Process Biochem. 40, 24552460.
Schgerl, C. (1991). Bioreaction Engineering: Charecteristics Features of Bioreactor, 2. John Wiley Sons, 393 p. UK.
Vogelpohl, A. (2000). Wastewater treatment by the HCR-Process. Acta Biotechnol. 20 (2), 119-128.
Yenkie, M.K.N., Geissen, S.U. and Vogelpohl, A. (1992). Biokinetics of wastewater treatment in the high
performance compact reactor (HCR). J. Chem. Eng., 49, B1-B12.
Yldz, E. (1999). apraz Ak Mikrofiltrasyon Sistemli Jet loop Reaktrlerde Biyolojik Artm. Doktora tezi, Atatrk
niversitesi Fen Bilimleri Enstits, Erzurum.
Yildiz, E., Keskinler, B., Pekdemir, T., Akay, G. and Nuhoglu, A. (2005). High strengthwastewater treatment in a jet
loop membrane bioreactor: kinetics and performance evaluation. Chemical Engineering Science 60, 1103 1116.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Biyofilm Sistemleri, zellikleri ve evre Mhendisliindeki
nemi
Nurgl Bac ve Erdem Kocadastan
Atatrk niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 25090, Erzurum
E- Posta: nbasci@atauni.edu.tr

z Bu almada son yllarda evre Mhendislii alannda, sunduu eitli avantajlardan dolay
tercih edilen biyofilm sistemler ele alnm, avantajlar, dezavantajlar ve zelliklerinden
bahsedilmitir. almann oluturulmasnda eitli literatrler ve tezler deerlendirilmitir.
Biyolojik artm, evre Mhendisliinde olduka nemli ve temel konulardan birisidir. Bu
artm ynteminde atk sular, balca bakterilerden oluan birtakm mikroorganizmalar
tarafndan zararsz bileiklere dntrlmektedir. Atk su artm iin kullanlan temel biyolojik
prosesler 2 ana kategoriye ayrlmaktadr: (i) Sspanse Bymeli Prosesler: Mikroorganizmalar
ve ham maddelerin birbiri ile sv ortam ierisinde kark halde bulunduu proseslerdir; (ii)
Bal Bymeli Prosesler (Biyofilm Sistemler): Biyodnm gerekletiren
mikroorganizmalarn bir ortama bal olarak ve sadece tek bir ynden hammaddeler ile temasta
bulunduklar proseslerdir. Biyofilm sistemleri dier biyolojik artm sistemlerine gre daha
basit, kullanl ve birim hacim bana den ok byk yzey alanna sahip, ucuz elde
edilebilen yeni tip ortamlar ihtiva etmeleri gibi eitli avantajlar sunmaktadrlar. Bu sistemlere
olan ilgi son yllarda artm ve zellikle evre biyoteknolojisinde, damlatmal filtreler, dner
biyolojik kontaktrler, havalandrmal filtreler, akkan yatak teknolojiler ve hareketli yatak
biyofilm reaktrleri gibi yeni biyofilm sistemlerin gelimesine katkda bulunmutur (Rodgers ve
di., 1999). Biyofilm sistemler, evre biyoteknolojisinde balca 3 sebepten dolay yaygn bir
ekilde kullanlmaktadr. 1. Byk hacimli, seyreltik sulu zeltilerin artlmasnda, 2. Doal ve
kark mikroorganizma topluluklarnn biyofilmi kolayca oluturduundan, 3. Proses, biyoktle
alkoyma ve geri devir iin kelticiye ihtiya duyulmakszn, reaktr ierisinde yksek
biyoktle konsantrasyonunda iletilebildiinden (Nicolella ve di., 2000). eitli
konfigrasyonlarda dizayn edilen biyofilm sistemler, zellikle mevsimsel olarak deien debi ve
KO konsantrasyonlarna kar daha direnli olabilmekte, ok eitli endstri tesislerinin
atksularnn artlmasnda daha elverili olarak kullanlmaktadrlar. Anaerobik
konfigrasyonlar aerobiklere kyasla, yksek derecede kirli sularn artlmasnda daha
baarldr. Ayrca faydal enerji retimi anaerobik sistemlerin bir dier avantajdr. Sonuta
yukarda pek ok avantajlarndan bahsedilen biyofilm sistemleri, gelecekte, zellikle evre
biyoteknolojisi alannda daha ok uygulama alan bulacaktr.
Anahtar Kelimeler biyofilm; biyoktle; biyolojik artm; destek materyal
1. Giri
Genel olarak biyolojik artmda birok mikroorganizma rol oynayan mikroorganizmalar;
bakteriler, protozoalar, virsler, mayalar, mantarlar ve rotiferlerdir. Bunlarn ierisinde
bakteriler, biyolojik artmda ok nemli bir paya sahiptirler. Biyofilm sistemler, evre
biyoteknolojisinde balca 3 sebepten dolay yaygn bir ekilde kullanlmaktadr.

496 N. Bac, E. Kocadastan


Byk hacimli, seyreltik sulu zeltilerin artlmasnda,
- Doal ve kark mikroorganizma topluluklarnn biyofilmi kolayca oluturduundan,
- Proses, biyoktle alkoyma ve geri devir iin kelticiye ihtiya duyulmakszn, reaktr
ierisinde yksek biyoktle konsantrasyonunda iletilebildiinden (Nicolella ve di., 2000).
2. Genel Bilgiler
2.1. Atksu Artm Proseslerinde Biyofilm Trleri
Atk su artm prosesleri, mikrobiyal oluum bakmndan 3 tre ayrlmaktadr.
- Statik Biyofilmler (rnein damlatmal filtreler): Sabit bir kat yzey zerine balanarak
byyen hcreler yaps ve hcreler rnleri.
- Partikl Biyofilmler (rnein akkan yatakl biyofilm, st akl anaerobik amur yatakl,
havalandrmal sspanse biyofilm reaktrler): Sspanse tayclar zerinde byyen ok hcreli
polimerler gibi kompleks yapk hcreler yaps ve hcreler rnleri.
- Floklar (rnein aktif amur prosesleri): Ortama farkl vastalarn ilavesinden sonra yada
spesifik reaktr artlar altnda meydana gelen mikrokolonilerin ve bireysel hcrelerin bir araya
geldii topluluklar (Nicolella ve di., 2000).
2.2. Biyofilmi Oluturan Mikrobiyal Topluluklar ve zellikleri
- Organik maddelerin son rnlere dnmnde, reaktrn hacimsel dnm kapasitesini
gelitirmek iin biyoktle alkonmas gerekli olacaktr.
- Substratlar maddelerin mikrobiyal topluluk-sv ara yzeyini gemesi, biyofilmin
porozitesine, sv fazdaki substrat konsantrasyonuna, biyofilm-sv ara yzeyindeki ktle
transferine ve biyofilm ierisindeki reaksiyon hzna bal olarak difzyon mekanizmasyla
gerekleir.
- Substrat konsantrasyon farkndan dolay, d tarafta en yksek byme hzna sahip, i
tarafta ise daha dk hzla byyen mikroorganizmalarn bulunaca, tabakal yapya sahip bir
biyofilm oluacaktr. Bylece daha dk hzla byyen mikroorganizmalar d kesme
kuvvetlerden korunmu olacaklar ve daha az kayp olacaktr (Nicolella ve di., 2000).
2.3. Biyofilm Sistemlerde Kullanlan Destek Materyalleri ve zellikleri
Biyofilm sistemlerde bu gne kadar, frnlanm kil, plastik tpler, PVC raing halkalar, seramik
raing halkalar, bilyeler, borular (Kocadastan ve di., 2005), plastik halkalar, polypropilen
halkalar, midye ve mercan kabuklar (Gourari ve di., 1997), (Saravanan ve di., 2006),
polyretan kpk (Mechichi ve di., 2005), ponza (en ve di., 2003), (Kocadastan ve di.,
2005), lifli tayclar (Li ve di., 2003), polietilen, poliester (Osorio ve di., 2002), quartz, kil,
istiridye kabuklar, ta, polimer kpk, aktif karbon ve kum (Annachhatre, 1996 ) gibi pek ok
farkl destek materyaller kullanlmtr.
2.4. Biyofilm Sistemlerinin Avantajlar
Dardan bir ayrma safhasn ortadan kaldran yksek kat son kelme hz, yksek biyoktle
konsantrasyonu, yksek biyofilm yzey alan, yksek biyoktle konsantrasyonu ve ktle
transfer alan sonucunda yksek dnm oran, kk alan ihtiyalarna sahip reaktr, yksek
Biyofilm Sistemleri, zellikleri ve evre Mhendisliindeki nemi 497


amur ya; fazla amur retimini en aza indirme biyofilm sistemlerinin avantajlardr (Nicolella
ve di., 2000).
2.5. Biyofilm Sistemlerinin Dezavantajlar
Uzun balang zamanlarnda tayclar zerindeki biyofilm oluum problemleri, biyofilm
kalnl kontrolnn gl, biyofilm ar bymesi sonucu partikllerin ykanmas, akkan
sistemlerde, sv datmlarnn byk lekli reaktrler iin maliyet fazlal, niform
akkanlk ve tkanmayla ilgili problemler biyofilm sistemlerinin dezavantajlardr (Nicolella ve
di., 2000).
3. Materyal ve Metod
Bu almann oluturulmasnda, biyofilm sistemlerle ilgili eitli literatrlerden
faydalanlmtr.
4. Sonular ve Deerlendirme
Aratrmaclar biyofilmin balca 2 ana bileenden olutuunu bildirmilerdir. Bunlar;
mikrobiyal hcreler ve bu mikrobiyal hcrelerin tayc yzeylere balanmasna yardmc
metabolizma rnleri (zellikle d polimerler). Yaplan almalar, d polimerlerin mikrobiyal
balanma olayn kolaylatrdn ve bu olayda anahtar bir neme sahip olduunu aka
gstermektedir (Ye ve di., 2005).
Btn biyofilm almalarnda, znm substratlarn biyofilm ierisine geii ve reaksiyon
rnleri Fickian difzyonuna atfedilmektedir (Gnen ve di., 1990 ). Substrat
uzaklatrlmasndaki nemli olaylar;
- Bakterilerin biyofilm oluumu ierisine yerlemesi
- Reaksiyon rnlerini indirgemek iin biyofilm oluumu ierisine substratlarn geii
(Gnen ve di., 1990).
Biyofilm kinetik almalar, dk COD konsantrasyonlarnda sistemin 1. derece
reaksiyonlarla, yksek COD konsantrasyonlarnda ise sfrnc derece reaksiyonlarla kontrol
edildiini gstermektedir (Gnen ve di., 1990 ). Biyofilm yap modelleri substrat indirgeme
ve difzyon kinetiklerine dayanarak formlize edilmektedir (Saravanan ve di., 2006 ).
Kullanlacak destek materyalleri, ucuz olmal (Gourari ve di., 1997), (Kocadastan ve di.,
2005), iyi bir mekanik dirence sahip olmal (Gourari ve di., 1997), kimyasal olarak inert,
korozif znm maddelere ve rnlere direnli olmal (Gourari ve di., 1997), daha iyi
bakteri biyofilm geliimi iin yksek bir yzey przllne sahip olmaldr (Gourari ve di.,
1997), (Kocadastan ve di., 2005).
almalar, filtre yatak materyalinin yzey durumu, por hacmi ve ortam geometrisinin, artm
verimi zerine spesifik yzey alanna gre daha nemli parametreler olduklarn gstermitir
(Gourari ve di., 1997), (Kocadastan ve di., 2005).
5. Sonu
Biyofilm sistemler, yukarda bahsedilen eitli avantajlarndan dolay, gelecekte evre
biyoteknolojisinde daha byk bir yere sahip olacaktr.

498 N. Bac, E. Kocadastan


Kaynaklar
Annachhatre A.P., (1996). Anaerobic Treatment Of Industrial Wastewater, Resources, Conservation and Recycling,
16, 161-166.
Gourari S., Begdouri A.A., (1997). Use Of Baked Clay Media As Biomass Support For Anaerobic Filters, Applied
Clay Science, 12, 365-375.
Gnen .E., Orhon D., Baykal B.B. (1991). Application of Biofilm Kinetics To Anaerobic Fixed Bed Reactors,
Water Science Technology, 23, 1319-1326.
Kocadastan B., Kocadastan E., et. al., (2005). Wastewater treatment with combined upflow anaerobic fixed-bed
and suspended aerobic reactor equipped with a membrane unit, Process Biochemistry, 40, 177-182.
Li J., Xing X.H., Wang B.Z., (2003), Characteristics Of Phosphorus Removal From Watewater By Biofilm
Sequencing Bath Reactor (SBR), Biochemical Engineering Journal, 16, 279-285.
Mechichi T., Sayadi S. (2005). Evaluating process imbalance of Anaerobic Digestion Of Olive Mill Wastewaters,
Process Biochemistry, 40, 139-145.
Nicolella C., Van Loosdrecht M.C.M., Heijnen J.J. (2000). Wastewater treatment with particulate biofilm reactors,
Journal of Biotechnology, 80, 1-33.
Osorio F., Hontoria E., (2002). Wastewater Treatment With A Double-Layer Submerged Biological Aerated Filter,
Using Waste Materials As Biofilm Support, Journal of Environmental Management, 65, 79-84.
Rodgers M. (1999). Organic Carbon Removal Using A New Biofilm Reactor, Water Research, 33, 1495-1499.
Saravanan V., Sreekrishnan T.R. (2006). Modelling anaerobic biofilm reactors-A review, Journal of Environmental
Management, 81, 1-18.
en S., Demirer G.N. (2003). Anaerobic Treatment Of Real Textile Wastewater With A Fluidized Bed Reactor,
Water Research, 37, 1868-1878.
Ye F., Chen Y., Feng X., (2005). Advanced Start-Up Of Anaerobic Attached Film Expanded Bed Reactor By Pre-
Aerotion Of Biofilm Carrier, 96, 115-119.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



KOSB Atksu Artma Tesisi Tasarm in Atksu
Karekterizasyonunun Belirlenmesi
Oktay zkan
1
, zgr zdemir
2
, Yakup Gltekin
3
, Ltfi Aka
4

1
Erciyes niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 38039 Kayseri
E-posta: ozkan@erciyes.edu.tr,
2
Kayseri Su ve Kanalizasyon daresi (KASK) Genel Mdrl, Kayseri
3
Kayseri Organize Sanayi Blgesi Mdrl, 38070 Kayseri
4
evre ve Orman Bakanl, evre Ynetimi Genel Mdrl, Ankara

z Bu almada, Kayseri Organize Sanayi Blgesinde (KOSB) yer alan Sanayilerin atksu
karakterizasyonunu belirlemek zere, toplam alan drt ana blgeye ayrlarak almalar
yrtlmtr. alma kapsamnda Ana kanaldaki atksu karekterizsayonunu belirlemek iin
numune alma program yaplarak, kanaldan 2 saatlik ve 24 saatlik kompozit numuneler
alnmtr. Ayrca Kayseri Organize Sanayi Blgesinde yer alan tesisleri atksu miktarlar ve
kirlilik ykleri asndan deerlendirebilmek amac ile bir anket almas yrtlerek yaplacak
olan artma tesisinin nasl bir proses ve nitelerden olumas gerektiine daha kolay karar
verilmesi amalanmtr.
Anahtar Kelimeler Kayseri organize sanayi blgesi; endstriyel atksu
1. Giri
Kayseri Organize Sanayi Blgesi (KOSB) Kayseri merkezine ortalama 14 km uzaklkta zirai
verimi dk, yaklak 11 milyon m
2
lik bir alanda gelimesine devam etmektedir. Kayseri
Organize sanayi Blgesinde Sanayiden kaynakl ortalama atksu debisi 2004 ylnda 15.000
m
3
/gn civarlarnda iken uan iin 30.000 m
3
/gne ulamtr. Kurulmas planlanan tesisin
tasarma esas atksu karekterizsayonunu belirlemek amac ile bu alma gerekletirilmitir.
Bylece artma tesisinin nasl bir proses ve nitelerden olumas gerektiine daha kolay karar
verilebilecektir.
2. Materyal ve Metot
KOSBden oluan atksularn karekterizsayonunu belirlemek iin toplam alan 4 ayr blgeye
ayrlarak alma yrtlmtr. Bu blgelerden Ana Blge + II Nolu Blgede doluluk oran
%100 ulamtr. Doluluk oran, Haclar blgesinde %45, I + III Nolu Blgede %94 ve IV Nolu
Blgede ise %45 civarndadr.
Ana kanaldaki atksu karekterizsayonunu belirlemek iin numune alma program yaplarak,
kanalda 2 saatlik ve 24 saatlik kompozit numuneler alnmtr. Atksu analizlerinin
deerlendirilmesi yaplrken, daha nce yaplm olan 1998, 2002 ve 2005 yllarndaki
almalarda elde edilen deerlerle karlatrld zaman atksu profilinde ok byk bir
deiikliin olmad grlmtr. Tablo 2.de KOSB atksu karekterizasyonunun yllara gre
deiimi verilmitir.
500 O zkan, zdemir, Y. Gltekin ve di.


Tablo 1. Kayseri OSBde yer alan tesislerin ana sektrlere gre dalm
Sra No Sektr Toplam
1 Mobilya 241
2 Metal Sanayi 169
3 Tekstil 87
4 Cam 16
5 Makine (tarm ve sanayi makineleri) 25
6 naat (seramik, karo, vitrifiye, yap malzemeleri) 25
7 Gda 24
8 Kt 41
9 Otomotiv 12
10 Reklmclk ve Matbaa Sanayi 16
11 Elektrik ve Elektronik 17
12 thalat ve hracat 11
13 Tamaclk 7
14 Kimya Sanayi 15
15 Dier 5
Toplam 711
Atksu artma tesisine gelecek kirlilik ykleri, 20052006 ylnda yaplan ana kanal atksu
analizlerinin %90 deerleri baz alnarak yaplmtr. Bu kanala gelen atksular Ana Blge ve II
Nolu Blgenin atksularndan olumaktadr. Bu da mevcuttaki toplam atksu oluumunun
%67sine karlk gelmektedir. Bununla birlikte Haclar ve IV nolu gelime blgelerinin mevcut
ve ileriye dnk yaplarna bakldnda, kirlilik ykn artracak bir profil gzlenmemektedir.
Tablo 2. KOSB atksu karekterizasyonunun yllara gre deiimi
Parametreler 1998
(mg/lt)
2001
(mg/lt)
2005
(mg/lt)
2006
(mg/lt)
KO 1750 700 1960 1700
AKM 600 780 600 1800
BO
5
650 450 550 700
TKN 35(17) 23(13) 40(27) 25(22)
Top-P 10(6) 9(5) 12(8) 13(7)
Ya-Gres 200 15 150
pH - 6,9-7,3 6,4-7,6 6,5-9
Toplam Cn 0,2 0,07 0,25 0,55
Top-Krom 0,8 0,45 1,2 2
Cr
+6
0,6 0,33 0,16 1
Zn 2,2 2 6 2,5
Civa - 0,00018 0,1 0,065
Kurun 0,4 0,53 1,7 2
Cd 0,02 - 0,25 0,18
Bakr 3 0,3 0,5 0,5
Slfat 550 350 600 600
Ayrca Kayseri Organize Sanayi Blgesinde yer alan tesislerin atksu miktarlar ve kirlilik
ykleri asndan deerlendirebilmek amac ile bir anket almas yrtlmtr. Atksu
miktar ve/veya kirletici dzeyi fazla olan tesisler seilerek bu anket almasna dahil
edilmitir. Bu kapsamda 30 adet tesis yerinde incelenerek ve anket almas yaplarak
deerlendirilmitir. Ayrca metal tesislerinden gelebilecek atksu miktarn ve kirlilik ykn
daha kapsaml deerlendirebilmek iin 75 tesis ile grlm bunlarn ierisinden proses
KOSB Atksu Artma Tesisi Tasarm in Atksu Karekterizasyonunun Belirlenmesi 501


atksuyu oluan firmalar tespit edilmitir. Aadaki ekillerde sras ile ekil 1de askda kat
madde (AKM), ekil 2de kimyasal oksijen ihtiyac (KO) ve ekil 3de biyokimyasal oksijen
ihtiyac (BOI
5
) parametrelerinin ynsal dalm grafikleri verilmitir.

ekil 1. 20052006 Yl birleik AKM dalm deerleri

ekil 2. 20052006 Yl birleik KO dalm deerleri

ekil 3. 20052006 Yl birleik BO
5
dalm deerleri
2005-2006 Yl AKM Dalm
0
500
1000
1500
2000
2500
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
A
K
M
(
m
g
/
l
)
1536
1305
2005-2006 Yl KO Dalmlar
0
500
1000
1500
2000
2500
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
K
O

(
m
g
/
l
)
1848
1755
2005-2006 Yl BO
5
Dalm
0
100
200
300
400
500
600
700
800
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
K
O

(
m
g
/
l
)
690
620
502 O zkan, zdemir, Y. Gltekin ve di.


3. Sonu
Kayseri Organize Sanayi Blgesinde (KOSB) kurulmas planlanan merkezi atksu artma
tesisinin tasarmna esas olacak atksu karekterizsayonunu belirlemek amac ile bu alma
gerekletirilmitir. Buradan elde edilecek sonular, tesisin hangi proseslerden ve nitelerden
olumas gerektii konusuna k tutacaktr.
Kayseri OSB iin yaplacak Merkezi Atksu Artma Tesisinin nihai kapasitesi blgenin %100
doluluk oranna ulamas sonucunda oluacak atksu miktar olarak ngrlmektedir. Bu
blgelerdeki mevcut sanayi profilinin ve buna bal olarak da atksu oluumunun ileride nasl
deiebileceinin tahmin edilmesi g olduu iin, ortalama hektar bana atksu oluumu oran
gelecek tahminleri iin kullanlmtr.
KOSBde yaplan atksu analizleri ve deerlendirmeler sonucunda, atksu artma tesisine
gelebilecek ar metallerin az sayda bulunan metal kaplama tesislerinden kaynakland tespit
edilmitir.
Kaynaklar
Aka L., zkan O. (2007). Kayseri Organize Sanayi Blgesi Merkezi artma Tesisi fizibilite raporu, Kayseri.
Kayseri OSB, (2007), Haber Blteni, Kayseri.




.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Kirlenmi Akiferlerin Pompaj ve Artm Yntemi ile
Temizlenmesi: Teknik Sorunlar, Sebepler ve zmler
Gamze Gngr Demirci
1
ve Ayegl Aksoy
2

1
Orta Dou Teknik niversitesi, evre Mhendislii Blm, 06531, Ankara
E-posta: ggamze@metu.edu.tr
2
Orta Dou Teknik niversitesi, evre Mhendislii Blm, 06531, Ankara

z Dnya zerinde mevcut en nemli tatl su kaynaklarndan biri olan yeralt sular yanl
ve/veya eksik endstriyel ve tarmsal uygulamalar ile yetersiz evre bilinci sonucu her geen
gn daha fazla kirlenmektedir. Kirlenmi akiferlerin temizlenmesi iin gelitirilen pekok
yntemden birisi de pomjaj ve artm ile temizlemedir. Uzun yllardr yaygn kullanlmasna
ramen uygulamada karlalan uzun temizleme sreleri, yksek maliyet ve istenilen standart
kirletici konsantrasyonuna ulalamama gibi sorunlar bu yntemin etkinliini tartlr hale
getirmitir. Bu alma pompaj ve artm ile temizleme sistemlerinin uygulanmas srasnda
karlalan sorunlar ve sebepleri konusunda bir inceleme olup bu sorunlara kar nerilen
potansiyel zmleri gstermeyi hedeflemektedir.
Anahtar Kelimeler akifer; kirletici; pompaj ve artm; temizleme; yeralt suyu
1. Giri
Yeralt sular, dnyadaki toplam tatl su hacminin %30unu oluturmas sebebiyle, mevcut en
nemli tatl su kaynaklarndan birisidir (USGS, 2008). Ancak bu ok deerli kaynak tpk yzey
sular gibi dnyada ve lkemizde youn kirlenme tehdidi ile kar karyadr. Kirli yzey sular
ve tarmda kullanlan gbre ve ilalarn yeralt sularna karmas, evsel ve endstriyel
atksularn artlmadan araziye verilmesi, endstriyel tesislerden kan kat ve sv tehlikeli
atklarn uygunsuz artlarda topraa gmlmesi ve/veya dklmesi, evsel kat atk ve tehlikeli
atklarn depoland dzenli depolama tesislerindeki kaaklar ve szntlar, endstriyel
tesislerdeki kimyasal madde depolarnda ve boru hatlarnda esitli sebeplerden dolay meydana
gelen kaak ve szntlar yeralt sularna ar metaller, organik bileikler, pestisitler gibi ok
eitli kirleticilerin karmasna ve kirlenmesine sebep olurlar (Simon ve di., 2002). Yeralt
sular bir kez kirlendikten sonra temizlenmesi ve tekrar kullanlabilir hale getirilmesi hayli uzun
ve maliyetli ilemler gerektirir. Kirlenmi yeralt sularnn temizlenmesi iin halihazrda bir ok
seenek mevcuttur. Pompaj ve artm ile temizleme bu seenekler iinde en yaygn kullanlan
yntemlerden biridir. Ancak bugne kadar pompaj ve artm ile temizleme sistemlerinin iletimi
srasnda karlalan baz sorunlar hedeflenen sonulara ulalmasn engellemi, bu yntemin
etkinlii ve kullanlmasna devam edilip edilmemesi konusunda tartmalara yol amtr. Bu
alma pompaj ve artm ile temizleme sistemlerinin bugne kadar kar karya kald
sorunlar ve bu sorunlarn sebepleri konusunda bir inceleme olup ayn zamanda bu sorunlara
kar nerilen potansiyel zmleri gstermeyi hedeflemektedir.
2. Pompaj ve Artm ile Temizleme
Pompaj ve artm ile temizleme kirlenmi yeralt sularnn temizlenmesi iin yllardr yaygn
olarak kullanlan yntemlerden biridir. Hem kirleticinin daha fazla yaylmasn engellemek
amacyla hidrolik evrelemeye imkan vermesi hem de akabinde mevcut kirlenmi yeralt
suyunun temizlenmesini salamas dolaysyla dier temizleme yntemlerinden farllk gsterir.
504 G. G. Demirci, A. Aksoy


Ancak sk tercih edilmesine ramen, dnyadaki uygulamalar srasnda karlalan baz sorunlar
bu yntemin etkinliini tartma konusu yapmtr (Travis ve Doty, 1990). Dier yandan mevcut
pekok alternatif arasnda, akifer iinde geni bir alana yaylm kirleticileri temizleme
konusunda pompaj ve artmdan daha stn olduu kantlanan baka bir yntem de yoktur
(Hoffman, 1993). 1982 ile 2005 ylllar arasnda, Amerika Birleik Devletlerinde, uygulanan
veya uygulanmas planlanan pompaj ve artm ile temizleme sistemleri, Ulusal ncelik
Listesindeki Superfund sahalarndaki tm temizleme giriimlerinin %68ini tekil etmektedir
(USEPA, 2007). Bu rakam pompaj ve artmn karlalan sorunlara ramen halen tercih edilen
bir yntem olduunu aka gstermektedir.
Pompaj ve artm ile temizleme, kirlenmi akiferin seilen noktalarna pompaj kuyular almas
ve kirlenmi yeralt suyunun pompalar vastasyla yerstne ekilmesi ile gerekletirilir.
Yerstndeki artma tesisinde aktif amur gibi biyolojik veya aktif karbon adsorpsiyonu,
havayla syrma gibi fiziksel/kimyasal yntemlerle artlan yeraltsuyu, kuyular araclyla
akifere geri verilir veya yakndaki bir alc ortama dearj edilir (Eastern Research Group, 1996).
3. Pompaj ve Artm ile Temizlemede Karlalan Sorunlar ve Sebepleri
Pompaj ve artm ile temizleme sistemlerinin en nemli sorunlarndan biri istenilen temizlemeyi
salamak iin gerekli olabilecek uzun iletim sreleridir. Dier yandan yksek kurulum
maliyetlerine, iletim srelerinin uzamas nedeniyle yksek iletim maliyetlerinin de eklenmesi
pompaj ve artm ile temizlemeyi olduka pahal bir yntem haline getirebilmektedir. Amerika
Birleik Devletlerindeki 32 pompaj ve artm ile temizleme sahasnda yaplan aratrma
sonular bu sistemlerinin kurulum maliyetinin 290 bin dolar ile 19 milyon dolar arasnda
deitiini, ortalamasnn ise 4.9 milyon dolar olduunu ortaya karmtr. Dier taraftan yllk
iletim maliyetinin 110 bin dolar ile 4.6 milyon dolar arasnda olduu ve yllk ortalama iletim
mailyetinin 770 bin dolar olduu grlmtr (USEPA, 2001). Bu rakamlar pompaj ve artm
sistemlerinin kar karya olduklar sorunlarn sebeplerinin tanmlanmas ve zm ve
maliyetlerin drlmesi iin harcanlan abann ne kadar anlaml olabileceini ortaya
koymaktadr.
Uzun temizleme srelerinin ana sebeplerinden biri temizleme sresinin ileri aamalarnda
znm kirletici konsantrasyonundaki d hznn azalmas, pompaj sona erdirilip pompalar
kapatldktan sonra akiferdeki kirletici konsantrasyonunun tekrar hzla ykselmesidir. Bu durum
literatrde kuyruk etkisine bal geri tepme etkisi olarak adlandrlr.
Kuyruk ve geri tepme etkisini tetikleyen faktrler kirleticinin, akiferin ve yeralt suyunun
fiziksel ve kimyasal zelliklerine baldr. Kirlenmi pekok sahada kirleticiler suda znm
olma durumunun yannda ayr sv faznda (NAPL), topraa adsorplanm veya kat kelek
olarak bulunurlar. Pompaj ve artm ile temizleme srasnda kirletici ktlesinin bu fazlardan
yeralt suyuna transferindeki yavalk kuyruk etkisine yol aar ve temizleme sresini uzatr.
(Cohen ve di., 1994). Kuyruk etkisinin bir dier sebebi akiferlerin hidrolik iletkenlik, porosite
gibi fiziksel zelliklerindeki heterojenliktir. Heterojen akiferlerde yeralt suyunun hz ve ak
yollar ok fazla deikenlik gsterir ve bu temizleme performansn etkiler. Ayrca hidrolik
iletkenliin dk olduu blgelerde hapsolup havuzlanan kirleticinin difzyon yoluyla yava
yava yeralt suyuna karmas kuyruk etkisine sebep olur. Bir kirleticinin topraa ne kadar
tutunaca kirleticinin zelliklerine bal olduu kadar akiferin kimyasal zelliklerine de
(rnein, organik karbon ierii) baldr. Tpk fiziksel zellikler gibi akiferin kimyasal
zelliklerindeki heterojenlikler de temizleme srelerinin uzamasna ve temizlemenin
zorlamasna neden olabilir. Uzun temizleme sreleri bu saylan faktrler dnda kirleticinin
Kirlenmi Akiferlerin Pompaj ve Artm ile Temizlenmesi Teknik Sorunlar, Sebepler ve zmler 505


akifer iindeki yaylma alanna, derinliine ve konsantrasyonuna ve ulalmak istenilen kirletici
konsantrasyonu hedefi ve dearj standartlarna da baldr (Berlung, 1995; Berlung, 1997;
USEPA, 1999).
Kuyruk ve geri tepmeye ek olarak pompaj ve artm sistemlerinin verimliliini dren
faktrlerden biri de akifer iindeki hidrolik olarak durgun blgelerdir. Bu durgun blgeler
pompalama ve/veya akifere suyu geri verme ilemleri srasnda dk hidrolik eim ve buna
bal olarak dk yeralt suyu ak hzlarna sebep olur. Eer sahada birden fazla pompaj veya
enjeksiyon kuyusu mevcutsa birden fazla durgun blge meydana gelebilir (Eastern Research
Group, 1996).
4. zm nerileri
Pompaj ve artm ile temizleme sistemlerinin etkinliini artrmak iin nerilebilecek
zmlerden biri uygulama yaplacak olan sahann fiziksel ve kimyasal zelliklerinin mmkn
olan en detayl biimde tanmlanmasdr. Genelde bir pompaj ve artm sahasndaki uzayan
temizleme sresine birden fazla faktr (mesela, znme, difzyon ve geri sorpsiyon) sebep
olabilir. Bu yzden bu etkilerin gerek sebeplerini bulmak iin sadece konsanstrasyonun
zamana kar nasl deitiini gzlemlemek yeterli olmaz, detayl bir saha aratrmas gerekir.
Analitik ve/veya nmerik modellerin kullanlmas farkl koullarn yol at sonular grmeye
ve kuyruk ve geri tepmenin sebeplerini tanmlamaya yardmc olabilir. Temizleme srasnda
sahada oluan durgun blgelerin yerlerini belirlemek iin de saha lmlerine ve modelleme
almalarna ihtiya vardr (Cohen ve di., 1994). Bir pompaj ve artm sistemini tasarlamadan
nce saha tanmlamas ve modelleme almalarnn yaplmas ilerleyen aamalarda sistemin
iletimi srasnda karlalmas muhtemel sorunlarn nne geebilmek iin ilk admdr.
Optimizasyon yntemleri kulllanlarak en uygun tasarmn seilmesi de en az modelleme
almalar kadar gerekli bir dier n almadr. Optimizasyon modelleri sayesinde pompaj ve
gzlemleme kuyularnn yerleri ve says, pompalanacak suyun miktar, yerstnde kurulacak
artma tesisinin zellikleri belirlenir ve sistem buna gre planlanr (Zheng ve Wang, 2002).
Pompaj ve artm sistemlerinin hem inas hem de iletimi srasnda dinamik bir ynetim tarz
benimsenmelidir. Sistem inaasn aamalandrmak, ilk aamada alan kuyulardan elde edilen
verilerle sonraki aamalar ekillendirmek asndan faydal bir yntem olabilir. Ayn ekilde
iletim srasnda sabit kuyular ve pompaj miktarlar kullanmak yerine pompalanan su miktarn
ve alan kuyularn yer ve saysn deitirmenin hem daha etkili bir hidrolik evreleme
salamas hem de hidrolik olarak durgun blgelerin oluumunu en aza indirmesi dolaysyla
sistemin performansn artraca literatrde modelleme almalar vastasyla kantlanm bir
gerektir (Hoffman, 1993). Dk hidrolik eimden kaynaklanan bu durgun blgeler hidrolik
eimin ve yeraltsuyu ak hznn llmesi ve modelleme almalar sayesinde belirlenir.
Durgun blgelerin yerlerinin belirlenmesi ve oluumlarnn en aza indirilmesi temizleme
sisteminin verimini artrmak asndan nemlidir (Eastern Research Group, 1996).
Srekli pompaj yerine fasla pompaj yntemini kullanmak akiferden ekilen su hacmi bana
den kirletici miktarn artrmas asndan sistem performansn artrd ve maliyetleri
drd dnlen bir dier yntemdir (Aksoy ve Culver, 2004). Bu yntem zellikle dk
hidrolik iletkenlie sahip akiferler ile ktle transfer kst olan akiferlerde etkilidir. Geleneksel
pompaj ve artm sistemlerinde pompalar srekli altrlr. Faslal pompajda ise temizleme
sresi pompalama ve dinlenme periyotlarna blnr. Dinlenme srasnda topraa sorplanm
durumda bulunan kirleticiler toprak ile su arasnda oluan konsantrasyon fark dolaysyla suya
geerler. Dk hidrolik iletkenlie sahip blgelerde hapsolmu kirleticiler difzyon yoluyla
506 G. G. Demirci, A. Aksoy


suya karrlar. Daha sonra pompalama periyodunda, znm kirletici konsantrasyonu artm
olan kirli su yerstne ekilerek artlr.
Pompaj ve artmn bioremediasyon, reaktif bariyerler gibi baka temizleme metodlar ile
birletirilmesi istenilen temizleme hedeflerine ulalmasn kolaylatrabilir. Ayrca topraa
sorplanm veya znrl dk kirleticilerin suya geiini artran yzey-aktif maddelerin
kullanm pompaj ve artm sistemlerinin veriminin artmasna da yardmc olur (Eastern
Research Group, 1996).
Kaynaklar
Aksoy, A. ve Culver, T.B. (2004). Comparison of Continuous and Pulsed Pump-and-Treat for Mass Transfer-Limited
Aquifers, Turkish J. Eng. Env. Sci., 28, 307-316.
Berlung, S. (1995). The effect of Langmuir remediation of sorption on pump-and-treat a stratified aquifer, J. Contam.
Hydrol., 18, 199-220.
Berlung, S. (1997). Aquifer remediation by pumping: A model for stochastic-advective transport with nonaqueous
phase liquid dissolution, Water Resour. Res., 33(4), 649-661.
Cohen, R.M., Vincent, A.H., Mercer, J.W., Faust, C.R., ve Spalding, C.P. (1994). Methods for Monitoring Pump-
and-Treat Performance. Rapor No: EPA/600/R-94/123, 102 sayfa.
Eastern Research Group, Inc. (1996). Pump-and-treat ground-water remediation: A guide for decision makers and
practitioners, Rapor No: EPA/625/R-95/005.
Hoffman, F. (1993). Ground-water remediation using Smart Pump and Treat, Ground Water, 31(1), 98-106.
Simon, F.G., Meggyes, T. ve Tnnermeier, T. (2002). Groundwater remediation using active and passive processes,
Advanced groundwater remediation: Active and Passive technologies, Editrler: Simon F.G., Meggyes T.,
McDonald C., Thomas Telford Ltd.
Travis, C.C. ve Doty, C.B. (1990). Can contaminated aquifers at Superfund sites be remediated?, Environ. Sci. Tech.,
24(10), 1464-1466.
U.S. Environmental Protection Agency (USEPA) (1999). Groundwater Cleanup: Overview of Operating Experience
at 28 Sites, Solid Waste and Emergency Response, Rapor No: EPA- 542-R-99-006.
USEPA (2001). Cost Analyses for Selected Groundwater Cleanup Projects: Pump and Treat Systems and Permeable
Reactive Barriers, Solid Waste and Emergency Response, Rapor No: EPA-542- R-00-013.
USEPA (2007). Treatment Technologies for site cleanup: Annual status report (Twelfth Edition), Solid Waste and
Emergency Response, Rapor No: EPA-542-R-07-012.
USGS (2008). United States Geological Survey Resmi Web Sitesi,
http://ga.water.usgs.gov/edu/waterdistribution.html.
Zheng, C.M. ve Wang, P.P. (2002). A field demonstration of the simulation optimization approach for remediation
system design, Ground Water, 40(3), 258-265.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Bakr Zenginletirme Tesisi Atklarnca Kirlenmi Topraklarda
Ar Metal Gideriminin ncelenmesi
E. Burcu zkaraova Gngr
Ondokuz Mays niversitesi, Mh. Fak., evre Mh. Bl. 55139 Kurupelit, Samsun
E-posta: gungorb@omu.edu.tr

zet: Samsun Tekkeky mevkiinde, Karadeniz Bakr Samsun letmesinin zenginletirme
faaliyetleri sonucu oluan izabe ve flotasyon atklarnn ak arazide depolanmalar nedeniyle
ar metal kirliliine rastlanmtr. Bitkilerin bulunduu blgeye yakn yerlerden st 0-25 cm
ksmdan alnan toprak rneklerinde yaklak olarak bakrn 2400 mg/kg, inkonun 700 mg/kg,
kadmiyumun 6 mg/kga kadar ykselebildii ve Toprak Kirliliinin Kontrol Ynetmeliinde
pH 5-6 topraklar iin verilen snr deerleri at anlalmtr. Sz konusu ar metal giderim
almasnda aminopolikarboksilik asitlere rnek olarak etilen diamin tetra asetik asit ve dietilen
triamin penta asetik asit kullanlmtr. almalar, toprak-zelti orannn 1/50 veya 1/25
olmasnn giderim veriminde nemli bir farkllk oluturmadn ortaya koymu, yine bakr ve
inko gideriminde 240 dakikalk bir reaksiyon sresinin yeterli olduunu gstermitir. Bakr ve
inko giderim verimlerinin kimyasaln konsantrasyonunun artmasyla artt, ancak toprak
numune zelliklerine (dane boyutu dalm, vs.) ve numunedeki kirletici konsantrasyonuna
bal olarak ar metal trne gre yaklak olarak % 20 ile % 80 arasnda deiim gsterdii
saptanmtr.
Anahtar Kelimeler ar metal giderimi; flotasyon at; elat oluturucu bileikler
1. Giri
Yirminci yzyln balarnda flotasyon tekniinin maden zenginletirme ilemlerinde uygulanmas
dolaysyla dk tenrl cevherlerin geni apta ilenebilmesi, bakr, kurun, inko, nikel, kobalt,
civa, antimuan, vs. gibi cevherlerin sanayi ve teknoloji gelimelerine paralel art gsteren
taleplerinin karlanmasn salamtr. Ancak, flotasyon gibi maden zenginletirme ilemleri
sonucunda kat ve sv atklar olumaktadr. Atklarn zellikle szdrmazln bulunmad
alanlarda kontrolszce depolanmas, endstriyel faaliyetler srasnda sznt gibi sebepler
sonucunda toprakta meydana gelen ar metal kirliliinin kontrol ve giderimi eitli yntemlerle
yaplmaktadr (Mulligan ve di., 2001; Gksu ve zkaraova Gngr, 2005). Arazi iinde basnl
ykama (soil flushing) ve arazi dnda toprak ykama (soil washing) ar metal gideriminde
yaygnlk kazanan artm teknolojileri olarak kabul edilmektedir (Peters, 1999; Atay ve di., 2007).
Samsun Tekkeky mevkiinde, 1973 ylnda retime giren Karadeniz Bakr letmesi (K.B.)nin
ortalama % 23 Cu tenrl Murgul, ayeli, Kre konsantrelerinden flash ergitme yntemiyle
250000 ton/yl bakr konsantresi ilenerek 38760 ton/yl blister bakr (% 99) retimi yan sra
280000 ton/yl % 93 slfrik asit retimi kapasitesi bulunmaktadr. Tesiste zenginletirme
faaliyetleri sonucu oluan izabe ve % 0,3-0,6 Cu ieren flotasyon atklar ak arazide
depolanmtr. 2004 ylnda zelletirilmi olan Samsun letmesi, edinilen bilgilere gre
faaliyetlerini srdrmektedir. alma, K.B.. civarndaki arazide muhtemel ar metal kirliinin n
508 E.B. zkaraova Gngr


incelemesi yaplarak toprak ortamndaki kirletici seviyelerinin tespit edilmesini ve ar metallerden
bakr ve inkonun organik asitlerle ykama yoluyla giderimlerini iermektedir.
2. Materyal ve Metot
2.1. Toprak rnek ve Analizleri
Deneysel almalarda kullanlmak zere, bakr ileme tesisi arazisi civarndan eitli noktalarndan
0-25 cm yzey tabakasndan birok toprak rnekleri alnmtr. Havada kurutulmu toprak
rneklerinin dane boyutu dalmlar belirlenmi, toplam ar metal ierikleri, pH tayinleri ve
giderim almalar dane boyutu 2 mmden kk numunelerle yaplmtr.
2.2. Zamana ve Konsantrasyona Bal Giderim almalar
(I) ve (III) no.lu toprak rnekleri kullanlarak zamana bal ar metal giderimleri, 1/25 ve 1/50
oranlarnda etilen diamin tetra asetikasit (EDTA) ve dietilen triamin penta asetikasit (DTPA)
zeltilerinin numunelerle 252Cde 5-1440 dakika sreyle reaksiyonu neticesinde incelenmitir.
Santrifj edilmi ve katsndan ayrlan solsyonlarn bakr ve inko ierikleri atomik absorbsiyon
cihaznda llmtr. Giderim almalar benzer ekilde farkl konsantrasyonlar iin tekrarlanmtr.
3. Deneysel alma Sonular
3.1. Toprak Analizleri
K.B..den alnan toprak rneklerinin ar metal ieriklerinin, bitkilerin bulunduu blgeye yakn
yerlerde bakr iin yaklak olarak 2400 mg/kg, inko iin 700 mg/kg, kadmiyum iin 6 mg/kga
kadar ykselebildii grlmtr. Toprak Kirliliinin Kontrol Ynetmeliinde pH 5-6 topraklar
iin verilen snr deerleri srasyla 50 mg/kg, 150 mg/kg ve 1 mg/kg olduu gz nne alnrsa
toprak yzeyindeki kirlenme daha iyi anlalmaktadr. Numunelerin dane boyutu dalmlar
incelendiinde topraklarn kum arlkl olduklar belirlenmi, III numaral topran ince fraksiyonu
(< 50 ) yaklak olarak topran % 35n oluturarak I numaral topraa (%1) gre daha ince
daneli bir bnye sergiledii belirlenmitir (ekil 1). I ve III numaral topraklarn ar metal giderim
almasnda kullanlmasna karar klnmtr.

ekil 1. I ve III numaral topraklarn dane dalm erileri
3.2. Zamana ve Konsantrasyona Bal Giderim almalar
Giderim almalarnn en uygun artlarda yaplabilmesi iin toprak-zelti oran ile optimum
reaksiyon sresinin belirlenmesi gerekmitir. Toprak-zelti orannn belirlenmesinde zamana bal
0
20
40
60
80
100
0.01 0.1 1 10
Tane Bykl, mm
K
a
l
a
n

K

l
a
t
i
f

T
o
p
r
a
k
,

%
Toprak No I
Toprak No III
Bakr Zenginletirme Tesisi Atklarnca Kirlenmi Topraklarda Ar Metal Gideriminin ncelenmesi 509


farkllklarn olabilecei dncesiyle giderim verimindeki deiimler zamana bal izlenmitir.
EDTA ile 1/25 ve 1/50 oranlarnda yaplan almada toprak-zelti orannn bakr giderimi
zerinde nemli bir etki yaratmad anlaldndan toprak-zelti oran 1/25 olarak belirlenmitir.
ekil 2den grld gibi her iki oran iin bakr giderimi 240. dakikadan sonra denge konumuna
ulamaya balam ve 1440. dakikann sonunda % 28 mertebesinde gereklemitir. Di Palma ve
Ferrantelli (2005) tarafndan EDTA ile 1/25 orannda yaplan bakr giderim almasnda 5 saatten
sonra denge konumuna ulald bildirilmitir.

ekil 2. Toprak-zelti orannn bakr giderim verimi zerine etkisi
I ve III numaral topraklardan bakr ve inkonun EDTA konsantrasyonuna bal giderimi
incelendiinde konsantrasyonun artmasyla verimin azalan oranlarda artmaya devam ettii tespit
edilmitir; benzer bir durum Yuan ve di. (2007) tarafndan tanmlanmtr. Her iki toprak iin
inko giderim verimlerinin (s % 95) bakra gre (s % 39) genelde daha yksek seyrettii
gzlemlenmitir (ekil 3). Giderim mg/kg olarak deerlendirildiinde inkonun bakra gre az
fazla alnd (III numaral toprak iin 587 mg Cu/kg ve 624 mg Zn/kg) ancak kirlilik dzeyinin
daha dk olmas nedeniyle verim yzdesinin yksek bulunduu anlalmtr. Bununla birlikte,
metal-EDTA denge sabitinin bakr iin daha yksek (log K
Cu
= 18,8 > log K
Zn
= 16,5) olmasna
ramen EDTA/EDTA-Me oranlar EDTAnn inko ile daha fazla komplekslemeye gittiini
gsteriyor. Topraklar kendi aralarnda kyaslandnda ise, III numaral topran bakr ieriinin
(2298 mg Cu/kg) I numaraya gre ok daha yksek olmas (425 mg Cu/kg) ve EDTA/EDTA-Me
oranlarnn dmesiyle EDTAnn daha ok tketilmesine bal giderim veriminin dt
anlalmaktadr (Tsang ve di., 2007).
DTPA ile yaplan bakr giderim almalarnda EDTAya gre olduka yksek verimlerin elde
edildii ve zellikle I numaral toprak iin % 46dan % 77ye ykseldii, III numaral toprak iin
ise % 33e ulat ekil 4de grlmektedir. Khodadoust ve di. (2005) DTPAnn performansnn
EDTA ile kyaslandnda daha iyi olduunu belirtmilerdir. Giderim verimlerin genelde daha
yksek olmas be dili elat oluturucu bir organik asit olarak denge sabitinin bakr iin daha
yksek (log K
Cu-DTPA
= 21 > log K
Cu-EDTA
= 18,8) olmasna balanmtr.
4. Sonu
1973 ylndan bu yana Samsun Tekkeky mevkisinde faaliyet gsteren K.B.. ait izabe ve flotasyon
atklarnn ak alanda depolanmas sonucunda ar metal kirliliine yol at tespit edilmitir.
Kirlenmi blgeden alnan toprak numunelerinde etilen diamin tetra asetik asit ve dietilen triamin
penta asetik asit kullanlarak yaplan giderim almasnda 1/25 orannn ve 240 dakika reaksiyon
sresinin yeterli olduu saptanmtr. EDTA ile elde inko giderimi yzde olarak bakr
gideriminden daha yksek olarak yansmasna ramen mg/kg olarak birbirine yakn olduu
0
20
40
60
80
100
0 500 1000 1500
Zaman, dak
B
a
k

r

G
i
d
e
r
i
m
i
,

%
Cu-2g Cu -1g
510 E.B. zkaraova Gngr


grlmtr. EDTA ile bakr gidermi I numaral toprak iin % 46, iki numaral toprak iin % 26,
DTPA ile srasyla % 33 ve % 77 verimleri elde edilmitir. DTPAnn yksek verimleri be dili
yaps dolaysyla denge sabitlerinin daha yksek olmasna balanmtr.

ekil 3. EDTA konsantrasyonuna bal bakr ve inko giderimleri

ekil 4. EDTA ve DTPA konsantrasyonlarna bal bakr giderimleri
Kaynaklar
Atay, ., zkaraova Gngr, E. B. ve Bke zko, H. (2007). Toprak kirlilii kontrolnde ykama teknolojilerinin yeri
ve uygulanabilirlilii, VII. Ulusal evre Mhendislii Kongresi, 889-895, Ekim 24-27, 2007, zmir, Trkiye.
Di Palma, L. ve Ferrantelli, P. (2005). Copper leaching from a sandy soil: Mechanism and parameters affecting EDTA
extraction, J. Hazard. Mater. B122, 85-90.
Gksu, . ve zkaraova Gngr, E. B. (2005). Toprak kirliliinin kontrol ve giderim teknolojileri, VI. Ulusal evre
Mhendislii Kongresi, Poster Bildiriler Kitab 179-183, Kasm 24-26, 2005, stanbul, Trkiye.
Khodadoust, A.P., Reddy, K.R. ve Maturi, K. (2005). Effect of different extraction agents on metal and organic
contaminant removal from a field soil, J. Hazard. Mater. B117, 15-24.
Mulligan, C.V., Yong, R.N. ve Gibbs, B.F. (2001). Remediation technologies for metal contaminated soils and
groundwater: an evaluation, Engineering Geology, 60, 193-207.
Peters, R.W. (1999). Chelant extraction of heavy metals from contaminated soils, J. Hazard. Mater. 66, 151-210.
Tsang, D.C.W., Zhang, W. ve Lo . M.(2007). Copper extraction effectiveness and soil dissolution issues of EDTA-
flushing of artificially contaminated soils, Chemospher, 68, 234-243.
Yuan, S., Xi, Z., Jiang, Y., Wan, J., Wu, c., Zheng, Z. ve Lu, X. (2007). Desorption of copper and cadmium from soils
enhanced by organic acids, Chemospher, 68, 1289-1297.
0
20
40
60
80
100
0 0.002 0.004 0.006 0.008 0.01 0.012 0.014 0.016
EDTA Konsantrasyonu, mg/L
M
e
t
a
l

G
i
d
e
r
i
m
i
,

%
KBT III - Cu
KBT I - Cu
KBT III - Zn
KBT I - Zn
0
20
40
60
80
100
0 0.002 0.004 0.006 0.008 0.01 0.012 0.014 0.016
EDTA/DTPA Konsantrasyonu, mg/L
B
a
k
i
r

G
i
d
e
r
i
m
i
,

%
KBT III -EDTA
KBT I-EDTA
KBT III-DTPA
KBT I-DTPA



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Erzurumda Doal Gaz Kullanmnn Hava Kirliliine Etkisi
Zeynep Eren
Atatrk niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm,25240 Erzurum.
E-posta: zeren@atauni.edu.tr

z Bu almada Erzurumda snma amal fosil yakt tketiminden doal gaza gei dnemi
ile birlikte hava kalite parametreleri deerlendirilerek, doal gaz kullanmnn hava kirliliine
etkisi incelenmitir.
Bu almada Erzurum ilinde doalgaz uygulamasna geildikten sonra hava kirliliindeki SO
2

ve PM deerleri dikkate alnarak nceki yllara gre azalmalar belirlenmitir. alma Atatrk
niversitesi evre Sorunlar Aratrma Merkezi ve Palen (Erzurum) Doal Gaz Datm
A..deki son drt yllk veriler dikkate alnarak hazrlanmtr. alma sonunda doalgaza
gei oran ile birlikte hava kirliliinde kademeli bir azalma meydana geldii tespit edilmitir.
Erzurum ilinde hava kirliliine sebep olan fosil yakt tketimi 2003 ylna kadar devam etmekte
idi. Doalgazn temiz yakt olmas ve ehrin hava kirliliini azaltmasnda salayaca etkin rol
dnlerek, 2003 yl Austos ay itibari ile doal gaz alt yap almalar balam, 2004 yl
Kasm itibari ile ehirde doalgaz snma amal kullanlmaya baland. 2007 yl sonuna
gelindiinde ise ehrin yaklak %40 doal gaz dnm projesine dahil olmutur. 2007 yl
sonu itibari ile hava kirleticilerde; SO
2
de %60lk, PMde %81lik toplam bir azalma meydana
gelmitir.
Anahtar Kelimeler doal gaz; fosil yakt; hava kirlilii; SO
2
; PM
1. Giri
Hava kirlenmesi lkemizin bir ok blgesinde k aylarnn deimez problemi haline gelmitir.
Bu sorunun temelini, plansz kentleme ve sanayileme, dk kaliteli yaktlar, yaktlara uygun
olarak projelendirilmeyen yakma sistemleri ve yetersiz evre bilinci oluturmaktadr. Hava
Kalitesinin Korunmas Ynetmelii 2 Kasm 1986da yrrle girmi olmasna ramen
(Mevcut Ynetmelik 13/01/2005 tarih ve 25699 sayl Isnmadan Kaynaklanan Hava Kirlilii
Ynetmelii olarak deimitir), hava kirlenmesi problemlerinin azalmasn salayamamtr.
Hava kirliliinin k aylarnda belirli blgelerimizde ynetmelikte belirtilen uyar kademelerini
amas kirlenme boyutunun insan yaamn tehdit edecek snrlara geldiini gstermektedir.
Hava kirliliinin nne geilebilmesi iin ynetmelikte ksa dnemi kapsayan nlemler ve uzun
dnemde uygulanacak nlemler vardr. Ksa dnemde kirletici kaynaklarn denetimi ve kontrol
altna alnarak, daha temiz yaktlarn (hava kirlenmesine daha az etkisi olan) kullanlmas
salanmaldr. Uzun dnemde ise; kaynaklarda daha az kirlenme oluturacak teknolojiler
kullanlmal, yeni teknolojiler gelitirilerek, kullanlan teknolojilere uygun olarak daha yksek
verimli kirletici kontrol teknolojileri kullanlmal, temiz yaktlarn retimi salanmal ve
yaktlara uygun daha yksek verimli yeni yakma sistemleri gelitirilerek uygulanmaldr
(Bayram ve Mezzinolu, 1996).



512 Z. Eren


Erzurum ehir merkezi 1800-2000 m ykseklikte kurulmu olup, 3200 m yksekliinde dalarla
evrilmitir. Erzurumun toporafik yaps ve corafik konumu il genelinde iddetli bir karasal
iklim yaratr. Trkiyenin scaklk ortalamas en dk ili olan Erzurumda klar olduka souk
ve sert geer. Yllk scaklk ortalamas 6
o
C ve gnlk scakln 5
o
Cden dk olduu gn
saysnn 165, ortalama donlu gn says 155 ve karla rtl gn says 112dir. Bu zellii ile
Erzurum lkenin en souk illerinden birisidir. Kentte snmaya ihtiya duyulan k aylarnda
etkili rzgar hz 2,2 m/s iken, snmaya ihtiya duyulmayan aylarda 2,9 m/sdir. Erzurum, bu
ar k artlarndan dolay snmak amal en az 6 ay yakt kullanmakta (Erzurumda l evre
mdrl verilerine gre 2004-2005 k dneminde 98254 ton/yl kat, 20138 ton/yl fuel-oil
kullanlmtr); ehrin toporafik ve meteorolojik yaps da bu kirleticilerin seyrelmesini
gletirmektedir. Erzurumda endstriyel kurulularn yok denecek kadar az sayda olmas
hava kirliliinin tamamen konutlardan kaynaklanmasna neden olmaktadr. Ayrca son yllarda
snmada kullanlan yaktlarn kalitesizliinden dolay zellikle k aylarnda Erzurumda hava
kirlilii artmaktadr. Gemi yllarda Erzurum bu zellii ile Trkiyede 1. derecede hava kirlili-
i olan iller listesinde yer almakta idi. (Turalolu ve Bayraktar, 2002; Kocadastan v.d., 2002).
Bu youn hava kirliliinin nne gemek amac ile ehirde 2003 yl Austos ay itibari ile
doalgaz alt yap almalar balam ve 2004 yl Kasm itibari ile snma amal doal gaz
kullanmna kademeli olarak gei balamtr. 2007 yl sonuna gelindiinde ise ehrin yaklak
%40 doal gaz dnm projesine dahil olmutur. Enerji Piyasas Dzenleme Kurumu
(EPDK) tarafndan 6 ubat 2004 tarihinde 30 yl sre ile Erzurum ve Ilcadan oluan datm
blgesinde Palen Doalgaz A. .ye datm faaliyeti yapmak zere lisans verilmitir.
Organik teoriye gre, dier fosil yakacaklar gibi doal gaz da milyonlarca yl nce yaam bitki
ve hayvan artklarndan olumutur. Yeryz kabuklar arasna gmlen bu artklar, basn ve
scaklk etkisiyle, kimyasal deiikliklere urayarak doal gaz meydana getirmitir. Dnyada
bilinen doal gaz rezervleri 100 trilyon m
3
mertebesinde olup, en byk rezerv % 35 ile eski Sovyetler
Birlii topraklarnda bulunmaktadr. Bunu % 34 payla Ortadou takip etmektedir. Trkiye'de
tketime sunulan yllk doal gaz miktar bugn iin 16 milyar m
3
mertebesinde olup, bu kapa-
sitenin yapm sren hatlarla ve imzalanan anlamalarla 2010 ylnda 55 milyar m
3
mertebesine
ulamas beklenmektedir. Trkiye'de de snrl miktarda doal gaz kmakta ve kullanma
sunulmaktadr. Trkiye doal gaz esas olarak Rusya ve ran'dan boru hatlaryla, Cezayir ve
Nijerya'dan svlatrlm olarak deniz yoluyla satn almaktadr. Ayrca Azerbaycan ve
Trkmenistan ile doal gaz temini iin anlamalar yaplmtr (Dasz, 2002).
Doal gaz esas olarak gaz halindeki parafin, karbon, hidrojen karmndan meydana gelir ve
yzdeleri de doal gazn kaynana gre deiir. Doal gaz esas olarak metan (CH
4
) ve daha az
oranda etan (C
2
H
6
) ve propan (C
3
H
8
) gibi hidrokarbonlardan meydana gelir. Doal gaz renksiz
ve kokusuz bir gazdr. Doal gaz ekonomiktir, doal gaz zellikle youmal kazan (veya duvar
tipi youmal kazan) ile kullanldnda kmr ve fuel oil'e gre ok daha ekonomik stma
imkan salar. Kazan verimlerindeki artlar dikkate alndnda doal gazn dier yaktlara gre
en az % 10 mertebesinde yakt ekonomisi salad sylenebilir. lave olarak temizlik,
depolama, yakt hazrlama ve kl atma maliyetleri gz nne alnrsa, doal gaz yaklmasnn
iletme maliyetlerinde nemli kazanlar salad sylenebilir.
Doal gaz evreyi kirletmeyen bir yakttr, evreyi kirleten ana faktr (SO
2
, PM ve is)
doal gaz duman ierisinde bulunmamaktadr. Doal gazn en nemli zelliklerinden birisi
zehirsiz olmasdr. Doal gazn solunmas halinde zehirleyici ve ldrc etkisi yoktur. Ancak
ortamda ok fazla birikmise teneffs edilecek oksijen azaldndan dolay boulma tehlikesi
Erzurumda Doal Gaz Kullanmnn Hava Kirliliine Etkisi 513


vardr. Yanma rn gazlar ortama yaylrsa, dier yaktlarda olduu gibi ierisindeki CO
nedeniyle zehirleme yapabilir (Kkyal, 2003).
Tablo 1. Doal Gazn Istmada Kullanmda Dier Yaktlarla Karlatrlmas
Kmr Fuel- oil Doal gaz
Karbon oran (%) 77,4 84,58 73,98
Hidrojen oran (%) 1,4 10,90 24,57
Kkrt oran (%) 1,0 4,00
Kl oran (%) 8,0 -
Nem oran (%) 7,0 -
Isl deeri [kj/kg (kcal/kg)] 29.600 (7.080) 39.220 (9.380) 49.085 (11.780)
Baca gazndaki SO
2
oran (ppm) 1,644 5,5 -
Hava fazlal 1 ,4 - 2,0 1 ,2 - 1 ,3 1,05- 1,1
2. Yntem ve Gereler
Bu aratrma Erzurum il merkezi iin 2004 yl ocak ayndan 2008 yl ocak ay (23 Ocaka
kadar) hava kirlilii lmlerinde elde edilen ehir ortalamas SO
2
ve partikl madde (PM)
deerleri esas alnarak hazrlanmtr. Atatrk niversitesi evre Sorunlar Aratrma Merkezi
1986 ylndan bu yana Erzurum ehir merkezinde farkl noktalara kurulu istasyonlaryla gnlk
hava kalitesi lmleri yapmaktadr. 2003 yl itibariyle (niversite Kampusu, Aziziye ..O,
12 Mart ..O, Devlet Demiryollar binas, Yakutiye Belediye binas ve Hfzsshha binasnda
kurulu olmak zere) 6 adet istasyonla hava kalitesi lmleri yaplmaktadr. lmler yakmann
gerekletii 1 Ekim-15 Nisan dneminde yaplmaktadr.
3. Bulgular ve Sonular
Doal gaz kullanmnn 2004 yl sonu itibari ile balad gz nne alnrsa Erzurumda Aralk
2004de llen SO
2
ve PM deerlerinin olduka yksek olduu grlr (SO
2
ve PM iin
srasyla 283 ve 215 g/m
3
). izelge 2deki SO
2
ve PM iin verilen snr deerler gz nne
alndnda 2004 yl Aralk aynda Erzurumda llen SO
2
ve PM deerleri 283 ve 215 g/m
3
ile Hava

Kalite Koruma Ynetmelii snr deerlerini amtr. PM deeri ise Dnya Salk
Tekilatnn KVSD deerini amtr.
Tablo 2. SO
2
ve PM iin Dnya Salk Tekilatna ve Hava Kalite Koruma
Ynetmeliine gre snr deerler
Standart Deerler SO
2
(g/m
3
) PM (g/m
3
)
Dnya Salk Tekilatna Gre
U.V.S.D.= 150
K.V.S. D.= 400
U.V.S.D.= 75
K.V.S. D.= 200
Hava Kalite Koruma Ynet. gre Standart Deerler 250 200
ekil 1de ise bu dnemdeki SO
2
ve PM deerlerindeki azalma gsterilmitir. Doal gaz
kullanmaya balayan abone says 2007 yl sonu itibari ile abone says 37.500 adet, gaz
kullancs says ise 34.500 adettir. Bu abonelerin %75 i snma amal doalgaz
kullanmaktadr. u anda ehirde %40 orannda dnm mevcuttur. Doal gaz kullanmaya
balayan abone saysnn 2005 yl ba itibari ile artmasyla beraber Erzurumda llen aylk
ortalama SO
2
ve PM deerlerinde kademeli olarak bir azalma grlmtr. 2005 yl Aralk
514 Z. Eren


aynda Erzurumda llen SO
2
ve PM deerleri 142 ve 103 g/m
3
olarak Hava Kalite Kontrol
Ynetmeliinde verilen snr deerlerin altna dmtr.

ekil 1. 2004-Ocak ve 2008-Ocak dneminde llen aylk SO
2
ve PM ortalamalar.
2006 yl Aralk aynda bu deerler daha da azalarak SO
2
ve PM 140 ve 70 g/m
3
olarak
kaydedilmitir. 2007 Aralk aynda SO
2
ve PM deerleri iyice gerileyerek 113 ve 40 g/m
3
ye

gerilemitir. 2008 Ocak ay ortalamalarna bakldnda ise SO
2
ve PM deerleri 106 ve 37
g/m
3
e dmtr. Doal gazn ilk kullanlmaya baland 2004 Aralk ayndan 2007 Aralk
ayna kadar olan dnemde SO
2
deerinde %60, PM deerinde %81 toplam azalma
kaydedilmitir.
Kaynaklar
Atatrk niversitesi evre Sorunlar Aratrma Merkezi yllk faaliyet raporlar.
Bayram, A. ve Mezzinolu, A. (1996). Byk kentler iin temiz hava plan, Yerleim ve evre Sorunlar:
anakkale ili; Dokuz Eyll niversitesi Mhendislik Fakltesi evre Mhendislii Blm.
Dasz, A. K. (2002). Doal Gaz ve LPG Devreleri, Cihazlar Hesab, Teknik Yayn No:3, T Makine Fakltesi,
3.Bask.
Kkyal, R. (2003) Doal Gaz-LPG Tesisat ve Bacalar, Issan almalar, No:345.
Kocadastan, M. E., Boncukcuolu, R., Keskinler, M. E., Turalolu, S., Kocadastan, E. (2002). Erzurum ehir
merkezinde kullanlan fosil yaktlar ile hava kirlilii arasndaki iliki, Erzurum.
Turalolu, F.S. ve Bayraktar, H. (2002). Erzurumda hava kalitesinin dn, bugn ve gelecei, 1. Ulusal evre
Sorunlar Sempozyumu, Erzurum.
0
50
100
150
200
250
300
O
c
a
.
0
4
N
i
s
.
0
4
T
e
m
.
0
4
E
k
i
.
0
4
O
c
a
.
0
5
N
i
s
.
0
5
T
e
m
.
0
5
E
k
i
.
0
5
O
c
a
.
0
6
N
i
s
.
0
6
T
e
m
.
0
6
E
k
i
.
0
6
O
c
a
.
0
7
N
i
s
.
0
7
T
e
m
.
0
7
E
k
i
.
0
7
O
c
a
.
0
8
K
i
r
l
e
t
i
c
i

k
o
n
s
a
n
t
r
a
s
y
o
n
u

(

g
/
m
3
)
SO2
PM



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Cep Telefonlar ve Baz stasyonlarnn nsan Sal ve evre
zerine Etkileri
Tuba Turan ve Meral Toksoy
1
Atatrk niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 25240, Erzurum
E-posta: tuba@atauni.edu.tr

z Baz istasyonlar, mobil telefonlar kullanclar ile iletiimi salayan dk gl radyo
frekans radyasyonu yayan radyo antenleridir. Baz istasyonlar belli bir alan veya hcre iinde
mobil telefon kullanclar ile iletiimi salar. Karakteristik olarak,20-30 cm genilikte ve 1 m
boyunda olan baz istasyonu antenleri, yerden 15-60 m ykseklie sahip kulelere, su depolarna
veya baz zel binalarn atlarna kurulur. Antenin yerden ykseklii nemlidir.
Elektromanyetik alanlarn insan sal zerinde oluturduu riskler, yeni teknolojilerin gnlk
yaamda giderek daha youn biimde kullanlmas sonucunda giderek artmaktadr. zellikle
son yllarda hzla artan cep telefonu kullanm ve buna paralel olarak giderek yaygnlaan baz
istasyonlar halk saln tehdit edecek boyuta ulamtr. Bu alanda yasal dzenlemelerin
olmamas, kurumsal eksiklikler ve bilinsizlik konunun nemini daha da arttrmaktadr. Cep
telefonlarnn kapsama alanlarn ve iletiim olanaklarn genileten baz istasyonlarnn ehrin
iinde yaam alanlarnda, hatta binalarn stlerine yerletirilmesi byk problemlere neden
olmaktadr. Bu istasyonlarn yayd mikrodalgalarn insan salna ynelik olumsuz etkileri
daha ok ortaya konulduka, bu cihazlarn insanlardan uzak yerlere konulmas talepleri
artmaktadr. Yaplan deneysel almalar sonucunda, elektromanyetik dalgalara maruz kalan
canllarda her trl olumsuz etki grlebilmektedir. Cep telefonlarnn tanmas, gereksiz ve
ar kullanlmas sadece kullananlar iin deil evresi iin de zellikle salk ynnden risk
yaratt belirtilmektedir. Bu yzden cep telefonlar ve baz istasyonlarnn bireysel olarak
llebilir dzeyde olmasa da toplum dzeyinde ok ciddi salk riskleri oluturabilecei,
nemli salk sorunlarnn uzun yllar sonra ortaya kabilecei gz nne alnmaldr. Bu
nedenle toplumun tayaca bu risk dzeyinin halk sal deerlendirmelerinde kural olarak
benimsenen nlem ilkesi temel alnarak en aza indirilmesi gerei ortaya kmaktadr.
Anahtar Kelimeler baz istasyonalar; elektromanyetik dalga; radyo frekans radyasyonu
1. Giri
Celullar baz istasyonlar srekli ve 800-900 mHz frekansa, PCS sistemleri de srekli ve 1800-
2000 mHz frekansa sahiptir. Celullar baz istasyonlarnda ounlukla direk veya ubuk gibi
grnen ynlendirilmemi antenler kullanlr. PCS baz istasyonlarnda ise dikdrtgen panelleri
halinde grlen ok sayda sektr antenleri kullanlr. Bir sektr anteninin genel olarak
genilii, 30 cm boyu ise 120 cm dir. Trkiyede elektrik frekans 60 Hzdir. 90 mHz e sahip
radyo frekansnn dalga boyu 33 cmdir.
Cep telefonlar dk gte alc-verici radyo cihazlardr. letiim iin 900-1800 Mhz aralnda
mikrodalga biiminde elektromanyetik dalga kullanrlar. Telefon akken srekli olarak
mikrodalga yaymaktadr. letiim halinde bu dalgalarn dozlar biraz daha ykselmekte ve
konuma asndan insan vcuduna zellikle de baa daha yakn tutulduu iin salk asndan
516 T. Turan, M. Toksoy


olumsuz etkileri daha artmaktadr. Bu srada ortaya kan 1 Wattlk s etkisiyle rnein beyin
iinin ss 0,1 derece ykselmektedir. Cep telefonlar konuma srasnda baa ok yakn bir
noktadan elektromanyetik nm yayan telefonlar ncelikle ba olmak zere vcut asndan
birok olumsuzluk yaratmaktadr. Hcre dzeyindeki deneysel almalarda hcrenin geliimi,
hcre duvar ve hcrenin madde alveriiyle ilgili bozulmalar ortaya konulmutur. Bunlar
arasnda kanser ynnden uyarc etki yapmas ve kanseri tetiklemesi ilk srada saylmaktadr.
Mikrodalga mann kesin bozulma yaratt noktalardan birisi de genlerdir. Kromozom
zerinde ortaya kan etkilerle hcrenin ana yap ta olan DNAnn gen yapsndaki krlmalar
ve deimelerin kansere yol at ortaya konulmutur. Baa yakn olmas nedeniyle beynin
etkilenmesi ok fazladr. Mikrodalga beyindekiler dahil sinir hcrelerinin uyarlmalarn
etkilemektedir. Bu yolla bata uyku bozukluklar, bellek sorunlar, ba ars, bulant, ba
dnmesi, sersemlik hali ve kan bascnn artmas beyin ve bu organmzla ilgili olumsuzluklar
ortaya kmakta, renme glkleri grlebilmektedir.
Cep telefonlar ve baz istasyonlarnn yayd elektromanyetik nlar salk asndan bir ok
olumsuzlua yol ayor. Cep telefonu ve bunlarn iletiiminde kullanlan baz istasyonlarnn
yayd mikrodalga biimindeki elektromanyetik mann insan dokusuna ynelik iki temel
etkisi olduu belirtilmektedir. Bunlardan birincisi s etkisidir. Mikrodalgalar iinde sv olan ve
duvarndan geebildii her tr maddeyi, bu arada da vcut dokularn stmaktadr. kinci tr
etkiyi ise hcrelerin iindeki kimyasal srelere yapt belirtilmektedir. Uzun sre dk
dozun, ksa sreli yksek doza gre bu kimyasal sreler bakmndan daha zararl olduu
kaydedilmitir. Uzun sreli etki hcrelerde byk molekllerin bozulmasna, hcre zarlarnn
birbirine yapmasna, sinirlerin zarlarnn bozulmas sonucu insanlarda rya grmenin azalmas
,bunama, Parkinson hastal, kas sertlemesi ve dejeneratif beyin hastalklar gibi hastalklarn
ortaya kmasna yol at gzlemlenmitir.
Vcudumuzdaki manyetik alanlar, doal evremizdeki yerkrenin manyetik alan ile uyum
ierisindedir. Baz istasyonlarnn evresinde elektromanyetik alan olumaktadr ve oluan bu
elektromanyetik alann insan vcudundaki ve doal evredeki elektromanyetik alandan fazla
olmas sebebiyle mevcut uyum bozulur. Bu da, elektromanyetik kirlilik ad verilen bir tr evre
kirliliine neden olur.
2. Kuramsal Temeller
evre Bakanl tarafndan karlan Genelge ile, evre kirlilii yaratan baz istasyonlar
hakknda somut yaptrmlar getirilmese de insan salna, insann salkl evrede yaama
hakkna nem veren bir yaklam getirilmitir. Genelgede, cep telefonlar baz istasyonlarnn
ierisinde yer ald 900 MHz ve 1800 MHz frekanslar iin Uluslararas yonlatrc Olmayan
Radyasyondan Koruma Komitesi (ICNIRP) tarafndan getirilen snr deerler 900 MHz iin
elektrik alan iddeti 42 V/m, 1800 MHz iin ise elektrik alan iddeti 59 V/m olarak
belirlenmitir. Burada nemli olan nokta evrede maruz kalnabilecek maksimum deerlerin
dikkate alnacak olmasdr.
Genelgede cep telefonu baz istasyonlarnn kamu binalar, okul, hastane, kre, kla ve park gibi
yap ve alanlarda kurulmamas gerektii belirtilerek ok nemli bir hususa deinilmitir.
Genelgenin yayn tarihinden itibaren kurulacak cep telefonu baz istasyonlarnn meskun mahal
dna kurulmas gerektii hususu belirtilerek toplum sal ne karlmtr.
Cep telefonu baz istasyonlar radyo frekans radyasyon (RFR) yayan bir tr mikro dalgadr.
Mikro dalgalar iin eik deerin ne olmas gerektii kesin olarak bilinmemekle birlikte bugn
iin benimsenen eik W/cm
2
dir. Ancak son epidemiolojik almalarn nda snrdeer 1
Cep Telefonlar ve Baz stasyonlarnn nsan Sal ve evre zerine Etkileri 517


W/cm
2
dzeyine ekilmesi nerilmektedir. Bugn dnyada pek ok lkede baz istasyonlar iin
kabul edilen deerler 900 MHz iin 0,5 mw/cm ve 2000 MHz (3.kuak) iin 1 mw/cmdir.
Bunun 100 kat kadar bir miktara (100 mw/cm) maruz kalnmasnn insan sal iin zararl
olduu kesindir.
lkemizde baz istasyonlar iin yaynlanan ynetmelikte kabul edilen snr deerler imdilik
Avrupa Birlii ile ayn olmakla birlikte, temel sorun ynetmelie uyulup uyulmadnn
denetlenmemesidir. Bugn Trkiyede hangi tip ve ka tane baz istasyonu olduu kamuoyu
tarafndan bilinmemektedir. Oysa gelimi lkelerde her baz istasyonunun yayd RFRu
gsteren haritalar izilmi ve kamuoyunun bilgisine sunulmutur.
3. Materyal ve Metod
Aratrmann ortaya kmasnda, kamu kurum ve kurulularnda yaplm almalar ve mevcut
olan rapor, alma ile istatistiki bilgilerden yararlanlmtr.
Baz istasyonlar konusunda, bir ok akademisyenin ve eitli meslek kurulularnn incelemeler
ve aratrmalar yapt ve bu konuda toplumu bilgilendirdii gzlemlenmektedir. Kamu
saln korumakla ykml yetkililerin de, elektromanyetik kirlilikle mcadele ynnden tm
kamuoyunun bilinlendirilmesi iin, bu konuda bilimsel almalar yapmas, bilimsel alma
yapan sivil toplum rgtlerini desteklemesi ve elde edilen sonular erevesinde yeni bir
mevzuat oluturmas gerekmektedir.
4. Sonu
Baz istasyonlarnn yaym olduu elektromanyetik nlarnn youn olmas durumunda
insan salnn ciddi boyutlarda zarar grecei konusunda bilimsel veriler ve belgeler vardr.
Elektromanyetik nlar sadece baz istasyonlarndan deil, radyo, televizyon, bilgisayar, enerji
hatlar ve anten gibi bir ok cihazdan evreye yaylmakta ve ortamda elektromanyetik kirlilik
yaratmaktadr. Baz istasyonlarnn, dier elektromanyetik enerji yayan cihazlara gre ok daha
fazla elektromanyetik enerji yayd bilimsel evrelerce bildirilmektedir. zellikle son
zamanlarda baz istasyonlar ehir iinde binalarn atlarna, bahelerine, hastanelere, i
merkezlerine, krelere gittike oalarak kurulmaktadr.
Bir ok bilim adam, baz istasyonlarnn ve cep telefonlarnn yaym olduu elektromanyetik
nlarn insanlar zerinde yarataca ciddi salk sorunlarnn yllar sonra ortaya kabilecei
konusunda hemfikirdir. Toplum sal risk altndadr. Bu durum toplum saln gzetmekle
ykml kamu kurumlarnca gz ard edilmemelidir.
Devlet ve ilgili kamu kurulular, baz istasyonlarnn zararl etkilerinden yurttalar korumak
iin baz istasyonlar konusunda gerekli dzenlemeleri yapmaldr. Bu konuda her trl nlemi
almal, baz istasyonlarnn iletimi srasnda gerekli denetlemeleri yapmal ve kurulu bulunan
baz istasyonlarnn says ve kurulu bulunduu yerler konusunda kamuoyunu aydnlatmaldr.
Elektromanyetik kirlilik konusunda gerekli nlemleri ieren, toplum salnn korunmas
konusuna nem ve ncelik veren bir yasal dzenlemenin ivedilikle yaplmas gerekmektedir.
Ynetmelikte baz istasyonlarnn kapatlma nedenleri arasnda "sala zarar verme" nedeni yer
almamaktadr. Baz istasyonlar hakknda yaplmas gereken dzenlemelerin toplum salna
ynelik olmas gerektii dnlrse, Ynetmelikte salkla ilgili bir hkmn yer almamas
artcdr.
518 T. Turan, M. Toksoy


Rastgele, dzensiz ve youn bir biimde kurulan baz istasyonlarnn zararl etkilerinin
giderilmesi ancak baz istasyonlarnn toplum sal l alnarak yaplan plan ve proje
erevesinde, dzenli ve snrl sayda kurulmasyla mmkndr.
Kaynaklar
Alsan,S., Cep Telefonlarnn Sala Zararlar.
Sevgi,L., Elektromanyetik Kirlilik, Cep Telefonlar ve Baz stasyonlar, EMO stanbul ubesi Blteni Ocak-Temmuz
2000 says.
Atalay,N., Biliim toplumuna Giderken Elektromanyetik Kirlilik Etkileri Sempozyumu Teblii.
IEGMP (Independent Expert Group on Mobile Phones) Raporu, Mobile Phones and Health,
http://www.iegmp.org.uk)
Akleman,F., Sevgi,L., FDTD Analysis of Human Head Mobile Phone Interaction in Terms of Specific Absorption
Rate (SAR) Calculations and Antenna Design, Proc. of IEEE-APS, Conference on Antennas & Propagation for
Wireless Comm., pp.85-88, Waltham, MA, USA 1998.



.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Bilecik Organize Sanayi Blgesinin ehir Hava Kalitesine
Etkisinin ncelenmesi
Gamze Gkmen Szak
1
ve Arslan Saral
2

1
Boazii niversitesi, evre BilimFleri Enstits, Bebek, 34342, stanbul.
E-posta: sozak@boun.edu.tr
2
Yldz Teknik niversitesi, evre Mhendislii Blm, Beikta, stanbul.

z Bilecik ilinde hava kalitesine etkisi olabilecek sanayi kirletici kaynaklar belirlenerek
emisyon envanteri oluturulmu ve bu kirleticilerin ehir hava kalitesine muhtemel etkileri
incelenmitir. Emisyon envanterinde yanma kaynakl btn temel kirleticiler (SO
2
, PM, NO
x
,
CO, HC) bulunmakla beraber, ehir hava kalitesiyle etkileimler yalnzca SO
2
ve PM
kirleticileri baznda incelenmitir. Zira ehirde sadece bu iki kirleticinin ortam havas gnlk
konsantrasyonlarnn srekli lm gerekletirilmektedir. Emisyon veritaban kullanlarak
dispersiyon modellemesi yaplm ve ehrin mevcut hava kalitesi lm verileri ile kyaslanarak
sanayi kaynakl emisyonlarn hava kalitesine etkisi aratrlmtr. Sanayi tesisleri ehrin
yaklak 2km kuzeyinde kurulu bulunan Bilecik Organize Sanayi Blgesinde (BOSB) toplanm
olup, birka tesis de BOSBnin dnda olarak toplam elli civarnda tesis faaliyet gstermektedir.
Uygun meteorolojik artlar olutuunda (kuzeyli rzgrlarn estii gnlerde) ve zellikle yaz
aylarnda sanayi kaynakl emisyonlarn ehir hava kalitesine zaman zaman olumsuz ynde etki
ettii ve llen SO
2
ve PM konsantrasyonlarnda art trendlerine sebep olduu tespit
edilmitir. Zira ehir hava kalitesini temelde karakterize eden snma kaynakl emisyonlar olup,
sadece k aylarnda baskn etki gstermektedirler. Dier taraftan sanayi kaynakl emisyonlar
tm yl boyunca devam etmektedir. Bunun sonucu olarak yaz aylarnda tamamen ortadan kalkan
snma kaynakl emisyonlarn yerini, hissedilir lde sanayi kaynakl emisyonlar
alabilmektedir.
Anahtar Kelimeler emisyon envanter; gauss dispersiyon model; PM; SO
2
1. Giri
Kirletici kaynak emisyonlarnn atmosferde oluturduu ortam konsantrasyonlar, atmosferdeki
kimyasal reaksiyonlardan, meteorolojik ve topografik koullara kadar eitli faktrlerden
etkilenir. Sz konusu bu emisyonlarn bir blgede sistematik olarak toplanmas ve
deerlendirilmesi emisyon envanteri almalar olarak bilinmektedir. Kirliliin nlenmesi veya
azaltlmas iin geree olabildiince yakn emisyon envanterleri ve modellemeler yaplmas
gerekmektedir (Kemerdere, 1996).
Bilecik iin hava kirleticileri envanteri ve modellemesi ile ilgili ilk defa yaplan bir alma
olmas ve emisyon envanterinin srekli gncelletirilmesi gerekliliinden dolay, bu alma
ileride bu blge iin yaplacak daha ayrntl almalara bir temel veri girdisi tekil
edebilecektir.


520 G. G. Szak, A. Saral


2. Materyal ve Metot
Bilecik ilinin hava kalitesi deerleri SO
2
ve PM baznda gnlk olarak llmektedir (Halk
Sal Laboratuvar, 2004-2005). ehir hava kalitesinin periyodik deiimi yaz ve k
mevsimleri baznda olumaktadr. Bu da ehir hava kalitesinin temelde kn snma maksatl
yakt tketimlerinden etkilendiini gstermektedir. ehirde snma maksatl olarak arlkla
kmr tketilmekte ve oluan hava kalitesi deerleri de bu durumu yanstmaktadr. Sanayi
kaynakl emisyon envanteri oluturulmasnda BOSBde faaliyette olan tesislerin emisyon
raporlarndan faydalanlmtr (B.. evre Bilimleri Enstits, 2004). BOSB iin SO
2
ve PM
baznda oluturulan emisyon deerleri, tesislerin faaliyet baznda snflandrmas ve 2004
ylnda kullandklar yaktlarn miktarlar Tablo 1 verilmektedir.
Tablo 1. Sanayi kaynakl yakt tketim miktarlar ve toplam emisyon deerleri
Sektr Yakt cinsi
Yakt tketimi,
ton/yl
Kirletici emisyonlar (mg/sn)
SO
2
PM
Madencilik
- (Elektrik
enerjisi)
0 0 63,3
Kimya
Kalorifer yakt
/ doalgaz
120 / 121,3 578,1 39,6
Endstriyel
rnler
Kalorifer yakt 25 0 0
Kereste
- (Elektrik
enerjisi)
0 0 22,2
Organik tarm
rnleri
Kalorifer yakt 700,8 2863,9 177,8
Saniteri
seramik
Doalgaz 3310,9 0 272,2
Teknik dkm
- (Elektrik
enerjisi)
0 0 47,2
Hammadde LPG / doalgaz 1182,6 / 262,8 0 258,3
Granit seramik Doalgaz 5753,6 0 456,9
Saniteri ve
turizm
LPG 504 0 16,7
Metal
Kalorifer yakt
/ odun
0,3 / 650 0 87,2
Kap kolu
retim
- (Elektrik
enerjisi)
0 0 1148,1
Alminyum Doalgaz 1490,8 0 55,6
Beton LPG 15 0 3,1
TOPLAM 3442 2648,2

Yaklak 50 sanayi tesisinin birka adedi darda olmak zere hepsi BOSB iinde kurulu
olduu iin tm sanayi kaynakl emisyonlar tek bir nokta kaynak olarak deerlendirilmitir.
BOSB ehrin tam kuzeyinde yer ald iin sanayi kaynakl emisyonlarn Bilecik zerindeki
etkisini deerlendirirken, konsantrasyon hesaplarnda ehir merkezini etkisi altna alan kuzey
ynl rzgarlarn (N, NNE, NNW) getirdii emisyonlar dikkate alnmtr. Rzgr hz ve
bulutluluk deerlerine gre rzgrn kuzeyden estii gnlerdeki meteorolojik veriler
incelenerek, Gauss dispersiyon denklemi iin gerekli meteorolojik veri taban oluturulmutur
(Devlet Meteoroloji leri Genel Mdrl, 2004-2005). Kaynaktan kan kirleticilerin
Bilecik Organize Sanayi Blgesinin ehir Hava Kalitesine Etkisinin ncelenmesi 521


dispersiyonu iin atmosferin kararll nemli bir parametredir. Meteorolojik veriler bu ynde
deerlendirildiinde Bilecikin atmosferik kararllnn kuzeyli rzgrlarn estii gnlerde
genelde A-B-C kategorilerinde olduu tespit edilmi ve dispersiyon katsaylar olan o
y
ve o
z

deerleri hesaplanmtr. Her sanayi tesisinin emisyon raporundan, tesis bacalarnn fiziksel
ykseklikleri, baca kesit alan, baca gaz dearj hz, gaz scakl verileri alnm ve bu veriler
ile kuzey rzgarl her bir gn iin baca yksekliindeki rzgar hz (u), hzme ykseklii (h)
ve etkin baca ykseklii (H) deerleri hesaplanmtr. Her bir bacann arlkl emisyon yk
dikkate alnarak tm BOSB iin tek bir ortalama ykseklik hesaplanmtr. Bylelikle kuzey
rzgrl her bir gn iin Gauss dispersiyon denkleminin tm girdi parametreleri hesaplanmtr.
3. Sonular ve Deerlendirmeler
Kirleticilerin ehir merkezine tanm-dispersiyonu ve BOSB ile ehir merkezinin corafi
konumu ve kuzey ynl rzgrlarn estii gnler dikkate alndnda BOSB kirliliinin ehir
hava kalitesine etkisi, mevsimsel bazda yaz ve k aylar olarak ve tanm baznda da sadece
kuzeyli rzgrlarn etkili olduu gnler baznda modelleme yaplarak incelenmitir.

ekil 1. Kuzey ynl rzgrlarn estii k gnlerinde ortamdaki SO2
konsantrasyonlar ile Gauss model ile hesaplanan sanayi kaynakl SO2
konsantrasyonlarnn kyaslanmas

ekil 2. Kuzey ynl rzgrlarn estii k gnlerinde ortamdaki PM konsantrasyonlar
ile Gauss model ile hesaplanan sanayi kaynakl PM konsantrasyonlarnn kyaslanmas

0
50
100
3
0
.
0
9
.
0
4
1
5
.
1
0
.
0
4
3
0
.
1
0
.
0
4
1
4
.
1
1
.
0
4
2
9
.
1
1
.
0
4
1
4
.
1
2
.
0
4
2
9
.
1
2
.
0
4
1
3
.
0
1
.
0
5
2
8
.
0
1
.
0
5
1
2
.
0
2
.
0
5
2
7
.
0
2
.
0
5
1
4
.
0
3
.
0
5
2
9
.
0
3
.
0
5
g
e
r

e
k

S
O
2
0
5
10
15
g
a
u
s
s

S
O
2
ortamda SO2
gauss SO2
0
20
40
60
3
0
.
0
9
.
0
4
1
5
.
1
0
.
0
4
3
0
.
1
0
.
0
4
1
4
.
1
1
.
0
4
2
9
.
1
1
.
0
4
1
4
.
1
2
.
0
4
2
9
.
1
2
.
0
4
1
3
.
0
1
.
0
5
2
8
.
0
1
.
0
5
1
2
.
0
2
.
0
5
2
7
.
0
2
.
0
5
1
4
.
0
3
.
0
5
2
9
.
0
3
.
0
5
g
e
r

e
k

P
M
0
2
4
6
g
a
u
s
s

P
M
ortamda PM
gauss PM
522 G. G. Szak, A. Saral



ekil 3. Kuzey ynl rzgarlarn estii yaz gnlerinde ortamdaki SO2
konsantrasyonlar ile Gauss model ile hesaplanan sanayi kaynakl SO2
konsantrasyonlarnn kyaslanmas

ekil 4. Kuzey ynl rzgrlarn estii yaz gnlerinde ortamdaki PM konsantrasyonlar
ile Gauss model ile hesaplanan sanayi kaynakl PM konsantrasyonlarnn kyaslanmas
Yaplan dispersiyon modellerinin sonular ekil 14 aras gsterilen grafiklerde verilmitir.
Tm grafiklere genel bir yaklamla bakldnda, model sonular ehir hava kalitesi
deerlerinin altnda kalmaktadr. Grld zere yaz aylarnda sanayi kaynakl emisyonlarn
toplam kirlilik zerine etkisi, evsel snma olmamas nedeniyle k aylarndakinden daha
yksektir. Ortam ve model konsantrasyonlarn temsil eden iki izginin paralel olmas
beklenirken baz noktalarda sapmalar gzlenmektedir. Bunun nedeni ktlesel debilerin
bulunmas srasnda yaplan lmlerin, o tesisin karakterini btnyle temsil edememesi ve
lmlerin srekli alnamamasdr. Ayn zamanda meteorolojik veriler de gn ierisinde srekli
alnamadndan o gnn karakterini yanstamamaktadr.
Rzgr ynleri incelendiinde tm yl boyunca N ynl rzgrlarn estii gnlerde; ortamdaki
SO
2
konsantrasyonu gnlk deeri 41,9 g/m
3
, model ile hesaplanan sanayi kaynakl SO
2

konsantrasyonu gnlk deeri 4,5 g/m
3
tr ve Bilecikin toplam SO
2
emisyonuna katks
%10,8dir. Ortamdaki PM konsantrasyonu gnlk deeri 18,7 g/m
3
, model ile hesaplanan
sanayi kaynakl PM konsantrasyonu gnlk deeri 2 g/m
3
tr ve Bilecikin toplam PM
emisyonuna katks %10,7dir. NNE ve NNW ynl rzgrlarn estii gnlerde; ortamdaki SO
2

konsantrasyonu gnlk deeri 38,2 g/m
3
, model ile hesaplanan sanayi kaynakl SO
2

konsantrasyonu gnlk deeri 0,4 g/m
3
tr ve Bilecikin toplam SO
2
emisyonuna katks
%1,1dir. Ortamdaki PM konsantrasyonu gnlk deeri 17,5 g/m
3
, model ile hesaplanan
sanayi kaynakl PM konsantrasyonu gnlk deeri 0,2 g/m
3
tr ve Bilecikin toplam PM
emisyonuna katks %1,1dir.
Sonu olarak, BOSBnin ehir hava kalitesine etkisi nem arz edecek seviyede
grlmemektedir ve doalgaz kullanmna geme almalar tamamlandnda BOSBden
kaynaklanan SO
2
ve PM kirliliinin ihmal edilebilecek seviyelerde kalaca aikrdr.
0
20
40
60
80
2
9
.
0
3
.
0
4
1
3
.
0
4
.
0
4
2
8
.
0
4
.
0
4
1
3
.
0
5
.
0
4
2
8
.
0
5
.
0
4
1
2
.
0
6
.
0
4
2
7
.
0
6
.
0
4
1
2
.
0
7
.
0
4
2
7
.
0
7
.
0
4
1
1
.
0
8
.
0
4
2
6
.
0
8
.
0
4
1
0
.
0
9
.
0
4
2
5
.
0
9
.
0
4
g
e
r

e
k

S
O
2
0
5
10
15
g
a
u
s
s

S
O
2
ortamda SO2
gauss SO2
0
20
40
60
2
9
.
0
3
.
0
4
1
3
.
0
4
.
0
4
2
8
.
0
4
.
0
4
1
3
.
0
5
.
0
4
2
8
.
0
5
.
0
4
1
2
.
0
6
.
0
4
2
7
.
0
6
.
0
4
1
2
.
0
7
.
0
4
2
7
.
0
7
.
0
4
1
1
.
0
8
.
0
4
2
6
.
0
8
.
0
4
1
0
.
0
9
.
0
4
2
5
.
0
9
.
0
4
g
e
r

e
k

P
M
0
2
4
6
g
a
u
s
s

P
M
ortamda PM
gauss PM
Bilecik Organize Sanayi Blgesinin ehir Hava Kalitesine Etkisinin ncelenmesi 523


Kaynaklar
Bilecik Halk Sal Laboratuar. (2004-2005). SO2 ve PM Verileri.
Boazii niversitesi evre Bilimleri Enstits. (2004). BOSB Emisyon Raporlar.
Devlet Meteoroloji leri Genel Mdrl. (2004-2005). Bilecik meteorolojik verileri.
Kemerdere, N., (1996). Gebze lesinde Emisyon Envanteri ve Hava Kalitesi Modellemesi Raporu, Enerji Sistemleri
ve evre Aratrma Enstits, Marmara Aratrma Merkezi, Tbitak, Gebze-Kocaeli






.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Erzurum Kenti Hava Kirlilii Haritalarnn Oluturulmas
Sevda Ocak
1
, Ferruh Ertrk
2
1
Atatrk . evre Sorunlar Aratrma Merkezi Md. Erzurum.
E-posta: sevdaocak@atauni.edu.tr
2
Yldz Teknik . naat Fak. evre Mh. Bl. Beikta stanbul.

z Bu almada, Erzurum kent merkezinde 2001-2002 ve 2006-2007 k sezonu dikkate
alnarak, snma amal yakt tketiminden kaynaklanan hava kirlilii dalmnn belirlenmesi
ve kirlilik haritalarnn oluturulmas amalanmtr. Kent merkezinde SO
2
konsantrasyonlar
ATDL (Atmospheric Turbulence Diffusion Laboratory) modelinin kompleks versiyonu
kullanlarak hesaplanmtr. Model tahminleri lm deerleri karlatrlmtr. Model
performans IA ve r istatistiksel snamalarna gre yaplmtr. IA 0.53-0.62 ve 0.60-0.63 olarak
hesaplanmtr. Model performans iki istasyon iin iyi olarak hesaplanmtr. ki k sezonu iin
lm ve model ile bulunan deerler ve Kriging Uzaysal Enterpolasyon Yntemi kullanlarak
hava kirlilii haritalar oluturulmutur. 2006-2007 k sezonunda doal gaz kullanm ile Hava
Kalitesi Korunmas Ynetmeliinde SO
2
iin belirlenen hedef deere (120g/m
3
) ulalmtr.
Anahtar Kelimeler hava kirlilii modellemesi; model performans; kirlilik haritala; kriging
1. Giri
Hava kirlilii, Trkiyede birok kentsel alanda endstrileme ve hzl kentlemenin sonucu
olarak grlen byk evre problemlerindendir. zellikle snma ihtiyacnn yksek olduu k
aylarnda birok kent havasnda, hava kalitesi standart deerleri almaktadr. Yakt ierisinde
bulunan safszlklarla, hava (oksijen) verili oran ve ekline, yanma scaklnn gereinden az
veya ok oluuna bal olarak tam olmayan yanma nedeniyle oluan partikl, gaz ve buharlar
hava kirleticilerdir. Artan hava kirletici seviyelerinin azaltlmas halk ve evre sal asndan
nemlidir. Havadaki kkrt oksitler ierisinde en nemli miktar kkrt dioksit oluturmaktadr.
Kkrt dioksit emisyonlar ounlukla kkrt ierikli yaktlarn yaklmasndan ve baz
madenlerin eritilmesinden kaynaklanmaktadr. Atmosferde olduka hzl bir oksitlenmeyle
kkrt trioksit ve hemen ardndan slfatlara dnr ve kelme yoluyla uzaklarlar (Boubel
v.d.,1994).
Yakt tketimi ve buna bal olarak hava kalitesindeki deiimler, emisyon envanterlerinin
hazrlanmas ve hava kalitesi model almalar belirlenmektedir. Farkl hava kalitesi modelleri
farkl leklerde ve farkl kirleticiler iin uygulanmtr (Karppinen v.d., 2000; Sivacoumar v.d.,
2001; Trs v.d., 1997). ATDL hava kalitesi modeli de gemite ve gnmzde farkl almalar
iin kullanlmtr (Hanna, 1971; Hanna ve Gifford ,1973; Ertrk, 1986; Gargava, 2001). Hava
kirliliini nleyici almalarda, ncelikle blgenin mevcut kirlilik haritasnn karlmas
gerekmektedir. Bu harita yardmyla kirliliin youn olduu blgeler sk bir denetime tabii
tutulabilir, gerekiyorsa yeni dzenlemelere gidilebilir ve kirlilik miktarlar nceden tahmin
edilebilir. nceleme alannn muhtelif yerlerinde yaplan lmlerden elde edilen veriler
kullanlarak, eitli tahmin yntemleri yardmyla kirlilik haritalar karlr. zellikle son
526 S. Ocak, F. Ertrk


yllarda eitli kirlilik haritalarnn karlmasnda jeoistatistiksel hesaplama yntemi geni bir
uygulama alan bulmutur (Elevli B v.d,1996; Tayan M, 200; Payan F ve Ertrk F 2002).
2. Materyal ve Metod
Bu almann amac 2001-2002 ve 2006-2007 k sezonunda snma maksadyla tketilen
yaktn hava kalitesine etkileri incelenmitir. Bu amala konut taban alan genilii ve konut
snma tipine gre yakt tketimi miktar belirlenerek emisyon envanteri hazrlanmtr. Hava
kalitesi iki k sezonu iin ATDL (Atmospheric Turbulence Diffusion Laboratory) model
kullanlaraktahmin edilmitir. Model sonular lm sonular ile karlatrlmtr. 2001-2002
ve 2006-2007 k sezonlar model tahminleri ve hava kalitesi lmleri kullanlarak kirlilik
haritalar oluturulmutur.
2.1. Hava Kalitesi lmleri
Erzurum 40
o
15` ve 42
o
35` boylamlarnda, 40
o
57` ve 39
o
10` enlemlerinde Trkiyenin
dousunda bulunan etraf dou, kuzey ve gneyden dalarla evrili bir kenttir. Kent merkezinde
toporafik yap, kentin nfus younluu ve trafik dalmna gre belirlenen farkl noktalarda
hava kalitesi lmleri, Atatrk . evre Sorunlar Aratrma merkezi tarafndan yaplmtr.
SO
2
lmleri WHO tarafndan kabul edilen asidimetrik titrasyon metoduna gre yaplmtr
(Elbir, 2003). lm istasyonlar ekil1a. da gsterilmitir.
2.2. Emisyon Envanteri ve Hava Kalitesi Model Uygulamas
Kent merkezinde (4.35*7.25km) yakt tketimi 1.45km grid alanlar iin konut taban alan
genilii ve konut snma tipine bal olarak belirlenmitir. Bu almada SO
2
emisyon
kuvvetleri, USEPA-AP42 emisyon faktrleri kullanlarak (EPA,1998) hesaplanmtr (Ocak ve
Ertrk, 2007b).
Hanna (1971) ve Gifford ve Hanna (1973) tarafndan gelitirilen ATDL modeli hem gauss
huzme snf (Arya,1999; Gargava, 2001) hemde kutu model snfnda (Juda-Rezler,1989)
deerlendirilmektedir. Koordinat sistemi merkezinde olduu dnlen alc grid iin ortalama
yzeysel konsantrasyon aadaki gibi hesaplanr:
( ) ( ) ( ) ( ) ( ) | |
)
`

+ +

A
=

=

n
i
n
j
b b
b
r r j i f j i Q Q
b a u
x
C
1 1
1 1
1 2 / 1
1 2 1 2 , , 0 , 0
) 1 (
) 2 / ( ) / 2 ( t
(1)
C=kirleticinin yer konsantrasyonu(g/m
3
), X A =grid uzunluu(m), n=alma alannn rzgar
st snr ile merkez grid arasndaki grid says, Q(0,0)= merkez griddeki emisyon
iddeti(g/m
2
sn), u=rzgar hz(m/sn), r = (i,j). grid ile merkez grid arasndaki grid saysdr, a
ve b atmosferik stabiliteye bal sabitler.
2.3. lm ve Model Deerlerinin statiksel Analizi
Dispersiyon modellerinin deerlendirilmesinde IA ve r yaygn olarak kullanlan
parametrelerdendir (Karppinen v.d., 2000; Sivacoumar v.d., 2001). IA ve r nin 1 yakn olmas
model baarsn gstermektedir. Maksimum, minimum ve standart sapma ile birlikte yukarda
geen parametrelere ilikin deerler Tablo 1. de verilmitir. Tablo 1. incelendiinde IA 0.53-
0.62 ve r 0.60-0.63 arasnda deitii grlmektedir. ATDL model performans Y.Yoncalk ve
Aziziye iin iyi seviyede, Atatrk istasyonu iin orta seviyede bulunmutur. IA ve NMSE
parametrelerine gre yaplan istatiksel snamada, ATDL model performans iyi seviyede
bulunmutur (Ocak ve Ertrk, 2007a).
Erzurum Kenti Hava Kirlilii Haritalarnn Oluturulmas 527


Tablo 1. 2001-2002 k sezonu SO
2
kirleticisi iin model tahmini ve lm
deerlerinin istatistiksel analizi
statistiksel parametreler Aziziye istasyonu Ataturk istasyonu Y.Yoncalk istasyonu
lm Tahmin lm Tahmin lm Tahmin
Ortalama (gm
-3
) 166 286 85 204 241 382
Maksimum(gm
-3
) 419 1569 252 1112 623 1942
Stand. Sapma(gm
-3
) 87 219 58 168 132 292
lm says 144 144 144
ndeks uyumu (IA) 0.60 0.53 0.62
Korelasyon katsays (r) 0.63 0.62 0.60
Farkl model almalar iin model performans deerleri Tablo 2.de verilmitir.
Tablo 2. eitli model performans almalar
statiksel parametreler Erbil,
2003
Karppinen,
2000
Mehdizadeh,
2004
Sivacoumar,
2001
Bu alma
ndeks uyumu (IA) 0.50-0.77 (-0.75)-0.79 0.68 0.53-0.62
Korelasyon katsays (r) 0.28-0.62 0.50-0.65 0.86 0.71 0.60-0.63
Tablo 2. incelendiinde bu almaya ait IA ve r sonular, dier almalara yakn
deerlerdedir. ATDL modelin dier modeller kadar iyi sonular retmesi nedeniyle hava kalitesi
almalarnda kullanlmas tavsiye edilmektedir.
2.4. Kirlilik Haritalar
Kirlilik haritalarnn kartlmas iin, alma blgesine ait koordinat deerleri, corafi
koordinat 0 seilen referans bir noktaya gre hesaplanmtr. Kirletici konsantrasyonlar ve
hesaplanan koordinat deerleri kullanlarak Kriging Uzaysal Enterpolasyon yntemi ile
kirlilik haritalar kartlmtr. Metodun ayrntl aklamas Cressie (1991) ve Wackernagel H
(2003) tarafndan verilmitir. ekil 1. b-e de 2001-2002 ve 2006-2007 k sezonlar model
tahminleri ve lm sonularna gre Spyglass Transform (3.02PPC) program kullanlarak elde
edilen kirlilik haritalar verilmitir.
3. Sonular ve Yorum
K sezonlarn temsil eden ekil1b-e hava kirlilii haritalar incelendiinde Y.Yoncalk ve
Aziziye de kirliliin younlat grlmektedir. Y.Yoncalk blgesinde konutlamann youn
olmas, Aziziyenin toporafik yaps kirleticilerin birikmesine neden olmaktadr. 2001-2002 k
sezonu iin Y.Yoncalk model tahmini ve lm deerleri srasyla 486 g/m
3
ve 242 g/m
3

olarak belirlenmitir. 2006-2007 k sezonu iin ise 222 g/m
3
ve 110 g/m
3
dr. 2005-2006
itibar ile Y.Yoncalk blgesinde konutlarn %32 si, Aziziye blgesinde konutlarn %46 s,
niversite blgesinde konutlarn %100 doalgaz kullanmtr (l evre ve Orman Md.,
2007). Doal gaz kullanm ile Y.Yoncalk blgesinde hava kalitesinde %54, Aziziyede %30
ve niversitede %53 orannda iyileme kaydedilmitir. Toporafik olarak ehrin ukur blgesi
olan Aziziye blgesinde hava kalitesinde dier blgelere nazaran daha az bir iyileme
grlmektedir. Atatrk . Kampus alannn iinde bulunduu blge dier blgelere gre
nazaran daha iyidir. Bunun birincil sebebi tmyle doal gaz kullanmna gemi olmas ve
konut younluunun dier blgelere gre az olmasdr. Hava kalitesi korunmas ynetmeliinde
SO
2
iin k sezonu ortalamas snr deeri 250g/m
3
, k sezonu ortalamas hedef deeri 120
g/m
3
olarak belirlenmitir (T.C. evre ve Orman Bakanl, 1986). 2006-2007 k sezonu
528 S. Ocak, F. Ertrk


itibar ile lm istasyonlarnn olduu alanlarda SO
2
deerleri hedeflenen 120 g/m
3
deerinin
altnda kalmtr. 2001-2002 k sezonu dikkate alndnda ise k sezonu ortalama snr deeri
(250 g/m
3
) almamtr. Hava kalitesinde daha fazla iyileme salamak iin doal gaz
kullanmnn alt yapnn uygun olaca tm blgelere yaylmas veya daha nitelikli yakt
kullanmnn tevik edilmesi (Ocak ve Ertrk, 2007b) gerekmektedir. Ayrca kaloriferler eitim
grm kiiler tarafndan yaklmal, binalarda s izolasyonu salanmaldr.


(a) (b) (c)

(d) (e)
ekil 1. (a) Erzurum kenti lm istasyonlar, (b) 2001-2002 model tahminleri ile elde
edilen hava kirlilii haritas, (c) 2001-2002 lm deerleri ile elde edilen hava kirlilii
haritas, (d) 2006-2007 model tahminleri ile elde edilen hava kirlilii haritas, (e) 2006-
2007 lm lm deerleri ile elde edilen hava kirlilii haritas. Model ve lm
deerleri g/m
3
birimindedir.
Kaynaklar
Arya, S.P. (1999). Air Pollution Meteorology and Dispersion, North Carolina State Univ., Oxford Univercity Pres.,
NewYork
Boubel, R.W., Fox, D.L., Turner, D.B. and Stern, A.C. (2006). Fundamentals of Air Pollution. USA
Cressie NAC. (1991). Statistics for Spatial Data. John Willey and Sons Pub. New York.
Erzurum Kenti Hava Kirlilii Haritalarnn Oluturulmas 529


Elbir, T. (2003). Comparison of model predictions with the data of an urban air quality monitoring network in Izmir,
Turkey. Atmospheric Environment 37, 2149-2157.
Elevli, B., Demirhan, S., Cokuner, G. (2000). Sivas Kent Merkezi Haftalk SO
2
Kirlilik Haritasnn karlmasnda
Jeoistatistiksel Yntemin Kullanm. Tr. J. of Engineering and Environmental Sciences, 20, 87-92.
EPA. (1998). Compilation of Air Pollutant Emission Factors: AP-42, Fifth Edition, Volume I: Stationary Point and
Area Sources, Chapter 1: External Combustion Sources.
http://www.epa.gov/ttn/chief/ap42/ch01/index.html
Ertrk, F., (1986). Investigation of strategies for the control of air pollution in the Golden Horn, Istanbul, using a
simple dispersion model. Environmental Pollution (Series B) 11, 161-168.
Gargava, P. (2001). Application of the model for air pollution predictions due to domestic sources-a case study,
Proceedings of the Second International Symposium on Air Quality Management at Urban, Regional and Global
Scales, 644-371, September 25-28, 2001, Istanbul,Trkiye.
Gifford, F.A, Hanna, S.R. (1973). Modeling urban air pollution. Atmospheric Environment 7, 131-136.
Hanna, S.R. (1971). A Simple Method of Calculating Dispersion From Urban Area Sources. JAPCA, 21, 771-777.
Juda-Rezler, K., 1989. Encylopedia of Environmental Controlling Technology. Air Pollution Modeling. Gulf
Publishing Company, Houston.
Karppinen, A., Kukkonen, J., Elolhde, T., Konttinen, M. and Koskentalo, T. (2000). A Modelling system for
predicting urban air pollution:comparison of model predictions with the data of an urban measurement network in
Helsinki. Atmospheric Environment 34, 3735-3743.
Mehdizadeh, F., Rifai, H.S. (2004). Modeling point source plumes at high altitudes using a modified Gaussian model.
Atmospheric Environment 38, 821-831.
Ocak, S., Ertrk, F. (2007a). ATDL hava kalitesi modeli ve deerlendirilmesi. VII.Ulusal Ekoloji ve evre Kongresi,
Malatya.
Ocak, S., Ertrk, F. (2007b). Erzurum ili hava kalitesinin atdl model ile incelenmesi ve deiik senaryolarn
deerlendirilmesi. TMMOB evre Mh. Odas 7.Ulusal evre Mh. Kongresi, zmir.
Payan, F ve Ertrk, F. (2002). SO
2
ve NOx Kirleticilerinin 1995-1996 K Sezonunda Bursa in Hava Kirlilii
Haritalarnn Oluturulmas. Ekoloji evre Dergisi, 11(45), 14-17.
Sivacoumer, R., Bhanarkar, A.D., Goyal, S.K.,Gadkari, S.K. and Aggarwal, A.L. (2001). Air pollution modeling for
an ndustrial complex and model performance evaluation. Environmental Pollution, 111, 471-477.
Tayan M. (2000). An assessment of spatial and temporal variation of sulfur dioxide levels over stanbul, Turkey.
Environmental Polllution, 107, 61-69.
T.C. evre ve Orman Bakanl, (1986). Hava Kalitesi Koruma Ynetmelii, Resmi Gazete 19269, Ankara.
T.C. evre ve Orman Bakanl, (2007). l evre ve Orman Md. Hava Kalitesi Ynetimi ub., Aratrma Raporu,
Erzurum.
Tiris, M., Dilmac, S., Tiris, C. and Ekinci, E. (1997). Modelling of SO
2
pollution changes with improving thermal
performance of building in Gebze, Turkey. Energy 22, 477-480.
Wackernagel H. (2003). Multivariate Geostatistics an Introduction with Applications, Heidelberg, Springer,.






.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Temiz retimde Kmr Biyoteknolojisi
Zeynep Seda Taylan ve Hlya Bke zko
Ondokuz Mays niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, Kurupelit,
55139, Samsun.
E-posta: staylan@omu.edu.tr

z Nfus art, hzl sanayileme ve teknolojik gelimenin dnya enerji talebini hzla arttrmas
sonucunda, kmr ve petrol gibi yaktlarn kullanm gnmze kadar nemini korumutur.
Petrol ve doal gaz rezervlerinin dnyann belli bal yerlerinde ve kmre gre snrl olmas,
zaman zaman dnya ekonomisinde politik pazarlklara ve dolaysyla krizlere neden olmu, bu
da hakl olarak dnya milletlerinin daha gvenilir enerji kaynaklarna veya kendi z
kaynaklarna ynelmelerine neden olmutur. Trkiye'nin giderek artan elektrik enerjisi talebi
dikkate alndnda enerji kaynaklarnn makro ekonomik seviyede optimum ekilde
kullanlmas gerektii aktr. Ayrca birincil enerji kaynaklarnn (kmr, doalgaz, petrol vb.)
yerli veya ithal kaynaklar olmas ekonomik dengeleri deitirecek niteliktedir. Enerjinin
ekonomik adan stratejik neme sahip olmas nedeniyle, mmkn olduu lde, yerli
kaynaklara ynelmek zorunluluu vardr. Bu erevede lkemizde de enerji taleplerini nemli
lde karlayabilecek olan kmr, en yaygn doal kaynak olarak ekonomik biimde
iletilebilmelidir. Elektrik enerjisi temininde en nemli 3 kaynak doal gaz, petrol ve kmr
asndan durum deerlendirildiinde en bol, her corafyada bulunan ve en ucuz enerji kayna
olarak kmr grlmektedir. Doal gaz ve petroln tersine kmrn retilen miktar,
tketileninden fazladr. Dolays ile enerji temininde da baml olmaktan ise; kendi z
kaynaklarmza ynelmemiz daha doru olabilir. Kmr dnyada en yal ekilde bulunan,
temiz retim teknolojileri kullanld taktirde ekolojik dngy en az etkileyen, gvenilir ayn
zamanda dk maliyetlerle elde edilebilen fosil yakttr.Kmrn avantajlar dnldnde,
dier enerji kaynaklarna kyasla tercih edilebilir. Ancak fosil yakt olmas, yapsnda bol
miktarda karbon, kkrt ve azot oksitler, bulunduu kayacn yapsna bal olarak klor, civa vb.
gibi kirleticileri iermesi kmrn temiz teknolojisinin gerekliliini ortaya koymaktadr.
Anahtar Kelimeler kmr; kmr biyoteknolojisi; kmr svlatrma; temiz retim
1. Giri
Fosil yaktlar, yksek oranda karbon iermektedirler. Bu sebeple evrede zararl birikimler
yapabilmektedirler. Yanma sonucunda karbon dioksit, karbon monoksit, kkrt dioksit, azot
oksitler, uucu organik bileikler, radyoaktif maddeler ile tanesel maddeler aa kmaktadr
(Ersz, 2006; zder ve Yrkolu, 2003). Yanma sonras oluan gazlar ve zellikle de CO
2
sera
gaz etkisine yol aarak kresel snmaya sebep olmaktadr. Son yzylda kresel scaklk art
ortalama olarak 0.6 C art gstermitir. Gerekli nlemler alnmazsa yeni yzyln sonunda
scaklk 5 C daha art gsterebilecektir. Son 125 ylda 1 trilyon varil petrol ve kresel orman
varl tketilmitir. Orman varl 1850-1980 yllar arasnda % 15 orannda azalmtr. Uzun
yllardr kutuplardaki buzul alanlarnn erimesi ok byk evre felaketlerine yol amaktadr.
Okyanuslarn sl ierii ve global deniz suyu seviyeleri ykselmitir. CO
2
ve dier sera etkisi
yaratan gaz emisyonlarndan dolay dnya atmosferi kalnlam, bylece dnya ortalama
scakl artmtr. Fosil yaktlarn evreye verdii olumsuz etkiler dnldnde evreye daha
uyumlu teknolojiler kullanarak NO
x
, SO
x
, CO
2
ve partikler madde emisyonlarn azaltarak;
532 Z. S. Taylan, H. B. zko


basnl kmr gazlatrma, basnl akkan yatak ve pulverize (toz kmr) yaktl basnl
yakma teknolojileri zerinde younlaarak, daha bol, daha temiz ve daha az maliyetli enerji
retimi salamak hedeflenmelidir (http://www.tki.gov.tr; http://www.iea-
coal.org.uk/site/ieacoal/home; http://www.kazancioglukomur.com ).
2. Temiz retimde Kmr Uygulamalar
Emisyonlar azaltc, daha bol, temiz ve dk maliyetli, evreye duyarl ynde yaplan
uygulamalar genel olarak 4 ana grupta toplanabilir.
Kmr Gazifikasyonu (Gazlatrma),
Akkan Yatakta Yakma Teknolojileri,
Biyoktlede Gazlatrma,
Biyolojik Yntemlerle Kmr Svlatrma Teknikleri.
lk yntem termokimyasal uygulamalar iermektedir. Termokimyasal uygulamalar yksek
scaklk ve basnta kmr sv ve gaz rnlere dntrmesine ramen; baarmas zor ve
pahal uygulamalardr. Drdnc yntem olan Biyolojik Yntemlerle Kmr Svlatrma Tek-
nikleri ilk ynteme alternatif olarak 1960-1970li yllarda ortaya konmutur. Bu sebeple;
almada biyolojik yntemlerle kmr svlatrma teknikleri zerinde durulmutur (Taylan,
2007).
2.1. Biyolojik Yntemlerle Kmr Svlatrma Teknikleri
Biyolojik yntem ile kmr svlatrma tekniinde ortam scakl ve basncnda kmr
svlatrmak iin mikroorganizmalar kullanlmaktadr. zellikle dk rankl (dereceli) ve
lignine benzer kmrn (linyit gibi) paralanmas, odunun (odun kmrne yakn)
paralanmasna benzediinden mikrobiyolojik paralanmada mantarlar ve bakteriler
kullanlmaktadr. Kmrn biyolojik svlatrlmas prosesi normal ortam scaklnda ve
basncnda meydana gelebildiinden artan neme, ilgiye sahip bir konudur (Hofrichter ve
Fakoussa, 2001). zellikle kmrn biyodnm mekanizmalar, organizmalarn (ounlukla
mantar-bakteri) rettii farkl enzimler ile kmrn organizmalar tarafndan substrat olarak
znrl ve depolimerizasyonunu etkileyerek kmr daha akkan bir hale getirmektedir
(ekil 1) (Hofrichter ve Fakoussa, 2001, Wainwright, 1992).




ekil 1. Flamentli Mikrofungus(mantar) ile Kmrn Svlamas (Damla ap 3 mm)
(Hofrichter ve Fakoussa, 2001, Wainwright, 1992)
2.2. Kmrn Biyo-Dnm Mekanizmalar
Kmrn Biyo-Dnm Mekanizmalar temelde znrlk ve depolimerizasyon olmak
zere iki ana ilkeye dayanr (ekil 2). Ancak kmrn fiziksel ve kimyasal yapsndaki
komplekslilik kmrn d yzeyine biyolojik hareketlilii snrlayan kmr materyaline
mikrobiyal eriimi/giriini daha zor hale getirmektedir (Hofrichter ve Fakoussa, 2001).
Temiz retimde Kmr Biyoteknolojisi 533











ekil 2. Kmrn Biyo-Dnm Mekanizmalar (Hofrichter ve Fakoussa, 2001)
znrlk; temelde enzimatik olmayan znme prosesidir. Yksek pHda (7-10) organizma
tarafndan alkali metabolitler retilir. Alkali maddeler ve/veya elatlayc ajanlarn oluumu
sebebiyle ortam bazikleir. Ayn zamanda belli baz hidrolitik enzimler znrlk prosesinin
oluumunu tetikler ve hzlandrr.
Depolimerizasyon; enzimatik proseslerdir. Organizmalar tarafndan baz makromolekller
(humik asitvs) retilir. Ortam pHs 3-6 aralndadr. Kmr ierisindeki balar yarlr.
Salglanan fulvik asit, humik asit ..v.b gibi maddeler kmrn polimer yapsn zer (ekil 3).
Fakoussa 1991de ABC sistemi olarak adlandrd sonra da ABCDE sistemi olarak kmrn
biyodnmn aklayan mekanizmalar sralamtr. Bu mekanizmaya gre organizmalarn
salglad enzimler ve dier salglar ekil 3deki gibi molekl zincirlerinde kopmalar salar
(Fakoussa ve Hofrichter, 1999).






ekil 3. Kmr Biyo-Dnm Mekanizmas (Hofrichter ve Fakoussa, 2001)
Organizma faaliyetini etkili klabilmek iin kmre baz n ilemler (nceden partikl boyutuna
paralama, havalandrma, oksitleyici maddeler ile ykama, ortama besin- organizma-enzim
ilavesivs) uygulamak gerekmektedir. Bu durum da kmrn biyoteknolojisinde baz
zorluklar gndeme getirmektedir (Fakoussa ve Hofrichter, 1999).
2.3. Kmrn Biyoteknolojisindeki Zorluklar
Kmr, esas olarak karbon, hidrojen, oksijen ve daha az miktarda kkrt ve azot ieren fiziksel
ve kimyasal adan heterojen organik bir kayadr. Su ortamnda znmez ve normal artlar
dnda pek ok organik zcde znmez. Porozitesinin az olmas, mikroorganizmalarn
A: Alkali Maddeler pH> 8
(deprotonlama)
B: Biyokataliz (oksitleyici enzimler),
C: elatlar,
D: Yzey Aktif Maddeler (surfaktanlar,
biotensitler),
E: Estereazlar

534 Z. S. Taylan, H. B. zko


girmesi asndan engel oluturur. D yzeyi biyolojik atak iin uygun deildir. Ayrca iinde
bulunduu kayacn yapsna bal olarak kil, kuarz minerali, slfr bileiklerivs. inorganik
safszlklar vardr. Mikroorganizmalara toksik olabilen iz elementleri de ierebilir (Fakoussa ve
Hofrichter, 1999).
2.4. Organizmalarn Salglad Enzimlerin Etkisi
Organizmalar tarafndan salglanan enzimler ve de yzey aktif maddeler kmrn hidrofobik
zelliini hidrofilike evirir, yani suda znme zelliini dolays ile organizmalarca
kullanmn da arttrr. Ortama ok etkili surfaktanlar (yzey aktif maddeler) salglanr. Bylece
yzey gerilimi 25.5 mN/m
2
ye der (suyun yzeydeki gerilimi 72.6 mN/m
2
). Yzey aktif
maddeler, kmrn hidrofobik yzeyine yapr, porlar tkar, kapatr, kaplar. Yksek oranda
uucu organik madde ieren kmrler bakteriler tarafndan daha kolay ataa urarlar. Kmr
partikllerinin renk, organizmalar tarafndan slatlabilirlik ve ekstrakte edilebilirlik
zelliklerine gre svlaabilirlikleri de deikenlik gstermektedir (Fakoussa ve Hofrichter,
1999).
3. Kmr Svlatrmann evresel Adan Faydal Ynleri
Kmrn yapsnda bulunan CO, CO
2
, SO
X
, NO
X
, ve dier hidrokarbonlu yaplar kmrn
svlatrlmas esnasnda organizmalar tarafndan besin maddesi olarak kullanlmakta ve
biyoktleye katlmaktadr. Dolays ile svlaan kmrdeki zararl emisyonlarn miktar
azaltlabilmektedir (Skodras ve Someus, 2003; Taylan, 2007). Temiz Kmr Teknolojisi ile
ilgili yaplan almalar sonucunda elde edilen sonular ve varsaymlar Clean Coal
Technology, Current Progress, Future Promise raporunda aadaki gibi verilmitir.
1. Elektrik ihtiyac nmzdeki 25 yl ierisinde % 53.4 orannda artacaktr.
2. Her biri 300 megawatt g salayan 1200 yeni g tesisinden daha fazlasna ihtiya
duyulacaktr.
3. Kmr, elektrik enerjisi retiminde en byk ve tek kaynak olacaktr. 2025 ylnda
g retiminin % 51i kmre dayal olacaktr.
4. Temiz kmr teknolojileri bu ihtiyalar karlayacak ve ayn zamanda SO
2
ve NO
X
emisyonlarn azaltmaya devam edecektir (Clean Coal Technology, 2005).
Raporun sonular incelendiinde endstriyel faaliyetler sonucunda gelecekteki 25 yl ierisinde
kmr kullanm ve atmosfere verebilecei emisyonlarn artaca, dolaysyla, temiz kmr
teknolojisinin kullanm gerekliliinin nem kazanaca grlmektedir (ekil 4)



ekil 4. Gelecekte Temiz Kmr Uygulamalar Sonucunda Oluabilecek Emisyonlar
(Clean Coal Technology, 2005)

A: Elektrik retiminden Kaynaklanan SO
2
Emisyonu (Ib/MWh)
B: Elektrik retiminden Kaynaklanan
NO
X
Emisyonu (Ib/MWh)
A B
Temiz retimde Kmr Biyoteknolojisi 535


4. Sonu
Dnyada, gerek evre kirlilii kayglar ve gerekse enerji kaynaklarnn giderek azalmaya yz
tutmas ve fiyatlarnn artmas nedeniyle enerji teknolojileri alannda hissedilebilir bir deiim
ve geliim sreci yaanmaktadr. Sfr emisyon asndan durum deerlendirildiinde aklmza
ilk olarak yenilenebilir enerji kaynaklar gelmektedir. Yenilenebilir enerjinin snrsz ancak
kullanmnn belli nedenlerden dolay snrl olmas sebebiyle ksa ve orta vadede zm
salanamamaktadr. Trkiye enerji retiminde hem enerji kayna olarak ve hem de kullanlan
enerji teknolojileri asndan byk lde da bamldr. Kmr hem lkemiz ve hem de
dnya leinde son derece homojen dalmtr. Kmrn 250-450 yl yetecek bir rezerve
sahip olduu da dnlrse enerji eldesinde vazgeilmez bir kaynak olma zelliini
srdrecei aktr. Bu sebeplere dayanarak; lkenin srdrlebilir kalknmas ve enerji
gvenlii asndan ulusal enerji kaynaklarnn temiz ve verimli bir ekilde kullanm, da
bamlln azaltlmas, enerji retiminde evre dostu temiz teknolojilerin gelitirilmesi, iklim
deiikliini de kapsayan evresel kayglarn, CO
2
emisyonlarnn bertaraf edilmesi gibi
zmlerle giderilmesi, yaklak sfr emisyon ile enerji retimi ve tama amal dk
maliyetli hidrojen ve sv yakt retimi ve enerji teknolojilerindeki (yenilenebilir enerji, temiz
yakma ve gazlatrma ile H
2
eldesi, biyolojik yntemlerle kmr svlatrma, yakt pili, merkezi
ve ayrklatrlm g santralleri v.b.) bu deiimin lkemiz asndan byk bir frsat olduu
deerlendirilmelidir. Bu frsat iyi deerlendirilip teknolojik deiime ayak uydurulabildii
takdirde, lkemiz iin byk bir katma deer salanacaktr.
Kaynaklar
Clean Coal Technology, 2005, Current Progress, Future Promise; National Minning Association 101 Constitution
Avenue, NW Suite 500 East Washington DC 20001 202/463-2600. (http://www.nma.org)
Ersz A., (2006). klim Deiiklii kapsamnda Enerji Aratrmalar, Tbitak MAM Enerji Enstits, klim
Deiiklii iin Paydalar Bulumas, 27-28 Nisan, Richmond Hotel, stanbul. (http://www.ipcc.ch)
Fakoussa R.M, Hofrichter M., (1999). Biotechnology and Microbiology of Coal Degradation, Appl Microbiol
Biotechnol. 52, 25-40.
Hofrichter M., Fakoussa R.M., (2001). Microbial Degredation and Modification of Coal, Biopolymers, Volume 1.,
Lignin, Humic Substances and Coal. 393-407. (www.wiley-vch.de/books/biopoly/pdf/v01_kap14.pdf).
http://www.iea-coal.org.uk/site/ieacoal/home
http://www.kazancioglukomur.com
http://www.tki.gov.tr
zder A., Yrkolu M, (2003). Genel Enerji Politikalar erisinde Kmrn Yeri, Babakanlk Yksek
Denetleme Kurulu, 24-27 Eyll, TK Genel Mdrl
Skodras G. ve Someus E., (2003). Clean Solid Fuels Production by Low Temperature Carbonisation for Sustainable
Energy Generation, submitted to Technica Chronika, Scientific Journal of the Grek Technical Chamber,
Organisations fort he Promotion of Energy Technologies, OPET Network.34. Skodras G., ve Someus E., British
Petroleum 2003, Statistical Review of World Energy, (http://www.bp.com/centres/energy)
Taylan Z.S., (2007). Temiz retimde Kmr Biyoteknolojisi, Ondokuz Mays niv., Fen Bilimleri Enstits, evre
Mh. Anabilim Dal, Doktora Semineri, Samsun.
Wainwright M., (1992). An Introduction to Fungal Biotechnology, Department of Molecular Biotechnology and
Biotechnology University of Sheffield, UK., WILEY BIOTECHNOLOGY SERIES, Chapter 5, WILEY
Publishers.





.T.. 11. Endstriyel Kirlenme Kontrol Sempozyumu
11-13 Haziran 2008



Hava Kirliliinin Erzurum li Tarihi Eserleri zerine Etkileri
Seil Saol, Zleyha Bingl ve Nuhi Demirciolu
Atatrk niversitesi, Mhendislik Fakltesi, evre Mhendislii Blm, 25090, Erzurum.
E-posta: secil@atauni.edu.tr, zbingul@atauni.edu.tr

z Bu almada Erzurumdaki Kale Mescidi, Yakutiye Medresesi, ifte Minare, Aziziye ve
Mecidiye Tabyalar, Kmbetler, Narmanl Camii, Ahmediye Medresesi, Gml Kmbet
eserlerindeki bozunmu talarda nitrat, nitrit ve slfat tayini yaplmtr. Ta rneklerinin
analizinde eitli yntemler arasndan spektrofotometrik metot kullanlmtr. Analizlerde ta
rnekleri HCl zeltisinde bekletilerek sonular okunmutur. Erzurum iline ait hava kirlilii ve
tarihi binalardaki ta bozunmalar arasndaki ilikisiyi incelemek amacyla yrtlen almada,
tarihi binalarn yzeyinden ve i ksmlardan 1-1,5 cm alnan rneklerde nitrat, nitrit ve jips
belirlemeleri yaplm ve ta bozunmasndaki etkileri tartlmtr. Elde edilen sonularda nitrat
konsantrasyonunun nitrit konsantrasyonundan daha yksek olduu bulunmutur. Yzeyden
alnan rneklerde en fazla nitrat deerleri (3.1; %3,05, 3.2; %3,86, 3.3; %3,97), nitrit deeri
(3.1; %2,48) ve azot deerleri (3.1; %0,69, 3.2; 0,872, 3.3; %0,897) il merkezinde trafiin
youn olduu blgede Yakutiye Medresesine aittir. Yine yzeyden alnan rneklerde en fazla
jips miktar deeri (1.1; %69,55) ile ehirde plansz yerlemenin olduu Kale Mescidine aittir.
alma sonucunda nitratn, nitritin, jipsin ve dier parametrelerin ta yaplar zerindeki etkisi
yaplan deneylerle ortaya konulmu ve ta yzeyinde tespit edilen nitrat, nitrat, jipsin varln
hava kirlilii ile ilikili olduunu grlmtr.
Anahtar Kelimeler hava kirlilii; jips; meteorolojik faktrler; nitrat; nitrit; ta bozunmas
1. Giri
Hava kirlilii herhangi bir atmosferik ortamda, havann doal olarak ierdii madde miktarnn
eitli nedenlerle artarak evredeki canl ve cansz varlklara zarar verecek dzeye ulamas
olarak tanmlanabilir. Sklkla karlatmz hava kirleticileri genel bir sralamayla sayarsak;
askda partikl maddeler (tozlar ve aerosoller), kkrtoksitler (SO
X
), organik maddeler,
azotoksitler (NO
X
), yanmam hidrokarbonlar (CH), karbonmonoksit (CO), halojenler,
radyoaktif maddelerdir.
Jeomorfolojik adan Erzurum, zellikle gney, dou ve kuzeyden dalarla evrilmi bir havza
zerinde kurulmutur. Bu zellik ve hava scaklnn dk olmas k aylarnda ehir zerinde
kalc bir inversiyon olumasna neden olmaktadr (Ouz vd 2001). K aylarnda hava
kirliliinin byk boyutlara ulat Erzurum kent merkezi, snma ve trafik kkenli hava
kirletici parametreler asndan ele alnabilir (pekolu vd 1996). ehirleme gerei nfusun
belli kesimlerde younlamas sonucu snma, ulam, ve benzeri ilerde fosil yaktlarn
kullanlmasyla birlikte kent merkezlerinde nemli hava kirlilii sorunu ortaya kmaktadr.
Ta bozunmas, normalde hava etkisi ile meydana gelen deiikliklere direnli iken, atmosferik
kirleticilerin varl, bozunmay nemli derecede hzlandrmaktadr. Yap malzemeleri
yzeyinde oluan bozunmann incelenmesi orijinal malzemede az miktarda veya hi
bulunmayan maddelerin byk miktarlarn bu kabukta bulunduunu gstermitir. Havadaki
kkrtdioksit etkisine bal olarak ta bozunmas ve siyah kabuk oluumu; atmosferik artlar,
538 S.Saol, Z. Bingl, N. Demirciolu


ta yzeyinin porozitesi ve przll gibi faktrlerle deimektedir. Ta bozunmasnda
agresif maddelerin az miktarlarnn bile bozunmay hzlandrd gzlenmitir (Unesco 1988).
Atmosferik kkrt bileenleri, kalkerli talar zerinde grlen bozunma ileminde esas
etkenlerdir. Gaz halindeki kkrt dioksit, bulut ve su damlacklar iinde znr, bunu
oksidasyon ilemi izler ve SO
2
, H
2
SO
4
e dnr. Bu asit damlacklar tan yzeyine
geldiinde kalsiyum karbonat jipse dntrr. (Winkler 1975; Serra and Starace 1978;
Annond and Hudson 1981). Yani, kalsiyum karbonatl talar SO
2
ile reaksiyona girdiklerinde
nce kalsiyum slfit meydana gelir daha sonra jips oluur.
NO
x
gazlarnn atmosferde varl tat eksozu ve sabit yakma tesislerinden kaynaklanr. Bu
gazlar, HNO
3
oluumuna neden olurlar. Byle kuvvetli bir asidin atmosferde varl ta
malzeme iin zararl bir etki olarak dikkate alnmaldr. Yksek nem artlar ve azot dioksitin
varl durumunda, kalkerli ta yzeylerde jips oluumunda, azot dioksitin katalitik etkisi
bellidir (Johannson vd. 1988; pekolu vd,1996; Ouz vd 2001).
2. Materyal ve Yntem
almada kullanlan rnekler, Kale Mescidi, Yakutiye Medresesi, ifte Minare, Aziziye ve
Mecidiye Tabyalar, Kmbetler, Narmanl Camii, Ahmediye Medresesi, Gml Kmbet
eserlerinin kuzey cephelerinden CaCO
3
l talarn bozunmu ve bozunmam yzeylerinden
toplanmtr. K mevsiminde hakim rzgar yn kuzey dou olduundan numuneler bu ynden
alnmtr. Yine en az esen yn kuzey yn olduu iin numuneler kuzeyden de alnmtr.
Bozunmu talardan iki seri rnek alnmtr. Bunlar toz veya rahatlkla kaldrlabilir yzey
tabakalarndan, yzeyden 1 cm ieriden alnmtr.
Nitrat, nitrit ve slfat analizleri iin Shimadzu UV 160 A model spektrofotometre kullanlmtr.
Analizlerde kullanlan kimyasal maddeler analitik kalitededir. rnekler analizden nce 24 saat
35
o
Cde kurutulmu, yaklak 28 saat 10 mL suda ekstrakte edilmitir.
3. Aratrma Bulgular ve Tartma
Yzeyden, alnan rneklerde yaplan spektrofotometrik analiz sonular Tablo 1de verilmitir.
Yzeyden alnan rnekler tabloda incelendiinde en fazla nitrat, nitrit, azot deerleri 3.rnek
(3.3; %3,97, 3.1; %2,48, azot; 3.3; %0,897) ile Yakutiye Medresesine aittir. En fazla jips ise
(1.1; %69,55) Kale Mescidine aittir. Yakutiye Medresesinde azot oranlarnn en fazla
kmasnn nedeni blgedeki youn trafikten ve dolaysyla egzoz dumanndan
kaynaklanmaktadr. Minumum deerler ise nitrat, nitrit, azot ve jips deerleri iin (5.2; %0,035,
%0,026, 0,008, %0,782) Aziziye Tabyalar kuzeydou cephesidir.
1cm ieriden alnan rnekler incelendiinde en fazla nitrat iin (3.3; %0,9) Yakutiye Medresesi,
nitrit iin (2.1; %0,42 ve 3.1; %0,416) Yakutiye ve Ahmediye Medresesi kuzey cephe, azot iin
(3.3; %1,3) Yakutiye Medresesi kuzey cephesine aittir. En fazla jips de (3.1; %35,46) Yakutiye
Medresesine aittir. Yakutiye Medresesinde azot oranlar ve jips deerleri yzeyden 1 cm
ierden alnan rneklerde de fazla kmtr. Minumum deerler ise nitrat, nitrit, azot ve jips
deerleri iin (5, 6 ve 7) Aziziye Tabyalar, Mecidiye Tabyalar ve Gml Kmbettir. Bu
blgeler, ehrin en az youn olduu blgelerdir.



Hava Kirliliinin Erzurum li Tarihi Eserleri zerine Etkileri 539


Tablo 1. Yzeyden, yzeyden 1 cm ieriden alnan bozunmu rneklerin analiz
sonular
Numunelerin alnd ta yaplar
Yzeydeki deerler (%) 1 cm ierideki deerler (%)
Nitrat Nitrit Azot Jips Nitrat Nitrit Azot Jips
Kale Mescidi kuzey cephe 0,92 0,324 0,208 69,55 0,16 0,065 0,036 22,26
Kale Mescidi kuzey cephe sa yan
pencere evresi
2,21 0,54 0,5 41,36 0,36 0,104 0,081 16,54
Kale Mescidi kuzey cephe kap evresi 0,913 1,512 0,207 65,66 0,2 0,003 0,045 22,57
Kale Mescidi kuzeydou cephe 0,368 0,13 0,0832 27,82 0,064 0,026 0,014 8,904
Ahmediye Medresesi kuzey cephe 0,17 1,4 0,039 23,11 0,4 0,42 0,09 12,38
Ahmediye Med. kuzey cephe kap ev. 0,69 1,3 0,156 24,08 0,171 0,312 0,04 11,34
Ahmediye Medresesi kuzeydou cephe 0,068 0,56 0,016 9,244 0,16 0,17 0,036 4,95
Yakutiye Medresesi portal, kuzey cephe 3,05 2,48 0,69 57,24 0,59 0,416 0,133 35,46
Yakutiye Medresesi portal, kuzey cephe,
kartaln kanat ksm
3,86 1,08 0,872 47,52 0,83 0,21 0,188 26,104
Yakutiye Medresesi portal, kuzey cephe
kartaln ba ksm
3,97 1,3 0,897 54,54 0,9 0,21 1,3 29,952
Yakutiye Med. portal, kuzeydou cephe 1,72 0,992 0,28 22,9 0,24 0,17 0,054 14,18
ifte Minareler kuzey cephe 2,324 2,13 0,525 52,06 0,54 0,39 0,05 30,78
ifte Minareler kuzeydou cephe 0,98 0,85 0,21 20,82 0,22 0,16 0,005 12,31
Aziziye Tabyalar kuzey cephe 0,0875 0,065 0,02 1,955 0,02 z 0,002 1,16
Aziziye Tabyalar kuzeydou cephe 0,035 0,026 0,008 0,782 0,008 z 0,05 0,5
Mecidiye Tabyalar kuzey cephe 0,103 0,07 0,023 1,99 0,023 z 0,004 1,2
Mecidiye Tabyalar kuzeydou cephe 0,0412 0,028 0,092 0,8 0,009 z 0,002 0,48
Gm Trbe kuzey cephe 0,107 0,07 0,024 2,08 0,026 z 0,005 1,3
Gm Trbe kuzeydou cephe 0,0428 0,028 0,0096 0,832 0,01 z 0,002 0,52
Narmanl Camii kuzey cephe 0,826 0,346 0,187 43,28 0,125 0,053 0,028 21,14
Narmanl Camii sa yan 0,165 0,227 0,037 33,26 0,265 0,053 0,06 15,74
Narmanl Camii sol yan 0,855 0,891 0,193 60,08 0,17 0,343 0,038 17,88
Narmanl Camii kuzeydou cephe 0,3304 0,14 0,077 24,03 0,07 0,02 0,016 8,5
Birinci Kmbet kuzey cephe 1,918 0,718 0,433 38,61 0,44 0,22 0,1 23,45
Birinci Kmbet kuzeydou cephe 0,7672 0,29 0,17 15,44 0,18 0,1 0,063 9,38
kinci Kmbet kuzey cephe 1,321 0,839 0,299 35,921 0,65 0,177 0,146 20,35
kinci Kmbet kuzeydou cephe 0,5284 0,336 0,12 14,06 0,26 0,071 0,06 8,14
nc Kmbet kuzey cephe 1,431 0,938 0,3234 38,156 0,74 0,156 0,167 23,05
nc Kmbet kuzeydou cephe 0,1724 0,38 0,13 15,26 0,3 0,06 0,07 9,22
540 S.Saol, Z. Bingl, N. Demirciolu


4. Sonu ve neriler
Bozunmam rneklerde nitrat, nitrit ve jips tespit edilememitir. Bu durum belirlenen nitrat,
nitrit ve bunlara bal olarak toplam azot ve jips deerlerinin hava kirliliinden
kaynaklandnda iaret ettii kanaati oluturmaktadr. Ayrca tan yapsnda azot
bulunmadndan belirlenen toplam azot miktar da hava kirliliine balanabilir.
Erzurumdaki kirlilik konsantrasyonlar ile ilikili olarak deerlendirilmesi, ta yzeyinde tespit
edilen nitrat, nitrat, jipsin varln hava kirlilii ile ilikili olduunu gstermektedir.
almada analizi yaplan ta rneklerinin nitrat konsantrasyonlar, nitrit konsantrasyonlarndan
daha yksek olduu bulunmutur. Ayrca kuzey ynnden alnan numuneler, kuzey dou
ynndeki numunelerden daha byktr. Yine, bulunan konsantrasyonlar gemi yllardan
fazladr. Bu sorun artan trafik, yaktta tamamen doalgaza geilememesi ve bilinsiz kmr
tketimi ile ilikilendirilebilir.
Erzurum arpk yaplama, plansz yerleim alanlar ile birlikte ayn zamanda hava kirliliini de
beraberinde getirmektedir. Tecrit ve s yaltm, yaklan yaktn kalitesi, kazanlarn kalitesi ve
modeli gibi konularda yaplan yanllklar da hava kirliliinin boyutunu artrmaktadr. Erzurum
ehir merkezi hava kalitesinin iyiletirilmesinde, kullanlan fosil yakt kontrolnn yannda,
ehrin toporafik ve meteorolojik koullarnn da ehirlemede dikkate alnmas nem arz
etmektedir. Doalgazn kullanmyla, hava kirlilii yani baca gazndaki SO
2
miktar byk
oranda azalacaktr. Mevcut kamu ve zel binalarn asgari %80 kadarnn acilen doalgaza
dntrlmesi gerekmektedir. Aksi durumda Erzurum ilindeki tarihi eserlerdeki bozunma
devam edecektir.
Kaynaklar
Annond, W.J.D., Hudson, A.M., (1981). Meteorological effects on smoke and sulphur dioxide concentration in the
Manchester Area. Atmosferic Environment. 15, 779806.
pekolu, B., Demirciolu, N., Dan, ., (1996). Erzurumda tarihi yaplardaki ta bozunmas zerine azot oksitlerin
etkisi. Tr. J. of Engineering and Environmental Sciences 20, 211216.
Johansson, C.G., Lindquist, O., Mangio, R.E., (1988). Durability of building materials. 5, 439.
Ouz, E., Ocak, S., Malko, E., Yldrm, Y., Demirciolu, N., (2001). Erzurumdaki kmbetler ve Narmanl
camiindeki bozunmu talarda nitrat, nitrit ve jips oluumunun incelenmesi. Mersin niversitesi Ulusal sanayi-
evre sempozyumu ve sergisi, 25-27 Nisan 2001, Mersin.
zbay, O., Dan ., pekolu, B., Keskinler, B., Acar, F., (1993). Erzurumdaki ant eserler zerine hava kirliliinin
etkisi. Trk Devletleri arasnda 2.ilmi ibirlii konferans, evre 93 tebliler, 26-29 Haziran 1993 Almati,
Kazakistan.
Serra, M., Starace, G., (1978). Study of the reactions between gaseous sulphur dioxide and calcium carbonate.
Deterioration and protection of Stone monuments, International Symposium, 3, 7. June 59 1978, Paris.
UNESCO (1988). The deterioration and conservation of Stone, notes from the International venetian courses on
Stone restoration, CO/88/WS. 8.
Winkler, E.M. (1976). Weathering rates of Stone in urban atmospheres. The conservation of Stone, ed., Rossi
Manaresi, cenro per la conservazione dele scuiture all Aperto, Bologna, June 19-21, 1975, 27-36.

541


YAZAR NDEKS



A. Aksoy, 27
A. Akyol, 433
A. Merve Kocaba, 35
A. Suna Erses, 347
Afar lgen, 391
Ahmet Samsunlu, 1
Ali Fuat Aydn, 337
Ali nyayar, 373
Alper Nuholu, 439, 491
Anja Drews, 205, 213
Arslan Saral, 249, 265, 519
Asude Hanedar, 59
Aykan Karademir, 257
Ayla Bilgin, 409
Aysun zkan, 43
Aye Kuleyin, 467
Ayegl Aksoy, 19, 503
Ayegl Latifolu, 463
B. Kasapgil nce, 383, 391
Baak elik, 233
Beril Byker, 19, 27
Betl Hande Grsoy, 157
Burcu Vardar, 133
Blent Keskinler, 165
Bnyamin Karagzolu, 117, 125, 427
Cevat Yaman, 9
idem Yangn Gme, 59, 187
Delya Sponza, 195, 355
Deniz . ifi, 241
Derin Orhon, 67, 305, 313
Didem Okutman Ta, 67
Dilek Gm, 99
Duygu C. ztrk, 67
E. Burcu zkaraova Gngr, 507
Ebru Dlekgrgen, 305, 313
Edip Avar, 273
Egemen Aydn, 67
Elif B. Gensoy, 241
Elif Erhan, 165
Elif Pehlivanolu-Manta, 67
Emine Malko, 75
Emine Ubay okgr, 67
Emrah A. Erkurt, 373
Eras Eraslan, 463
Erdem Grgn, 67
Erdem Kocadastan, 495
Erdoan Ik, 51
Ergn Yldz, 439, 491
Erkin Gzdereliler, 391
Ertan Durmuolu, 257
F. Sezer Tutalolu, 281
F. Yeim Ekinci, 399
Fazilet Malik, 413
Fehiman iner, 451
Ferdi Gerel, 479
Ferruh Ertrk, 265, 525
542


Feryal Akbal, 459
Filiz B. Dilek, 19, 27, 35
Fuat zyonar, 117, 125, 427
Gamze Gkmen Szak, 519
Gamze Gngr Demirci, 503
Gke Didar Halolu, 151
Gke Treli, 287
Gl nsel, 67
Gler Trkolu, 133
Gnay Kocasoy, 107
Hakan Ayyldz, 413
Hakan elebi, 355
Halil Hasar, 221
Halil Kumbur, 373
Halime Sulak, 241
Handan Ucun, 439, 491
Hande Ykseler, 35, 179
Hanefi Bayraktar, 281
Hanife Bykgngr, 455
Hasan Kseolu, 205, 213
Hlya Bke zko, 531
Hlya Erten, 249
Ik Kabdal, 133, 141
Il Akmehmet Balcolu, 91, 297
. Ayhan engil, 473
dil Arslan-Alaton, 133, 141, 157, 287, 305, 313
smail Koyuncu, 337
smail Torz, 273
zzet ztrk, 187, 241, 337
Jean Jaques Godon, 399
Kadir Alp, 59, 273
Kahraman nl, 19, 27, 233
Keziban Seven Yalap, 91
Levent Alta, 421
Levent Ylmaz, 323
Leyla imek, 391
Lindsey Miller, 329
Ltfi Aka, 9, 59, 499
M. Bayramolu, 433
M. Evren Erahin, 187
M. Kemal Korucu, 257
M. Kolukrk, 383
Mahmut Altnba, 241
Matthias Kraume, 205, 213
Mehmet Ali Kker, 417
Mehmet Kitis, 205, 213
Mehtap Yaan, 459
Melek zkan, 227
Melih iler, 337
Meltem Gvener, 19, 27
Meltem nl, 179
Meral Evci Yurtsever, 473
Meral Toksoy, 515
Merih tker Uslu, 297
Merve Oya Orkun, 467
Mesut Akgn, 99
Mevlt Bilge, 187
Mohamed Dahab, 329
Mustafa Ik, 421, 485
Mustafa Turan, 413
Mfide Banar, 43
N. Altnay Perendeci, 399
Naci St, 241
Nermin iek, 9
Nevzat . Yiit, 205, 213
Nimet Uzal, 323
543


Nilgn z, 391
Nuhi Demirciolu, 83, 537
Nurgl Bac, 495
Nusret Karakaya, 173
Ouzhan Gk, 195
Oktay zkan, 413, 499
Olcay Tnay, 133, 141
Onur . St, 99
Orhan nce, 383, 391
Osman Arkan, 241
zgl Gerel, 479
zgr zdemir, 413, 499
Pnar Karagz, 227
R. Kaan Dereli, 187
Recep leri, 365
Ruhi Malko, 117
S. Semih Salam, 485
S.Yasin zdemir, 485
Seil Saol, 83, 537
Seda Aslan, 257
Sedat Kadolu, 9
Selami Demir, 249, 265
Selva Camc, 459
Senem stn Kurnaz, 455
Serdar Doruel, 305
Serkan Girgin, 19, 27
Sevda Ocak, 525
Sevtap Bilgn, 337
Sinan Yatkn, 173
. elikkol, 383
ahset rdemez, 151
ener Polat, 19, 27
eyda Korkut, 165
kr Aslan, 329
Tuba Ik, 241
Tuba Turan, 515
Tuba lmez, 67, 141, 305, 313
Turgut T. Onay, 347, 417
Tlin Arslan, 141
lk Yeti, 19, 27, 35, 179, 323
Vedat Uyak, 273
Vera Iversen, 205, 213
Veysel Aslan, 9
Vicdan ahin, 107
Yakup Gltekin, 499
Yakup Karaaslan, 9
Yakup Kurma, 421
Yaln Gne, 173
Yaln evki Yldz, 151
Yasemin Damar, 365
Yasemin ahin, 133
Yaar Nuholu, 75
Z. eteciolu, 383
Zerrin okaygil, 43
Zeynep Eren, 443, 511
Zeynep Seda Taylan, 531
Zleyha Bingl, 83, 151, 537