ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆ʹ ΤΑΞΗΣ
ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ
ΠΑΡΑΣΚΕΥΗ 1 ΙΟΥΝΙΟΥ 2001
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:
ΒΙΟΛΟΓΙΑ
ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ : ΤΕΣΣΕΡΙΣ (4)

ΘΕΜΑ 1ο
Α. Να γράψετε στο τετράδιό σας τις σωστές απαντήσεις για
τις τρεις ερωτήσεις που ακολουθούν:
1. Ποια είναι (ονοµαστικά) τα 4 είδη RNA;
2. Η παρουσία του Ο 2 βοηθάει την
µικροοργανισµών σε µια καλλιέργεια;

ανάπτυξη

3. Οι ιοί περιέχουν γενετικό υλικό; Τι είδους µπορεί
να είναι αυτό;
Μονάδες 15
Β. Να γράψετε στο τετράδιό σας τα γράµµατα της
στήλης Ι και δίπλα σε κάθε γράµµα τον αριθµό
της στήλης ΙΙ που συσχετίζει σωστά τους όρους.
α.
β.
γ.
δ.

Ι
ζυµοµύκητες
πλασµίδιο
κωδικόνιο
νουκλεόσωµα

1.
2.
3.
4.
5.
6.

ΙΙ
βακτήριο
εσώνιο
ιστόνες
τριπλέτα
µικροέγχυση
ζύµωση
Μονάδες 10

ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ

ΘΕΜΑ 2ο
Α. Καθεµιά από τις τρεις προτάσεις που ακολουθούν
είναι είτε σωστή είτε λανθασµένη. Να µεταφέρετε
και τις τρεις στο τετράδιό σας, τις σωστές όπως
είναι και
τις λανθασµένες, αφού πρώτα τις
διορθώσετε.
1. Η σύνδεση µε δεσµούς υδρογόνου της Α
(αδενίνης) µε την C (κυτοσίνη) είναι τόσο
ισχυρή όσο και η σύνδεση της Τ (θυµίνης) µε τη
G (γουανίνη).
2. Οι
περιοριστικές
ενδονουκλεάσες
συνδέουν
κοµµάτια του DNA ενώ η DNA δεσµάση κόβει
κάθε αλυσίδα του DNA σε συγκεκριµένες θέσεις.
3. Ο βιοαντιδραστήρας και τα θρεπτικά υλικά
που χρησιµοποιούνται σε µια καλλιέργεια
µικροοργανισµών είναι απαραίτητο να είναι
αποστειρωµένα.
Μονάδες 15
Β. Να γράψετε στο τετράδιό σας τους αριθµούς των
παρακάτω προτάσεων, και δίπλα τις κατάλληλες
λέξεις που τις συµπληρώνουν σωστά .
1. Η αλληλουχία των
στο µόριο ενός
mRNA
καθορίζει
την
αλληλουχία
των
αµινοξέων της αντίστοιχης
.
2. Ο γενετικός κώδικας είναι
, δηλαδή
το mRNA διαβάζεται συνεχώς ανά τρία
νουκλεοτίδια χωρίς να παραλείπεται κάποιο
νουκλεοτίδιο.
3. Με τη Βιοτεχνολογία, η παραγωγή φαρµακευτικών πρωτεϊνών µπορεί να γίνει από
ζώα.

ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ

4. Τα
χρωµοσώµατα
του
ανθρώπου
που
καθορίζουν αν ένα άτοµο θα είναι αρσενικό ή
θηλυκό λέγονται
.
Μονάδες 10
ΘΕΜΑ 3ο
Nα απαντήσετε
στις δύο ερωτήσεις που
ακολουθούν:
1. Τα έντοµα δηµιουργούν µεγάλα προβλήµατα
στη γεωργία και οδηγούν σε σηµαντική µείωση
της παραγωγής. Γνωρίζετε αν η Βιοτεχνολογία
µπορεί να βοηθήσει στην καταπολέµηση των
εντόµων και µε ποιο τρόπο µπορεί να γίνει
αυτό;
Μονάδες 10
2. Η ινσουλίνη είναι µία πρωτεΐνη που παράγεται
από τον ανθρώπινο οργανισµό όπως και η
αντιθρυψίνη (ΑΤΤ). Με ποιο τρόπο θα
µπορούσε να παραχθεί η ινσουλίνη αν
αξιοποιούσαµε τις δυνατότητες της γενετικής
µηχανικής και τις ιδιότητες που έχουν τα
διαγονιδιακά ζώα;
Μονάδες 15
ΘΕΜΑ 4ο
∆ίνεται τυχαίο τµήµα ενός µορίου mRNA:
- AUU - UCA - CCU - CUU - CGA - CAA 1. ∆εδοµένου ότι το mRNA αυτό δεν υπέστη
διαδικασία ωρίµανσης, να γράψετε στο
τετράδιό σας το δίκλωνο µόριο του DNA απ'
το οποίο προήλθε.
Μονάδες 10

ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ

αµέσως µόλις σας παραδοθούν. 3. Πόσα αµινοξέα κωδικοποιεί το τµήµα αυτό. ∆εν επιτρέπεται να γράψετε καµιά άλλη σηµείωση. Μονάδες 5 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. ∆εν θα µεταφέρετε στο τετράδιο τα κείµενα και τις παρατηρήσεις. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ ώρα µετά την .ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ 2. Στο αρχικό DNA ποιο ζευγάρι βάσεων συµµετέχει σε ποσοστό µεγαλύτερο του 50%. 2. Χρόνος δυνατής αποχώρησης : Μια (1) έναρξη της εξέτασης. Κατά την αποχώρησή σας. κατεύθυνση. να παραδώσετε µαζί µε το τετράδιο και το φωτοαντίγραφο. Μονάδες 10 3. εξεταζόµενο µάθηµα). 4. ∆ιάρκεια εξέτασης : τρεις (3) ώρες. 5. Στο τετράδιο να γράψετε µόνον τα προκαταρκτικά (ηµεροµηνία. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων. Να απαντήσετε σε όλες τις ερωτήσεις.

φυλοσύνδετα γ. Από τη διασταύρωση ενός λευκού µ’ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. τη µέθοδο της µικροέγχυσης β. αυξάνεται. µειώνεται β. Β. το πλασµίδιο Τi. Μονάδες 3 Το DNA αποτελεί το γενετικό υλικό όλων των κυττάρων και των περισσότερων ιών. Στις ερωτήσεις 1-3. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 2. Σε µία καλλιέργεια µικροοργανισµών κατά τη λανθάνουσα φάση ο πληθυσµός των µικροοργανισµών: α. Να περιγράψετε συνοπτικά τις λειτουργίες του γενετικού υλικού. Μονάδες 3 3. 1. ατελώς επικρατή. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. παραµένει σχεδόν σταθερός γ. 1. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. τη µέθοδο της διαµόλυνσης γ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . Για να δηµιουργήσουµε διαγονιδιακά φυτά χρησιµοποιούµε: α. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. συνεπικρατή β.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α.

Μονάδες 10 Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ηµιαυτόνοµα και γιατί. Να αναφέρετε τις ειδικές θέσεις που έχει κάθε µόριο tRNA και να εξηγήσετε το ρόλο των tRNA στην πρωτεϊνοσύνθεση. Μονάδες 5 ΘΕΜΑ 2ο 1. Α Τ C G Κύτταρο 1: 28 28 22 22 Κύτταρο 2: 31 31 19 19 Τα κύτταρα 1. 2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισµών. Να περιγράψετε τον τρόπο κατασκευής µιας cDNA βιβλιοθήκης. Μονάδες 10 2. Μονάδες 5 ΘΕΜΑ 3ο 1. coli αναπτύσσεται σε θρεπτικό υλικό που περιέχει τη λακτόζη ως πηγή άνθρακα. 3. Όταν η λακτόζη εξαντληθεί προσθέτουµε γλυκόζη. Σε δύο κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω επί τοις % σύσταση σε αζωτούχες βάσεις. Μονάδες 3 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 2. Μονάδες 2 Να αιτιολογήσετε την απάντησή σας. Να περιγράψετε τον τρόπο λειτουργίας του οπερονίου της λακτόζης πριν και µετά την προσθήκη της γλυκόζης. Ένας πληθυσµός βακτηρίων Ε.

ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ
Γ΄ ΤΑΞΗ

2. Από το φυτό Zea mays (καλαµπόκι) αποµονώθηκαν τρία
διαφορετικά φυσιολογικά κύτταρα στα οποία προσδιορίστηκε
το µέγεθος του γονιδιώµατος σε ζεύγη βάσεων.
Στο πρώτο κύτταρο το µέγεθος του γονιδιώµατος
υπολογίστηκε σε 20 Χ 10 9 ζεύγη βάσεων,
στο δεύτερο κύτταρο σε 5 Χ 10 9 ζεύγη βάσεων και
στο τρίτο κύτταρο σε 10 Χ 10 9 ζεύγη βάσεων.
Να εξηγήσετε γιατί υπάρχουν οι διαφορές αυτές στο
µέγεθος του γονιδιώµατος των τριών κυττάρων.
Μονάδες 12
3. Μία ανωµαλία του γονιδίου που ελέγχει τη σύνθεση του
ενζύµου απαµινάση της αδενοσίνης (ADA) προκαλεί µία
ασθένεια του ανοσοποιητικού συστήµατος. Αποµονώθηκε το
mRNA του ενζύµου ADA από υγιές άτοµο και από
άτοµο που ασθενεί. Τµήµατα των παραπάνω mRNA
είναι:
Υγιές άτοµο:
AUG GAA UUU UGG GGG CGC ACG UCG..........
Άτοµο που ασθενεί:
AUG GAA UUU UAG GGG CGC ACG UCG..........
α. Ποια είναι η αιτία της ασθένειας;
Μονάδες 6
β. Με ποιο τρόπο κληρονοµείται αυτή η ασθένεια;
Μονάδες 2

ΘΕΜΑ 4ο
∆ίνεται το παρακάτω γενεαλογικό δέντρο στο οποίο :
- Οι φαινότυποι των γονέων Ι-1, Ι-2 είναι άγνωστοι.

ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ
Γ΄ ΤΑΞΗ

- Τα άτοµα ΙΙ-2, ΙΙ-3 είναι ασθενή.

;

;

Να γραφούν οι πιθανοί φαινότυποι και γονότυποι των
γονέων Ι-1 και Ι-2 όταν:
α. το αλληλόµορφο γονίδιο που προκαλεί την ασθένεια
είναι επικρατές.
Μονάδες 4
Να αιτιολογήσετε την απάντησή σας.
Μονάδες 5
β. το αλληλόµορφο γονίδιο που προκαλεί την ασθένεια
είναι υπολειπόµενο.
Μονάδες 6
Να αιτιολογήσετε την απάντησή σας.
Μονάδες 10

Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους)
1. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά
(ηµεροµηνία, κατεύθυνση, εξεταζόµενο µάθηµα). Τα
θέµατα να µην τα αντιγράψετε στο τετράδιο.
2. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των
φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Καµιά
άλλη σηµείωση δεν επιτρέπεται να γράψετε.
ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ
Γ΄ ΤΑΞΗ

3.
4.
5.
6.

Κατά την αποχώρησή σας να παραδώσετε µαζί µε το
τετράδιο και τα φωτοαντίγραφα.
Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα.
Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι
αποδεκτή.
∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των
φωτοαντιγράφων.
Χρόνος δυνατής αποχώρησης: Μιάµιση (1 1/2 ) ώρα µετά
τη διανοµή των φωτοαντιγράφων.
KΑΛΗ ΕΠΙΤΥΧΙΑ
ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ

γ. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 2. µεταφέρει ένα συγκεκριµένο αµινοξύ στο ριβόσωµα. συνεπικρατή. Μονάδες 3 3. µεταφέρει ενέργεια στα ριβοσώµατα.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠAΡΑΣΚΕΥΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΡΕΙΣ (3) ΘΕΜΑ 1ο Α. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. β. Τα άτοµα που πάσχουν από σύνδροµο Turner είναι: α. Τα γονίδια που καθορίζουν το χρώµα του άνθους είναι: α. Για καθεµιά από τις ερωτήσεις 1-3. γ. 1. Από τη διασταύρωση ενός φυτού σκυλάκι µε κόκκινα άνθη µε ένα φυτό σκυλάκι µε λευκά άνθη όλοι οι απόγονοι έχουν ροζ άνθη. β. µόνο θηλυκά. φυλοσύνδετα. β. µόνο αρσενικά. µεταφέρει τη γενετική πληροφορία. ατελώς επικρατή. είτε αρσενικά είτε θηλυκά. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. Μονάδες 3 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . Κάθε µεταφορικό RNA (tRNA): α. γ. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας.

Μονάδες 12 3. Μονάδες 6 2. Μονάδες 7 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 5 Τι ονοµάζεται καρυότυπος. 2. Να αναφέρετε τα βασικά χαρακτηριστικά του γενετικού κώδικα και να τα περιγράψετε. 1. Μονάδες 10 2. Μονάδες 5 ΘΕΜΑ 2ο 1. Ποιες µεταλλάξεις χαρακτηρίζονται ως ουδέτερες και ποιες ως σιωπηλές.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Β. Ποια είναι τα θρεπτικά συστατικά που απαιτούνται για την καλλιέργεια ετερότροφων µικροοργανισµών. Να περιγράψετε την τεχνική παραγωγής µονοκλωνικών αντισωµάτων για ένα συγκεκριµένο αντιγόνο. Μονάδες 5 3. Πότε ένα κύτταρο χαρακτηρίζεται απλοειδές και πότε διπλοειδές. Μονάδες 10 ΘΕΜΑ 3ο 1. Να περιγράψετε τη διαδικασία σχηµατισµού "ώριµου" mRNΑ. Να περιγράψετε τα στάδια της διαδικασίας αυτής. Η τεχνολογία του ανασυνδυασµένου DNA περιλαµβάνει όλες τις τεχνικές που οδηγούν σε µεταφορά του γενετικού υλικού από τον έναν οργανισµό στον άλλο.

Ποιοι είναι οι γονότυποι των γονέων. 3. Αποκτούν δυο παιδιά. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοτυπιών.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 4ο Σε ένα ζευγάρι ο άνδρας και η γυναίκα έχουν οµάδα αίµατος Α και φυσιολογική όραση. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. 5. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. Μονάδες 4 Να δικαιολογήσετε την απάντησή σας. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τις φωτοτυπίες οι οποίες και θα καταστραφούν µετά το πέρας της εξέτασης. α. Ποιοι είναι οι πιθανοί γονότυποι των δυο παιδιών. Μονάδες 8 β. Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. Το άλλο είναι αγόρι µε οµάδα αίµατος Α και πάσχει από µερική αχρωµατοψία στο πράσινο χρώµα. Χρόνος δυνατής αποχώρησης: Μια (1) ώρα µετά τη διανοµή των φωτοτυπιών. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 11 Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) 1. 6. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. 2. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοτυπιών µόλις σας παραδοθούν. εξεταζόµενο µάθηµα). 4. Κάθε απάντηση τεκµηριωµένη είναι αποδεκτή. Το ένα είναι κορίτσι οµάδας αίµατος Ο και έχει κανονική όραση.

Οι δύο αδερφές χρωµατίδες συγκροτούν ένα α. κυκλικό δίκλωνο DNA. β. τη DNA δεσµάση. β. νουκλεόσωµα. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ Μονάδες 5 . αν βοηθηθούν από α. δ. το πριµόσωµα. µεταφασικό χρωµόσωµα. να γράψετε στο τετράδιό σας τον αριθµό της βασικής πρότασης και δίπλα του το γράµµα που αντιστοιχεί στο σωστό συµπλήρωµά της. Μονάδες 5 3. υβρίδωµα. Στις προτάσεις 1 έως 3. δίκλωνο RNA. δ. µονόκλωνο DNA. τα ένζυµα που διορθώνουν τα λάθη της αντιγραφής. γ. δ. Το πλασµίδιο είναι α. 1. µονόκλωνο RNA. γ. β. Οι DNA πολυµεράσες που συµµετέχουν στην αντιγραφή του DNA µπορούν να ξεκινήσουν τη διαδικασία της αντιγραφής. κύτταρο. γ. Μονάδες 5 2.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ∆ΕΥΤΕΡΑ 10 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. το κωδικόνιο.

.... ένα προς ένα. 2... ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ ... και ειδικότερα το ποσοστό της γλυκόζης στο . το αντίστοιχο από τα περιεχόµενα της Στήλης ΙΙ...... Να ξαναγράψετε στο τετράδιό σας τις προτάσεις.. Η ινσουλίνη είναι µία ορµόνη που αποτελείται από 51 .... τα περιεχόµενα της Στήλης Ι και..... Το πρόδροµο mRNA µετατρέπεται σε mRNA µε τη διαδικασία της .. κόβονται από µικρά ριβονουκλεοπρωτεϊνικά σωµατίδια και αποµακρύνονται.......... Η ορµόνη αυτή ρυθµίζει το µεταβολισµό των . ..... Στήλη Ι µεταφασικό χρωµόσωµα Στήλη ΙΙ αποδιάταξη υποχρεωτικά αερόβιοι µικροοργανισµοί ωρίµανση mRNA πολυσακχαρίτης από φύκη κλειστή καλλιέργεια κεντροµερίδιο άγαρ εκθετική φάση ανάπτυξης οξυγόνο υποκινητής Μονάδες 10 ΘΕΜΑ 2ο A. αφού συµπληρώσετε τα κενά µε τις σωστές λέξεις.. και παράγεται από ειδικά κύτταρα του .. δίπλα στο καθένα απ' αυτά.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ B.. ... 1.......... ώστε να δηµιουργείται µία σωστή συσχέτιση... Να γράψετε στο τετράδιό σας............... κατά την οποία τα .

σε φυτά. 2.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Β. Τι είναι το νουκλεόσωµα. 1. κυττάρου Μονάδες 8 Μονάδες 4 Μονάδες 4 ΘΕΜΑ 3ο Α. Μονάδες 8 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Τι είναι τα µονοκλωνικά αντισώµατα. σε ζώα. 1. Ποια οργανίδια του ευκαρυωτικού χαρακτηρίζονται ως ηµιαυτόνοµα και γιατί. Ποια από τις δύο αλυσίδες είναι η µεταγραφόµενη και γιατί. Τι είναι το πολύσωµα. Μονάδες 8 Β. 3. Μονάδες 5 2. Μονάδες 9 Να απαντήσετε στις τρεις ερωτήσεις που ακολουθούν. Να περιγράψετε από µία µέθοδο µεταφοράς γονιδίων 1. 2. Πώς λειτουργούν τα µονοκλωνικά αντισώµατα ως θεραπευτικά µέσα. Μονάδες 12 ΘΕΜΑ 4ο ∆ίνεται τµήµα διπλής έλικας του DNA : α) Ποια από τις δύο αλυσίδες έχει προσανατολισµό 3΄→5΄ και ποια 5΄→3΄.

Μονάδες 9 Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) 1. κατεύθυνση. 4. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. εξεταζόµενο µάθηµα). Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. 3. Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. 6.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ β) Ποιο είναι το mRNA µεταγραφόµενη αλυσίδα. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. Να γράψετε στο τετράδιό σας τα tRNA που θα πάρουν µέρος στη µετάφραση. 2. 5. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα µετά τη διανοµή των φωτοαντιγράφων. που θα προκύψει από τη Μονάδες 8 γ) Το mRNA που προκύπτει από τη συγκεκριµένη µεταγραφόµενη αλυσίδα δεν υφίσταται διαδικασία ωρίµανσης.

Μονάδες 5 2. 2. Συνεχής καλλιέργεια. νουκλεόσωµα. ∆ίκλωνο κυκλικό µόριο DNA περιέχεται σε: α. Ανοικτό πλαίσιο ανάγνωσης. 1. Μονάδες 5 Β. βακτήριο δ. δρεπανοκυτταρική αναιµία δ. οικογενής υπερχοληστερολαιµία γ. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ Μονάδες 7 Μονάδες 8 . γαµέτη β. Να οριστούν οι παρακάτω έννοιες: 1.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. φαινυλκετονουρία β. Ασθένεια που οφείλεται σε αυτοσωµικό επικρατές γονίδιο είναι η: α. ευκαρυωτικό πυρήνα γ. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. β-θαλασσαιµία. Στις ερωτήσεις 1-2.

Να περιγράψετε τη διαδικασία για την παραγωγή στελέχους καλαµποκιού. Μονάδες 10 2. Να βρείτε την αλληλουχία των αµινοξέων του πολυπεπτιδίου µε χρήση του παρατιθέµενου γενετικού κώδικα. Μονάδες 6 Να αιτιολογήσετε την απάντησή σας. Παρατίθεται ο γενετικός κώδικας. προκειµένου να ενσωµατωθεί σε κατάλληλο πλασµίδιο που έχει κοπεί µε την ίδια περιοριστική ενδονουκλεάση.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΘΕΜΑ 2ο 1. ∆ίνεται το παρακάτω τµήµα µορίου DNA προκαρυωτικού κυττάρου. Μονάδες 15 ΘΕΜΑ 3ο 1. 5΄ 3΄ GAATTCTTAATGCΑAGATCATAAAGAATTCTAG CTTAAGAATTACGΤTCTAGTATTTCTTAAGATC 3΄ 5΄ Το παραπάνω τµήµα DNA κόβεται µε EcoRI. ποικιλίας Bt. µε τελικό σκοπό να εισαχθεί σε βακτήριο για την παραγωγή φαρµακευτικού πολυπεπτιδίου. ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ Μονάδες 8 . Να περιγράψετε τις διαδικασίες στις οποίες γνωρίζετε ότι βρίσκει εφαρµογή η ιχνηθέτηση.

Καρπός πλούσιος σε υδατάνθρακες που ελέγχεται από το γονίδιο Υ και καρπός φτωχός σε υδατάνθρακες που ελέγχεται από το γονίδιο υ. Να περιγράψετε τις διαδικασίες που ακολουθήθηκαν για τη διάγνωση. µεταξύ άλλων. οι εξής χαρακτήρες: Καρπός µεγάλος που ελέγχεται από το γονίδιο Μ και καρπός µικρός που ελέγχεται από το γονίδιο µ.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ∆ ε ύ τ ε ρ ο U U Π ρ ώ τ ο γ ρ ά µ µ α γ ρ ά µ µ α C A UUU UUC UUA UUG φ α ι ν υ λ α λ α νί ν η φ α ι ν υ λ α λ α νί ν η λ ε υ κί ν η λ ε υ κί ν η UCU UCC UCA UCG σερίνη σερίνη σερίνη σερίνη UAU UAC UAA UAG τυροσίνη τυροσίνη λ ή ξη λ ή ξη U C A G CUU CUC CUA CUG λ ε υ κί ν η λ ε υ κί ν η λ ε υ κί ν η λ ε υ κί ν η CCU CCC CCA CCG προλίνη προλίνη προλίνη προλίνη CAU CAC CAA CAG ι σ τ ι δ ίν η ι σ τ ι δ ίν η γ λ ο υ τ α µ ί νη γ λ ο υ τ α µ ί νη U C A G Α A U U ι σ ο λ ε υ κί νη A U C ι σ ο λ ε υ κί νη A U A ι σ ο λ ε υ κί νη A U G µ ε θ ε ι ο ν ίν η έναρξη ACU ACC ACA ACG θρεονίνη θρεονίνη θρεονίνη θρεονίνη A AU A AC A AA A AG ασπαραγγίνη ασπαραγγίνη λ υ σ ί νη λ υ σ ί νη U C A G G GUU GUC GUA GUG GCU GCC GCA GCG αλανίνη αλανίνη αλανίνη αλανίνη GAU GAC GAA GAG α σ π α ρ τ ι κό ο ξ ύ U α σ π α ρ τ ι κό ο ξ ύ C γ λ ο υ τ α µ ι νι κό ο ξ ύ A γ λ ο υ τ α µ ι νι κό ο ξ ύ G C β α λ ί νη β α λ ί νη β α λ ί νη β α λ ί νη Τ ρ ί τ ο γ ρ ά µ µ α 2. διαπιστώθηκε ότι το έµβρυο νοσεί από το σύνδροµο Cri-du-chat (κλάµα της γάτας) και επιπλέον φέρει αναστροφή στο µικρό βραχίονα του χρωµοσώµατος 3. Κατά τον προγεννητικό έλεγχο σε κυοφορούσα γυναίκα. α. Μονάδες 3 ΘΕΜΑ 4ο Σε ένα φυτό παρατηρούνται. Βάσει ποιών παρατηρήσεων έγινε η διάγνωση. Έχετε στη διάθεσή σας ένα ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 8 β.

Μονάδες 4 β. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. Χρόνος δυνατής αποχώρησης: Μιάµιση (1 1/2 ) ώρα µετά τη διανοµή των φωτοαντιγράφων. Να διασταυρώσετε τα παραπάνω στελέχη και να βρείτε τους γονότυπους και φαινότυπους των απογόνων της F 1 και F 2 γενιάς. 5. 6. 3. να αιτιολογήσετε πώς µπορείτε να αποµονώσετε αµιγή στελέχη µε φαινότυπο καρπό µεγάλο και πλούσιο σε υδατάνθρακες. Μονάδες 9 γ. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. κάνοντας τις κατάλληλες διασταυρώσεις. Έχοντας στη διάθεσή σας τα φυτά της F 2 γενιάς. 4. α.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ αµιγές στέλεχος µε καρπό µεγάλο και φτωχό σε υδατάνθρακες. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. εξεταζόµενο µάθηµα). ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. καθώς και ένα αµιγές στέλεχος µε καρπό µικρό και πλούσιο σε υδατάνθρακες. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Να αιτιολογήσετε τη φαινοτυπική αναλογία των ατόµων της F 2 γενιάς. 2. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. κατεύθυνση. Μονάδες 12 Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) 1.

ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 20 ΣΕΠΤΕΜΒΡΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΡΕΙΣ (3) ΘΕΜΑ 1ο Α. Στις προτάσεις 1 έως 3. Μονάδες 3 3. επιδιορθώνει λάθη της αντιγραφής Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. 1. Μονάδες 3 2. να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στη σωστή συµπλήρωσή της. σπάει τους υδρογονικούς δεσµούς στο δίκλωνο µόριο του DNA β. Μονάδες 3 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . Η DNA ελικάση : α. µικρότερο σε µέγεθος από το ώριµο mRNA. µεγαλύτερο σε µέγεθος από το ώριµο mRNA γ. τοποθετεί νουκλεοτίδια γ. 45 χρωµοσώµατα β. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. 47 χρωµοσώµατα Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. Το πρόδροµο mRNA στα ευκαρυωτικά κύτταρα είναι : α. 46 χρωµοσώµατα γ. Τα άτοµα που πάσχουν από το σύνδροµο Kleinefelter έχουν : α. ίσο σε µέγεθος µε το ώριµο mRNA β.

Μονάδες 8 3. Ποια είναι η δοµή του DNA στο χώρο. Μονάδες 10 ΘΕΜΑ 3ο 1. σύµφωνα µε το µοντέλο της διπλής έλικας. Να περιγράψετε πώς τα µονοκλωνικά αντισώµατα µπορούν να χρησιµοποιηθούν ως θεραπευτικά µέσα. Μονάδες 5 Μονάδες 5 Μονάδες 5 2. ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ Μονάδες 5 . Μονάδες 10 3. Να περιγράψετε πώς ρυθµίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα. ΘΕΜΑ 2ο 1. 2. Τι γνωρίζετε για τον αλφισµό. Τι γνωρίζετε για τις φάσεις ανάπτυξης µιας κλειστής καλλιέργειας µικροοργανισµών. Μονάδες 12 2. Τι είναι οι φαρµακευτικές πρωτεΐνες.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Β. Τι είναι τα διαγονιδιακά ζώα. Τι είναι ο γονότυπος.1.

Ποιοι είναι οι γονότυποι των γονέων. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 4ο Ένας άνδρας που πάσχει από οικογενή υπερχοληστερολαιµία και έχει ελεύθερους λοβούς αυτιών. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. 3. Το ζευγάρι αυτό αποκτά τρία παιδιά. Μονάδες 10 Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Να δικαιολογήσετε την απάντησή σας. το δεύτερο δεν πάσχει από υπερχοληστερολαιµία και έχει προσκολληµένους λοβούς αυτιών και το τρίτο δεν πάσχει από υπερχοληστερολαιµία και έχει ελεύθερους λοβούς αυτιών. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. Το πρώτο εµφανίζει υπερχοληστερολαιµία και έχει ελεύθερους λοβούς αυτιών. 1. 5. α. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . 6. ∆εν επιτρέπεται να γράψετε καµιά άλλη σηµείωση. 2. εξεταζόµενο µάθηµα). Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοτυπιών αµέσως µόλις σας παραδοθούν. Μονάδες 2 Μονάδες 8 β. παντρεύεται µία γυναίκα. Μονάδες 5 Να δικαιολογήσετε την απάντησή σας. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τις φωτοτυπίες. 4. Ποιοι είναι οι πιθανοί γονότυποι των τριών παιδιών. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοτυπιών. Χρόνος δυνατής αποχώρησης : Μία (1) ώρα µετά τη διανοµή των φωτοτυπιών. η οποία δεν πάσχει από υπερχοληστερολαιµία και έχει ελεύθερους λοβούς αυτιών.

γραµµικό δίκλωνο DNA. γ. προέκυψαν µετά από χρήση αντιβιοτικών. δ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 19 ΣΕΠΤΕΜΒΡΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις προτάσεις 1 έως 5. Το υλικό των προκαρυωτικών κυττάρων είναι α. έχουν υποστεί την επίδραση φυτοφαρµάκων. µειωµένη συγκέντρωση διοξειδίου του άνθρακα. Οι υποχρεωτικά αερόβιοι µικροοργανισµοί απαιτούν για την ανάπτυξή τους α. γ. ένα επιπλέον χρωµόσωµα 21. υψηλή συγκέντρωση οξυγόνου. β. γραµµικό µονόκλωνο DNA. Μονάδες 5 2. Τα άτοµα που πάσχουν από σύνδροµο Down έχουν α. β. δε δίνουν απογόνους. Μονάδες 5 3. Μονάδες 5 4. δ. κυκλικό δίκλωνο DNA. γ. ∆ιαγονιδιακά φυτά ονοµάζονται αυτά τα οποία α. τρία φυλετικά χρωµοσώµατα. δίκλωνο RNA. να γράψετε στο τετράδιό σας τον αριθµό της πρότασης και δίπλα το γράµµα που αντιστοιχεί στη σωστή συµπλήρωσή της. έχουν υποστεί γενετική αλλαγή µε τη χρήση τεχνικών γενετικής µηχανικής. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . β. έλλειψη του χρωµοσώµατος 5. µία επιπλέον σειρά χρωµοσωµάτων. δ. 1. β.

έναν κλώνο Β-λεµφοκυττάρων.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ γ. πολύ υψηλές θερµοκρασίες. σ’ ένα τετράχρονο κορίτσι που έπασχε από έλλειψη του ενζύµου απαµινάση της αδενοσίνης (ADA). Μονάδες 5 2. δ. δ. ΘΕΜΑ 2ο Α. Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 5 Β. Να περιγράψετε τη διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας. Μονάδες 5 5. υψηλή συγκέντρωση αζώτου. β. καρκινικά κύτταρα. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το 1990. Η δρεπανοκυτταρική γονιδιακής µετάλλαξης. στη β-πολυπεπτιδική Μονάδες 5 3. ερυθρά αιµοσφαίρια. Ποια αλλαγή συµβαίνει στην κωδική αλυσίδα του DNA. Ποια αλλαγή συµβαίνει αλυσίδα της ΗbA. Μονάδες 10 ΘΕΜΑ 3ο Α. Τι ονοµάζεται πολύσωµα. βακτήρια. αναιµία είναι Μονάδες 5 αποτέλεσµα 1. γ. Τα µονοκλωνικά αντισώµατα παράγονται από α. Ποια συµπτώµατα εµφανίζει ένα άτοµο που πάσχει από δρεπανοκυτταρική αναιµία.

... (Ι) ή (ΙΙ).. Πόσα αµινοξέα έχει η αλυσίδα που σχηµατίζεται και γιατί. Να γράψετε το µόριο του m-RNA το οποίο σχηµατίζεται κατά τη µεταγραφή του παραπάνω DNA και να ορίσετε το 3΄και το 5΄ άκρο του µορίου αυτού.. βρίσκεται η γενετική πληροφορία και γιατί. Να γράψετε τα αντικωδικόνια των t-RNA που συµµετέχουν στη µετάφραση του παραπάνω µορίου m-RNA. Μονάδες 10 β. Σε ποια από τις αλυσίδες. Να γράψετε το γονότυπο ανθρώπου. στο οποίο κωδικοποιείται η γενετική πληροφορία για τη σύνθεση µικρής αλυσίδας αµινοξέων: (I) .. Μονάδες 5 δ. (II) . Μονάδες 5 γ. Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .. Μονάδες 6 3.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Β. Να γράψετε τα αλληλόµορφα γονίδια που καθορίζουν τον τύπο των οµάδων αίµατος ΑΒΟ του ανθρώπου. Μονάδες 6 ΘΕΜΑ 4ο ∆ίδεται το παρακάτω τµήµα µορίου προκαρυωτικού DNA.. A A A A T G C A A T A C T T T C T A T G A G C C G A G . α. οµάδας αίµατος ΑΒ. 1. Να γράψετε τους πιθανούς γονοτύπους ανθρώπου οµάδας αίµατος Β και να αιτιολογήσετε την απάντησή σας. T T T T A C G T T A T G A A A G A T A C T C G G C T C . Μονάδες 3 2.

Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τις φωτοτυπίες. 2. Χρόνος δυνατής αποχώρησης : Μία (1) ώρα µετά τη διανοµή των φωτοτυπιών. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. εξεταζόµενο µάθηµα). Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. ∆εν επιτρέπεται να γράψετε καµιά άλλη σηµείωση. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 3.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ 1. 4. 5. 6. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοτυπιών. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοτυπιών αµέσως µόλις σας παραδοθούν.

Το πλασµίδιο Τi χρησιµοποιείται στη γονιδιακή θεραπεία της κυστικής ίνωσης. Ο τύπος των οµάδων αίµατος ΑΒΟ στον άνθρωπο καθορίζεται από ένα γονίδιο το οποίο έχει δύο αλληλόµορφα. Μονάδες 2 5. Μονάδες 2 4. Μονάδες 2 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . αν η πρόταση είναι σωστή.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 4 ΙΟΥΛΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. δεν αναπτύσσονται παρουσία οξυγόνου. Πολλά νουκλεοτίδια ενώνονται ετεροπολικούς δεσµούς και πολυνουκλεοτιδική αλυσίδα. Οι υποχρεωτικά αναερόβιοι οργανισµοί όπως τα βακτήρια του γένους Clostridium. µεταξύ τους δηµιουργούν µε µία Μονάδες 2 2. αν η πρόταση είναι λανθασµένη. 1. Οι DNA πολυµεράσες είναι ένζυµα που συµµετέχουν στην αντιγραφή των µορίων DNA. Μονάδες 2 3. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό. ή Λάθος.

πρωτεϊνών. Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Ποια διαδικασία ονοµάζεται αποδιάταξη νουκλεϊκών οξέων. Cri du chat (φωνή της γάτας). Μονάδες 5 2. Kleinefelter β. στα εσώνια δ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ Β. Μονάδες 5 ΘΕΜΑ 2ο 1. στις αλληλουχίες λήξης. Turner γ. 1. στον υποκινητή β. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. Η τρισωµία στο 21ο χρωµόσωµα του ανθρώπου προκαλεί το σύνδροµο : α. c DNA γ. Από τι αποτελείται το νουκλεόσωµα και ποιος είναι ο ρόλος του. στην 3΄ αµετάφραστη περιοχή γ. Η διαδικασία µεταγραφής οδηγεί στο σχηµατισµό µορίων : α. DNA β. Για τις ερωτήσεις 1-3. Η RNA πολυµεράση προσδένεται : α. Μονάδες 5 3. Dοwn δ. RNA δ. Μονάδες 5 2.

Από τι αποτελείται το µόριο της ινσουλίνης. έξι (6) και επτά (7) πάσχουν από αιµορροφιλία.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 3. Μονάδες 10 ΘΕΜΑ 3ο Η ινσουλίνη είναι µία ορµόνη απαραίτητη για την καλή λειτουργία του ανθρώπινου οργανισµού. Μονάδες 5 3. ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Να εξηγήσετε το είδος της µετάλλαξης που προκαλεί τη δρεπανοκυτταρική αναιµία στον άνθρωπο. Τα άτοµα τρία (3). Μονάδες 5 2. Μονάδες 15 ΘΕΜΑ 4ο ∆ίδεται το γενεαλογικό δέντρο µιας οικογένειας στην οποία εµφανίζεται η ασθένεια της αιµορροφιλίας. 1. Να γράψετε συνοπτικά τα στάδια παραγωγής της ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων. Ποιος είναι ο ρόλος της ινσουλίνης στον οργανισµό µας.

KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . εξεταζόµενο µάθηµα). Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. Να γράψετε τους πιθανούς γονότυπους όλων των ατόµων που απεικονίζονται στο παραπάνω γενεαλογικό δέντρο. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. 5. Μονάδες 5 2. ∆ιάρκεια εξέτασης: τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. Μονάδες 9 3. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 1. Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. 2. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. Ποια είναι η πιθανότητα το παιδί των γονέων οκτώ (8) και εννέα (9) να είναι αγόρι αιµορροφιλικό. 4. Χρόνος δυνατής αποχώρησης: µετά τη 10:00 πρωινή. 3. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. 6. Τι είναι γενεαλογικό δέντρο. Να αιτιολογήσετε την απάντησή σας (Μονάδες 8). (Μονάδες 3). Μονάδες 11 1.

που βρίσκεται µπροστά από τον υποκινητή. Τα άτοµα που πάσχουν από αναιµία παράγουν µόνο HbA. Η µέθοδος αλυσιδωτής αντίδρασης πολυµεράσης (PCR) επιτρέπει την επιλεκτική αντιγραφή µορίων DNA. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. αν η πρόταση είναι σωστή. Μονάδες 2 4. 5. Ο καταστολέας κωδικοποιείται από ένα ρυθµιστικό γονίδιο. Μονάδες 2 3. οφείλεται ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ δρεπανοκυτταρική Μονάδες 2 σε αυτοσωµικό Μονάδες 2 . αν η πρόταση είναι λανθασµένη. 1. Η αιµορροφιλία Α υπολειπόµενο γονίδιο.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό. Μονάδες 2 2. ή Λάθος. χωρίς τη µεσολάβηση ζωικών κυττάρων.

Μονάδες 5 2. Μονάδες 5 ΘΕΜΑ 2ο 1.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ Β. Τι ονοµάζεται υβριδοποίηση νουκλεϊκών οξέων. σε όλα τα κύτταρα δ. µόνο στα ηπατικά κύτταρα. Μονάδες 5 2. µόνο στα γεννητικά κύτταρα γ. I A i. αντίγραφα ανασυνδυασµένων κυττάρων. Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου δ. Ι Β i δ. Ι Α Ι Β β. το σύνολο του DNA ενός οργανισµού γ. µόνο στα µυϊκά κύτταρα β. να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. Το 1997 οι ερευνητές του Ινστιτούτου Roselin της Σκωτίας ανακοίνωσαν ότι κλωνοποίησαν ένα πρόβατο (Dolly). ii γ. Μονάδες 5 3. 1. Μια γονιδιωµατική βιβλιοθήκη περιέχει: α. Τα φυλετικά χρωµοσώµατα του ανθρώπου βρίσκονται: α. Για τις ερωτήσεις 1-3. Ένα άτοµο που ανήκει στην οµάδα αίµατος ΑΒ έχει γονότυπο: α. Ποια διαδικασία ακολούθησαν. το σύνολο του m-RNA ενός οργανισµού β.

Τι πιθανότητες υπάρχουν να είναι τα παιδιά τους φυσιολογικά. Να µεταφέρετε το παραπάνω σχήµα στο τετράδιό σας και να σηµειώσετε επάνω σ’ αυτό τα κωδικόνια του DNA. που κωδικοποιούν το τµήµα του πεπτιδίου αυτού (Μονάδες 3) και να δικαιολογήσετε την απάντησή σας (Μονάδες 9).ισολευκίνη… και η διεύθυνση της µεταγραφής. σχηµατισµό µιας µε προσανατολισµό Μονάδες 10 ΘΕΜΑ 3ο 1. το οποίο είναι υπεύθυνο για τη σύνθεση του πεπτιδίου: …ισολευκίνη – τυροσίνη – ισολευκίνη – τυροσίνη . Να δικαιολογήσετε την απάντησή σας.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 3. Μονάδες 12 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 15 ΘΕΜΑ 4ο ∆ίδεται το παρακάτω τµήµα DNA. Πώς αντιµετωπίζεται η κυστική ίνωση µε γονιδιακή θεραπεία. Να περιγράψετε το πολυνουκλεοτιδικής αλυσίδας. Μονάδες 10 2. 5΄→3΄. Άνδρας ο οποίος πάσχει από κυστική ίνωση και υποβλήθηκε σε γονιδιακή θεραπεία για τη νόσο αποκτά παιδιά µε φυσιολογική γυναίκα. 3´ 5´ 5´ 3´ ∆ιεύθυνση µεταγραφής 1.

Μονάδες 13 ∆ίδονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων. 4. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. Τυροσίνη ― UAU Ισολευκίνη ―AUA Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους) 1. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Χρόνος δυνατής αποχώρησης: Μετά την 10. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 6. κατεύθυνση.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 2. 3. Τα σχήµατα σχεδιάζονται µε στυλό διαρκείας χρώµατος µαύρου ή µπλε. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. εξεταζόµενο µάθηµα). ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων.τυροσίνη… Να εντοπίσετε το είδος της µετάλλαξης (Μονάδες 6) και να αιτιολογήσετε την απάντησή σας (Μονάδες 7).30 πρωινή. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. 5. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Μετάλλαξη που έγινε σ’ ένα σηµείο στο παραπάνω DNA έδωσε το πεπτίδιο: …τυροσίνη – ισολευκίνη – τυροσίνη – ισολευκίνη . 2.

γ. 1. β. δίπλα του. Μονάδες 5 2. γ. γ. αντιικές πρωτεΐνες που παράγονται από κύτταρα που έχουν µολυνθεί από ιούς. δεν περιέχουν γονίδια. Ο γενετικός κώδικας είναι α. το σύνολο των ενζύµων ενός κυττάρου. ο αριθµός των γονιδίων του κυττάρου. β. δ. β. η αντιστοίχιση τριπλετών βάσεων σε αµινοξέα. Μονάδες 5 3. είναι όµοια µορφολογικά στους άνδρες και στις γυναίκες. Τα φυλετικά χρωµοσώµατα του ανθρώπου α. ένζυµα που ελέγχουν το µεταβολισµό των σακχάρων. δ. το γράµµα που αντιστοιχεί στη σωστή φράση-συµπλήρωµα. δεν µεταβιβάζονται στους απογόνους. ο τρόπος αντιστοίχισης των νουκλεοτιδίων µεταξύ τους. να γράψετε στο τετράδιό σας τον αριθµό της βασικής πρότασης και.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις 1 έως 5. χηµικές ενώσεις που προκαλούν αλλαγές στα γονίδια. δ. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . πρωτεΐνες που προκαλούν σύντηξη των καρκινικών κυττάρων. Οι ιντερφερόνες είναι α. καθορίζουν το φύλο.

µικρό πυρηνικό RNA (snRNA). κλώνων βακτηρίων Το σύνολο των ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Οι περιοριστικές ______________ παράγονται από ______________ και ο φυσιολογικός τους ρόλος είναι να τα προστατεύουν από την εισβολή «ξένου» DNA. αγγελιαφόρο RNA (mRNA). µε το αντίστοιχο ______________ του mRNA. Κάθε µόριο tRNA έχει µια ειδική τριπλέτα νουκλεοτιδίων. υπάρχει στο Bacillus thuringiensis. Μονάδες 5 5. χρησιµοποιείται στη µικροέγχυση. Να µεταφέρετε στο τετράδιό σας τις παρακάτω προτάσεις. λόγω συµπληρωµατικότητας. πλασµίδιο Τi υπάρχει σε όλα τα βακτήρια. ριβοσωµικό RNA (rRNA). Μονάδες 5 3. χρησιµοποιείται στη γενετική τροποποίηση φυτών. αφού συµπληρώσετε τα κενά µε τις σωστές λέξεις.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Μονάδες 5 4. γ. µε την οποία προσδένεται. µεταφορικό RNA (tRNA). δ. Το α. 1. δ. β. β. Η διαδικασία δηµιουργίας ονοµάζεται ______________. Μονάδες 5 2. Μονάδες 5 ΘΕΜΑ 2ο Α. γ. Το είδος του RNA που µεταφέρει στα ριβοσώµατα την πληροφορία για τη σύνθεση µιας πολυπεπτιδικής αλυσίδας είναι το α. το ______________.

Μονάδες 10 ΘΕΜΑ 4ο ∆ίνονται τα παρακάτω αµινοξέα και. Τι είναι το κωδικόνιο έναρξης και τι τα συνώνυµα κωδικόνια. Μονάδες 10 Β. Μονάδες 5 Ποια πλεονεκτήµατα έχει η χρήση των ζώων αυτών για την αύξηση της ζωικής παραγωγής έναντι της κλασικής µεθόδου των διασταυρώσεων. Μονάδες 5 2. 1. Μονάδες 5 Να απαντήσετε στις ερωτήσεις που ακολουθούν. Μονάδες 5 ΘΕΜΑ 3ο Α. Το βακτήριο Bacillus thuringiensis που ζει στο έδαφος. βακτηριακών κλώνων αποτελεί τη ______________ βιβλιοθήκη. τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αµινοξέα αυτά: τυροσίνη (tyr) – UAU φαινυλαλανίνη (phe) – UUU ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Β. Ποια είναι τα στάδια της διαδικασίας παραγωγής ενός γενετικά τροποποιηµένου φυτού που παρουσιάζει αντοχή στα έντοµα αξιοποιώντας την παραπάνω ιδιότητα του βακτηρίου αυτού. Ποιοι µικροοργανισµοί χαρακτηρίζονται ως υποχρεωτικά αερόβιοι και ποιοι ως υποχρεωτικά αναερόβιοι. δίπλα τους. Τι είναι τα διαγονιδιακά ζώα. παράγει µια τοξίνη η οποία είναι ισχυρότατο εντοµοκτόνο.

ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ
∆΄ ΤΑΞΗ

προλίνη
(pro) – CCC
α) Αξιοποιώντας τις παραπάνω πληροφορίες να δώσετε το
mRNA
που
κωδικοποιεί
το
ακόλουθο
τµήµα
πολυπεπτιδικής αλυσίδας:
..... - phe – phe – pro – tyr – tyr – pro - .....
Μονάδες 5
β) Να γράψετε την κωδική αλυσίδα του DNA και τη
συµπληρωµατική της, προσδιορίζοντας το 3΄ και 5΄ άκρο
καθεµιάς απ’ αυτές.
Μονάδες 15
γ) Πόσοι είναι οι δεσµοί υδρογόνου που σταθεροποιούν τις
δύο πολυνουκλεοτιδικές αλυσίδες στο παραπάνω µόριο
του DNA;
Μονάδες 5
Ο∆ΗΓΙΕΣ (για τους εξεταζόµενους)
1. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά
(ηµεροµηνία, κατεύθυνση, εξεταζόµενο µάθηµα). Τα
θέµατα να µην τα αντιγράψετε στο τετράδιο.
2. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των
φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Καµιά
άλλη σηµείωση δεν επιτρέπεται να γράψετε.
Κατά την αποχώρησή σας να παραδώσετε µαζί µε το
τετράδιο και τα φωτοαντίγραφα.
3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα.
4. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι
αποδεκτή.
5. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των
φωτοαντιγράφων.
6. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα µετά τη
διανοµή των φωτοαντιγράφων.
KΑΛΗ ΕΠΙΤΥΧΙΑ
ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ
∆΄ ΤΑΞΗ

ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ
∆΄ ΤΑΞΗ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ
ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ
∆ΕΥΤΕΡΑ 7 ΙΟΥΝΙΟΥ 2004
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:
ΒΙΟΛΟΓΙΑ
ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4)
ΘΕΜΑ 1ο
Στις ηµιτελείς προτάσεις 1 έως 5, να γράψετε στο τετράδιό
σας τον αριθµό της βασικής φράσης και, δίπλα του, το
γράµµα που αντιστοιχεί στο σωστό συµπλήρωµά της.
1. Το γεγονός ότι κάθε νουκλεοτίδιο του γενετικού κώδικα
ανήκει σε ένα µόνο κωδικόνιο οδηγεί στο χαρακτηρισµό
του κώδικα ως
α. συνεχούς.
β. µη επικαλυπτόµενου.
γ. εκφυλισµένου.
δ. σχεδόν καθολικού.
Μονάδες 5
2. Στα
ευκαρυωτικά
κύτταρα,
το
γενετικό
υλικό
κατανέµεται
α. στον πυρήνα.
β. στα µιτοχόνδρια και στο πλασµίδιο.
γ. στον
πυρήνα,
στα
µιτοχόνδρια
και
στους
χλωροπλάστες.
δ. στον πυρήνα και στα ριβοσώµατα.
Μονάδες 5
3. Η ποσότητα του DNA είναι
α. ίδια σε όλα τα είδη των σωµατικών κυττάρων ενός
οργανισµού.
β. διπλάσια στα ηπατικά κύτταρα των οργανισµών.
γ. µικρότερη
στους
περισσότερο
εξελιγµένους
οργανισµούς.

ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ δ. δεσµούς υδρογόνου. το µεταβολισµό των υδατανθράκων στο αίµα. φωσφοδιεστερικούς δεσµούς. Μια πολυνουκλεοτιδική αλυσίδα σχηµατίζεται από την ένωση των νουκλεοτιδίων µε α. Μονάδες 5 ΘΕΜΑ 2ο Α. πεπτιδικούς δεσµούς. ετεροπολικούς δεσµούς. είναι 2. δ. συµπληρώνοντας τα κενά µε τις σωστές λέξεις. γ. Οι αδελφές χρωµατίδες ______________ . δ. το µεταβολισµό της χοληστερόλης. τη συγκέντρωση των αλάτων στο αίµα. β. β. Να µεταφέρετε στο τετράδιό σας τις παρακάτω προτάσεις. Η διαδικασία δηµιουργίας ονοµάζεται ______________ . συνδεδεµένες στο Μονάδες 2 κλώνων ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ βακτηρίων Μονάδες 2 . Μονάδες 15 Β. 1. τη συγκέντρωση των πρωτεϊνών στο αίµα. Μονάδες 5 4. γ. η µισή στα διπλοειδή κύτταρα σε σχέση µε τα απλοειδή. Ποιες είναι συνοπτικά οι λειτουργίες του γενετικού υλικού. Μονάδες 5 5. Η ινσουλίνη είναι µια ορµόνη που ρυθµίζει α.

στα οποία το γονιδίωµα υπάρχει σε ένα µόνο αντίγραφο. Κάθε νουκλεοτίδιο του DNA αποτελείται από µια πεντόζη.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 3. ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . ονοµάζονται ______________ . Μονάδες 5 ΘΕΜΑ 4ο Η παρακάτω καµπύλη αποδίδει την ανάπτυξη µικροοργανισµών του είδους Escherichia coli σε κάποια κλειστή καλλιέργεια. Να αναφέρετε δύο δυνατότητες που µπορούν να προσφέρουν στους αγρότες τα γενετικά τροποποιηµένα φυτά. Μονάδες 5 Β. Τα κύτταρα. µέθοδο δηµιουργίας των Μονάδες 15 Γ. Να περιγράψετε τη διαγονιδιακών φυτών. ενωµένη µε µία φωσφορική οµάδα και µια ___________ ___________ . τη ______________. Τι είναι τα διαγονιδιακά ή γενετικά τροποποιηµένα φυτά. Μονάδες 4 4. Μονάδες 2 ΘΕΜΑ 3ο Α.

∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σηµείωση. 5. 4. Πού οφείλεται η αύξηση του αριθµού των µικροοργανισµών που παρατηρείται στο διάστηµα από t 1 έως t 2 και πώς ονοµάζεται η φάση αυτή. Μονάδες 5 Γ. Πώς ονοµάζεται η φάση από τη χρονική στιγµή t0 έως και t1 και τι συµβαίνει µε τον πληθυσµό των µικροοργανισµών. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. Να ερµηνεύσετε τις µεταβολές του πληθυσµού των µικροοργανισµών από τη στιγµή t3 και µετά. εξεταζόµενο µάθηµα). κατεύθυνση. από βλάβη στο βιοαντιδραστήρα η θερµοκρασία ανεβαίνει απότοµα στους 80 0C. Μονάδες 15 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. 2. 6. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Μονάδες 5 Β. Χρόνος δυνατής αποχώρησης: µία (1) ώρα µετά τη διανοµή των φωτοαντιγράφων. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Α. και ενώ η σταθερή φάση είναι σχεδόν στο µέσον της. Τη χρονική στιγµή t3. Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν. Η βλάβη αποκαθίσταται ταχύτατα. 3. ∆ιάρκεια εξέτασης: τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. όπως αυτές περιγράφονται από την καµπύλη ανάπτυξης. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα.

αντίγραφα του mRNA ενός µόνο γονιδίου. β. δ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που συµπληρώνει σωστά την ηµιτελή πρόταση. β. µονόκλωνο µόριο DNA. δ. 1. είναι επικρατές φυλοσύνδετο. Μονάδες 5 2. Μια cDNA βιβλιοθήκη περιέχει … α. αντίγραφα των mRNA όλων των γονιδίων που εκφράζονται σε συγκεκριµένα κύτταρα. µονόκλωνο RNA. β. γ. γ. γ. γονίδιο που είναι υπεύθυνο για τη β θαλασσαιµία … είναι υπολειπόµενο φυλοσύνδετο. το σύνολο του DNA ενός οργανισµού. αντίγραφα που περιέχουν κοµµάτια γονιδίων και άλλα τµήµατα DNA. δίκλωνο µόριο DNA. Το α. δίκλωνο RNA. έχει πολλαπλά αλληλόµορφα. είναι επικρατές αυτοσωµικό. δ. Μονάδες 5 3. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . Κατά τη µεταγραφή του DNA συντίθεται ένα… α.

Τα ένζυµα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι … α. κύτταρα ζώων. DNA ελικάσες και DNA δεσµάση. Ποια βήµατα απαιτούνται για την παραγωγή µιας φαρµακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 4. δ. γενετικά τροποποιηµένα βακτήρια. Ποιος ο ρόλος των µονοκλωνικών αντισωµάτων ως ανοσοδιαγνωστικά. δ. DNA πολυµεράσες και επιδιορθωτικά ένζυµα. DNA δεσµάση και επιδιορθωτικά ένζυµα. β. Μονάδες 9 3. RNA πολυµεράσες και πριµόσωµα. κύτταρα ανθρώπου. Ποια είδη RNA παράγονται κατά τη µεταγραφή του DNA προκαρυωτικού κυττάρου (µονάδες 3) και ποιος είναι ο ρόλος τους (µονάδες 6). γ. Μονάδες 5 5. Οι ιντερφερόνες που χρησιµοποιεί σήµερα ο άνθρωπος είναι δυνατόν να παράγονται σε µεγάλες ποσότητες από … α. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. β. Μονάδες 7 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 9 2. φυτικά κύτταρα. γ.

γεννήθηκε παιδί µε σύνδροµο Turner (ΧΟ).ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΘΕΜΑ 3ο Από δύο φυσιολογικούς γονείς. Να προσδιορίσετε τους γονότυπους των γονέων του άνδρα. α. Μονάδες 12 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Να περιγράψετε τις διαδικασίες που πρέπει να ακολουθηθούν για τη διάγνωση του συνδρόµου Turner πριν από τη γέννηση ενός παιδιού. Μονάδες 7 2. που είναι φορέας µερικής αχρωµατοψίας στο πράσινο και στο κόκκινο. Μονάδες 12 ΘΕΜΑ 4ο Ένας άνδρας µε οµάδα αίµατος Ο και µε φυσιολογική όραση παντρεύεται µια γυναίκα µε οµάδα αίµατος Α. Ποια είναι τα χαρακτηριστικά του συνδρόµου Turner. ως προς τον αριθµό και το µέγεθος των χρωµοσωµάτων. Μονάδες 6 β. Να γράψετε τις πιθανές διασταυρώσεις µεταξύ του άνδρα οµάδας αίµατος Ο µε φυσιολογική όραση και της γυναίκας οµάδας αίµατος Α που είναι φορέας µερικής αχρωµατοψίας. Να γράψετε έναν από τους πιθανούς µηχανισµούς που µπορεί να εξηγήσει τη γέννηση του συγκεκριµένου παιδιού. 1. Μονάδες 6 3. Ο πατέρας του συγκεκριµένου άνδρα είναι οµάδας αίµατος Α µε φυσιολογική όραση και η µητέρα του είναι οµάδας αίµατος Β µε φυσιολογική όραση.

αµέσως µόλις σας παραδοθούν.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ γ. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Σε καθεµιά από τις προηγούµενες διασταυρώσεις του ερωτήµατος β. Χρόνος δυνατής αποχώρησης: µετά τη 10:30 πρωινή. να βρείτε την πιθανότητα να γεννηθεί αγόρι οµάδας αίµατος Α µε µερική αχρωµατοψία στο πράσινο και το κόκκινο (µονάδες 2). Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. ∆ιάρκεια εξέτασης: τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. τα οποία θα καταστραφούν µετά το πέρας της εξέτασης. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 6. και να δικαιολογήσετε την απάντησή σας (µονάδες 5). 2. Να µην αντιγράψετε τα θέµατα στο τετράδιό σας. 5. 4. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων. Μονάδες 7 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. 3. εξεταζόµενο µάθηµα). κατεύθυνση.

δ. συµµετέχουν στην ωρίµανση του mRNA. Μονάδες 5 2. τα βακτήρια του γένους Clostridium. γ. δ. γ. Μονάδες 5 3. ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ Μονάδες 5 . β. αυξητική ορµόνη. Σε άτοµα που πάσχουν από αιµορροφιλία Β χορηγείται … α. συµµετέχουν στην αντιγραφή του DNA. γ. Το α. πλασµίδιο Ti αποµονώνεται από … τα βακτήρια του γένους Lactobacillus. το βακτήριο Βacillus thuringiensis. β.αντιθρυψίνη. δίκλωνο γραµµικό µόριο DNA. δίκλωνο κυκλικό µόριο RNA. δ. το βακτήριο Agrobacterium tumefaciens. ινσουλίνη.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση που συµπληρώνει σωστά την ηµιτελή πρόταση. γ. δίκλωνο κυκλικό µόριο DNA. δ. β. Μονάδες 5 4. Οι περιοριστικές ενδονουκλεάσες … α. συµµετέχουν στη µεταγραφή του DNA. µονόκλωνο κυκλικό µόριο RNA. αναγνωρίζουν ειδικές αλληλουχίες DNA. Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα … α. α 1 . β. 1. παράγοντας ΙΧ.

ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 5. Γιατί τα µιτοχόνδρια χαρακτηρίζονται ως ηµιαυτόνοµα οργανίδια. ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . δ. ιχνηθέτηση. Με ποια αντισώµατα αντιγόνο. η β-θαλασσαιµία και η φαινυλκετονουρία είναι µερικές από τις συχνά εµφανιζόµενες γενετικές ασθένειες του ανθρώπου που οφείλονται σε µεταλλάξεις. µετασχηµατισµός. Η εισαγωγή ανασυνδυασµένου DNA σε βακτηριακό κύτταρο – ξενιστή ονοµάζεται … α. β. Τι εννοούµε µε τον όρο ζύµωση (Μονάδες 4) και ποια είναι τα προϊόντα της (Μονάδες 4). Μονάδες 8 4. εµβολιασµός. Μονάδες 6 2. µικροέγχυση. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. διαδικασία παράγονται µονοκλωνικά στο εργαστήριο για ένα επιλεγµένο Μονάδες 7 ΘΕΜΑ 3ο Η δρεπανοκυτταρική αναιµία. Ποιες λειτουργίες επιτελούν τα ένζυµα DNA πολυµεράσες κατά την αντιγραφή του DNA. γ. Μονάδες 4 3.

Μονάδες 8 4. Σε τι µας βοηθά η διάγνωση των γενετικών ασθενειών. Γιατί τα άτοµα που πάσχουν από φαινυλκετονουρία εµφανίζουν διανοητική καθυστέρηση. Γιατί τα άτοµα που πάσχουν από β-θαλασσαιµία παρουσιάζουν µεγάλη ετερογένεια συµπτωµάτων. Μονάδες 6 2. Ποιες τεχνικές µάς δίνουν τη δυνατότητα διάγνωσης της δρεπανοκυτταρικής αναιµίας σε ενήλικα άτοµα που πάσχουν από αυτή. ενώ στην οικογένεια Β τα άτοµα ΙΙ 2 και II 3 (µαυρισµένα) είναι ασθενή. ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 1. II 2 και ΙΙΙ 2 (µαυρισµένα) είναι ασθενή. Στην οικογένεια Α τα άτοµα Ι 2 . Μονάδες 5 ΘΕΜΑ 4ο Στα παρακάτω γενεαλογικά δέντρα µελετάται ο τρόπος κληρονόµησης της ίδιας ασθένειας σε δύο διαφορετικές οικογένειες Α και Β. Μονάδες 6 3.

ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 1. Με βάση τα παραπάνω γενεαλογικά δέντρα να βρείτε τον τύπο κληρονοµικότητας της ασθένειας αυτής. Να γράψετε τους πιθανούς γονότυπους όλων των ατόµων που απεικονίζονται στα γενεαλογικά δέντρα των οικογενειών Α και Β. Μονάδες 8 3. 2. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. Μονάδες 7 2. ∆ιάρκεια εξέτασης: τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. Κάθε απάντηση τεκµηριωµένη είναι αποδεκτή. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. εξεταζόµενο µάθηµα). Τα θέµατα να µην τα αντιγράψετε στο τετράδιο. αµέσως µόλις σας παραδοθούν. κατεύθυνση. 6. 4. Καµιά άλλη σηµείωση δεν επιτρέπεται να γράψετε. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων. Να υπολογίσετε την πιθανότητα να γεννηθεί αγόρι µε την ασθένεια αυτή από το γάµο του ατόµου ΙΙΙ 2 της οικογένειας Α µε το άτοµο ΙΙΙ 1 της οικογένειας Β. Χρόνος δυνατής αποχώρησης: 10:00. 5. Μονάδες 10 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. (Να µη ληφθεί υπόψη η περίπτωση µετάλλαξης).

ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ
ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ
ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ
ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ
ΤΡΙΤΗ 21 ΣΕΠΤΕΜΒΡΙΟΥ 2004
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:
BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ)
ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4)

ΘΕΜΑ 1ο
Για καθεµιά από τις προτάσεις 1 έως 5, να γράψετε στο
τετράδιό σας τον αριθµό της βασικής φράσης και δίπλα του
το γράµµα που αντιστοιχεί στο σωστό συµπλήρωµά της.
1. Ο γονότυπος αναφέρεται
α. στο σύνολο των χαρακτήρων ενός οργανισµού.
β. στο σύνολο των αλληλοµόρφων γονιδίων ενός
οργανισµού.
γ. στον αριθµό των φυλετικών χρωµοσωµάτων του
οργανισµού.
δ. στον αριθµό των αυτοσωµικών χρωµοσωµάτων του
οργανισµού.
Μονάδες 5
2. Η αντιγραφή του DNA αρχίζει µε το σπάσιµο των
υδρογονικών δεσµών µεταξύ των δύο συµπληρωµατικών
αλυσίδων µε τη βοήθεια ενζύµων που ονοµάζονται
α. DNA πολυµεράσες.
β. DNA ελικάσες.
γ. DNA δεσµάσες.
δ. RNA πολυµεράσες.
Μονάδες 5
3. Οι ιντερφερόνες είναι πρωτεΐνες οι οποίες παράγονται
από κύτταρα
α. που µολύνθηκαν από ιούς.
β. που µολύνθηκαν από µύκητες.
γ. ατόµων µε χρωµοσωµικές ανωµαλίες.
δ. µόνο φυτικών οργανισµών.
Μονάδες 5
ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ

4. Η φαινυλκετονουρία οφείλεται σε γονίδιο
α. αυτοσωµικό υπολειπόµενο.
β. φυλοσύνδετο υπολειπόµενο.
γ. αυτοσωµικό επικρατές.
δ. φυλοσύνδετο επικρατές.

Μονάδες 5

5. Το βακτήριο Clostridium είναι ένας µικροοργανισµός
α. υποχρεωτικά αερόβιος.
β. υποχρεωτικά αναερόβιος.
γ. που ζει σε πολύ υψηλές θερµοκρασίες.
δ. που απαιτεί υψηλή συγκέντρωση οξυγόνου.
Μονάδες 5
ΘΕΜΑ 2ο
Α
α. Να αναφέρετε τα βήµατα που απαιτούνται για την
παραγωγή φαρµακευτικής πρωτεΐνης ανθρώπινης
προέλευσης από ένα διαγονιδιακό ζώο.
Μονάδες 12
β. Τι είναι η µικροέγχυση;

Μονάδες 5

Β. Τι περιέχει
α. µια γονιδιωµατική βιβλιοθήκη;
β. µια C-DNA βιβλιοθήκη;
Μονάδες 8
ΘΕΜΑ 3ο
Α. Σε µια θέση έναρξης αντιγραφής του DNA, η σύνθεση
στη µια αλυσίδα είναι συνεχής, όπως φαίνεται στο
παρακάτω σχήµα:

ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ

α. Να µεταφέρετε στο τετράδιό σας το παραπάνω σχήµα,
να σχεδιάσετε σ’ αυτό όλες τις νεοσυντιθέµενες
αλυσίδες του DNA και να σηµειώσετε τον
προσανατολισµό τους, γράφοντας τα 3΄ και 5΄ άκρα.
Μονάδες 5
β. Η σύνθεση των νέων αλυσίδων του DNA γίνεται είτε
µε συνεχή είτε µε ασυνεχή τρόπο. Γιατί συµβαίνει
αυτό;
Μονάδες 10
Β.

α. Ποια άτοµα ονοµάζονται ανευπλοειδή;
β. Τι είναι το σύνδροµο Klinefelter;

Μονάδες 5
Μονάδες 5

ΘΕΜΑ 4ο
Ένας φυσιολογικός άνδρας οµάδας αίµατος Ο, παντρεύεται
φυσιολογική γυναίκα οµάδας αίµατος Α, της οποίας ο
πατέρας ήταν αιµορροφιλικός οµάδας αίµατος Ο.
α. Ποιοι είναι οι γονότυποι των τριών παραπάνω ατόµων;
Να δικαιολογήσετε την απάντησή σας.
Μονάδες 6
β. Ποια είναι η πιθανότητα το παραπάνω ζευγάρι να
αποκτήσει γιο αιµορροφιλικό οµάδας αίµατος Ο; Να
δικαιολογήσετε την απάντησή σας.
Μονάδες 12
γ. Έστω ότι το παραπάνω ζευγάρι αποκτά ένα γιο
αιµορροφιλικό. Τι πιθανότητα έχει αυτό το άτοµο να
αποκτήσει φυσιολογικό παιδί;
Μονάδες 7

ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ

τα οποία και θα καταστραφούν µετά το πέρας της εξέτασης. Κάθε απάντηση επιστηµονικά τεκµηριωµένη είναι αποδεκτή. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες µετά τη διανοµή των φωτοαντιγράφων. 3. Κατά την αποχώρησή σας να παραδώσετε µαζί µε το τετράδιο και τα φωτοαντίγραφα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέµατα. Να γράψετε το ονοµατεπώνυµό σας στο πάνω µέρος των φωτοαντιγράφων αµέσως µόλις σας παραδοθούν.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ 1. 2. 6. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ Στο τετράδιο να γράψετε µόνο τα προκαταρκτικά (ηµεροµηνία. 5. εξεταζόµενο µάθηµα). Να µην αντιγράψετε τα θέµατα στο τετράδιό σας. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σηµείωση. Χρόνος δυνατής αποχώρησης : Μία (1) ώρα µετά τη διανοµή των φωτοαντιγράφων. 4.

μύκητες. Η εισαγωγή του ανασυνδυασμένου μορίου DNA σε βακτηριακό κύτταρο-ξενιστή ονομάζεται α. ιούς. γονιδιωματική βιβλιοθήκη. Μονάδες 5 3. μετασχηματισμός. δ. γ. δ. γ. βακτήρια. φυτά. επικρατή και υπολειπόμενα. βακτηριακός κλώνος. συνεπικρατή γονίδια. β. Μονάδες 5 2. ατελώς επικρατή. δ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 16 ΣΕΠΤΕΜΒΡΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1 ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και. το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. β. Τα δύο αλληλόμορφα γονίδια που εκφράζονται ταυτόχρονα στο φαινότυπο των ετερόζυγων ατόμων ονομάζονται α. δίπλα του. θνησιγόνα γονίδια. 1. β. Οι περιοριστικές ενδονουκλεάσες παράγονται από α. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . cDNA βιβλιοθήκη. γ.

Ποια είναι τα είδη του RNA και ποιος είναι ο ρόλος κάθε είδους. β. δ. στο κυτταρόπλασμα. Να περιγράψετε τι συμβαίνει σε κάθε φάση. Μονάδες 8 ΘΕΜΑ 3ο Α. Τι είναι το πλασμίδιο Τi και πώς χρησιμοποιείται για τη δημιουργία των διαγονιδιακών φυτών. Στα σωματικά κύτταρα του ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα. στον πυρήνα. γίνεται πλήρης αντικατάσταση του μεταλλαγμένου γονιδίου. Ποιες είναι οι φάσεις που παρατηρούνται σε μια κλειστή καλλιέργεια μικροοργανισμών. δ. στο κεντρομερίδιο. τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό. Μονάδες 5 5. Η μεταγραφή σ’ ένα ευκαρυωτικό κύτταρο γίνεται α. γ. γ. β. τα φυσιολογικά γονίδια εισάγονται κατ’ ευθείαν στον οργανισμό. χρησιμοποιούνται ως φορείς βακτήρια ή πρωτόζωα. Μονάδες 8 2. Μονάδες 5 ΘΕΜΑ 2 ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του. Μονάδες 9 3. Μονάδες 2 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. Κατά την in vivo γονιδιακή θεραπεία α. 1. στα ριβοσώματα.

1. Να περιγράψετε το μηχανισμό που προκαλεί αυτή τη χρωμοσωμική ανωμαλία. Μονάδες 6 2. 2. I II 1 2 1 2 3 III 1 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ 2 3 . Στον καρυότυπο των ατόμων με το συγκεκριμένο σύνδρομο εμφανίζεται ένα επιπλέον χρωμόσωμα. Μονάδες 3 Το σύνδρομο Down είναι η πιο κοινή χρωμοσωμική ανωμαλία. Β. Πόσα αυτοσωμικά χρωμοσώματα σωματικά κύτταρα μιας γυναίκας. Μονάδες 9 ΘΕΜΑ 4 ο Το παρακάτω γενεαλογικό δένδρο αναπαριστά τον τρόπο κληρονόμησης της β-θαλασσαιμίας σε μια οικογένεια. Ποια είναι τα φαινοτυπικά χαρακτηριστικά των ατόμων που πάσχουν από σύνδρομο Down. Μονάδες 3 υπάρχουν στα Μονάδες 2 Να δικαιολογήσετε την απάντησή σας.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Να δικαιολογήσετε την απάντησή σας.

ΙΙ 3 ) θελήσει να αποκτήσει και τέταρτο παιδί. κατεύθυνση. Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Μονάδες 12 Αν το ζευγάρι (ΙΙ 2 .ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Με βάση τα δεδομένα του γενεαλογικού δένδρου. Μονάδες 8 Να γράψετε και να εξηγήσετε τους γονότυπους όλων των ατόμων του παραπάνω γενεαλογικού δένδρου. ποια είναι η πιθανότητα το παιδί αυτό να πάσχει από β-θαλασσαιμία. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. Να δικαιολογήσετε την απάντησή σας. 3. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 5. 4. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Να δικαιολογήσετε την απάντησή σας. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 6. 2. Να μην αντιγράψετε τα θέματα στο τετράδιο. εξεταζόμενο μάθημα). να βρείτε αν η β-θαλασσαιμία κληρονομείται ως επικρατής ή υπολειπόμενος χαρακτήρας και αν οφείλεται σε αυτοσωμικό ή φυλοσύνδετο γονίδιο. Μονάδες 5 1. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν.

φυλοσύνδετο υπολειπόμενο γονίδιο. Η αιμορροφιλία Α είναι μια ασθένεια που εμφανίζεται… α. Στα πειράματά τους οι Avery. αυτοσωμικό υπολειπόμενο γονίδιο. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . στις πρωτεΐνες. μόνο στα αρσενικά άτομα. 1. φυλοσύνδετο επικρατές γονίδιο. στο RNA. Μονάδες 5 3. β. μόνο στα θηλυκά άτομα. δ. δ. Μονάδες 5 2. β. Mac-Leod και McCarty διαπίστωσαν ότι o μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται … α. γ. συχνότερα στα θηλυκά άτομα. γ. Ο χαρακτήρας προσκολλημένοι λοβοί των αυτιών στον άνθρωπο καθορίζεται από … α. δ. στο DNA.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ∆ΕΥΤΕΡΑ 4 ΙΟΥΛΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. β. στους υδατάνθρακες. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. συχνότερα στα αρσενικά άτομα. γ. αυτοσωμικό επικρατές γονίδιο.

η αναστροφή. η μετατόπιση. Τι μπορούμε να πετύχουμε με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης (PCR) και ποιες είναι οι πρακτικές εφαρμογές της. μόνο της στατικής φάσης ανάπτυξής τους. Η χρωμοσωμική ανωμαλία που αλλάζει την ποσότητα του γενετικού υλικού ενός κυττάρου είναι … α. της εκθετικής και στατικής φάσης ανάπτυξής τους. Οι μικροοργανισμοί παράγουν συνήθως χρήσιμα προϊόντα κατά τη διάρκεια … α. Μονάδες 5 5. Τι δυνατότητες δίνουν στους αγρότες τα γενετικά τροποποιημένα φυτά (Μονάδες 4) και ποια είναι τα κυριότερα φυτά που έχουν τροποποιηθεί γενετικά (Μονάδες 5). η αμοιβαία μετατόπιση. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. β. μόνο της εκθετικής φάσης ανάπτυξής τους. δ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 4. Μονάδες 8 3. πριν προχωρήσουν στην απόκτηση απογόνων. Μονάδες 9 2. γ. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση. γ. Μονάδες 8 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . δ. ο διπλασιασμός. β. της λανθάνουσας και εκθετικής φάσης ανάπτυξής τους.

Γιατί η χρήση της γονιδιακής περιορισμένη στο άμεσο μέλλον. Μονάδες 8 2. και η διεύθυνση της μεταγραφής. 1. μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών. Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου (Μονάδες 6) και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του (Μονάδες 2). Ποια διαδικασία ακολουθείται στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος η οποία οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (Μονάδες 8) και τι πιθανά προβλήματα αντιμετωπίζουν τα άτομα που πάσχουν από τη συγκεκριμένη ασθένεια (Μονάδες 3). ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . θεραπείας θα είναι Μονάδες 6 ΘΕΜΑ 4ο ∆ίνονται τρία κωδικόνια ενός τμήματος γονιδίου από ένα μόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τμήματος μιας πρωτεΐνης.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΘΕΜΑ 3ο Η Βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της Ιατρικής. Μονάδες 11 3.

Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Να μην αντιγράψετε τα θέματα στο τετράδιο. εξεταζόμενο μάθημα). Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. κατεύθυνση. η οποία δεν τροποποιείται.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ Να ορίσετε τα άκρα 3΄ και 5΄ των παραπάνω αλυσίδων DNA και να αιτιολογήσετε την απάντησή σας (Μονάδες 5). Μονάδες 25 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Ποιο ένζυμο καταλύει το μηχανισμό της μεταγραφής και ποια είναι η δράση του μετά την πρόσδεσή του στον υποκινητή (Μονάδες 7). τα οποία θα καταστραφούν μετά το πέρας της εξέτασης. Τι επιπτώσεις μπορεί να έχει στη λειτουργικότητα της πρωτεΐνης. ∆εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. σημειώνοντας τα άκρα 3΄ και 5΄ και να αιτιολογήσετε την απάντησή σας (Μονάδες 7). 2. 3. αμέσως μόλις σας παραδοθούν. 4. Να γράψετε την αλληλουχία των βάσεων του τμήματος του mRNA που προκύπτει από τη μεταγραφή. η προσθήκη τριών διαδοχικών βάσεων που δεν κωδικοποιούν κωδικόνιο λήξης ή μιας βάσης. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων. μεταξύ των παραπάνω κωδικονίων (Μονάδες 6). Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.

30΄ πρωινή.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 5. 6. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ . Χρόνος δυνατής αποχώρησης: μετά τη 10.

γ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . εντοπίζονται στα φυτικά και στα βακτηριακά κύτταρα. 1. β. ο πληθυσμός των μικροοργανισμών … α. β. Κατά τη λανθάνουσα φάση. β. τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς. τα κύτταρα πολλαπλασιάζονται στο εργαστήριο. δ. υπάρχουν στα σωματικά και στα γεννητικά κύτταρα.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. υπάρχουν μόνο στα γεννητικά κύτταρα. παραμένει σχεδόν σταθερός. γ. τα κύτταρα συντήκονται με αντισώματα. δ. αυξάνεται σταθερά. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν. σε μια κλειστή καλλιέργεια. αυξάνεται με γρήγορους ρυθμούς. γ. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Μονάδες 5 2. Τα φυλετικά χρωμοσώματα … α. εντοπίζονται μόνο στα σωματικά κύτταρα. δ. Μονάδες 5 3. Ex vivo ονομάζεται η γονιδιακή θεραπεία κατά την οποία … α. χαρακτηρίζεται από αυξομειώσεις.

χρωμοσωμική ανωμαλία οφείλεται… ο αλφισμός. Μονάδες 5 5. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. δ. δ. η θαλασσαιμία.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ 4. β. άτομα που πάσχουν από αιμορροφιλία Β.αντιθρυψίνη. β. Σε α. η α 1 . Σε α. Μονάδες 7 2. η απαμινάση της αδενοσίνης. χορηγείται … η αυξητική ορμόνη. γ. το σύνδρομο φωνή της γάτας. η κυστική ίνωση. Ποια είναι τα πλεονεκτήματα της χρησιμοποίησης διαγονιδιακών ζώων και φυτών για την αύξηση της ζωικής και φυτικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων. Μονάδες 9 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Ποια είναι η δομή του DNA στο χώρο σύμφωνα με το μοντέλο της διπλής έλικας των Watson και Crick. γ. ο παράγοντας IΧ. Τι είναι οι ιντερφερόνες. Μονάδες 9 3. τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών.

Με βάση τα δεδομένα του γενεαλογικού δέντρου να βρείτε αν η δρεπανοκυτταρική αναιμία α. κληρονομείται ως επικρατής ή υπολειπόμενος χαρακτήρας. Να αιτιολογήσετε τις απαντήσεις σας και να προσδιορίσετε τους γονότυπους των μελών της οικογένειας (Μονάδες 12). οφείλεται σε αυτοσωμικό ή φυλοσύνδετο γονίδιο (Μονάδες 2). β. Μονάδες 5 3. Μονάδες 14 2. Πού οφείλεται η δρεπανοκυτταρική αναιμία. 1. Τι προβλήματα προκαλούν τα δρεπανοκύτταρα στους ασθενείς με δρεπανοκυτταρική αναιμία.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΘΕΜΑ 3ο Το παρακάτω γενεαλογικό δέντρο αναπαριστά τον τρόπο με τον οποίο κληρονομείται η δρεπανοκυτταρική αναιμία σε μια οικογένεια. Μονάδες 6 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .

Πώς μπορούμε να δημιουργήσουμε ένα ανασυνδυασμένο πλασμίδιο.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ ΘΕΜΑ 4ο ∆ίνεται τμήμα μορίου DNA ευκαρυωτικού κυττάρου που περιέχει ασυνεχές γονίδιο. ∆ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων από το γενετικό κώδικα: Μεθειονίνη → ΑUG Φαινυλαλανίνη → UUU Βαλίνη → GUU ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ αμινοξέων και Μονάδες 25 . που να περιέχει το συγκεκριμένο γονίδιο χρησιμοποιώντας την περιοριστική ενδονουκλεάση EcoRI. το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου. (Μονάδες 7). το πρόδρομο m−RNA και το ώριμο m−RNA (Μονάδες 4) και να ορίσετε τα 3΄ και 5΄ άκρα των παραπάνω νουκλεοτιδικών αλυσίδων αιτιολογώντας την απάντησή σας (Μονάδες 8). που δεν έχει υποστεί καμιά τροποποίηση: H 2 N − Μεθειονίνη − φαινυλαλανίνη − βαλίνη − COOH Να γράψετε την κωδική και τη μη κωδική αλυσίδα του γονιδίου. Να αναφέρετε τις διαδικασίες κατά την πορεία από το γονίδιο στο πεπτίδιο και τις περιοχές του κυττάρου στις οποίες πραγματοποιούνται (Μονάδες 6).

τα οποία θα καταστραφούν μετά το πέρας της εξέτασης. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ Γ΄ ΤΑΞΗ Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. κατεύθυνση. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. εξεταζόμενο μάθημα). Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. αμέσως μόλις σας παραδοθούν. 6. Να μην αντιγράψετε τα θέματα στο τετράδιο. Χρόνος δυνατής αποχώρησης: μετά τη 10. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ . 2. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 3. 4. 5. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων.30΄ πρωινή. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων.

δ. γ. β.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. αποτελούν βασικό συστατικό του νουκλεοσώματος. χρήση βιοαντιδραστήρων. γ. καταλύουν την ωρίμανση του πρόδρομου mRΝΑ. φέρουν πληροφορίες για πρωτεΐνες με αντιγονική δράση. Μονάδες 3 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . δ. να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. Μονάδες 3 Τα πλασμίδια α. Μονάδες 3 Η επιλογή ενός βακτηριακού κλώνου που περιέχει το επιθυμητό τμήμα DNA γίνεται με α. 3. γ. μεταξύ άλλων. Οι α. χρήση αντιβιοτικών. συνδέουν τα κομμάτια της ασυνεχούς αλυσίδας του DNA. 2. δ. είναι δίκλωνα. β. αρχίζουν την αντιγραφή του DNA. κυκλικά μόρια DNA με διάφορα μεγέθη. DNA πολυμεράσες. Για τις ημιτελείς προτάσεις 1 έως και 5. χρήση ειδικών μορίων ανιχνευτών. επιδιορθώνουν λάθη που συμβαίνουν στην αντιγραφή του DNA. ένζυμα πρωτεϊνοσύνθεσης. β. απαντούν σε όλους τους ευκαρυωτικούς οργανισμούς. 1.

β. ∆ύο στοιχεία της Στήλης ΙΙ περισσεύουν. συνοπτικά. ζ. κυττάρων ή οργανισμών. 3. β. γ. 5. παραγωγής αντισωμάτων. ε. γ. δ. τα μιτοχόνδρια και τα ριβοσώματα. Η κλωνοποίηση είναι διαδικασία α. οι χλωροπλάστες και ο πυρήνας. Ποιες είναι. δημιουργίας πανομοιότυπων μορίων. Μονάδες 3 Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται α. Μονάδες 3 B. γ. αύξησης του χρόνου διπλασιασμού των κυττάρων. 5. β. 2. τα ζεύγη των φυλετικών χρωμοσωμάτων. η. Μονάδες 10 ΘΕΜΑ 2ο Α. δ. 4. οι χλωροπλάστες και τα μιτοχόνδρια. Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και δίπλα στον αριθμό αυτό το γράμμα από στοιχείο της Στήλης ΙΙ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 4. Στήλη ΙΙ αδελφές χρωματίδες ορμόνη υβρίδωμα tRNA μικροέγχυση ιντερφερόνη ζύμωση Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . ώστε να προκύπτει σωστή αντιστοίχιση. δ. Στήλη Ι αντικωδικόνιο κεντρομερίδιο βιοαντιδραστήρας διαγονιδιακά ζώα ινσουλίνη α. οι λειτουργίες του γενετικού υλικού. δημιουργίας της συμπληρωματικής αλυσίδας σε μονόκλωνο μόριο DNA. 1.

Μονάδες 3 3. 1. Πώς παράγονται στο εργαστήριο μεγάλες ποσότητες μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο. 1. Μονάδες 15 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 3 5. Το πλασμίδιο Τi υπάρχει σε όλα τα διαγονιδιακά ζώα. αν αυτή είναι λανθασμένη. Η ποσότητα του DNA σε κάθε οργανισμό είναι σταθερή και δεν μεταβάλλεται από τις αλλαγές στο περιβάλλον. Για καθεμιά από τις επόμενες προτάσεις να γράψετε στο τετράδιό σας τον αριθμό της και ακριβώς δίπλα την ένδειξη Σ. Οι μικροοργανισμοί για τους οποίους το οξυγόνο είναι τοξικό χαρακτηρίζονται ως υποχρεωτικά αναερόβιοι. Η γονιδιακή θεραπεία στηρίζεται στην εφαρμογή της τεχνολογίας του ανασυνδυασμένου DNA. Μονάδες 3 ΘΕΜΑ 3ο Ο οργανισμός μας είναι ικανός να παράγει αντισώματα εναντίον κάθε ξένου αντιγόνου. αν η πρόταση είναι σωστή. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Β. ή Λ. Μονάδες 3 4. Μονάδες 10 2. Μονάδες 3 2. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος. δηλαδή κάθε κωδικόνιο ανήκει σε ένα μόνο νουκλεοτίδιο.

απαντάται σε κάθε μόριο mRNA. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. 4. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. εξεταζόμενο μάθημα). Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Να δικαιολογήσετε την απάντησή σας. Τα θέματα δεν θα τα αντιγράψετε στο τετράδιο. 5. 3. κατεύθυνση. Μονάδες 2 4. ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 6 3. σύμφωνα με το γενετικό κώδικα. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να γράψετε στο τετράδιό σας το μόριο του mRNA επισημαίνοντας το 5΄ και το 3΄ άκρο της αλυσίδας του. Να γράψετε στο τετράδιό σας την αλληλουχία των βάσεων του δίκλωνου μορίου DNA από το οποίο προήλθε. Κάθε λύση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Ποια είναι αυτή. Μονάδες 9 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. πώς ονομάζεται και ποιο αμινοξύ κωδικοποιεί. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Πόσα αμινοξέα συγκροτούν την ολιγοπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του παραπάνω μορίου mRNA.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΘΕΜΑ 4ο Η αλληλουχία των βάσεων ενός βακτηριακού mRNA είναι: AUGAAAUUUCCCGGGGAUUGAUAA 1. 2. Μονάδες 8 2. Στο μόριο του mRNA που σας δόθηκε υπάρχει μία τριπλέτα η οποία.

ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 6. 7. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ . Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων.

το σύμπλεγμα πολλών ριβοσωμάτων με το mRNA. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . είναι ομόζυγο για το υπολειπόμενο γονίδιο της αχρωματοψίας. δ. γ. Αυτό οφείλεται στο γεγονός ότι α. του διπλασιασμού. β. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. το σύνολο των εξωνίων ενός ώριμου mRNA. κληρονόμησε αυτή την ιδιότητα από τη μητέρα του.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 6 ΙΟΥΛΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. β. της αμοιβαίας μετατόπισης. Η ποσότητα του γενετικού υλικού ενός κυττάρου αλλάζει στην περίπτωση της χρωμοσωμικής ανωμαλίας α. Μονάδες 5 3. Πολύσωμα είναι α. κληρονόμησε αυτή την ιδιότητα από τον πατέρα του. β. κληρονόμησε αυτή την ιδιότητα και από τους δύο γονείς του. Μονάδες 5 2. γ. Ένα αγόρι πάσχει από μερική αχρωματοψία στο πράσινο και στο κόκκινο χρώμα. 1. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. της μετατόπισης. δ. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. της αναστροφής. δ.

Μονάδες 5 5. Η ένωση αυτή γίνεται με τη βοήθεια του ενζύμου α. Ποιοι παράγοντες μπορεί να δράσουν ως μεταλλαξογόνοι και με ποιο τρόπο τα κύτταρα αντιμετωπίζουν τις αλλαγές που εμφανίζονται από τη δράση τους. Μονάδες 8 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Να τις περιγράψετε. Μονάδες 4 2. γ. DNA πολυμεράση. Μονάδες 5 4. DNA δεσμάση. β. Ποιες φάσεις ανάπτυξης παρατηρούνται σε μια κλειστή καλλιέργεια μικροοργανισμών. γ. δ. συντήκονται με καρκινικά κύτταρα. τα οποία κόπηκαν από την ίδια περιοριστική ενδονουκλεάση. Ποια βήματα ακολουθούνται για την κατασκευή μιας cDNA βιβλιοθήκης. DNA ελικάση. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. δ. τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν. Στην ex vivo γονιδιακή θεραπεία τα κύτταρα του ασθενούς α. τροποποιούνται μέσα στον οργανισμό του. Μονάδες 8 3. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα. Για τη δημιουργία ανασυνδυασμένου DNA ενώνονται τμήματα DNA διαφορετικών οργανισμών. β.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. ιχνηθετούνται με ραδιενεργό φώσφορο. RNA πολυμεράση.

Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τμήμα του μορίου DNA (μονάδες 8). φαινότυπος και τι γονότυπος ενός Μονάδες 5 ΘΕΜΑ 4ο ∆ίνεται το πεπτίδιο H2N – Μεθειονίνη – Αλανίνη – Τυροσίνη – Προλίνη – Σερίνη – COOH. Να περιγράψετε τη διαδικασία ωρίμανσης του πρόδρομου mRNA (μονάδες 8). που προέκυψαν από την πρώτη διασταύρωση. που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαρυωτικού κυττάρου: 5΄ C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 ΄ 3΄ G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 ΄ Να γράψετε την αλληλουχία του πρόδρομου mRNA. να υπολογίσετε την πιθανότητα να προκύψουν φυτά με πορτοκαλί άνθη και στρογγυλούς καρπούς.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 3ο Ένας γεωργός καλλιεργεί στο κτήμα του ένα φυτό που έχει κίτρινα ή κόκκινα άνθη και καρπούς με στρογγυλό ή ωοειδές σχήμα. 1. Μονάδες 12 3. Να κάνετε τη διασταύρωση και να αιτιολογήσετε τα αποτελέσματα. ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Αν διασταυρωθούν μεταξύ τους τα φυτά. Τι ονομάζεται οργανισμού. την αλληλουχία του ώριμου mRNA που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντησή σας (μονάδες 9). Μονάδες 8 2. Από τη διασταύρωση φυτών με κίτρινα άνθη και στρογγυλούς καρπούς με φυτά που έχουν κόκκινα άνθη και ωοειδείς καρπούς πήρε μόνο φυτά με πορτοκαλί άνθη και ωοειδείς καρπούς. Τα στελέχη που διασταυρώθηκαν ήταν αμιγή και τα γονίδια που ελέγχουν τις δύο ιδιότητες βρίσκονται σε διαφορετικά ζεύγη ομολόγων χρωμοσωμάτων.

Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. κατεύθυνση.30΄ πρωινή. εξεταζόμενο μάθημα). αμέσως μόλις σας παραδοθούν. 3. 5. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . 4. Να μην αντιγράψετε τα θέματα στο τετράδιο. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων από το γενετικό κώδικα: Αλανίνη → GCC Μεθειονίνη → AUG Προλίνη → CCC Σερίνη → AGC Τυροσίνη → UAU αμινοξέων και Μονάδες 25 Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) 1. Χρόνος δυνατής αποχώρησης: μετά τη 10. Τα σχήματα που θα χρησιμοποιήσετε στο τετράδιο μπορείτε να τα σχεδιάσετε και με μολύβι. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 6. 2. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων.

Μονάδες 3 Οι περιοριστικές ενδονουκλεάσες α. παράγονται από ιούς. 4. δ. δ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. H μεταγραφή του DNA καταλύεται από την α. 3. παράγονται από βακτήρια. γ. λιπίδια. συμμετέχουν στην αντίστροφη μεταγραφή. δ. β. β. πρωτεΐνες. DNA πολυμεράση. β. γ. RNA πολυμεράση. Για τις ημιτελείς προτάσεις 1 έως και 5. Μονάδες 3 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . υδατάνθρακες. DNA πολυμεράση και RNA πολυμεράση. β. σε όλα τα κύτταρα του ανθρώπινου σώματος. γ. γ. μόνο κατά τη μεσόφαση. μόνο στους γαμέτες. 2. μόνο κατά την αναπαραγωγική ηλικία. Μονάδες 3 Τα αντισώματα είναι α. DNA δεσμάση και DNA πολυμεράση. να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. είναι απαραίτητες για την έναρξη της αντιγραφής. Μονάδες 3 Τα φυλετικά χρωμοσώματα του ανθρώπου απαντώνται α. 1. νουκλεϊκά οξέα. δ.

θυμίνη. β. Ποια είναι τα τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή και ποιος ο ρόλος του καθενός από αυτά. DNA δεσμάση. Να μεταφέρετε στο τετράδιό σας τις δύο ενότητες που ακολουθούν. Η ασθένεια που οφείλεται στην έλλειψη ή μείωση της ινσουλίνης ονομάζεται (διαβήτης – αναιμία). Τα μιτοχόνδρια περιέχουν ως γενετικό υλικό (DNA– RNA). αφού παραλείψετε όρους από τους ευρισκόμενους μέσα σε παρένθεση.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 5. Μονάδες 3 B. γ. Μονάδες 4 2. έτσι ώστε οι προτάσεις που θα παραμείνουν να είναι σωστές. Τα μιτοχόνδρια χαρακτηρίζονται ως (αυτόνομα – ημιαυτόνομα) οργανίδια και στους ανώτερους οργανισμούς έχουν (μητρική – πατρική) προέλευση. αδενίνη. αδενίνη. φωσφορική ομάδα. φωσφορική ομάδα. δ. ουρακίλη. φωσφορική ομάδα. Η ινσουλίνη είναι μία (ορμόνη – βιταμίνη) που αποτελείται από 51 (αμινοξέα – νουκλεοτίδια) και παράγεται από ειδικά κύτταρα του (ήπατος – παγκρέατος). δεοξυριβόζη. δεοξυριβόζη. Ρυθμίζει το μεταβολισμό των (υδατανθράκων – πρωτεϊνών) και ειδικότερα το ποσοστό τους (στο αίμα – στα ούρα). 1. φωσφορική ομάδα. ριβόζη. Ένα νουκλεοτίδιο DNA μπορεί να αποτελείται από α. Μονάδες 6 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . το οποίο κωδικοποιεί μικρό αριθμό πρωτεϊνών που ελέγχουν τη λειτουργία της (φωτοσύνθεσης – οξειδωτικής φωσφορυλίωσης). Μονάδες 10 ΘΕΜΑ 2ο Α.

Μονάδες 3 ΘΕΜΑ 3ο Η παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης μπορεί να γίνει και από τα διαγονιδιακά ζώα. Η γονιδιακή θεραπεία στοχεύει να “διορθώσει” τη γενετική βλάβη εισάγοντας στους ασθενείς φυσιολογικά αλληλόμορφα του μεταλλαγμένου γονιδίου. Να χαρακτηρίσετε καθεμία από τις προτάσεις που ακολουθούν γράφοντας στο τετράδιό σας. Μονάδες 3 4. Μονάδες 3 5. Μονάδες 6 2. 1. από ποιους άλλους οργανισμούς είναι δυνατή η παραγωγή ανθρώπινης φαρμακευτικής πρωτεΐνης και σε ποιο χαρακτηριστικό του γενετικού κώδικα στηρίζεται η δυνατότητα αυτή. Οι DNA ελικάσες σπάνε τους δεσμούς υδρογόνου μεταξύ δύο πολυνουκλεοτιδικών αλυσίδων RNA. υπάρχουν και τα πλασμίδια. Μονάδες 3 2. ή το γράμμα Λ. δίπλα από τον αριθμό κάθε πρότασης. το γράμμα Σ. σημειώνονται Μονάδες 3 3. Οι γενετικά τροποποιημένες τομάτες δημιουργούνται με ελεγχόμενες διασταυρώσεις.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Β. Σε μία συνεχή καλλιέργεια δεν θάνατοι των μικροοργανισμών. αν αυτή είναι Λανθασμένη. εκτός από το κύριο κυκλικό μόριο DNA. Ποια είναι τα βήματα της διαδικασίας που προηγούνται της γέννησης ενός διαγονιδιακού ζώου. 1. Σε πολλά βακτήρια. Μονάδες 10 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Εκτός από τα διαγονιδιακά ζώα. αν αυτή είναι Σωστή.

Από τις φιάλες αυτές έχει απομακρυνθεί ο αέρας.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 3. ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . απομακρύνονται τα πώματα από τις φιάλες των καλλιεργειών και οι μικροοργανισμοί έρχονται σε επαφή με τον ατμοσφαιρικό αέρα. ενώ ο μικροοργανισμός Β τους 45 ο C. Γιατί η κλωνοποίηση είναι χρήσιμη πολλαπλασιασμό των διαγονιδιακών ζώων. Β Α t1 t2 35 o C χρόνος 45 o C Τη χρονική στιγμή t1. για τον Μονάδες 9 αριθμός μικροοργανισμών ΘΕΜΑ 4ο Σε αποστειρωμένο θάλαμο καλλιεργειών όπου η θερμοκρασία έχει ρυθμιστεί στους 35 ο C έχουν τοποθετηθεί δύο φιάλες με καλλιέργειες μικροοργανισμών. Ο μικροοργανισμός Α έχει άριστη θερμοκρασία ανάπτυξης τους 35 ο C. για κάποιο λόγο. Στη μία φιάλη καλλιεργείται ο μικροοργανισμός Α και στην άλλη ο μικροοργανισμός Β.

Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να εξηγήσετε γιατί συμβαίνει η αλλαγή αυτή στον καθένα από τους δύο πληθυσμούς. Με βάση το παραπάνω διάγραμμα. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. 7. ποια είναι η αλλαγή που παρατηρείται στους πληθυσμούς των μικροοργανισμών Α και Β. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. Κάθε λύση επιστημονικά τεκμηριωμένη είναι αποδεκτή.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 1. κατεύθυνση. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 10 3. α. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Μονάδες 5 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. 3. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Μονάδες 5 β. 5. Μονάδες 5 2. 6. Στη χρονική στιγμή t 2 η θερμοκρασία του θαλάμου καλλιέργειας αλλάζει στους 45 ο C. Ποια θα είναι η επίδραση της αλλαγής αυτής στον πληθυσμό του μικροοργανισμού Β. Ποια θα είναι η επίδραση της αλλαγής αυτής στον πληθυσμό του μικροοργανισμού Α. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. εξεταζόμενο μάθημα). ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Τα θέματα δεν θα τα αντιγράψετε στο τετράδιο. 4. 2.

παραγωγής διαγονιδιακών ζώων. τη δημιουργία αντιγράφων των πολυπεπτιδικών αλυσίδων ενός οργανισμού. γ. συμβαίνει μόνο στους ευκαρυωτικούς οργανισμούς. τον προσδιορισμό όλων των σωματικών κυττάρων ενός οργανισμού. β. οδηγεί στη δημιουργία m-RNA χωρίς εξώνια. δ. την αντιγραφή συγκεκριμένων αλληλουχιών DNA. δ. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. χωρίς μεσολάβηση ζωντανών κυττάρων.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. 1. β. παραγωγής διαγονιδιακών φυτών. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. Μονάδες 5 2. Η μικροέγχυση είναι μέθοδος α. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . β. Μονάδες 5 3. γ. γ. παραγωγής μονοκλωνικών αντισωμάτων. Η μέθοδος της αλυσιδωτής αντίδρασης PCR μας επιτρέπει α. εισαγωγής ξένου DNA σε ιούς. δ. Η ωρίμανση του RNA είναι μια διαδικασία η οποία α. τον ανασυνδυασμό πολλών πλασμιδίων από διαφορετικά βακτήρια. καταλύεται από το ένζυμο DNA ελικάση.

Μονάδες 6 3. γ. σε αναστροφή ενός χρωμοσωμικού τμήματος. απεικονίζει την ταξινόμηση των χρωμοσωμάτων κατά ελαττούμενο μέγεθος.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. στην έλλειψη ενός τμήματος του χρωμοσώματος 5. β. γ. Μονάδες 8 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Ο καρυότυπος α. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Ποιοι παράγοντες επηρεάζουν το ρυθμό ανάπτυξης των μικροοργανισμών σε μια μικροβιακή καλλιέργεια και με ποιο τρόπο. Τι είναι το πριμόσωμα και ποιος είναι ο ρόλος του στην αντιγραφή του DNA. δ. απεικονίζει το γενετικό υλικό κατά το στάδιο της μεσόφασης. Το α. χρησιμοποιείται για τον εντοπισμό γονιδιακών μεταλλάξεων. σύνδρομο φωνή της γάτας (cri-du-chat) οφείλεται σε αριθμητική χρωμοσωμική ανωμαλία. Μονάδες 7 4. Μονάδες 5 5. Μονάδες 4 2. δ. σε ουδέτερη γονιδιακή μετάλλαξη. Πώς προκύπτουν τα ογκογονίδια και πώς σχετίζονται με την καρκινογένεση. χρησιμοποιείται μόνο για τη μελέτη φυλετικών χρωμοσωμάτων. Πώς επιβεβαιώθηκε οριστικά από τους Hershey και Chase ότι το DNA είναι το γενετικό υλικό των κυττάρων. β.

..CTG AAG CGA GAA CCC.. 5΄. Να προσδιορίσετε τους τύπους των μεταλλάξεων που συνέβησαν στην αρχική αλληλουχία και τις επιπτώσεις τους στο γονιδιακό προϊόν σε κάθε μια από τις παρακάτω περιπτώσεις: α.3΄ 1. Σε ποιες περιπτώσεις οι γονιδιακές μεταλλάξεις δεν είναι επιβλαβείς για τον ανθρώπινο οργανισμό... Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από βθαλασσαιμία. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και βθαλασσαιμία... να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία. ενώ η Ελένη δεν παρουσιάζει καμία από τις δύο ασθένειες. Μονάδες 9 ΘΕΜΑ 4ο Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά.. χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6). το Γιάννη και την Ελένη.CTG CCG AAG CGA GAA CCC.3΄ β.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 3ο ∆ίνεται το παρακάτω τμήμα της κωδικής αλυσίδας ενός γονιδίου που κωδικοποιεί τμήμα μιας πρωτεΐνης.... ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Eαν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί.. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6). 5΄. 5΄. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα.CTG AAG CGA TAA CCC.3΄ Μονάδες 16 2.

∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7). Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. 2. αμέσως μόλις σας παραδοθούν. Χρόνος δυνατής αποχώρησης : μετά τη 10. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 3. 4. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. εξεταζόμενο μάθημα). κατεύθυνση.30΄ πρωινή. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 5. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. Τα σχήματα που θα χρησιμοποιήσετε στο τετράδιο μπορείτε να τα σχεδιάσετε και με μολύβι. 6. Μονάδες 25 Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) 1.

η οποία συμπληρώνει σωστά την ημιτελή πρόταση. δ. οι μεταγραφικοί παράγοντες. Εμβολιασμός είναι α. δ. δ. η αποστείρωση του θρεπτικού υλικού. β. τα πριμοσώματα. Μονάδες 5 2. Τα βακτηριακά ένζυμα που κόβουν το δίκλωνο DNA σε συγκεκριμένες θέσεις ονομάζονται α. περιοριστικές ενδονουκλεάσες. DNA δεσμάσες. τα πρωταρχικά τμήματα. β. η προσθήκη μικρής ποσότητας μικροοργανισμών σε θρεπτικό υλικό. β. οι υποκινητές. η προσθήκη θρεπτικών συστατικών σε μία καλλιέργεια. RNA πολυμεράσες. DNA πολυμεράσες. γ. γ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. Από RNA αποτελούνται α. Μονάδες 5 3. η απομάκρυνση άχρηστων προϊόντων από μία καλλιέργεια. 1. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . γ.

δ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4.λεμφοκύτταρα. Μονάδες 6 2. Ποια διαδικασία ακολούθησαν οι ερευνητές του Ινστιτούτου Roselin της Σκωτίας για τη δημιουργία ενός κλωνοποιημένου προβάτου. Πώς διατυπώνεται ο 1 ος νόμος του Mendel. απομονώνεται από το βακτήριο γ. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. β. Το πλασμίδιο Ti α. γ. απομονώνεται από το thuringiensis. (μονάδες 2) Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993. ρυθμίζει την παραγωγή αντιικών πρωτεϊνών. Τι είναι και πού οφείλεται η κυστική ίνωση. παράγεται από Β . Μονάδες 6 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . παράγεται από πρόδρομα ερυθροκύτταρα. ενσωματώνεται στο γενετικό κυττάρων. υλικό των φυτικών υλικό των ζωικών Μονάδες 5 5. βακτήριο Bacillus Escherichia coli. ρυθμίζει το μεταβολισμό των υδατανθράκων. Μονάδες 5 3. δ. β. Πώς μπορούμε να εντοπίσουμε ένα συγκεκριμένο κομμάτι κλωνοποιημένου DNA σε μία γονιδιωματική βιβλιοθήκη. ενσωματώνεται στο γενετικό κυττάρων. Η ινσουλίνη είναι μια ορμόνη που α. (μονάδες 6) Μονάδες 8 4.

5΄.. (μονάδες 8) Μονάδες 10 2. 1. Μονάδες 8 3. Μονάδες 7 ΘΕΜΑ 4ο ∆ίνεται το γενεαλογικό δέντρο μιας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Ι 1 2 ΙΙ 1 3 2 ΙΙΙ 1 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. Όλα τα μέλη της οικογένειας έχουν φυσιολογικό αριθμό και μέγεθος χρωμοσωμάτων.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 3ο ∆ίνεται το παρακάτω τμήμα μορίου βακτηριακού mRNA.. Το άτομο III 1 πάσχει από αιμορροφιλία Α. Να περιγράψετε το δεσμό με τον οποίο ενώνονται μεταξύ τους δύο διαδοχικά νουκλεοτίδια σε ένα μόριο mRNA. Ποιος είναι ο αριθμός των αμινοξέων που αποτελούν αυτή την πεπτιδική αλυσίδα. 3΄ Από τη μετάφραση αυτού του mRNA προκύπτει μία πεπτιδική αλυσίδα...Α G A U G A A A G C C A C G G A G C C C U G A G C A A . Να περιγράψετε το στάδιο έναρξης της πρωτεϊνοσύνθεσης.

2. 6. Χρόνος δυνατής αποχώρησης: μετά τη 10. (μονάδες 6) Πόσα συνολικά μόρια DNA περιέχονται στα χρωμοσώματα που απεικονίζονται στον καρυότυπο του παιδιού με σύνδρομο Klinefelter. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. (μονάδες 4) Το ζευγάρι II 2.00΄ πρωινή. 5. ∆εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. Να μη ληφθεί υπόψη η περίπτωση γονιδιακής μετάλλαξης. 3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. (μονάδες 4) Μονάδες 25 Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) 1. εξεταζόμενο μάθημα). 4. (μονάδες 6) Ποιο πρόβλημα αντιμετωπίζουν τα άτομα με αιμορροφιλία Α. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. κατεύθυνση. 7. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να περιγράψετε τη διαδικασία μέσω της οποίας προέκυψε ο γονότυπος του συγκεκριμένου παιδιού.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Να γράψετε τους πιθανούς γονότυπους όλων των μελών της οικογένειας που απεικονίζονται στο παραπάνω γενεαλογικό δέντρο (μονάδες 3) και να αιτιολογήσετε την απάντησή σας. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. II 3 αποκτά δεύτερο παιδί με αιμορροφιλία Α και σύνδρομο Klinefelter. (μονάδες 2) Να εξηγήσετε την απάντησή σας. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Να μην αντιγράψετε τα θέματα στο τετράδιο.

β. 1. γ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . δ. στη φάση θανάτου. δ. β. γ. οι μικροοργανισμοί Μονάδες 5 Τα άτομα που πάσχουν από σύνδρομο Turner έχουν στον καρυότυπό τους α. το πριμόσωμα. το πολύσωμα. 44 χρωμοσώματα. 45 χρωμοσώματα. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. γ. β. Τα πρωταρχικά τμήματα κατά την αντιγραφή του DNA συντίθενται από α.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. δ. στη λανθάνουσα φάση. 47 χρωμοσώματα. 3. στη στατική φάση. την DNA δεσμάση. 46 χρωμοσώματα. την DNA πολυμεράση. στην εκθετική φάση. Σε μια κλειστή καλλιέργεια διαιρούνται με ταχύ ρυθμό α. Μονάδες 5 2.

αυτοσωμικό επικρατή τύπο κληρονομικότητας.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. Το α. όπως οι χώρες της Μεσογείου. Μονάδες 12 3. (μονάδες 5) Μονάδες 7 2. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. φυλοσύνδετο επικρατή τύπο κληρονομικότητας. φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας. δ. δίκλωνο κυκλικό μόριο DNA. β. Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα (μονάδες 2) και για ποιο λόγο. Γιατί η συχνότητα των ετερόζυγων ατόμων με β-θαλασσαιμία είναι αυξημένη σε περιοχές. γ. δ. Μονάδες 5 Η κυστική ίνωση κληρονομείται με α. δίκλωνο κυκλικό μόριο RNA. δίκλωνο γραμμικό μόριο RNA. αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. γ. 5. πλασμίδιο είναι δίκλωνο γραμμικό μόριο DNA. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται. Μονάδες 6 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . β.

στο ένα Μονάδες 8 3. χρήση της τεχνολογίας του βακτηρίου Bacillus τη διαδικασία παραγωγής ανθεκτικών στα έντομα. με τη του ανασυνδυασμένου DNA και thuringiensis. όπως η γεωργία. τη χρήση της τεχνικής PCR και την παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε τομείς. η κτηνοτροφία και η Ιατρική. Μονάδες 10 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . 1. Να περιγράψετε διαγονιδιακών φυτών. Να περιγράψετε τη διαδικασία παραγωγής εργαστήριο μονοκλωνικών αντισωμάτων για επιλεγμένο αντιγόνο.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 3ο Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA. Μονάδες 7 2. (μονάδες 4) Να αναφέρετε τρεις πρακτικές εφαρμογές της (μονάδες 3). Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR).

Να υπολογίσετε την πιθανότητα να γεννηθεί παιδί με δρεπανοκυτταρική αναιμία και φυσιολογική όραση (μονάδες 6). Να γράψετε τους γονότυπους όλων των μελών της οικογένειας που απεικονίζεται στο γενεαλογικό δέντρο Α και να αιτιολογήσετε την απάντησή σας (μονάδες 5). Να αναφέρετε τις διαδικασίες που ακολουθούνται κατά τον προγεννητικό έλεγχο για τη δρεπανοκυτταρική αναιμία. Να αιτιολογήσετε την απάντησή σας (μονάδες 5). όταν η μητέρα βρίσκεται στην 11 η εβδομάδα της κύησης (μονάδες 4). Το ζευγάρι (Ι1. Μονάδες 25 ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Ι2) περιμένει τρίτο παιδί.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 4ο Τα παρακάτω γενεαλογικά δέντρα αναπαριστούν τον τρόπο με τον οποίο κληρονομείται στα μέλη της ίδιας οικογένειας η μερική αχρωματοψία στο πράσινο και το κόκκινο χρώμα (γενεαλογικό δέντρο Α) και η δρεπανοκυτταρική αναιμία (γενεαλογικό δέντρο Β). Να γράψετε τους γονότυπους όλων των μελών της οικογένειας που απεικονίζεται στο γενεαλογικό δέντρο Β και να αιτιολογήσετε την απάντησή σας (μονάδες 5).

εξεταζόμενο μάθημα). Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. κατεύθυνση. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. 4. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ .30΄ πρωινή.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ Ο∆ΗΓΙΕΣ (για τους εξεταζόμενους) 1. αμέσως μόλις σας παραδοθούν. 7. 5. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 2. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. Να μην αντιγράψετε τα θέματα στο τετράδιο. 3. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Χρόνος δυνατής αποχώρησης : μετά τη 10. 6. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή.

συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. παραγωγής μονοκλωνικών αντισωμάτων. Η μικροέγχυση είναι μέθοδος α.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. εισαγωγής ξένου DNA σε ιούς. β. Μονάδες 5 2. παραγωγής διαγονιδιακών φυτών. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . τον προσδιορισμό όλων των σωματικών κυττάρων ενός οργανισμού. Η μέθοδος της αλυσιδωτής αντίδρασης PCR μας επιτρέπει α. τη δημιουργία αντιγράφων των πολυπεπτιδικών αλυσίδων ενός οργανισμού. τον ανασυνδυασμό πολλών πλασμιδίων από διαφορετικά βακτήρια. οδηγεί στη δημιουργία m-RNA χωρίς εξώνια. γ. γ. παραγωγής διαγονιδιακών ζώων. την αντιγραφή συγκεκριμένων αλληλουχιών DNA. Η ωρίμανση του RNA είναι μια διαδικασία η οποία α. δ. 1. β. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. δ. συμβαίνει μόνο στους ευκαρυωτικούς οργανισμούς. Μονάδες 5 3. γ. δ. β. χωρίς μεσολάβηση ζωντανών κυττάρων. καταλύεται από το ένζυμο DNA ελικάση.

Τι είναι το πριμόσωμα και ποιος είναι ο ρόλος του στην αντιγραφή του DNA. απεικονίζει την ταξινόμηση των χρωμοσωμάτων κατά ελαττούμενο μέγεθος. Μονάδες 5 5. β. χρησιμοποιείται μόνο για τη μελέτη φυλετικών χρωμοσωμάτων. Πώς προκύπτουν τα ογκογονίδια και πώς σχετίζονται με την καρκινογένεση. Το α. σε ουδέτερη γονιδιακή μετάλλαξη. Μονάδες 6 3. Πώς επιβεβαιώθηκε οριστικά από τους Hershey και Chase ότι το DNA είναι το γενετικό υλικό των κυττάρων. στην έλλειψη ενός τμήματος του χρωμοσώματος 5. Ποιοι παράγοντες επηρεάζουν το ρυθμό ανάπτυξης των μικροοργανισμών σε μια μικροβιακή καλλιέργεια και με ποιο τρόπο. δ. γ. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. Μονάδες 7 4. χρησιμοποιείται για τον εντοπισμό γονιδιακών μεταλλάξεων.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. Ο καρυότυπος α. σύνδρομο φωνή της γάτας (cri-du-chat) οφείλεται σε αριθμητική χρωμοσωμική ανωμαλία. απεικονίζει το γενετικό υλικό κατά το στάδιο της μεσόφασης. Μονάδες 8 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . β. σε αναστροφή ενός χρωμοσωμικού τμήματος. δ. γ. Μονάδες 4 2.

να προσδιορίσετε την πιθανότητα να πάσχει μόνο από υπερχοληστερολαιμία.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 3ο ∆ίνεται το παρακάτω τμήμα της κωδικής αλυσίδας ενός γονιδίου που κωδικοποιεί τμήμα μιας πρωτεΐνης.... χωρίς να ληφθεί υπόψη η β-θαλασσαιμία (Μονάδες 6). Να προσδιορίσετε τους τύπους των μεταλλάξεων που συνέβησαν στην αρχική αλληλουχία και τις επιπτώσεις τους στο γονιδιακό προϊόν σε κάθε μια από τις παρακάτω περιπτώσεις: α... το Γιάννη και την Ελένη...CTG CCG AAG CGA GAA CCC... 5΄..3΄ 1.3΄ β. Eαν οι συγκεκριμένοι γονείς αποκτήσουν και τρίτο παιδί. ενώ η Ελένη δεν παρουσιάζει καμία από τις δύο ασθένειες. 5΄. Λαμβάνοντας υπόψη ότι τα γονίδια των αιμοσφαιρινών εκφράζονται στα πρόδρομα ερυθροκύτταρα. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών (Μονάδες 6) και να δικαιολογήσετε την απάντησή σας (Μονάδες 6).. Πρόσφατα ανακοινώθηκε μελέτη για την εφαρμογή της γονιδιακής θεραπείας σε ασθενείς που πάσχουν από βθαλασσαιμία.3΄ Μονάδες 16 2. Σε ποιες περιπτώσεις οι γονιδιακές μεταλλάξεις δεν είναι επιβλαβείς για τον ανθρώπινο οργανισμό.CTG AAG CGA GAA CCC. ποιος τύπος γονιδιακής θεραπείας θα μπορούσε να ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 9 ΘΕΜΑ 4ο Μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα και αποκτούν δύο παιδιά.. Ο Γιάννης παρουσιάζει οικογενή υπερχοληστερολαιμία και βθαλασσαιμία. 5΄.CTG AAG CGA TAA CCC.

2. Τα σχήματα που θα χρησιμοποιήσετε στο τετράδιο μπορείτε να τα σχεδιάσετε και με μολύβι. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 6. αμέσως μόλις σας παραδοθούν. Να μην αντιγράψετε τα θέματα στο τετράδιο. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 3. Χρόνος δυνατής αποχώρησης : μετά τη 10.30΄ πρωινή.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ εφαρμοστεί για την αντιμετώπιση της β-θαλασσαιμίας και γιατί (Μονάδες 7). 5. Μονάδες 25 Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) 1. εξεταζόμενο μάθημα). Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. κατεύθυνση. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 4. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων.

44 χρωμοσώματα. στη στατική φάση.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 26 ΜΑΪΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. β. γ. στην εκθετική φάση. β. Σε μια κλειστή καλλιέργεια διαιρούνται με ταχύ ρυθμό α. 1. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . γ. β. οι μικροοργανισμοί Μονάδες 5 Τα άτομα που πάσχουν από σύνδρομο Turner έχουν στον καρυότυπό τους α. δ. Τα πρωταρχικά τμήματα κατά την αντιγραφή του DNA συντίθενται από α. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. την DNA πολυμεράση. Μονάδες 5 2. 46 χρωμοσώματα. το πολύσωμα. δ. 3. δ. 45 χρωμοσώματα. στη φάση θανάτου. γ. την DNA δεσμάση. στη λανθάνουσα φάση. το πριμόσωμα. 47 χρωμοσώματα.

Το α. β. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. β. δίκλωνο κυκλικό μόριο RNA. αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας. Μονάδες 6 ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . πλασμίδιο είναι δίκλωνο γραμμικό μόριο DNA. δ. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται. γ. Μονάδες 5 Η κυστική ίνωση κληρονομείται με α. (μονάδες 5) Μονάδες 7 2.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. Μονάδες 12 3. φυλοσύνδετο επικρατή τύπο κληρονομικότητας. 5. Γιατί η συχνότητα των ετερόζυγων ατόμων με β-θαλασσαιμία είναι αυξημένη σε περιοχές. δίκλωνο κυκλικό μόριο DNA. όπως οι χώρες της Μεσογείου. φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας. δ. γ. αυτοσωμικό επικρατή τύπο κληρονομικότητας. Ποια κυτταρικά οργανίδια χαρακτηρίζονται ως ημιαυτόνομα (μονάδες 2) και για ποιο λόγο. δίκλωνο γραμμικό μόριο RNA.

ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ

ΘΕΜΑ 3ο
Η Βιοτεχνολογία με την ανάπτυξη της τεχνολογίας του
ανασυνδυασμένου DNA, τη χρήση της τεχνικής PCR και την
παραγωγή μονοκλωνικών αντισωμάτων συνεισφέρει σε
τομείς, όπως η γεωργία, η κτηνοτροφία και η Ιατρική.
1. Τι επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης της
πολυμεράσης (PCR); (μονάδες 4) Να αναφέρετε τρεις
πρακτικές εφαρμογές της (μονάδες 3).
Μονάδες 7
2. Να περιγράψετε τη διαδικασία παραγωγής
εργαστήριο μονοκλωνικών αντισωμάτων για
επιλεγμένο αντιγόνο.

στο
ένα

Μονάδες 8
3. Να
περιγράψετε
διαγονιδιακών φυτών,
χρήση της τεχνολογίας
του βακτηρίου Bacillus

τη
διαδικασία
παραγωγής
ανθεκτικών στα έντομα, με τη
του ανασυνδυασμένου DNA και
thuringiensis.
Μονάδες 10

ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ

ΘΕΜΑ 4ο
Τα παρακάτω γενεαλογικά δέντρα αναπαριστούν τον τρόπο
με τον οποίο κληρονομείται στα μέλη της ίδιας οικογένειας η
μερική αχρωματοψία στο πράσινο και το κόκκινο χρώμα
(γενεαλογικό δέντρο Α) και η δρεπανοκυτταρική αναιμία
(γενεαλογικό δέντρο Β).

Να γράψετε τους γονότυπους όλων των μελών της
οικογένειας που απεικονίζεται στο γενεαλογικό δέντρο Α
και να αιτιολογήσετε την απάντησή σας (μονάδες 5). Να
γράψετε τους γονότυπους όλων των μελών της οικογένειας
που απεικονίζεται στο γενεαλογικό δέντρο Β και να
αιτιολογήσετε την απάντησή σας (μονάδες 5). Το ζευγάρι
(Ι1, Ι2) περιμένει τρίτο παιδί. Να υπολογίσετε την
πιθανότητα να γεννηθεί παιδί με δρεπανοκυτταρική αναιμία
και φυσιολογική όραση (μονάδες 6). Να αιτιολογήσετε την
απάντησή σας (μονάδες 5). Να αναφέρετε τις διαδικασίες
που ακολουθούνται κατά τον προγεννητικό έλεγχο για τη
δρεπανοκυτταρική αναιμία, όταν η μητέρα βρίσκεται στην
11 η εβδομάδα της κύησης (μονάδες 4).
Μονάδες 25
ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ

ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ

Ο∆ΗΓΙΕΣ (για τους εξεταζόμενους)
1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά
(ημερομηνία, κατεύθυνση, εξεταζόμενο μάθημα). Να μην
αντιγράψετε τα θέματα στο τετράδιο.
2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των
φωτοαντιγράφων, αμέσως μόλις σας παραδοθούν. Καμιά
άλλη σημείωση δεν επιτρέπεται να γράψετε.
Κατά την αποχώρησή σας να παραδώσετε μαζί με το
τετράδιο και τα φωτοαντίγραφα.
3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.
4. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με
μαύρο στυλό.
5. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι
αποδεκτή.
6. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των
φωτοαντιγράφων.

7. Χρόνος δυνατής αποχώρησης : μετά τη 10.30΄ πρωινή.
KΑΛΗ ΕΠΙΤΥΧΙΑ
ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 5ΗΣ ΣΕΛΙ∆ΑΣ

οι χλωροπλάστες και τα μιτοχόνδρια. βακτήριο Bacillus thuringiensis που ζει στο έδαφος παράγει μια ισχυρή τοξίνη. μολύνει τα διαγονιδιακά ζώα. Μονάδες 5 3. δ. Οι περιοριστικές ενδονουκλεάσες α. δ. β. Το α. τα χρωμοσώματα και τα ριβοσώματα. είναι απαραίτητες για την έναρξη της αντιγραφής του DNA. Μονάδες 5 2. β. γ. είναι απαραίτητες για τη διαδικασία της αντίστροφης μεταγραφής. β. Ως α. 1. ο πυρήνας και οι χλωροπλάστες. επιβιώνει για πολύ χρόνο. παράγονται μόνο από μύκητες.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις 1 έως και 5. εκκρίνει μια χρήσιμη ορμόνη. γ. ημιαυτόνομα οργανίδια χαρακτηρίζονται τα ριβοσώματα και οι χλωροπλάστες. παράγονται από βακτήρια. γ. δ. ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ Μονάδες 5 . να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της.

5. είναι μια διαδικασία που καταλύεται από DNA ελικάσες. τα κύτταρα τροποποιούνται έξω από τον ανθρώπινο οργανισμό. χρησιμοποιούνται μεταλλαγμένα βακτήρια ως φορείς. γ. δ. Μονάδες 5 Η ωρίμανση του mRNA α. Ποια χρωμοσώματα χαρακτηρίζονται ως αυτοσωμικά. Μονάδες 8 3. Γιατί ο μηχανισμός αυτοδιπλασιασμού ονομάζεται ημισυντηρητικός. τα φυσιολογικά γονίδια εισάγονται κατευθείαν στον οργανισμό. γ. β. β. δ. συμβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 4. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. Γιατί η “διόρθωση” μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους. ποια ως φυλετικά και πώς καθορίζεται το φύλο στον άνθρωπο. του DNA Μονάδες 8 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Μονάδες 9 2. Κατά την in vivo γονιδιακή θεραπεία α. είναι μία διαδικασία στην οποία παραμένουν για μετάφραση τα εσώνια. Μονάδες 5 ΘΕΜΑ 2ο Να γράψετε στο τετράδιό παρακάτω ερωτήσεων: σας τις απαντήσεις των 1. γίνεται αντικατάσταση των μεταλλαγμένων γονιδίων.

Σε ποια συνήθως χρονικά διαστήματα της καλλιέργειας των βακτηρίων αναμένεται να παραχθεί η προϊνσουλίνη. δηλαδή της προϊνσουλίνης. Αφού παραλάβουμε την προϊνσουλίνη από τον βιοαντιδραστήρα. να χαρακτηρίσετε τον τύπο της καλλιέργειας και να περιγράψετε τις φάσεις της. Μονάδες 10 3.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΘΕΜΑ 3ο Για την παραγωγή του προδρόμου μορίου της ινσουλίνης. Με βάση το διάγραμμα αυτό. πώς θα την μετατρέψουμε σε ινσουλίνη. Η απεικόνιση της μεταβολής του πληθυσμού του βακτηρίου (Ν) σε σχέση με τον χρόνο (t) έδωσε το παρακάτω διάγραμμα: 1. Μονάδες 10 2. κατάλληλα μετασχηματισμένα κύτταρα Escherichia coli καλλιεργήθηκαν σε βιοαντιδραστήρα. Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Ποιος είναι ο βιολογικός ρόλος της ινσουλίνης και ποια ασθένεια προκαλεί η μείωση ή η έλλειψή της.

UGA .. Μονάδες 10 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1.. α.. Πώς ερμηνεύεται το γεγονός αυτό με βάση τα χαρακτηριστικά του γενετικού κώδικα.. 2.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΘΕΜΑ 4ο ∆ίνεται το παρακάτω τμήμα mRNA που προκύπτει από τη μεταγραφή ενός γονιδίου βακτηριακού κυττάρου: .... Η τριπλέτα . (μονάδες 8) Μονάδες 10 5΄ 3΄ γ. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία... Αν αντικαταστήσουμε 5΄ 3΄ αυτή την τριπλέτα με την τριπλέτα .. εξεταζόμενο μάθημα). του παραπάνω mRNA κωδικοποιεί το αμινοξύ σερίνη. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. Να γράψετε στο τετράδιό σας τη μη κωδική αλυσίδα από την οποία προήλθε το παραπάνω mRNA και να ορίσετε τον προσανατολισμό της... δεν προκύπτει η παραμικρή αλλαγή στο πεπτίδιο. UCC . Αντικαθιστούμε μία τριπλέτα του παραπάνω mRNA με 5΄ 3΄ και το πεπτίδιο που την τριπλέτα . ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ .. UCU . 5΄ AUG–CCU–CAU–CGU–UCU–ACU–UUU–UAA 3΄ . ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση... Μονάδες 5 β. κωδικοποιείται δεν υφίσταται την παραμικρή αλλαγή. αμέσως μόλις σας παραδοθούν. ∆εν θα αντιγράψετε τα θέματα στο τετράδιο... Ποια είναι η τριπλέτα αυτή. κατεύθυνση.

4.30΄ απογευματινή. επιστημονικά τεκμηριωμένη είναι 6. 5. ΣΑΣ ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Ώρα δυνατής αποχώρησης η 8. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. 3. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Κάθε απάντηση αποδεκτή. 7.

Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . πολλαπλά αλληλόμορφα. γ. Μονάδες 5 3. βακτήριο. γ. στον πυρήνα. δύο συνεπικρατή γονίδια και ένα υπολειπόμενο. γ. Ο πνευμονιόκοκκος. δ. περιορίζουν τη μεταγραφή του DNA. Μονάδες 5 4. είναι: α. δύο υπολειπόμενα και ένα επικρατές. μύκητας. β. δ. είναι απαραίτητες για την έναρξη της μεταγραφής. κόβουν το DNA σε ειδικές θέσεις. Μονάδες 5 2. όλα ισοεπικρατή. β. 1. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. δύο αλληλόμορφα με σχέση υποτελούς-επικρατούς. τα δύο στελέχη του οποίου χρησιμοποίησε ο Griffith στο γνωστό πείραμα. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του RNA σε ειδικές θέσεις. στο κυτταρόπλασμα. δ. ιός. Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται: α. β. Οι περιοριστικές ενδονουκλεάσες: α. στα μιτοχόνδρια. δ. στο κυτταρικό τοίχωμα. πρωτόζωο. β. Η ομάδα αίματος του ανθρώπου ελέγχεται από: α.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. γ.

1. Μονάδες 8 3. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. γ. Πώς αναστέλλεται η δράση των ογκοκατασταλτικών γονιδίων. όταν εμφανίζεται ένα επιπλέον χρωμόσωμα 21 και πώς προκύπτει αυτό. Πώς ονομάζεται η αλλαγή που παρουσιάζεται στον καρυότυπο ενός ανθρώπου. πολυπλοειδικά. πολυγονικά. που έχουν υποστεί γενετική τροποποίηση λέγονται: α. σε ποιο στάδιο της κυτταρικής διαίρεσης εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και πώς μοιράζονται στα δύο νέα κύτταρα. β. Τα ζώα. Μονάδες 7 4. Πώς συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος στη μελέτη της εξέλιξής του και στη μαζική παραγωγή προϊόντων. Να αναφέρετε ένα χαρακτηριστικό παράδειγμα. Μονάδες 5 2. Πώς χρησιμοποιείται ο όρος αδελφές χρωματίδες. Μονάδες 5 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων. πολυγενετικά. δ. διαγονιδιακά.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. Μονάδες 5 ΘΕΜΑ 3ο Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη.

Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ. όπως τα νευρικά και τα μυϊκά. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA. διαφέρουν στη μορφή και τη λειτουργία. Σε κάθε κλώνο να συμπληρώσετε τον προσανατολισμό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (μονάδες 4). αν και έχουν το ίδιο γενετικό υλικό.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ 2. όπως φαίνεται στο παρακάτω σχήμα. Ποιά ένζυμα τοποθετούν τα συμπληρωματικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν. (μονάδες 7). Μονάδες 8 3. Οι ελ ικάσες ξετυλ ίγ ου ν τη διπλή έλι κα A 3΄ 5΄ ∆ιχάλα αν τιγ ραφής B Η DNA-δεσμάση εκτός του ότι συνδέει όλα τα κομμάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . έχει ξεκινήσει η αντιγραφή. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού. Μονάδες 12 ΘΕΜΑ 4ο Σε μια θέση τμήματος μορίου DNA με κλώνους Α και Β. ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών. δρα κατά την αντιγραφή του κλώνου Β.

έχει ως αποτέλεσμα το 4 ο κωδικόνιο στο μεταγραφόμενο mRNA να έχει τις βάσεις UAA και ο αριθμός των κωδικονίων να παραμένει σταθερός. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. να εξηγήσετε ποια είναι η συγκεκριμένη αλλαγή που συνέβη και τι συνέπειες μπορεί να έχει για το πεπτίδιο. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. έχει την εξής αλληλουχία βάσεων: 5΄. που είναι υπεύθυνο για την παραγωγή ενός πεπτιδίου.. 5. 7. 6. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. ATG CCA TGC AAA CCG AAA TGA …3΄ Να γράψετε την αλληλουχία του mRNA που προκύπτει (μονάδες 2). Μονάδες 25 1. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. κατεύθυνση). KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Γιατί η πρωτεϊνοσύνθεση στους ευκαρυωτικούς οργανισμούς είναι μια «οικονομική διαδικασία». Ο∆ΗΓΙΕΣ (για τους εξεταζόμενους) Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. αμέσως μόλις σας παραδοθούν.30΄ πρωινή. 2.. Αφού γράψετε το νέο mRNA που προκύπτει. Κάποια αλλαγή που συνέβη στην παραπάνω κωδική αλυσίδα του DNA. (μονάδες 4). 4. Χρόνος δυνατής αποχώρησης : μετά τη 10. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. εξεταζόμενο μάθημα.. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. (μονάδες 8). Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Στην κωδική αλυσίδα Α το γονίδιο. 3.

Μονάδες 5 Η φαινυλκετονουρία οφείλεται σε α. δ. δεν αυξάνεται. β. φυλοσύνδετο υπολειπόμενο γονίδιο. θνησιγόνο γονίδιο. αυτοσωμικό υπολειπόμενο γονίδιο. αυξάνεται. ένα μόριο γραμμικού RNA. Στους περισσότερους οργανισμούς ένα μιτοχόνδριο περιέχει α. 1. β. αυτοσωμικό επικρατές γονίδιο. ο πληθυσμός α. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. γ. δ. 4. Μονάδες 5 Τα εμβρυϊκά κύτταρα που λαμβάνονται με την αμνιοπαρακέντηση χρησιμοποιούνται για α. την ανάλυση DNA. αυξάνεται με ταχύ ρυθμό. τη διάγνωση χρωμοσωμικών ανωμαλιών. όλα τα παραπάνω. δ. 3. β. πολλά μόρια γραμμικού RNA. γ. και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση. γ. γ. τη βιοχημική ανάλυση ορισμένων πρωτεϊνών και ενζύμων. Μονάδες 5 Στη στατική φάση μιας κλειστής καλλιέργειας μικροοργανισμών. β. 2. δύο έως δέκα μόρια κυκλικού DNA. εξαφανίζεται. δ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ .ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 4 ΙΟΥΛΙΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5. ένα μόριο κυκλικού DNA.

παράγονται από υβριδώματα. β. γ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. ∆ίνεται μία μετάλλαξη στο κωδικόνιο που κωδικοποιεί το 6 ο αμινοξύ της β– πολυπεπτιδικής αλυσίδας της αιμοσφαιρίνης Α (ΗbA). έχουν αντιιική δράση. Τι είναι τα πολλαπλά αλληλόμορφα γονίδια και γιατί μπορεί να αλλάζουν τις αναλογίες των νόμων του Μendel. Τι είναι η γονιδιακή θεραπεία και ποιος ο στόχος της. Οι α. Ποιες ονομάζονται θέσεις έναρξης της αντιγραφής του DNA (μονάδες 3). Μονάδες 4 ΘΕΜΑ 3ο Τα γονίδια που κωδικοποιούν τις αλυσίδες των αιμοσφαιρινών του ανθρώπου εμφανίζουν πολλές μεταλλάξεις. Πώς σχηματίζεται το ώριμο mRNA στα ευκαρυωτικά κύτταρα. και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα. φέρουν γενετικές πληροφορίες. (μονάδες 4) Μονάδες 7 4. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. που οδηγούν στη δημιουργία αιμοσφαιρινοπαθειών. δ. Μονάδες 6 2. Στην ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Στο γονίδιο που κωδικοποιεί την αλυσίδα β έχουν βρεθεί περισσότερες από 300 μεταλλάξεις. ιντερφερόνες είναι πρωτεΐνες που παράγονται από τα κύτταρα του παγκρέατος. Μονάδες 8 3.

Τι συνέπειες έχει αυτή η μετάλλαξη για αιμοσφαιρίνη Α (HbA) και για τα ερυθροκύτταρα. Να μην αντιγράψετε τα θέματα στο τετράδιο. Σε ποια άτομα η σύνθεση της αιμοσφαιρίνης Α 2 (HbA 2 ) αποτελεί διαγνωστικό δείκτη.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ κωδική αλυσίδα του DNA το κωδικόνιο GAG έγινε GTG. α. Γιατί στα ομόζυγα άτομα με β–θαλασσαιμία εμφανίζεται συχνά αύξηση της αιμοσφαιρίνης F (HbF). Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. (μονάδες 6) Μονάδες 25 ΘΕΜΑ 4ο Γυναίκα με ομάδα αίματος Α παντρεύεται άνδρα με ομάδα αίματος Β και γεννούν δύο παιδιά εκ των οποίων το πρώτο. έχει ομάδα αίματος Α και το δεύτερο ομάδα αίματος Ο. Να βρείτε τους γονότυπους των γονέων και των παιδιών τους ως προς τους δύο χαρακτήρες. που είναι κορίτσι. την (μονάδες 12) β. και να δικαιολογήσετε το φύλο του δεύτερου παιδιού (μονάδες 10). κατεύθυνση). ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Οι δύο γονείς είναι υγιείς και η μητέρα μόνον είναι φορέας του υπολειπόμενου γονιδίου που ελέγχει τη νόσο αυτή. Για τα γονίδια που ελέγχουν τους παραπάνω χαρακτήρες ισχύει ο δεύτερος νόμος του Μendel. Το δεύτερο παιδί πάσχει από κληρονομική μεταβολική νόσο. εξεταζόμενο μάθημα. κάνοντας τις κατάλληλες διασταυρώσεις (μονάδες 15). (μονάδες 7) γ. Μονάδες 25 1.

ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων.2.00΄ πρωινή. αμέσως μόλις σας παραδοθούν. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 5. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . 6. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Χρόνος δυνατής αποχώρησης: μετά τη 10. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. 7. 4. 3.

επιδιορθώνει λάθη της αντιγραφής. β. γ. μεταγράφει την πολυνουκλεοτιδική αλυσίδα. γ. το νουκλεόσωμα. 4. τον καρυότυπο. δ. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. του αλφισμού. ιχνηθετείται το DNA. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . 3. αποχωρίζονται οι κλώνοι του DNA. το μόριο DNA. β. Μονάδες 5 Η DNA δεσμάση α. κόβεται το DNA. δ. γ. 2. Μονάδες 5 Αποδιάταξη είναι το φαινόμενο κατά το οποίο α. δ. 1.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΛΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5. δ. συνδέει τμήματα DNA. ∆ύο αδελφές χρωματίδες συγκροτούν α. της υπερχοληστερολαιμίας. του συνδρόμου Down. γ. συνδέει το αμινοξύ με το tRNA. Μονάδες 5 Η γονιδιακή θεραπεία εφαρμόσθηκε για την αντιμετώπιση α. και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση. συνδέονται μεταξύ τους οι κλώνοι του DNA. β. κάθε μεταφασικό χρωμόσωμα. β. της κυστικής ίνωσης.

δ. αλλά μπορεί να μετατρέπει τη φαινυλαλανίνη σε τυροσίνη. (μονάδες 3) Πώς επιτυγχάνεται η καταστολή στο οπερόνιο της λακτόζης. Μονάδες 5 ΘΕΜΑ 2ο 1.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. προκαλεί καθυστέρηση στην αύξηση του φυτού. Να βρείτε τους πιθανούς γονότυπους και φαινότυπους των παιδιών. Το α. Μονάδες 12 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . πλασμίδιο Ti προέρχεται από το βακτήριο Escherichia coli. γ. Να αναφέρετε τα συστατικά που πρέπει να περιέχονται σε στερεό θρεπτικό υλικό για την ανάπτυξη των μικροοργανισμών. (μονάδες 6) Μονάδες 9 4. αποκτά απογόνους με γυναίκα που πάσχει από αλφισμό. β. Μονάδες 5 2. Τα γονίδια που ελέγχουν την φαινυλκετονουρία και τον αλφισμό. Μονάδες 6 ΘΕΜΑ 3ο Α. εισάγεται με μικροέγχυση στα φυτικά κύτταρα. Ποια γονίδια οργανώνονται σε οπερόνια. προκαλεί όγκους στα φυτά στα οποία εισέρχεται. Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNA είναι το γενετικό υλικό. Μονάδες 5 3. Άνδρας που πάσχει από φαινυλκετονουρία και συνθέτει φυσιολογική ποσότητα μελανίνης. βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Να περιγράψετε τη διαδικασία της κλωνοποίησης με την οποία δημιουργήθηκε το πρόβατο «Dolly».

Να γράψετε την αλληλουχία του mRNA. α. Μονάδες 13 ΘΕΜΑ 4ο ∆ίνεται το παρακάτω τμήμα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αμινοξέα μιας πολυπεπτιδικής αλυσίδας. Να διακρίνετε περιπτώσεις κατά τις οποίες είναι αιμορροφιλικό το παιδί. Να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του tRNA. Τι είναι το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (μονάδες 5) και ποια είναι η μετέπειτα πορεία του tRNA. (μονάδες 7) Μονάδες 9 β. που συμμετέχει σε αυτό. Η κατεύθυνση στην οποία κινείται η RNA πολυμεράση κατά τη μεταγραφή υποδεικνύεται από το βέλος. που αποκτά φυσιολογικός άνδρας με φυσιολογική γυναίκα της οποίας ο πατέρας είναι αιμορροφιλικός. Μονάδες 5 δ. (μονάδες 3) Μονάδες 8 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ .ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Β. Οι γονείς και το παιδί έχουν φυσιολογικό καρυότυπο. Ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η μη κωδική. Μονάδες 3 γ. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. που μεταφέρει το 2 ο αμινοξύ της πολυπεπτιδικής αλυσίδας. που προκύπτει από τη μεταγραφή του παραπάνω DNA.

αμέσως μόλις σας παραδοθούν. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. κατεύθυνση. 4. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Χρόνος δυνατής αποχώρησης: 10.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. 3. 6. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή.00 π. 7. 2. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα.). Να μην αντιγράψετε τα θέματα στο τετράδιο. εξεταζόμενο μάθημα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. 5. ∆εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων.μ.

1. δ. γ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται α.αντιθρυψίνη. ∆ιαγονιδιακά είναι φυτά α. αποτελούνται αποκλειστικά από DNA. δεν σχηματίζονται κατά τη μεσόφαση. γ. υποκινητής. β. β. στα οποία έχουν εισαχθεί αντιβιοτικά. β. τα οποία έχουν υποστεί γενετική αλλαγή. παράγοντας ΙΧ. ινσουλίνη. Μονάδες 5 3. δομικά γονίδια. αυξητική ορμόνη. τα οποία έχουν εμβολιαστεί με αντιγόνα in vitro. γ. χειριστής. δ. γ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΠΑΝΕΛΛΑ∆ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΠΑΛ (ΟΜΑ∆Α Β΄) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. α 1 . β. δ. Μονάδες 5 2. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται α. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. δ. αποτελούνται από DNA που τυλίγεται γύρω από πρωτεΐνες. στα οποία έχουν εισαχθεί ορμόνες. είναι ορατά μόνο με το οπτικό μικροσκόπιο. Τα νουκλεοσώματα α. Μονάδες 5 4. snRNA.

Μετασχηματισμός βακτηριακού κυττάρου ξενιστή είναι α. η εισαγωγή θρεπτικών συστατικών. Μονάδες 4 2. (μονάδες 2) Μονάδες 7 3. γ. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου. η εισαγωγή αντισώματος. Τι είναι η μετατόπιση και τι είναι η αμοιβαία μετατόπιση. (μονάδες 5) Ποια είναι τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας. η εισαγωγή αντίστροφης μεταγραφάσης.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. I 1 I 2 1 2 II II 1 2 1η οικογένεια 3 1 2 2η οικογένεια ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ 3 . Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. δ. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση. Τι εννοούμε με τον όρο ζύμωση και ποια τα προϊόντα της. β. Μονάδες 6 4. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες 1 και 2. η εισαγωγή DNA πλασμιδίου. Μονάδες 8 ΘΕΜΑ 3ο Α. Ποια προβλήματα μπορεί να προκαλέσει η αμοιβαία μετατόπιση στον άνθρωπο.

(μονάδες 2) ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . εσώνιο Κατεύθυνση μεταγραφής α) Πού συναντάμε ασυνεχή γονίδια.. . ΙΙ 3 (μαυρισμένα)..C TTCCTCCAACGAATTCCCCGGGATGG TTA . αιτιολογώντας την απάντησή σας με τις κατάλληλες διασταυρώσεις (Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου). (μονάδες 6) Να περιγράψετε τη διαδικασία με την οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμου με σύνδρομο Turner. Να προσδιορίσετε τον τρόπο κληρονόμησης του χαρακτηριστικού με βάση τα παραπάνω στοιχεία. ΙΙ 2 .OH ελεύθερο .. ΙΙ 3 (μαυρισμένα) ενώ στην 2 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα ΙΙ 2 ..ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Στην 1 η οικογένεια φέρουν το χαρακτηριστικό τα άτομα Ι 2 . GAAGGAGGTTGCTTAAGGGGCCCTACCAAT . (μονάδες 5) Μονάδες 13 Β. (μονάδες 6) Μονάδες 12 ΘΕΜΑ 4ο ∆ίνεται δίκλωνο μόριο DNA το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mRNA. εσώνιο .. μετά τη γέννησή του. Να υποδείξετε ένα πιθανό μηχανισμό που μπορεί να εξηγήσει τη γέννηση ατόμου με σύνδρομο Turner από γονείς με φυσιολογικό αριθμό χρωμοσωμάτων.. (μονάδες 8) Να γράψετε τους γονότυπους όλων των ατόμων.

χωρίς αιτιολόγηση.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ β) Να προσδιορίσετε τα 3΄ και 5΄ άκρα του παραπάνω μορίου DNA. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. εξεταζόμενο μάθημα). (μονάδες 8) Μονάδες 25 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. (μονάδες 3) ε) Μπορεί η περιοριστική ενδονουκλεάση ΕcoRI να κόψει το παραπάνω τμήμα DNA. Χρόνος δυνατής αποχώρησης: 10. αμέσως μόλις σας παραδοθούν.00 π. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. (μονάδες 3) στ) Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cDNA βιβλιοθήκη. 6. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 4. (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. 5. (μονάδες 4) γ) Να γράψετε το τμήμα του πρόδρομου mRNA και του ώριμου mRNA που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA. 8. 3. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. 7. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. (μονάδες 2) δ) Πώς προκύπτει το ώριμο mRNA. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία.μ. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης.

23 χρωμοσώματα. β. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . δ. β. Μονάδες 5 2. α 1 – αντιθρυψίνης. γ. Escherichia coli. β. Το α. γ. Agrobacterium tumefaciens. μονοκλωνικών αντισωμάτων. ινσουλίνης.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ∆΄ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 23 ΜΑΪΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις 1 έως και 5. ιντερφερονών. δ. Bacillus thuringiensis. πλασμίδιο Τ i εντοπίζεται στο βακτήριο πνευμονιόκοκκος (Diplococcus pneumoniae). Στον ανθρώπινο φυσιολογικό καρυότυπο απεικονίζονται α. 22 ζεύγη χρωμοσωμάτων. 46 ζεύγη χρωμοσωμάτων. Μονάδες 5 3. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες α. γ. 23 ζεύγη χρωμοσωμάτων. να γράψετε στο τετράδιό σας τον αριθμό της φράσης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. δ. 1.

Να γράψετε στο τετράδιό σας τον αριθμό κάθε στοιχείου της Στήλης Ι και. ΑUG. Το κωδικόνιο έναρξης της μετάφρασης του mRNA σε όλους τους οργανισμούς είναι το α. ∆ύο στοιχεία της Στήλης ΙΙ περισσεύουν: 1. δίπλα σε κάθε αριθμό. 3. ένζυμα πρωτεϊνοσύνθεσης. UUU. 2. η. δ. δ. CAA. β. δ. διαγονιδιακά ζώα β. κεντρομερίδιο ωρίμανση mRNA βιοαντιδραστήρας γ. χρήση ειδικών μορίων ανιχνευτών. χρήση αντιβιοτικών. 5. Μονάδες 5 5. χρήση βιοαντιδραστήρων. UAA. ε. το γράμμα από στοιχείο της Στήλης ΙΙ. Η επιλογή ενός βακτηριακού κλώνου που περιέχει το ανασυνδυασμένο πλασμίδιο γίνεται με: α. 4. γ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 4. Στήλη Ι διαβήτης α. γ. ώστε να προκύπτει η σωστή αντιστοίχιση. ζ. β. Μονάδες 5 ΘΕΜΑ 2ο Α. Στήλη ΙΙ αδελφές χρωματίδες ριβονουκλεοπρωτεϊνικά “σωματίδια” ινσουλίνη μικροέγχυση ιντερφερόνη ζύμωση περιοριστικές ενδονουκλεάσες Μονάδες 10 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ .

Πώς μπορούμε να διαπιστώσουμε αν ο μικροοργανισμός αυτός είναι υποχρεωτικά αναερόβιος. Μονάδες 8 2. Ένας νέος τομέας της βιοτεχνολογίας που αναπτύσσεται ταχύτατα είναι η γονιδιακή θεραπεία. Μονάδες 6 3. Μονάδες 7 3. Ποιος είναι ο στόχος της γονιδιακής θεραπείας. Μονάδες 5 2. 1. Τι γνωρίζετε για τους άλλους παράγοντες επιδρούν στην ανάπτυξη του μικροοργανισμού. Ποιες είναι οι προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας. ώστε ο μικροοργανισμός αυτός να αναπτυχθεί φυσιολογικά. Να αναφέρετε ονομαστικά τα θρεπτικά συστατικά τα οποία πρέπει να προστεθούν στο μέσο καλλιέργειας. Μονάδες 4 ΘΕΜΑ 3ο Πρόκειται να καλλιεργηθεί στο εργαστήριο ένας ετερότροφος μικροοργανισμός. Να αναφέρεται ονομαστικά τους τύπους γονιδιακής θεραπείας.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ Β. 1. που Μονάδες 10 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ .

∆. Ποια ένζυμα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής.Ζ να αντιστοιχίσετε τις ενδείξεις 3΄ ή 5΄ ώστε να φαίνεται ο προσανατολισμός των αρχικών και των νεοσυντιθέμενων αλυσίδων. Τι είναι τα πρωταρχικά τμήματα. Στις θέσεις Α. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να μην αντιγράψετε τα θέματα στο τετράδιο.Γ. ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ .Β. πως δημιουργούνται και πως επιμηκύνονται. εξεταζόμενο μάθημα). στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυμο DNA δεσμάση και πώς θα δράσει αυτό. Μονάδες 6 4.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ ΘΕΜΑ 4ο ∆ίνεται το παρακάτω τμήμα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής: 1.Ε. Μονάδες 6 2. κατεύθυνση. Μονάδες 4 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Μονάδες 9 3. Εξηγήστε γιατί πρέπει.

Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . 5. 6. 7. Χρόνος δυνατής αποχώρησης: μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ ∆΄ ΤΑΞΗ 2. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. 3. 4. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή.

η RNA πολυμεράση και το πριμόσωμα Μονάδες 5 Α2. Σε χρωμοσωμική ανωμαλία οφείλεται α. στο ύπαιθρο β. δεν εμφανίζει μεγάλη ποικιλότητα Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . σε έναν οργανισμό γ. ο αλφισμός β. στον πυθμένα μιας λίμνης δ. Α1. η DNA δεσμάση και τα επιδιορθωτικά ένζυμα β. Ο Mendel επέλεξε για τα πειράματά του το μοσχομπίζελο (Pisum sativum) επειδή α. Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι α. η β-θαλασσαιμία γ. Η έκφραση in vitro χρησιμοποιείται για την περιγραφή μιας βιολογικής διαδικασίας που πραγματοποιείται α. οι DNA πολυμεράσες και τα επιδιορθωτικά ένζυμα γ. οι DNA ελικάσες και η DNA δεσμάση δ. η κυστική ίνωση Μονάδες 5 Α3. το σύνδρομο φωνή της γάτας (cri-du-chat) δ. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. αναπτύσσεται δύσκολα β. δίνει μεγάλο αριθμό απογόνων δ. σε δοκιμαστικό σωλήνα Μονάδες 5 Α4. δεν επιτρέπει την τεχνητή γονιμοποίηση γ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 8 ΙΟΥΛΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση.

ορίζοντας τα 5΄ και 3΄ άκρα του (μονάδες 2). και να δικαιολογήσετε την απάντησή σας (μονάδες 5). Τι γνωρίζετε για το άγαρ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ Α5. Μονάδες 4 Β5. Μονάδες 6 ΘΕΜΑ Γ ∆ίνεται το παρακάτω δίκλωνο μόριο DNA που κωδικοποιεί ένα πεπτίδιο. το οποίο λειτουργεί ως ένζυμο CTTAACTAATAGGGTGGACCTAACATAGAT GAATTGATTATCCCACCTGGATTGTATCTA Γ1. Σε μια κλειστή καλλιέργεια οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα κατά τη διάρκεια της α. φάσης θανάτου Μονάδες 5 ΘΕΜΑ Β Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Πού οφείλεται η έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA) και ποιες είναι οι επιπτώσεις της στον οργανισμό. εκθετικής και στατικής φάσης της ανάπτυξής τους β. Μονάδες 7 Μονάδες 4 Β3. Β2. Να γράψετε το mRNA που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA. Μονάδες 4 Β4. στατικής φάσης της ανάπτυξής τους γ. Μονάδες 7 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Από τι αποτελείται η ινσουλίνη και ποιος είναι ο ρόλος της στον ανθρώπινο οργανισμό. Να περιγράψετε τη διαδικασία με την οποία μπορεί να κατασκευαστεί ο καρυότυπος ενός ανθρώπου. Να ορίσετε τι είναι η γονιδιωματική βιβλιοθήκη. εκθετικής φάσης της ανάπτυξής τους δ.

αν συμβεί γονιδιακή μετάλλαξη. Να βρείτε τον αριθμό των αμινοξέων από τα οποία θα αποτελείται το ένζυμο μετά τη μετάφραση του παραπάνω mRNA (μονάδες 2) και να δικαιολογήσετε την απάντησή σας με βάση τις ιδιότητες του γενετικού κώδικα (μονάδες 8). Να κάνετε τις κατάλληλες διασταυρώσεις αιτιολογήσετε τις απαντήσεις σας. ΙΙ 5 . Μονάδες 7 ∆2. ΙΙ 3 . Να εξηγήσετε ποιο θα είναι το αποτέλεσμα στη λειτουργία του ενζύμου. ΙΙ 4 . ΙΙ 2 . πάσχουν από μονογονιδιακή ασθένεια. ΙΙ 6 . Μονάδες 4 ∆3. και να Μονάδες 14 Σημείωση: Να μην εξετασθεί η περίπτωση φυλοσύνδετου επικρατούς γονιδίου.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ2. Να προσδιορίσετε όλους τους πιθανούς γονότυπους όλων των παιδιών στο παραπάνω γενεαλογικό δέντρο. Μονάδες 10 Γ3. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . η οποία θα προκαλέσει έλλειψη του δεύτερου νουκλεοτιδίου στο δεύτερο κωδικόνιο του γονιδίου. ∆1. Μονάδες 8 ΘΕΜΑ ∆ ∆ίνεται το παρακάτω γενεαλογικό δέντρο στο οποίο τα άτομα Ι 1 και ΙΙ 1 . Να προσδιορίσετε όλους τους πιθανούς γονότυπους των γονέων στο παραπάνω γενεαλογικό δέντρο.

Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων. 2. αμέσως μόλις σας παραδοθούν. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. εξεταζόμενο μάθημα). 5. Χρόνος δυνατής αποχώρησης: 09. Καμιά άλλη σημείωση δεν επιτρέπεται να γράψετε. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 8. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα.30 π. Στο τετράδιο να γράψετε μόνον τα προκαταρκτικά (ημερομηνία. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . 3.μ. 4. 7. 6.

τα πρωτο-ογκογονίδια. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ . πηγή αζώτου για τις κυτταροκαλλιέργειες. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. έλλειψη τμήματος ενός χρωμοσώματος. 4. τα ογκοκατασταλτικά γονίδια. γ. 1. ρευστό υλικό σε θερμοκρασίες κάτω από 45 ο C. πολυσακχαρίτης που προέρχεται από φύκη. γ. το σύμπλεγμα πολλών ριβοσωμάτων με το mRNA. 3. β. Το σύνδρομο φωνή της γάτας (cri du chat) οφείλεται σε α. δ. το σύνολο των εξωνίων του ώριμου mRNA. γ. τα ρυθμιστικά γονίδια. τα ογκογονίδια. δ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. Μονάδες 5 Τα γονίδια που ενεργοποιούν φυσιολογικά τον κυτταρικό πολλαπλασιασμό είναι α. Μονάδες 5 Πολύσωμα είναι α. γ. πρωτεΐνη που προέρχεται από φύκη. Μονάδες 5 Το άγαρ είναι α. β. δ. επίδραση ιών και βακτηρίων. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. 2. δ. προσθήκη βάσεων και νουκλεοτιδίων. β. γονιδιακή μετάλλαξη.

Μονάδες 9 3. Τι ονομάζεται διασταύρωση ελέγχου και για ποιο σκοπό τη χρησιμοποιούμε. Φυτό Α διασταυρώνεται με φυτό Β. Τι είναι μονοκλωνικά χρησιμοποιούνται. β. του ιδίου είδους. Μονάδες 6 Β. Από τη διασταύρωση αυτή παίρνουμε φυτά με λευκά και κόκκινα άνθη. γ.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. εφαρμόζεται μόνο στα λεμφοκύτταρα. Το κόκκινο χρώμα καθορίζεται από υπολειπόμενο γονίδιο. Να γράψετε τη διασταύρωση μεταξύ των φυτών Α και Β και να δικαιολογήσετε το γονότυπο του φυτού Α. μεταβιβάζεται πάντοτε στους απογόνους. έχει ως στόχο να διορθώσει μια γενετική βλάβη. αντικαθιστά πολλά μεταλλαγμένα γονίδια. Μονάδες 8 2. δ. που έχει κόκκινα άνθη. 1. Ποια ονομάζουμε διαγονιδιακά ζώα και με ποιο τρόπο δημιουργούνται. Τι εννοούμε με τον όρο γονιδίωμα. Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή. Η γονιδιακή θεραπεία α. Η αλληλουχία των βάσεων του mRNA καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . Μονάδες 9 2. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. αντισώματα και ως τι Μονάδες 8 ΘΕΜΑ 3ο Α.

Ποια αλυσίδα από αυτό το DNA μεταγράφεται και γιατί. ο οποίος ονομάζεται γενετικός κώδικας. Να γράψετε το τμήμα DNA που προκύπτει μετά από τη δράση της EcoRI και να δικαιολογήσετε την απάντησή σας. Μονάδες 6 Να γράψετε την αλληλουχία του mRNA που προκύπτει από αυτή τη μεταγραφή και να σημειώσετε το 5΄ και το 3΄ άκρο της. κώδικας Μονάδες 5 χαρακτηρίζεται ως Μονάδες 5 ΘΕΜΑ 4ο ∆ίνεται το παρακάτω τμήμα DNA ενός προκαρυωτικού οργανισμού: 5΄ CCAGΑATTCAATTCAGGACGAAAAGAATTCAAC 3΄ 3΄ GGTCTTAAGTTAAGTCCTGCTTTΤCTTAAGTTG 5΄ To παραπάνω τμήμα DNA κόβεται με περιοριστική ενδονουκλεάση EcoRI. Γιατί ο γενετικός εκφυλισμένος. Μονάδες 6 Ποιοι οργανισμοί διαθέτουν περιοριστικές ενδονουκλεάσες και ποιος είναι ο φυσιολογικός τους ρόλος. Τι σημαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός». Μονάδες 8 Το τμήμα του DNA που προέκυψε μετά τη δράση της EcoRI μεταγράφεται.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών. 2. 1. Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .

3. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 2. Να μην αντιγράψετε τα θέματα στο τετράδιο. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 5. κατεύθυνση. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . εξεταζόμενο μάθημα). Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. 4. 6.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ 1.

μόνο στα θηλυκά άτομα. το ολικό «ώριμο» mRNA ενός οργανισμού. συχνότερα στα θηλυκά άτομα. Η DNA δεσμάση α. όλο το γονιδίωμα ενός οργανισμού. γ.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 14 ΣΕΠΤΕΜΒΡΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. μόνο ορισμένα γονίδια ενός οργανισμού. ενώνει τα κομμάτια της αλυσίδας DNA που αντιγράφεται ασυνεχώς. Μονάδες 5 Μια γονιδιωματική βιβλιοθήκη περιέχει α. 1. 2. δ. γ. όλα τα είδη RNA ενός οργανισμού. συχνότερα στα αρσενικά άτομα. επιδιορθώνει τα λάθη της αντιγραφής. δ. είναι το κύριο ένζυμο της αντιγραφής. είναι το ένζυμο με το οποίο σχηματίζονται τα πρωταρχικά τμήματα. Μονάδες 5 Η αιμορροφιλία Α είναι μια κληρονομική ασθένεια που εμφανίζεται α. δ. γ. β. β. β. 3. μόνο στα αρσενικά άτομα. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΣΕΛΙ∆ΑΣ .

Στη μέθοδο της μικροέγχυσης χρησιμοποιούνται α. η μεσογειακή αναιμία. με την ευρεία έννοια. Μονάδες 6 2. Β – λεμφοκύτταρα. το σύνδρομο Down. Μονάδες 10 ΘΕΜΑ 3ο Βιοτεχνολογία. (μονάδες 5) Μονάδες 9 3. πλασμίδια. Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1. β. γονιμοποιημένα ωάρια ζώων. β. οι λειτουργίες του γενετικού υλικού. είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA. η κυστική ίνωση. γ. το σύνδρομο Turner. δ. ΤΕΛΟΣ 2ΗΣ ΣΕΛΙ∆ΑΣ . δ. Ποιες είναι. Ποιοι περιβαλλοντικοί παράγοντες έχουν μεταλλαξογόνο δράση (μονάδες 4) και πώς αντιμετωπίζονται από το κύτταρο οι αλλαγές που προκαλούνται από τη δράση των παραγόντων αυτών. συνοπτικά. καρκινικά κύτταρα. Μονάδες 5 5. Η μοναδική μονοσωμία που έχει βρεθεί στον άνθρωπο είναι α.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 4. γ. Ποια γονίδια ονομάζονται συνεπικρατή και ποια ατελώς επικρατή.

.. Με ποιο τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια). Μονάδες 10 ΘΕΜΑ 4ο ∆ίνεται το παρακάτω τμήμα μορίου βακτηριακού DNA που κωδικοποιεί ένα πεπτίδιο με έξι αμινοξέα: 5΄. 3΄ 3΄... Μία από τις μεθόδους που χρησιμοποιούνται για την παραγωγή της είναι η παραγωγή του πρόδρομου μορίου της σε μία βακτηριακή καλλιέργεια και η μετατροπή του σε ινσουλίνη με ενζυμική κατεργασία. Η ανθρώπινη ινσουλίνη είναι μία από τις φαρμακευτικές πρωτεΐνες που παράγονται από βακτήρια.. Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης. CCGΑTGACCAAACCTCACGCCTAGACC . Μονάδες 10 2.. Μονάδες 3 ΤΕΛΟΣ 3ΗΣ ΣΕΛΙ∆ΑΣ .ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ 1. τα στάδια αυτής της μεθόδου. Μονάδες 3 Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που προκύπτει από τη μετάφραση του παραπάνω mRNA. 5΄ Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η μη κωδική. GGCTACTGGTTTGGAGTGCGGATCTGG . Να γράψετε. (μονάδες 9) Μονάδες 13 Να γράψετε την αλληλουχία του mRNA που προκύπτει από τη μεταγραφή του παραπάνω τμήματος DNA. συνοπτικά.. Μονάδες 5 3.. (μονάδες 4) Να αιτιολογήσετε την απάντησή σας.

4. 3. AUG → Μεθειονίνη ACC → Θρεονίνη AAA → Λυσίνη CCU → Προλίνη CAC → Ιστιδίνη GCC → Αλανίνη Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Μονάδες 6 ∆ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: 1. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΣΕΛΙ∆ΑΣ . Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 2. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 6. Να μην αντιγράψετε τα θέματα στο τετράδιο. 5.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Να γράψετε τα αντικωδικόνια των tRNA με τη σειρά που θα πάρουν μέρος στη μετάφραση του παραπάνω mRNA. εξεταζόμενο μάθημα). κατεύθυνση. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή.

Μονάδες 5 3. β. της μεταγραφής του DNA. Η τρισωμία στο 21 ο χρωμόσωμα προκαλεί το σύνδρομο α. Turner. γραμμικό μονόκλωνο DNA. β. Μονάδες 5 2. το σύνολο του m-RNA ενός οργανισμού. το σύνολο του DNA ενός οργανισμού. αντίγραφα ενός μόνο ανασυνδυασμένου πλασμιδίου. της αντιγραφής του DNA. Μια γονιδιωματική βιβλιοθήκη περιλαμβάνει α. γενετικό υλικό των προκαρυωτικών κυττάρων είναι κυκλικό μονόκλωνο DNA. δ. 1. Down. γ. Το α. αντίγραφα πολλών ανασυνδυασμένων κυττάρων.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. της μετάφρασης του m-RNA. Μονάδες 5 4. β. Το αντικωδικόνιο συνδέεται με το κωδικόνιο κατά τη διαδικασία α. β. γ. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . της ωρίμανσης του πρόδρομου m-RNA. γ. δ. Cri du chat. δ. γ. γραμμικό δίκλωνο DNA. κυκλικό δίκλωνο DNA. Kleinefelter. δ.

1.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. διαγονιδιακά και που Μονάδες 6 4. Ποιος είναι ο ρόλος του ενζύμου αυτού (μονάδες 3) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με έλλειψη του συγκεκριμένου ενζύμου (μονάδες 6). πλασμίδιο Τi απομονώνεται από τα βακτήρια Agrobacterium tumefaciens. του γένους Lactobacillus. δ. Μονάδες 9 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . του γένους Clostridium. Μονάδες 6 ΘΕΜΑ 3ο Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). Γιατί ο μηχανισμός αυτοδιπλασιασμού ονομάστηκε ημισυντηρητικός. Bacillus thuringiensis. Ποια ζώα ονομάζονται χρησιμοποιούνται. Μονάδες 8 2. γ. Ποιοι μικροοργανισμοί ονομάζονται υποχρεωτικά αερόβιοι και ποιοι προαιρετικά αερόβιοι. β. Πώς καθορίζεται το φύλο στον άνθρωπο (μονάδες 4). Το α. του DNA Μονάδες 5 3. Ποια χρωμοσώματα στον άνθρωπο ονομάζονται αυτοσωμικά και ποια φυλετικά (μονάδες 4). Μονάδες 5 ΘΕΜΑ 2ο Να απαντήσετε στις παρακάτω ερωτήσεις: 1.

εξεταζόμενο μάθημα). 2. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Μονάδες 6 3. Πώς προκαλείται η φαινυλκετονουρία (μονάδες 5) και πως κληρονομείται (μονάδες 2). Μονάδες 6 3. κατεύθυνση. αποκτούν ένα κορίτσι και ένα αγόρι. 1. Μονάδες 7 2. Ποια είναι η διαδικασία που ακολουθείται στη γονιδιακή θεραπεία της παραπάνω ασθένειας. της γυναίκας και των παιδιών τους (μονάδες 8). Μονάδες 12 Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. κάνοντας τις κατάλληλες διασταυρώσεις (μονάδες 4). ενώ το αγόρι εμφανίζει αχρωματοψία στο πράσινο και στο κόκκινο και πάσχει από φαινυλκετονουρία. Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (μονάδες 2) και γιατί (μονάδες 4). Μονάδες 10 ΘΕΜΑ 4ο Ένας άνδρας με φυσιολογική όραση που πάσχει από φαινυλκετονουρία (PKU) και μια γυναίκα με φυσιολογική όραση που δεν πάσχει από φαινυλκετονουρία. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Πώς κληρονομείται η μερική αχρωματοψία στο πράσινο και στο κόκκινο. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Να βρείτε και να γράψετε τους γονότυπους του άνδρα. Να μην αντιγράψετε τα θέματα στο τετράδιο.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ 2. Το κορίτσι έχει φυσιολογική όραση και δεν παρουσιάζει φαινυλκετονουρία.

Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ 3. 6. 5. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων και όχι πριν την 17:00. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. 4. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα.

γ. μονόκλωνα κυκλικά μόρια DNA. κλωνοποίηση.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως και 5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. β. Τα πλασμίδια είναι α. 44 XY. δ. δ. β. δ. β. 44 XXY. δ. Μονάδες 5 3. γ. η τρισωμία του 21 χρωμοσώματος. 1. 44 XΟ. Στο σύνδρομο Klinefelter ο καρυότυπος των ατόμων είναι α. το σύμπλεγμα των ριβοσωμάτων με το mRNA. δίκλωνα γραμμικά μόρια RNA. γ. Μονάδες 5 4. Πολύσωμα ονομάζεται α. μετασχηματισμός. 44 XYY. δίκλωνα κυκλικά μόρια RNA. Μονάδες 5 2. γ. υβριδοποίηση. το ειδικό σύμπλοκο που συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA. αποδιάταξη. δίκλωνα κυκλικά μόρια DNA. το σύμπλεγμα του DNA με τις ιστόνες. β. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Η μεταφορά ανασυνδυασμένου μορίου DNA στο κύτταρο ξενιστή λέγεται α.

Μονάδες 9 2. γράψτε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του τμήματος mRNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Τι ονομάζεται νουκλεόσωμα και ποια είναι η δομή του. Μονάδες 4 4. Μονάδες 5 ΘΕΜΑ 2ο 1. β.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ 5. DNA. λιπιδίων.COOH Α. ∆ικαιολογήστε την απάντησή σας. Μονάδες 13 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . γ. Με τη βοήθεια του τμήματος του γενετικού κώδικα που παρατίθεται. Ποια πλεονεκτήματα του μοσχομπίζελου το καθιστούν κατάλληλο στη μελέτη της Μενδελικής κληρονομικότητας. Τα υβριδώματα μπορούν να παράγουν μεγάλες ποσότητες α. δ. Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια. RNA. Μονάδες 4 3. Μονάδες 8 ΘΕΜΑ 3ο ∆ίνεται το παρακάτω ολιγοπεπτίδιο έξι αμινοξέων το οποίο δεν έχει υποστεί καμία τροποποίηση μετά τη σύνθεσή του Η 2 Ν – Μεθειονίνη – Γλυκίνη – Λυσίνη – Τρυπτοφάνη – Βαλίνη – Αλανίνη . μονοκλωνικών αντισωμάτων. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο.

ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Γράψτε με τον κατάλληλο προσανατολισμό την αλληλουχία νουκλεοτιδίων στο δίκλωνο μόριο DNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Ποια είναι η κωδική και ποια η μη κωδική αλυσίδα. ΙΙ 4 και ΙΙΙ 1). Μονάδες 6 Γ. Μονάδες 6 ∆ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: GUCöΒαλίνη UGGöΤρυπτοφάνη GGUöΓλυκίνη AUGöΜεθειονίνη AAAöΛυσίνη GCCöΑλανίνη ΘΕΜΑ 4ο Στο παρακάτω γενεαλογικό δέντρο απεικονίζεται ο τρόπος με τον οποίο κληρονομείται στα μέλη μιας οικογένειας η αιμορροφιλία Α.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Β. γράψτε την αλληλουχία των αμινοξέων στο νέο ολιγοπεπτίδιο που θα συντεθεί. (Είναι μαυρισμένα τα ΙΙ 1. Εάν η τριπλέτα 5΄-UGG-3΄ στο mRNA αντικατασταθεί από την τριπλέτα 5΄-UGA-3΄.

Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων. Μπορείτε να χρησιμοποιήσετε μολύβι μόνο για σχέδια. Ο∆ΗΓΙΕΣ ΠΡΟΣ ΤΟΥΣ ΥΠΟΨΗΦΙΟΥΣ Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Μονάδες 13 Γ. Να γράψετε και να δικαιολογήσετε με τις κατάλληλες διασταυρώσεις τους γονοτύπους όλων των μελών που απεικονίζονται στο γενεαλογικό δέντρο. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Να γράψετε τις απαντήσεις σας μόνον με μπλε ή μαύρο στυλό διαρκείας και μόνον ανεξίτηλης μελάνης. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Πώς κληρονομείται η αιμορροφιλία Α. Να μη χρησιμοποιηθεί το μιλιμετρέ φύλλο του τετραδίου. 4. 7. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 5. 2. Μονάδες 5 Β. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . 6. ποια είναι η πιθανότητα να νοσεί από αιμορροφιλία Α. Μονάδες 7 1. 3. εξεταζόμενο μάθημα).ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ Α. κατεύθυνση. Εάν οι γονείς ΙΙ 3 και ΙΙ 4 αποκτήσουν επόμενο παιδί. ∆ιάρκεια εξέτασης: Τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 8. ∆εν επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. διαγράμματα και πίνακες.

παραμένει σχεδόν σταθερός. ελαττώνεται απότομα. κλωνοποίηση. δ. στο Bacillus thuringiensis. διασταύρωση. Οι ποικιλίες Bt του καλαμποκιού είναι ανθεκτικές α. H εισαγωγή ξένου DNA σε κύτταρα ζώου επιτυγχάνεται με α. δ. γ. των υδατανθράκων. στα διάφορα έντομα. δ. Μονάδες 5 A4. A1. γ. β. Μονάδες 5 A2. Η ινσουλίνη είναι μία ορμόνη που ρυθμίζει το μεταβολισμό α. νεκρώνεται. δ. αυξάνεται απότομα. των αλάτων. της χοληστερόλης. στο Agrobacterium tumefaciens.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ A Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως και Α5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. Μονάδες 5 A3. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . της αιμοσφαιρίνης. υβριδοποίηση. γ. γ. μικροέγχυση. β. β. β. στις υψηλές θερμοκρασίες. Κατά τη λανθάνουσα φάση μιας κλειστής καλλιέργειας ο πληθυσμός των μικροοργανισμών α.

Μονάδες 4 ΘΕΜΑ Γ Γυναίκα κυοφορεί ένα έμβρυο. φυλοσύνδετο υπολειπόμενο. δ. φυλοσύνδετο επικρατή. Ποια γονίδια ονομάζονται πολλαπλά αλληλόμορφα. Η οικογενής υπερχοληστερολαιμία κληρονομείται με τρόπο α. Μονάδες 5 ΘΕΜΑ B Να απαντήσετε στις παρακάτω ερωτήσεις: B1. Σε ποιες ομάδες ατόμων είναι απαραίτητη η γενετική καθοδήγηση. Τι είναι κλωνοποίηση. Γ1. Τι ονομάζεται αντιγονικός καθοριστής. Μονάδες 3 B5. Στον καρυότυπο που έγινε σε κύτταρα του εμβρύου διαπιστώθηκε τρισωμία 18 και σύνδρομο Turner. γ. Μονάδες 9 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Να αιτιολογήσετε τον αριθμό των χρωμοσωμάτων του εμβρύου. β. τη διαδικασία κατασκευής του Μονάδες 10 Γ2. Μονάδες 6 B3. Μονάδες 6 B2. Tι είναι ζύμωση. Να περιγράψετε καρυότυπου. αυτοσωμικό υπολειπόμενο. αυτοσωμικό επικρατή.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ A5. Μονάδες 6 B4.

αν μετά το τέλος της αντιγραφής προσθέσουμε στο μίγμα το ένζυμο EcoRΙ. Μονάδες 6 ΘΕΜΑ ∆ ∆ίνεται το παρακάτω δίκλωνο τμήμα DNA το οποίο αντιγράφεται in vitro. 2. επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. Πόσα τμήματα DNA θα προκύψουν. Να μην αντιγράψετε τα θέματα στο τετράδιο. εξεταζόμενο μάθημα).ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ3. Να αιτιολογήσετε τον αριθμό των μορίων DNA στον καρυότυπο του εμβρύου. ∆1. Το λάθος αυτό παραμένει και μετά το τέλος της αντιγραφής. 5΄ TAAGTATACTAAACGAAΤΤCATATTAT 3΄ 3΄ ATTCATATGATTTGCTTAAGTATAATA 5΄ Κατά τη διάρκεια της αντιγραφής οι DNA πολυμεράσες ενσωματώνουν κατά λάθος στη θέση 12. απέναντι από το νουκλεοτίδιο Α (αδενίνη) το νουκλεοτίδιο C (κυτοσίνη). κατεύθυνση. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των ∆εν φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Μονάδες 9 Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. αντί του νουκλεοτιδίου T (θυμίνη). Να δικαιολογήσετε την απάντησή σας. Κατά την ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Μονάδες 16 ∆2. Να γράψετε τα δίκλωνα τμήματα DNA που θα προκύψουν μετά το τέλος της αντιγραφής και να δικαιολογήσετε την απάντησή σας.

Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό ανεξίτηλης μελάνης. 6. τα οποία και θα καταστραφούν μετά το πέρας της εξέτασης. 4. ∆ιάρκεια εξέτασης: φωτοαντιγράφων.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. 5. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων και όχι πριν τις 17:00. 3. Τρεις (3) ώρες μετά τη διανομή των 7.

β. Το πλασμίδιο Ti χρησιμοποιείται στη διαδικασία α. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . β. δ. δ. Μονάδες 5 Α4. συμμετέχουν στη μετάφραση του mRNA. δημιουργίας διαγονιδιακών ζώων. γ. Οι περιοριστικές ενδονουκλεάσες α. γ. συμμετέχουν στη μεταγραφή του DNA. δ. β. Το γεγονός ότι κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο σημαίνει ότι ο γενετικός κώδικας είναι α. μειώνεται σταθερά. Α1. της μικροέγχυσης. αρχικά αυξάνεται και μετά μειώνεται. γ. μη επικαλυπτόμενος. σχεδόν καθολικός. παραγωγής υβριδωμάτων. Μονάδες 5 Α2. η οποία συμπληρώνει σωστά την ημιτελή πρόταση. αναγνωρίζουν ειδικές αλληλουχίες DNA. παραμένει σχεδόν σταθερός. Μονάδες 5 Α3. αυξάνεται σταθερά. δ. β.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ∆Α Β΄) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια ο πληθυσμός των μικροοργανισμών α. καταλύουν την ωρίμανση του mRNA. γ. εκφυλισμένος. συνεχής. δημιουργίας διαγονιδιακών φυτών.

Να εξηγήσετε αν τα βακτήρια των δύο καλλιεργειών ανήκουν στο ίδιο ή σε διαφορετικό είδος. Β3. Στο φυτό μοσχομπίζελο το χρώμα των σπερμάτων μπορεί να είναι είτε κίτρινο είτε πράσινο. γ. Τι είναι: α) γονιδιωματική βιβλιοθήκη. β) cDNA βιβλιοθήκη. Τα γονίδια που ελέγχουν τις παραπάνω ιδιότητες βρίσκονται σε διαφορετικά ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη βρέθηκε ποσοστό γουανίνης (G) 28%. Γ΄ ΗΜΕΡΗΣΙΩΝ υβριδώματα παράγονται ύστερα από σύντηξη βακτηρίων με καρκινικά κύτταρα. Μονάδες 8 Β2. ενώ το ύψος του είναι είτε ψηλό είτε κοντό. υβριδοποίηση δύο μονόκλωνων αλυσίδων DNA. Μονάδες 5 ΘΕΜΑ Β Να απαντήσετε στα παρακάτω: Β1.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Α5. Μονάδες 7 Μονάδες 6 Β4. σύντηξη Β λεμφοκυττάρων με ιούς. β. Να εξηγήσετε γιατί τα άτομα που πάσχουν από μελαγχρωματική ξηροδερμία εμφανίζουν πολλαπλάσια συχνότητα καρκίνου του δέρματος σε σχέση με τα φυσιολογικά άτομα. Tα α. δ. Να περιγράψετε το πείραμα του Griffith και να αναφέρετε το συμπέρασμα στο οποίο κατέληξε. σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα. Μονάδες 4 ΘΕΜΑ Γ Γ1.

Να εξηγήσετε τους πιθανούς μηχανισμούς σύμφωνα με τους οποίους από δύο φυσιολογικούς γονείς μπορεί να γεννηθεί παιδί με σύνδρομο Turner. Μονάδες 8 Γ3. Να αναφέρετε τους λόγους αυτής της διαφοράς.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ζεύγη ομολόγων χρωμοσωμάτων. Μονάδες 11 Γ2. Μονάδες 6 ΘΕΜΑ ∆ ∆ίδεται το παραπάνω τμήμα DNA. το οποίο αντιγράφεται. Τα σημεία ∆ και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. Το γονίδιο από το οποίο κωδικοποιήθηκε η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. να κάνετε τις κατάλληλες διασταυρώσεις που απαιτούνται για να βρείτε το γονότυπό του (μονάδες 4). ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Να αιτιολογήσετε την απάντησή σας (μονάδες 7). Στον κλώνο ΖΗ η αντιγραφή γίνεται με ασυνεχή τρόπο. Εάν έχετε στη διάθεσή σας ένα ψηλό μοσχομπίζελο με κίτρινα σπέρματα. Μία πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από μία πολυπεπτιδική αλυσίδα 100 αμινοξέων.

επανασυνδέεται στα ίδια σημεία κοπής μετά από αναστροφή. Μονάδες 2 ∆4. 5 ’ -TACATGTCGCGATGCAAGTTCTAATCTCAATAΤCTT-3΄ 3 ’ -ATGTACAGCGCTACGTTCAAGATTAGAGTTATΑGAA-5΄ ∆3. Να γράψετε το τμήμα του DNA που αποκόπηκε και να σημειώσετε τον προσανατολισμό του. Το τμήμα του DNA που αποκόπηκε. Να αιτιολογήσετε την απάντησή σας (μονάδες 4).ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ∆1. Μονάδες 6 ∆2. Να αιτιολογήσετε την απάντησή σας (μονάδες 3). Στον κλώνο που αντιγράφεται με συνεχή τρόπο να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του πρωταρχικού τμήματος. να σχεδιάσετε τα συνεχή και ασυνεχή τμήματα των νέων κλώνων με βέλη υποδεικνύοντας τους προσανατολισμούς των νέων και των μητρικών κλώνων (μονάδες 2). Να γράψετε τα κωδικόνια του μορίου DNA που κωδικοποιούν το νέο πεπτίδιο. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα. το οποίο αποτελείται από 8 (οκτώ) νουκλεοτίδια (μονάδες 2). Να γράψετε τα κωδικόνια του DNA που κωδικοποιούν το πεπτίδιο αυτό. Μετά την επίδραση ακτινοβολίας το παραπάνω τμήμα DNA σπάει στα σημεία που υποδεικνύονται από τα βέλη. Μονάδες 5 ∆ίνεται το παρακάτω τμήμα μορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. Να γράψετε ολόκληρο το μόριο του DNA που προκύπτει μετά την αναστροφή (μονάδες 4). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). (μονάδες 2) Μονάδες 10 ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . Μονάδες 2 ∆5.

3. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων.μ. 2. διαγράμματα και πίνακες. ∆εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. Μπορείτε να χρησιμοποιήσετε μολύβι μόνο για σχέδια. 6. εξεταζόμενο μάθημα). 7. Γ΄ ΗΜΕΡΗΣΙΩΝ Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. ΚΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ . 4. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ – 1. Χρόνος δυνατής αποχώρησης: 10. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. 5. 8. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Να μην αντιγράψετε τα θέματα στο τετράδιο.30 π. Να μη χρησιμοποιήσετε χαρτί μιλιμετρέ.

γ. η α 1 . οι μεταγραφικοί παράγοντες. Σε άτομα που πάσχουν από αιμορροφιλία Α. τα πρωταρχικά τμήματα. δ. γ. β. γ. δ. η ιντερφερόνη α. οι RNA πολυμεράσες. είναι ίδια σε όλους τους απλοειδείς οργανισμούς. δ. ο πληθυσμός των μικροοργανισμών α. οι υποκινητές. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . παραμένει σχεδόν σταθερός. γ. διαφέρει στα κύτταρα των οργανισμών που ανήκουν σε διαφορετικά είδη. Η ποσότητα του DNA α. μειώνεται. χορηγείται α. δ. αυξάνεται εκθετικά. μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού. Μονάδες 5 Α4. Α1. Μονάδες 5 Α3. Μονάδες 5 Α2. είναι σταθερή σε όλους τους διπλοειδείς οργανισμούς. Σε μια κλειστή καλλιέργεια. β. ο παράγοντας VIII. κατά τη λανθάνουσα φάση. β.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 7 ΙΟΥΝΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. η ινσουλίνη. χαρακτηρίζεται από αυξομειώσεις. Από RNA αποτελούνται α.αντιθρυψίνη. β.

(μονάδες 3) Μονάδες 6 ΘΕΜΑ Γ ∆ίνεται το παρακάτω δίκλωνο μόριο DNA. (μονάδες 3) Μονάδες 9 Β3. β. ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Ποια είναι συνοπτικά τα στάδια παραγωγής ανθρώπινης ινσουλίνης σε καλλιέργεια βακτηρίων. γενετικά τροποποιημένα πλασμίδια Ti. γενετικά τροποποιημένα βακτήρια Bacillus thuringiensis. ποικιλίες βακτηρίων Agrobacterium tumefaciens. Μονάδες 5 ΘΕΜΑ Β Να απαντήσετε στις παρακάτω ερωτήσεις: Β1.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Α5. Ποια είναι η μορφή των μεταφασικών χρωμοσωμάτων ενός κυττάρου (μονάδες 3). Ποιες προϋποθέσεις απαιτούνται για να εκδηλωθεί ένα φυλοσύνδετο υπολειπόμενο γνώρισμα στα αρσενικά (μονάδες 3) και ποιες στα θηλυκά άτομα. σε τι διαφέρουν μεταξύ τους (μονάδες 3) και με ποια κριτήρια ταξινομούνται κατά τη δημιουργία καρυοτύπου. που κωδικοποιεί ένα πεπτίδιο το οποίο λειτουργεί ως ένζυμο. γενετικά τροποποιημένα φυτά με ανθεκτικότητα σε έντομα. Μονάδες 10 Β2. γ. δ. Στο μόριο αυτό συμβαίνει μετάλλαξη προσθήκης τριών (3) διαδοχικών νουκλεοτιδίων (5΄-GAT-3΄). Οι ποικιλίες Bt είναι α.

να εξηγήσετε ποιες θα είναι οι συνέπειες: στη δομή του ενζύμου (μονάδες 5) και στη λειτουργικότητα του ενζύμου. Αν η προσθήκη συμβεί στη θέση Χ. Να μεταφέρετε το σχήμα στο τετράδιό σας.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Χ Υ ΑTΑTGTTGTCCAGATCAGAACCTGAGTTCCAATAGCCAG TATACAACAGGTCTAGTCTTGGACTCAAGGTTATCGGTC Γ1. Στο δεύτερο άτομο η ανάλυση έδειξε δύο πανομοιότυπες και μία διαφορετική αλληλουχία βάσεων DNA. ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Σε δύο άτομα που πάσχουν από σύνδρομο Klinefelter έγινε ανάλυση της αλληλουχίας των βάσεων του DNA των φυλετικών χρωμοσωμάτων τους. (μονάδες 2) Μονάδες 7 Γ2. (μονάδες 5) Η παραπάνω μετάλλαξη έχει ελάχιστη επίδραση στη λειτουργικότητα του ενζύμου. μεταξύ των σημείων Κ και Λ περιέχεται ένα γονίδιο. Στο διάγραμμα υποδεικνύεται η θέση του υποκινητή του γονιδίου. Αν η προσθήκη συμβεί στη θέση Υ. να εξηγήσετε ποιες θα είναι οι συνέπειες στη δομή του ενζύμου. (μονάδες 2) Nα εξηγήσετε την απάντησή σας. Μονάδες 9 ΘΕΜΑ ∆ Στο παρακάτω τμήμα δίκλωνου μορίου DNA. (μονάδες 2) Μονάδες 9 Γ3. Να εξηγήσετε τους πιθανούς μηχανισμούς σύμφωνα με τους οποίους γεννήθηκαν τα άτομα αυτά από φυσιολογικούς γονείς. Στο πρώτο άτομο η ανάλυση έδειξε τρεις διαφορετικές αλληλουχίες βάσεων DNA. Πώς χαρακτηρίζεται αυτή η μετάλλαξη.

Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. 2. 5. Να τοποθετήσετε στο σχήμα και στις κατάλληλες θέσεις το κωδικόνιο έναρξης του γονιδίου και ένα από τα κωδικόνια λήξης (της επιλογής σας). Να σημειώσετε στο σχήμα τους προσανατολισμούς των κλώνων του μορίου (μονάδες 2) και να αιτιολογήσετε την απάντησή σας.30 KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . εξεταζόμενο μάθημα).ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Φωσφορική ομάδα Υποκινητής K Λ ∆1. 8. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6 ∆2. (μονάδες 9) Μονάδες 13 ∆3. Να μην αντιγράψετε τα θέματα στο τετράδιο. Να εξηγήσετε τι γίνεται μεταγραφής ενός γονιδίου. Μπορείτε να χρησιμοποιήσετε μολύβι μόνο για σχέδια. 7. ∆ιάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. 3. κατά την έναρξη της Μονάδες 6 Ο∆ΗΓΙΕΣ (για τους εξεταζομένους) Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. ∆εν επιτρέπεται να γράψετε καμιά άλλη σημείωση. 4. διαγράμματα και πίνακες. Να μη χρησιμοποιήσετε χαρτί μιλιμετρέ. 6. 1. Χρόνος δυνατής αποχώρησης: 18. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή.

β. δ. Τα άτομα στον καρυότυπo των οποίων περιέχονται τα φυλετικά χρωμοσώματα ΧΧΥ α. στον πυρήνα. γ. Μονάδες 5 A4. Οι περιοριστικές ενδονουκλεάσες α. στον πυρήνα και στα μιτοχόνδρια. πάσχουν από σύνδρομο Down. β. β. Μέσα σ’ ένα φυτικό ευκαρυωτικό κύτταρο. δ. στον πυρήνα. έχουν φυσιολογικό καρυότυπο. χρησιμοποιείται στη μικροέγχυση. συμμετέχουν στη μετάφραση του RNA. γ. κόβουν το DNA σε καθορισμένες θέσεις. Μονάδες 5 ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Το πλασμίδιο Ti α. Μονάδες 5 A2. πάσχουν από σύνδρομο Turner. υπάρχει στο Bacillus thuringiensis. πάσχουν από σύνδρομο Klinefelter.ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ∆ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ A Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως και Α5 και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της. στα μιτοχόνδρια και στους χλωροπλάστες. γ. A1. χρησιμοποιείται για τη γενετική τροποποίηση φυτών. χρησιμοποιείται για τη γενετική τροποποίηση ζώων. Μονάδες 5 A3. β. γ. συμμετέχουν στη μεταγραφή του DNA. είναι απαραίτητες για την έναρξη της αντιγραφής. δ. στα ριβοσώματα και στους χλωροπλάστες. δ. DNA υπάρχει μόνο α.

Κατά την αντιγραφή του DNΑ. Μονάδες 6 B3. Nα περιγράψετε τη διαδικασία παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο.ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ A5. Το κορίτσι έχει ομάδα αίματος ΑΒ. στην κατασκευή των πρωταρχικών τμημάτων συμμετέχει το α. πολύσωμα. νουκλεόσωμα. Τι μας επιτρέπει να κάνουμε η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR). Γ1. Μονάδες 8 B2. Να εξηγήσετε πώς συνδέονται μεταξύ τους οι δύο αλυσίδες ενός δίκλωνου μορίου DNΑ. Να γράψετε τους πιθανούς γονότυπους των γονέων και των παιδιών ως προς τους δύο χαρακτήρες (μονάδες 8). Μονάδες 18 ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . ενώ το αγόρι ομάδα αίματος Ο. Να εξηγήσετε τι συμβαίνει στον πληθυσμό των μικροοργανισμών μιας κλειστής καλλιέργειας κατά την εκθετική φάση. Να αιτιολογήσετε την απάντησή σας (μονάδες 10). πριμόσωμα. β. δ. Μονάδες 5 ΘΕΜΑ Γ Μητέρα με φυσιολογική όραση και ομάδα αίματος Β αποκτά δύο παιδιά με έναν άνδρα με φυσιολογική όραση. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 6 B4. Το ένα από τα δύο παιδιά πάσχει από μερική αχρωματοψία στο πράσινο – κόκκινο. ριβόσωμα. γ.

Μονάδες 5 ∆4. Ποιο από τα δύο παιδιά δεν έχει φυσιολογική όραση. Μονάδες 7 ΘΕΜΑ ∆ ∆ίνεται το παρακάτω τμήμα δίκλωνου μορίου DNA (Ι) GACTAATAAAAGAAGTAGTTAGGATCATAGG (ΙΙ) CTGATTATTTTCTTCATCAATCCTAGTATCC που κωδικοποιεί το πεπτίδιο H 2 N-Μεθειονίνη-ΤυροσίνηΦαινυλαλανίνη-Φαινυλαλανίνη-Τυροσίνη-COOH. να εξηγήσετε ποιο θα είναι το αποτέλεσμα στη δομή του πεπτιδίου. (μονάδες 3) Μονάδες 7 ∆3. (μονάδες 4) Να γράψετε τον προσανατολισμό των αλυσίδων (μονάδες 2) και να αιτιολογήσετε την απάντησή σας. Να εξηγήσετε ποια από τις δύο αλυσίδες του παραπάνω τμήματος DNA είναι η κωδική και ποια είναι η μη κωδική αλυσίδα. (μονάδες 2) Μονάδες 8 ∆2. Να αιτιολογήσετε την απάντησή σας.ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ Γ2. Να γράψετε την αλληλουχία του πρόδρομου mRNA που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA (μονάδες 2) καθώς και την αλληλουχία του ώριμου mRNA (μονάδες 2). Μονάδες 5 ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . Εάν η παραπάνω γονιδιακή μετάλλαξη οδηγήσει σε αντικατάσταση της κυτοσίνης από αδενίνη. Να αιτιολογήσετε πού οφείλεται η διαφορά μεταξύ των δύο αυτών μορίων. ∆1. Να εξηγήσετε ποιο θα είναι το αποτέλεσμα στη δομή του παραπάνω πεπτιδίου. εάν μια γονιδιακή μετάλλαξη που θα συμβεί στο κωδικόνιο της τυροσίνης οδηγήσει σε αντικατάσταση της κυτοσίνης από θυμίνη.

Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία. Να γράψετε το ονοματεπώνυμό σας στο επάνω μέρος των ∆εν φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. ∆ιάρκεια εξέτασης: φωτοαντιγράφων. Να μην αντιγράψετε τα θέματα στο τετράδιο. 6. 3. Τρεις (3) ώρες μετά τη διανομή των 7. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα. ΕΥΧΟΜΑΣΤΕ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ . 5. επιτρέπεται να γράψετε οποιαδήποτε άλλη σημείωση. 2.ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ ∆ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων από το γενετικό κώδικα: Μεθειονίνη: AUG Τυροσίνη: UAC . εξεταζόμενο μάθημα). τα οποία και θα καταστραφούν μετά το πέρας της εξέτασης. Χρόνος δυνατής αποχώρησης: Μία (1) ώρα μετά τη διανομή των φωτοαντιγράφων και όχι πριν τις 17:00. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο στυλό ανεξίτηλης μελάνης. UAU Φαινυλαλανίνη: UUU . 4. UUC αμινοξέων και Ο∆ΗΓΙΕΣ ΓΙΑ ΤΟΥΣ ΕΞΕΤΑΖΟΜΕΝΟΥΣ 1.

Sign up to vote on this title
UsefulNot useful