DNA Sequencing

Dr. M. Ravichandran/ Dr P. Lalitha

1

DNA Sequencing
Two main methods 1. Sanger dideoxynucleotide chain termination method (Commonly used method) A. Manual method B. Automated method 2. Chemical cleavage method (Maxam and Gilbert method) Not used nowadays Use of the technique: Provides the order of the nucleotides in a given DNA
2

Sanger Method Campbell. 5e. 378 3 .DNA Sequencing . p.

DNA Sequencing . p.Sanger Method Campbell. 5e. 378 4 .

5e.Sanger Method Campbell.DNA Sequencing . 371 5 . p.

DNA Sequencing 6 .

DNA Sequencing 7 .

5e.DNA Sequencing Campbell. CD 8 .

each containing one of four ddNTPs • DNA is synthesized in the presence of the ddNTPs. adjacent to a primer site • Four reactions are set up -.Procedure for the Sanger dideoxy chain termination technique • DNA to be sequenced is cloned into a vector. giving rise to sets of DNA products representing all of the possible size fragments for the unknown sequence • The fragments are resolved by gel electrophoresis and the sequence is read up from the bottom of the gel by identifying the lane giving the next larger size fragment 9 .

Radioactive and non radioactive labeling 10 . dCTP. dTTP • One type of ddNTP in each type of reaction • DNA polymerase (Taq polymerase can also be used. dGTP.cycle sequencing) • One primer • Template DNA • Labeling.Composition of a DNA sequencing reaction • dNTP – dATP.

T.O OP OO O P OO O P OHO O C BASE (A. G. C) O OH 11 • structure of a ddNTP . T. C) O OH • structure of a dNTP O OP OO O P OO O P OO C BASE (A. G.

Labeling the primers S35dNTP or P32 dNTP Or Fluorescent labeled dNTP 12 . Labeling the nucleotides S35dNTP or P32 dNTP Or Fluorescent labeled dNTP 2.Labeling methods 1.

primer binding site gene for ampicillin resistance Pst I EcoRI Sal I gene for tetracycline resistance pBR322 ori • DNA to be sequenced is cloned into the EcoRI site immediately adjacent to the primer binding site 13 .

• For sequencing • the DNA is denatured into single strands • the primer is hybridized to the template strand • DNA is synthesized using DNA polymerase 5’ ||||||||||||||| 3’ 3’ 14 .

ddATP DNA dNTPs ddTTP DNA dNTPs ddGTP DNA dNTPs ddCTP DNA dNTPs 5’ ||||||||||||||| 3’ ATCATGTCATCAAGTCTAGCAC TA TAGTA • Each fragment is terminated by a ddA • All possible products of the reaction containing ddATP TAGTACA TAGTACAGTA TAGTACAGTAGTTCA TAGTACAGTAGTTCAGA 15 .

5’ ||||||||||||||| 3’ ATCATGTCATCAAGTCTAGCAC A Longer fragments T G C 3’ TAGTACAGTAGTTCAGATCGTG Sequence of the strand that was synthesized Shorter fragments 16 5’ .

Sanger dideoxy chain termination technique Automated method Manual method 17 .

Automated DNA sequencing result 18 .

Manual DNA sequencing result 3’ 5’ 19 .

http://www.htm 20 .ac.uk/Extranet/DNA_1/6_Sequencing.rvc.

• DNA Sequencing by the Enzymatic Method 21 .

They therefore act as chain terminators. but also present are dideoxynucleotides. Dideoxynucleotides are deoxynucleotides which lack a hydroxyl groups at both the 2' and 3' positions. Not only are all four normal deoxynucleotide triphosphates present within the reaction mixture (dATP. known as dideoxy sequencing or the Sanger method (to distinguish it from the chemical Maxam/Gilbert sequencing method). dGTP. dCTP). 22 . therefore cannot extend the chain by linking to another nucleotide. The DNA to be sequenced is used as a template for in vitro synthesis by DNA polymerase. one of each type (eg.• The predominate method used nowadays for DNA sequencing is an enzymatic technique. dTTP. ddATP) per sequencing reaction.

or one of the normal deoxynucleotides. is labelled. one can read the sequence directly eg. There is therefore a competition between deoxynucleotides and dideoxynucleotides (eg. Four separate reactions are run and these are loaded and their components separated within four separate lanes of a denaturing gel by electrophoresis. one for each of the four dideoxy chain terminators to be used. 23 . used to start the reaction. In addition. four reactions are set up. Thus. from the bottom to the top. in manual sequencing. The dideoxynucleotide is present at a concentration about 200-fold less than its competing nucleotide. either the primer. here for dA and ddA) for incorporation into the growing chain leading to a statistical representation of lengths of DNA which correspond to the first 200-500 residues complementary to the template.• Typically. from the autoradiograph. Labelled bands will appear at each location where the dideoxynucleotide brought that particular elongation reactions to a halt. this could be through a radioactive atom or through a fluorescent tag.

Cycle sequencing Cycle sequencing 24 .

A second strategy known as "primer walking" requires very fast and accurate analysis of sequence reads since each sequencing reaction uses information from the previous read. Methanococcus jannaschii . know as "shotgun sequencing" takes maximum advantage of the speed and low cost of automated sequencing. but relies totally on software to assembly a jumble of sequence reads into a coherent and accurate contig. The Institute for Genomic Research (TIGR) has demonstrated the power and utility of the shotgun approach by determining the complete genomic sequences of Haemophilus influenzae . 2. and Mycoplasma genitalium. 3.Strategy for DNA sequencing 1. A "directed cloning" strategy. carefully preparing ordered overlapping fragments. 25 . A third strategy.

2 5’ 3’ 600-800bases 26 .2 5’ 3’ 600-800bases Design primer at 3’ end Primer.Primer walking Primer.1 DNA Template to be sequenced in a plasmid vector/PCR product (2kb) 5’ 3’ 600-800bases Design primer at 3’ end Primer.

. 3’ 5’ 3’ DNA sequence of 2kb DNA 27 .Primer walking Contig assembly 5’ 5’ 5’ 3’ 3’ cont.

Shotgun sequencing DNA Template to be sequenced in a plasmid vector. Sequence the insert Contig assembly 28 . YAC or BAC ( 20 kb) Insert cut in to small fragments by restriction enzymes Clone in a plasmid vector Gene fragments in the plasmid vector.

vector sequence present in the sequence should be 29 removed (usually done using a molecular biology software eg. The resulting sequences has to be contig-assembled as shown in the picture above using software. DNASIS. BIOEDIT. DNA has to be sequenced as a stretch of 600-800 bases in five sequencing reactions. eg. DNASTAR .Contig assembly • • • • By a DNA sequencing reaction we can get upto 600-800 bases of DNA sequence Both the forward and reverse strand can be sequenced separately using specific primers In the case of 3kb DNA. DNASIS. DNASTAR Before contig-assembly.

Sign up to vote on this title
UsefulNot useful