P. 1
icke

icke

|Views: 33|Likes:
Published by JUANDEPADMOS

More info:

Published by: JUANDEPADMOS on Jun 14, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

01/14/2014

pdf

text

original

Las ilustraciones originales en este libro son por Neil Hague

!
# $
#

% & '
' #

#

"
$)

(#
$ #

#
!

#

!
*

!

%
&

$
!

#

'
)
!

$
#

# #
, -

!

.

$
#/$

$

+)

0

%

#
$)
0 .%

"El trabajo de Neil Hague es único - el lenguaje de una mente
muy creativa y abierta. Usted mira con sus ojos, pero él habla a
su corazón." (David Icke)
"A Través de Ojos Antiguos debería inspirar hasta al alma más
dimensionalmente resistente para abrirse hasta realidades más
benignas y suntuosas que actualmente se reúnen con, o
integran, nuestro planeta en peligro." (Jaye Beldo)
Para más información sobre el trabajo de Neil y como comprar
sus cuadros visite www.neilhague.com

Contenido
1
1
1
1
1
1
1
1
1
1

#2
#2
#2
#2
#2
#2
#2
#2
#2
#2
#
#

3 4
4
4
1
4
1
4
, 4
, 4
+ '4
4
.4
4
4

/ 1 #

0
9
0

+
,
1

,
5 #
$ %%%%%%%%6
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% 7
5
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% 8
!:
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%8;
1
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%<<
9
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%76
)
=* 0
>
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%?@
0
A
,
A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%@<
B
C1 ) D%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% ;@
,
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
>
B
1 2
5
% E;
"
1 ( 5#
*
F
2
G% %%%%%%%%%%%%%%%%% EE

Verdades Eternas...
Cada hombre toma los límites de su propio campo visual por los límites del mundo. (Arthur
Schopenhauer)
Los medios violentos darán libertad violenta. (Gandhi)
El disidente es cada ser humano en aquellos momentos de su vida cuando él renuncia
momentáneamente a la manada y piensa por sí mismo. (Archibald Macleish)
Pienso que todos tenemos una pequeña voz dentro de nosotros que nos guiará... si excluimos todo el
ruido y desorden de nuestras vidas y escuchamos esa voz, ella nos dirá lo correcto a hacer.
(Christopher Reeve)
No vale el tiempo de un hombre inteligente el estar en la mayoría. Por definición, hay ya bastantes
personas que hacen eso. (G. H. Hardy)
Cualquier tonto puede hacer las cosas más grandes, más complejas, y más violentas. Se necesita un
poco de genialidad - y mucho coraje - para moverse en dirección contraria. (Albert Einstein)
Un cobarde es incapaz de mostrar amor; es el derecho del valiente. (Gandhi)
Aprecia para siempre lo que te hace único, porque tú eres realmente un bostezo si se va. (Bette
Midler)

Siempre Considera el Lado Brillante de la Vida...
Algunas cosas en la vida son malas
Ellas realmente pueden volverte loco
Otras cosas sólo te hacen jurar y blasfemar.
Cuando masticas el cartílago de la vida
No te quejes, da un silbido
Y esto ayudará a que las cosas resulten mejor...
Si la vida parece muy putrefacta
Hay algo que has olvidado
Y eso es reír, sonreír, bailar y cantar.
Cuando te sientes en los vertederos
no seas un tonto zoquete
Sólo aprieta tus labios y silba - esa es la cosa...
La vida es un pedazo de mierda
Cuando la miras
La vida es una risa y la muerte una broma, es verdad.
Verás que es todo un espectáculo
Mantenlos riendo mientras vas
Sólo recuerda que la última risa está en tí.
Y siempre considera el lado brillante de la vida...
Siempre considera el lado luminoso de la vida...
Siempre considera el lado brillante de la vida.
Palabras por Eric Idle, La Vida de Brian de Monty Python

Quién mira afuera, sueña; quién mira adentro, despierta. (Carl Gustav Jung)
Los grandes espíritus siempre han encontrado oposición violenta de los mediocres. Éstos últimos no
pueden entender cuando un hombre no se rinde sin pensar a prejuicios hereditarios, sino que franca
y valientemente usa su inteligencia. (Albert Einstein)
Todas las verdades son fáciles de entender una vez que son descubiertas; el punto es descubrirlas.
(Galileo)

E

$ " # $ 3 ' # ! # # " $ . sus pasiones una cita. sus vidas una imitación. . 2 # 24 " # " " ' ! $ ) $) # A A % > ! ( # ! " ' ! .# $ ! $ " # 2 !" # - 2 $ % # $ ! # # %1 # ! 2 %* % ' ! # $ " # - ! # # ' # # # F1 .% " $ % " J $ ! # " 2 ' " " 2 ! $ J " " # ' $ % ) # # " %* " ' ' " - $ % $ " ! " 2 ' $ K ! ! % " $ A " A ' # %9 ! # A" $ ! # # " ! ) # A % . . 2 $ $ G% FI ' G% .CAPÍTULO UNO Ningún Copo de Nieve en un Alud Nunca se Sintió Responsable La mayoría de las personas son otra gente. (Oscar Wilde) @@." A A 3 " # ' ' ' %F " A ! %3 $ $ ) " # # ' $ % ) $ # %H # 2 G% FI # # # " " $ ! G% 9 # # " # 2 . # % FH # %* ) # ' ' $2 # " ) # # " % # " # " ' !) A % # " ) A %3 F $ # 2 # % % ! $ %H G% . # $ " # %. # ! $ # ! 2 # 2 G% B F ! G% FI " ' !" ' ! 2 $ # $ J $ A A % $ " . Sus pensamientos son opiniones de alguien más. = $ A " # $) ! # ) 2$ % H ' $2 " (# = = # " " % H $ & # # ' " # " # &# # ' # ( " " %1 $ 2$ # % . " # J! " ! % G% # %* ! 2 # . 2 " $ $ # # " = # %9 $ # " $ $ " # # # # # $ # % # 6 J # % # ' (# ! " $ % ! 2 # # " # 2 $ # ' ' " ' ' " .

! 9 # ' ! " ! $ # # # # ) # # - ' # 2 " " ) G% " % 4 * 1 5 3 + $ . ! # . ' ' ' N% F1 5 # 4 $ " - # ( ( # A % B " . / .% M+! ' $ D% * % A A( A % $ # $ # A -% # ! " # A ( A % $ 2 '$ % 2" A # $! ( K % + ' ' ! 0 # - " % " $ .! ) % M+' A A # $ F" G% FI " ) ! # " G% * A A # # " ! A # AA # A# " (# ) $ ) % * " # % 1 $ )4 A / " A %& $ )" A " " # # A % $ # ' . + F9 " " $ ' ! C # # # # .) " ' " $ 2$ " ' ' A # % $ # 8 # # 2 A# '$ $ $ ) . # " " ' ! A A # # 4A JF ' GA %B " " G% 1 A A G% * ! 2 (# !# ' . $ )AA $ ' ' ! 2" ' ! " 2 A # A " ' $2 B - ) ! . $ " " " $ # .N% .* " ! ' F G% F1 # .# . / 7. $ ) " # A G% F ) $ - " 2 " ' G% FI ') ! G% F A $ # # % F9 " $ # ' %F # ! ' # G% F1 ' " ( " 2 " # 2 # 2G% " # 9 ' $2 C ! $ . .# $) " " A$ $ ' " ! # " A $ A # . # ! % ( ! ' 2 # $ - " - # A# $ 8 " .6 " ') $ $) ' # " " %3 # ) )" # # ! ! ( D 2 ! # ( # " G% 9 .# ) " $ # .% M0 $ $ 2$ ! 2" ! $2 K B % 4 2!9 " 2 ! # 8 . # G% 9 A! AA $ A# ' " " # # # L.% FH ! # # % $ 2 # " " 2N% '$ $ " ! # $ ( # # % ..

! % " ' ' " = # " " " 2 " $ ' / " # # " D% . compañero." A # N% # $ ' 2 2% %& 2 ' ' %A> # " ' " # " # A % $ A 2 . " % ( $ ' # # ( % ¿' Te gustaría salir hoy.' 'No gracias. " " $ # Figura 1: ¿'Pero podríamos salir si quisiéramos.' " % FI ' /# =# ' " 4 A A 2" # 2 @@.2 # " $ ! " $ # " ! # $ ( $ 2# " $ !# % M& 2 # $ $ " J 2 G% '! * 2 ! L ! # # # " 2 2 ' $ " ' %A # " # $ +O ' 2 $ " # % ) # " # $ A % # ! $ 2 $ (# # ) J! ! " # 2$ !# %* 2# ' $ # ! # $ % !# # / # ! 2 / 2 # # # % # # " # . ! $ % # " '! . ' # " " $ %* ' 2# # ! # # # # % # $ " A $% # 2 # ' " ' $2 ' ! ' %0 ' ) # # " ' # # )4 A / $ - # " % 0 # ' % ! $ " ' # # ' # ' A %3 B > # %9 " " $ A ' ! 2 # # " ) ! . $ " = $ " D% " %9 C: C %H $ / ! " = . estoy feliz sentado aquí'. Bill?. verdad?. (Él lee "Dosis Diaria de Ilusión") < " " A! '$ " ' ) %* A 2 $ $ $ .

'Está bien." 2" # # ! ' 2 ' %* # A K > A+ O # 2 2 $ . entonces . banco central y ejército mundiales.' (# )" 2 ' 2 ' $ # # ! ! # % ' > A 2 # A " " 2 " . Lo que ahora llamamos 'países' serían simplemente filiales administrativas controladas por el gobierno.# $ % # " " " . # ! ' ' ' $ . 2 !' " ! % # ! ' # / # " # 2C # # D 2 $ % .'Seguro podríamos'. # # A2 A! ' " # # % # #2 ! # $ " !" ' " 2% # 2" 2 ! # # 2" 2 % A %> ! # # % = # GOBIERNO MUNDIAL Banco Moneda Ejército Centrales Población con Microchips Unión Europea Unión Americana Unión del Pacífico Unión Africana (Evolucionada desde la CEE) (Evolucionada desde el NAFTA) (Evolucionada desde el APEC) (Evolucionada desde la OAU) Estados Nacionales y Regiones Figura 2: El estado fascista global Iluminati. # $ '# ! # $ C: D% * # . !A $ ! (# # 6. # $ $ ! ) " . " # A %9 # (# . A 2 A ! " # # # A 1 # # $ $ !A # " $ A $ # . ! ' .# 2 $ # " . # !# # " . $. " %& # ! . $) . % # ! P . El plan es para una dictadura del gobierno mundial que incluye un segundo nivel de súper-estados como la Unión Europea. # A# " $ % 2# ! # ) # 2" % 3 A ' $ # $ ) " $ A ) % 0 ' % > $2 # = =!! $ %3 )4 A $/ " %. Esta estructura permitiría que unos cuantos impongan su voluntad a la población global. ) 1 B # # A" .¿no es grandioso ser libre?." P ' 2 % * # # # % # 2 ! ' # # $ " # (# ( ' % # 2 /# = 3 # 7 ! # ) 4 3 . " ' ( # # 2 A C 0 0 ! 1 0 D% 9 . - @@.

A! ) A $ " . ! # # % # # ) # ' ' # 1 . Linajes Iluminati Élite Global Banca Empresas Educación Política Fuerzas armadas Medios de comunicación Servicios de inteligencia Medicina/industria farmacéutica Drogas ilegales/crimen organizado Figura 3: La dictadura de muñecas rusas. % . # # A $ A 9 # # ) + .% 1 # $ # '. ! # # ) . de cajero del banco a presidente de la junta Todas las instituciones y grupos principales que afectan nuestras vidas diarias se conectan con los Iluminati.ej.1 # C: D% & # = ' %* $ =9 2 # # 1 C 9 1D ! # . 9 # ! % # # ! # % $ # A % # " Q A *$ 1 ' ' $ # # " # .# $ %+ # $ # ' 2 # A %%% $ A % # 2 $ # %1 # " 2 0 . ' " ! 0 A # ! 1 ' # 2 % $ " 1 ! 0 $ 9 1 . # % 2 # % * $ " $ # $ # " ) .% ! # # $ " # ) ) ! ' ' " 1 $ # " " # " 9 1 =!1 # 2 ) . %1 '4A % " # 0 ! ' .%* # 2 # # # $ % La Pirámide de Manipulación Niveles de conocimiento y jerarquía dentro de las instituciones. quienes deciden la política coordinada a través de toda la pirámide. p. Las ‘sociedades libres’ son un mito porque la Mano Oculta impone su orden del día detrás de este velo del engaño. ' # 2 # ) % * )D # 2 ! C $ 9 1 5 3 ' A A" # # .= $ " " " $ # %. Encima están las familias Iluminati que manipulan su orden del día para el control global a través de organizaciones e instituciones aparentemente inconexas. $ ! 3 # # 2# 2 2 # % $) ' % / $ # # # : . La sociedad global está estructurada como pirámides dentro de pirámides más grandes con una abarcando a todas ellas. # - " ! ' # 2 A$ # # 3 * # 2 /# $ # 2 . $ # = = ! # # 5 ' ' # 2$ ! 2 B 1 C ? # # 0 D' ! # . La gente en los compartimentos inferiores no tendrá ni idea de lo que Religión ellos son parte.

$ 2 " $ # 2$ # $ %* $ $ $ A # # # # A " " " $ C: 6D% F1 # G% F.! # # # " # # 2 # ) " $ ' ! A %* ! # # ! # # # # # " $ # # $ # 2! $ # C: # " # ! %* . 2 A % * . $ # ! . %9 # % ! # %1 # . $ " %9 % " # # # = %1 # . ' # # # =# # %* # A A ! $! ' # $ A $ ( " ' A # A # # $ # . $ ! ! . $ . y hasta el 'dinero en efectivo' es sólo un pagaré que promete pagar en algún tiempo en el 'futuro'. $ % F1 # # '! G% 0 # A " ( A " # " ' A # A! # # " %* " = '" C 2# ' " !A ! # 9 #' # 2 ! '% > # 2 " $ # 2 ! 2 <. $ ' " $ G% . $ ! $ " ( ! '" J % # % * # $ 4 # " F # 1 $ " # $ $ !' $ A A %* " A 2A A " % =! ' A # A D A! # " A # " A % # # % # G% # %M ! # A $ A # " " A ( ' A # N% .R# # $ " # A A # # $ # > #' # ' # ' # 2 ' $2 / " $ % 2 $2 A K %F 2 # 9 1 G% & @ ' $2 # '. Está allí para que todos lo vean en los billetes de banco británicos. " # $ %.2 $ . # ' # ! $ %. # !' # - # ED% $ 2 2 " # # $ 2 # % " " ' ! # # " % Figura 4: El Dinero es simplemente deuda.

" # $ $ # . aguantará su carga sin queja. o tan dependientes de sus favores. mientras por otra parte. !' % 3 # 4 # 5 ' ' H ?<E Los pocos que entienden el sistema o estarán tan interesados en sus ganancias. ' ' ' " ! # $ 3 " # 2 # " " ' C:11D # " # " K ! +O # ( : ! # # $ % # C .' $ # # $ % % $ $ % $ '! .. " # % %1 . que no habrá ninguna oposición de esa clase." ! " $ # $ # # # # ! $ ! 2 # % $ # # $ # ' " # 2 !' # " " $ # 2 " # $ ! $ %9 $ " # # $ # # . ! # $ " # 2 # %9 K $ ! " 2 G% % % %9 # 2 %1 # # '! % # -2 1 % * = # " 2 # # $ $ $) !B # # # # ( ) ! ! # %* 1 : 1 $. el gran cuerpo de la gente.E 1 1 .." ! " # " # ' $ # # % 1 " .. # ') 1 9O 0 ' ( # # ) 2 % # ) ! $ ! !# %* " % ( $ @?6% 3 # 1 1 " B ' ) # %> # / A A % # ! .!' F9 " " $ # ' # # # ! # 4 # # $ " ! # " '! A A / " " ! # S# C D # 5 3 % 2 # ) $ K A # A # # ( !# # % A # '# A % F9 " '# G% / N% MH $ C # # $ 2 ! D % " $ % # $ ! N% # ! T 2 " # J ' @7. ' # " T $ 2 # . $ " %0 ' # # " # # A A $ $ '" ! % . mentalmente incapaz de entender las ventajas enormes. y quizás sin sospechar que el sistema es hostil a sus mejores intereses. A A # # # " $ # %* # $ %* # S ! ) # % * $) # " # # # $ $ M9 # = =# $ # ! ( $ ! # -2 = # " .# # # 2' > #' % # % # 2" A ! # A # A L A $ 2 # # " 2 # ) # $ # # " ' $ # # N% $ %M # ' $2 L # 2 / ( # # $ .

U 3 S0 V>55 ! UV I 9 5 % $ # 3 .%* # $ 5 0 ! %* 2 ! # " % $ 2 '$ A ) % 2 Figura 5: Los ataques del 11 de septiembre fueron un ejemplo clásico de la técnica de Problema-ReacciónSolución y las 'soluciones' fueron todas planeadas mucho " . . : VW . . 3 B1 ! $ 3 B1% # " # # % H = 5 U . A# # ) A B * $ :B ! = %* 5 ' ! % # A (# A %0 # # # A A! $ # $ A # A % ! '# % # ! 2 ! " " ! $ 2 $ $2 $ ' / D" #/$ # # 1 $ A A ' 6' # 2% * # A A' " " 2 # # " A# A # # # " 2% 5 # 2" 2%9 # .) # # ! # ) 3 # BB1 # " # $ 5 0 . 1' VW W S: U ' V V. B1 B 0 . L S.1 0 V 0 > U . # % # ! ' " = # 2 #/$ ! ' .+ : V0 . : V 5W : ( V . . ! % ' $ ! ' $.$) D # ! * # # # # # ' . ! % '! # ! % ' ! % ! . . S: U ' U 51 U ' U L0 V . B * 5# ! 1 0 ! :( ':( 1 # > !O # # 2 !# $ O # 0 # > # 1 :( O C " ' ' 0 ' / %3 . % K ! 2 A A % K # B1 1 B1 0 . . % # 0 ! (# C '$ ( ' ' =! ! ! %: K > A A % #/$ C D '.# " antes de que las torres gemelas fueran golpeadas. =: U B1 = V B1 * Q U 0 I 1' U1 3: V . " A @@ # A " " )" # $ " ' $2 %1 # " ' $2 # # # # ) BB1 " A 5 0 AC # D * # # A# A $ % A $ 2 '$ ' . (Vea $ Alice en el Mundo Maravilloso y el Desastre del Centro # Mundial de Comercio y Cuentos del Bucle del Tiempo # # ! # para el trasfondo detallado).. # -2 " ) ! D# O ' #'% 3 A A # # K $ / ! ! 2 %3 # ! # ! ( ' % ! ! +*= =U # A ! " $ ! ' # %. U > U 1 ' U 10 > 1 $ U 0 B ' UL 5 9 V SVU >H * Q L3 H U . L S. # # 2% A " ! " " # " .

y aparecen más espectacularmente en tiempos de guerra.. # # ! ' # GA % # 2 # '# # # # $ G% 3 $ " .# $ D ' $ " A $ ' A 8D% 1 ' . Sus varias manifestaciones grupales son a veces clasificadas bajo el título de 'instinto de manada'.! ' 2 ' '#% 1 2 # %A 3 ' A ) %F 2 # '# ' $ ' " # ! ) # ! # # = %1 # . C # D 2% ') # $ " ' $ ) %A F # $) # ! ' # 2# # # " .' * . B ! % H ! # .# ' $ %1 # ! (# ' # %. " ' 9 $ =5 =. accidental o deliberadamente inducidos.. J! D " $ # # ( %.# # # ' C. ' # AC $ 2 ' # # A # # $ $ $ " 2$ ( # # # # ) " # % ' ' . * $ $ " C: +O # .# # '# ! ) N% # $ ! # $ A $ ' - $ ! % 3 2 C ! " . durante epidemias severas. # $ > ! # # = ' # $ 5 0 # # 2 B ) # $ %9 # " $ J# # # ' A A % * '# ! 2 2 ' . Nos aconsejarían no subestimar el efecto en la psique colectiva en términos de miedo y un deseo de que las autoridades "protejan a la gente" de ese miedo. cólera o entusiasmo. !D ) " ! ' $2 ' $2 # " ! # $ #/$ ' $2 / # * " # ) # . '.# $ A % * # ! " # # # " K B # 0 4 1 # ! # # % - ! / # . $ %F ' ) %. %%% # " 2 # # 2N% # ! # 2 " " $2 # %3 ' $ # " # ! % $ (# # K # ! # # ' / ..# # 2 $ % * # %M # ! 2 %* # . # ! $) # ) '# " 2 # . '# ! ! ! # " 2 $ ! % 2 " '# 2 # G% 9 " # " %> 9 # '# % 1 . . y todos los períodos similares de peligro común. ' 2 2 % # U $ $ @87 'Varios tipos de creencia pueden ser implantados en la gente después de que la función cerebral ha sido deliberadamente interrumpida por miedo.# ( # % M ' ) # . que aumentan la ansiedad y así la sugestionabilidad individual y masiva. De los resultados causados por tales perturbaciones el más común es el juicio temporalmente dañado y la sugestionabilidad aumentada.

> D# A ! # $ A A 2 " '# ! # 2# 5: " ' # +O # # $) $= # " # .# $ 4 . # C ## .. D : " # A !A . # " A 3 $ 1'# V A A A " # # 2 % Figura 7: Campos de concentración digitales . > $) T.6 ) ! A % % 1 # # 2 5 $ C5: D " # %A * # 2 ' $ ! ) ' # $) $ # # ! A 2 %1 $ # C D4 A 0 # ! # #/$ ! $ # A % ) # # C " '# ' Figura 6: El microchip con el tamaño de un grano de arroz diseñado para convertir a la gente en robots. Traerá cosas buenas para usted. Es vital para la libertad humana que la gente rechace ser implantada con un microchip. 3 2 # -2 # # .el mundo con microchip simbolizado por Neil Hague.# $ ) # $ $ $ / # # % # %I # $ % " # -2 " 0 .# # # # '# 1'# A # . '# Q % # # 2 ) . '# $ X' 9 >) 2 'El Ángel Digital será una conexión desde usted hacia el mundo electrónico. A A # " A V %.. ! .C: < ! 7D% > " ) '# # ' # A # A' . 1'# ' '# - # # ! : K A J! $ . protector. " # # $ '# # # > # # # % ' %3 $ ! " # # # # # % 9 # '$ # # 0 ( # # -2 ( # # = A % '# $ %* ! $ . +5B1+0 0 # -2 $ .' ! '# ! . 1'# # # A # # E ! # # '# . $ . Será su guardián.. U $ # .6 " ' $2 1 # ## . A ! A # 39 D" C >>.D ' # # $ " 2 ' $2 ' $ .C . Seremos un híbrido de inteligencia electrónica y nuestra propia alma.% 3 # C# ! # 9 3 . D! .

% # " C 1 D! @<@% " # # 2 %%% * > # " $2% " ' # * $ D! % # " 4 La experiencia ha demostrado que el método más simple de asegurarse un arma silenciosa y ganar el control del público es mantenerlo indisciplinado e ignorante de los principios básicos del sistema por una parte. > 3Y. comprometiendo sus emociones. 2 " H # " $) ! - # K B0 # # ) " . 6 .sobre todo la TV y los periódicos.6 = # -2 # # 1'# C # . A # 9 B 'A# ' '#D %* $)# # # ! %> ' 2 $ $ # # # ' ' A ' # A '# $ $ ! $ % F1 " # " $ G% D! # B $ # D E@ %%%A %L ! 9 3 # ! A . y desalentando creatividad técnica.. saboteando sus actividades mentales. proporcionando un programa de baja calidad de educación pública en matemáticas. # # ) " ! %1 # %* 1 '# $) . # % $ . y guerras en los medios . # % # $ ' ' # ! ! ! C5: D # $ 1'# # # C: ' 2 $2 @@6 " ' $ C # '#% # # '# # '# !# ( # $ ) # ' @@7 " '# & ) " ' H * # / ( C ( # %3 # 1 C 2 '# ' # # ' ! ' $ # 3 " A A % : ' # " '# " # 2 !' % # % # @8. aumentando su auto indulgencia y su indulgencia en actividades emocionales y físicas por: a) endureciéndolos a afrentas y ataques emocionales (violación mental y emocional) mediante un bombardeo constante de sexo.+5B1+0 0 # # )" ! %. # $ # " # $ %* # $ % '# # 2 ( K # B D " # # ! " % .2 # $ $ # $ ! # # ) $ $ " # ! 9 3 ( $ # > *$ '# ' 2 # $ # ! ) %. mientras por otra parte se lo mantiene confundido.% @86A % 3 . @?< $ $ . diseño de sistemas y economía. $ ! L' * # A %. y distraído con asuntos de ninguna verdadera importancia. A( A ' . @86 C " # " $ $ $ ' # $ # 2 # D ) ) " % # '# # # # " % 2' '# # $ 4 A $. Esto es conseguido por: 1. !. 2. # . violencia. desacople de sus mentes (de la planificación). desorganizado.

en vez de un tirador. ellos no pueden expresar su sentimiento de un modo racional. La regla general consiste en que hay ganancia en la confusión. opciones. verdadera ley. sin tiempo para pensar. y por lo tanto no pueden creer que ellos estén siendo atacados y sometidos por un arma. ocupado. ocupado. y sus fuerzas y debilidades físicas. el público se ajusta / adapta a su presencia y aprende a tolerar su invasión en sus vidas hasta que la presión (psicológica vía lo económico) se hace demasiado grande y ellos colapsan mentalmente. no causa ningún daño físico obvio. Por lo tanto. las armas silenciosas de la tecnología de automatización social. verdadera economía. propulsadas por procesamiento de datos. es decir. En resumen: Medios: Mantenga la atención pública adulta distraída lejos de las verdaderas cuestiones sociales. ellos no saben cómo pedir ayuda. Éstos impiden su interés en. Esto no hace ningún ruido obvio. # !/ 1V G% ! " % # S $ S# $ C 2D %1 ." S $ !/ % ' # " ! ! ! % * ! # # ! ' $ ! ) $ # !/ ! / / % ' $ C! )D $ " ! # ) ' ! # $ % $ $ % * = % 2 = # # 8 A# " % # ! ! ! 9 ! # ) 1 %* " " ) $ $ ! . el mejor acercamiento es crear problemas y luego ofrecer soluciones. y de modo inconfundible interfiere con la vida social diaria.' A A 4 Dispara situaciones. y no saben asociarse con otros para defenderse contra ella. Cuando un arma silenciosa es aplicada gradualmente. y no interfiere obviamente con la vida social diaria de alguien. F5 G% 9 # $ % F> !! " # #$ 0 > # $ # $ ! S # $ # " ! ! 3 ' ' ' # " " !/ ( Z " ' A ) " " # ! 2 # ' - $ # " " " . y cautivada por asuntos de ninguna verdadera importancia. Por lo tanto. desde un ordenador. Trabajo: Mantenga al público ocupado. y movilidad de los individuos de una sociedad conociendo. en vez de un general militar. causa daño físico y mental inequívoco. y atacando sus fuentes de energía natural y social.y privarlos de lo que ellos realmente necesitan. bajo las órdenes de un magnate bancario. más ganancia. uno que sabe qué buscar. operado por un programador de ordenador.en exceso . c) rescribir la historia y la ley y someter al público a la creación anormal. de regreso en la granja con los otros animales. Por lo tanto. inequívoco a un observador entrenado. el arma silenciosa es un tipo de guerra biológica. entendiendo. en vez de balas. Entretenimiento: Mantenga el entretenimiento público por debajo de un nivel de sexto grado. en vez de granos de pólvora. Aún así hace un 'ruido' inequívoco. y el descubrimiento de. El público podría sentir por instinto que algo está mal. o manejar el problema con inteligencia. y emocionales. en vez de un arma de fuego.'comida basura para el pensamiento' . manipulando. Escuelas: Mantenga al público joven ignorante de verdaderas matemáticas. El público no puede entender el arma. siendo así capaces de cambiar su pensamiento de las necesidades personales hacia muy fabricadas prioridades exteriores. y verdadera historia. mentales. pero debido a la naturaleza técnica del arma silenciosa. a más confusión.b) darles lo que ellos desean . Ataca la vitalidad.

Los doctores destruyen la salud. $ ! ! ) " 2 # " # 2 " $ !/ %A . $ !/ # 2 # ." . % # # . # %9 C # % ! # % $) # # ' ! ! # 2 $ ! $ " 2% % (# ' ' " B " J' $ '! $ 2# ' 2 # # 0 ' % ' %* ) # ) # # '4 'Sólo mírenos. los abogados destruyen la justicia.' F9 " G% 9 " # " ' % < . / " 2 # # # # # # # " $) ' ) # 2 311% * 1 # ! / $ % 9 2 '$ $ ) # $ ! 2 > #' ' ' # % # $ # # % # % $ $2 ! # $ % 9 " 1V A= " # $ B *! 0 2 $ ! $ 3 1 =A ) ! ' $2 $ $ ! # 2# ) $ # 2 ! " " % % # !/ # ) " $ # $ %+ # ( )" " ' $2 .2 # " A A % # " ! # # ! $ $ !/ # " $ # % $2 # # 2 > #' # " / . # $ 9 / % # ' $2 / # $ # " $2 " %& %9 # " '." $ $ ! %* # -2 " # # $ $ 'J " - 2 " J! " A A $ " # $ ! " # # 2% 3 . las universidades destruyen el conocimiento. % )2! '$ # $ / # 2 ' $2 $ !/ % " # # ! " # ! # A A" ( % $ # % ! H* ! # $ # * > " ' *$ # $ J 2 # # ' !1 . los gobiernos destruyen la libertad. " ! # $ % 9 2! ) % D $$ ! ! $ # # 2! .# " $ " ( % 3 ) # % ) B # * ) ! 3 1 $ ! K B .J " ' # $ $ !/ ' $2 # " % > '$ )." '# " # # 2 # # # # J $ $ 0 ! " # ! . todo es al revés.% # )# ' # $ $ " ! (# # " ' % # )" ' $2 . # $ ! .! $ ' " 3 ! 1 # " $ # " ! " 9 $ !/ 2# " ' $2 ! # ' ! " $ % ! . los medios principales destruyen la información y las religiones destruyen la espiritualidad. " $ A ) $ % . Todo está hacia atrás.

. " ) # $ 2 # ! A ( # # %5 ' # " 1 % . .: Columbia Journalism Review: http://www.%+ " $ ! $ %* " ! # 2" C 2 " # $ # % $ . ! ' % %3 $ " ' " ( ' 2 " %0 # # " # " 2 " % * 2 " ( " $ $ # . (Oscar Wilde) " # 2 # " '. / # # " " ' 1 # # # DJ # $ # # % %1 # T . ! . =" .. ! $ 2 A % A ) ! ! 5 ! ! # = ' %3 " $. 2 A " = % = # # ' # ! " / # 2 ! ! % 2 . S # A2 $ # $ # ! # (# 2 # # ) " 2" " $ %. % $ # / - ( ' " 1 # ! A # * A' $ 2 ! @. / # $ " " # " !# " ( " 2 # ' $ 2# # " * # $ ! " " ) $ # " ! 2 % ! ' 2 2 %9 ( ' $ A ./ . A2 # " '$ # 2" ! A " ! ! # %* % # " % .%.org/tools/owners/ 1 CAPÍTULO DOS Más Allá del Velo Cada vez que la gente está de acuerdo conmigo siempre siento que debo estar equivocado.cjr. A # " A ! # %.8 # ' # A % 2 " ' 2 . " @@." $ # ' # # ! %1 2 % # # # % A 2 ! / $ A .. 5 5 # 5 # ! 7 # $ " %0 # B # ! A % ! # " 5 2 A ! %.. . # ( A ' '$ ! # . ' %1 # # = " B # = ( ( $ A ' 'A % # # # @@.

( $ " . # 2 $ A = " % # # ) # A ' ! # $ # " ' # $ # # # '$ % A ' ) # # A # %3 # 2# 2% A ' # # ! ? % ' .6 $ # $ # % >% % 5 ! # : .2 ' # # # % # # @@. J# A 0 ' " 0 2A 2 % * (# ! % ' $ ' 3 # ! # ! # ' %3 " # A# 2A %A FI GA# A A % " # %3 $ '$ 2 ' # ! " 2 " 2" $ $ ) %* # # ' # " $ " ' % 1 # # " # . # # J 2 . $ # " ' " ! ' # %3 # $ % $ $ ' % " A ! A J # " " $% # %3 $ / !# %1 $ # # %> # " # # # # % 3 $ ' ! ' $ .! # ' # '# A! A A A A # 2 " # $ %1 %1 = A " %* ..# # " # " % * '" # 2" " # $ A! % $ A # 2" A % * # 2" 2 # 2$ ! # A # ! # # A / $$ # ! % 2 $ ' A A= # " ! A # # % $$ " # # =" # A % = % * # " ! " # $ # # ! %* A 2% * " " A A " # # # % ' !A $ " ! # # " " " " $ . * )4 A / " ) %9 " # % ( % $ A % . .D" 2 # # " $ # #/$ ! % 1 " $ # # ' " # ! (# $ % # $ ( A # " ! " # 6.# # # # " 1 % # A2 . A A # 2" %> ! # 2 ! '" " # $ " # # . # . C# # D! C $ # .% > $ # ! ! # .

..puede ser accesible -9 a la visión humana. # # . / .# % # 3 A $ # " # ' # $ $ # # $ 2" # ) # $ % % # ' ! .! # no estamos solos porque " ! # ! D# ! A D sólo puede percibir una # A..005% %& ' !% 1 A >) * ! " # A ' % ' ' : = # # $ @ ' %9 ! .5% Espectro electromagnético 0. ' # " A 2 2 # # 10 1nm 10 2 2 # " " 2 ( # $ % M1 N% 9 # " ! 2 # #/$ % # $ " # espectro electromagnético sólo una fracción ." 0 O 9 A! # ' '$ + . S # # ) # $ A= A. 1' 25 # " A >) 9 = S D% C' 5 # . # ! ' ())* fracción casi inmensurable de la materia / energía que se estima que existe en el +universo ¡y todavía la gente ridiculiza la suposición que " $ AC ' # " .'luz visible' .8 # # # ! 2 % = " # ' " # A = .. # # nunca han visto a un 'extraterrestre'!. A # A ' # A A # # % # # A A ' ! # J $ # A A # ' $ % " # A A C: ? ! @D% A" # " A A # ) A # # # ( .5% Materia luminosa ordinaria 0. A CB Figura 8: La vista humana Energía / materia oscura 95% Materia no luminosa ordinaria 4. 400nm * 5# 10 " $ 750nm ' -3 1mm 10 1cm 10 1m 10 -2 # $ % # ! # # 5 " # $ ' # ' A! A # A# ' ' # %1 B ' # # % 1 & 0 # # ' ! ' -6 ! # ! Figura 9: Incluso dentro del -13 Longitud de onda (metros) 1 m % " ! @8 # # # .8 # A(# % C0 2 ) A $ A %* % # $ ' ' % ! 2 %M # $ ' N% # $ J# A % 2 68 [ 2 ' 2 # . # # # ) ! ) %D1 ) # ' ' C A 2 S A D # 2 ! . Histérico.

! # ! # $ D% Figuras 10 y 11: Vemos la forma 'humana' de los linajes Iluminati vibrando dentro de la frecuencia de la 'luz visible'. !# " # # ! # " # # # $ " 5# C ' # $ ) % # % # ! A # ' D % # 2 = A= Figura 12: El cerebro reptiliano.# # A # 2 A# " ' ! A ' # " # . un deseo de controlar. # # ' '$ # )5 ! # # J . (dibujos de Neil Hague) (# # # # " ' . # # # %1 '$ A2 A ! '! # ) # . Éstos son los mismos rasgos de los linajes Iluminati. constituyendo así un aspecto del control de la Matriz. . $ # %* # # - $ " # % " . pero ellos son 'poseídos' por reptilianos y otras entidades que operan en los reinos más allá de la vista humana y dictan sus acciones en 'nuestro' mundo. 1 !' # $ '$ % ( '$ %* # " ) . es la parte más antigua del cerebro humano. una obsesión con estructuras jerárquicas de poder y la idea que la fuerza es derecho. $ ) 1 / 2 2 ) " % & % # " % # # 5# ' $ A # A # # % " . Representa el instinto de supervivencia y produce los rasgos de carácter del comportamiento de sangre fría. el ganador toma todo. o 'Complejo-R'. ( %1 $ ' ! # $ $ # 2 # $$ " 2 # ! # ! . C: A % 9 # #/$ . # $ # ' C: # D% # 2 JA ! 2 '! A! J " .

.# # / # A % B ' # # ! # # $ B '% M # # ( " ' $ " ' $2 # ) # # N% P' $ ! ! $ # B ' " G% $ # .. ! $ A # # # .. más primitivas en nuestra evolución mental. " # # " # # # $ $ # # ! %* ! # . $ 0 " 4 Figura 13: Los hipócritas (y luego unos) Iluminati manipulando la sociedad humana bajo el control de los Reptilianos. Cuando llega a una . 4 A . El deseo de exceso viene del "cerebro reptiliano. porque está concentrado en la supervivencia. # # 2 A # % F K (# J1 K% 1 P 2 # A % $ 2 $ $ $ ( 5# # K D " = . (ilustración por Neil Hague) '. ser tan grande y poderoso como sea posible." las estructuras más tempranas. El reptiliano quiere agarrar tanta comida como sea posible. $ ! # " " # # 2 $ %3 2 * ( % : $.A2 2 A % . A % # ! $ .6 # C# # # " # " 2 '. # 1 . " $ $ " # " # ' # ' = =' .

B ' %* % > $ > # $ A ' # ' ! $ C: 5 # ED% W 8D% ! # # # 2 ! $ " $ ) # $ % # ! " ( ! " 2" . Exigimos cosas que.. y más vulnerables que nunca a la enfermedad cardíaca y diabetes. %* K ') # ! ' # # ! # B$ >) " " . A" $ 5! # # ) 0 ' # 0 $ . el reptiliano siempre gana. . el Rey de los Francos y Emperador del Sacro Imperio Romano Germánico. Bush descienden del monarca nacido alemán. 1D " .. $ B ' B $ ' 1 ' " # ! # B 77<% # # = # % = # %5 " . Adolf Hitler y los nazis también estuvieron obsesionados con él. 1 # . B . 1 ) 5# # ' # 2 # % # " # " # # AC: $ # ! ) %> C76 =? 6D $ 1 # 5 K C: 6D% 6E # U ' B ' " > ! . 'Satisfacer ese lagarto interior tiene sus desventajas.% * .D% * : $ Figura 14: Carlos el Grande. realmente no queremos o ni siquiera usamos.opción entre el intelecto y el reptiliano..$ ' % 5 2 2 . que vivió de 742 a 814. '2$ # ') %1 C6%. %. Su linaje es muy significativo para los Iluminati y 35 de los 43 presidentes desde George Washington hasta George W. o Carlomagno. Acumulamos montañas de deuda (los cargos por mora que pagamos en tarjetas de crédito se han más que triplicado desde 1996.300 millones por año) y quemando combustibles fósiles como locos..' ! # # $ # 2 $ # ' %* A K " ! # $ # ' $ .3 ' ) # J # ) / # " * : # 2 (# B ' " . de lo que estábamos hace dos décadas. a u$s 7. por término medio.# =1 # % * 2" .. # " % 0 % # # # # $ ) % ! # $ # " . $ . ) . %& ' 2 # ) ' 5 . # # ' 5 # ( !* >) # 0 ! # C 0 ! . %* # 3 1 .. en lo más profundo. " E8 J > 2 #2 : ! # ( . ' % A ' A 2 ') ' # $ $ ' $ % * ( # # " $ ) . Nuestros apetitos insaciables han dejado a los norteamericanos 9 libras (4 Kg) más pesados. ( % > A 5 A ) " . * (# .

= $ B $ % ! ! # : 5 B 5 ' ' 5 B '! " $ % # # B '! U ) # $ $$ ! % # ) " # # " $ $ 2 A 1 A $ " ) 5# ' # . ' ! $ # $ ' $ " 2 " 1' $ # 2 % Figura 15: Vlad Dracul. ( 2 ' ' $ A ' 2 ' ) ' C ( %H ! % - E A 2 " . ! # 2 " # " ' # %0 $ ! # # ! " $ " 2% 1 ' (# $ # $$ ! ' " ' . # A % 2 ' # % $ # $ )% # " . el regente del siglo XV de Valaquia en la región una vez llamada Transilvania . Mary de Teck. o Vlad el Empalador. # ! ! ! '2$ $ % * ) '2$ 2 # # '! 2 # 2 ! " " $ # % '2 A A 2 # 3 U ' ' B '% B $ 2 # ' ! ) # " . .' %. . ( ! # # ! $ % * $ 2 $) # - # $ ! " " # 5# %0 ' ' ) " # . . ) '2$ ' = # A A ! A ' K $ A % A 'A # " 2 A A! $ '2$ A A %: " ! ! # % 1' # ' $ A # A! ' # # 2$ # 5# % * ! 0 " '! A 2 0 A A A! > ) 0 . # ! # # $ 5 C# # 5 D # % ! # ! K B . 2 = = ' .ahora Rumania. % ! # # # ) '2$ # # " 3 % 1 # # # ) # % ) ) ! " # ) ' # ! ' " # 2 % * / " # ' # " $) $ $2 " %> ! # " # # # 2 ' ' . La reina Elizabeth II está relacionada con Vlad el Empalador por su abuela.'2$ " A >) . * 1 !D" # 2 . ! A ' A % %. incluso los Bush y Windsors. Q ' . Dracul fue la inspiración para el Drácula de Bram Stoker y muchas familias Iluminati descienden de esta línea.: ! # # # $ * B $* = % " $ # 5 2 # B . % * ) '2$ (# B $ .

. . # # $ $$ % $ # $ %0 ' # " 5# # # A ' ' $ # - # ! $ - " $2 . (dibujo de Neil Hague) * $ ' . % $ % ' ' J " # % A ) A " ! 2 . # %D 1 > " # 9 % ( # A ' 0 2# % FI # ! ' . ! # ( 2 $ " ! ( # ( .5# ' $ 2 G= #2 '! $ # " . . # # 2 # # 2 % # @<? A # 2 # # $ A AC: A # # " # %C # # # $ . $ ' ) $ . Éstos son los reinos de los manipuladores Reptilianos y otras entidades que procuran poseer a los linajes Iluminati y cualesquiera otros que caen vibratoriamente en sus garras." # % C0 $ $ . % Figura 16: Más allá de la frecuencia de la visión humana están los planos de intervalo entre esta dimensión y la siguiente.# =#/$ # $ ! ) . / 2 $ # % ! 2 B $ 2# 2 % . " ! " " # 2 ' ! # ' ! $ 6 # A % " # - ( 2 ! " ' ' ) $ # $$ # $ $ " %1 ! ! A ' " ' ' ' ) % 5# % $ " 2 !# 2 2 # # %* 2 . # ! 5# ! 2 " $ + . # A # $ %1 0 O # 2 # A %3 % ' ' $ # " " ' # ' A" K <D% & # % * 5 " 2 ! $ 5# # " # 2 ' ! % = # # # # % ' $ $ # # %& # # # ! ! " # )" A ) % # . 2" ! # 5# # 2 " " 5 # ( A! A 2 # %* # !' .

# A A $ % ( ' % $ " A A" / " " # ! ' $J % ) $ # # # S 2 A .. (Oscar Wilde) F1 A # ) G% A " '. A. %D% " ' $2 5# " # " $ # % ! 2 # (# " $ ! # % # % 3 ! 2% CAPÍTULO TRES Descargando Realidad La verdadera vida de uno es tan a menudo la vida que uno no conduce. 2% * # $ 2 # 2 # ! 2 # 2" # . # $ %* " )G% 0 2 ! ! / ! # " " # " " ) ! K (# % + ! ' # " # " ' $ %.." . ! " # # # # # " # # # 4F " # # ( .8 # " / ) ) %. ! # " $ " ' D% # # !' " C $ D ' ) $ % " $ # !# ! # -2 # A A' # " ( " ) $. # ! # # ( ! ! # ! # 2% * A ' A ' # = C # / (# 9 ' %9 $ # % (# 5# - ! # %* ' ! @@. 5# 2 % * # # # 2 ! ' '# .E % ' 5# # $ ' # ' .# " G% ' # $ " ) # " ' # ' ! ' %* # $ $ " ' " # ' $ # # 2$ ! ' $ %0 $ " ! $ $ % # ! ' # ! # $ " " . 2 $ A . 2 ' $ % # ! . % # ! . # " 1 2 " # # .A A2 % # % " $ " 2 - % A % * . ' ' " % 2 ' ) # 2 " ' ' " # # # # .# # ( # ! $2 $ # 1 ! $) # % # ' # .. " 2 # " " 8 " $ " $ A # " - A . " " %* # F1 # $ ' % 0 %9 %.

(

C:

7D%

'!
$

/

A

A

#

$

J

%
Figura 17: El cerebro crea la realidad 'física' descifrando
señales eléctricas en una ilusión tridimensional holográfica.
Esto es hecho por la corteza visual en un nivel, pero el
cerebro entero está implicado porque es un holograma,
como explicaré dentro de poco.

0
#
# A2 AM
!
$ !

Corteza
visual
primaria

2
$

'!
=

/
% ,

"

"
A "
"

A
#

"
#

#

'

"

%*
A
(#
# "

!
AA
C:
?D%
2
(#

#
#

%
$
$ .%

#
.A
$

"
'!

%

$

"
%
#

$
#

! '

#

$
$

$
#

#

( #

#
$. = !
"

-

-

#
"

$
(
$ N%

/

#
'
'!
!

"

%
Figura 18: El único lugar donde el mundo 'físico'
existe está en su cerebro. No hay 'ahí fuera', como
lo percibimos; sólo un 'aquí dentro'. Los ojos sólo
transforman el diminuto rango de frecuencias
conocido como 'luz visible' en señales eléctricas
que son descifradas por la red de cerebro/ADN en
una realidad holográfica 'tridimensional'. ¡El
mundo 'físico' que pensamos que está 'alrededor
de nosotros' sólo existe en nuestras cabezas!.

#
'

$

=

% 9

#

.
#
A
% ,

$
#

'
#
2

"

AA
%

#
#
#

#

$

!#

"
C

=

=

*

#
D
# 2
' 2

#
#

$
9

#
G% , = =

/

(

# (
#
'
$

$ !
%* "

C

=

#
#
% *
=
D%

# !
"
"
% F1
= =

$
J

#

'

!
."

%
CD
#

J! CD
"

A
L' U !
#

!

#
#

#
."
)% +
) #
%
!

"
%
"

$
#
% &
'

#

#
$ 2

"

B 'A
" '$

"
<

#
"
# "

A!
#
)
! "
$

"

#
"

# 2
!
'
$
;;6
" K
U% B '
# #
JC$D
" 2 !
$
2
#
'
$
#
%
$
# "
#
$
$
.

#

$ !
" #

1

#

)
"

"

$

#

% >

%

'

1

B
#
$
'#
.
"
#
%* " #
# 0 '
$
$
( #
3
>
C> # 9
H
@@ D% 3 #
#
'#
!
#
#
"
#
"
. %9
2 ! $2
. # "
#
#
'#
.
2
$
$
% *
'#
#
#
#
. %
#
%> !
!
#
#
%
$
' $
L
U
$
%&
2
$
#
# $ %1
."
2
$ A
A
$2
2 J!
$
$
$
$
# )
CFF
$2 "
$
2 GGD% H
2
"
#
%+
A
A
!
# $ %3
'! * '
) #
"
! # $
$
2
#
#
%1
!
/
$
%
! " #
#
#
#
%
1
#

!
"
%

'

'#
-

$

#

.

#
A
%*

"
$

1
#

%
' A
# 2"

!
A ) $
!
'#
%
A
L /

$
A
D
$ .% 0

A
#

A

"
'

'
"

A !
. A
%

;;#

(

#

#
% 1
#
"

"
2

,

"
.

(
#

#
$

)"
AA
%
$

%

$
'
,
. / 1
0 O
# "
.
# "
K'
)"
! #
A
A
%1
#
%

F 2" "
G%
) #
#
#
#
'$
.
$
.
#
#
% *
2
# 2 '$
! '$
%* . '
#
C
D

!

# "

0 '
$
)
"
')%
"
' "
#
$
A
#
# 2
')
.
2 #
# 2 2 % '#
.
$ %& )"
2
! F# 2
#
# "
#
$ #
% A
3
# 2
#
)!
2 '. % M
!
)N% F # $ G% F:
G%
$
%*
')
$ 2 "
"
$
!
$ #
% 1
= # 2 =
' $2
#
#
"
$

"

=

A
#
L / C!
' '
)$

)

'#
.
2 # .

#
#

D'
)
'
%
)
A

#

!
)

#
A

C!

!'

!
A
#
A
#

"

"

"

'#

#
')

.

%1
) % , ')

%P P
') ! #
"
G%
#
)A ) %
'#
.
#
')
$
#
#
'#
$2 !
A
A
') "
%

#
#

"

"

#
'

#

"
!

'

#

#

7

A
"

!
.
# 2
.
'#

%
(#

$
$

!

%
A

' '
"

%
A

A

#

.
G% ,
(
" # 2
' "
'!
#
'#
. J
'#
.

'
A
#

!

"

$

(
"
# "

% 9
% F9
) "
#
A( #
)
$
# %

$
#

!#

$

"

"

! #
" '!
2

#
!

#
#

'

"

%

+
$

"

$
J
J!

"
$

#

"

9

# "

5%

#
A

/
$

%9
"

"
'!
%

*

/
#

)!
#
'

"
#
% :
O

/ '

-

1
) #

!
#
J

"

A
%+
"
0

"

!
'
.% 3

# "
# )

A
%
#
#

%

' '
"

#

%,#

"

(#
#
% ,
'
#
# !
# # 2
2
% > !
0 (%
!

#
"

!
.

# 2
# % , #
$ #
#
"

#

# "
A

$

"

/

2$

#

"
!

!
#

2

#

#

"
$

%
2 #

= $
!D
A

#

"

"

!

.
%1

#
J
! #
'$ C
!
' #
( .%
4

#

'!

-

$
"
% 9

'

"

)

)
"
) !
(#
'

$
$ !"
'
#
# !
/

,#

=,

. '
$
%
"
#
%*
)4 A
,
"
'
4A
+
"
#
A
K #
A"
"
!
%

%,

A

=5

#
2% *
"

$

)

$ *
"
'$ % &
'. !
#
"
)% 1
#
#
"
2
"

!9 $

"
(
!

"

)

%

*

%1

!#

%1

"

2

"
(

'#
$ !

! #
F
#
$ G% A
1
1

%1
%9

A

$

#
'

A

L

A

'Somos perceptores. Somos la conciencia; no somos
objetos; no tenemos ninguna solidez. Somos ilimitados...
Nosotros, o mejor dicho nuestra razón, olvidamos [esto] y
así entrampamos a la totalidad de nosotros en un círculo
vicioso del cual raramente surgimos en nuestra vida.'

'

Figura 19: Un átomo es 'vacío' para la realidad de los
cinco sentidos y así ¿cómo pueden ellos ser los
componentes básicos de nuestro mundo 'sólido'?. No
pueden - la 'solidez' es una ilusión. Los electrones y el
núcleo (también 'vacío') están mucho más separados de lo
que puede ser retratado un este gráfico. Como dijo un
escritor: 'Si un átomo fuera del tamaño de una catedral, el
núcleo sería aproximadamente del tamaño de una
moneda de diez centavos'.

* 2
#
A2 A

(#

2
!A

A
%
D

#

!

$ %

"
#

!

"

2
?

$
!# 2
"
A! A
2
2

#
#
2
%

C"
'
$

"

! " # ! # (# (# 2$ ' ' # %9 ! # # A . " M N% . * # $ # # # J # ! # %1 .E ! # ! ' % " !A A %1 '$ # # # ' * ' # . A % A 2A# # # 2" $ " " # 2 2 # # $ # ! # " .# # # A # A! A 2 A # # # " $ ! % $ ' $2 / " # # $ # %* - # # $ % % 0 % H ' $2 % / ! ' # . ' # % !# A# " $ ! ." $ $ # 2 # # 2 # . D# # " %9 ' " $ A # ' " = " ' # # ! # ' # %9 # .. . % ' ." / C' ' # ! D" # % * " # A2 A A! ' # " '!$ # # ( # # # 2 A# )4 A .%3 ! / " F 2 G% = " % A O # ' " # # $$ " % # A # # # ! ! A # $ . $) '$ . " A .! # !# J # !' $ % # X %1 ! ' '." '.$ # # 2' # # A' A # $ . A! A! A! ! A %1 2" 2 . DA 2# AC# D # # $ " A" ' G% # $ ' %1 # ' " % .% " ' ' # % 2 # # . # " - ' % # # ( ' # # ) ! ' " ! # . / 2 .D% ' . '! .$ " # " . ! $ . %. " # " ! # 2 # 2 " A AF G% M ' ' $ C " 2% F1 A / # $ A 2 $ # # 2A % 1 # ( # " A2 A ! ' $ % . $ S C D ' # (# $ ! ' (# ' ' - " % 1 " # " $ # # 0 @D% J " ' # % " B B N% C: C # 1 .AC: . 2 # (# @ % ! % ! ! # ! ' ! # # $ % $ " !! $ 2% !# $ % # ' .

A % " G%A9 # % = J / . o chakras. (# '$ 1 " " 2% # / 2 ! # $ # 2 ! # # " $% ) $ ! 2 " # ' ' $. # # " ! # # 2 # $ ! ! 2 # $ " % A % ' / " " ' $2 % " " 9 $ %9 ! $ % ! %H A ) $ / $ ! # !! # " . (ilustración por Neil Hague) # 2 " % 9 2 # .! 3 % ! A HA % 3 ! " $ # $ 3 2 ! 3 " ' $2 " ! '$ 3 " 2 3 2 # %* % 2 ' / . # $ $ 1 A AA 3 A! A 3 A % 1 ) # $ %* ! # $ " ! 0 .' )4 A $ \1 0 ! \ ]% '! A % ' 2! . # " / 1 = %H S F" ( " % 1 %* ! # ! '$ # " A A ) . A $ % A 2 $ % ! J A A # % $ ! # . # 2 # ' # ( # %A* J $ 2 GAC ( D A " " % 2 E. = 4A F5 . # # # %0 # # ' $2 ' # ' $2 %9 % ! # 2" . # " ' B ! ' $ ! '$ / $ # % # # $ 2! ' $ 2 A ( 1 ' $2 .% A $ . / $ '$ .4 A # $ # %H / ] ) " $ ' $2 ) %* % .! . " # " # # ( ! ) ' # " ( " # '# % H $ ! 2 " $ % Figura 20: Los siete principales puntos de vórtice..A 1 % ' $2 # # / $ % (# # %H " ( " (# % 2 2 A H $ " 2! ! $ 2%H $ !! A $ A %9 # $ # # 3 ! $ P )" ! # 2 % # # # $ 2 .$ * I # # # $ ! # ! ! # ! # J! %H 3 A # # # ! 2 # # %A P%A $ . que unen el cuerpo / holograma humano con otros niveles de la realidad. # 3 $ # " $ 2 .

) % # $ # " $ ' # " $ $ 3 9 $ % A A .lo atemporal.% 1 " 9 $ " # " $ 3 % ! # # $ # ! $ ( % Figura 23 (abajo) % ! ) % $ ! 2 %1 ! JH B 2 . con esto vino la ilusión de separación. la conciencia humana comenzó como una ondulación que decidió dejar el océano de conciencia . Cuando se despertó en este estado 'desconectado'. olvidó que era la parte del océano infinito y se sintió aislada y separada. # A " AC . ! ' A $ 0 9 $ '$ # % ' ! # ) " " ) " # $ # ( ' C 2# .! % * A . Primero vino la imaginación en la 'forma'. # (# ' /% 2 " ' ' $2 " ) = A # $ # A A 2 " # ! # % " . Como dice un mito hindú. esto llevó Figura 21 (arr. ! A % 1 ! # ! )% 9 A A (# % Figuras 21 a 23: La  creación de la Matriz. ! A # 2 (# " ' # " ! % '% > # # $ ! '% # ! # :2 1 %9 ' ( # / $ $ " $ 2 J 0 " 2 4 " ! $ ! % . * 2 3 ' " ! > C: C D <D% 9 # DJ # # % E $ . ubicuo y eterno.) Figura 22 (ab. " 3 " .! ' " ' # ! 2 ' " A $ A # " " $ $ ! $ ) * 3 9 $ # A2 A ) # %1 '. A % A 5# A A ' ' # " % " # D ' ' 2 # .) a la manifestación del miedo (la entidad  alada) que tomó una vida propia. y la conciencia fue atrapada en una ilusión que creyó que era 'real'. # 5# " $ ! =' # " " # $ A A % '! 9 #2 P # )P ! 2 # " ' ' " 1 4A 3 2 2# " # " A % . como es simbolizada por Neil Hague.A .

* 0 0 0 . % 2 " # ! " # # % * - %1 # # # % # 2 . 25 y 26 (# (# '! 3 # 2 # ! % # 2# # 0 . " # * ) " .A % B ! # $ ' $2 # 0 .= # # !# 0 . $ ! %.% # $ ! # " 2 " % . > ' # $ # # $) / 2 % ' ' $ " '$ . # $ ." . %* A 0 . # # " B " # ! " Figuras 24. # 2 % . 2 %0 ' ' ' # C: 7D% ! " " % * ' # 2' : # .%D% " " 1 (# E # ! # # %9 # # .# # 2# " - # !# # % F1 ! G% 0 ' # 0 A * ' %U ' C* $ B! V ! !$ * %33% @?@D4 0 ' $ $ %* # $ % 9 # $ ' # # # # # # * 0 # %%% %A # . # # # $ " '2 $ = . ! (# %* %1 # ! ! $2 ' ' ! $ $ $ % 3 A A' " '! . % A2 # A # 0 . %* # ! 2% * 0 . # ) # 2 ' # # ! # 2 A A# # % '2 . # 3 $ 1 # ! # $ # 2 # " CH $ 2 (# # '! 0 # .

# ! # " $ .# # %H $ $ ') L ! ' U '% 1 % ' $) $ " " 8 ) # Figura 27: El juego de realidad virtual: la conciencia entrampada. se volvió controlada por su propio miedo en un laberinto de autoengaño e ilusión manipulada que yo llamo la Matriz. ! " K $ $ )% & $ " D! %1 # ) % # # . . # . / ' ' $2 A D # " .% 3 ! .% 9 A $) ! ." ' $2 " %9 %5 $ % 1 # ' # " =A %9 # %+ # $ " - A " A (# L! ! $ A N% ! -% $ # ! 9 # # 2 %* ' ' C: ?D% ' # 2 ! $ $) " " # # 2 C ! ! $ )D% ! $) $ $ # 2 EE @6. (por Neil Hague) $ ! $ # ! 1 # ' % ' L! .: ' $) # # 2 % . en un estado de amnesia colectiva. $) C $ $) ' /# =' ' $ # ' ' A A %M 2 $ # $ C" * 0 $ . A " $ / ' 9 2 $ # % # " ! 2 2 ' ! % ) $ # # # % ' $2 %1 ! ' $2 $ " CA # " # $ ! ' $2 # (# " A A D # ' 2 0 ." # =# L # $ # $ ! # = = . # .

%1 " /# =' # ' $ # # " ! ' " # 2 # 2 E6 $ C: E8D% # " - # . Un patrón de interferencia se forma sobre la placa fotográfica Laser Divisor del rayo (espejo semi-transparente) Figura 29 (izq. # # # # " A. E %.ru). Una mitad (rayo de Sujeto referencia) va casi directamente a la placa fotográfica y la otra (rayo de trabajo) es desviada sobre el sujeto. Centro de Exposición de Toda-Rusia. # # " - % . Moscú. pero usted está viendo hologramas por los cuales usted podría pasar su mano. ' $ ! " # ! .# 2 # # # A' A ! = % 3 ' # # # " # 2 # # # $ C: ' # # # . Cuando este rayo de trabajo es desviado otra vez sobre la impresión esto forma "un patrón de interferencia" con el rayo de referencia.su 'solidez' es una ilusión (Cuadros 'Pequeña y Abedul' y 'Viejo Soldado' cortesía de Estudio de Holografía. A! # ! ! # . * 0 . # " # " -% . Parece aleatorio y sin sentido hasta que el patrón sea iluminado con una luz de láser y se forma un holograma. . ' 3 ) 2 % # ' . Si se ilumina con un láser este patrón crea una imagen tridimensional holográfica del sujeto. ! # EE ! E6D% * E J " # ' ! " 2 A " # " # %* . Por más vea www. ' # ) $ A= ! C: E. Figuras 30 y 31 (abajo): Esta muchacha y soldado parecen 'reales' y 'sólidos'.holograph y. $ # # ! .): La onda o patrón de 'interferencia' sobre una impresión holográfica. Es lo mismo con el cuerpo humano . ' (# $ ! ' @D% 9 # # # ! " ' 2% : % % # # $) # # . ' ! % Figura 28: Los Hologramas se hacen usando dos partes de la misma luz láser.

Figura 33 (der. '.' $ A2 A ' A " # ! # 2 $ ' # " '! (# $ $ # $ S .este es otro holograma. ( % # .3Dhologrammen.% # " " " # $ '2 A" 2 $ " ! ' # %3 " %9 O ) " ' - .= # " 0 . Correo electrónico: lasertrend@aol. # # " $ ! # 0 . Lo mismo es esto. " $ . $ ! ' # % %* # " # " $ # 2 !$ ' ! ' # % # # " % 9 # ' 2 # ! 2 % # # " . A ' $ A # # % $ " 2 0 .G% * 0 .! # # J# . # ' " ' # .# 0 A 0 $ ! " # 2 " (# # # ) # # " .com. una canilla metálica 'sólida'. Ámsterdam.# ' # " ' # 2 " # ' 0 " AC $ A % 2 # " ' .com.):.): Lo que puede parecer ser tan sólido no lo es . Cuadro 'Medina' cortesía de Laser Trend Holographie.. Por más vea www. $ '! " %1 0 # # # ' # % $ # " ' # $ %. $ 2 . % + ( 9 )4 A ' % O % + $ 0 ( " ' # # %H # 2 " ! 2 2 $ % ) ( $ .' " # # " $ # # " ' # " " % (# A 2 $ " # " # # " ! ' ' A % * # 2 # " - ' # !# E8 - A= %1 -A %%% . (# ! # A ' F# ! # # $ " # C: # 2 '! ! # $ . $ ' ! D! # ! $ $ A $ A 0 . ! # # " # ! %. " $ - # C: E<D% Figura 32 (izq. Cuadro 'Canilla Abierta' cortesía de 3-D Hologrammen.. Alemania. 1 # # # # " # # " . % # # % # # A! $ $ % # # $ ! " # ! O # " # 2' 0 $ # " " ! ." E7D% " A A $.

A su vez. Nueva York (vea detalles detrás del libro). ¿no?. Estudios Holográficos. Cuadro 'Padre' cortesía de Estudio de Holografía. Figura 36 (izq. E< . manos holográficas que usted no podría estrechar ¡a menos que su cerebro le dijera lo contrario!. los cerebros humanos dan retroalimentació n a la Matriz y este bucle de doble sentido lleva a cambios que llamamos 'Evolución'. los que descifran las señales en una realidad tridimensional holográfica ilusoria.): Juego de manos. Figura 35 (der.): El ordenador central o 'cerebro' de la Matriz comunica una realidad colectiva a los terminales de ordenador / cerebros humanos (y todos los otros). Este es un holograma de la columna vertebral humana que es sólo una proyección ilusoria. Por más vea www. Moscú...ru. Centro de Exposición de Toda-Rusia.): Nuestros huesos parecen tan 'sólidos' y seguramente nuestros cuerpos deben ser 'físicos' y 'reales'.holography. Es como rescribir un programa de ordenador y así es como la conciencia puede recobrar el control de la Matriz. Cuadro 'Espina' cortesía de Jason Sapan.Figura 34 (izq. en todas partes del súperholograma.

): La hélice de doble espiral del ADN. A A! " %A % # $ ! ( # 2 2 # " # # ! @8 @7 # # %^ " ' $2 (# # # $ . C y T. El ADN es el programa de software que contiene nuestros datos genéticos y lo que llamamos mente y emociones. Figura 39 (abajo): El ADN puede ser expresado como una serie de códigos de letras en secuencias de A..% M " # # . G. Usted podría verlo como televisión holográfica en la cual los cuadros transmitidos como formas de onda desde el transmisor son descifrados en imágenes móviles por la TV. AGTAAGAGCCTTACGGGAATTCCGGCGAAGCGTTTCACAGAGATCACGCTCATACCATCAACCTGGTGAAT CGACAGTACAACCCACGTCACGAGACGAATCGCCGGTATTTGTATCAACTAACACGAGACCACTTTTCTCT GGCATGTAGGGAGGGATCCTCGCTCGAACGAATTGCAACGGACATCGGGTCGTGTTGGAGAAGGCCAACA GGACGTCCGCGTGCTTGCGACAAGAGATGTCCCCCTTGATGCATCACCAGACTAACACTGCCACACCTTGA GGACTTGGTGCCATTACAACAAGAGGTCATAGATAGCTACCGTAGATGTCGTCCTGCGTCCTATCTACGGTT GATACGATGGTTCGGGGGGGTGGACCGGGTATCGGACTACCGAATGTTCCTCGGCTTAAACATTTCGCTTA CACCTAGCCGAAAGCATCAAGAATTAATCATTACCAACTATGTGTTGTCGAGACCGTTCAGAGCCTTCATTG GCCGTACCCGCCCATGTGATTTAATCTAGGGGGGGACCTCGACACCTTAAAAGTGCGATTATACAGTAACG CGCTCTTGGAGACGTCGGAACAGTAGTCCGCTAAACGGTCGCACGGAAGCCGCTTATGATACGGTAGTTAT GACAGTCGAAGGGGCAGGTTAGAACTCTACAGTCCCGAGTCCCTTCTAACCATCCATGTCGACTGGTGTTG 0 # %M N% 2 ' = " N% 1 C: ' ^ * ! 2 $ 0 $ ' %* 2 E?D $ # / ! " $ " " . el cristalino receptor.4 " ! ) " 2 = " " 12 # ' # $ # . K 1 ! ! C D% D ! ! ' # # # A . Cómo se ordenan éstas decide la naturaleza de la forma 'física'.A % Figura 37: Recibimos constantemente una realidad colectiva en forma de onda desde la Matriz y desciframos estas frecuencias en una realidad tridimensional holográfica ilusoria. # ' " D% % 1 " # # % * # ( # ' 2 0 - ! # # D # ..' $/ " # " '! # " % * " ) " 2 # # % ...%. 0 ( $ . transmisor y amplificador de frecuencias o 'luz'. ' * " $ $ % # / J ' ' =) " 2 0 * $ # ) 2 ' ' ' # # ) " 2 # " ' # $) $ $ $$ # C @E%.' $2 : ' # " @.. ¿Le recuerdan los códigos en las películas de Matrix?..[% / $ % E7 .6 U ' ! %0 %1 " # " # % 2 " # ) " 2 %A 1 # @?. Figura 38 (izq. que nos conecta con la Matriz.

! . apropiadamente.D! % # " # C: # # # # # C: $ 1 2 A # A # A % ' $$ " / % Figura 42: El 'láser' ARN lee el 'software' ADN y pasa la información a las células. % # ' : ! 4A %% %% $ # . la profesión médica de hoy. 2 # % " %3 A C# D! % 1 2 8. un símbolo para el ADN y. .): La antigua imagen de serpiente de doble hélice conocida hoy como el caduceo. # # 2$ # # '! A2 A 1 # )=5 #2 ' $ ! 1 6 D% # # $ # %* %* " # % % # # $ = " (# ! ' # 2$ ! # # ! $$% A2 $ ' ) A ' # 2 # A # %9 A O A A # 2 .' %* # ! 2$ # K 1! C: # %* ' O ! %1 % )A %H 2 ) " # .): El ADN tiene una sensación reptiliana acerca de él cuando es masivamente amplificado.% Figura 40 (izq. 2 # E? 5 $ A ! % ! # ADN ' ! ! # # % 5 # % $ $) ! . E@D ! ' ! ' ! '! 2 1 ' ' ) ) 2 $ 0 # " ) . $ " O # ! # ' ($ # ! # # $ 5# $$ " 2 6.el programa o conciencia. Qué parte del 'disco' ADN decide leer y comunicar es controlado por la fuerza que controla el ARN .. O $ " # # %9 # " C: 5 3 " " $ $ J 5 # $ 6 D% ) ADN Ácido Ácido Ribonucleico Desoxirribonucleico % % # 0 # ! )A ! '2 5 = = 2 ) %9 " 2' ! 5 # . Figura 41 (der. según nuestro estado de conciencia y conexión.

que puede tomar muy bien pulsos eléctricos. Esta información es intercambiada con el cerebro de la Matriz y con otra gente y formas de vida.el ADN representa una antena electromagnética ideal. Por otra parte. tiene la forma de un anillo y así es una antena magnética muy buena. (Ilustración por Neil Hague) # S " 0 .una doble hélice enrollada .# ! C D! ! $$ % & !" 2 5 ! # ! # ! 2 5 ! '# # " A # A ' O %1 # %9 " $ ! C " D # # !# = " '$ " ! # A A # % * " # ' S # 5 D% * # " $ % ' $2 " # " ! " (# # 2 " %9 ! ')% $ 5 = ! %1 5 % ! $) % ' %1 A # A! $ A! # " '$ # ! " A# * A % # " 2 A . 2 ( ' # ! $ AC " 24 'A partir de la forma característica de esta molécula gigantesca .% H ' ! $ . # 2 " $ $ # / ') L ! # " # # $ # " 0 # A %1 2) ' " " $) # ) A / $ 4A # S # 2 S% 3 # # " % " " " ! # 5 # " . % 5 # % 5 ) # # " # ! 2 ! " ! . visto desde arriba.' Figura 43: Nuestros cerebros y el ADN/ARN son como terminales de ordenador recibiendo y transmitiendo datos. Por una parte es alargada y así una antena de lámina. '$ $ ! # # ! % # 2 $ " 2 $ . Operamos en una versión holográfica de la Internet." ' % # E@ # .

GA % * $ ! ! 2 ! ) " A 0 . . 0 ! %5 B # %* . # ! 2 $ " %* 0 . " $ # = # " /# =' # ! " A %* # . )" ) " 2 A A # $ " ' 2 " - # # # $ # # 2 # ! $.U U U $ C: 6ED% # ) # $ U $ # $ # 2 " 2 # ! " $) ) ! " % % # * ' # 2 C ' $ $ ! # ' $) # D ) " A2 A % $ # " 2 $ . # 6. # ! # % " ( ' ! % $ # " A %M U =! 0 . ) $ " ' " )" # 1 # $ )4 A * 5 # " " " " $ A % . ! # D% # # O ^ D " # )4 A F # $ # 0 .! # 2 % ' ' # " # $ ' A$ $% ) # % " # # 0 % $ ! % 3 .% # # %9 # C $ # )C U O$ U C 2D% ' $ # D# D # ( # ! ( % # U $ 2 $ %1 ! # # . (# # ! A ) ' # ! ! 2 # # # # AC # A ! # # C 5 S 5 . ' A 0 ! ' ' # " # ! 2 . 2 # ! % * ' . % %* D% $% # % # # $ A %* # = ' # " . 2" A$ " (# ' 2 " # # # .! (# # " ! $ ! ! ' A L # 2 ' ' ' $ ' ! . % A $ % S5 $ $ ! # = " # = 0 0 % & . # A 1 A % D= 0 $ # O ! AC " % # " ' # 2" # A ' $ # ! ) = # $ # % H ' $2 = O # ! # .= " $ S ! ! # $ ^ 9 $ A CU ! ! - # ' " 193 # # 4 $ A N% 9 ) # " 9 # # $ # # ! # $ ' ! ' / / $ '$ $ !) % .

% 2 ' # # # ! ( % . ) ) = # # *$ " # " $ # 2 1 # # > # 2 % 0 $ # : A # % . Las agujas de acupuntura se usan para mantener la energía fluyendo y equilibrada . La energía que fluye por los meridianos. # $) $ % ' ! ' $2 #2 2 .. El sistema de chakras también se conecta con esta red y cuando el flujo de energía (información) es bloqueado o suprimido se manifiesta como enfermedad o des-alivio (juego de palabras en inglés: enfermedad).y así el cuerpo sano. ' 'Cuando primero las conectamos el avión 'se estrellaba' todo el tiempo.(# 193 193 " # # $ % % # # # $ $ : " A! 2 66 $ ' 2" ! # . Figura 44: Una imagen realzada por ordenador del sistema de meridianos tomado por una cámara gamma después que trazadores radiactivos habían sido inyectados en puntos de acupuntura. consiste en fotones que llevan información por todo el cuerpo. # # " . Al rato.' * # " 2 ) ! ! # $ $ " $ # ( # ! (# $ ! # 2 " # 2 # # 2 % 0 (# A$ A # 6 % # # A # A # 0 ( % C ' ' F' ) .. " A # A! 2 - % # / / % # 0 . La red recibe la información sobre el cabeceo y la rodadura del avión en forma de pulsos de estímulo y su respuesta cambia con el tiempo. pero..# %B ) # .. produce una agradable trayectoria recta y nivelada. Esta es la placa de circuitos del ordenador del cuerpo. # A A $ A %: 2 )4 $ % " ) # # A # 0 > # " ' 3 A %M A $ # ! A # ! $ A # A % # $ # %* # 2 # # " 2 ) ! 2 . ' % ! # # ) <. Somos sus profesores externos mientras aprende'. ' $2 ! # % 9 2 . conocida como chi en la acupuntura. A # 8%. ( 2 := N% # A A" # " O 2" # .! ) # # 1 % ' ' # # " 2 # " % * ! # $) $ " # $ # ! # # # # " ! 0 G%D* . la red de neuronas se adapta lentamente a medida que el cerebro aprende a controlar el cabeceo y la rodadura del avión.

. ! $ - ' # ! %* 2 ' : = # 5 !V $ # ' D% * ! / @7. # # " $ # - % L A % # # " = . " # # $ % ! " N% 3 $ . % A2 ' ' ' ' % (# # " $ # # K # B $ ! ) # 5 D A # " ' # (# $ " ! ( $A % " " ' !# .) ! $ ! 2 A . ' C# # " A % A AA = $ )" # " = ' # . # ! $ # 2" " # !# )% 2% 3 A AC 2 # 2 6 $ 5 D 2 " . % " " ' ' " $ # # ' # " # # ! ' # A ! # " % ' ' # $ S 5 2 % " " $ # # % # # " %* / # S5 ' ' ' '$ : = L B% L% : %& # ' # 2 # !" $ ' % M( # # # / # # B 2 ' W # ! " # $ " AC # A $ " 2 " ! # # # ' .# D # ' 2 %3 $ $ C= = $ # " D = $ # > A % " # $ ( ! . ' % * 0 # ' . # ! 9 %* 2 ! # C) ' $ ' % S5 " C " ! ! S5 =# A . " ) " 2 D # # 2 $ CA# = 2 . = # # . B # . " # " % $ : # # " # $ A D! U $# " # # # # $ . $ ! $ ! $ %9 A % 2 # # % # # . 1 A # # * # 2 # $ = %A +! # ' . " %* 0 " 1 " ' % 2$ ! # 2 % ! A " A % 1 # A # # 2" # " 2 !# $ % ' ! ! . # $ % H 0 .

" $ 2 # # $ # " $ " ' ^ # % " # . Pero si pudiésemos deshacernos de nuestras lentes. ' 4 > $ ' " # A$ A= " = # ! 2 # 2 C $ # ! # ' ' C# 2 D ( % " # %* # $ J # 2 3 . ' . ! # $ % / ! # 2 2 % Figura 45: '¿Elefante?. esto no significa que no hay tazas de porcelana y granos de arena de playa ahí fuera. Esto simplemente significa que una taza de porcelana tiene dos aspectos muy diferentes a su realidad.. si lo prefiere. En otras palabras. $ % S5 S % ' A2 A %V (# $ D( # 3 # 9$ ...%* " # ! ' A ' 1 # ' " S5 S % ! A # 2 # # .'. [Karl] Pribram [se dio cuenta] que el mundo objetivo no existe." dice Pribram. ninguno de ellos es real. 2' # . 'Me entrené en Harvard y Oxford y si hubiera un elefante en este cuarto yo sería el primero en verlo'. '. A % " 2% . ¿Qué elefante?'. (Dibujo de Tomassi) * # . Lo que está 'ahí fuera' es un océano enorme de ondas y frecuencias y la realidad luce concreta para nosotros sólo porque nuestros cerebros son capaces de tomar este aspecto borroso holográfico y convertirlo en palos y piedras y otros objetos familiares que forman nuestro mundo.."' .! # " $ # # '! ! J ' $ 2 # # ' % S5 %. Cuando es filtrada por la lente de nuestros cerebros se manifiesta como una taza. "o. la suavidad de una pieza de porcelana fina y la sensación de arena de playa bajo nuestros pies son realmente sólo versiones elaboradas del síndrome del miembro fantasma [cuando las personas amputadas "sienten" un miembro mucho después de que ha sido amputado]. "Ambos son reales para mí.' 'Según Pribram.. " # ! # # # * # # ( % 41 # 2 6E $ " $ ! ^ # 2 " 2 A 3 ) ' % . ¿Cuál es real y cuál es ilusión?.. ' 2 % 0 ' $ $ % '. # # - %* ( " / # # " # # . la experimentaríamos como un patrón de interferencia. ! # S5 # # A # A %. al menos no en el modo en que estamos acostumbrados a creer.

# % F9 " A '. el 95 por ciento de la actividad cerebral no implicada con el estado despierto. A A " " 66 ' " # . $ = A 2 A $ ' ) # # % FF9 A # # / • " • * " ' $ G= ' 2$ # GC # # 68D% # " A A ' # 2 # # 2 # $ G% FH " # A' ' 2 2 ! @8 # ( A! @8 # # # @8 # A ) @8 # A @7 # F# # $ D 2 2 # " " C % 9 GG% # A D% * $ # $ 2 % $ # ' ' $ ! @8 # ' % 2 5 % % 0 2 2 ! ( % $ 2 C: # # $ " ! ' A # . : 6<G% +! $ ./ ! G% FA A % • # $ # A 2 " 2S " A % $ @8 # # " . = F G% Figura 46: El 95 por ciento del ADN 'chatarra'. y al menos la mayor parte de la enorme capacidad cerebral que la ciencia dice que no usamos. $ $ . (Ilustración por Neil Hague) ) # " )% # " " %9 A $ 2 ! !# ' # A '.# F % # # $ " @7 # ' ) # # @8 @7 # . realmente nos conectan (o debería ser) con el 95 por ciento de la energía / materia en el universo que no podemos ver y también a reinos más allá de eso.

. y todo lo 68 . . %." S C: '# A " " ! %* / % ' # # $ A # 2 A # A! = $) # ! ' A A %* # A2 $ ! # " ! ! # " # $ . # $ ! ! A ! $ ' # # ." # ! A # 2" ! " " " $ +)A# ' $ % * " 2 A'2 # " 67D% $ A # / # " ) ! $ % # A 2 %1 ! # ' " $ # # / " # " # $ ! .# " " A $ A! . así como el hambre." ! C %. El Hipotálamo es vital para el equilibrio de cuerpo. apetito y consumo de comida.. # ( % FI 2 A % . mente y emociones y. como veremos más tarde." . ! " . 24 '. A A' A J $ N% # A # # A D A # / " - . es el blanco de productos químicos ( ( usados en comidas y bebidas de consumo masivo.% * " (# $ $ $ " " " 2G% " " ! # 2 ' ' D% @7 # # ' " . y todo lo que tiene que ver con el concepto del placer y la actividad creativa.. apetito y consumo de comida. $) # C" # # A " '! D # $ # " $ . # '! ! # # O ! # # $ %3 " 2 # '# $ $ # " # 2 # %1 A ' A" 0 ! # A 3 % 1 # A % * " ) '! ." ' # A $ " A2 $ # ! % % $ J # A % C # # # ) # # A ! ' = / # = % 2 $ Figura 47: El hipotálamo en el cerebro es un regulador clave de nuestro estado emocional y organiza y controla los sentimientos y el humor. > ! $ # # " ! ' % ) $ $ # ' " $ J $ " %1 ! 0 ..%: C D $ # # M! ' $ $ 6. sentimientos y humores.# " - * # 4 # ! % 2 = % 3 %+ (# % * .. " # % " ( # ' $ ' $ " A " # ' / # ( # %> ! " ' % $) # # 2 # $ . El Hipotálamo organiza y controla muchas emociones complejas. así como todos los estados motivacionales incluso el hambre.

que luego traduce.. $ (# A 9 $ % * " ! $ $ " # " ) . destila y ensambla en un "paquete" discernible. ' A ! " ' A ' " ) %& # # (# ' $2 $ # " # V " # " $ %* A # $ % ' " $ )" " # 0 # " $ ' 6< % . relacionando todos los atributos de una experiencia.... $ ) # .que tiene que ver con el concepto del placer incluyendo satisfacción...' '# (# ) # A D ( # 2 # = S $ # " A 3 A $ ( ! $ %H (# % * 3 " =! " 3 % * 3 # # A L.6 # # " 2 # " ' ! $) % % ! ! # !' A! % ! A # A' 0 . El Hipotálamo. %.. 3 2 " 2 " # . O * " - A # A A # " %* 2 . 0 $ " # 2 D $ # % 1 2%%% # " (# 3 A %> 2 # ! 2! ! 3 " " 2! % B $ " 3 # CA $ 2 ' $2 # ( " $ ! . " # !# $ " " A " A ' # %9 A O $ " ' ' / % .2 2 D! > 9 % ! 2 # A $ D ) $ $ $ 2 C $ " # $) 2% ! % ! % % # > " # A > % 1 # # 5 " # $ " ! $ # " # $ 2 . . . comodidad y actividades creativas.... " $ " # $ 3 = A % " # ./ " C!S ! " $) 2 '$ .A % " % .' ! " A % / $ ! A# ..% V ! %> # # ' A2 A % #2 $ A A" 8. A 3 3 %& # % A +' # ' # $ " . está íntimamente implicado en la integración de todo estímulo fisiológico. .. Las neuronas en el Hipotálamo producen varios neurotransmisores Hipotalámicos que transmiten información e instrucciones a todas las partes del cuerpo. # $) " ! ! ' 2 " . todos los 5 sentidos. ' # % # $ # 2 # ! '! A $) % # ( D! # C (# " * ' ! % % * # ' ! 3 % C % $ " " $ # J 2 # ! '$ ) $ .

El cristal en la Figura 48 se formó después de que el agua fue expuesta a palabras de amor y apreciación. La bioquímica está íntimamente relacionada con el ADN. (Para más ejemplos vea los libros. que. ) A A " " ) # !$ $ / # !# ) / # $ % $ # # $ % # !# # # $ " 2 A AC # # " # # ' / $ # ! 67 ) $ ( # '# $ ! " 2 A ' % # # 5$ 9 # '$ ' # " " ' 2 " $ # / 2 ! / % H D A # M! " $ $ % %* ! $ " # # # " 2 % A %1 2 %9 %* # ' $ ' 6? ! 6@ D # / ! $ ' # > % ! # ) # " %1 : C$ # ! ! # " 2 " 2 ' A! ! ! ! / # A " # ( % 1 # $ $ # # ! = # $ " ! # A A % 3 .. es en su mayor parte agua. volúmenes uno y dos.. los pensamientos y emociones para afectar el mundo. sobre todo el cuerpo humano. las palabras eran 'Me enfermas . La diferencia deja claro el poder de las palabras. componentes son afectados por pensamientos y emociones entonces los pensamientos y las emociones también deben afectar nuestro ADN.te mataré'.# # N%D # # %. que estudia el efecto de pensamientos y emociones en nuestra bioquímica. en la Figura 49. por Masaru Emoto) M. Mensajes del Agua.' Figuras 48 y 49: El efecto impactante del pensamiento y las palabras en cristales de hielo. así que si estos.# %& 4 'Hay una rama entera de la medicina llamada psiconeuroinmunología. # C # DJ! ! $ ' %C " 2 " " = = # 7.2 # " N% $) $ 2 )# 0 %>%0 % ' # = %& ! " # (# # $ ! (# ! # # ( $) # # $ # " # # $ !# A ! # A! A 0 = A % # $ ! # ( 7. '# S # ) # # $ " # # # # # A . en esta realidad.

" " =# ! 9 $ S5 # ( A A . %9 %* # ! = " $ (# # = # '! '! ! / ' $ % F1 # G% 2 J # # A ' ' A" # ' # 9 $ G% # # # # ! " %1 # $ $ !# # " ! # . *$ . A % * = ! D F1 ! " # S # . / = # ! % # " ! 2 %1 O $ # % F. # " 3 ! # %0 . %1 # / # $ # " # " # " " # " 9 $ " 2# $ 3 S5 % 0 # " # " # # # " . 1 L " # ' ! 2 " % & ) " " ! ' ' ! " " # ! ' # % L " 2# !# 2 ' ' ! " )$ A ! A " 2# %& " A 3 A $ %* 2 # # ! $ # 2 3 2L %* " $ 2 !# $ / %H 2" 2 . = % $ = # O % * 3 # 2# ! AC $ # . % " " # $ .% . . 2 S $ %* 0 ./ " %3 " " $ % # " .# # # % # # A % . # $ # # $ ! $ % * 0 . : $ X 6? A2 A %B ) # " $ %." " > # 0 $ % . .S # " 2 # " 9 1 2 3& ! 41 C1 # -2 *$ . " ! # " 0 .. # % . 3 L = 2S " # " / @8 # $ # ! @8 # 2 A ' A %^ # " " ) # ' ! ' # % = %& " ' A ' A % # O ' % 1 A ' A ! " %* # " ! # $) A ' A # ! '# .$ ! = # A % . $ @@@D )4 A " ! # A % # " = (# % * " A # # !' # " $ " $ G% 9 ' % # A # # # - " 1 1 > # 2 # A " # # / ! % ! # % %> / # . # " " 2# 0 .. 1 # ( !B " # ' # : = $ ! $ $ # # # $ ! $ " A" 3 ^.% # $ ! 2" ) .." C# D ) " %.

6D4 'Tenemos que recordar que la materia luminosa que observamos con nuestros instrumentos es sólo el 0.# . tal cuerpo es sólo "un traje" que nos deja participar en la "película" misma por un rato.! # % ' # # $ ! . #' 0 " :$ ' 2% 2 " 2 % " 2 '$ " 2! * S5 9 # A$ 2 A# .% %%%% * E8? E ' # ! 1' ' # ! 2 # ! :$ .5 por ciento de toda la masa calculada." 2# # # $ . $ ! 2 # " " 9 $ 9 ) 0 # # $ . # 0 0 ..' 2" F" 0 .G% ! # " ' # 2 2 ! / 0 . no es nuestra identidad verdadera o "yo". "La realidad" es una "película" delgada de luz [electromagnética]. $ # " ' ' # " %* # = " 2 " ! # ( # % # % # ! ! $) $ / $2 ' #2 # 2 % ! 1 U ' A 9 2" $ ' # $ % $ " S5 # $ 9 # 2 A! # # A # # > !O ! A ' # # 2A! # ! ) $ # 2% # # % ' # 2% 2 $ (# %F =5 =. # $ !# # # . $ $ 3 $ %* C .# " K # # # " # # 2A # .% .# # ." ( ! ' # # # ' " 2 # # '$ $ # $." % " / ! . ." .% * # $ # %* 2 # ' # (# " ' $ 2% $ 2 \]A %& # 2 2 # % ! 4A % 2 % ' )" % 6@ ! # 0 # 2 2 $ ! " ' ) A . + . $ 0 . una matriz visible..% %0 ' " ! 0 2 # % ! ' $ # ! # . " % % % * " . Lo que vemos con nuestros ojos es todavía menos. # / / # # ( # " / # 9 2! # # ! 2 %+ 9 # ' C # Q %& D / A ! $) % ! (# 2$ ! # " ' 0 & # (# U ' ' A %1 A# ! ! %1% # / # # # " # ! 0 . G% ! K' )" % # # ! # # S5 # 2 # $ K 1 . con la que nuestro cuerpo o robot biológico puede relacionarse.$ . ' ! $ ! ! # ! $ $ / 0 .

%3 # B 1 # # # %9 # # 2 # " $ ' ) ( % 2 2 " ' # %. # # . # A #A! $ $ " ( " ' 2 2% # 2 # " ' / A A %9 # A # A! " ! 2 " A A %1 # 2 " ' ! ' (# 2 2# " (# # " . % A # A .% K # ' # $ '# ! 0 " .A! ' A )A # # ) " # " = F1 " ) # " G% 9 ) # " # F1 # ) '! / # G% # %9 # ) O 0 . (Oscar Wilde) # * 0 . # 2 # '2 ' 3 %%% % # # A2A G% ! $ %F # # # A. " .= " % " " 9 # " # # # # # .C '# ! D! %3 ' # ) ! 2 # = # # # $ ) ) %* # # ) ! %* '$ # # $ O ) " # $ # % $ > $ ! % F1 # # ' %* 3 A # A # 2 " # ! ' 2 % % (# . # # ! # $ ' = " ' $ # $ = # % ' " 2 ' ' # $ % " # 2 " %3 # $ ! # 2 . " 2% %9 # % .% % CAPÍTULO CUATRO Pasado y Futuro en DVD El público es maravillosamente tolerante. # 0 . - # " X " # # # G% +! $) %%% 1 # 2= ! ! " '. Perdona todo excepto la genialidad.% # # $ # 2! $ % ! # ! # 2 # O %3 A # A $ # # # $ % # " ' " A # A! # A # A %1 # # # # ! # # # % ' ' " # $ " '! / # % # # ! A A % A # A $ ! $ 2 ' A # A % # ' ! ' ! *2 1 $ : ' 2 % # % 2 $) B 8.

S5 " $ # )" (# # 2 # 2 A # A # # % # ) " $ $ S5 " ' " # )# . $ ) " # 2 (# # # # $ J A # =! $ ' . $$ # " S5 ' %5 # ' $ " $) ) # # : 5 B . 3 $ C # $ D # " .# # %3 2 " # % =) # .$ # A# A # %.$ " ! $ ' # N% . F A # " " # # " %* " # # ' # $ % % # 2 % " S5 S ! # # # # $ # ! ! % O " # # $ # 0 . CA • * # " ! ) ' # . $ # %K # # ! A A # ! A # A A # A % F9 # # ! # O # 2 G% '! / # = # >+5 % 2 # 2" # . ' % ' $ ' $2 $ (# ! ( 2% " # # " '$ %. A# ! # 0 " A G% F ." $ ' $ ! # $ $% * " $ %* 0 . " # $ 2 " . (# ' # B " # 2 O # ' # %* " 2 A # A( ' A ) )4 A * $ # 2 0 ( $ ) % ! # % ) ) " %A $ A ) % A ' A G% # % > ! ! $ $ ) 0 . ( # ! # # ) # B % A # A # 2# # % A D% " =# • • ' ' '! # 2 0 ! 2 # / # ' / ! # 0 . A A " % . S5 8 . $ (# " ' $2 $ # # # ' $2 # # % M.% ' ' . 0 .1 B $ $ # # 0 $ .% 2 $ $ # $ % %A * $ ! ! A % F5 A A " # J # # % % # " % 3 %. # ! %* # 2 " )% ) # A A $ 4 ' # = $ ' " # %* " . / # # %9 # G% S5 ! %5 # 2 # 2% > # A # A !O G% F " $ # # ) # ' ' /# =' $ % ) # %3 0 .

% ." 0 . Todos ocurren al mismo 'tiempo' en partes diferentes del mismo 'disco' y lo que pasa en una 'escena' puede afectar todo el resto. # 2 # !# ! ' $2 ! # S5 " # # C 2 $ " $ # ( A # !AF' 0 . 2 # %9 % ' $2 " 2 ( $2 # ' ' 5 9 # G% ! . el 'pasado' puede cambiar el 'futuro' y 'el futuro' puede cambiar el 'pasado'. Así. (ilustración por Neil Hague) > 2 ! ' ' (# ' ! ' $ ' %5 # $ " # $ - " '$ '$ %1 $ " ' ) D (# % # 1 ! " # ! : !A A A %3 $ # ! # # A K # A . ' # # %* # A ' !A # # # # 2" # 0 . ' # 2 " # $ %* % $ # ' ! " (# = > # # 2 " # # ! % . ! /% " (# # # 2 ! # 1 # 2 # ' A ' . # " # O %& # " " '.% 1 $$ . > ! .# # # A A # 2 % " % Figura 50: 'Pasado'. ' # ) # # S# 2 0 . 0 . K $ # 0 / 8 A %H # O ! # # %3 # # $ . # $ A' A A' ! A A %0 $ 2 2# ' # ! C(# D " 2' " $ %* " # " / # % $ # % .% ! ) # # " ' A # A ' ) ' # " # # " # '! # # . 5 8. ! % - # .SB # % M9 ' ! " N% # . " .% # % . % # 9 %. 'presente' y 'futuro' en DVD.

la imagen del centro representa la mayoría de los 'humanos' que son conciencia consciente de sí misma. pero atrapada en la ilusión y dominada por el programa. Por esta razón ellos perciben la vida y el mundo muy diferentemente al resto y pueden ser vistos como 'locos' o 'peligrosos'.número de personas que están conectados conscientemente con la conciencia más allá de la Matriz.9 $ % A %.! ' %9 (# A ' A $ $ 2 $ " # # $ # ) %> ! 2 ) A" 2% 9 # % ' A K # # ! " # " .) B * 2 . % # ! % # % 2 S ' # " # # ! A B # 2 " # $ # " " . (Por Neil Hague) D9 # 0 O ! / S5 . $ 8E $ % . # $ % # O 0 . A # $ # # " # " # # )A ' AC $ % # %* ( # # 2 0 # O $ ) ( # A A = > A !O # # 0 % # .% . el caballo sin jinete. 3 % * # # A A # $ '$ # ) # $ ! # # ! # # %3 # 2" # $ 2 A B * # # # A 5 )A O % * 2 ! .C % A ) > ! $ # A # A 8 D4 : Figura 51: Los tres tipos de 'humano': a la izquierda está el programa de software puro." # # # ) % $ . y a la derecha es simbolizado el mucho más pequeño . # # " # " A ) O # O ! (# C # ' D %. que incluye los linajes Iluminati 'puros'. # # %* # # A A2 0 " % A $ ! 2 A$ # 2 ) D% 9 " 2 A # " " O .pero rápidamente creciente . # .

" $ %9 0 % ) 0 % A # (# A $ # # # ! $ - 2 2# ! ! " ! $ " # ! (# . ' # 2 !A ' (% 0 ' 0 A $ % D+ # # '# . ." ) $ ! 5) % 86 " '$ # O " $ # % " )! # ! J # ' . ! # 2 " " % # " O % * # # % $ O # # 2 % . # .# " # A# O . # # " = # # " ' ' # A %3 " ' $ ! %1 ' ! " # # O C# ! D = ')% # O ! O # C 5)D 1 (# # $ # . % $ " 2 5) ' . # . # # = ED ! # ' !' O % # " . ) # # " ' %& A A A %. 0 # # $ # $ ! $ ' ' # !# " " $ # . ! 0 . $ $ " $ 2 # % 3 = % # " % # .# O # = # ) # " . ! 2 # " # 2 ' # # " # # # " # 2 N% # . 2 ' % ." %3 # F9 0 # 3 # ! " # ! # $ ! # $ # # " E? # # ." " $ %* 0 . # % . . # / $ # O # % # # ! ! ! $ # " $ ' * ' %* # = # # 5)A A %* " =" $ $) 0 . # # 2 ' ! ! # ) " / # $ ' # # " 2 " % " # - # ' # %> # # # G% " $ $ ! # % N% # =M # " # ! # % * %* # " ! # # 2 1 ! ! %M 2 " # $) . # %* 0 # # # 2 ! ' ' # % # . 0 %3 A2 . ' " . # # # 2 # # % # " 0 .

CA # ! A D# % # " " 5) . banca. negocios y medios. política. . . # . O # # # ! # # " 5) ' % * " ! 0 # 2 # # # . Ellos se cruzan de una forma obsesiva para impedir que el programa de software sea reescrito por la infusión de conciencia consciente de sí misma. % $ ' # # # # O 5 ' ' B ' '! $ $ C: 8 D% * : A $! A# $ % +$ ( # ! ! # # 2 $ " ! 2 K # O # $ 2% * D $ $ # . (ilustración por Neil Hague) * 0 . / 2 ." $ " # ' # . # % 0 ( ) O 0 % 3 # C# ) D # ' > $ # 2 $ $ 1 " # ( % $ # ! 0 )0 " " # 2 $ ' : " ! $ # % >$ ' " A # . % Figura 52: Los linajes 'Vestido Rojo' de los Iluminati que dominan la realeza. C C # $ " # # ! D " 5) ! U 5 ! # %* # " $ $ $ ! ) # # . " ' A# )% 5 $ A # % 88 ! 1 0 O # A %1 # ! !# .

' % # # " ' $ # # A D% . % $ %* . rayos gama.." # %> # # 2 C# # $ # 2 C # " ( # 2# D! O : 2 # # " '! ) " # $ ' 2 2 $ $% * # % 9 D! # # 5 # $ 2$ $ $ ' ! . rayos X . ' ' ) # # ! * $ # # # O 5# # # # ! % ." # $ ' ' " /# =' ) # A A ' . . A # $ # 0 (% A ) .% * % # 2 $ # ! O % # # # GA# # 2" ' # # 0 ' # %A .% # # " 2 # # ' " # $ % # ! . # " - %* 5# 2 C# $2 " # 5# # " . B %* # " # 2 0 # 5# # # . " A % ! (# . ! ) $ % 3 B % " # $ " 2 " ( # ! 5# ) " $ / ) ) # $ = ! % * * # B # A ' # A $ A" # ' ' 5# # $ " # 2 % # " # 5# 9 2 # . ondas de radio. como algún cambiador de forma del folklore.% * 5 # # " 0 % 2 A 0 0 $ A) . A! A 3 ! # " # A %9 2 " # % CA ' A D " 2 ! # 0 ' $ 2 $ 4 'El electrón. " $ $ # %1 )" % # # " # . puede manifestarse o bien como una partícula o bien como una onda.! ' # . Luz. % * $ 3 > 2 %* A # % ! # $ # # # ! ' $ # " A2 A " ! $ # # 2 A $ 5# $ CA # 2 %1 '$ # ! # # %. sino como una categoría sola 8< . 2 9 ' # ! . También es común a todas las cosas que una vez se pensó que se manifestaban exclusivamente como ondas.F 2 $ J 2 2 ' # ! O ! / # $ # " ) 0 (% A# ! ! 5# " . Hoy los físicos creen que los fenómenos subatómicos no deberían ser clasificados únicamente como ondas o como partículas. Esta capacidad parecida a la de un camaleón es común a todas las partículas subatómicas..todos pueden cambiar desde ondas (a partículas) y viceversa. '2 # # D $ % $ " 3 0 $ ! " # 2 '! 5 # 2S . # # ) 0 ' .

de 'algos' que son siempre de alguna manera ambos. A A# " ' % H # " # 2 " # K . La conciencia consciente de sí misma también puede comportarse del mismo modo cuando está profundamente atrapada en la ilusión. y los físicos creen que ellos son la materia básica de la cual el universo entero está formado. Esto incluye la utilización de técnicas como Problema-Reacción-Solución y manipulación de Mano Oculta para avanzar su orden del día para una dictadura global Orwelliana. Usted los encuentra en todos los niveles de la sociedad y ellos a menudo son recaderos parecidos a un clon que sirven al sistema sin dudar. % * 5) # # ! ' $ ! % ' # O ' O L' U ! % +2" 2 BB14 A * $ $ F $ G% # 2# " (# ! # (# ! " " # # " " B # A % 0 # . " $ $ $ L # O % 2 # ) # ! 2 # # ! # % 87 . (Ilustración por Neil Hague) H $ ! 2 # # ( " 5# ! 5) # %3 # ! $ !# # " 0 . # # C: 8ED% $ !# " $ C ' 0 .D " # C( D # % # $ # . Los Iluminati usan a sus clones de software humanos para dirigir su sistema de control. Estos 'algos' son llamados quántums. # % # ' ." # " " .' $ # " # " # - " A# " $ ! A( %%% !# # " 2! # # A 4A $ A % # $ % 2 2 # # " ) $ .% Figura 53: Los programas de software puros no están limitados a las familias Iluminati.U O @8 " .

) " B ' $2 # " A! . Los Animales.A O .el programa de la Matriz. el Mundo Natural y la 'ley de la naturaleza' son todas ilusiones holográficas proyectadas por el software de ADN . # $ # # - 3 2 8? % # % * . 1 " ! # " % " # " # ! ' # - ! 2 " . # # # # # # ! " (# " ' " ' %* %* C $ # # Q ! # - # A Q # # 2 A " " ) ( " $ # $ " %* " ! # O %9 %& ! . $ $ $ % # " # # ! - = $ D! %* " # ! " C'# D # = $ (# # # # " .# # # % > # ." 5) O % ! # # " # ) # # # ' ! 2 " ' # (# 5 # ! # # # # (# # ! $ $ " # S $ ' # $ # % * " # A 2 # A %* $ 2 # $ % $ " $ O # $ % Figura 54: Todo en nuestra realidad 'física' es un holograma descifrado desde formas de onda por el cerebro/ADN/ARN.

Todas las criaturas grandes y pequeñas.! ! . El Señor Dios los hizo a todos ellos. %%% A! 2 " # ) " # # . )" 0 . .0 F1 . $ $ 2! " # . ! B 1 # ' 2 !> ! % G% 4 Todas las cosas brillantes y hermosas.ru). " $ " ) . * .holography. Él hizo sus alas diminutas. . El gato y la rosa 'sólidos' aquí son hologramas." . Él hizo sus pétalos brillantes. El Señor Dios las hizo a todas ellas. Cada pequeña ave que canta.% # % C+$ $ # # (# " '# . Cada pequeña serpiente que te pica.0 # % 3 ! ! . Cada gran tiburón que te come. # # # # # (# 0 2 2# BB1 # ' / # # . # " A! A )$ # ! ' ! = (# # A # " # # $ %D> $2 A! $2 # # '# . B 4 $ 1 # # " - " 2%> ! Todas las cosas de mierda y horribles. 2 ' 2 0 . Centro de Exposición de Toda-Rusia. Él hizo el veneno letal. C: . Por más vea www. ' ( # A A# " ! ' AA # % 88 ! 8<D% Figuras 55 y 56: Todo en nuestra realidad 'física' es un holograma descifrado a partir de formas de onda por nuestro cerebro/ADN/ARN. Cuadros 'Siam' y 'Rose2' cortesía de Estudio de Holografía. $ # # # $ $ 2 $ %. Todos los asesinos grandes y pequeños. Moscú. % * 0 . . Todas las cosas sabias y maravillosas. A ' A D% 1 # A 8@ # " # 2 " # A' 2 '% ) $ ! !# " " # $ . Él hizo las alas arrancadas. % C ' # $ " %9 . Todas las cosas destrozadas vivas. B # 4A F9 " ' 2 GA %* " # # ! ' 86D% * . Cada pequeña flor que se abre.# # ) # # " A 9 % 9 2 " 2 = " # ) " " # # C: .

G% FI . # # ' # $ %1 '$ $ O # ' $ D ! ! ! %* $ # ) # ' O 0 # # ! ) # ! $ # ! 2 !# $ " ' " $ %.' ' G% . # 2$ $ $ G% F3 # ' K # # # B # $ ! # 2 ) A! ! - %1 B 2 # # $ # ' ! # # 2 " $ ! %+ $ # A # $ # .! K <@.$ $ ' $ Q )# # # . # . G% # # . " ! $ % ' .% F1 # ! .# ! $ # 2 - # $ " # # # % * $ $) # " ' %* ! ! # # $ D% # ! 2$ % .3 # # $ $ _ " # - # # BB1% 1 ' $ " $ ! 2 $ " 2 % A # O # 2 $ # # . % FI # A A . # %3 $) # %1 # D % # 3 # " 0 . " = # . 2 $) # ! O ! 2 %* ! # =! = ' / # .! " ) # ' % * ! .2 = # 0 . # = C9 $ # # ! 52 B ! %* " ! $ %I # # # " # $ $ # C # $ + # $ . ! # # " % * . ' 2 ' ' '% $ ( B ! $ $ B '$ # # # L $ ! # ) ) C # D .% D ' $ D% K CU L $ CL # ) # $ " # 2 # " <. D . ' ' " # % $ (# # ! % 2 % .% ( # # % # A # # # + " $ ' $2 + # ' ' $ ! # $ # # ! + # ! 2 ' $2 %F # K # $ G% # ' 2 A # # ! 0 $ C ! # A # O ! - " . !' $ # " 2 2 $ % 2 # ' ) # # " %* $ # F! " G% " ! # # % # $) . " # A A # % 2 ' %3 # " # # ( $ $ C# # # O # .

Por más vea www. G% # ' %* ! # 0 . $ P ' PA %+ # 4A )4 P> ! # A A! ' $ . # " " ' ! " A " # A $ % ' ! A'2 A ! # # % % F* 2 ..P ! .ca). cortesía de Galería de Arte Holográfica Real.% A F G%A1 / " " (# ! ' %* . # ! # ! )" # # A # " A # " ' 3 C: # " 2$ 2 2 # " % $2 2 " . # # . A < . ¿Piensas que el Infinito tiene que respirar o morirá?. (Cuadro 'Saturno'. Cuando usted mira al cielo nocturno ilusorio en un planetario puede parecer increíblemente 'real'. " $ ' $ # " " $ C # D" # A A # %* # =A ' $ M# NA %1 . por qué lo hacen esos en el Bucle del Tiempo?.' Figura 57: El universo es una ilusión holográfica similar a alzar la vista al "cielo" proyectado en el techo de un planetario. )4 A F9 B # ! # A H $ ' # " # " " # $ . )" " 0 . 'El Planeta Saturno' aquí es un holograma. 1 .# # # % ! ' ! 2= A # A %1 ' $ . # $ 2 % " # ) # ! # 2 % .P ! 87D% * / ' A A % F9 # $. N% H ' $. " # " # # 4 P> ! .S %A F9 $ # B # 2 # " # " ! # ' K $ % . " A A A A %1 " G% M3 # N% ) ." ' # ! % F5 # ! %.A % . > $ " ' ) # # " # $ $ A A # ! %* A A # # # $ GA # . B )4 '¿Piensas que el Infinito se sienta a cenar?.! # $ ' # " " # ! %A 0 # !# ' %A # (# $ ! ' G% 0 %%% M N% A 1 0 . A2 A # ! ' % " ' A ) . # # A A# " O A .# " # ! $ %.% " . " ' # " # # 2 0 ( # ) !0 ' O G% 0 " # # 4A F9 " " # ' G%A9 # # 2 '$ # " $ # # %9 2 # $ # " # # ' 2%F* 2# # " # # G% F # " ' # $ G% . " ! # # # %9 % $ # % 0 .bc.holograms. # A % " ' ' # " # # = " ! # = # % # .P 2P! # 4A) " ' # # (# . ¡Un programa de ordenador!. ¿Pero qué es?. Respuesta: porque ellos identifican quiénes son y su sentido de posibilidad con ser una "personalidad" física subordinada a "leyes" ilusorias y no con ser lo que realmente son .el Infinito Uno. $ ! # .% M1 2 " ! ! 2 $ 2 2! $ " ! A ! 2A ( 2 %A 5 # A ) . ¿Entonces.

(Cuadro 'Usheptis' cortesía de 3-D Hologrammen. $ # ' # " # ' ! # " ! ) % 2 /# =' % Figura 58: Este es un holograma de artefactos egipcios. Por más vea www. # 0 .3-Dhologrammen. los monolitos y otras 'pruebas históricas' son simplemente escritos en el programa en este punto?. 2% F9 ! # ' N% 1 # $$ A # A A $ ' ( # # $ ! M! $ 0 . # " ) # G% + .com).2 # " $ 2 # %9 " . > ! S ! . ' A %3 ( ! 0 . C $ Vea un Mundo en un Grano de Arena Y un Cielo en una Flor Salvaje Sostenga la Infinidad en la palma de su mano Y la Eternidad en una hora./ = # ! ! # % A# # A 2 ( %1 # # A % # $ # # " # " # 2 # ! # $ " # " '! A / # ! '$ '! / # S5 # # # B! G%AU B / A= # " ! 2 # $ % '! A # '$ # ' ' J A D % # # % S # # $.% FI $ A ' A G% +V H # % . las reliquias. " ! A A # # (# # $ A A % FH # $ # G% 3 # 2$ " $ " # # 2 ! # " " A # A# A # A % 0 ! # $ # A ' A G% 1 A D " CA A D ' . entonces la 'historia' en cualquier etapa sólo es lo que la Matriz decide comunicar al ADN. ¿Y si los hallazgos arqueológicos. $ # '! # 2 # %9 '! 2 # / ( # 3 % A! / % # # # $ A 3 #2A # ! # % /# =' # # # %9 ' ! # % F. El ADN recibe constantemente la información de la Matriz. ¿Realmente existió 'ayer' como usted pensaba que lo hizo o es sólo una señal que su ADN está recibiendo ahora?. CA $ .# " " ! ) # # B )4 A F9 " " G% # ! D% F9 " " # 2 $ 4 " # $ %* # '$ # ! # A# A %9 %9 - % " 2 ! %* / # 2 2 $ # # A %* ' ! 1 # " # # %F 3 %* * %A . $ # O # # 2 " # 2 " '! ' $ A A G% " ' ' ' " (# ' ' # " ' $ $ # $ # 2 SB # 2 # " / # $ " % F9 " # # # # C A # < 0 # . Ámsterdam. ' G% .

y hay un número infinito de estos universos paralelos.. # BB1 > # %* . Pero desde los años 1920 los físicos han intentado explicar un inquietante descubrimiento. # % 9 '! " # . Esta vez serían diferentes y todavía más extraños que la idea de que Elvis aún viva. también. K U% B '% 1 # " 2 # 2" $ '$ % # # # # # A $ A 0 .' 3 . # 24 'Durante casi cien años la ciencia ha estado obsesionada por un oscuro secreto: que podría haber mundos ocultos y misteriosos más allá de nuestros sentidos humanos. Las matrices son como canales de TV.% $ '! # 0 .' 'La única explicación que a alguien se le puede ocurrir es que las partículas no existen solamente en nuestro universo. 0 . También existen en otros universos. '.' * " $ 0 . tal vez en todas ellas. 3 % .' 'Esta idea era tan inquietante que durante décadas los científicos la descartaron. No tenían una única ubicación. todos ellos ligeramente diferentes.$ % # ) % % # " !A $ '$ A 2 A ' A 9 0 " 2 '! ! .% # ' J J 0 .... sino también en más de una. %A 0 " # # " 0 # ! %9 # $ " # # ' A ' . Decían que estaban llenos de fantasmas y espíritus. # A A ' % F5 ' G% 9 " 2' ! 5 $ . Podríamos participar en otras películas. . 1 # A ' ! A " $ F / # J # ') # " = /# =' J! $ / G% FI % " G% <E ( " %* 9 $ ! 2 % ( # " 2 ) " % . Pero con el tiempo los universos paralelos tendrían una espectacular reaparición. / !# # %0 # # A A # ) # # $ ! # # # % 1 # A A % # # # ! ! ' # % 0 # ) # # # $ $. # / # G% * # " ` # " - " C: " ( # # T " 8?D% # A! A A % F1 # A # # - % " 2% > '$ $ B # ! 0 ." ! %A '! ' % * " $ %* / # # + # !" # . Lo último con lo que la ciencia quería estar asociada era la superstición. Cuando quisieron determinar la ubicación exacta de partículas atómicas como los electrones. Los místicos hace tiempo aseguraban que dichos lugares existían." 2 # $ # ! % 1 2 ! K 1 ) 5 6 4 'No estamos sólo "dentro" de una matriz visible. en otro ustedes jamás nacieron. descubrieron que era totalmente imposible. en otro el Imperio Británico conservó su colonia americana. hay un universo paralelo en el que Napoleón ganó la Batalla de Waterloo. . cada una con su propio horizonte de eventos o frecuencias peculiares.. De hecho.

olvidó que era parte del océano infinito y se sintió aislada y separada. ubicuo y eterno. la conciencia humana comenzó como una ondulación que decidió dejar el océano de conciencia . <6 .. la conciencia fue atrapada en una ilusión que creyó que era 'real'.lo atemporal. Como un mito hindú dice. Cuando despertó a sí misma en este estado 'desconectado'.. .Galería en Colores de Neil Hague C $) " # # $ D La creación de la Matriz: primero la imaginación devino en la 'forma' y con esto vino la ilusión de separación. La separación llevó a la manifestación del miedo (la entidad alada) que tomó una vida propia.

<8 . El hipócrita (y luego unos) Iluminati manipulando la sociedad humana bajo el control del programa de la Matriz. y un sentido de separación. 'tiempo'.El miedo consciente de sí mismo se volvió el Frankenstein que controló a su creador manipulando la realidad a través de la ilusión de forma.

Mientras la energía de la Unidad penetra la Matriz, la vibración del miedo
se disuelve y la realidad de su conciencia cautiva es transformada en la
Unidad Infinita (vea el capítulo diez).

CAPÍTULO CINCO

Médico, Cura Tu Virus Informático
En una ocasión de esta clase se hace más que un deber moral el decir la opinión de alguien. Se hace
un placer. (Oscar Wilde)

# '

!

#

# #
!
" #
A 2 A '
'
#

"
'

"
A
(#
#
# "

%*
#

#

(

$
2!

#

#

!
#

#

#

G% F1

)!

(#
#

'
'

#

!
#

5 %

#
% F1
)

$ "

#
# A
%
!

%5

"
<<

'2
#
# #

#
#

)
. G% 9

#
$

'

"

#

#
3

# " )

#
#
!

% *)
"
# "
%

#

"
#

$

#
'

%
# " -

Figura 59: Este es el gráfico del colon que vi
durante mi limpieza. Cada sección está
relacionada con un área diferente del cuerpo
porque en un holograma cada parte contiene el
todo. (Gráfico cortesía del dueño del copyright,
Bernard Jensen Internacional de California.
Para comprar este y otros gráficos vea
www.bernardjensen.org. Detalles adicionales en
la contratapa del libro)

#
# " - C#

D
!

$

A
#
'
# !
"
#
#

$ A
#
#

#
! 2 '
$) '
'
%
#

# "
%1
#
#

!
!
#

"
'
#
0

#

"

# " 0 .%
0 .% *
# " # !
)
$
#
#
% H
#
/# ='
"
(
A
#
A
% 2
%

#

.!

%
! (#
"
$

/# ='
$ '
#

$

Figura 60: La columna, también, representa al cuerpo entero. Por ejemplo,
T7 en el centro afecta al páncreas, duodeno, estómago, hígado, bazo,
vesícula biliar y peritoneo. (Gráfico cortesía del dueño del copyright,
Publicaciones Koren, Surrey, Inglaterra. Para comprar este gráfico (que
incluye la información sobre cuales áreas del cuerpo representan las
vértebras), envíe un correo electrónico a Richard@familychiropractic.co.uk.
Detalles en la contratapa detrás del libro)

;;6
2"
2
#
$ '

' $2
'
2

#

#
#
"
#

#
#
*

"

"

#

#

!

"

2'

#

%&

$
#

#
'

# "
"

!

"
2% 3

'
%&

# .
)"

#

.

! !
#

#
#

!

#
$

#
' $2

( - ! ' $2
>O ! 2
#
%3
"
>O %:
#

#

#

#

# .

>O
$

!

# .
%
' '
9 !
2#
"
#
! 2

2

'

!
#
$

!

2%
' 2
%9
# #
$
! %
'
"
2" !
2
%H
' # $
0
$
"
2"
K
9
# $
K
"
%

$

'$
>O %B
' $2
# $ %H
#
$
# " -

)
$

$ %1
!

"
"

'

(#
F 'G%

2
O' =$ =
<7

' $2 ' $
%
.'
= -

# "
$$

# .
# %
'

$ C(

#

D%

0

#

$

'#

M#

2
%

!
"

!

N

#
$
#
#

#

% *

)

/ (#
)
$
)
"
%* '
$
% 3 # $
/ #
$
#
"
#
# $ $
%3
#
"
#
#
!#
%
#
2
# 2
2 ' $2
#
!#
# = '
C:
8@D% 1
# (
'
#
#
#
.
0
.
)
#
#
2 !
!
# .
.
"
$
#
>
2
' $2
)
- !
!
#
$
%
# !
2
"
#
% &
# 2
.
! )"
#
" ' $2
%9
'.
$)
# . '
$
$
!
' $2
.
#
# C:
<;D%
"
"
'
) C:
< D%

'
. "
$
$

%
)
# %
$
# .
%

Figura 61: Cada parte del ojo en este nivel de la
ilusión representa una parte del cuerpo - esto es un
gráfico del ojo izquierdo. (Gráfico cortesía del dueño
del copyright, Bernard Jensen Internacional de
California. Para comprar este y otros gráficos vea
www.bernardjensen.org. Detalles adicionales en la
contratapa del libro)

"

#

)

#

" ! # 2
#
# "
#
#
$
%
B
'.
$
" !
2
"
' $2 #
% *
# .
$
(#
!
='
#
%
'
#
%,
!
A
A
'
AC
D%
#
2
"
'
"
'
#
%* 2
#
)
=
"
#
"
#
'2
2
#
!
2
!
%0
)
% 9
) #
#
#
$
%
'2
#
=
%

# "
!

#
# #
$
# "

!

A
# "
(#
# .

'

%> !
#
'2
!
$
$ $) "
$$
# "
'2
#
(

#
'
!

%
#

"
#

"

#
(

*

2
(#
$

#

'2

#

$
$ %
%

"
!

$

"

#
"
D' '
#
#
)

#

(
% 3
(
(

!

#

2 %1
' $
."
'

$

'2

$ "
% '2
# $ "

$
!

'
. #
# " - #

(

#

'

AC
"

(

!
"

$ !
.
!

#
'!

(
A
#

$

.

(
#

#

# " #
#
#

2
)

#
#

'2
!

# %
<?

#

9

!

" " # # # . = 2 % " '$ # # ! S5 " ! ( ! % # ' ! $ " <@ $ %3 # / ! S5 %0 # " S # # $) # $ # . # ! $ " # ( ( % 3 % * %9 .2% * $ # 2 %0 9 ' $2 $ ! # ) ( . # 2 # = = % . ! # $ # ' # # # ' ! ! " # " $ ' 1 $ " ! # # '2 A # A '2 % " % $ " # # # # " ' # ! $ $ $) $ % $. %1 % . '2 # " # %." ' % %* ! %0 ' # 5 $ # ( # '2 % * ! '2 6? ' ! $ # . # ( % # $ ! ! # * 2 ' ! . ! ( '2 ( " # ! # ! $ # ) ! S ( # ! G% ! ! # # 2 ! # %* " ' # # # % % # . # S5 # S' $ $ ( # ! $ ' # ' % # % # # ! " # " ( # # $ ! ! $ # " # ! " $ % ! '2 " '$ ! ' ' # $ ! # %9 $ % # 5 ! # ( " # = # S5 % * # # %> ! 4 ( " " 2 2 ! % K B # %* ' # # ' " . $ 2 ( $ # " 2 2 F# ' # $ " # ( $ " A A %9 '2 % .. $ ! ! 2! % $) # " # ! '." " # . . ! # # ' $ 2! $ 2 ! 2 % " # $$ = %+ # 0 $) # 2 % # % % % % # # # " % # # " / ! # ! S5 # # .% . ! $) $.

# # ( A $ A " # # # ! $ # % " # ) ' $2 # " 2' " ! $ . # ! " % A % 2 " $ ! $ " ! ! ( % 3 # (# # # # " 2 ' (# % * # % 0 # $ # # " # %* . ! " ' $2 # ! $ C # ! " $ " '! # # " # ' $2 $ 5 '$ 12 0 > O %5 0 5 '$ H %. # % # = " (# % . . G% $ " ' " # " A ' # # % A $ % .2 =# # . $ " % 1 # # $ '! # )! " # ) # '$ / %. %& " $ # ! " ' $2 " $ %3 . $ 1 # @@ D ! $ . # ! " # ' %H 2 # 2 " " % 2 # A ! # " % FH " # # / . # $ # $ " $ ) / $. # ' # ) $ $ % " $ $ # %> ! # 2 " # # # ! L' % . . ! # H ' ! ) $ " ! ) # # % 0 . . L' 3 >O % 9 H 1 4* 1 0 ! 0 1 # 0 ( 3 C* $ U S $ %. " % F# " G% 1 %3 # !A A % %9 ' # ! (# $ . % ' # ( # $ ! (# %+ . # ' " ) %3 2 %0 " $ %. % # $ A # # A # # " . ( ! # ! # 2 %* ' ." '. $ ' D! # " " ' $2 # " # A2 A (# % 1 # )# % 2 " ! " %1 # $ ! # ' $2 ( # # # # # 2' % * # # ! % ' $2 / ( 4A .# # * $ $ " 7. A # $ ! ! $ # 2 % . ( # # ' ( ' # 2 " 2" $ % . . % $ ! .# .

2 " =# 2 $ " # # " = " % " . C $ " # ! # ! $ $ .# # " ( $ D! '2 2 C " # # =! %> $ %* $ %9 # = $ 2 ( # # " " # ' 2# = = ' % 1 ! # . 0 C # # % ! " ! # # % ' $ EE $ ! # ( % . A# ) # 2 # ' A # " 2 " 2 # $ D / # ' 2 ! " # $) " 1 %1 " # $ # # ! % > 9 ' 2# # C # 2 # # ) ! # . # # # ' A ) $$ $ " 2 2 # $.! (# # ! ' # ) A . # . S5 % * D 0 % # $ ! ! % A . " " ! # / " J % ( '2 ! D! ! $ ) ! ' 4 7 % %1 S % ' ' $ # ! " # . " " 2 / ! # # # 2 0 . '2 " $ $ # $ '2 .# )" # # " 2 %& $ 9 2 $ * # ! > # # # $ " # % 2# $ %0 * $ " ) % 1 # # A % * # 2 ! ) !' " ' $ 3 1 * Q 2' ! ' " % " # 2" $ C D% " ' CFF A 1 2 > $ A GG%D% A # $ $ # 2 '$ $ V D% * # # . % * # # " # 2 % ' $ ' .. ' 9 / " A % O " # " # .# . ! # $ %* " 2 ! $$ ! A A # # # 0 .# ' # ! )" ' !! 2 # # " # %A $ " '! " # ! $ " .# . ! # ! ! ! A ) % %A 0 2 %A $ =! " 2 %3 # 2 # % % # # O ( 2 # " # $ % $ % 9 # '2 # ! $ " % # % " ' " S5 C . C ' # " '2 % * ! ! D ' # $ " .

vaccinationnews. # . # 2 ' " ' . %+ $ # # # 2 " " # 3 # ! ( # 2 ! # % M& " A # ! >% 9 $. # ! # ! - / # " ' 7 . # - ! # # " # % '." % ' ' # " # $ " / # " # ' ( % * ' # " # # $ % .! # ( %* ' # # 3 .• > ( ) !# • : . $ 1 - ( # # " # ! ( C % '2 D! # # ' 2 " 2 % ' ' ! ( !# ) - % 4 ( # ! 2! ) ! % (Por más detalles vea www.. %A 2 %A 2 " % " A A " " # $ " ! B ! # # . > '2 • 4 ' • : % # ! $ % # # % # ) ' ! $ % % 4 $ / $ $.%. / ' %9 $ % # % # ! " .htm) $ " # # $ %9 .. %A ! %%% $ . 2 - # 3 B #/$ $ 2'$ # # $ ! S5 %3 # # # $ # " 2# %3 " # %* " %* A " '! ! # " N% 0 # ! % ' A # $ % # " " # # % F 'G% A +! ' # FA +' 1' A 1 2 A 1 9 " # $ / G%A ! 1' ' $ . 4 ! ! '2 : 4 # # • Q # %. % # $ % ! 1 $) 2. " # ! ' " # ! " A .% ' # # # " # $ # 2 # $ F %* ' # ! ! / # " # 2 G% ..% # $ ! $ $ ! $ # # $$ S5 .! % 4 ( ' ' ! • # # $.com/dailynews/may2001/whatsinvax.

" $ # " DJ! 2 % 1 Q G% $) ! 2 / " " $ ! % F* )# ') ! ! # $ # %* # # # # # $$ ' % 9 # # ) % . # # = ! ' # ) %& # # ' / / 1 (# G% F # % $ " $ % " # .$ - " " 1 B # % * # % * " A ' # # $ $ $ A 2 # ! ( # ! %* # $$ # # # 0 " # % 9 " " 2 " ' " $ ) J# # " (# $) % # # $$ ! $ 1 * C ! " 3 - # $ / " # 2! ' $ %.! # A A' $ 1 " ! !" # # ! # $ " # . " 0 . " % # " S 0 ! ( $ # . # # A A % . (# # # . 0 J % " '! 2 $ # # $ * O ) $ # C $) # = # # %3 % '# !# $ D% $ # " # # " $ " 2 # DJ ( 2C ' # # # %9 ' $ ! ! $ 0 .! %9 # # $ $) # # % % F C= 0 # # ' ! % ( $ 2" ! % $) " D # ' $ # S 5 DJ DJ # C " / $ ' # " # # S S # !# . ! ) G% ' 1 '! ! # # % F1 / A B # " 2 ' 2 # ' %A % . " %H' ! % # # ' C % $ 9 ) " # ) $ > % ! .* # " " !' (# ! # " 7E ! # %0 S5 . % ) " # " %A ( # " # " S5 '! A % " # % G% J J# $ # # A K $ " A .

A %> ! 1 # / A % # " A % I # . y usted encontrará un resumen de su trabajo en el Apéndice I. ! L 2 " $ * 0 0 24 A 0 . $ # / )# $ G% 0 # )! # ) # " # $ ) ) # )% * " (# A A A( = # A $ 2# 2 2 $) # ! # " % F. Él se ahorra la vista del horror de su cosecha. Sus descubrimientos apoyan el tema del ADN como 'Internet biológica'.J $ 0 $ ) 2" # %1 . $ .A '! ! '! " ) # ) S5 # $ O # 0 $ ' " !# # # # " ' # H # A F $ " ! % .# # ) %9 ' ' ! % > ' " $ ! " 2' ! # " # % '! / )% F. CAPÍTULO SEIS El Programa de Dios Está bien para su paz que el santo vaya a su martirio.% # $ " ! '! A ) # / / % 1 A" F 'G% # ! / % Nota: Cuando yo había completado este libro y entró en la etapa de producción. que detalla los descubrimientos de científicos e investigadores rusos respecto al ADN. # A" ' # " %9 ! $ = % '! $ " A ' % $ # .A G% " % * ! # J# A ." 2 76 # %* 2 # # $) # # %* ' %* # # %* % # # # # % # ! . (Oscar Wilde) 3 (# 5 # # # ! % $ " ! ! " ' ' # $ # # " ! # # ! ! $ # ) # # ) 2 # # A %* 0 ' $/ " " 2# # # " ) $ # K ) ) ! # % # " . # ) ! # # # %* A . # 2 A %1 " A( A ' ' " " ' %1 # " " = = " % % # " A # . Vale la pena leer el Apéndice I en la página 130 antes de seguir porque está estrechamente relacionado con mucho de lo que usted ha leído hasta ahora. vi revisiones en Internet sobre un libro llamado Vernetzte Intelligenz. ) ' $ " # G% 9 " % ! " 2' " ! # # # " A ) " A % F9 # ) " # G% " .

2 $ # N% * # " # %0 % F. Pero. Luego deben usarse empujados hacia adelante de la oreja para que sean visibles. y no deben crecer más cortos que la parte superior del pómulo. Muchos quienes se dejan crecer peyos largos lo hacen así por motivos Cabalísticos.. ! " 2G% 9 '$ $ $ $ $% * ' $ # 2% # A # # AC# # # # ! A % M !N% > ! $ $ =M %F # " # # % !! + ( # # $ %& # 2 2" " 2' ! # "% 4 ) ) 2 " # $ " ) G% # " # D ') $ N% $ 'Realmente. y permitir al área de las patillas (en todo hasta la parte superior de la oreja) crecer largas también (las patillas largas son llamadas peyos).. $2 # 2 $... las patillas simplemente tienen que ser lo bastante largas para que uno pueda tirar del pelo.." # $ A 0 A A 3 " AC A A D% 78 . no debería permitirse a los peyos del costado de la cabeza crecer más abajo de donde los lados de la barba comienzan a aparecer. Muchos Ortodoxos dicen que los peyos (alias cabellos de las orejas / costados) comienzan directamente en la sien. específicamente dentro de la comunidad Jasídica..! $ A % * $ $ # ' $ $ 2 9 B ' *$ 7 / 7? 4 A 5 $ ! ) $ $ \ ]A % B " / # # ' ' $ $ 2" F" # G% ( .% FH G% ! $ # ) # ! # # O 9 ! ) 2 " %* $ $ $ ! 1 " # ' ! $ = ) ) 2 ! % # # A F9 " $ $ GA K ! " ' # $ %9 # 0 . y el área de la barba puede ser afeitada con algo que no sea una hoja afilada (muchas personas aceptan el uso de afeitadoras). '1 X. Unos arropan el pelo bajo su kipá/solideo.. '! # # 2 $ %* ! " $ $ ) A ') ! " M # N% 9 # '$ # # $ % $ " # ' C $ A 0 D# '2$ ) 2 " # G% $ # % 9 F# " " G% B ' * 2 @4 7 4A # $ $ $A % F # " J! # % M0 $ $ $ # " ! # ! " # # $ " " " ! %* ! % ! " # % A ! G% .. "$ =# 1 # ! 1 1 (# $ % " $ 2 # # 9 ! A # # ( A $ " # ' ... hasta justo detrás de la oreja. mientras otros rizan el pelo. Una vez que la barba crece. hay una costumbre de no afeitarse (y con frecuencia ni siquiera recortar) la barba. # % . # $ '$ # ! A ' # 9 $ " # . Una de las opiniones en la Cábala es que los peyos tienen que usarse largos sólo hasta que salga la barba. (Dibujo de Neil Hague)) 3 " ) # # # $ # ' # F..! ' # " C: < D% Figura 62: 'Cantaremos ahora el himno 364 ..El Señor es Mi Pastor'...

Las uñas también nos ayudan a caminar. Si usted decide no cortar sus uñas. # A ! ' # # . # C D% * ) $ # 2$ = ! % # ) # ! ) $ $. honesta y progreso en la vida.6 $ # # !# 9 $ # ! > # $ %* " $! # # 2% % %. Las uñas nos han sido dadas de modo que podamos trabajar y caminar. )C $ . Así por lo tanto el Sijismo permite que sean cortadas. ) (# $ ) F# " # G% 9 '. # " # " . $ " $ ! # A %H . # % * .. ! # G% ' 2# % # T T# # # 0 ! <ED% . Por ejemplo. ) " CK U% B ' D! # " ( # # # # $. )% $ $ " # ! $ ) $) % 3 5. G% * / ..C: # * # ! " # " 2 $ % & (# 2 7 C $ ! .' 4 % % # 'El Sijismo cree en tener una vida sincera." $. cuando usted trabaja eventualmente se romperán.2" ' % * # 1 ) 2 # ' # $ $ ! # ...) # C / $ . si usted levanta cualquier objeto con sus dedos usted verá la presión en sus uñas.) ! ' ' " ' $ .. ! D )$ " 9 D! # / ' # .6D% # # " $ O ! ! 2 % $ " > " O / ' $ .) G% # " . 2 2%* . (Ilustración por Neil Hague) # 2 # % ' F 1 # * % $ " $ # 4 0 # $) $ % $ 2 " # $ # " " % F ) G% FI ' ' ' # " $ " G% 9 # # # # 9 $ % / # $ # % * $ $. ' .' Figura 63: El Programa de Dios de la Matriz..! '! # " %3 U $. ¡Adoradme a MÍÍÍÍÍ!.) $ % ) 2 ! 2 .) $ % $ # ! 9 B $ * # # F# " '. )# C# " %%%D% 9 $ # 9 ) # " " 2" # # 4 F# " . # 7 ) # " 3 8 $ % 9 " # $ ' " # " 2 $ # $ % # " $ ! # # % * *!L 2 ) # " 7< " 1 " 6 .

# $ D " ' ! # # A# ! " # # # # E.% * % H " # $ ) 2 ( % # # ! !L " ' % $ # ( $2$ # 9 2 9 5$ V! # ' # %& $ $$ $ 2 ! $ 2 $ ! $ ' 5 $2 % .' %1 0 # # 2 $ . # # = $ 2" . lo que usted no puede decir.% & $ " B ' # # $ % ! # ( %9 F # G% 2$ % # $ $ B (# " # ! # " # . 2" $2 ' %& 2" ' " # 2 % 2# " # 2 # . # ) ! A ' $ '$ # ' % ' $ : % 5$ ! V $ # " .% . cómo uno actúa . A ) " $ ) %A # # $ # ! . ! 2= GD% ' # " .antes de rezar por la mañana no comemos .% 9 " " %9 ' ' $ .0 . lo que usted hace en la sinagoga. lo que usted puede decir antes de que usted rece.' 3 %* . * # # " # 77 $ # L $ ! % $ )" $ ) # # $ # 1 " ' $ . # $% ( 2 # % $ V! $) # %& $ '$ # ! 2' $2 # % # # " ' $ 2% ' . CF # # # . %9 '. lo que pasa si usted llega un poco tarde para los rezos.A # ' C# .cómo usted puede saludar a alguien por la mañana. cómo usted va a la sinagoga.D ) " ' " '$ $ ' . !0 !# ' $ " # ! # ( -% # B 2 ' ' $ # " !# !# ' 2 " " " ' 0 ! # 2 (# " '! - !" %9 ' " : $ B ' 0 4 ! %A # " ! $ '$ 2" # 2 % $ " " !" ' $2 # $ . " " ) 2 # # # B ' $ ( " # ! # 0 # $ ' $ " % & )4 'Este libro aquí realmente nos dice lo que usted hace cuando usted se despierta por la mañana. . todas estas cosas están allí. ! 2 " " )=! # ' % > $2 ' 5$ V ! ! %& %3 $ * " $ # # ( . qué partes usted se pierde. " " % 0 ! ' 0 # ' " % * 5$ V ! $ $.' $ $ # ' # K " $ %5 # # " 2$ ! $ %9 " ! '$ ' % 3 %A $ L #' ' # (# # . B ' # ! $$ ' " = # $ # $$ $ $ ! ' . cómo uno se viste. ' ' ' ' ! 2 .O ! C9 2 1' 2 ' 1 $ % ) 2 " # # # %A >$ 9 ) 5$ 2% 1 .# $ $ # # " ' # .

' # # $ # ( $ " # 4 '.' F+ G% 'Un búfalo.# " " '$ # ' G% ' # ) %3 / / * ' ' 2 ) # ' # $ # # " ' 2" # # )" " '! ! " " " # ! 2" . aunque no haya ninguna verdadera diferencia en la leche.# ! ' ' ! ' % 3 # # " ) ' ) B ' ! 4 # # ) 2 ( ! $ a7<< ?8@ 6@6% . ! " ' $2 # . el mismo hecho que estemos aquí comprobando.# 2 # '%& )" $ % # ! %9 $ " - %* . es muy extraño tener una manada mezclada de todos modos. $ 2( # %I . pero a pesar de todo las exigencias son que estemos aquí. 5$ # 2 %1 ' # ' $2 # A )A # % ! % % # ) # $ # # " # # " 2 % & .. Realmente sabemos que no hay ningún otro animal en la manada. > % A' # # G% 0 '2 ' : $ # 2 . ' C !D ' \ $ ]A % 3 $ $ " # ' $ $ ! . %9 % * # 2" # " ..' F9 2 ' A # # %& )" $ ..) 2 A # )A ) % " # # # # / %1 ( ! # % & $ $ # # # $ B $ " $ ' (# A % $ %M N # $ # # $ % # $ %* ) " ' # ) ) 2 " $ $ # # ( # ' " $ '! ! $ 2 * ' 2 " ' ' # $ # " $ " # # # $ %* '" " / ( # $ %. ' ' # 2 / E< ' ! # # # 0 % " # $ # 2 ! # $ %& ) # $ '$ $ . " # % %3 $ 2 # ) " 2" # 2 ' $2 '" %* # ' $ 'Yo estaría aquí bastante durante el ordeñe para asegurar que no hay ningún otro animal en la manada además de vacas. ' ) " $ " # %9 2" # $ $ ' 2 " # % # V ! ! )" '$ $ ! $ # ' " # # # " # 2 ' / /# " # " . Es lo que hace kosher a la leche. $ % 2" ! ! ! # = ) )" %1 # ' $ %1 ' 5$ V ! 0 2 %F $ % # 2 # " # . $$ A > A % ) U $) 2 A $ b # # A %H # % $ : )" # $ ' $2 ' ' # ! " ' # $ A % 7? A % $ ." A % 1 # " " # ! / # A $ $.

2 # ' % $ (# 2 %K # # %A ' ' " ' # ' A ) % $ )" # " ( # # 2 $ A # . 'Así que. GD! A $ $ %%%A % 5 . ) # 2 2 . y si luego ponen una hogaza de pan allí dentro enseguida el pan tendría una calidad de leche. Si aquel danés resultara estar al final de la lámina y el queso se extiende y sobrepasa el borde de la bandeja se caería en el suelo del horno." " 2 %3 %F $ : / # $ # # " # G% 2 $ 2 2 (# " # $ ' # 2 % # # " " ' 2! $ )" ! # % $ # 2 # # (# ' $ $/ ! %& )" ' $ #2 " # ) 2 $ 2 % B # # # ' # % $ # " # ' $2 ' ! " 2 " # # % 9 " ) 2 ( # $ # # # # ' # % & ! # " # " ' # " # # $ 2 # $ 2 ' # ' % $ : )" # $ ' # A F! GA % FH # ! # G% 2 / # $ %* ) '$ # $ # " I 4 'Ahora ellos hacen un pequeño danés y ellos ponen una porción de queso en el medio." # # " % ) 2 ) # 9 ) ) 2 # " # # " ) 2 ' # " " # '$ . # '$ # $ ! " " ! % $ ' ! (# '# ! ) 2 " # '2$ $$ " ' ' # ) 2% 0 % " ' ' A ) # ) 2 " $ %%%A % 0 # F# " 2 ' G% 9 # # " $ ! $$ 2 # ! P# ' # # P" # % 9 '# 2% $ ! B C# 2 '$ ' D (# " ! $ # A # $ ! A# %I ' $2 $ ' ' ' # ) 2 ' ' # ) 2 ! # $ ! # $ '% / A # A ! =A 9 " " " %%% A %F $ )" / ) 2 $ ' # 2 CF" ' . # A % FI ) G% * $ ' $2 ' # $ # )" ! ) 2 2G ' " ! % # 2 ) 2 . F# " 2 # " ! # " # $ % B # 2 $ 2 % $ $ # # # # %.' # $ " ) 2 " # % ! " ' ' ! ' $2 . $$ # $ " 7@ $ ! 9 ) ( # % # " L $ " ' $2 ' ' $ % # %5 . ) " # 2 # # C$ )" # # 4A * " . % $ : ) " ' # 2 ' # # ) 2 ! 2 ' # ) # ) 2% A ' # # # A ) %. A veces el queso desbordará los bordes. me he tomado muchas molestias para convencer a los panaderos de hornear su Danés de Queso en bandejas que tienen bordes en los cuatro lados de modo que no tendrán esta posibilidad de "¿y si el queso se desborda?". ) 2 A .# B A % F1 G% + $ # 9 *!L 2 ) 2 2 9 ) 2 # % ' $ D ! ! . y le daría una calidad de leche.F ' G% .

J # O' ! " " " %A " A ! A * !A # 9 )A ' 2 -% $ " $ # # . la luz ha sido encendida para usted. . las luces están apagadas aquí. yo tendría que dejar el cuarto porque me estoy beneficiando de algo hecho para mí en el Sabbat. # ! ' ' $ ' # ! ' ' . V! ' $ %1 " # $ . Y cuando usted deja el cuarto. el único problema es que el cuarto está un poco oscuro.% 9 # ) ) # # " I ' 4A " $) # # " ! ' 2% ' 2 # # ' $ !! %A ) % ' $2 # $ # # '$ ) 2# ) 2# ! # %> ! $ " " " # 9 # " # ' $ % ) A $ A! % J # # % ) 2 " 9 )# '2$ # ) 2 # # % # # 2 1 ! )" ' $2 ' E. $$ % FI G% I " " $ ( ' .% & ) 9 )4 A 9 # ! A %9 " # $ $ 2# $ # ' 2 # " A # ' A %I 2 !" %F $ " & " 2G% F9 " A &A /# G% 9 ) # $ ' $ L )" $ # .J . "Ah. .. # '$ . % $ B ) " . $$ . . pero si un fuego arde.. $$ ' . "John. " ! # # # # # # %. $$ 64E %%% E ! 7 E? E? $ 2 $ %A # " 2 " $ " ' %F 2 # G% M1 N% # .' .' $$ % ) ! . 'Pero si digo. encenderé la luz".! $% A 3 ." .# " $ C $ . puedo dejarlo seguir ardiendo. " A # A %1 ) ' " " % ) # ! 2 # # # # " ' ) # 5$ " 9 )% " A % ] " A '! A . % $ V! # %H ' $2 ' % & ) " '! A ' . $$ 2 # # C " '! " A A" D% 5 ' L )" 2" ' # # " # . no me gusta verlo sentado en la oscuridad". bebamos un trago. Si usted viniera a mi casa un sábado y me viera sentado en la oscuridad y pensara. hazme un favor no la apagues"." y usted dice "Ah." .! ' %%% # . y usted se sienta. $$ # / 2 ! ! $ " " # $A ) . " =# # " )! %. $$ $ %%% . eso está bien. $$ A # %A E48E . ! $ ! % " # " ) \ # %* 2 # 2'$ ] # # 2 A ! ! % 2 " - # 2 2% A . enciende la luz y se va. "John. % L % A . digo. $$ .\ ] .! ) A ) ) ' $2 $ $ " . $$ # %%% \ 2" ]%%% # ' # " " $ $ A %1 # 2 5$ V! $ # 4 'Usted no debería encender un fuego. # " 4 A# ! # 5$ A %3 ?.% % A * \ # 2 . D# )" # # # # # # ' # %A ! $ %9 . bien.

. Tenemos miedo del daño espiritual que puede venir sobre nosotros." / $ # % )" $ # # C 2 " 2 $ D# " 2 ') ' $ %9 / 2 ' 2 ) 2% A A ) %F G% 9 2 $ # ' ' " ') ') " / # $ !S ! % # ! %* )" " ! $ # % 2 " A ' ! . . # " # '2$ =A ! " ! ' # ' ' " # ' # ! " # ' % D # " %A 2 # ' ' ' '... %3 ) 2 # C# ( ( $ .P P ( $ ) 2 ( 2 # 9 . . . # " # % $ # # % ) ' # # $ 2 " " # # " # ! # $ A A $ % / " # 2 = D # 2" % ) 2 " ' $ $ $ ' % " .%* 0 % G% F " . si arreglamos los errores que cometimos en este mundo entonces no tenemos que tratar con eso en el mundo por venir.A ) %1 $ # ! $ (# % # 2 # $ A %F " I ' A: $ #2 = A FH GA 4 'Aplicamos esta clase de pensamiento a todo lo que hacemos . ' # ) ' %1 # % C ' # # %. # ' " ' % ! 2 !A A 9 ) ! $ .% ) " # # %1 2 # A # # % # F # $ : # I " # *!L 2! " ' $ $ ! # " # G% * A " ! # " # $ " 2 ' ! " % 9 $ ? # " ! %0 $ G% * 2 2 . # # # 2 ) ! ' % # " ' $2 ) ! " # ' # % # # O 9 .' F1 # 0 .. # # %3 ) 2 ( )" 2 " $ !# # # " 2 ') .y si esto puede pasar. # D! # L L '$ 2 $ % # ) 5$ $ $ A # $ $ 2 " ' $2 % 2 9 = C . y si eso puede pasar porque tenemos miedo. Sin embargo. de los errores que cometimos recibimos el castigo por ellos. # J $ ! # # " %1 # $ % % # ' $2 $ 9 # %%% # # ' # ! 5$ %1 $ : )4 'Tenemos que entender que en el mundo por venir vamos a tener que tratar con esta tarjeta de resultados que hemos desarrollado a través de nuestra vida y. # # " # ! 2 3 # A# A.' (Mi énfasis) & )" ' ' # 2 2 ' ' ' " ' A % 3 4A . ' '% : / # $ $ # L (# L ' 5$ ! ' %9 B " " $ ' $ C # D% 3 '" ' $ $) # # $ L )! A % .

C 9 $ $ D" " ) # # 1 2 = ' # / # # $ $ %9 # ' " 5 ( = ' $ A # 2 . # 2 $ !# 0 2 %9 J# 0 ' ' / V ' % F0 # ' 2 . $ # % 9 !# 3 ! $ ! # " " ) # ! # " 2 " # # " $ $ # # ! A B ! %3 " %* # $ $% " ( . )% # # * (# 2 ' ( F $ ! $ 2 $ G% B ' ) 2 G% F3 ! $ .) $ ' ' %+ ' 9 L / J# ) 2 $ ' 0 K / J# $ B J! # > ! V ' CV ' 9 DG% % 9 /4 A %9 # 0 " . %> " ! J# / %. " # ' " $ " " # 2 %0 2 # " # $ # " " # $ ! ' # # ) ( 2# 2 ? $2$ # % 9 $ # # B$ % ." ' # # " '. $ $ % $) $ B 0 ! 9! ' % C2 $ L /D # $ ! A % * " '.A % . B 2 # 1 %1 # % . C %9 2 ! # $ " %* " . $ $ $ . # # $ % ! 5 ' # A " # " 3 # %1 2 " # ! $2 $ ) $ $ A $ ( # # / A % ) ) # " # " B $ $ 4 # ! 0 0 . $ 2 ' * B A % 3 # .A %* ' ' $ % '! ! O $ 3 ! # " ' ' " %.) " ! . % 2 $ " .# # # # " " ( L' ' . # 2 # # #2 # 2 . B '$ D! # 2 $ $ " ' ' ' # # .# 2 ' # ( !# # % # " # # . %. !A # O ! % 2 ( %& ' ' %I . 0 " # . ' ' " $ ' / " $ $ # " $ " # % # # A A ! ' # A % # %* # ' # ! / ! .

# $ ! 2 # # " ' $ $ ! # " # %* # " %1 . Y la presentación es tal que evita toda la terminología "religiosa"'. $ " ! L / " ) # % $! # # $ $ $ " !# . # $ % 2 9 $ # " # # # " 2 " $) ( # # ' ) % * 0 . $ 2 # $ # %: " # # 2 # . 5) # # 2 ' . Nunca antes las técnicas para "liberarse" .las técnicas de hechicería. # # A % % & ' $2 (# " ! A A % '# '! # % " " " ) %1 4A %%% P # # P ( " " " ! " # # ' ' 2A % (# 2 # '$ B$ ! . # G% 3 2 # ' $2 2 " # $ %A +! 2 # ) %AH ) ! ! # # $! .' $2 " 9# " $ % " . Estamos en un umbral en la historia. # . " L / $ '$ ( !" $ ' $ % # " # (# % # $ ! .A A $ D% * . # '! # $ ) # / " 2 % FI " " L / # ) ! # $ %* " $ %* % $ % % # " * # $ . Toda la humanidad no salvada realmente busca ser libre de lo que ellos ven como su "tiranía". A A ! # # # ' ' '! C: ! * ' # - # # ! % ?E # !L A <6D% * # ' A ) 0 ." " A # $ A ) " ' $2 %3 )" A #2 A $ '$ $) " " $ ! $ B$ " ' C . ." # $ ' # $ # C D 2 %* # # 2 " # # # # $ %* ' ! " A A " # 2 " '% * # # # " @@%@ # C D % * B$ * # # # % " ! L / # ! # . han estado tan cerca de ser presentadas al gran público. -% ! # . % F9 G% F3 " " " ' $ G% # 2 ! $ # # # ' 2C D %A # $ $ " ' $ 2 # # # ! ( # $ ! %A& ) " B$ $ " " " # " # " ' '% 9 ! ' $2 " # 5$ : $ # " % ) # 4 9 A 2# ! " # % *2 2 'Cada uno REALMENTE sabe que Dios existe y que Él está al mando. %* 2 ' ' 2 # !# # . 2 2 = # " % $ '. .

2 A 0 A 0 > A! A 5 ' A $ A# A A= . * A ') 2 AL / ! > $ ?6 2$ # . 2 2 A % ') # C .+ ! : S ) 9# 0 2 A 0 L / A! ' 2 . " $ . .D C" 9 % # << FF 1 A 5 C: $ # ) . y el Papa con la mitra en la cabeza de la Iglesia Católica. GG% A " # )" 1 A! <7 <? ! <@D% . ¿¿Piensa usted por casualidad que ellos podrían estar relacionados??. $ > ) ! #2 . B $ + $$ ' . $ B % <8 ! $ .A! 1 A ! Figuras 65 y 66: El dios pez Oannes (Nimrod) como era simbolizado en Babilonia. # . (por Neil Hague) ! ' ' $ $ # B $ ! 5 # " 5 $ " % " 1 '. # B $ $ % $) 3 " A A B $ A $$ 2 ! . A .Figura 64: Las religiones humanas adoran al mismo 'Dios' de la Matriz a través de versiones diferentes del programa. ' D ! A 5 2 C # D $$ ' % 2$ ! " 9. son todos aspectos del mismo Programa de Dios de la Matriz.% A 5 .

También note como la Semíramis babilónica sostiene la cruz 'cristiana' miles de años antes del cristianismo. 71. Son la misma deidad. N% $ " ( % L / # ! ' # # 2 # # $ ' $ ( " # 2 # 2 * )" ) " ' ' # % # # # # # $ # C 9 0 D% 2 . que es la Britannia británica. 7 ! 7 D% * C: 7ED% 1 ?8 2 . B 2$ # 5 .$ % * ' $ $ # ! >) ' 0 . A D% * ' $ A L / A! S S$ $ # ' 0 ! $ A 8 5 ! ' ' $ . !* # # C0 ' D! B $ C # # $ . B $ 5 . A ') . la Isis egipcia y Horus. H # # ) $ . L / ' # 2 . 72 y 73: La reina Semíramis como es representada en una moneda antigua y las Estatuas de la Libertad en Nueva York y París. 2 . '$ ! 0 K$ * 9 !' 1 ' " %9 $ * = D )" *" C *# " # # A 2 A# " '! !# ) 2% # 2 9 9 # L / $ 2 " $ '$ %* # 2 # # ) 2 L /! 9 # " $ '$ % " 2 4M '$ / L /= $ ! . y la Reina babilónica Semíramis y Tammuz. " 2% Figuras 70. 2 9 2 C: 7. .% * A % ( ' ! . Es el mismo mito bajo disfraces (apenas) diferentes. 2 . 68 y 69: Tres de una clase: la Madre cristiana María y Jesús. 2 # " # SB ! ' *$ : = $ # 52 .= # " # " % $ = Figuras 67.

' ' %. . ' . A # L /A # N% ) 2 ) 1 $2$ 5! B $ ! $$ # 2 ' 0 # ! # # B $ %: ! '! $ $ %& L %* $ # ' $ .D! $ $ ') .$ ) 2 " 8 2 " ' $2 A A ' $2 % A ' $ A . .) # # . . . A 1 A D 2 ! %. )" . # $ # " " % $$ 2 " ) 2 ( ) # # -% 1 = / # # . = % ' " $ .$ # )!# . . ! ! # %* * ! ' $ ' $ % $ ) # ) !. ) 2!# A ' $2 I ' " 2 " %.%& # % ' $2 ' C D A A $ $ ' K '% 1 2 $$ A ) 2 A %* * ' ! $$ ! %* # ' ' ' ' # ) " 2% 3 # $$ / # ) 2 ! L 2 ! 1 % $ . 2 " # $ % $ 9 $ 7. ..% * AA 2$ : 2 # $ B $ ! . 2 # # $ . = %L / $ 2$ ! ' $ ! " L / " A A= '.) " ' $2 A # A B ! $ 2 A A 9 % * 9 # ' C.! B $ %* K S$ $ 2 # " # !' ) 2 # % ! ) ! A A ! B$ ' ' 2$ $ 8?7 ' $2 $ $ . ! ) 9 % $ 2 A # A # = # . 8 $ % 2 . 0 # 0 . 2 ." # " A $ ) ! ! # A % ! $$ " # $ - # ! 2 ) ! ) 2 $$ $ A 0 B $ ! # $ % ' # $ $ . 2 %* ' A 9 AC ' D! A $ B $ %* . 2 )" ' '. ! # # $ * ! C !D= - ! A ! ) ! # % # -2 # ! AA # # B $ " $2 ! $$ ! # )%3 5 !0 # $$ # 52 # A ) # V '% * ' " '. # ! 0= = ." A / ') .% * = = ' # # % M* " # $ . ! * A= !. A! 2 C ) # # $ " % #2 B$ 2 # ! " ?< ) . ! " # 2 # $) # $ % 9 2 %* $ %& # ' 2 # $ ' " 2 " # 2 ' 1 . 2 " * # * ! # # 9 # # .

la señal distintiva del clero babilónico era la cabeza afeitada. " E4 8 $.$ # # $$ ! L 2 ! # ( L / ! A # ) 2 $ ' " $ ' %* " $ ' S$ ' # ) " # 0 ' %. " $ ' V $ * 0 %* ! # ' $ $ ' 1 ! '! ' # 0 % * $ " $ ' . # # 1 # ! ! %3 # " A %%% ! # 2 ) 1 B$ $ . La diferencia básica en las dos sectas es la de la fe chiíta del sistema de "Imamah". ) 2D > # $ # $ * B $ 'Por todo el mundo." 664 ? # A % # '2 %* # # . donde se encuentran los rastros del sistema Caldeo. siempre eran distinguidos por el afeitado de sus cabezas.# " > $ 9 $ '! . En la Roma Pagana. es directamente designado por Dios. La designación del primer "imán" fue hecha ?7 . y hasta en China.!" 78 .# ' % . $ 9# 1 # B $ % = 1' $ J J! ' %. siempre es encontrada junto con ellos. ! ' # # # # " 2 # ! # " ) . ! # J 2" ( " " B - B $ ! 1'2 0 ' % " 2 ' # 1 # # 9 # ! 1 %* # ) 2 % $ (# % 9 4 'Hay varias diferencias en las opiniones de juristas Shi'ah (chiítas) y Sunitas. en cualquier momento dado. # " $ 4 " !' " ( $ 9 2 A A %* ) 2 # $ J " ! L / J! " " " A A $% 9 = O 0 ." 1 ! A % . y luego se puso a trabajar para conseguir que otros imiten su ejemplo. ' $ A $ $ " L 2 ! $ " # 0 0 # . primero afeitó su propia cabeza. 9# $ $." ! ! 9 2% * " " 2! ! # 0 . Los sacerdotes de Osiris. % . no todas estas diferencias pueden ser llamadas como las " diferencias básicas" en estas dos sectas principales del Islam.% 2 " $ ' . La fe chiíta de "Imamah" implica que después del Profeta (pbuh). Así Gautama Buda. . como él fingió. el Baco egipcio. en obediencia. el único líder verdadero de los musulmanes. al establecer la secta del budismo en India que se extiende hasta las regiones más remotas del Este. Sin embargo. 9 ! ! % # # # # $. a una orden Divina.) ' /# 2% . en India. que vivió al menos 540 años antes de Cristo. # # ! B $ % * ) " # # # $ # ( $ " # % * " # ' # L 2 0 . como los profetas de Dios.' $ . 2 ! % $ Q ! C # # '# B $ ! 1 % ( # @@?D4 B $ C9 $ ! %* " %L 2 2 ) $ $ # 1 ! # %* # " $. . es "un Imán" que. pero. no debe haber ningún otro profeta. esta tonsura o afeitado de la cabeza.

$ # %3 # $) %A $ 9 0 F# .' $ " ) . Otro requisito del "imán. inocente) y. no adhiere a ninguna de tales creencias. # - ! 9 # 2" # # C' # " H " $ %& # % .% $) # 0 9 " 2 U U' # ) ! 2 %& " $ ! 2 " $ ( ) # # # % 0 . como los profetas de Dios. La creencia chiíta sostiene que los "Imanes". son así no sólo los líderes políticos de los musulmanes sino también sus líderes religiosos y clero." que lo precede. por lo tanto.por Dios a través del último Profeta (pbuh). # ! %I $ 2 # G% %. ' # ! ' # % . B '! B $ & ! ! 2C " ! G% ! ' ! $ T $ $ ! )% & $ ! " A # # A# ! $ % #C '! ! $ C " ! B $ : 5 A ! $ ! $ # # . por otra parte. son "ma'soom" (libre de pecado. ' '. ! # ) 2 1 2 B $ D 9 " %* # 0 " $ # ! . $ % ! $) $ # ' $ % FI A JA ! 2# ! A 1 $ $ . 1 " # # " 0 # # . '3 FB # 2" ' ' . mientras cada "imán" subsiguiente es designado a través del "imán." según la fe chiíta. # ! ! # # # 0 A! # $ ' ! $ " ) " " ! 2# " " ! ' 2 ' # $ = " # $) A # $ A # O # )D% F1 G% F* # " * ! ! F $ !B 9 0 A" 2 C ' 2 ' $ # G% F ! $ )D" # $ $ " > ! ) !' D G% * # . Los "Imanes." según la creencia chiíta es que él debe pertenecer a la familia del último Profeta (pbuh). $ " # " ' ' '. $ " G% # / G% % FI A " ! A $) " ' # $ A % " . H ' J# $ $ ! ! A # / $ $ ' / 2 ! %* # # )% A# " !' ' )G% + . %.A JA $ ' $ ! " " G% H !# A $ ! & " $ '!# ) G% F $ % . DF ! " 2 ' $ $ # # % ) ! 2 $ 2% % $ ! ! $ # J# ) 2 & & 2 $ '2# =# $ $) 4 ' % # # # # # # % . ?? = ( $2 " $ $ ' " %. deberían ser obedecidos en todos los asuntos y en todas las circunstancias. La escuela Sunita.!" D C # %9 J# & J! # (# % 9 ! % .

php?id=26320 3 http://www.% * $ # " / # $ .% % " 2 # % $) O % ) # A ! ' / # " # # ! # # . A % . $ -% B . . # % 0 0 1 1 " 0 . ! # 0 " '$ %+ ?@ % % # 0 % # # ) # " ' # A A % " $ ' % # A # # # ! % A ) ! " # " " $ # 2 ! # " # $ $) %* A A * . % $2 ! $ # 0 # 2 # # # .ecademy.# $ 2 % 9 ! A . # O S " ' # %.html http://www. # " A # " (# # .com/related/text.La Misma Historia Discrepar con tres cuartos del público británico es uno de los primeros requisitos de la cordura. % " #2 ! (# # ! %3 2 " " # ! %9 " ' ' " # A A %* 0 . Nueva Era . (Oscar Wilde) . # " 5# '$ 2 # A! " 0 .aspx?type=question&qid=417 1 2 CAPÍTULO SIETE Vieja Era.: http://www./# .understanding-islam.% % " / # A2 A ' 9 2 A " 2 2 A $ $ # 0 . %9 " # " $ # # " A # $ ! #2 # 2 $ A# " '! ! 2 $ .# 0 .# " ' A # * 0 . .com/node. A # 2 % ! $ " $ # ' ' A ( % 9 $ O # # ( 3 ! $ ! '! ' $ ' A2 ! 2 ' (# 0 " $ $ . A $ ! ! ( " # / ! ( ) # # ' % " %> $ $ ' # % " # ! .faqs. $ 2 $) .org/faqs/judaism/FAQ/05-Worship/section-42.! ! ' . # ! ' 2 $/ " # 0 %.

# # F G% * O " # A! A ' $2 (# GA# # " 1 # " $ A % * " 0 . Hombres han vaciado cargadores enteros sobre ellos y no han acertado a nada salvo al aire. CA 3 A D " % '! # # 2 # " ' # " G% . ! (# " " ( N% * # $. " . # % 2$ ! " 2 ! 0 ' " %> ) % A # 0 9 $ %9 " # $ # # A A % ' $ $ S % 2 # ! ! % # # . $) ' ! $ % * " # # 0 # = # $ ! : # ! %* ' % .% 9 (# # $ " # * 2 ) 2 .' 'No. ) # $ % 1 " % . A ' B (# % )" @.% 0 (4 'He visto a un agente [programa de software] atravesar una pared de concreto. $ $% $ ! ' $2 % # $ % # 0 # (# # . # $ % M # $ " %* '$ '$ $ # # ! A! A $ % #2 # # # G% ! # ! ! " ! % / O 2 # % F9 " ! 2 J 2 K B ! # % " " # % 2 ! !/ 0 .' '¿Qué tratas de decirme. ' # " A A" " # 3 # " / " 2 # (# " " " .% * 3 %* .# . '! ) # . Y todavía su fuerza y su velocidad aún se basan en un mundo que está hecho de reglas.' * 0 . Trato de decirte que cuando estés listo. Neo. Por eso. $ " '! 2 J % ' ' 0 . % . % $ # J 2 # # " # $ # $ ! " # ! # % 9 # $ # B # " % ! ( # ! # # ' ! # ! " # ! %* ! # " ! ! A 3 A ) A *! A * " $ O %5 2 " '! %* . % .% ' $2 ! 2 # A! A %A F9 " % # " . nunca serán tan fuertes o tan rápidos como tú puedes ser.% * A !A " # 2 2 % P ! P# O " # # # # ! % 2 ! # % 2 2 % 9 ! $ 2 # A A 0 " F ! # # # 0 . 3 " 2! 0 " B )4 A . no tendrás que hacerlo. que puedo esquivar balas?.

$ = . ! .! " . # ' " # 2 %A F M / # $ # 2 ( $ ! # ! $ % # " # % . )" $ # A2 A= # % ! 2 J D $ % ' %& " " $ D% $ % ' $2 2 ' # " # 2 ! " # " # 2" ! ! # # 2 # ! # B $ A$ .$ . $ ! 9 $ # G% " " # 3 # " A F* # 2 A (# ! %9 $ 2 2 *$ D% 0 # # # A % # # A# ! $ (# * > # " $ ..% S # / # %* . $ B ' $ 0 ! # " 2 ' %1 # # " # ! $ %.% %* " ! " # % . ! A # A A " A A .N% * A % # # A # " # . ' 2 . %1 $ # 1 0 .! " P A F9 $ $ $ # * 1 # ' 2 ' P . A # $ (# A $ ' " /! A # # ! # # / # $ $ % 2 . 2 A % . O # # " ! ' " $ % # $ 0 # 1' J " # (# # ! # " ' % F9 " 0 =A2 " H % ! $ " # ! 2 " " " % " " (# # - # A O A' $ # 0 . ' # ' - # 2" # # %* # $ . # ' 2 $ .# % 1 $ A2 # $ " %9 ! % # . # # % @ ! " # ! 2 % " $ # " / # . # %* B # C $ B # $ # # $ ' .# " ! # # # ) ! 2 * 0 (# 3 %9 " ! # B # %A F9 % ! ' " '! # O # 2 " A" / " # ( . A A J %.' $ B 0 ." A C ! A # # " # A # ! " # GA# G%A0 B A O .% A F9 2 # $ ) # 2 ! )4 A +' # 2" ( # # # # H % " " " . GA ) # # $ A) 2 ' GA ) G%A+ " " B $ ( C " " 0 .

Cree que progresa 'subiendo las dimensiones'. )% $ A 0 . 3 # ! " # $) # " A F9 " (# $ 2 (# 0 . B %A F9 '! " $ G%A .% " I ! A$ " A A % ) $ ' ' ' (# ' ' ' (# " " % A . )A # . pero la Matriz está diseñada para asegurarse que no se escape. " # # ! $ 1 % ..# # ! $ ( A ) . ' %0 A# " % " # # # # 2 " # 4 " A " A! A 0 . # " ' (# % # # A %. ! @ $ A # .% 0 % 2# " ). 5$ : # " % " " # 2" * % ! ." ' ' # 2" $ 1 " # ). 2 A ' % ' (# / 2 " . # . # # " " A# " 0 . # " L / " 2% > " ' # A # # 9 " L / # A %* " # " .# 2 G%A* A # A! $ = " 4 . A '$ 1 A " # A . # 2 2% * A A ) # # AA $ 'A A % % 9 % Figura 74: La Matriz de la Nueva Era: la conciencia atrapada en la ilusión de evolucionar a través de la experiencia reencarnada juega a una especie de juego de escaleras y serpientes.

$ . .D . Sananda. A' A # " # 2 " # $ A A A 2# A ' !% . " ! # $ 1 ) ' ! A A C: 76D% * 0 # % $ '. @E L . " K * > S* > B A 0 A" ' A A 1 $ ) " A " 2 ! ! !' $ 5 # A # $ " 2 # " # $ $ $ 2' ! " $) # ' . $ $ B ' A" %* # > > # A 1 ) B 2 '$ A# S $ ' A# A % # $ '$ . Incluso aunque esta imagen clásica de Jesús se derive sólo de artistas occidentales. 0 ' $ (# # %%% # %%% A L /1 K 0 0 % ' ' L / # # %9 . A# " # 2# * * # A % # !' # ) $.) ! # A % $ *! 1 # $ > ]A % " 2 % . ' %1 $. " ' \ 0 " 2 $ ( ! $ % $ $ " K # # # " 2% > ! A / ! + # A # ! # K (# ) # ' 2 A % . % 1 # A " # ! 2 A K ! A $. 0 " $ $ # / # . K # 2 G% F # " # G% 9 ! ' # % . A # " L / C: 78 ! 7<D! / $ % M '! B$ " 2L / $ # " 2 # N% 9 / 2 ! A L /A %* K > B $ ! A 0 $ A L " 2 # 0 $ 1 # " $ 2 ' A % FI G% F1 2 ' G% F1 # G% FI ' G% # % K # K %9 " ' # 2# ' % ' $2 # % # # # A' A! # $ .0 .# " ) " 2 '! 3 G% # % C B * . '! 3 % F1 # Figuras 75 y 76: La representación cristiana de Jesús y su alias de la Nueva Era. $ ) " 2 0 . .% FH # " # . A! A > $ A *!1 " # ' ! # G% F # 0 . % . tanto el cristianismo como la Nueva Era se las arreglan para retratarlo del mismo modo.. A 0 K > B A % A . " K > B $) B ! A + " 2 # A .

yo. 0 # D% K ! G% " # % O # ! %> " " ! $ > ! A ' # . # # % M* 1 # $) # $ ) ! # N%AC )" ' . $ )$ 2 ! # $ 2 !# 2 # N% # " ! " $ % M* $ # $ # " A '$ / " " ! %D* 1 $ ! %A MMM $ ! $) #2 ! # # ) 24 Figuras 77 y 78: Dos de muchas representaciones de la Nueva Era de 'Ashtar'. . $ A # D $ 2 ) . Starene. A % B $ $ # " 9 B ' + # C 2 % F9 " # 2 " 2" 0 5 S( # # ! 1 ' A " 0 " ' 1 # ! . ¡Estamos tan contentos de que escuchen y se conecten con nosotros!.< # ... *. =# ! + ( ( S+ ' A AA ' A! A # " -A $ # 2 # " 0 . # % c% " % # A A A# A" 2 # = %+ 7%.# # (# % # # 2 " ) 2 # 1 ' ' ' 77 ! 7?D% * " # $ A # # + 9 1 A AC: # " A # '! " # 2 # 2 A ' # ! . Estén en @6 . A % B $ =# ! A A ) ' # ) " '! " O " $ " E.' A # $ # ! # # " . ¡Queridos Amados. ' A # 9 NA % +! ) %M ' 2 # ! $) 5! " N%A ' % C$ = # # 5! % A )A # 2$ $ = " ' .NNN%A . les envío vibraciones de AMOR de la Más Dorada Rosa a todos y cada uno de USTEDES!.. L / A A # A %3 U $# # $ ' A %M# " $ # A # # ' = " ' # %9 $/ " " ! ' A= A .# 2 ( # ! 2% ) 2% > ' # 7 : 0 2 ' ' " A! ) A 1 .

y a menudo una entidad cósmica. Kadoish.000 trabajadores de luz llamados Águilas conectados con el Comando y ese es el mínimo de almas requeridas para el proceso de ascensión. %3 '$ $ A . 2 $ ' %%% ' % 9 " " 2% # C$ D% 3 # 2" L / # / ! # # % 1 ' # A A ( ! . . " $ 0 $) # A %9 G% * 0 . y que ellos son Cristo (fundamental para cualquier discusión de la Cristología de la Nueva Era es el reconocimiento que los seguidores de la Nueva Era distinguen entre Jesús. 9 ! # " # " 1 ' # '! . pero siempre divina. Adonai. # " . Kadoish. Starene. ¡¡¡¡¡¡LOS AMAMOS!!!!!!. Ellos saben que son uno con todos.0 ' ! $ %3 U $ ' $ 0 0 2 9 % ' ! # # 1 )3 1 9 # % ! % 4 'Hay 144. # # A ) > # $ # . $ % " # 0 " ) $ ! ! . ¡ShaLaeLa!. '3 3 .A! A ( $ '! 66%. % .! P P $) # $ ' A $) A # .% * # $) $ 2" L / C A( ! A# # % 3 $% ' $2 . " " # ! " 2 $) ! A A # 2 $ ! ' # $ %H % %1 A# B # A # ! # " ! ) " 2% # ) - b " . 7ma Flota Comando Ashtar =0 2 $ ) .!# $2 D! .. impersonal)..paz interior como exterior.% * . un mero recipiente humano. ¡Amor & Luz!. D! F # 3 $ # ' C # # # GA D ) # = # %. Ellos sirven como comadronas cósmicas en el proceso de ascensión. C 0 5 D 0 " L / 1 A % 3 # $ . ¡¡Kadoish. ¡Adonai!. y la conciencia de Cristo diversamente definida. %1 " # ! . El trabajo de luz incorpora el mensaje de Jesús de Amor y Luz en nuestras vidas diarias. ! $ ' $2 $ !C 3 * " )" K %* . ! 3 % '! " % %* A % F. Firmado Cte.. K % A F1 # . el parto de la humanidad desde lo denso y físico hacia cuerpos físicos-etéricos de Luz.!!!.. Estas Águilas son un grupo de almas que no se identifican con un planeta especial. # " " % " # # B $ 5 A *$ A. Tsebayoth!!!!.% " ' / G% > $ " ! ' " " ! # %* # # " ' " ' % # # 9 @8 2 % ... ! % 0 . ¡¡¡Estén en AMOR. a la larga conectándose con nuestro más Alto Ser.. capaces de ascender con la tierra a la quinta dimensión. " ' $2 ' $2 ' $ $) # 66%..

ascension-research. (Oscar Wilde) .! (# # # !! ) 2 ' ! 2# %* # .galactic. (# % %.++++ A ) 0 # # # / % $ " 2 .to/ 1 CAPÍTULO OCHO Otra Mirada a la 'Sociedad' La educación es una cosa maravillosa. " A A " " ) # # 2 ' * # % . " 2 # # # " ' 2# # # .htm 3 http://ashtar.# $ " # # " 0 . # ) # = $ (# %%%GA. a condición de que usted siempre recuerde que nada digno de saberse puede ser nunca enseñado.# # % * ' ' % A " % 1 ! A A % * 0 " 2 2% / " 2" 0 D # 3 % S5 D0 # " # # %* 0 .theosociety. 2 ' % . .' @< % F9 " # C ! % # # # ! 2 2 " / # $ '# . " > ! ' L 2 " 3 ! # # " # . . A# " )" L / ( %B # !! " L / !. $ " $ # " % ' ' " '$ / A .! # # % . - # # # 2" # 9 %A F9 " '2 # . $4 % $ 2 ! !' A % A " = ' ' " ' " # # " # A # O 2 " ! ) " # D! " 0 ! # # A % G% * # ! 2 # . # (# # " ! .org/pasadena/gdpmanu/mahat_ch/m_c-5. $ / # $ % *$ % $ " %.html 2 http://www. " ' " ! $ # # ) % # # ! 0 " % ' ' ! # # " # ' " # # % 9 % # # # : http://www.org/gwb.) ! ' ' (# 9 H ' ! # ' # 2 # 2 # $ % # # 0 % # " % * ) % .# / # !! # # # " # " # .

# $ 9 " ! ! " ! # # # .A # A# .= $ $2 % ' 9 # 5) $ ) " @7 # # # % .# # % ED . ( = 9 A - B A A A %* # " . ' . # # 0 # # # ! #2 . # .$ ! 9 ! ) ' 7D9 # # / ! # .!3 D! %%% O > A )A # # # % O !# ! ! ! 2 " 0 92 . trabajan juntos para imponer el estado centralizado global. % O $ ! ! 2 $ % C % ' O D %1 # 9 9 0 0 # 5) # A . C " $ % 2 %* <D ' D% $ " 2 '. " # # ! ' ! 9 3 2% 1 C # D! " 6D1 C = $ 9 $ # # # # . # # # # # 8D1 ! X $ # " % " $ 2 # / " # # = # ' !% 9 A . A" # . que a menudo parecen estar F GD en 'lados' opuestos. 0 $ # " # " % # # $ 1 # ' ! ' % " ! # " / # # ! # # # # C # " # 9 A= # A 3 % # # D " ! $ ! # $ -% O ) # " $ " # ! % " ! A# ( # " # # $ ' C: $ # 7@D% % > ! Figura 79: Tras bambalinas los > ) ) 0 2' operarios y las marionetas de los Iluminati.$ % 0 =* K &( % # : 3 0 9 # $- $$ ! # . Unos hacen esto a sabiendas mientras algunos tienen sus acciones manipuladas sin entender las implicaciones completas de lo que hacen. ' # # # " 2 ' " = 0 .$ ! $ # > .

" # . $ $ $ .# " # # % %. # %A* ! 2 " ' ' .# " $ # # $ %> 2 # " # " % # ! ( .# # ! ' %* 0 .$ # # # ! 2 ' ! 2 9 0 0 .% 2 " # 2 # " # 2% 2# 0 . ' ' # '# % # A A $) # # 4 # 0 $ ' ! % 3 ' # ! ! ' " " )4 A * ! 2 # 2 # " # # C# % D! ' 2 # # .! %1 + # # 0 * $ A# ' %.! # ' D% 9 ! '! # ! # # # ' # ! % " C ( . * # $ $) # C.# # $ !' ' " A A # " # # % " 2 # # " % ! " !# ' " # " 2" O # 0 % . # '$ % # # " # # @? # # # / ! # ! # % $ # " " . % # # C. - # # 9 % ! 3 # % %% * # ! %A > ( 4A FI - 2 A D" ! ( " # % * $ $ D% ' ! # %* $ # ' A A # 9 A % # " " # # # U # $ " # . $ $ ) '# # # ) A # A # # = 3 2 % 9 0 " . % " ) O' ' # .% # %3 " - " " " A " ! ' ' " # % # # " ' ' G%A3 $ # " ( % * # ) % F> " '! $ " ' " " ) # # ) 2 # $ # $ % E." % - 1 C 2 $ " 9 ! X C # " %3 D" D # # ' % 3 # AC ' $ ' '. A A %* " (# O # # # # ! $ # $ % 9 0 .$ ) # B K %1 " $ $ # 0 .G% " %1 " % '$ # " 0 .D " ! 2.

B $ # %* # ! # %5= $ @@ " # # %4 5 = $ " 0 ( ' # ' # ( ( % # .E ' % & " . A ( ) ' # % 1 ' ! ! # . # %3 # $ $ O ! # ! 2 ( ' " " ! % M3 ' # 2 % ' ." 5 3 ! # " # . " # # !# # # " 2% # % * # # # ! C # ! " ' ( " # %1 2 % $ )A %3 $ % 2 ' ' 1 # $ O # (# . # # # %* A # # ' # # # $ # * ' $ %1 ! ' $ ! # # " " 2 ! 0 $ # ! $ ) " B # 2 % 2% * # $ $ ' $ " $ A " $ ! / %0 ' ' " ! $ " # # A C D " " # # Q # " " ..% H " # # # # ! 2 $ ..#/$ # -2 # ! A/# % (# .% * / $ 0 " # .$ B . A ! # ) 2 " # # $ )A % ' $ $ # # # # # ) # A $ )A %* # $ # D . # # J# S0 # % # $ ! " $ # " " " 2 2 # # # % 0 # F $ # # $ $ G% . / ' # # # N% * . # -2 $ # " ! = $ ' # " " ! # 0 ' 0 ' . # 2 % # # % $ # S5 ! # $ # / 2! # % . " 2 " $$ ! %1 . : 4A %%% # $ ' # ) # ) D% # " # # $ # = ! % 2 .E $ % # -2 $ # # # -2 $ % .'$ # ' / ' % * 3 '! # ! # 3 # A " $ ' 5 ' K B . ) 2 # # ! # # " 5 % ! 9 ! # B 3 3 . ! 2 ' # '$ $ % 2# A # % * ) A A C # ! ! $ . (# %> %+ 4 F# " $ 2 # $ $ )A G% L / 0 .

# " D # " - # # # 2 $ # $ . %3 2 ' # 2 # " ) ' " $ # ' $ ! " ) $$ $ %. ! 4 $. ! 3 ( $ A ) # %I # B . . ! # # - # $ . de leer los instrumentos y por muy poco evitó un aterrizaje trágico./ ! " =0 # # # 2 . un piloto experimentó visión borrosa tan que severa fue incapaz. $ !9 " # 4 'Después de sólo dos tazas de chocolate caliente artificialmente endulzado. % & .# . # %* $ ) " . % * # ' ! ! * " " # $ ! # # % # ! . % ! # " # $ " " # ' $. # # # $ # $) # - ! K L $ ' # # / # ' $ % A ! * 0 # ! ' 0 % . 3 $ ! ! # % 0 2 # : " " .O % # ./ $$ # ! . A # . S # # # D # $ # " %* ..O % 1 2 ' %9 # !9 @@ ' @@.# " # $ " # # # # C # # " ( = $ !! %H ! $) # # $ ! % @. $ $ = . $ # " 2 -%* # $ % " 2 " 2 $$ - $ $ ! # # $ - " $ . en el vuelo. A salvo en tierra. # # 2 " . " " ' # # . . # A .O ' % * : $$ . [Él contó] de experimentar síntomas similares después de ingerir productos con aspartamo. . / ! # / $ %+ # # # ! # $ ! % C # # . # $ 2 # . # ! ' ) # % # # # . .. $$ ! # $ % 3 . A ' A # " " 2 ) # " # # C: D# B ' ! # 5 =B ' %. # " ! . # " .' # C % ' # D# # # ! $ " - $ # !# " ' " $ $ # " $ %.! # ' '! $ % " ! $ $ 2% . ) # 5 9 # ' 0 # -2 # . él mencionó sus síntomas a las secretarias en su oficina.

#' # % D! # 2 # # # 2 F # 2 # ( # $ # # $ P+' .K ! # # ' " ( " ! % '2" . - " " % # # G%P ' 2 " 2 ! !# # # %A 1 # ' ) . # ! # * / # 3 2 @ . ! .! 2 $ % K " ' 0 . # .K $ " 1 ' # # 0 .K " " ' # # 0 . 'O .# $ # % $ '.K% 3 %* $ C7E .K %1 = - # # ! ! %* % 0 : $ A$ S % 0 .' $ %3 ' # # 6. / " /$ .# 2 $ %* # " " # ! $$ % 1 " 2 $ $ # ! % %A $ A # A $ $ " " 2 " 2 1 # ) C 8 # / " '.K (# # $ ' " ) '# $ ! # A A . # ! 0 . ! 0 .K # % 0 .' 9 $ !%%% $ % 0 . ( '# $ A ) # # % * " $ 2 @@8 " ' E " 6" " " ' # $ # " $ # ! $ %9 ' $ " '$ % & # 2 $ " # " $ ! $ %1 2 ' $ )$ 1 C1 D% # 2 " 2 ! @# 1 # # " 2 %3 2 % ! # % ! " % .K " " # ( ( 0 . - . % * % . = # ! # $ ! # " # % $ $ % ( ( ! $ " - # 0 ! . - !# ) # " % * # # $ % * 0 : # .( ( " ( '! ! 2 $ A ) $ % A $ A ' ' D ! ( $ . " ! # $ =# A # !# $ # % ' $ ! # %5 '# $ 0 . <. - $ %1 $ ( % 0 .K # # A 0 .K ! # $ 2 .K A! ( # # " # = $ " $ " # ! $ # .K %+ # ' %* $ %3 #2 % $ " $ . .

2 2 7 ! 4 =0 $ + > H % " 2 # $ # " $ # # ! # -2 %* # " 2 ) . " % " % $ $ % * # # ! 6. ! ? % M ' N% M* # / 0 . ' $2 ' # $ . : * # $ ! 1 ?.. # # $ $ # # # # > # $ $ % # # $ 3 ! ! ! # " . )% 2 $ A ) # >! 2 " )" # ( * K ! 2 )" # ! * $ '. # % 8 . % (# # % $ " ' ' " 4A FI A # 2 # # >! * * ! ) # # # 2 %3 # # " # ..% * # ! ! " # # $ # $ # . )A 2 # . # + 29 3 # 1 # # # 2% * # ' ' " ' $2 !" # ' # B ! : $ (# # ! %A # # ( ' A ) %3 3 $ A $ " $ ' ' A %* $ 1 $ " %& ' $2 # $ # ( 6. # 2 $ # # ! % ! # # A %& $ .. ' % EK # # $ # % " $ - 2 # # # ) $ . % * " # )" 5 )# # ! # 0 # # $$ : ! ' # BB1 2 %3 $ ! * #/$ 1 2 8 $ '. ! ..# ' %3 ! # " A $ $ A# ( 2 " 0 . $ # " 2 # $.6 6. !> ' # ' ' # 2 N% K . B 2 .# .K ! # ' % $ $ ' ' % A # !# " !# ) # . )" # ) $ $ )" $ $ - ' $2 # # " " ' # ' 2 # ) # # 2 # $ $ A % .# " ' $2 # " % A ' ! # $ " !$ # ! % $ G%A % ' %M' $ C # ! # (# D! N% * " # $ H * > *$ ! $ # $ ! > !* $ $.%.." $ # 0 @88 $ ! 2 # # 2 # " " $ # ' # # # " % '! # " ! % " " !' .

. % - A % " ! - $! ' $2 ' ' $ ' # # . A ) % 2 $ " ' ! . . ) # " " $ ! $ $ '$ " " U% B ' $ $ %. %0 (# ' $ A %K # X ! # $ ! * $ ' ' $ # $ % # # . O # $ # 2 68 [ .8 0 $ ! A )" !. A la izquierda el agua fue expuesta a palabras de amor y gratitud. Mensajes del Agua. / # ! . volúmenes uno y dos. E.' % * S5 ! ! % ) % I " # $ $$ ! # " # # $ ! # ) " # ! %* # # % # - B " 2 2 $ # = ! # $ . (Por más ejemplos vea los libros..# ) A # A 9 * # # $ AC ) ( # 5 # $ A . por Masaru Emoto) 1 1 $ $ ) 9 - ' % # # # 5 . %* # A A L # " " # C# # A# " # A $2 * *O ) $ D% " # 1 #/$ D ) . # $ A ) % +' # %A .E 1 ! % K 1 " " / - $ # 2 ! ' 2 # ! # # " ( # ) % 2 %%% A %& <. - ) " # A$ $ % A(# . ( $. lo que pasó cuando fue sometida a frecuencias de teléfono celular. $ . # A' ' " %* .. O # # # 2 # # # $ " .y el cuerpo humano en esta realidad es sobre todo agua!.. a la derecha. # L # $ % Figuras 80 y 81: ¡El efecto de un teléfono móvil en cristales de hielo . U # $ A # " 9 $ $ 1 $2 3 5 # K B % F0 # # . # " # ' $2 )" A - # # " $ % > ! 6%7.= # " G% F 'G% 1' ! $ 2 3 * 1' # $ " # $ 2 # # A/ " 2 ' 2 ' (# (# " E. ) # ' 2 # %A 9 .

%* .%3 $ # J J J $ J J J J J # J # J J 2 J $ J . %* " " # *$ # " J # %9 # # # " # A+O A# " # % " # ! .% % # " ! # 2 0 # $) # . ! !9 . ) J# # # $ A J ( 29 .6 ! 9 . " 1 2! 9 2 > # " 5 ! $ ! " # % 1 )4 A 5 " $ " 2 = A % M+ 5 ! # $ 2 # $ # ' " # # ! $ # C$ D # 2 ) # # ! # '# ! = 2 " # " U $ # # 9 . ' (# $ % # 2% > ' 2 " ! B ' $ A " ' $ 2 # A . J J 2J J J $ # J 2 J J 9 . ' # ' $2 2 8 # $ % $ 8 T @7@% @?. 1 $ # .S5 # * " # 2 (# # # # # # %3 A (# 4A ! G% * # - ! # ! 2 # 2 4 .! 3 " # - ' % * " # .$ % $ $ ' . $ %9 3 ' " 5 % EE $ " # # # 5% B L' - # '. A # $ ! A %1 # # " ) N% - # . # ) " 2 %3 / $ '# $ - C 9 " ' !% # $ " # @?. =# # J J # ) .. J J$ J # J $ .% 0 . # # * ! B ' # # % * $ 2" $ 2 (# " 4 : $ J # " # J 2 ! J J J ! J# # . # J J -J % # " # ! ) # # ' - ( # .K ! # - * # A %* 0 2 ! ' A % 0 " # " 2 @@6 5 )2 ! " $ #' $ A# .J J # J$ . - $ = ' 3 ( # # $ %: 2 # # .'! ! $ @@6 % " A # F . $ J $ J $ ( ' ! ! # $ - " % %9 2 %* D' $2 % $ .

A $ ! ' = A % FI # $ ! $ ! A % " # $ ' # " $ # $ ' A# # A $) $ # " $ $ ." # '$ ' # # % * ' $ # ! ! 2 '$ " $ # # " $ # %3 ) # 0 # " " . ' $ S # # # '# " ' % 1 $ " # " ! " ' $ 2 " # $ # # ) '# # S % '# / " # ( ' # ." # (# # " 2 ' # # % # # ! # 3 " 2 # # # # 2 S5 % * " " " ! " ) % * ! @@7 " =# 1 ! # ( # ! " $ ' 2 2 A ! # % ( # " A # % $ # # # # " ) )! '# # ! # % ." A # " %1 # ! # 2 # ) % & ) " # ! 2 % $ " # % C0 . ' ' ' " " 2 ! .8 # # # # ! # 2 " $ " ! # 2 " ! ! 2 # " " ( ! # G% ! # .% # % * # 2 # # # 2 " # # # # # -2 ! ' $ ! # # # ' ! # ' . ! ' # # # # % F9 " # ' $ # 2 # $ G% # 2 2 %B F# " ' 2# 2 # " 2' ! # $ " $ " . ' # " " %& %1 $) # # " % $ # ) ! # . ) # # " ! %.# ! ! ' .2 2 % " 2 # $ $ ! $ 2 % " .D# " '# # A2 A! 5 # # # " # '# " " $2% I ' # .# %9 % . = % ." = B '# # # !# # " '# ' G% $ " $ " % % ! # 2 ! ' $ # # " . # . # # = ! I !' % ) $ #2 ) ) # ! ! # # # # %9 $ +$ % # .

! # 9 BB1 " $ 2 - # A # ' # ! # '% % .% I " # # 2# # # 2 $ " 7. % # # ! %.! # ! ! # # $ D% * ! # ! % ! " " # # " ! ) 2 ! $ " ' % * ! $ ! $) ! # " C! # . 2 % !B " # ! $ A ) . D% " % - # B '# " 2 " # $ # ! # # '! # % ! # # C$ 5 9/$ F GD% A > ! / ! " " # ! A %. $ 2 " " R7 . # %> $ " A! % ' # $ $ $ " # ! - $ C # ! . " 0 # J # .... %9 ! ( " # # # .! # 5) " " 2% # ' ! .< .. A *! # " A! $ ..1 ..# 2 " !# # $ . %9 # . ! ! %9 $ ( $ " # # # %9 # ! ( % $ 2 ! % # ' $ " ! # !# $ %* ! # # # % - # 2 % " $ . $ # $ . # % # 2# 9 ! 9 .J # " ! . # # 0 # # " $ # ' # # = ( " $ / ! . .6 - ! # # R@.6 !A # 2 # = 0 3 # $ .E 2 " ! # ! %* % # $ " # 2% # .J 2 . ! ' 8 %. # O $ # # J # " %0 ! ' 9 " # ! " # $ $ ! # 2 $ ! 2 2 " # # # C O % # . $ " ! $) # *! ." % # " * # 0 .% B O " " 2 # ! # " ' $2 %9 " !" % '! # ! # .= S5 # %3 " $ # " .8 ' $2 ( 3Y. $ ! # # # $ %H " 2 # % %9 2# .A # ! # * ! $ 0 .D # # % * # 5) ! " % # ) ! # $ " 2 " ( * Q ( $ # " A $ . 3 # # " " # 9 '! b. # .

. " # " " # # 2 # .# .# # %9 # " # ) ! $ $ # " 2 # $ # $ # / # A" $ # $ $) # ! $) # 4 # C# # # %* # # %+ . 3Y.% " !# / # " " # A C # . " 2 # # 0 . $ A# # 1 # # # $ ) # 2 " ' = " ' # # # # # ) # # # # # # . = $ # ( A 2 ) " ' % ! # # % ! .% M1 A " " ! 2 $ 2 # $) ' # ' # P ! # % ' # 2 # # P " " $ 2 A A % ! # # $ . # 2 # . . # ' '% * 2 " '#% * " + # # $ # ' " 2 2 A # ! A # ! " ' . 0 $ %* ' # # # -2 # # ' $2 ( (# # $ $ # % $ ' # !$ = 2 # ! # ' # % + # =! 3 # % # # " ! % ! ' $2 2 ) # 2N% . % $ # # # # 2 %3 # $ # ' # ' # # # B % : ' 2 % $ A " $ $ 0 ) 2D # # " " ! # $ R<. ! P' # A A # " # # P% # ) ' % 2 S ! 2 # # $ # # / .! 5) D' ! # " # %3 " 2G% B % FI # " # = $) # # %M .! '! # / # $ # # 0 $ # * 0 . " # ! ) % ! $ $ O $ # % 0 0 # ! /# # # 5) ! ) % $2 A J .7 ' %* $ $ # 2 '# 1 / A( A N% % F+ # # G% 0 # " $. ! $ )% * # $ " # # # $ '. ! ." # %* # # $ A # # . %* # ! $ # ! ! # J ! $ = # %* # # 3 1 # # $ # ! ) ) # '$ -% * ! # " .

$ .% * " $ $ %* " ! # ! / D ! " C " ! # # # # % ' %. ¡Qué amargura!. los abogados destruyen la justicia. todo está al revés. 0 ' & )4 # ! # " # ( # # ! ! # # -2 ! " ' # ' " " " ! # . los medios principales destruyen la información y las religiones destruyen la espiritualidad. ) 4 'El nacimiento de un hombre es el nacimiento de su pena. Cuanto más vive.! . . Todo está hacia atrás. ! # " ." 2 . los gobiernos destruyen la libertad.A %1 % $ % " # $/ " # $ % ' " 1' . " '! = " 0 % " 2 0 . ¡Él vive por lo que siempre está fuera de alcance!.' # " $ ' • * " # • * # 4 ! $ # # " = ! ! • * # #2 ) % # # " ! # • * # # = $ % # ! # # " # # # # # $ B # # # # $ % F1 # 9 # # # # ! # " # #2 = # # # $ #2 % ! ) # # $ " # $ % ! - # " # " # • * $ % ! • * A !A ) # " " $ # % # 0 # ! $ 2 2' " 0 # ! ' % ) 4 % * 0 .' 2 $ I / B %1 L : 5$ : # " # F# # " ! " % . las universidades destruyen el conocimiento. A ! # . Los doctores destruyen la salud. # # ! %9 %0 2 # % $) # " $ # " # # $ ! # $ ! ! !' C %* " " $ # # # " " # " 2 $ ! S5 # D% * 0 . # $ # " $% 'Sólo mírenos. Su sed por la supervivencia en el futuro lo hace incapaz de vivir en el presente.? ! ' %. porque su ansiedad por evitar la muerte inevitable se hace cada vez más aguda. 2 " # !' G% .$ # 0 # # # ( $ / ' ' G% % %. más estúpido se hace. # ! / S $ S ' " ! # ! $ # % * " # ! 0 .

# !$ $ # ! " # '# ! $ ' 2 " # $ # % ) $- $$ # # " ! ' # ) ! . ! " ) $ 0 ) # ' # # ( ) $ $ # . $ O '# " $ # # 1 9 '! # $ " '$ O '# ' A !# O 'A %> ! ' ' ' # !# / # ' " ! 1 ' 2 %1 % 2" G% + . # 2 %9 # " # " # " # ! * # ! ) ! # " " . % & ' $2 # # '$ ' ' ' 2 ! % $ ) ) . $ / " . ) '# % $ %4 3 (# . ! ' ' # ! # %* '! " ) ) ! $ %3 ' ' " !# D # # " '# $$ ) # ) " %9 ) " " % '# ) # C# # ! %4 > ! % %1 % 2 " $ $ % = ! ' # 2 # " ) # # " % $ % CAPÍTULO NUEVE Es todo Bollocks (Cojones) La representación fue un gran éxito. #. % ! 2 " # F # % # ! 2 % $ . (Oscar Wilde) . ! *$ $ # $ # $ # $ # # G% 1 % MI $ N% $ # # #2 " . " 0 # # .! H # # 2 # $ % . " # ) . # ( # ( % 2 / # $ # O '# ' $2 O '% I 2 # # O ' % 2$ # ! # ) 2 # . pero el público fue un desastre.0 .@ " 2$ O '% 2 $ # $ . 2 # %1 ) # $/! ' % ' # ' # $ ! ' ' ' ' = " # $ % +' %A0 ^^^^% F " ( % 2" # " $ " " $ . # $ 2# # ( 7< # " # ) . ( # " $ # F $ ! '! ( # % 9 ) # ) G% A ' # G% 1 +V H # ^^^^ F" # " ' # 0 $ # $ # # $ # # # # " # # . %* -% %9 2 " ' # %3 # $ %9 .

% (# $ /# = # ! A ' A A!A # # % ¿'Pene al cerebro.%. la gran cosa sobre la 2 ! ! # ' # $ F GF - $ % # # " ( !" $ # # " 2" ' $ # B ' # ' # # ' ( . # % ( G% B %H # ! ( $ " S5 % * 1 A(A !' ( ' ' =' $ % " 2 ( ' ! A 'A # % # 9 $ . " ' ' F& 4 # ' G% ! % % FI ! F" G% . # )P (# 2 # # # ! # 2 # # " ' . ¿Cuál es # " $ # 2 8.% 3 ( ! desnudez?... G% ! # $ $ 2 # # '2 ' # " % Respuesta: programación.%9 9 '! $ ! " # $ 2$ ' # . # ) F" $ ! $ # %%% 1 # " % # G% # $/ # ? D% Figura 82: Soy Yo..C: * '$ 2 # # %5 # # G% F G% = 9 $ 1 Soy Libre. ! # ( ..' 'Fuerte y claro. sólo preocupado de la eyaculación preco. y que Dios es perfecto. # ! pero si las religiones % creen que su 'Dios' # ' % ! $ " % creó el cuerpo.P# ( " . ' ) ' # ' ( '$ ' # . ' ! ! ( A2 A ( G% # O " ' ! G% mostrar su ' # $ ! # # avergonzados de %H # % ML / N% * Q $ # ' %%% %3 # # $ # " ¿por qué están tan # F" 2" $ # . # # '! $ !# . " F" ( creación?. Es una # ilusión holográfica de todos modos.! % % ( .' . ! $ $ 2 ) # ' ! ) # ( # # # $ # % % " " # $ # ) 0 . ahí vas de nuevo. 3Y. Pene.. . me recibes?.% " $ % 9 2 # $ %9 % F" # $ " # # # 2 ! ! # # $ %9 # # ' % . oh. " ' ! ! ! $ 2 A # $ . # '$ # # .! $2 # " # )" ! % # " A A % $ 2 (# ( # " # # # # % # " 2 # %* ! A $ # # A % A %I ' ! A $ A $ %.

! ' " ( # " (# ( # $ ) ! $ % # ( " # # ' # " 2 %* 2 ( ' ( # (# %. ( ( $ # ( !' ) %F " % '# .%A # 2 A # # " # ' 5! ) ( . # $ # ( ! ' A %+ .# # % " " ! 1 O % 0 . !' ' ) ! 2 ! # # S5 % * # ' 2 " ! $ ( ! # (%3 # " # $ % " $ 2 ! / # ' " # " ( ' # '$ ' ' # # # ' ' ! $ 2 # # # ' %+ $ 2 # +V H F>+* G% F " 2 # ! ( %F 2 $ ' ( " G% &( 2G% " 2 '$ 2 # # $ G%AB # % * # $ %3 # # $) ( $ ( % * # $ $ # ! $ # % %5 2 % ( # = = ( # 1 # ) ! " " %* $ " 2 ! # " + " U )4 A ! " # % * $ A L # '$ %.% %5$ +A %A (# A # $ :% V !L 1 ." " " $ (%. %> ! # # (% " # 0 . # " # . # ! " # " 2 " 2 O ' A # " 2 # L /J # $ ' J! " $ ) ' %. ( I # $" 2 ' %> ! # " " A A I ' A 9 " ) A F5 G% FI $ I $ ' # # 2 # # % I # " ( A $ ! ! # " " A" # # % ' ' ' G%A # ( 0 $ ' .6D ) 4 A ' " # .. " # . 9 %* # # " ! $ $ $ A! # ' # ' . $ A " % 9 A! ' # ( # " # ! . C> # 1 H " $ ! ' # ! $ # ( ! $ # $ % A(# $ J ) 2 . ( %>$ ! ' # # # ' 2 (% ( ( %9 # # # ! % # $ # " A2 A # " # # # " % 9 . 5 ! " 5# ' 5# .

0 2 # % ' ' A # # " A ! - # # ) " 2 $ 9 # " ! 0 # " A # $ % * $ % % 5 / 3 9 # 2 " ! # $ # # 1 " $ ' $2 # " % ! ' ) $ # $ " A ' " # " 1 # ! # # # . ! # # 2 " A U '#A 2% M.% * # 2 # C: ?6D% =$ '! V ! ..# # 2 % ' ' " ' A# ..%3 )2 0 ' ' B ' " # # # # 2 " 2 ' $ ! ) ) # ! ) * C: ?ED% 9 # 2 $ %A F " # $ 2 G% FI # $ B ' 2!V ! G% FH 2 ) # G% F9 " V ! 2 ) G% FH G F# " 2 G F! B ' G% $ GN% " % Figura 83: George W Bush. la profecía de su llegada: 'A medida que la democracia se perfecciona. . %* = * I % FI ' H G% * 0 .5 >#> # ! % " " ' # A '2# =# $ $ * ' ' - # ' " $ # # " % $ $ # ' ) # $ ' $ # # 2 $ $ % # # # AA ! . el alma interior de la gente. Mencken (1880-1956) * # ) B # B 9 2 # 2 # # K U% B '% $ %33% C! K B -D # # ! # .' H.. la gente sencilla de la tierra alcanzará por fin el deseo de su corazón y la Casa Blanca será adornada por un completo idiota.6 = ! $ # # " / # B ' . cada vez más estrechamente. # 1' ' # # ! . ' ' ' 2$ # # # 2! A # A# A A " % ! " / 4 K # 1 ! ' ! > $ # $.H = K # # $ % +$ # ! $ % ! ) # 2 ' # % # $ ! $ 3 % ' $ # * # 2 # 2 $ 2 ! 2 " " # ' MFI 1 '! A % * 0 A! . # 2 2 $ # " # # # $ # # ! $ ( # /# # % " # " $ 2 " . L' U ! 2 = # " A - A / % " ) " 2% 9 # " 9" . la oficina del presidente representa. $ 2$ " $ 1 # 2 - # ' $ # % .L... 'En algún día grandioso y glorioso.# " # # " .

/ N% $ '$ A # U $4 % %9 # ' ' ' # A ' A %M $ 2 A ! A +' # V B O 0 ( = +' # K B 'N% : ( V ' > 2 B ' # $ : L$B ' ' % " $ # 2 ! 2 % E ." # 2 # !N% * # 2 # # $ A .en el cual a la gente constantemente se le reparte de un mazo marcado. 1 D # ! $ ! > C.. # % ' $2 ! B '! V - # A # $ 3 !# " $ A $ !1 " 2 K " ) - # 2# $ ! % $ 2 $ " # 2 2 G% 9 A # *$ $ ' $2 %9 $ 2 1 '. # %>! ) # 1 # ( .# $ 0 $ # " # 2 # # ! # 0 A # # $ # 1 . !> " ! @8 J# # 1 B # > B ' )" '$ # .la Matriz . A " ! $ ! # 5# $ ! . # # # B '" $ A # ! +' C D# %%A % # " +' @. ! A # " $ " ' ) 5 9 ' $2 2 # 1 # # " # ! # %* # 2 # # C! A %* " $ ' " % " " ' ' D! # A A % Figura 84: La representación de Neil Hague del juego de naipes de 'Lucifer ' . '$ A % FI # $ " 2 $ 9/$ C9B.. F G% M* " # # # # " # ! $ N% $ $ '1 +' % . ' $ " A AC D" # $ $ % %9 ! 2 B '" U +A " $ M $ '$ " A # A# A # 0 ..D! ) A % # 2 # A$ A % * # ' ! # % $ U% B '# " 2 # B ' $ " # # # " # ' $2 %.6 B ' ! V ..... B .%.% # 2 # 2 # J 2" 5 # # " # # " # .

' . " # % O ' A ! " ' % ' # ! $ %* # $ ." # ' !' # . A# % . ! # # " # # # # $ " # # ! # # ) # $ $. / # %V A A %H " 3 ! % # * A ' ) O O # ' # " B ' $/ " ! B$ ! ' !K % # ) $ ' $ .. % .# # # # B ' . # " ! ! # / # 6 # A # %.. ! " # # ) # B ' # A H' A % " H' # # # ) $ $ 3 " $ # %& %& ! " %%%G%A $ " " ' " 2 ! D% & # ! 1' # AC # $ # # " 2 ''''NN% . V B !G% F9 " # ) ! " 2 " .6 # # 3 # # /$ 1 # $ % F9 ! " # 2 ... A K K # # A # # ) " V # B ! ! 2 # $ ) # $ % .6 ! # % B '' $2 # # $ %. 2# /# =# $) " V !G% F: . B ' ! # . A # # ! $ + ! ! ! # # ' " 2 " ' ! !$ " # 2G% F . ! # ( $ # " $ # C # " 2D% + # " " 9 % # " V % * " ! - '! =.# # ) $ A # # ! $ $ A' $ # 2 " # ' $ # # V B 9 O " ' % > $ !B 0 ' ' # ! # # G% 9 %1 " ! + 9 # ! 9 + ! + " A A %1 $ . " ! % # # $ " A .. ) # $ ! ! ' MM * / A # = # 2 " # B '# # " /# =# # ) % * " # ! # " $ # ! ) ' $ # # $ ! ! A2 $ A %& # L' U ! # ! %9 % * # $ " 2 # " ' # # )..%. /$ # ' % M9 " ) # N% & 9 3 $ # $ # # % ' ! # $$ 2 $ ) # %* # + % # % / $ * " A. ' $ . ' .2 # F# $ !$ " (# # $ ) O %..

# # (# %. # ! $ " " ) C # %0 $ 2 " D " " # # % 0 ' # $ 2 ! ( # *! L 2 # " %* ' ') ) # $ # % # - ' 8 " " ! % . (# %B %0 $ $ 2 L' U ! )4 A 1 # " .# " .# # # % % 0 " ! % # " # $ A %+ ') # " $ $ A %1 ! ! (# # $ # # ! " $ # . '$ # . $ > ! $ # " - # # =A . % * / S# 2 % * " $) %. % =V " ! ( (# % ! # # # A # 2! # % . !' $ " " # G% F $ 2 $/ # # # $ !' # G% F $ $ # # G% F $ # ! # $ # " ! # G% '$ 3 $ $ ! '$ ' " # $ *$ % FA 1 # / # 2% . $ %3 1 " (# $ $ 9 # ! # %9 " # ! % 2 ' $2 # $ " " ! + " # # # $ # ( # # " " $ . # $ .B " %A % " " ) # S ) # A # 2A 0 ' 9 ' " A + A # 2A J! # # # % 3 2# 9 ) % > $2 . ( ! % * # / $ 2 # 2 O B # = ! " $ %3 C % . '2 %1 ' '. ( $ %3 / " # $ " . # ' # " # " A 2 " ' # !' # " 2 " ( $ # " # # (# ( ! # # " $ # " ! " # # A O " = D 5 # A' " # 2 ' # 3 # %. $ ! # (# # . %9 " ' ! 2 U O @8 .' # # %* # $ $ # ' ' $ # $ %& )" ' $2 # !A A $ # " %& ! ' / # 2 3 $ % 4 ' % F $ # # # $ G% F $ . # O # # ( = ' # ' % B ! # 2 - G%AB % '! $ %.

! $$ ) 2 " $ ' A! # A # # # ' ." %* " # ' $ L $ # # " # $% - G% F9 $ 2 # # $ # # .# ') ' % # % A % ! ! . ! " # # # # # $ # # " # 2 " 2% $ % ' ' '! A A % " " # # A " F # # !) 2 ( ! E # % # " " ' $ $ $ # 2 ) E . ." ) 2 # ) ) 2% & . $ " # $ O $ # # " # ! % # ! # # $ .$ $ '. # # $ $ % # % " " '$ ! " ! # 2 # # . % # $ # " $$ ! ' " L " /%3 " # ! 2 % D # $ " # $ ' ' $2 -% # . # " $ ' % * ' # " ) ) ' # " % . ' . # C .) $ '$ % 2 # " " # A $ '. ' ' # # # " $ ') $ % > ! ! ' ') # # " # # %9 (# # %9 # % ' $ " # $ 2 ' # # # '2% * %9 A # % # 3 # (# # % * ') ) # %A +' ! ' b . .B 0 . # " . # * # " # # # ! %AB $ J # # # A! # $ $ > . # 3 %. # # O A ( A " =! ! ( % $ ! % O " # ! 2 " ' A( A # # $ ) .! ' ' # $ $ ( # ' )" 2 # 2 ) $) 2 ! ! # % $ - 2 $) $ ! ) # " ' " A % .G% : .# # 2 # " # 2 ! ) 2% .) 2 # " ( $ ' # $ " (# # L '$ $ + $ $ - # % ) " J # 2 # # G% # # ' % %3 % F9 ! " % FI # ) 2 $ ' 2 ) 2 ! " G% % .# " A ') A! !A # # (# # " A # # " ) # " ') ! # 2 # # 2 ! # ! % 1 " # " . " " # " . " # 9 % 2% . # = # $ $ 4 # % % " ( ! $ # # ! %.) < .

2 %. " # A % A ) A # . " 2 # %9 # $) ' ' $ # # % FH ' # F F! !' # ( " " # '$ # " ! # ! " . 2 % ( G% * ' # 2 2 ! ' # 2 .# 1 2 2 %& ' " 2 % F9 " = / %9 " # K # $ G% * $ # # / ! # U% B ' ! A %9 0 $ $ . A( A # # # " A( A 4 ! A( A . # ' G% ( G% 7 ( G% # ' $ J # # ' " " 2 # # # / ! " # J! $ " . " # " # ! # A 9 # $ C %* A! # # T" # # # D) %1 % F ( G% .= !# " " " ( ' # # . # ! # $ ! '$ # A # # )% F ( G% 3 $ " # !# # ! 2 $ !# $ # A A ! %* # $ $ # $ # 2 " $! %* # # $ # # $! " ! # # " A ! A" % $ % F ( G% * # $ ' $ # " # ( # / L . " # # " ' 3 # # ( # " # 2 ). ). A # % ( G% F * # # ' # F 2 # - %* # $ % $ " # # ' % # # 2 " # ! # ' # ! $ # ! ( # ) .% & ! " # # 2 ! " # # " # ' # .' (# " # # $ F A ! ! $ # # A %0 ' # 2 " % ( G% 3 " %& # .

A % * $/ " % > ( ' # ' 2 ) ( # $ # ! # # $ # 2' " ' ' ' ' .. $ )% K '2% A A $ # # # -2 A# #2 8 A A % " ! " # # " $ " # ! $ 2 ! # -2 % # ? % " " . G% " % ! =5 * =' # " %+ A # # " " # ! A '# # " . % F ( G% $ %> ! " # # # " # # $ )% # $ % . =. $) ' # # " 2 # . % '! / $ G% 3 % F9 " G% " " '. # " %1 # - # : # A( A %* # ) ! %3 $ = # # ' # # A ! ! 2: 2 " / $ # " '! / F # ' ' " " ' ' ' ! # " # A # %9 ! !# ' ! $% B " " %.* $ ) # ' A A A" # $ # A %9 F" * ) $ ) # A # $ ..%. ! 1 $ # 2 ) ) # # .R%A A K ( A JF" ' G%A %A FA H%%%G%A A %A $ % " ' ' ' $ = = # " " $) / % 0 $ ' $ A # " ' $ ) 6. !' $ # # # D A AC# " # * # " ' F $) # 0 K0 K %* A A # ( G% * " 9 $ A A % $ # ! %* " # ! # # - ! 2= # # # " " # $ %* / " # A %3 $ " $ " ( % U ..# " ! K B # $ ." % ! # $ " . # # ' # ' = 8# ! % # " ' " # # # % # # # ! $2 # A! # " # ! % # # # # A 0 .

5 3 '.% A A ) " # # !# # % # 2 # $ .A# " A A! '" ' 4A . Así hay una variedad de identidades ofrecidas a ellos y tienen que insertarse en una.# % F9 2 # # ! # " # 2 = # " # = ' 2 . '! # # # " .." # %* A = = $ A % 3 ) " # A '. . $ 4 'Los niños pueden pensar que ellos hacen elecciones cuando realmente han sido capturados por una opción. 2 # !%%% " 2 #) A % " $ A .# # # # @ $ 9 # ) # = # % # )4 A H # # $ - ! ! ' %* $ / %9 2 2 A %3 # " # . $ " # 2A $ A %9 # $ ! % " 2 " %1 $ ' # # " # - %3 # # # # $ " ! N% A ( (# ! $ # # # " # " # - % M9 ! $ $ A % ! " ( ( # # 2 2 # # ! % ( ( * AO " # " # # * # # # % 2%9 " " / $ " # % $) # # # # # AO A A ' ! % A 1 2 ) ! # A %3 9 BB1 $ . # ) # # ' %%% 1 \# # '] # " " A %3 . # $ % * " # " A A %. ! * ( % ' " - # # " # # %1 % % 1 # 2 " ' # # !' " " $ = " # " % ! # ' ' / 2# # 2 A %3 # 2! %3 A .$ ! " # / # " 2 )! # 2 % M9 # $ # " N% 0 ! 0 : !1 .# ' # # 2 $ 2% . Han sido capturados por una identidad en vez de ser capaces de descubrir su propia identidad.6 $ AO A # " # # % # -2 ' # # $ " (# $ # 2 # $ ! # + # # # 2% A$ A # % * ! $ " ' # # .' ( ' " %H " % ' ! # = '! ' ' ' " ' # # " 4A .

A ' # " " 9## ' # / ) . % " ' ' ! # # ( # 4 G% * 1 O .%.' * / # # # $ ! .! %. La palabra original vino de un hierro largo con un logotipo al extremo que quemaba el costado de una vaca y mostraba que el granjero la poseía. 2 # # % ' # # 5 #' * !' # 2 . 1 O ! # .9 . % F5 1 O $ ) . 1 O (# %A +' # # # A %* " # ' ( # 3 . $ ( P P 2" ' $ % % MA 0 % ) ! $ ' ( # = ! # " ) ' / $ " # # # O O '" # # - ' # N% * $ = ! %A * 2$ / ( %1 . : ! % F9 " # G% F1 ( . %. 1 O ) $ % " %. ! # " .2 # $ # " $ ( # " ! %9 2 $ ) !S " ! ' % $) # 2 # % 2 ' %> # " 0 .'! " # $ ." " # " $ # " = # # # ' # ( " ' %9 ! % F9 " " ) # ! # " " G% FB G% = 3. . " % .# B ( " " # # # " O '# # B ' % O # % . . / # # %3 # " " # #/$ $ $ '$ ) 9 % " 2 $) # . ! A # %A 1 O $) # # " ( ! # # " ! '! ( # " # " ! % # A A# " # . Entonces sólo tener el nombre de la compañía a lo largo de la parte superior muestra que ellos te poseen o algo. . $ 4 'Es como si alguien te posee. J ! # ! $ A # # " % /%* # ! $ ! . " # # " ! ' # $ 0 .# $ G%A> . # ! # # # 3 ! " 1 O " %3 .A $ " # ' ' 2# ! % G% B # $/ " 0/ $ # " # d # A A %I !" ! .# " % A )" # ! # # # # # ! ' $2 " A % $ # " !# # % " " ! # $ # . A ' ( ! # " " " ' A %& # " # %3 2 # # ! ! " 2# ! 2 % # = # # !' ( 0 . # = % " # A ' * I ! ' ( .

$ # G% F # A 2" $) # # # " G% F # " $ 2 ( $ " 2% % * ! 2 # $/ " ! " '! $ % # # # 2 $ . # % " ' $ # ! ! ' (# " ! # ! % " % . G% F * 0 %. # . C '. # # ! # # # A A ( G% F # ) # 2 ' $ # G% F # 2# $ !# 2 " G% &( ! ! " 2 # ) . $ ! ! % # # ' # # % # # %%% * 0 A ! !% 0 " $ ! # A ! $ % ' ! # " " ! 2 # # ) # %%% 0 $ % ' # ! # . # $ # %%% 0 A # A# " 2' . $ % CAPÍTULO DIEZ Salir del Sistema Amarse a uno mismo es el principio de un romance para toda la vida. # ! # / # . (Oscar Wilde) Siempre perdone a sus enemigos.% 3 $ " F" # ' G% " . (Oscar Wilde) " # # %* " $ $ $ . %9 ! # " " ' 0 . / # ( # # % # # # " # " ' #2 ( % . ! % # " $ 2 # " 2 2 ! . G% F # . # # 2 # $ ! $ " # # " " # ' # " ' ' # 4 $ ! ' " # 0/ 9 #% = $ # % ! # ) # ' 1 %1 ! A " A ! ' % ( # ! 2 # ' %9 = % 4 % # 2 ( # 2 ) % # d A " # ) # G% F # # ( " # $ ) # " %B /$ " ! D # ' 0 . - . nada los enoja tanto. 0 .2 ! ' # # # %." # ! $ 2 $ # " # " # " F - # ! " G% F $ # .

* A A # # ) .# # A 4 = " O !# ! %. " # J ' # $ ! $ # # # # % $ % # ! # # % ) A J # # A " ! 0 ' 5 " 0 . 2 # 5 / # " 2 '! # # " # =! A ' A A % . A # A $ $ . # # # # $. / '!# !% $ = # # / A %* " $ " # # 3 ! / / " =9 $ ! A (# # # # # 1 # % " %A " " $ 3 '! 2 # 2 3 %* . '! ! # " 3 " # " % # ! # ! " ! ! " ' ' # A= % . $ % A " %* (# A # %A = ' # %* " $ A! A " # " A # 3 ! %* A = / % " # $ # '! # 2J # 1 # % # 2% # $ " %5 .% 3 . # # G% ." # ) # ." 2 ! # . ' % .# # $ $ %0 # # # ! O % # ! ! ) D% ! # # ! # ) $ # % ' 2" '$ # % " # % $ ! ) # $ $ ! # %> " # ) # " " A2 A " ' %1 )$ C ! " " " % 2 '! (# # / ! ! # ' " O " " . # # # . %* (# A # ! " $ ! ' $ AA # A! A F! % % . ). # = ' " # A # " AA # %* . # ' # % .# " # # " $ 0 4 # # # # # # $ ' ! ! % $ 2$ # ! # 2% 9 " (# # ' ! 1 ! ! # . ! " " # % # (# % . ! " # ( GA %* # % 9 $ C # ! % * # %0 ' %+ / # $ 2G% 1 # # % # # 2' # ) % $ / # # %%% % F1 ) # # ' # . D ! ' ! % F9 ' ! # 0 .

! %3 " ! 9 $ " # $ # " # %3 " ( ' # U O @8% * %1 $ % 2 % # ! + $ ) " " 0 # 0 %.% A ' + A 0 ) . # % $ ' " ) # ) > ! # # ' # F> .# $ # $) " # " 2! # # ! % 9 " $ 2 % $ # . (# # # # # $ # . ' $2 ' ' # # . # !# '! + $% 1 $% 1 ' $ G% 1 # # # C: $ " # %A E % $) " " # ) ) # A " " " # " ' " 0 # # # '! =# ) % A $ ' ( ! . # 2 $ # # # # # # " ) # " %> ! # )0 4 A $ " A % 2 # $ % # # # % # 2 ! ! # ) # %* " $ ' " ' $ # . A %3 A # % F1 ) # % 9 # ( # " % $ 0 ! (# A # $ " # 2 % # 2 ! $. $ # " ' $2 # ' # # " ! " $% . 3 $ ! $ 2 $ # " $ # # " ' " ' - # # # # ! " # # # > $ %9 ' # " A2 % $% . '! $ # " # # ! F # ! # % 2 $ # ( % # . # G% 1 ' A K A '2 A $ ! +* A % / " ! A A # # " (# = ! '. # A %% %% $ / # # " ?8D% 1 " # # 3 '! " % # = . $) % $ # ! ! # ' $ %H A %%% A %1 $ ! 0 %1 # % + % .R% ) " 2" )" # 2 '$ ( # # %1 $ # 2 ! 5 # A A % % " # $ ' A A A A$ # . ) # A %3 $ % 9 $ A ! ' A # % " # # # $ # ! # %* # G% # # ' ' # )# " A! % " ' ' ) # $ !'! ' # $ " / " % # 2 4 " 2# A %%% A # !# O $ %.%& " ! )" 9 $ ! # 2 2 # 2 $ 2 ' E.% 3 .

peligrosa o extrema. $ % % # ! 4 A 3 ' " " " # " 3 % $ " ! 2 # ' ' ' # # ( # 2 2% 9 A A # # %3 . A! %1 A # # $ " %1 # # " ) # ! # .! GG% * " # " 6 # '! ' ' '! ' ' '! # " % = % FH # " # . Esos todavía atrapados en la ilusión ven a tal gente como loca.$ $ # %A ' $ # %* = ! '# $ % " " $ . + # # ' " " ! A( A A A # " ' ! # " . comenzamos a ver a través de la ilusión y la Matriz pierde su control de nuestro sentido de la realidad. % = $ # # ) AA $ % AA $ # 0 .H A $ # # A # . A $ # ! 0 # AA $ %.A * - # " # " # ! ' " J " % ' . % 3 " % % FF1 $ ' ) $ # # C # ! # " " A %H D% # = $ #2 %5 $ $) ' ' ' " A 9" .! A # % # # . # # # ! # # # $ " # ' $ ' ! # # " $ # # F1 # % 3 %. % Figura 85: Cuando nos abrimos a la Conciencia Infinita que somos. $) $ ' A J '! # . # A %9 " # # $ " A # " . ! ' % .' A A $ %* % * " '.G% .

4 # % ( # A " # A " A " # A %1 " ) # $ # $ # # # # / # " # # # %0 ) ') L ! " # ' F" G% . %1 ' ' ." # # ! $ % ' %* 0 3 $ '! # %. # " .A # " $% O " # 3 . # $ $ % . $ " # ." 1 $ " # # 2% '$ ' ! ' # /$ ! $ $ # ! ' 3 %. $ ! %3 # ! (# %9 $ " # ' # A * . J . # " . # # 2 %3 %+ # . " $ # = $ ' ! ( ! 0 . ( %9 " # ! # O %0 ' .!> .2 3 # $ " ' ' 2 # ! # %3 8 2 0 . A + # ( ! A # ! ) $ # A ) A .! " $ " 2 $ ! $ " B $ 2 %. ! # ! # " # # ! 2% # $ " # %* # % % 2 # # " ( # ." ( # " " ." # # # ) A# ! $ G% # # $ ' # " # A " # # ! * ' ) # " /$ $ " % = # $) . ) $ ( %9 %* " # ! # % # ) " " L! # (# " # " % " # ( ! " J ' # # # ( ! ' /# =' ) " 9 0 ." % $ ' ! # A %." % 3 . ! '$ # A % * " # # ! ! $ " # ' ! " ! ! # ! ! 2 # = 0 $ = . " " 2" # . $ ! # ." # # % ! %. ) # " %. ." ' # ! - %3 !' # % # ) # $ ) $ # ) * # # # # # %* " 0 " $ 2 %1 J # # $ " ! ! # % .A ' # 2 2" %3 A * . % %. # # # " ! " %1 %9 ! % %1 $ ) $ " /$ ! .A %. $ " " ' # # A % )% 1 " ' # 2 % # # 2 %> ! ' $ 3 3 ) $ . # # # " * 1 # " (# " ' # # % * . $ %.

$2% * # $ ! =# # =3 %1 ' % 2 $ $ % '$ / # < %H " ' # # $ ' .' & # 2 '$ # " 9 $ 3 # # # $ 3 / " # # ( 0 . Y el personaje del Agente Smith. %* .# " 1 " $ %1 # # # ' !! ) " 1 $ # # 4A # # # 4# " % # A % " %1 ! % # # %+ A %* A + $ . # # % " # A# A ! # A * !A ! " " % A !A # %1 0 . observó: 'Sin propósito no existiríamos. Es el propósito lo que nos define. # " " ) .! O " $ " # = = ! # # 2% = $ %* # " " # ! # # 0 . $ ! 2 " A) 3 # # / ) % " % FI G% # (# %3 ' # $ $ A # # A %3 # '$ A " # # ! # . el propósito lo que nos jala. ! " " (# A A! $ # # # # " ! " 9 $ ' " % %H # # 0 ' ' ' # 2 $ J ) %* " ! % # # # ) # )# " " %H " 9 $ .% I $ . Es el propósito lo que nos creó.A# " " # G% + ! A2 $ A % # " %* # $ A A " ( # # ! # %. " % (# # ! 2 # # ! 2 " # $% H ' 2 / # # " ' ! # # % $2 $ $ %. ! $ % F9 " " A + $ 2%* ! " # ! % # 3 # %* A !A # =5 ' 9 $ ) 0 $ 2 . " ." A * . lo que nos conduce. # " # $ %> ! # $ 4 'Cada programa que es creado debe tener un propósito. # # # " ' ! " $ 2 # 2 0 (" # " " ! # %. ' ' # # ' / " # A ! 5 " " # %9 . el propósito lo que nos liga.'! ! / ! '! " %0 / $ # " %1 ' . ' # %* ' # $ # ' # # J! ' " $ $ )% ' # # . el propósito lo que nos une. Si no lo tiene es suprimido'. " ' $ # " 9 $ % # $ ( 3 # " U 4A * $ %0 # A % # # # # % 3 = * I = %3 $ " %. '! # $ # $ ( %9 ) ' ) * # ) % # ." %> " $ ' ' # " " ) % " A A! 2 # # %. un programa de ordenador. lo que nos guía. ! # " % # " " ' % " " ! 2 .

" ! # .# . $ %1 . # # %* # # = # $ " # ! $ # ! # % # # % # # 2 % 3 $ # ! # # # ! F " ' . 3 G% # 2 %1 # K D 2 ' ' ' # # 2 $ ! !! ! # !# J J ' $ " ' $ %. $ = ( 2 A % = $ 0 . $ $ 3 ! " # ' # $ $ % 9 ' # # # # $ # (# % # # '! % %+ " 2 ( %9 " " ' % # # " '! / $ " B # %1 # 1 # # ! # ' # # 2 '$ !' # # % # 2 % * 2 % * # !# A " A # $ ! %3 ! J J # ! # J ! %.% 3 'No hay ninguna razón para no tomar un salto de fe en imaginar lo que puede esperarse. - ) % 9 1 " 0 ! 2 2 # # # " ) # # !J ! ! 2 A# A G% . $ A " A # 0 . Podemos confiar que es tiempo de que la humanidad despierte a una asociación verdadera de unos con otros.. # 1 0 ! " ' # " E 6 1 ! A K K A " ! 2 ! " '$ 1 2 1 A % ! .4 A . 3 4 $ ! # # $ % F1 # $ " % $ 2 J ! # # $ !" . U $ $ ! # " ! ! %1 ! $ %. $ . 7 . " # C$ " ! # # # ' % $ = 3 %* ! " $ # # % # A! % ... $ = # " %1 $ # $ %* " %1 # # " A # A 9 B " # $ # # 9 # ! ! ! # ' " $ %* # <%.% 3 # 9 $ # 0 # # # % A ! " $ ! J % 1 # # ! $ F G% '$ ! # 2 ! 2 # ! # " " ' % F '! # " ' !# A " A # $ %. ! G% B 2! % # # ! $/ " # # ! ' 2 " $ # %. ' ." '$ % H # - $ % * ! # ! $ " 1 . # % 9 A ! ' $ 4 # # 2 " '! % . % % # # %> # = " ( J# # # $ 3 %H # # # 3 ) $ %3 # ! # J ' ! ' J $ ! " " 3 # # % # # ) .

con la tierra, y el Cosmos. Aceptando esta asociación podemos reclamar nuestros derechos de
nacimiento y hacernos Ciudadanos Galácticos que cuidan al planeta y lo mantienen, así
manteniéndonos. Este es claramente el desafío de nuestros tiempos. Todavía, llegando justo a tiempo
y según lo programado está el alba de Solsticio de Invierno en el día que podemos recordar que
somos verdaderamente Hijos del Mundo.'

'
"

/ # $
!

"

' '
"
2
# %,
#
'

!"

;

B
$

"

1

2
'
%

2

-

"

"

#

%

/
A
A

# !
>)

"

A
) #

0 !

'
) "

"
A' $2

.
/ !
#

2

"

3

$
-

0
"

%
"

#

A
0 .%

A
1
#

'

$

# (
!
$ %
' $2 #
#
% *
!
2 "
"
A
9 '
A
#
$A
%
#
C
' ' !
%9
'
"

A

A
%0
! 1

*

"
0

A
A
'

1

!

#

'!

2

"

#
"

'

3

%

#

2
%

'

%

K
0

#
$ %

A!
.
$

*

9 /
!

#
'

8;;
' $2
$2 $ )
- !
%9 '
A
A A # A! 1
.
!
"
!
#
D
#
0 .#
;
$
#
2
%& /
%
Figuras 86 y 87: A
medida que la
energía de la
Unidad penetra la
Matriz, la vibración
del miedo se
disuelve y la
realidad de su
conciencia cautiva
es transformada.

> !
"

#
# %

%
9
A

2
A

3
#

'
!

#
#

(

=
%

$
!
% * A
FL

%

,
(

#
'
)
A
0 .!
% F3
$
)
G% F
/
$
) J
C:
?< ! ?7D%

'

%9
"
$ =
$
3

%
0

#
3

* I

(

$
"
!
3
G% F "
$ G% *

3
?

J!
%

2

"

G% F

.J#
!
!
#
3
!

)
$

"
"

)

$ G%
0 .
'

*

2

!
3 %
%
" $
'
" $
#

9 $
# 2
$
%
!
!
%1
0 .!
/# ='
$
3
$
%
2

! (
$

'
"
#
#

$ "
"
"

3
#
'

'
#

$

#

#
"

#
"

)

# A

#
.! #

$
!

#
#
'

%

>

#

! "
# %* 3
#

$

)
(

'
!

A
!

$
# 2

#

"

)

%
#

/
$ #
#

!

$ A

"
#

%

%1

'

2#
%

2 "
0 .A
#
'
A #
A A
%
$ "
#
%

%

'

!

"
$

2
2

"
2

$
(#
'

!

- "
$ "

"

$

2

A.

#

%

"
'!

$
!

# A
.

"

!
'
"

$

2

%

A

! (#

$

#
A

3
#

!
#

A
%
(#
'

'
$

)
3

!

Figura 88: La
transformación de la
división a la Unidad
está abierta para
cada uno. No hay
ningún 'pueblo
elegido', sólo Amor
Infinito.

,
$

"
3

#

#
C:
#

??D% * "
#

2
$
#

'

%

1
# #
3
"
)
#

!

"
#

%

#

4 F
3

A

2

#

G% F
2

A
G%

F

3
#
)
3

2
#
F
@

3

( G%
)2

# "
" #
#
# 2 G% F 3
2
F 3
2" #
"
3
' 2#
A
A
G% F 3
2
%
F# " '
3
2
#

G% F

3
2
$
# ! 2
#
# 2
#
#
I
G%
A
+
A
G% F 3
#
# 2
2
G% F 3
2
(
A A
G% F 2
# .G% F 3
#
# 2
2 A
#
A
2
A
A
( G%
# "
3 G% * /
! 3
" '
"
%

# " - # "
2% 9

"

# " - J!

"

)

!

>

"
# )

!

"

"

#

.

#

"

%

F

"
%
$)
%

#
#

"

#
$ "
%9

#

%
* I

#
$

%

#
%

(

G%

,

%

F1

G%

, # %
'!

%

Apéndice I

El ADN Humano es una Internet Biológica, Dicen Científicos Rusos
#

"

! ' $2
#
$
' .
# ! $
U $%

2
"
$)

$
$

#
#

$ ! ' $2
2
#
#

!
$

!

#

'

!

'

A

=#
#2

2

#

A
D

#
# $
$

#
!

$

)

!

#

"
(#

@; [
N% , /
$
"

#
#

#

#

"
#
%

#
#
b

'

#

! $

%
/
@; [ #

%9

#
!

$

D
%

D

!
)%
'

(

E

!
!

$) #
%
(#

) '
#

$
)D!

'

#

#

"

)

\

%

#
(
.

#

( C
C$

A
%*
b
' .
#
$

A
% M,

"

C
"

2

!

A

$)

# .

]%

!
"

$ 2

!

#
#

"
@;[
.
A
'

%

#

!

.#

#

*
/

% * /
.

'!
!

\

$

%

#

#

#

!
C

$
#
#

24

(#
#

8 []%
(

#
%H
$
! " 2' !

C\]D

2

[

$

'

'

,

#

'
\ ! 9)

#

]%
K ))

E;

!

$

(#

# # " * # (# " K )) ( # $ # % # # $ =# 2 # ) # $ $ N% \M # $ S' = " N%] ! ) !' 2 ! # # # 0 # 0 %] # # ' )% \ % M3 ) ' # # ! / * (# ! %\ ' 2 # " .4 1 ' ! / % ' ) 2 % \* > 5 A 2 $ $) 2 ) A # A " ' ] $ # % \ $ ]% # A '2# = K 2% ( 1 J # . $ $ % # 1 =5+0 " # 2" # $ # %\ " %] # $ # . 6 % # . $ " ' % # # /$ A " A $ $ # % 0 # . # ! A\ . ! - . # " ! % " ) $ $ " 2 # # $ ' " ' ! " # $) 2 # ]% ! # $ ! :! $ # %9 # ( ! # . %3 %M ' $ $ # # # % .# $ % # 4A * ) A % \* " # " =' # # # ) # .% " $ $) \ . # # # $ ]% * # # " % <. # " # ' $ $ % ! # ' .% > $2 '% * ! 2 $ # $ " ' ' $ $ $2 $ $ E ' " $ # ." # ! A P ) ! # (# # 2 ]% ) $ $ )%] 2 $ " # $ # $ N% \ # # $ ! ! # # N% M $ # ' ! # % " ! '# # " # # % # ! ! # ]% ' $) # ! # # # ! W# ( # $ N% M N% %M # - # # # (# ! \ ' ' ! ) # $ ! # $ ' % M # $ # # ! # # $ ! ! " 2$ . ! =% 3 ! 2 # ! ' %3 ) # # # ! (# A\M $ N]% 9 .! > $ # ) $ .%] " A (# - ## - .

" " S " (# # % $ A! A A ! 2 %] A 2 > ! ) ! ! $ # $ # % * $ " 2 $ # .% 0 ' 2 ! # 2" " " # # ' J \5 # $ ' M* 2 2 # # & / # " " # N% * .B " \! 2" ! ! (# '2# = $ . # " " $ $ # % > $ 2% 5 2 # $ 2 2 % 5 D K . '# '2# = ( / % \ # .1 '2# = %* ' 2# # " %0 ! # 2 %1 ' # $ # . ! ' $ %] # # $ ) " =5 ) C ) D% / # # ! # '2# = %* ) % ( ! # 2! # " ) # ( # ' ! B $ 2 # # # % (# # ! # ) ) ' '2# = ' # $ )% 1 $ ]% - # # ! # \' (# " . $ # # ! $ # ! 2%9 ! '2# = # ]% * $ $ " # $ (# ' $2 # " ' $! 5 . # $ # " ! .) # %9 # $ # $ # 2 5 . ! A \ " ]D # % A! A . E # \ B ! ! 9# ? ' '2# = '2# = % * ' # ! # ! " " .?C ( ( ! ' $ # ! $ " # ]% ' " " 1 %* .! $ : !: " . D% A= . ) # " # . 5 A $ /# =# " - = 2% > ! # A % ) 2 " # ) ! % B ) # " " # $ ! " ! $ " 2% 0 ' A # # A $ $) . ! # %I . ) 2 # (# . # " (# 2 # " # # # 2 1 # # # . $ " ' . " $ 2 % '2# = %* ) $ # # 2# % (# 1 ! % 2 # # # A C # 2 # # A\ " .

% ' $ " # J# \( # $ % 2 (# % # $ $ \ # \ . ' ]% 9 .A # $ A # ( ) %9 # # ] .$ . 2 ! # # %] * # ' ' 2 " $ . G% ' ! # . .' ' !]% * '2# = % M* # " # 2 # # ' '! . Soy un practicante de medicina homeopática e EE . # # % " %9 . # . ' . mi nombre es Barry Newton.' \ # C A # 2 # % \* $ 2 # # # # # 2 $ ! A# ) # D '$ $ ! D% $ 2 # ! / - % ! - / # 2 2 # # .?# $ ? b ' # ' ' ' # " $ ' 2 # %.! 1 2 # " . \ N% 3 ( ' %. 2% \F1 %] 9 " . # # ! . 6E E7% * 2V \ $ # $ ( # : # 2 " : !: OOO% ! 2 " " " K .. $ # 2 # # % 3 # $ 2 # 2 $2 2 . ¿eh? $) (# . ' # ' - ) # # # # " ' $ ! # ! - ]% # . % '! $ ! (# A ) # A\ " 0]% " # # # 2 # '2# = 1 J! # $ ]% 1 # # C % 9 $ " # ' # # # # . # " # '2 /$ # N% $ E@E.B %3 # =$ % .4 Hola David.8 '# # ! # " $ 2 $ # $2 % ! ' " ' # - @@. ! ! . $ N% H ' # % ! % " \B '.B % # A$ A % ! " 2# " " ! %] APÉNDICE II Conque la Conexión Reptiliana es una Locura. . # / % M3 9 . # ! % 9 $ # # . ' ]% MH # 2 / .

y esto E6 . La piel del cuerpo anfitrión aparentemente se hace fluida. así como a unir ideas. una persona totalmente diferente. como los Annunaki también llamados los Observadores por los antiguos Mesopotámicos y otros. La finalización del cambio revela una presencia. Desde 1994 hasta 2001.hipnoterapia clínica residente en Australia. El cambio de personalidad no es diferente de hablar a. Esta paciente me proveyó de dibujos que ella había hecho que para mí no tenían ningún significado especial hasta ahora en 2005.cuando los pacientes con el Desorden Disociativo de Identidad cambian de una personalidad a otra. fláccida. Copyright Healing Health & Harmony Presenciar un cambio es una experiencia completamente notable y extraña. y comportamiento facial (incluso corporal) totalmente diferente de lo que era el anterior. y estar en la presencia de. Lo que al principio me golpeó fue que su idea del 'cambio de forma' era muchísimo similar a un proceso conocido como 'cambio' . La lectura de su trabajo me incitó a recordar tales acontecimientos. después de leer su libro. traté a una paciente que sufría la condición psiquiátrica monstruosa conocida como Desorden Disociativo de Identidad o DID (una vez conocido como 'personalidad múltiple') el resultado de nacer en un Culto Satánico y ser posteriormente ritualmente abusada por más de tres décadas. y burbujea con protuberancias y hundimientos y es muy difícil de enfocar. El cambio es a veces profundo y a veces discreto. estructura. Hijos de la Matriz.

cdsubliminal. En efecto parece que la presencia y el uso de serpientes es integral en todos los casos de Abuso Ritual Satánico. http://www.ojos que le dijeron que estaban 'siempre mirando'. Revisé las notas del caso para localizar los dibujos de ojos mirando. Saludos cordiales. 1 #! '> > 'e > ! Note que los ojos del mal son dibujados con pupilas verticales.com.au/ 1 # ' ' $ / E8 # # %9 $ # % . y para mi muy grande sorpresa encontré varios dibujos más que también parecen confirmar sus exposiciones en cuanto a Satanismo y reptiles. que ahora expido a usted. y que los dos perpetradores principales son representados como reptiliano y serpiente. Barry.conectó mi memoria con los dibujos de ojos que fueron hechos por mi paciente .

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->