Neurotoxin Gene Profiling of Clostridium botulinum Types C and D Native to Different Countries within Europe

Cedric Woudstra, Hanna Skarin, Fabrizio Anniballi, Lucia Fenicia, Luca Bano, Ilenia Drigo, Miriam Koene, Marie-Hélène Bäyon-Auboyer, Jean-Philippe Buffereau, Dario De Medici and Patrick Fach Appl. Environ. Microbiol. 2012, 78(9):3120. DOI: 10.1128/AEM.07568-11. Published Ahead of Print 17 February 2012. Downloaded from http://aem.asm.org/ on April 9, 2012 by guest

Updated information and services can be found at: http://aem.asm.org/content/78/9/3120 These include:
SUPPLEMENTAL MATERIAL

http://aem.asm.org/content/suppl/2012/04/03/78.9.3120.DC1.ht ml This article cites 50 articles, 21 of which can be accessed free at: http://aem.asm.org/content/78/9/3120#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

REFERENCES

CONTENT ALERTS

Information about commercial reprint orders: http://aem.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

This study reports on the development of low-density macroarrays based on the GeneDisc cycler platform (Pall-GeneDisc Technologies) applied to the simultaneous detection of the C. doi:10. South Korea (47. since toxic activity is not equivalent between the different botulism neurotoxins. and bovines (n ‫ ؍‬56). argentinense (BoNT G) (23). Francea. and. botulinum types C (n ‫ ؍‬12). B. F are mainly responsible for human botulism. United Kingdom). Interestingly. several cases of animal botulism were reported in the recent years. corresponding to 15 genome copies. dilated pupils. American Society for Microbiology. Regarding animal botulism.000 wild water birds in the Namdong flood control basin. Strains producing interserotype recombinant toxins.b Fabrizio Anniballi.a Hanna Skarin. National Veterinary Institute. whereas toxin types C and D are involved in animal botulism worldwide (40). and showed a high specificity. animal botulism is responsible for high mortality (32. only BoNT mosaics. D.Neurotoxin Gene Profiling of Clostridium botulinum Types C and D Native to Different Countries within Europe Cedric Woudstra.000 seabirds.f Jean-Philippe Buffereau. 2012 by guest otulism is a severe flaccid paralytic disease caused by seven different neuroparalytic toxin subtypes (A to G) (20). loss of tongue tone. For the seroneutralization test. The limit of detection of the PCR assays was 38 fg of total DNA.asm. Downloaded from http://aem. but only a few laboratories are able to perform routinely this analysis.c and Patrick Facha ANSES (French Agency for Food. 52). E. and flaccid paralysis (5.c Luca Bano. the most common sources of contamination are poultry litter and contaminated ground or carcasses (22. Botulism diagnosis in animals is based on specific clinical symptoms such as abnormal posture of the head. Central Veterinary Institute of Wageningen. patrick. the quick typing of botulism toxins is of major importance (36. botulinum type D.07568-11 3120 aem. have been reported (34. and Analysis and Development Laboratory 22. The tests were performed with a large variety of bacterial strains. and there are ethical considerations associated with the use of animals (6. 41). All BoNT subtypes act at the neuromuscular junction. 6). Netherlandse. Copyright © 2012. 21). botulinum in 292 samples collected from cases of botulism events in four European regions. are associated with avian and mammalian botulism. Among the 292 samples. died from type C botulism in the Blekinge archipelago in southeastern Sweden (37). poultry (n ‫ ؍‬60). more rarely. 38. there is a commercially available equine antiserum for types C and D. From 2003 to 2009. It occurs as sporadic cases and also massive outbreaks all over the world (5. and C. 46). Italyd. veterinarians need to quickly identify the nature of the disease.94%. Istituto Zooprofilattico Sperimentale delle Venezie.00 Applied and Environmental Microbiology p. 50). Supplemental material for this article may be found at http://aem. The disease is common in wild and domestic animals. Swedenb. more than 10. Istituto Superiore di Sanita ` Laboratorio Alimenti. A laboratory confirmation is also required to determine the BoNT serotype. an outbreak of avian type C botulism affected approximately 2. 3120 –3127 . and D-C (n ‫ ؍‬10). types C-D and D-C. Further investigations should now be performed in order to check that mosaic types dominate in Europe and that acquisition of mosaic types helps in survival or adaptation to particular niche. Ploufragan. All Rights Reserved. In Sweden from 2000 to 2004. provided by the NIBSC (Health Protection Agency. However.fach@anses. These PCR assays were compared to previously published real-time PCRs for the detection of C. In Korea. baratii (BoNT F). Food Safety Laboratory. Uppsala. other botulinum neurotoxin (BoNT)-producing Clostridium strains (n ‫ ؍‬20).org/ on April 9. 7). Treviso. blocking the release of acetylcholine interfering within the exocytose mechanism and thus leading to a flaccid paralysis (26. Furthermore. B In intensively farmed animals. The reliability of the results tallied to 97. Incheon. BoNT types A. Laboratorio di Treviso.org/.d Ilenia Drigo. the mouse bioassay has major drawbacks: it is timeconsuming and expensive. C. 33. In Europe. 144 were positive for either the bont/C-D or the bont/D-C gene by using the GeneDisc arrays. weakness. botulinum subtypes C. with the notable emergence of C. The reference method is currently the mouse lethality bioassay (standard mouse bioassay). primarily the C-D and D-C mosaic subtypes. C-D. Francef Clostridium botulinum types C and D. 36). were found in naturally contaminated samples whatever their animal origin and their geographical location. The majority of the samples originated from wild birds (n ‫؍‬ 108). Environmental and Occupational Health Safety).fr.asm. 38). These botulinum neurotoxins (BoNTs) are produced by anaerobic Gram-positive bacteria species such as Clostridium botulinum (BoNT A to F). In order to take appropriate measures. Finland also reported their first case of a bovine type C botulism outbreak in 2008 (35). including C. 43). Italyc. non-BoNT-producing clostridia (n ‫ ؍‬20). Lelystad. five outbreaks of botulism in water birds were reported over a 5-year period from 2004 to 2008. primarily Herring Gulls. Rome.asm. 168 cattle and 19 sheep botulism incidents were reported in England and Wales. C-D (n ‫ ؍‬29).f Dario De Medici. In October 2008. as well as their mosaic variants C-D and D-C.e Marie-Hélène Bäyon-Auboyer. followed by seroneutralization (8. suggesting a change in the source or epidemiology of botulism in the United Kingdom (39). and other bacterial species (n ‫ ؍‬23). butyricum (BoNT E).c Lucia Fenicia.org 0099-2240/12/$12. and D-C. C. Department of Bacteriology. Maisons-Alfort. Artificially contaminated samples of cecum showed a limit of detection below 50 spores/g. D (n ‫ ؍‬5). The seroneutralization test is used to dem- Received 16 November 2011 Accepted 7 February 2012 Published ahead of print 17 February 2012 Address correspondence to Patrick Fach.d Miriam Koene.1128/AEM.

In a recent study. C-D 138 Suffix: F. strain 003-9. botulinum. 48. whereas no other methodologies are currently able to differentiate these two subtypes. X71126. baratii. D38442*. strain C-Stockholm.nih. PCR-based assays have been recently developed for various bacterial diagnostic methods. in contrast to conventional PCR.asm. D-C 141 Downloaded from http://aem. P.ncbi. The specificity of the oligonucleotides for toxin gene-specific identification was checked by in silico analysis against the published sequences from the GenBank database using Basic Local Alignment Search Tool (BLAST) algorithm (http://www. ROX. bont/C-D. While not solving the shortcoming of the detection of bacteria instead of toxin. and bont/D-C. 42. strain OFD-05. All probes were 5=-labeled with 6-carboxy-x-rhodamine (ROX) and 3=-labeled with Black Hole Quencher (BHQ-2). S49407. D90210. 13.nih. 11. AP008983. botulinum types A. together with negative and internal amplifi- May 2012 Volume 78 Number 9 aem. 45). Primer pairs and probes were designed using the bont/C. France). bont/E. The C. botulinum type C and D GeneDisc array (GD1 C&D) contains the primer and probe sets C-I. D49440*. These oligonucleotides allowed the detection of C. two GeneDisc arrays were developed for the simultaneous detection of C. These PCR assays have been optimized to differentiate mosaic C-D and D-C strains from parental C and D strains. AB461916*. D-I. C-D 135 C. c GenBank accession numbers: bont/C.jp/). In the present study. but a negative result does not exclude the possibility of botulism since the toxin can be rapidly degraded (51). and reliable alternative biological techniques for the identification of BoNT-producing clostridia (6. probe. All primers and probes were purchased from Sigma-Aldrich (St. and EF378947*).ncbi.genome. AB461919*. specific. Quentin-Fallavier. AB037920*. strain 1873. each being tested for bont/C. easy to perform. onstrate the presence of BoNT in clinical samples and to identify the toxin type. B. X62389. C-II. AB037166*. recent research has focused on the development of rapid. France) for the screening of C. while only a few such genes have been detected by real-time PCR (25. Accession numbers labeled with stars indicated sequences of the mosaic types. 29). butyricum available in the National Centre for Biotechnology Information GenBank (http://www. 30. botulinum types C and D and mosaic types C-D and D-C for veterinary and epizootic study purposes. AB461915*. and D-II designed in the gene sequences encoding for the light chains (i. bont/D.asm. forward (primer). and bont/F genes. bont/D. bont/B. X54254. AB461921*. the accession numbers for bont/D and bont/D-C areAB012112. GD1 C&D was designed for the simultaneous examination of six different samples. AB200360. X62389. Design of GeneDisc arrays. 19. respectively. which are responsible for toxin production leading to human botulism (1–4. botulinum bont/A. 18. AB461914*.gov/BLAST). The GeneDisc arrays were evaluated for their specificity and sensitivity and used to investigate the neurotoxin gene profile (molecular toxinotype) of neurotoxinproducing clostridia involved in animal botulism across Europe. AB461918*. R. 31). 14. 17. and F in food samples (13). 28. AB012112. AB200364*. ABDQ01000029*. E..org/ on April 9. AB461920*. MATERIALS AND METHODS Primers and probes. 49). but without the possibility to differentiate nonmosaic and mosaic types. These primers and probes were designed by alignment of the neurotoxin gene sequences bont/A to bont/G from C. D-C 116 D. X53751. FN436021*. 24. AB200359. Two GeneDisc arrays were designed. the N-terminal portion) of BoNT/C and BoNT/D. 15. botulinum type C and D and mosaic type C-D and D-C bont genes. AY251553*. and bont/D-C gene sequences available (the accession numbers for bont/C and bont/C-D are AB061780. reverse (primer). PCR-based assays have the advantage of being rapid. AB461915. C. Thus. AB461917*.e. and FN436022*.org 3121 . Real-time PCR technique presents the advantages of being highly specific and sensitive with no need for a post-PCR detection assay. Black Hole Quencher. AB200361*. AB200362*. bont/C-D. BHQ.Characterization of BoNT-Producing Clostridia TABLE 1 Primers and probes Primer or probea C-I_F C-I_R C-I_P C-II_F C-II_R C-II_P C-III_F C-III_R C-III_P D-C_F D-C_R D-C_P D-I_F D-I_R D-I_P D-II_F D-II_R D-II_P D-III_F D-III_R D-III_P a b Sequence (5=–3=)b TCCTGGGAATAACAATACTC CTAGGTCCAGTTATTATAACAC [ROX]AACCCAGTTGTTACCTTGTCTAGTTT[BHQ2] GGGTCAAAATTTATCTCG AGCTCTCTACAATCTAATG [ROX]ATCCAGCATTAAGAAAAGTCAATCCT[BHQ2] TCAGCTTAATCCAATATTTCC GGGTTACTATAACTTTACCTC [ROX]CCCTGAACTACCTAATTTAAAGTCAAA[BHQ2] GACTGATTTAGTTCCACTAG GCATGGTTGTATTATAAACG [ROX]ACGTATCTCATCCATTGGTTGATC[BHQ2] TCCAGTAATAGCTTTAATGC TCCTCAAATTGTACGTTG [ROX]AAATCCCTCGCTAACTTGTGGAC[BHQ2] GAAGCATTAGGTTATAGCAATAAG TCCTCAACTACTTCATTCG [ROX]AGAATAAACCTGCTTGAACACCTTT[BHQ2] ATGGCAATATAGAATGGA ACCCCATTATATTATTAGTTATAG [ROX]ATCCTGTATGACTTAATGATTCACT[BHQ2] Target bont types C. X72793. 6-carboxy-x-rhodamine. and highly specific. we described the advantage of using macroarrays such as the GeneDisc array from Pall-GeneDisc Technologies (Bruz. AB200358. D-C 77 D-C 82 D. A large number of studies have focused on the detection of C. X66433. AB200360*. respectively. and C.and bont/D-specific gene targets. AB200363*. 2012 by guest D. Several studies have also reported on the detection of type C (bont/C) and type D (bont/D) genes by conventional PCR (9. The primers and probes used in the present study are listed in Table 1.gov/GenBank/) using the multi-alignment program CLUSTAL W (http://align. C-D Positionc 348–367 485–464 441–416 1233–1250 1367–1349 1253–1278 2697–2717 2773–2753 2745–2719 3561–3580 3642–3623 3612–3589 666–685 806–789 771–749 1696–1719 1811–1793 1783–1759 2949–2966 3086–3063 3038–3014 Amplicon size (bp) 135 C.

and negative results for C-II. we looked at the positive signals for C-II and D-III. bont/C-I. France). microwell 5. negative PCR control together with the PCR internal amplification control. D-C (targeting specifically the mosaic D-C). The negative PCR control and internal amplification control are part of the GeneDisc technology. BoNT/Ab. showing that they could be easily transferred and adapted to the GeneDisc technology (data not shown). The primers and probes incorporated in the GeneDisc arrays were previously validated on a LightCycler 480 (Roche Diagnostics. Bacterial strains and growth. To validate a C. D-I. the tests were performed in accordance with European Directive 86/609&EEC on the protection of animals used for experimental and other scientific purposes. D-III. For a type D-positive result to be valid. 1. Schematic locations of the various primers and probes used in the assays are shown in Fig. microwell 3. and the negative control. together with the IAC. and the negative control.org/ on April 9. To validate a C. together with the IAC. and D-II. microwell 2. and paralysis) for up to 4 days. bont/D-II. D-II. D-II. botulinum type D-C-positive result. and microwell 6. bont/D-III. five type D (strain 1873 as the bont/D reference). and we used the same DNA sample concentrations as those used in the GeneDisc assays. The specificity was evaluated with 12 C.org Applied and Environmental Microbiology . Briefly. The C. and BoNT/F) were evaluated as negative controls.5 ml of 10-fold serial dilutions was then injected intraperitoneally into Swiss male mice (two mice per sample).asm. Downloaded from http://aem. 28). positive signals were required for C-I and C-II. D-C. botulinum type C-positive result. and the mice were monitored for the characteristic symptoms of botulism (labored breathing. D-III. and the negative control. D-C. For a type C-positive result to be valid. C-III. D-C. Each sector had the following settings: microwell 1. D-II. Botulinum toxins were confirmed. To validate a C. bont/C-III. Primers are incorporated at final concentrations of 600 nM and probe is incorporated at final concentrations of 400 nM. microwell 2. microwell 5. and types were identified by using a seroneutralization test on mice with specific botulinum antitoxins for types C and D (Istituto Superiore di Sanita ` . allowing detection and also distinction between nonmosaic and mosaic gene types. botulinum type D-positive result. together with the IAC and the negative control. GeneDisc spotting and manufacturing were performed by Pall GeneDisc Technologies. A volume of 0. and negative results for C-III. BoNT/B. negative PCR control. cation controls. and 10 mosaic type D-C (strain 4456/11 as the bont/D-C reference) strains. together with the IAC and the negative control. All BoNT-producing Clostridium strains were toxinotyped by a reference mouse bioassay according to the previously described method (7). and D-III (targeting the heavy chain of BoNT/D). Twenty strains of other clostridial species were used as non-BoNT- 3122 aem. microwell 4. and negative results for C-II. and microwell 6. Schematic locations of the various primers and probes used in the assays are shown in Fig. Highly homologous domains are represented with the same pattern. C-III. 2012 by guest FIG 1 Position of oligonucleotides. botulinum mosaic type C-D-positive result.D&mosaic) contained the primer and probe sets C-II (targeting the light chain of BoNT/C). botulinum type C and D and mosaic GeneDisc array (GD2 C. 1. To confirm the results obtained with the two GeneDisc arrays. botulinum type C (strain C-Stockholm as the bont/C reference). and the negative control. together with the IAC. together with the IAC. GD2 C. bont/D-C. bont/C-II. microwell 4. C-II. and D-III oligonucleotides. and the negative control.Woudstra et al. PCR internal amplification control (IAC). Italy). D-II. 2 ml of the enrichment culture (48 h) were centrifuged and 1 ml of the culture supernatant was incubated with 200 ␮g of trypsin/ml for 20 min at room temperature. and negative results for D-I. together with the IAC. and the negative control. BoNT/E. 29 mosaic type C-D (strain 07-BKT002873 as the bont/C-D reference). The real-time PCR conditions were identical to those previously published. D-C was specifically designed to detect only C. This allows the detection of N-term part of the neurotoxin genes and also allows the detection of but not distinction between nonmosaic and mosaic genes types. pinching of the waist. bont/C-II. The GeneDisc is preloaded with desiccated PCR primers and fluorescent TaqMan probes labeled with the reporter dye 6-carboxy-x-rhodamine (ROX. It targets both the N-terminal and C-terminal parts of the neurotoxin genes. The selected strains used in the present study are listed in Table 2.asm. positive signals were required for D-I and D-II. we considered the positive signals for C-II and C-III. and negative results for C-I. A total of 20 BoNT-producing Clostridium strains (BoNT/A.D&mosaic used the following settings: microwell 1. Meylan. all strains and naturally contaminated samples were tested on the LightCycler 480 using previously published conventional real-time PCR systems (25. we validated the positive signals for D-II and D-III. bont/D-II. botulinum mosaic type D-C. GD2 C. microwell 3. D-II (targeting the light chain of BoNT/D). D-C.D&mosaic contains the C-II. C-III (targeting the heavy chain of BoNT/C). Rome. C-II. and negative results for D-C. bont/D-I. 575 to 602 nm). together with the IAC. and D-II oligonucleotides. To validate a C. GD1 C&D contains the C-I. we considered the positive signals for C-III. These oligonucleotides were designed to target both the N-terminal and the C-terminal parts of the bont/C and bont/D genes permitting the detection and specific identification of nonmosaic types and mosaic types.

beijerinckii. botulinum type D (1873) C.64 98. botulinum type C-D (07-BKT002873) C. C. S. Samples of chicken cecum (1 g) that previously tested negative for the presence of C.09 Ϫ3. C.9997 0.9928 0. botulinum type C (C-Stockholm) Primers and probes C-I C-II C-III D-I D-II D-III C-I C-II D-III D-I D-II C-III D-C LOD (fg) for DNAa 66 66 66 38 38 38 70 70 70 103 103 103 103 Genome equivalentsb 21 21 21 15 15 15 22 22 22 40 40 40 40 R2c 0. or in broth-fortified cooked meat medium (27). Genome equivalents were calculated based on the masses of the genomes of C. enterica serovar Enteritidis. Staphylococcus aureus. Spiking of chicken cecum samples with a known concentration of botulinum spores was performed to evaluate the performance of the enrichment protocol and to determine the capability of detecting a low number of spores. DE). C. sporogenes. C. botulinum strains were grown overnight in Trypticase-peptone-glucoseyeast extract (TPGY) broth at 30°C under anaerobic conditions. enterica serovar Typhimurium.36 106. Citrobacter sp. May 2012 Volume 78 Number 9 aem.org/ on April 9. All experiments were performed in triplicate.9984 0..D&mosaic PCRb 12 29 5 10 7 4 2 3 2 1 1 1 20 23 C C D D – – – – – – – – – – C C-D D D-C – – – – – – – – – – C C D D – – – – – – – – – – –. e The efficiency was calculated based on the following formula: E ϭ Ϫ1 ϩ 10Ϫ1/slope.9990 0. d The slope was calculated based on logarithm dilution plotted against their corresponding threshold cycles (CT). C. botulinum types C (C-Stockholm). C. CA). 29). Each dilution was tested in triplicate. Shigella sp. botulinum type C (strain Stockholm). and the Automatic Microlab Starlet System (Hamilton. baratii. 2012 by guest TABLE 3 Limit of detection of GeneDisc arrays GeneDisc array data Purified genomic DNA type (strain) C. bifermentans. sordellii. After culturing.9962 0. Spore solutions from C. enterica serovar Hadar. The PCR efficiency was assessed for each primer-probe combination with a serial dilution in accordance with the correlation coefficient (R2). septicum. C. and D-C (OFD-05) were used to determine the limit of detection (LOD) of the PCR assays. 1 ml of the cell cultures was DNA extracted using different protocols.9989 0.27 –3. Pseudomonas sp. edematiens. chauvoei. enterica serovar Infantis.74 110. botulinum type D-C (OFD-05) a b LOD. of Reference strains GD1 C&D GD2 C. Purified DNAs were quantified prior to serial dilution by using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific.17 Ϫ3. The first spore dilution for which no visible growth was recorded was also included in the experiment (Ͻ1 spore/g). C.01 Ϫ3. S. perfringens type C.9969 0. D (NCTC 1873).58 102. C-D (07BKT002873). Proteus sp. Austin. butyricum.44 Ϫ3. Paris.39 96.75 99. Salmonella enterica serovar Virchow.33 Ϫ3. France).48 114. Twenty-three strains of other bacterial species were also analyzed as non-Clostridium negative controls. spirogenes. C.52 95.. C.35 –3. botulinum types C (2. Klebsiella pneumoniae. no amplification. cereus. C.61 C. S. difficile.404 bp) and on the assumption that the average mass of a base pair is 650 Da. botulinum in a test sample that was reproducibly detected in three experiment sets. such as a phenol-chloroform method (16).asm.76 95.379. Downloaded from http://aem.66 94. LOD was the lowest amount of C. 28). C. d Non-Clostridium strains tested: Bacillus anthracis. DNA extraction.46 Ϫ3. B. C.11 Ϫ3. type C-D (strain 07-V891). perfringens type A.. c Non-BoNT-producing Clostridium strains tested: C. botulinum were inoculated with 50 and 100 spores of each strain.33 98. The C.9981 0.41 Efficiency (%)e 109. TX). It was expressed as the genomic copy number after converting the total genomic DNA from each strain. a DNeasy blood and tissue kit (Qiagen.961.asm. and Yersinia enterocolitica. perfringens type E. C.. B.43 Ϫ3.186 bp) and D (2. or type D (strain CIP-105256) were prepared and titrated by the five-tube most-probablenumber (MPN) method as previously described (10. in brain heart infusion medium (Difco.34 Ϫ3. Streptococcus faecalis.9984 0. Chelex 100 (Bio-Rad Life Science Research. mangenotii. and C. C. DNAs from C.36 Ϫ3. tetani. A volume of 1 ml was then subjected to DNA extraction using a DNeasy blood and tissue kit (Qiagen) and analyzed with GeneDisc arrays GD1 and GD2 (Table 4). producing negative controls. Escherichia coli.9933 0.Characterization of BoNT-Producing Clostridia TABLE 2 Specificity of GeneDisc arrays GeneDisc and PCR specificitya Strain Clostridium botulinum Type C Type C-D Type D Type D-C Type A Type B Type Ab Type E Toxic Clostridium butyricum type E Clostridium botulinum type F Toxic Clostridium baratii type F Clostridium botulinum type G Non-BoNT-producing clostridiac Non-Clostridium bacteriad a b No.40 99. limit of detection. Hafnia alvei. S.9973 0. C.9925 0. Performed as described previously (25. regression correlation coefficient. Spiking experiments. Listeria monocytogenes. Hercules. perfringens type D. employing a MegaMax total nucleic acid isolation kit (Ambion. DNA was stored at Ϫ20°C until analysis. Wilmington. Nevada).org 3123 . Spiked samples were enriched and incubated under anaerobic conditions in prereduced TPGY medium for 48 h at 30°C. subterminale. c 2 R . The LOD was determined using serial 10-fold dilutions of genomic DNA over a range of 6 orders of magnitude (Table 3). thuringiensis. Germany).9941 Sloped Ϫ3. Nonclostridial strains were grown in brain heart infusion medium at 37°C for 24 h. according to manufacturers’ instructions for Gram-positive bacteria. Hilden.

showing that the samples carried no significant levels of PCR inhibitors. Spiking experiments.61 4. were tested with GeneDisc arrays GD1 and GD2 for the presence of C. strains of mosaic type C-D (n ϭ 29). revealing high PCR efficiencies (Table 3).55 1. botulinum type C (n ϭ 12). C-D (strain 07-BKT002873).67 0. and both GeneDisc arrays were able to detect the bont genes in all spiked cecum samples tested with a limit of detection below 1 to 50 spores/g (Table 4).78 27.42) with the GeneDisc arrays but was negative with the reference PCR systems.01. Sensitivity study. The slopes ranged from Ϫ3. and the factors behind the outbreaks are not well identified. All spiking experiments were performed in triplicate.95 25.48 1. 120 naturally contaminated samples were collected by Analysis and Development Laboratory 22 (Brittany. B. 144 were tested positive for either the bont/C-D or the bont/D-C gene by using the GeneDisc arrays.4 Mbp) strains. F. DISCUSSION Downloaded from http://aem.Woudstra et al. Naturally contaminated samples. Molecular genotyping of bont/C and bont/D genes using the GeneDisc arrays perfectly matched the results of the conventional real-time PCR used as reference (Table 2) and those of the standard mouse bioassay (data not shown). D (strain NCTC 1873). Lastly. It has become an emerging and serious problem in poultry flocks and waterfowl in Sweden for the last few years (37) and in other European regions (35).D&mosaic CT 34. C-D.08 0. Enrichment broths of chicken cecum samples (1 g) spiked with C. botulinum spores. Netherlands). 110 were type C-D.79 1. Of these. The results are summarized in Table S1 in the supplemental material.40 to 114. Little is known regarding the epidemiology of the disease.85 34.46 35.46 to Ϫ3. No amplification was observed with the GeneDisc arrays when 20 non-BoNT-producing clostridial and 23 nonclostridial bacterial DNAs were used as a template (Table 2).60 Toxin type (strain) C (C-Stockholm) Estimated no. 24 were type D-C. TABLE 4 Use of GeneDisc arrays for testing spiked cecum samplesa GD1 C&D CT 35. Purified genomic DNA of C. botulinum types C (strain C-Stockholm).99 23. mostly due to the absence of methods able to 3124 aem. The DNA concentrations were converted to genomic copy number. The PCR assays included negative and internal inhibition controls to exclude PCR inhibition by the sample material: all samples yielded positive results for the internal amplification control and negative results for the negative control.14 33. SD here indicates the standard deviation of the mean CT values for the whole experiments.asm.09 27.58 2.org Applied and Environmental Microbiology . The data obtained with the GD1 and the GD2 arrays correlated perfectly and showed no discordant results: the agreement between the GD arrays and previously published real-time PCR systems used as a reference reached 97.60 34. and G toxin tested negative with GeneDisc arrays GD1 and GD2.21 1.D&mosaic.00 GD2 C. and D-C (strain OFD-05) were used as references for determining the LODs of the GeneDisc arrays.90 18. Italy) during botulism outbreaks reported in 2010. The results were consistent with the toxin types.78 31.08 24. After 48 h of incubation at 30°C.00 21.08) were negative in the GeneDisc arrays. The supernatant was discarded. Specificity was evaluated on genomic DNA extracted from strains of C. The 20 strains of BoNT-producing clostridia expressing types A.00 0. as determined with conventional approaches (data not shown). A total of 292 naturally contaminated samples collected across Europe during animal botulism events reported in the last few years were investigated (see Table S1 in the supplemental material).16 23. and 1 sample was detected as type D-C (CT ϭ 34. botulinum types C. strains of type D (n ϭ 5).99) between the threshold cycle (CT) values and the template concentration over a range of 6 orders of magnitude.22 1. The LOD was determined using triplicate serial dilutions of each DNA strain and ranged from 15 to 40 genome copies using the BoNT GeneDisc arrays with PCR efficiency ranging from 94. among a total of 292 samples. Of 292 samples. Only 4 of the samples detected as type C with the conventional real-time PCR test (CT ϭ 36.94%. All samples gave positive results for the internal amplification control. Of these them.18) was negative with the GeneDisc arrays. RESULTS Specificity study. The results obtained with the GeneDisc arrays GD1 and GD2 on these strains were consistent with conventional real-time PCR assays used as reference (Table 2). 1 sample detected as type D (CT ϭ 38.62 21. Italy) during botulism outbreaks recorded from 2006 to 2009. Most of the samples (n ϭ 181) were tested in the mouse lethality bioassay. The prevalence of mosaic strains in Europe has also remained unclear. Another 36 naturally contaminated samples were collected by the Istituto Zooprofilattico Sperimentale delle Venezie (Treviso. E.59 SD 1.000 ϫ g for 5 min. Molecular toxinotyping of neurotoxin-producing clostridia in naturally contaminated samples gathered in Europe. of spores/g Ͻ1 50 100 Ͻ1 50 100 Ͻ1 50 100 C-D (07-V891) D (CIP-105256) a Cecum samples were inoculated with the estimated number of spores as determined by MPN and tested with the GeneDisc arrays GD1 and GD2. assuming that the size of each strain’s genome is equal to those of the sequenced C. and 9 were detected as both types C-D and D-C.25 0. France) during animal botulism epizootic events identified in France in 2009.74% (Table 3). botulinum types C (2.asm. An additional 112 naturally contaminated samples were collected by the Istituto Superiore di Sanita ` (Rome. and the cell pellet was subjected to DNA extraction using either a DNeasy blood and tissue kit or Chelex 100 (Bio-Rad) according to the manufacturer’s instructions.16 2. with spiking levels ranging from 0 to 100 spores. Naturally contaminated samples (n ϭ 292) from animal botulism events reported in different European regions in the last few years were analyzed for the presence of C. and D-C.92 1. botulinum. 1-ml aliquots of the enrichment broths were collected and centrifuged at 9. and all were tested for their neurotoxin gene profile (molecular toxinotype) using conventional real-time PCR systems as reference methods (25. and strains of mosaic type D-C (n ϭ 10).9 Mbp) and D (2.16 30. 2012 by guest Animal botulism is a worldwide problem that causes large economic losses since it affects cattle and other livestock (39).50 2. 28) and the GeneDisc arrays GD1 C&D and GD2 C. Each sample (1 g) was 10fold diluted (wt/vol) and then incubated in anaerobic conditions in prereduced TPGY medium. The GeneDisc arrays yielded specific positive signals with the various toxin type-specific detection systems of the BoNT GeneDisc arrays.49 to 38.65 18.34 2. D. 24 naturally contaminated samples were collected in 2011 by the Central Veterinary Institute (Lelystad.23 SD 0. All real-time PCR assays of the GeneDisc arrays showed a strong linear correlation (R2 Ͼ 0.03 4.org/ on April 9.

pigeon. turkey.and BoNT/D-producing clostridial strains. and raw material were determined to be negative. mink. However. our data support that mosaic gene types are common in Europe. Positive results were only valid when both targets were amplified. pigeons. 28). The GeneDisc arrays GD1 and GD2 described here provide a reliable alternative detection tool for the routine diagnostics detection and molecular typing of the neurotoxin genes of C. rabbit. 292 naturally contaminated samples from various origins (bovine. which counted only viable cells. Of the 292 samples tested. smaller numbers of dead cells were probably also present in these samples. botulinum bont/C. All results obtained with GD2 were concordant with the GD1 results. botulinum subtypes. the GeneDisc arrays GD1 and GD2 provided a double-detection system per target. and bont/D-C genes. The lowest LOD was observed for C.org 3125 . The method is not a substitute for a standard mouse bioassay. feed. and decrease the cost of analysis. botulinum types C. bont/C-D. In contrast to many other diagnostic tests. whereas C-D types were highly represented among isolates from several avian species. was also evaluated by testing the recovery of known quantities of inoculated spores of C. and the data were compared to former published real-time PCR tests used as reference methods during the present study (25. partridge. GD1 was able to detect bont/C. The results were generated without the need for specifically trained personnel. horse. bont/C-D. botulinum types C and D and the corresponding mosaic types C-D and D-C. including enrichment and analysis by the GeneDisc arrays. were also reported for the samples inoculated with Ͻ1 spore/g. and wild duck) were tested. coot. and bont/D-C genes of BoNT-producing clostridia since no cross-reaction was observed with other BoNT-producing clostridia and other bacterial species. Data obtained with both GeneDisc arrays GD1 and GD2 showed 97. goose. The total assay time included the enrichment step (48 h). the hypothesis of clonal spreading of the mosaic gene types in Europe cannot be supported. heron. These types might also possibly be missed due to incomplete serological toxinotyping in diagnostic laboratories. In the present study two GeneDisc arrays (GD1 C&D and GD2 C. 144 were determined to be positive. environment.org/ on April 9. herring gull. maggot. moorhen. The aim of the present study was to assess both GeneDisc arrays in an investigation of animal botulism events occurring in different geographic regions within Europe and to gain further insight regarding the neurotoxin gene profiles (molecular toxinotype) of these neurotoxin-producing clostridia. botulinum type D (15 genome copies). Interestingly. and D in spiked cecum samples. but it can be used to reduce the number of animal tests. The GeneDisc arrays GD1 and GD2 were found specific for detecting bont/C. swan. It may be hypothesized that acquisition of mosaic types helps in survival or adaptation to a particular niche. Moreover. Since the GeneDisc arrays contained an internal amplification control. bont/D.asm. and the highest LOD was reported for C.18) strengthened this hypothesis. mallard. In order to test the applicability of the GD1 C&D and GD2 C.94% agreement with the real-time PCR tests used as references (25. Further investigations in other regions across Europe should be performed in order to consolidate the current data and study the prevalence of mosaic types C-D and D-C. botulinum types. raw material. C-D. 44).Characterization of BoNT-Producing Clostridia discriminate nonmosaic from mosaic C. thus increasing the specificity of the system. no strain could be isolated during the present study. all positive samples were recorded as mosaic types C-D or D-C irrespective of the nature of the samples and the regions where they were collected. 2012 by guest May 2012 Volume 78 Number 9 aem. pheasant. Such GeneDisc arrays offer important tools to veterinary laboratories. probably because the neurotoxin genes are mediated by bacteriophages and hence easily lost through laboratory experiments.D&mosaic) based on real-time PCR were developed for detecting the neurotoxin genes carried by C. The mosaic types are probably underdiagnosed since most of the PCR assays described in the literature failed to distinguish mosaic neurotoxin gene types from nonmosaic types C and D. peewit gull. Positive re- sults. offering also the possibility of differentiation between nonmosaic and mosaic types. poultry. This can be explained by the fact that the concentrations were based on the MPN method. guinea fowl. The identification of the bont type by the PCR assays correlated very well with the BoNT toxinotyping mouse bioassay. rat. the results obtained with the GeneDisc arrays GD1 and GD2 allowed clear discrimination between nonmosaic and mosaic types. These results confirmed that both GeneDisc arrays GD1 and GD2 were suitable for the rapid and specific molecular characterization of BoNT/C. In the absence of sequences of the entire toxin genes from strains derived from the samples investigated here.D&mosaic arrays for the investigation of botulism outbreaks across Europe. The LOD of the GeneDisc arrays was determined using serial dilutions of clostridial DNA as a template. bont/C-D. botulinum types C and D is really challenging. The CT values of these discrepancies (between 36. botulinum types C and D and their mosaic C-D and D-C variants. GD2 was designed to confirm the GD1 results and to differentiate between nonmosaic and mosaic C. the DNA extraction (30 min). the discrepancies observed between the two methods were not attributed to PCR inhibition but were most probably due to uncertainty of detection in case of very low levels of contaminants. 28). Despite considerable efforts to isolate strains from the positive samples. dog. botulinum type D-C (40 genome copies).49 and 38. and only samples collected from horses. bont/D. although with high CT values. No cross-reaction was observed with other clostridia and other bacterial species that are frequently isolated from environmental samples. Isolation of C. The LOD of the complete method. The high efficiency and coefficient of correlation characterizing the various PCR assays presented here emphasize that the primers and probes used in these assays are highly sensitive for the detection of C. and bont/D-C genes but did not differentiate between nonmosaic and mosaic types. and the PCR detection (Ͻ1 h). pochard. and the assays were performed in a very short time. gallus. Italy. Identification of the mosaic types represents an improvement in regard to the current PCR approaches since it could be used for epidemiological purposes and for bont/C and bont/D gene profiling. bont/D. However. and the Netherlands were tested blindly with GD1 and GD2. The data have shown that D-C types were highly represented among the bovine isolates. coypus. providing data in only 2 days after receiving the sample. The LOD for artificially contaminated cecum samples was found to be Ͻ50 spores/g irrespective of the strains used for spiking. which can partly explain the observed differences regarding the LOD values. Type C and D bont genes are carried by circular plasmid prophages that express unstable lysogeny in the bacteria (12. allowing epidemiologists to better investigate the neurotoxin gene profiles (molecular toxinotype) of neurotoxin-produc- Downloaded from http://aem.asm. shorten the time to result. This might result in mosaic types being found more frequently than usually expected. Samples gathered from France. egret.

1995.) Prevot V. Serological classification and typing of Clostridium botulinum.000 farmed foxes and minks in Finland. Skarin H. J. A PCR approach to determine the distribution of toxin genes in closely related Clostridium species: Clostridium botulinum type C and D neurotoxins and C2 toxin. 1976. Detection of Clostridium botulinum types A. Livesey CT. Braconnier A. Fach P. 2005. Methods 67:416 – 423. 25:186 –190. How botulinum and tetanus neurotoxins block neurotransmitter release. 2003. Knutsson R. Roest HI. Vet. Public Health 53:45– 47. SYBR green real-time PCR method to detect Clostridium botulinum type A. Appl. Lett. Chaffer M. Moriishi K. 23. Vet. Microbiol. Otter A. Botulism outbreak associated with poultry litter consumption in three Brazilian cattle herds. Microbiol. Rev. Clostridium botulinum: monovalent and polyvalent antitoxins. Singh BR. 146:118 –123. 32. 34. 5. and E in cooked chilled foods containing vegetables and raw material using polymerase chain reaction and molecular probes. Microbiol. 2004. J. Microbiol. F producing Clostridium botulinum. 2005. Emergence of suspected type D botulism in ruminants in England and Wales (2001 to 2009). J. 39. Application of PCR for detection of Clostridium botulinum type D in bovine samples. 195:1–29. 1998. and F in foods by PCR and DNA probe. Poulain B. Microbiol. Curr. 43:4342– 4348. Grinberg K. Caldiani C. Haagsma J. Botulism diagnostics: from clinical symptoms to in vitro assays. Type C botulism due to toxic feed affecting 52. Gibert M. et al. 12. Type C bovine botulism outbreak due to carcass contaminated non-acidified silage. First case of type E wound botulism diagnosed using real-time PCR. 4. Hill BJ. Popoff M. Dermatol. associated with exposure to broiler litter. Can. Clin.org/ on April 9. 2001. REFERENCES 1. 28. Fenicia L.org Applied and Environmental Microbiology . Fach P. et al. 1997. GA. 195:55–75. 27. Båverud V. et al. Development of real-time PCR tests for detecting botulinum neurotoxins A. Mosaic structures of neurotoxins produced from Clostridium botulinum types C and D organisms. E. 1996. C-D (strain 6813. Lindberg A. Acta 1307:123–126.) Hatheway CL. Appl. 38. clinical. 32:175–183. Microbiol. 2009. et al. 19. Popoff MR. Micheau P. 13. Douek DC. Lonchamp E. 30. 156:438 – 441. Epidemiol. 1980. 2009. Ann. 17:301–305. 29. 31. Humeau Y. Microbiol. Holst E. 22. 35. 116:663– 669. Curr. European Commission–Directorate General Home Affairs. Med. PCR and gene probe identification of botulinum neurotoxin A-. Investigation of animal botulism outbreaks by PCR and standard methods. F and other botulinum neurotoxin-producing clostridia based on the GeneDisc cycler. Microbiol. Grant KA. 11. Pospischil A. Japan. Evidence that botulinum C2 toxin has two dissimilar components. Elad D. Microbiol. Downloaded from http://aem. (In Dutch. Nakamura K. 19:298 –314. et al. food. 8. Iwasaki M. Immun. B-. FEMS Immunol. B Infect. 2000. Immunol. and Clostridium novyi alpha toxin. Interconversion of type C and D strains of Clostridium botulinum by specific bacteriophages. and D-C (strain OFD-05). De Medici D. Appl. Wildl. 14. 42:4718 – 4725. Crit. Centers for Disease Control and Prevention. et al. 37. 17. We also acknowledge the DIM malinf Ile de France for financial support of the project. J. 1983. Sakaguchi G. Osaka. Top. 67:5694 –5699. and the European Commission cannot be held responsible for any use which may be made of the information contained therein. Microbiol. Feige K. and F in food and fecal material. J. Rev. Microbiol. Tijdschr. Int. Biochim. 1974. Fenicia L. 43:327–336. 27: 251–258. Poulain B. The data obtained here indicate that mosaic types C-D and D-C are predominant in the samples gathered in the regions investigated. Popoff MR. J. 18. Environ. 42. Akbulut D. 34:882– 885. Gimenez JA. Immunol. Clin. Microbiol. Grant NJ. Ortolani EL. 1987.asm. Microbiol. Baum M. Asensio MA. Mechanisms of action of botulinum toxins and neurotoxins. 1996. De Man JC. Microbiol. Mazuet C. 168:640. Clin. Med. Real-time PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene. Aureli P. Environ. Anniballi F. Botulism: the present status of the disease. Griffais R. 2001. Ohishi I. Vet. PCR for detection of Clostridium botulinum type C in avian and environmental samples. 1995. E-. Bjorkman P. Med. Microbiol. 61:389 –392. Appl. 2006. 33. Lindstrom M. and evaluation in food samples. Stand. Biol. Hum. Venereol. corrected. 2012 by guest 3126 aem. 45:3589 –3594. Smith TJ. who kindly provided the DNAs of C. Microbiol. 2010. alpha-toxin (phospholipase C) gene from Clostridium perfringens. 40. Vet. 56:196 –201. Laboratory diagnostics of botulism. Microbiol. Fach P. Improvement in laboratory diagnosis of wound botulism and tetanus among injecting illicit-drug users by use of real-time PCR assays for neurotoxin gene fragments. Molgo J. Universal and specific quantitative detection of botulinum neurotoxin genes. 75:6457– 6461. Detection by in vitro amplification of the 25. Clostridium baratii. Osaka Prefecture University. Microbiol. Atlanta. 13:279 –285. Popoff MR. Jover E. J. Aranda E. Toxicol. 10. Blomqvist G. Atlanta. et al. 2009. 33:109 –125. ACKNOWLEDGMENTS This research was supported by the framework of the EU AniBioThreat (grant agreement Home/2009/ISEC/AG/191) project with financial support from the Prevention of and Fight against Crime Programme of the European Union. Characterization of the D/C mosaic neurotoxin produced by Clostridium botulinum associated with bovine botulism in Japan. Hogg RA. Bacteriol. 74:61– 66. J. Sharma S. Popoff MR. 24. 26. 1997. 2007. Arnon SS. Rec. 2006. Eur. (In French. 2009. ing clostridia associated with animal botulism across Europe. Payne JH. McLauchlin J. F-. 1996. Environ. Lindstrom M. et al. Environ. Appl. 1995. We thank Sophie Roussel for helpful comments during the writing of the paper. Lindstrom M. Poxton IR. 39:89 –92. et al. Eklund MW. p 17–20. J. 1995. Botulism in cattle: a review. J. 20. 44:493– 495. This publication reflects the views only of the authors. 2010. Microbiol. and laboratory workers. Braun U. Centers for Disease Control and Prevention. Biophys. botulinum types C (strain CB-19). Screening for clostridium botulinum type A. 15. Franciosa G. Dis. 145(Suppl 1):S145–S151. Centers for Disease Control and Prevention. Clin. 3. Centers for Disease Control and Prevention. Botulism in United States: 1899 –1966. GA. 1991. Perelle S. Food Prot. 73:2891–2896. Guillou JP. Biochimie 82:427– 446. and Clostridium butyricum. Doussau F. 136(Suppl 4):S73–S76. Poysky FT. Multiplex PCR for detection of botulinum neurotoxin-producing clostridia in clinical. Dev. Multiplex PCR assay for detection and identification of Clostridium botulinum types A. 41. Neimanis A. An outbreak of type C botulism in herring gulls (Larus argentatus) in southeastern Sweden. Food Microbiol. Schweizer G. 2011. Appl. Myllykoski J. Vet. Vet. Skerry JC. An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A. B. et al. 16. B. Gimenez DF. Fach P. Cai S. 2. 6. Microbiol. 2007. E. 29:390 –394. Clinical findings and treatment of 30 cattle with botulism. 9.asm. Ecology of neurotoxigenic strains of clostridia. 2007. Rodriguez MM. Guillou JP. and G-producing Clostridium spp. Cronqvist J. Molad T. Martin S. B. Top. Aureli P. 2007. In Prevention: handbook for epidemiologists. Griffais R. MPN tables. Microbiol. 2007. Kouguchi H. Rec. Biotechnol. B. 27:1–9. Appl. Diergeneeskd. Infect. 107:465– 473. and environmental samples. J. Appl. 36. et al. Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples. also covering a chimeric C/D sequence: application on outbreaks of botulism in poultry. E. Gimenez DF. Delibato E. We also thank Shunji Kozaki and Keiji Nakamura.Woudstra et al. J. Dis. B. 2006. 2010. Fach P. Radstrom P. 21. Korkeala H. Vet. Vet. Infect. Int. J.003-9). Artin I. 2007. Heffron A. 10:267. D (strain 1873). Gibert M. 1993. 2011. 7. De Medici D. Food Microbiol. J. Quantitative detection of gene expression and toxin complex produced by Clostridium botulinum serotype D strain 4947. Zoonoses Public Health 54:320 –327. BMC Microbiol. J. 64: 201–207. Clostridium botulinum type D intoxication in a dairy herd in Ontario. The typing of botulinal neurotoxins. 137:284 –293. 140:147–154. Cordoba JJ. Clin. et al. Appl. E.

et al. 2009. 40:5–11. Takeda M. 46. Sensitivity of mouse bioassay in clinical wound botulism. 44. An outbreak of type C botulism in waterbirds: Incheon. S. Vugia D. Montecucco C. 130:398 – 400. 2008. 46:912–917. et al. Trueman KF. 2005. 48:1669 – 1673. J.asm. 45. Vet. Rossetto O. 49. Woo GH. et al. Presynaptic enzymatic neurotoxins. Morbiato L. Proc.org 3127 May 2012 Volume 78 Number 9 . et al. 2010. 46:951–955. Rigoni M. Wildl. Korea. Acad. et al. Med. Infect. Clin. 1996. 47. et al. J. J. Korea. 2005. and F. 51. 2006. Suspected botulism in three intensively managed Australian cattle herds.org/ on April 9. The genome sequence of Clostridium botulinum type C neurotoxin-converting phage and the molecular mechanisms of unstable lysogeny. 2012 by guest aem. Neurochem. Inami G. Rec 162:409 – 412. 2010. 59:55– 64. Vet. Sharpe AE. J. Characterization of the neurotoxin produced by isolates associated with avian botulism. 1992. Natl. Sci. Major outbreak of suspected botulism in a dairy herd in the Republic of Ireland. Satterfield BA. B. Dis. Takeshi K. 2010. Avian Dis. 97:1534 –1545.Characterization of BoNT-Producing Clostridia 43. Caccin P. Microbiol. Outbreak of botulism (Clostridium botulinum type C) in wild waterfowl: Seoul. Mohle-Boetani J. Shin NR. 50. Sakaguchi Y. A. Dis. Simple method for detection of Clostridium botulinum type A to F neurotoxin genes by polymerase chain reaction. A quadruplex real-time PCR assay for rapid detection and differentiation of the Clostridium botulinum toxin genes A. Microbiol. et al. U. Immunol. Wheeler C. Dis. 52. 48. Downloaded from http://aem. et al. Wildl. 102:17472–17477. 49:376 –381. Rec.asm. E.

Sign up to vote on this title
UsefulNot useful