P. 1
Adn - Informe

Adn - Informe

|Views: 1|Likes:
Published by Confidant Prado

More info:

Published by: Confidant Prado on Sep 05, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOCX, PDF, TXT or read online from Scribd
See more
See less

09/05/2013

pdf

text

original

AÑO DE LA INVERSIÓN PARA EL DESARROLLO RURAL Y LA SEGURIDAD ALIMENTARIA

“UNIVERSIDAD PERUANA UNIÓN”

ADN

PRESENTADA POR: ROJAS SAMANIEGO, Cecili Jeanneth

ESCUELA PROFESIONAL Informática Empresarial LIMA – PERÚ 2013

citosina y guanina a lo largo de la cadena de ADN es lo que determina las instrucciones biológicas que contiene.ADN ¿Qué es el ADN? ADN = ÁCIDO DESOXIRRIBONUCLEICO Es la sustancia química donde se almacenan las instrucciones que dirigen el desarrollo de un huevo hasta adulto. llamados ácido desoxirribosas. la guanina. la timina y la citosina. Es una molécula de longitud gigantesca. Cada peldaño está formado por la unión de dos bases. Se unen a las cadenas mediante un enlace con los azúcares. la adenina. y el bases nitrogenadas de cuatro tipos. formando los pares de bases anteriormente mencionados. Las secuencias -el orden en que se van poniendo. que está formada por agregación de tres tipos de sustancias: azúcares. pero estos emparejamientos sólo pueden darse entre la adenina y la timina o entre la citosina y la guanina. . formando dos largas cadenas que se enrollan en hélice. fosfórico. Los azúcares y los ácidos fosfóricos se unen lineal y alternativamente. formar que un organismo su mantienen funcionamiento y que permite la herencia. timina. Las bases nitrogenadas se encuentran en el interior de esta doble hélice y forman una estructura similar a los peldaños de una escalera.que forman adenina.

las bases están enfrentadas por parejas. los nucleótidos que contienen adenina se acoplan siempre con los que contienen timina. Estas subunidades enlazadas desoxirribosa-fosfato forman los lados de la escalera. La molécula de desoxirribosa ocupa el centro del nucleótido y está flanqueada por un grupo fosfato a un lado y una base al otro. timina (T) y citosina (C). y forman los travesaños. un grupo fosfato y uno de cuatro posibles llamados compuestos nitrogenados bases: adenina (abreviada como A). Debido a la afinidad química entre las bases. En 1953. El grupo fosfato está a su vez unido a la desoxirribosa del nucleótido adyacente de la cadena. mirando hacia el interior. Las bases complementarias se unen entre sí por enlaces químicos débiles llamados enlaces de hidrógeno.¿Con qué elementos está formado? Cada molécula de ADN está constituida por dos cadenas o bandas formadas por un elevado número de compuestos químicos llamados nucleótidos. Estas cadenas forman una especie de escalera retorcida que se llama doble hélice. Cada nucleótido está formado por tres unidades: una molécula de azúcar llamada desoxirribosa. el bioquímico estadounidense James Watson y el biofísico británico Francis . guanina (G). Los nucleótidos de cada una de las dos cadenas que forman el ADN establecen una asociación específica con los correspondientes de la otra cadena. y los que contienen citosina con los que contienen guanina.

que especifica un aminoácido determinado. El ARNm sale del núcleo celular y se acopla a los ribosomas. guanina) corresponde al aminoácido valina. Como resultado de la sustitución. adenina. Por tanto. La síntesis proteica comienza con la separación de la molécula de ADN en sus dos hebras. citosina) es el codón correspondiente al aminoácido leucina. mientras que el CAG (citosina. Un gen es una secuencia de nucleótidos de ADN que especifica el orden de aminoácidos de una proteína por medio de una molécula intermediaria de ARNm. Cada secuencia de tres bases. sólo una. Una proteína es un compuesto formado por moléculas pequeñas llamadas aminoácidos. llamada antiparalela. En un proceso llamado transcripción. que los científicos obtuvieron en 1962 el Premio Nobel de Medicina por su trabajo Síntesis proteica El ADN incorpora las instrucciones de producción de proteínas. Su modelo adquirió tal importancia para comprender la síntesis proteica. la replicación del ADN y las mutaciones. Los aminoácidos son transportados hasta los ribosomas por otro tipo de ARN llamado de transferencia (ARNt). una parte de la hebra paralela actúa como plantilla para formar una nueva cadena que se llama ARN mensajero o ARN (véase Ácido ribonucleico). Se inicia un fenómeno llamado traducción que consiste en el enlace de los aminoácidos en una secuencia determinada por el ARNm para formar una molécula de proteína. Así. La sustitución de un nucleótido de ADN por otro que contiene una base distinta hace que todas las células o virus descendientes contengan esa misma secuencia de bases alterada. contiene la información necesaria para la producción de una secuencia de aminoácidos determinada. el triplete GAC (guanina. De las dos cadenas de polinucleótidos que forman una molécula de ADN. también puede cambiar la secuencia de aminoácidos de la proteína . llamada triplete.Crick publicaron la primera descripción de la estructura del ADN. llamada paralela. La otra. una proteína formada por 100 aminoácidos queda codificada por un segmento de 300 nucleótidos de ADN. constituye una palabra del código genético o codón. La secuencia de aminoácidos está a su vez determinada por la secuencia de bases de los nucleótidos del ADN. adenina. unas estructuras celulares especializadas que actúan como centro de síntesis de proteínas. que determinan su estructura y función. ayuda a la replicación.

cada uno de los nucleótidos de las dos cadenas resultantes atrae a otro nucleótido complementario previamente formado por la célula. Empieza con la separación de las dos cadenas de polinucleótidos. se reconstruye así una nueva molécula con estructura de doble hélice.resultante. Una de estas herramientas utiliza un grupo de enzimas especializadas. para así construir la hebra lateral de la nueva molécula de ADN. denominadas enzimas de restricción. que fueron encontradas en bacterias y que se usan como tijeras moleculares para cortar los enlaces fosfato de la molécula de ADN en secuencias específicas. también conocida como PCR por su traducción directa del inglés . cada una de las cuales actúa a continuación como plantilla para el montaje de una nueva cadena complementaria. La exposición de una célula o un virus a las radiaciones o a determinados compuestos químicos aumenta la probabilidad de sufrir mutaciones. que pueden unirse a otros fragmentos de ADN que presentan extremos del mismo tipo. Replicación En casi todos los organismos celulares. A medida que los nucleótidos complementarios van encajando en su lugar. la replicación de las moléculas de ADN tiene lugar en el núcleo. Esta alteración de una molécula de ADN se llama mutación. Esto implica la eliminación de genes específicos de un organismo y su sustitución por genes de otro organismo. Otra herramienta muy útil para trabajar con ADN es un procedimiento llamado reacción en cadena de la polimerasa (RCP). Este proceso continúa hasta que se ha formado una nueva cadena de polinucleótidos a lo largo de la antigua. Casi todas las mutaciones son resultado de errores durante el proceso de replicación. Los nucleótidos se unen entre sí mediante enlaces de hidrógeno para formar los travesaños de una nueva molécula de ADN. A medida que la cadena original se abre. Los científicos utilizan este tipo de enzimas para llevar a cabo la tecnología del ADN recombinante o ingeniería genética. Herramientas y técnicas para el estudio del ADN Existen numerosas técnicas y procedimientos que emplean los científicos para estudiar el ADN. una enzima llamada ADN polimerasa los une enlazando el grupo fosfato de uno con la molécula de azúcar del siguiente. justo antes de la división celular. Las cadenas de ADN que han sido cortadas con estas enzimas presentan extremos de cadena sencilla.

(polymerase chain reaction). permite a los científicos obtener gran número de copias a partir de un segmento determinado de ADN. Pero el acontecimiento más importante. se obtiene una huella de ADN. Los modernos secuenciadores de ADN parten de la idea del biólogo molecular estadounidense Leroy Hood. . de esta manera. de manera independiente. por el consorcio público internacional Proyecto Genoma Humano y la empresa privada Celera Genomics. de manera análoga a la comparación de huellas dactilares. de tal modo que el extremo del fragmento presenta una forma fluorescente de una de las cuatro bases nucleótidos. entre otros organismos. La tecnología denominada huella de ADN (DNA fingerprinting) permite comparar muestras de ADN de diversos orígenes. tras una exposición a una película de rayos X. Se puede obtener así un patrón de bandas o huella característica de cada organismo. un patrón de bandas negras característico para cada tipo de ADN. Se utiliza una sonda (fragmento de ADN marcado) que hibride (se una específicamente) con algunos de los fragmentos obtenidos y. dentro de este grupo de investigaciones. que ha revolucionado todos los campos de la biología. Un procedimiento denominado secuenciación de ADN permite determinar el orden preciso de bases nucleótidos (secuencia) de un fragmento de ADN. un gusano nematodo conocido como Caenorhabditis elegans. Este proceso. En 1998 se llevó a cabo el reto de la secuenciación del genoma de un organismo pluricelular. En esta técnica se lleva a cabo una replicación de fragmentos específicos de ADN. fue el desciframiento del genoma humano llevado a cabo en febrero de 2001. La mayoría de los tipos de secuenciación de ADN se basan en una técnica denominada extensión de oligonucleótido (primer extensión) desarrollada por el biólogo molecular británico Frederick Sanger. los fragmentos se ordenan en función de su tamaño. es decir. Los científicos ya han completado la secuenciación del material genético de varios microorganismos incluyendo la bacteria Escherichia coli. En esta técnica los investigadores utilizan también las enzimas de restricción para romper una molécula de ADN en pequeños fragmentos que separan en un gel al que someten a una corriente eléctrica (electroforesis). ya que los más pequeños migran más rápidamente que los de mayor tamaño. incorporando ordenadores y láser en el proceso. En el año 2000 se descifró el material genético de la mosca del vinagre (Drosophila melanogaster) y de la planta Arabidopsis thaliana. Esta técnica utiliza una enzima denominada ADN polimerasa que copia cadenas de ADN en un proceso que simula la forma en la que el ADN se replica de modo natural en la célula.

piel o sangre en el escenario del crimen se comparan con el ADN del sospechoso. Esta información puede ser valiosa para el diagnóstico preventivo de varios tipos de enfermedades. . esta técnica se ha empleado para producir insulina (necesaria para los enfermos de diabetes) o interferón (muy útil en el tratamiento del cáncer). A través de la tecnología del ADN recombinante los científicos pueden modificar microorganismos que llegan a convertir en auténticas fábricas para producir grandes cantidades de sustancias útiles. los buitres americanos están más emparentados con las cigüeñas que con los buitres europeos. ya que las especies más cercanas filogenéticamente presentan moléculas de ADN más semejantes entre sí que cuando se comparan con especies más distantes evolutivamente. a pesar de que morfológicamente y etológicamente son más similares a estos últimos.Aplicaciones La investigación sobre el ADN tiene un impacto significativo. asiáticos o africanos. El estudio del ADN también ayuda a los taxónomos a establecer las relaciones evolutivas entre animales. Por ejemplo. Las estirpes de plantas cultivadas a las que se han transferido genes pueden rendir cosechas mayores o ser más resistentes a los insectos. Los estudios sobre el ADN humano también revelan la existencia de genes asociados con enfermedades específicas como la fibrosis quística y determinados tipos de cáncer. plantas y otras formas de vida. Véase Pruebas de ADN. Por ejemplo. Las muestras de ADN tomadas de semen. el resultado es una prueba que puede utilizarse ante los tribunales. También los animales se han sometido a intervenciones de este tipo para obtener razas con mayor producción de leche o de carne o razas de cerdo más ricas en carne y con menos grasa. especialmente en el ámbito de la medicina. La agricultura y la ganadería se valen ahora de técnicas de manipulación de ADN conocidas como ingeniería genética y biotecnología. La medicina forense utiliza técnicas desarrolladas en el curso de la investigación sobre el ADN para identificar delincuentes.

. llamado ácido desoxirribonucleico (ADN). el ARN está formado por una cadena de compuestos químicos llamados nucleótidos. en los organismos celulares. el que lleva la información que determina la estructura de las proteínas.A c i d o r i b o n u c l e i c o (a r n) Material genético de ciertos virus (virus ARN) y. un grupo fosfato y uno de cuatro posibles compuestos nitrogenados llamados bases: adenina. molécula que dirige las etapas intermedias de la síntesis proteica. Pero el ADN no puede actuar solo. El ARN se diferencia químicamente del ADN por dos cosas: la molécula de azúcar del ARN contiene un átomo de oxígeno que falta en el ADN. esta molécula dirige dos procesos: la síntesis de proteínas (producción de las proteínas que forman la cápsula del virus) y replicación (proceso mediante el cual el ARN forma una copia de sí mismo). Estos compuestos se unen igual que en el ácido desoxirribonucleico (ADN). uracilo y citosina. En los virus ARN. guanina. Cada uno está formado por una molécula de un azúcar llamado ribosa. y se vale del ARN para transferir esta información vital durante la síntesis de proteínas (producción de las proteínas que necesita la célula para sus actividades y su desarrollo). Como el ADN. y el ARN contiene la base uracilo en lugar de la timina del ADN. En los organismos celulares es otro tipo de material genético.

“…siendo hecho lo que se ve. El ADN. Cada ser humano lleva escrito en su MOLÉCULA de ADN. GCAAAACCCTAAAAGGGGGCCCCAAATTTT…. y en tu libro (El Plan Maestro de Dios. por ej. es el Plan Maestro de Dios para cada tipo de ser vivo en particular.200 millones dedatos de información. las cuales se repiten veztras vez. el ámbito espiritual es primero. Ahí se describen todos los grandes y pequeños detalles tanto de sus características. Sal. Las 4 letras son: A adenosina G guanina C citosina T tiaminaEl código Genético se compone de esas letras.” He. y codificados por solo 4 letras o bases químicasdiferentes. embrión espirituales. 3. además una gran diversidad de Indicaciones específicas. y además uno INVISIBLE espiritual. Y sin duda. 11:3 El Código Genético.el ADN o CÓDIGO GENÉTICO) estaban escritas todas aquellas cosas que fueron luego formadas sin faltar una de ellas”.Dios y el ADN ¿Qué es el ADN en relación a Dios el Creador. 139:16 Poseemos un cuerpo físico VISIBLE. como naturales. contiene una parte NATURAL. y otra ESPIRITUAL. de lo que no se veía. formado por una combinación de unos. un texto Enciclopédico. contiene Relojes Exactos que marcan el tiempo de cosas relacionadas a nuestra existencia.“Mi vieron tus ojos. El Código Genético o ADN. Hay investigadores que establecen una correlación del Nombre Divino comola clave que está detrás del código de trascripción de las letras químicasque desarrollan el cuerpo .

Para ilustrar esto. sin embargo. He Son 3. Están en CÓDIGO. lo seguro. He. La estructura del ADN.200 millones de esas letras. . se dice que estas 4 letras están relacionadas con las 4 letras del Nombre de DIOS*** YHVH oYod. Pero no es un GUÍA ROJI de las Carreteras deMéxico que establecen con precisión aún pequeños poblados y sus caminosvecinales. es como tener un MAPA general de las carreteras de México. aseguran haber hecho ya. “jamás alcanzarán la Obra de Dios. es que no les alcanzará el tiempo para lograr sucometido.humano. o manipular el ADN ESPIRITUAL.Vau. Sus peldaños son precisamente los genes dondeestá registrada toda la información hereditaria de cada especie viva. en el AMBITO ESPIRITUAL (Alma y espíritu)”. Los Genes son diminutas moléculas extraordinariamente complejas quecontienen la información necesaria para construir a cualquier ser vivo. pero. Los Ingenieros Genéticos. Los Genetistas dicen que aún se tardarán unos 100 años para DESCIFRARtoda la información contenida en el ADN. un MAPA generalde la estructura del CÓDIGO GENÉTICO. En la actualidad los científicos. sabiendo que “Jesúsviene pronto”. Pero no detalla con precisión lainformación. que tienen que ver con datos o puntos de información codificados. pensemos en los Códigos secretos de la Biblia. y forman como una hélice doble parecida a una escalera de caracol. es una molécula compuesta por dosfilamentos enrollados entre sí.posible podrían manipular hasta cierto grado los genes para crear criaturas manipulas enlo natural o físico.

La misma técnica se podría utilizar para la reparación de órganos internos y sustituirlos completamente sin necesidad de trasplantes. sin embargo. el proceso de reproducción del ADN por medio de la función de la célula. solo crearán esos monstruos de laboratorios poseídos por demonios. A estos errores se les llama:MUTACIONES. En fin. Cuando esos ERRORES en el copiado no se corrigen de inmediato. la sus entre IngenieríaGenética propósitos bien establecido pues intencionados. afirman queuna vez que se descubran los mecanismos genéticos de la regeneración será posible que una “extremidad amputada” crezca sola. es el pensamiento de “clonar seres humanos”. y en algunos ha casos. que la Ingeniería Genética es una ciencia de recientecreación. y que sin duda. Se dice que la . Por otro lado. y que lespermite repararse a sí mismos cuando sufren la pérdida o daños severos dealguno de sus miembros. Se ha planeado crear ovejas cuya leche contengan altas cantidades de insulina para ofrecerla a los enfermos. de que hemos mencionado que el hombre trata de alcanzar la Obra de Dios. o que la piel quemada se regenere de manera más eficaz y sin dejar cicatrices. todos estos proyectos tienen un tinte noble y bienintencionado que puede beneficiar a las masas. aveces COMETE ERRORES y cambia un “nucleótido” por otro. También la Ingeniería Genética ha permitido mejorar la calidad de muchas semillas. a pesar.En algunos casos.Este es un proceso normal en muchas especies animales. pero lo malévolo de lamanipulación genética. sin embargo: La enzimallamada “polinerasa” que se encarga de hacer las COPIAS del ADN. pasana las nuevas generaciones y se modifica el contenido de las instrucciones ypueden ocasionar alteraciones nocivas. verduras y frutas para mejorar sus propiedades alimenticias y hacerlas más resistentes a las plagas. o animales de granja cuya carne esté libre de colesterol. plantas. que permite modificar el Código Genético de los seres vivos paraobtener resultados específicos. Según algunos expertos en el tema. ya que asegura la continuidad de lainformación biológica en todos los organismos. susobjetivos está llegar al punto de que el “cuerpo humano se repare oregenere de manera espontánea” cuando sufre daños físicos. es casi perfecto.Pero debemos saber.

no fuimos testigos oculares. una Nación Santa.alteración que lleva al Síndrome de Dawn. DIOS. 1:26 . entre los cuales figura el acontecimiento del Nacimiento de Su Hijo en la eternidad pasada. ¡¡y muchísimos más!! “A saber. en el ADN. Solo la Sangre de JESUCRISTO y la PALABRA de DIOS generarán esaRaza Superior. pero sin duda que dentro del Plan Maestro de Dios.pero. un Pueblo Escogido. se registró ese acontecimiento…. mas ahora ha sido manifestado a sus santos” Col. ahí registraron una gran infinidad de acontecimientos. yel Alzheimer se generaron en el Cromosoma 21 Hoy los Ingenieros Genéticos buscan crear una Raza Perfecta o Superior através de la manipulación de los genes. registró como parte de la información que Él quería que el hombre tuviese. sin duda. el misterio que había estado oculto desde los siglos Yedades. ni estuvimos ahí presentes.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->