…

! !

…

}! « }!

{

{

}

¾

¢

{ 

¾

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

GENETIC CENTRE
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Prof. Dr. Madhavan

Vethathiri Science Research Academy

Science Integrates
Scientists Divide? Life Biology

Life and mind, are they made out of lifeless and mindless substrate physics? Let us Think again!

Molecules

Chemistry

Particles & Forces

Physics

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Science 2 God
Vethathirian Sciences open up a new vistas of bridging Science and God Vethathirian Gravity throws new light on “Unified force Principle” Vethathirian Universal / Bio Magnetism forms the energy network of the Universe (Material energy to Bio energy and back to material energy) Vethathirian Genetic centre, a new morality factor connecting the issue of karmic pains / pleasure.
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Gravity – The Almighty God Atom E.Gravity Strong Particle Weak Wave Things Active Energy Space Gravity Passive Absolute Space Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232 Electro Mag

Within . UNIVERSE Beyond UNIVERSE

Repulsive

Attractive

Vethathiri Science Research Academy

What is Centre of Gravity for Mass (UM) is Center of Genetics for Human Mind (BM) is called as

GENETIC CENTER

Vethathirian Holistic Sciences

Gravity is due to Self compressive Pressure Force That is the Vethathirian Gravity – God.

Genetics are the Information imprints pressure force That is the Vethathirian – Genetic Centre Humans are Imprints Recorder and Player. Recording in GC by Gravity Attractive Pressure force Playing from GC by Repulsive force GC is the center for 3 – namely BM, LF and Seed cells

Vethathirian Holistic Sciences

Particle
Formative Dust Particle 2

Character Rotate @ High Speed

Functions Results - Self Rotative Force - Particle - Transmitting spreading - Wave Wave 3
>

>

>

>

Spreading Wave
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Magnetism
Character Functions - Create Magnetism effect (opposites) - Particles comes closer forming Masses - Quantity transformation Results - Universal Magnetism
4

• •

Rub with adjacent Abs. Space through spreading wave Looses speed in time

• •

- 5 Elements - Akash - Air - Heavy Air - Earth 5 Changes in Magnetism - Quality transformation - Pressure 6 (due to changes in - Sound 7 speed & Particles) - Light 8 - Taste 9 At Integrative Speed - Formation of Living - Smell Organisms - Evolution of Living Beings Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232 - Mind 10

Vethathiri Science Research Academy

Duality of Matter
Universe is made up of two kinds of stuff: “Seen” (Physical) and “Unseen” (Felt as Effects). And both are one and the same. 1. Matter - Particles - Discreteness, reductionism 2. "Energy" Mind, Spirit, Soul,Vital Force - Electromagnetic/ bioenergetic fields - Continuity, holism
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Body

Vethathiri Science Research Academy

Energy Fields of Life
". . . energy fields are postulated to constitute the fundamental unit of the living and nonliving.“ [The field is] "a unifying concept and energy signifies the dynamical nature of the field. Energy fields are infinite and Para dimensional; they are in continuous motion." Martha Rogers

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Body

A+T, C+G

Cell Nucleus

DNA Helix

Chromosome

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Genes

Vethathiri Science Research Academy

TRIOLOGY
VEDANTA MIND HINDU CHIRIST VETHATHIRI LIGHT SCIENCE BODY BODY + MIND + SPIRIT (SOUL) CONSCIOUS + SUB CONSCIOUS + SUPER CONSCIOUS BRAHMA + VISHNU + MAHESWARA FATHER + SON + HOLY SPIRIT SPACE + PARTICLE + MAGNETISM PARTICLE + WAVE + MEDIUM PHYSICS + CHEMISTRY + BIOLOGY CELL + CHROMOSOMES + GENES

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

BIOLOGY
BIOLOGY GENETICS GENES STUDY OF LIFE, LIVING ORGANISMS SCIENCE OF GENES, HEREDITY & VARIATIONS BASIC UNIT OF GENETIC INFORMATION

CHROMOSOMES - STORAGE UNIT OF GENES DNA PROTEINS CONTAINS GENETIC INSTRUCTIONS MADE BY THE GENETIC INSTRUCTIONS MACHINES THAT PERFORM BODY FUNCTIONS POWER ENGINES THAT MOVE BODY FUNCTIONS 100 TRILLION CELLS
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

CELLS BODY -

Vethathiri Science Research Academy

GENES
DNA - Alphabets ATGCATGCATGCATGCATGCATGCATGC A= Adnine, T= Thymine, G= Guonine, C= Cystosine

DNA - Words

- ATG CTC GAA TAA GTA CTG

DNA - Sentence

- <ATG CTC GAA>

<CTG ATG CAC>

Such DNA sentences are called GENES

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

See how DNAs are packed in a Chromosome

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center
The Basics… The cell is the structural and functional unit of all known living organisms, and is sometimes called the ‘building block of life’. The cell nucleus acts like the brain of the cell. It helps control eating, movement, and reproduction. If something happens in a cell, the nucleus certainly comes to know about it.

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center
Formation of a Single Celled Organism: As per specific gravity principle, a bio-cell is formed with a denser middle region due to extreme compression and a surrounding region which is generally loosely packed.

Such loosely packed molecules form the cytoplasm of a single celled organism where as the inner region with densely packed molecules becomes the nucleus.
Formation of Nucleus due to specific gravity in a single cell
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center
Magnetism is developed in a single celled organism due to the motion of life force particles [vethans] in it. As per specific gravity principle, the generated magnetic waves form a wave packet at the vortex region. This wave packet consists of all the magnetic waves generated from the different molecules of that cell and so it contains the properties of that single celled organism. This wave packet is termed as ‘Genetic Center’.
Formation of Magnetic Wave Packet due to specific gravity in a single cell
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center
The magnetic wave packet formed in the vortex region transfers its energy with the molecules in that region and so the properties of all the magnetic waves are imprinted in those molecules. This imprinting process takes place through the five wave functions Clash, Reflection, Refraction, Interaction, Penetration. Such imprinted molecules are invented to be the Genetic Code [DNA] of that cell.
Formation of Magnetic Imprints in a Single Celled Organism
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center

In Eukaryotes, the manifestation of specific gravity is very effective that a separate part called nucleus is formed. The genetic code of that cell is embedded with in that nucleus. In prokaryotes, the nucleus is not fully developed and the genetic code floats in the inner regions of the cytoplasm.
Prokaryote

Eukaryote

Location Aspects of Genetic Codes in a Single Cell

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center

Genetic Center

Bio-Magnetic Field

As the evolution progressed, multiple celled bodies were formed and in them, the generated magnetic waves, formed a magnetic field as well as a magnetic wave packet in the middle.

Formation of Bio-Magnetic Field in Multiple Celled Organisms

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center

In humans, life force particles spin inside atoms and move in between clusters of atoms that a magnetic field is formed. This magnetic field also comprises the waves that emerge from the brain cells.

The magnetic field formed is called as BioMagnetism this is the energy repository of a human body.

Bio-Magnetic Field of a Human
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Theory of Genetic Center
Physics Background: According to wave theory of Vethathiriam, energy transfer takes place in universal Magnetism as well as in Bio-Magnetism based on five wave functions. They are,
Clash Event

Interaction Event

1. Clash. 2. Reflection.

Refraction Event Penetration Event

3. Refraction. 4. Interaction.

Reflection Event

5. Penetration. These five wave functions play a major role in the formation of Prof. Dr. Madhavan – Bangalore Cell 0 imprints. magnetic 98860 67232

Wave Functions and Energy Transfer

Vethathiri Science Research Academy

Theory of Genetic Center
The vortex region of a human’s bio-magnetic field, called as Moola dhara is the region where all the magnetic waves are clustered as a wave packet. This wave packet is called as the genetic center of a human. In humans, this packet consists of waves from the brain cells also. Hence, genetic center of a human, is the storage location of all bio-magnetic waves including the brain waves which decide the character of a human.
Genetic Center of a Human
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Bio-Magnetic Field

Genetic Center

Vethathiri Science Research Academy

Universal Magnetism Flow Ether Energy Particle Prana Life force - BM

Bio Magnetism

Air Filling Particle Fire Transfer Particle Water Flowing Particle Earth Massive Particle

Air Resipiratory System Fire Nervous System Water Blood circulation Earth Physical Body
Prof. Dr. Universal Magnetism Flow Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Bio Magnetism

Purpose of Living is to purify Impurities in GC. Impurities in GC Unfulfilled desires Telling lies Hurting others feelings Negative emotions (Anger, Vengeance etc) Not adopting ‘Limit & Method’ Leading Lazy life and living in others efforts SKY Techniques for Purification Body Exercises Kaya Kalpa Exercise Meditation Introspection Dropping 6 vices and Developing 6 virtues 5 Living Discipline Understanding Brahma Gyan
Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Maharishi focus on Genetic Centre is: - to purify its instruction codes for better heredity Heredity inherited from parents and their past. They are our Traits Physical Traits – Skin, Eye, Hair color, Face type, Shape, size etc Behavioral traits – Anger, worry, Depression, smart, fearsome etc. Purification of Genetic centre can modify these traits, not only in oneself But essentially in the future generations to come. Let us start now for betterment of our future generations!

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

THANKS
VAAZGHA VALAMUDAN!

Prof. Dr. Madhavan – Bangalore Cell 0 98860 67232

Vethathiri Science Research Academy

Sign up to vote on this title
UsefulNot useful