You are on page 1of 30

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.

ro

WORKSHOP
CULTURI STARTER DE BACTERII FOLOSITE LA FABRICAREA PRODUSELOR PE BAZ DE CEREALE

Iunie 2010 Facultatea tiina i Ingineria Alimentelor, Universitatea Dunrea de Jos din Galai

www.nutrirye.ugal.ro
Iunie 2010 Galai

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.ro

PROGRAM
10-10:20 10:20-10:30 10:30 10:50 10:50-11:00 11:00 11:20 11:20-11:30 Aluatul acid Discuii Bacterii lactice utilizate n panificaie Discuii Aplicaii ale ingineriei metabolice la bacteriile lactice Discuii Lector Dr. Iuliana Aprodu Prof.Dr.Ing. Gabriela Bahrim Conf.Dr.Ing. Iuliana Banu

Pauz: 11:30 12:00


12-12:20 12:20-12:30 12:30 12:45 Tulpini de bacterii lactice izolate din cereale aflate n colecia MIUG Discuii Testarea proprietilor biotehnologice ale unor aluaturi acide liofilizate Nicoleta erban, absolvent 2010, licen BI Prof.dr.ing. Gabriela Bahrim Lector Dr.Ing. Aida Vasile Conf.Dr.Ing. Vasilica Barbu

12:45-12:55 12:55 13:10

Discuii Lactobacillus helveticus (LH-B02) i K. marxianus ssp. marxianus (LAF-4) ca alternativ la fabricarea pinii de secar prin metoda tradiional Discuii Biosinteza de exopolizaharide n aluatul acid de secar Discuii Concluzii Drd.Ing Ina Vasilean As.Dr.Ing. Corina Neagu Conf.Dr.Ing. Iuliana Banu Mariana Vdeanu, Mdlina Ru, absolvente 2010, licen CEPA Lector Dr. Iuliana Aprodu Conf.Dr.Ing. Iuliana Banu

13:10-13:20 13:20 13:40

13:40-13:50 13:50 14:30

Iunie 2010 Galai

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.ro

NutriRye - Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PN-II-ID-PCE-2008: ID_500/2008, Contract nr. 1046/2009 Director: Conf.Dr.Ing. Iuliana Banu Proiect finanat de CNCSIS prin UEFISCSU, n cadrul Planului Naional de Cercetare, Dezvoltare i Inovare II, pentru perioada 2007-2013 Cele mai multe dintre tehnologiile de prelucrare aplicate n industria alimentar modern determin o diminuare a coninutului de substane nutritive al materiilor prime supuse procesrii. De cele mai multe ori alimentele rezultate au o valoare energetic mare i un coninut sczut de compui biologic activi. n schimb, aportul necorespunztor att al energiei, dar ndeosebi al nutrienilor biologic activi, determin dezechilibre metabolice. n consecin, calitatea actului alimentar este determinant pentru starea de sntate a individului. Interaciunea dintre alimentaie i sntate, posibilul caracter nociv al hranei asupra organismului precum i soluiile de protecie prin alimentaie sunt de mare actualitate. Comunitatea tiinific i specialitii din industria alimentar au rspuns unor astfel de probleme legate de calitatea alimentaiei prin dezvoltarea unei noi concepii nutriionale, aceea a alimentelor funcionale, alimente cu efect benefic asupra sntii care pot trata sau preveni mbolnviri. Cercetrile din domeniu au fost direcionate spre creterea biodisponibilitii unor componente valoroase din punct de vedere fiziologic i valorificarea optim a diversitii componentelor cu rol funcional din bioresursele de natur vegetal i animal. Tema abordat de proiect se ncadreaz n politica Romnieii n domeniul cercetrii, dezvoltrii i inovrii, prin obiectivele strategice ale planului naional: crearea de cunoatere, obinerea de rezultate tiinifice i tehnologice de vrf, competitive pe plan global, creterea competitivitii economiei romneti prin inovare, cu impact la nivelul agenilor economici i transferul cunotinelor n practica economic, creterea calitii sociale, respectiv gsirea de soluii tehnice i tiinifice care susin dezvoltarea social i mbuntete condiia uman a acesteia. Ideea care st la baza proiectului este valorificarea compuilor biologic activi din materiile prime alimentare dezvoltnd noi tehnologii prin care se asigur valorificarea superioar a secarei. Astfel, proiectul i propune elaborarea unor alimente funcionale pe baz de cereale, domenii de cercetare n direct consonan cu cerinele EU, i anume cercetarea din domeniul cerealier trebuie s contribuie la creterea consumului de produse pe baz de cereale cu mrirea beneficiilor nutriionale, reducerea alergenilor i a compuilor toxici, la creterea nivelului de siguran a acestor produse (Bruno Hansen, director Life Sciences: Biotechnology, Agriculture and Food Research European Commission, www.icc.or.at).

Iunie 2010 Galai

Aluatul acid
Conf.Dr.Ing. Iuliana Banu

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Ce este aluatul acid?


Nu exist o definiie oficial; Un amestec de fin i ap fermentat cu bacterii lactice; Lonner/Hansen (2006) aluatul acid trebuie s conin LAB mai mult de 5x108 ufc/g de aluat i s aib un pH mai mic de 4,5; aluatul acid exclude acidifierea artificial, cu acid lactic i acid acetic.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Specialit i de panificaie tradiionale sunt produse prin tehnologia cu aluat acid (Vuyst i Vancanneyt, 2007).

Ex. Italia mai mult de 30% din produsele de panificaie sunt obinute prin aceast tehnologie; cele mai cunoscute produse italieneti sunt cele produse n mod tradiional de Crciun, Panettone i Pandoro, i de Pate, Colomba, realizate din fin de gru; ri cu tradiie n folosirea acestei tehnologii de panificaie Italia, Grecia, Spania, Belgia, Egipt, Maroc, SUA (San Francisco Bay) produse de panificaie din gru; Germania, Finlanda, Suedia, Danemarca, Polonia, Rusia, rile Baltice produse de panificaie din secar, amestec secar i gru, orz.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Care sunt avantajele folosirii aluatului acid? (Gobbetti .a., 2005; Hansen, 2006)

posibilitatea dospirii pinii cu puin drojdie; mbuntirea proprietilor reologice ale aluatului (prin acumularea de metabolii, respectiv de aminoacizi); obinerea unor produse cu arom i textur mai bune comparativ cu produsele fermentate doar cu drojdie; mbuntirea valorii nutritive a pinii, prin creterea biodisponibilitii mineralelor i scderea indexului glicemic etc; cretere a duratei de pstrare datorit efectului inhibitor asupra mucegaiurilor pe care l au acizii organici formai n timpul fermentrii.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Cum poate fi obinut aluatul acid? (Muller .a., 2001; Vuyst i Neysens, 2005; Corsetti i Settanni, 2007)

prin fermentaia microflorei lactice spontane din fin, n anumite condiii de temperatur i timp; prin adugarea n aluat a unei cantiti de aluat acid obinut ntr-un proces de fermentare anterior (aluat acid matur); prin adaugarea n amestecul de fin i ap a unei culturi starter obinute din tulpini de LAB.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Fermentaia microflorei lactice spontane din fin Aluat acid de tip I (tip 0) microflora specific aluatului acid; tuplinile identificate Lb. sanfranciscensi (heterofermentativ) productoare de Ia cantiti mari de AL i AAc din maltoz, i drojdiile C. humilis i S. exiguus; procesul de fermentaie: 3 - 48 ore/20 - 30C.

Ib

principala tulpin identificat este Lb. sanfranciscensi; alte LAB heterofermentative: Lb. brevis, Lb. fermentum, Lb. fructivorans, Lb. pontis, W. cibaria; facultativ heterofermentative: Lb. alimentarius, Lb. casei, Lb. plantarum; homofermentative: Lb. acidophilus, Lb. delbruekii; a fost identificat C. humilis asociat n mediul de aluat cu Lb. sanfranciscensi i Lb. pontis; procesul de fermentaie se realizeaz n 3 etape. specific aluatului acid obinut din sorg, specific Africii; principalele tulpini identificate de LAB heterofermentative: Lb. fermentum, Lb. pontis, Lb. reuteri i homofermentative: Lb. amylovorus; drojdia asociat este Issatchenkia orientalis; procesul de fermentaie are loc la temperaturi mai mari de 35C.

Ic

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Aluatul acid matur obinut ntrntr-un proces de fermentare anterior (tip II) se obine n brutrie, sub form proaspt instalaii continue de producerea a aluatului acid brutrii mari; tuplinile identificate de LAB homofermentative: Lb. acidoplhilus, Lb. delbruekii, Lb. amylovorus, Lb. farciminis, L. johnsonii; heterofermentative: Lb. brevis, Lb. fermentum, Lb. pontis, Lb. panis, Lb. reuteri, W. Confusa; nu au fost identificate drojdii asociate LAB specifice aluatului de tip II; proces de fermentaie dup 24 ore de fermentare pH < 3,5; poate fi pstrat o sptmn; poate fi supus uscrii; aluatul preparat cu aluat acid de tip II necesit pentru dospire adaos de drojdie.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Culturi starter de bacterii lactice (tip III) culturi pure de LAB sau amestecuri de LAB i drojdii uscate/liofilizate; cele mai cunoscute produse comercializate pinea din fin de gru, Sanfrancisco sour, pinea din fin de secar Bocker-Reinzucht-Sauer, se amestec cu fin i ap i sunt meninute cteva ore, la anumite temperaturi, pentru multiplicare i fermentare; LAB sunt selecionate n funcie de abilitatea lor de a acidifia aluatul ntrun timp scurt i de forma compui de arom specifici produselor de panificaie; se prezint sub form de pudr; se obine folosind tulpini de LAB rezistente la uscare: heterofermentative: Lb. brevis; facultativ heterofermentative: P. Pentosaceus i Lb. plantarum; aluatul preparat cu din aluat acid de tip III necesit pentru dospire adaos de drojdie.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Exist numeroase patente care descriu tehnologii de obinere a aluatului acid uscat Spiller aluat acid uscat obinut dintr-o cultur mixt de Lb. brevis i Saccharomyces dairensis i fin integral de gru sau secar, folosete ca aditivi: uleiul de soia, uleiul de msline, fina integral din gru sau secar germinate; Kline aluat acid uscat cu urmtoarea compoziie 2,1109 ufc/g Lb. safranscisco, 1104 ufc/g T. holmii, 22,4% stabilizatori i 2% ap, reconstituire fin:ap = 1:2,5; 4,9% aluat acid uscat; 0,6% sare; T = 48-50C, 0 ore pH 5,24; 6,9 107 ufc/g, 3,5 ore pH 4,72; 4,6 108 ufc/g, 7 ore pH 3,78; 2,1 109 ufc/g.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Tendin folosirea unor tulpini de LAB specifice altor grupe de alimente, alimente, spre exemplu produselor lactate sau crnii (Caballero .a., 1995; Plessas .a., 2008; Dimitrellou .a.; 2009) Kluyveromyces marxianus, Lb. delbrueckii ssp. bulgaricus and Lb. helveticus Lb. delbrueckii ssp. bulgaricus este homofermentativ, spectrul de glucide fermentate fructoz, glucoz i lactoz; Lb. helveticus se poate adapta la diferite condiii de cultur i poate utiliza diferite surse de carbohidrai dar i de proteine (are un sistem proteolitic puternic; are o mare abilitate de a produce acid i are o mai mare toleran oxidativ dect ali LAB); optim de reet 50% aluat acid (raportat la fin) raport K. marxianus : Lb. delbrueckii ssp. bulgaricus de 1:4, fermentare de 16 ore la 40C.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Alegerea unei culturi starter de LAB s fie posibil optimizarea procesului de obinere a aluatului acid; reglarea raportului lactat/acetat, dar i obinerea altor metabolii; produsele de panificaie s aib calitatea dorit;

preferina LAB pentru anumite glucide din fin influeneaz acumularea anumitor metabolii n timpul fermentrii, poate reduce competiia metabolic cu drojdiile, sunt influenate ATT i coninutul de AAc.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Exopolizaharidele (EPZ)

metabolii secretai n mediul exterior, sub forma unui biofilm vscos, de ctre LAB: HePZ i HoPZ; HoPZ produse de LAB se formeaz n timpul fermentrii aluatului acid i sunt cunoscute pentru capacitatea lor de a mbunti proprietile structurale ale produselor de panificaie (Corsetti i Settanni, 2007);

considerate prebiotice (Ketabi .a., 2008) sunt rezistente la pH redus (nu sunt degradate n timpul fermentrii) i temperatur ridicat (rezist la temperaturile de coacere); specii de LAB precum Lb. sanfranciscensis, Lb. pontis, Lb. panis, Lb. mucoase, Lb. reuteri, Lb. oris, Lb. acidophilus, Lb. rossiae au fost identificate att n intestine ct n i n aluatul acid un posibil caracter probiotic al acestor microorganisme (Corsetti i Settanni, 2007).

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID

Factori tehnologici ce influeneaz obinerea aluatului acid Natura finii gru/secar fina reprezint substratul pe care fermenteaz microorganismele cantitatea de glucide fermentescibile, degradabilitatea amidonului i activitatea enzimelor endogene pot influena caracteristicile aluatului acid. Extracia finii finurile de extracie mare (80-100%) stimuleaz dezvoltarea i activitatea biochimic a microflorei aluatului acid LAB se dezvolt bine n medii bogate din punct de vedere nutritiv, n aluatul acid obinut din FN de gru se acumuleaz o cantitate dubl de AAc i cu 30-50% mai mult AL, dect n aluatul acid obinut din FA (Salovaara i Valjakka, 2007), ntre ATT i coninutul de cenu al finii a fost observat o relaie liniar ATT a fost dubl n cazul aluatului acid obinut din FN fa de cel obinut din FA, iar pH-ul final a fost obinut ntr-un timp mai scurt n aluatul acid preparat din fin de extracie mic (Brummer i Lorenz, 1991) .
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Raportul fin/ap se exprim prin cantitatea de aluat calculat ca raport dintre catitatea de aluat acid i 100 kg fin; variaz ntre 150 (aluat acid consistent) i 300 (aluat acid fluid); producia de AL nu este influenat de raportul fin/ap, producia de AAc este, n general, mai mic n aluatul acid fluid. Temperatura timpul de generaie: Lb. brevis este de 20 min la 35C; Lb. plantarum este de 60 min la 40C; temperatura optim de cultivare i de producere a acizilor: 30-35C; cele mai multe LAB heterofermentative (Lb. plantarum, Lb. rhamnosus, Lb. brevis, Lb. sanfranciscensi) pot fi cultivate la T<15C; speciile de LAB homofermentative (Lb. acidophilus, Lb. amylovorus, Lb. delbrueckii) pot fi cultivate la 45C<T<55C; exist i specii heterofermentative care pot fi cultivate la T=45C (Lb. pontis, Lb. reuteri etc.); producia de acid lactic din aluatul acid crete cu creterea temperaturii de fermentare, n timp ce producia de acid acid acetic este foarte puin influenat.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Cantitatea de aluat acid se recomand folosirea unei cantiti mai mari de aluat acid la prepararea unui nou aluat acid astfel nct scderea pH-ului s se fac rapid, i bacteriile Gram-negative din fina nou adugat s fie inhibate; se recomand un adaos de 10-20% aluat acid; n cazul aluatului acid San Francisco, care este refcut la fiecare 8 ore, cantitatea de aluat acid folosit la prepararea unui nou aluat este de 2540%.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

ALUATUL ACID
Lactococcus lactis ssp. Lactis (UGAL2) Weissella confusa (UGAL1) Lactobacillus plantarum (15GAL) Lactobacillus brevis (16GAL) Condiii de fermentaie: TC, timp

FN de secar FI de secar

Lactobacillus plantarum i Lactobacillus brevis (DI-PROX MTTX) Lactobacillus helveticus (LH-B02) i K. marxianus ssp. marxianus (LAF-4)

Analiza metaboliilor formai lactat, acetat, glicerol, etanol; Capacitatea antioxidant; Coninutul de vitamine (acid folic)

Optimizarea procesului tehnologic de obinere a produselor de panificaie


Obinerea de aluat acid uscat folosind diferii stabilizatori, Caracterizarea aluatului acid uscat.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

Bacterii lactice utilizate n panificaie


Prof.dr.ing. Gabriela Bahrim

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

BACTERIILE LACTICE- ingrediente naturale in alimente bioactive - in situ (produse alimentare) probiotice - in vivo (organismele vii)
ncidena bacteriilor lactice n produsele alimentare Indigene in microbiota specific a unor materii prime de origine vegetal (cereale, fructe, legume) sau animal (lapte, carne) Culturi starter artizanale sau comerciale Prin controlul i dirijarea activitii metabolice a bacteriilor lactice se obin efecte benefice cu implicaii n tehnologia produselor fermentate, diversificarea gamei sortimentale, conservarea alimentelor, precum i pentru asigurarea functiei de alimentente funcionale.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

Bacteriile lactice - grup heterogen de microorganisme - capacitatea de a produce acid lactic ca produs principal al fermentaiei lactice a glucidelor simple. Fermentatia glucidelor simple: FERMENTAIE HOMOLACTIC - acidul lactic este unicul produs final al fermentaiei lactice FERMENTAIE HETEROLACTIC - pe lng acid lactic se formeaz i acid acetic, alcool etilic, dioxid de carbon i acid formic. Implicatii tehnologice si pentru cresterea calitatii vietii definirea caracteristicilor senzoriale, nutritive i reologice ale produselor alimentare fermentate; mbuntirea inocuitii, stabilitii microbiologice ; asigurarea siguranei alimentare; rol functional in vivo
Carr F.J., Chill D., Maida N., 2002, The lactic acid bacteria. A literature survey. Crit. Rev. Microbiol., 28, 281-370 Kleerebezem M, Hugenholtz J., 2003, Metabolic pathway engineering in lactic acid bacteria. Curent Opinion Biotechnology, 14, 232237 Leroy F., de Vuyst I., 2004, Lactic acid bacteria as functional starter cultures for the food fermentations industry. Trends Food Science and Technology, 15, 67-78 Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008, Contract nr. 1046/2009

Bacteriile lactice

Microorganisme din categoria GRAS (n limba englez, Generally Recognized as Safe). Aerococcus Alloiococcus AtopobiumB Bifidobacterium Carnobacterium Enterococcus Lactobacillus Lactococcus Leuconostoc Pediococcus Streptococcus Tetragenococcus Vagnococcus Weisella

9Celule de forma cilindric (bastona) sau sferic (forma coccus) 9Gram pozitive 9Lipsite de mobilitate 9Facultative anaerobe 9Nesporulate 9Catalazo-negative 9Acid tolerante

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008, Contract nr. 1046/2009

Modificri n nomenclatura bacteriilor lactice, produse n perioada 19802000

Axelsson, A., 2004, Lactic Acid Bacteria: Classification and Physiology. In: Salminen, S.; von Wright, A; Ouwehand, AC (Eds.). (2004). Lactic Acid Bacteria: Microbiological and Functional Aspects (3rd ed.). New York: Marcel Dekker, Inc. Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008, Contract nr. 1046/2009

Arborele filogenetic ce descrie afilierea bacteriilor lactice la grupuri taxonomice

Axelsson, A., 2004, Lactic Acid Bacteria: Classification and Physiology. In: Salminen, S.; von Wright, A; Ouwehand, AC (Eds.). (2004). Lactic Acid Bacteria: Microbiological and Functional Aspects (3rd ed.). New York: Marcel Dekker, Inc.

Caracteristici

Bastonae
Carnobacterium Lactobacillus Aerococcus Enterococcus Lactococcus Vagococcus

Coci
Leuconostoc Oenococcus Pediococcus Streptococcus Teragenococcus Weissellab)

Formarea de tetrade Formarea de CO2 din glucozc) Cretere la 10C Cretere la 45C Cretere n prezena a 6,5% NaCl Cretere n prezena a 18% NaCl Cretere la pH 4,4 Cretere la pH 9,6 Tip de acid lactic produs

- d)

+ -

+ -

+ -

+ nd

+ +

+ + +

+ -

+ +

+ +

nd L

D, L, DL

+ L

+ + L

+ L, DL

+ L

D, DL

+, pozitiv; +, negative; , respuns variabil; nd, nedeterminat b) unele tulpini de Weissella spp. se pot prezenta sub form de bastonae curbate c) fermentaii homo i heterofermentative
Axelsson, A., 2004, Lactic Acid Bacteria: Classification and Physiology. In: Salminen, S.; von Wright, A; Ouwehand, AC (Eds.). (2004). Lactic Acid Bacteria: Microbiological and Functional Aspects (3rd ed.). New York: Marcel Dekker, Inc.

Clasificarea bacteriilor lactice in functie de proprietatile biochimice si fentotipice Grupul A bacterii lactice strict homofermentative care au capacitatea de a fermenta hexozele cu producere de acid lactic (85%) pe calea Embden-MeyerhofParnas. Au capacitatea de a fermenta de asemenea fructoza dar nu transform nici gluconatul nici pentozele ; Grupul B- bacterii lactice facultativ heterofermentative care fermenteaz complet hexozele cu formare de acid lactic pec alea EMP. Transform pentozele n acid lactic i acid acetic graie prezenei unei fosfoketolaze indus ; Grupul C- bacterii lactice strict heterofermentative - care fermenteaz hexozele cu formare de acid lactic, acid acetic, etanol i dioxid de carbon i transform pentrozele n acid lactic i acid acetic, n ambele cazuri fiind implicat enzima fosfoketolaza a- grupul Lb. delbrueckii; b- grupul Lb. casei/Pediococcus; c- grupul Leuconostoc Aa specii strict homofermentative incluse in grupul Lb. delbrueckii Cb specii stric heterofermentative apartinand grupului Lb. casei/Pediococcus
Stlolz P. , 2003, Biological Fundamentals of Yeast and Lactobacili Fermentation in Bread Dough. In: Kulp K., Lorenz K (Eds.), Handbook of Dough Fermentations, Macel Dekker Inc.

Bacterii lactice identificate n microbiota diferitelor tipuri de aluat acid

Specii de bacterii lactice Lactobacillus zymae, Lb. pontis, Lb. acidifarinae, Lb. plantarum, Lb. sanfranciscensis, Lb. paralimentarius, Lb. spicheri Lb. reuteri, Lb. panis., Lb. amylovorans Lb pantarum, L. casei, Lb. delbrueckii subsp. delbrueckii, Lb. acidophilus, Lb. brevis, Lb. curvatus, Pediococcus pentosaceus Lb. hammesii Lb. nantensis Lb. amylovorus, Lb. pontis, Lb. frumenti, Lb. reuteri

ara Belgia

Tipul de aluat acid Aluaturi acide din fain de gru

Danemarca Aluat acid din fin de secar Frana Paine (fin de gru) Aluaturi acide din fain de gru Aluaturi acide din fain de gru Aluat acid din fin de secar Aluat acid din fin de secar Aluat acid din fin de secar Fin de secar Aluaturi acide din fain de gru Panetone, brioe Aluaturi acide din fain de gru

Germania

Lb. panis Lb. spicheri Lb. pontis, Lb. sanfranciscensis,Lb. mendensis, Lb. crispatus, Lb. fermentum, Lb. reuteri (fermenti), Lb. johnsonii, Lb. panis Lb. paralimentarius, Lb. sanfranciscensis, Lb. brevis, Grecia Lactobacillus sp., Wiesella cibaria Lb. sanfranciscensis, Lb. fermentum, Lb. plantarum, Italia Leuconostoc mesenteroides, Pediococcus spp. Lb. alimentarius, Lb. sanfranciscensis, Lb. brevis, Lb. plantarum, Lb. acidophilus, b. fermentum, Lb. delbrueckii subsp. bulgaricus, Lactococcus lactis subsp. lactis, Wiesella confusa, W. rosii Lb. sanfranciscensis, Lb. acidophilus, Lb. plantarum, Lb. farciminis Lb. brevis, Lb. plantarum Spania Lb. siliginis Coreea de sud Lb. sanfranciscensis SUA

Aluaturi acide din fain de gru Aluaturi acide din fain de gru Aluaturi acide din fain de gru Aluat tip San Francisco Produse de panificaie din Frana

Font de Valdez G., Gerez, C.L., Torino M.I., Rolln G., 2010, New Trends in Cereal-based Products Using Lactic Acid Bacteria, pp. 273-287. In: Mozzi F., Raya R.R., Vignolo G.M. (Eds.), 2010, Biotechnology of lactic Acid Bacteria. Novel Aplications, WileyBlackwell Publishing

Grupuri i caracteristicile fiziologice ale unor lactobacili identificai n microbiota aluaturilor acide
Caracteristici fiziologice Cretere la 15C Cretere la 45C Fermentare pentoze Formare CO2 din glucoz Formare CO2 din gluconat Producere de FDPa aldolaz Producere de fosfoketolaz Strict homofermentativi + + Facultativi heterofermentativi + + + + +b) Strict heterofermentativi +/+/+ + + +

Specii reprezentative n microbiota aluaturilor acide

Lb. acidophilus Lb. amylovorus Lb. delbrueckii subsp. bulgaricus Lb. delbrueckii subsp. delbrueckii Lb. farciminis Lb. helveticus Lb. leichmanni Lb. mindensis

Lb. alimentarius Lb. casei Lb.curvatus Lb. paralimentarius Lb. plantarum Lb. rhamnosus

Lb. brevis Lb. buchneri Lb. fermentum Lb. fructivorans Lb frumenti Lb. panis Lb. pontis Lb. reuteri Lb. sanfranciscensisc) Lb.viridiscens

a) FDP fructozo-1,6 difosfat; b) indus de pentoze; c) cu denumiri sinonime Lb. brevis ssp. lindneri, Lb. sanfransisco Axelsson, A., 2004, Lactic Acid Bacteria: Classification and Physiology. In: Salminen, S.; von Wright, A; Ouwehand, AC (Eds.). (2004). Lactic Acid Bacteria: Microbiological and Functional Aspects (3rd ed.). New York: Marcel Dekker, Inc.

Bacterii lactice din microbiota aluaturilor acide Grupuri taxonomice, n funcie de proprietile biochimice i fenotipice

Grupul Aa

Genuri i specii Lb. acidophilus, Lb. amylovorus, Lb. crispatus, Lb. delbrueckii (Lb. delbrueckii ssp. bulgaricus, Lb. delbrueckii ssp. delbrueckii, Lb. delbrueckii ssp. lactis), Lb. johnsonii Lb. farciminis Lb. alimentarius, lb. casei, Lb. plantarum Lb. brevis, Lb. buchneri, Lb.fermentum, Lb. fructivorans, Lb. reuteri, lb. pontis, Lb. sanfranciscensis Lb. confusus (sinonim Weissella confusus) Weisella ssp.( Weissella confusus) Pediococcus (Pediococcus acidilactici, Pediococcus pentosaceus)

Ab Bb Cb Cc

SPECII NOI IDENTIFICATE:


Grupul Lactobacillus buchneri - Lactobacillus acidifarinae, Lactobacillus hammesii, Lactobacillus
spicheri i Lactobacillus zymae

Grupul Lactobacillus alimentarius -Lactobacillus mindensis i Lactobacillus nantensis Grupul Lactobacillus reuteri -Lactobacillus rossiae Grupul Pediococcus - Pediococcus argentinicus
Stlolz P. , 2003, Biological Fundamentals of Yeast and Lactobacili Fermentation in Bread Dough. In: Kulp K., Lorenz K (Eds.), Handbook of Dough Fermentations, Macel Dekker Inc. Font de Valdez G., Gerez, C.L., Torino M.I., Rolln G., 2010, New Trends in Cereal-based Products Using Lactic Acid Bacteria, pp. 273-287. In: Mozzi F., Raya R.R., Vignolo G.M. (Eds.), 2010, Biotechnology of lactic Acid Bacteria. Novel Aplications, WileyBlackwell Publishing

TEHNICI DE INVESTIGATIE A BACTERIILOR LACTICE DIN MICROBIOTA ALUATURILOR ACIDE

Metode clasice
Specii de bacteria lactice Lb pontis Lb. panis Lb. mindensis Lb. spicheri Lb. rossiae

Examen cultural

Evaluare: -calitativa -cantitativa

Condiii selective de cultivare Mediul MRS suplimentat cu aminoacizi i vitamine Mediul MRS suplimentat cu maltoz i fructoz MRS5 pH= 5,4 pH acid 30C 30C 30C Anaerobioz Microaerofilie Aerobioz

MRS suplimentat cu 1% maltoz i pH= 5,6 10% extract de drojdie MRS suplimentat cu 1% maltoz i pH=5,4 fructoz i 0,1% ciclohexamin MRS suplimentat cu 2% maltoz pH =5,4

Lb. acidifarinae

37C

Lb. zymae Lb hammesii Lb.nantensis

30C 30C

Aerobioz Anaerobioz

MRS suplimentat cu 1% maltoz i pH= 6,2 0,5% extract de drojdie

De Vuyst L., Vancanneyt M., 2007, Biodiversity of sordough lactic acid bacteria. Food Microbiology, 24, 120-127

TEHNICI DE INVESTIGATIE A BACTERIILOR LACTICE DIN MICROBIOTA ALUATURILOR ACIDE s - s PCR - specific-specific PCR

Analiza culturilor pure


Culture-dependent

RFLP -restriction fragment length polymorphism AFLP - ribotyping, amplified fragment length polymorphism ARDRA - amplified ribosomal DNA restriction analysis PFGE - pulsed - field gel electrophoresis RAPD (random amplifi ed polymorphic)

techniques

Metode moderne Biologie moleculara


Analiza in situ Culture-independent techniques Genomica independent de cultur - metagenomic

9PCR DGGE -PCR denaturing gradient gel electrophoresis 9PCR - TGGE -PCR temperature gradient gel electrophoresis 9FISH -fluorescence in situ hybridization . 9FISH & Flow cytometry

De Vuyst L., Vancanneyt M., 2007, Biodiversity of sordough lactic acid bacteria. Food Microbiology, 24, 120-127

CULTURI STARTER COMERCIALE Culturi multiple de bacteria lactice i drojdii,


n stare liofilizat, coninnd n diferite proporii speciile: Lactobacillus sanfranciscensis Lb. plantarum, Lb. brevis Lb. fructivorans sau Lb. brevis Lb. pontis Saccharomyces cervisiae

Tulpini selecionate pentru a satisface cerinele practice:


Scurtarea timpului de fermentaie. Optimizarea procesului fermentativ. Obinerea unui aluat de calitate care s conduc la obinerea unor produse de panificaie cu caracteristici senzoriale, fizico-chimice, nutritive i funcionale adecvate cerintelor consumatorilor. Asigurarea stabilitatii microbiologice timp cat mai ndelungat .

Hansen A, 2006, Sourdough Bread, pp. 183-1/183-21. In. Hui Y. H. ; Sherka F., Handbook of Food Science, Technology and Engineering, volume 4, Taylor and Francis Group, LLC

CONCLUZII
Desi bacteriile lactice au fost studiate de multa vreme (prima clasificare a fost realizata de Orla Jensen, in anul 1919), inca exista destule enigme privind biodiversitatea si functionalitatea acestora in situ si in vivo. Dezvoltarea permanenta a tehnicilor biotehnologiei moderne (biologie celular i molecular, genetic, inginerie metabolic, bioinformatic etc.) va conduce la acumularea de cunostinte pretioase privind biodiversitatea bacteriilor lactice cu implicatii stiintifice si aplicative deosebite Preocuparea actual pentru obinerea de produse de panificaie funcionale prin utilizarea de culturi starter probiotice de bacterii lactice reprezint direcii moderne de cercetare n acest domeniu. Cercetrile moderne privind diversificarea gamei de alimente funcionale derivate din cereale exploreaz capacitatea substraturilor de a conine compui cu rol prebiotic (component chimice nedigestibile cum sunt fibrele) corelat cu i rolul probiotic al bacteriilor lactice starter.
Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008, Contract nr. 1046/2009

Aplicaii ale ingineriei metabolice la bacteriile lactice


Iuliana Aprodu

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERIA METABOLIC

SINTEZ Modificri genetice


Biologie molecular Tehnologie ADN recombinant Clonri Transformri

DESIGN Planificarea modificrilor


Interpretarea rezultatelor Decizii privind modificri ulterioare

ANALIZ Caracterizare metabolic


Fiziologia fermentaiei Analiza cilor metabolice Analiza expresiei Caracterizarea proteinelor Nivel metabolii Analiza fluxului

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERIA METABOLIC

9abordare sistematic focalizat pe inelegerea n ansamblu a cilor metabolice celulare 9evit neajunsurile abordrilor alternative prin considerarea n detaliu att a reelelor de ci metabolice intracelulare ct i a mecanismelor de reglare 9investigarea, evidenierea i nelegerea trsturilor mecanistice conferite de modificrile genetice, permit explorarea raional a cilor metabolice 9cercetarea cilor metabolice a fost focalizat n principal pe studiul: - utilizrii substratului - formrii produilor - manipulrii genetice n scopul controlrii reaciilor biochimice intracelulare (flux)
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

I. SINTEZA Modificri genetice

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

II. ANALIZA Caracterizare metabolic

Fenotipul metabolic poate fi evaluat utiliznd diferite strategii. Separarea metaboliilor extracelulari i msurarea vitezei lor de acumulare furnizeaz informaii limitate referitoare la fluxurile intracelulare.
Msurtorile efectuate trebuie s permit analiza cantitativa a unei mari pari din reeaua metabolic pentru a obine cat mai multe informaii referitoare la efectul indus de o anumit modificare.

Gaz cromatografia cuplat cu spectrometria de masa (GC-MS) i rezonana magnetic nuclear (RMN) sunt folosite n mod curent pentru msurarea
cantitii de metabolii i a vitezei reaciilor chimice din celule. A fost dezvoltat i tehnologia microarray precum i alte instrumente proteomice pentru monitorizarea rspunsului expresiei genelor ca urmare a diferitelor modificri genetice.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

III. DESIGN Planificarea modificrilor

9O analiz robust este necesar pentru: - a stabili poriunile cilor metabolice susceptibile pentru manipulare genetic - a genera ipoteze relevante folosind vasta cantitate de date acumulat. 9Analiznd diferenele aprute n fluxurile metabolice ca urmare a modificrilor, pot fi identificate noi targete care ar putea conduce la mbuntirea fenotipului. 9Modificrile genetice sunt urmate de alte runde de analize i pot induce: - mrirea activitii unei enzime int dintr-o cale fie prin supraexpresie fie prin modificarea cii de reglare, - eliminarea enzimelor care direcioneaza carbonul spre produi intermediari nedorii, folosind diferite substraturi, sau schimbnd starea general a celulei pentru a favoriza anumite ci metabolice.
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INSTRUMENTELE INGINERIEI METABOLICE

9Control activitii enzimelor: -adaptarea promotorilor - se face prin schimbarea dimensiunii secvenei de baze n sensul modificrii activitii activatorului sau inhibitorilor, sau prin modificarea secvenei de baze - prin controlarea numrului de copii ale unei plasmide, se poate controla numrul de citiri disponibile pentru transcripie -ingineria transcrierii ARN controleaz cantitatea de ARNm disponibil pentru a fi translat in proteine active 9Compararea fenotipului metabolic al cii modificate cu al celei nemodificate - msurtori de flux metabolic - ncorporarea de metabolii marcai - substratul marcat sufer transformri de-a lungul cii metabolice i n acest fel metaboliii formai devin la rndul lor marcai

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INSTRUMENTELE INGINERIEI METABOLICE

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

REGLAREA PROCESELOR METABOLICE

Enzime constitutive sintetizate indiferent de compoziia mediului de cultur


- concentraia lor n celule este constant - ex: enzimele implicate n procese metabolice de baz (glicoliza, ciclul ATC, etc)

Enzime inductive sintetizate de celule ca raspuns la prezena unui substrat


- sunt sintetizate doar atunci cnd sunt necesare - substratul/compusul similar substratului care determin sinteza enzimelor se numete inductor

Enzime represive a cror sintez este blocat de prezena produsului final


specific cii metabolice la care particip in mod normal - produsul final se numete corepresor enzimatic
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

REGLAREA PROCESELOR METABOLICE

I. Controlul/reglarea activitii enzimelor - Inhibiie prin feedback sau inhibiie prin produs de reactie

II. Controlul/reglarea biosintezei enzimelor 1. Mecanisme de control negativ - Conduc la scderea vitezei de transcripie a proteinelor

2. Mecanisme de controlul pozitiv - Determin creterea vitezei de transcripie a proteinelor

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

REGLAREA PROCESELOR METABOLICE


Nivel de reglare ADN Transcriptie ARNm Translatie Proteina Modificari post-translationale Activitate enzimatica
substrat produs
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

Mecanism de control Modificarea genelor structurale

Exemple
Inductia enzimatica Represia catabolica Sinteza toxinelor

Controlul vitezei de transcriptie Represia enzimatica Modularea translatiei Modificarea proteinei dupa sinteza

Proteina modificata Proteina allosterica

Fosforilarea proteinelor

Enzime implicate in Modulare prin concentrarea moleculelor mici capabile sa se cai de biosinteza Proteine reglatoare lege la situsul efector implicate in reglarea transcriptiei

APLICAII ALE INGINERIEI METABOLICE LA BACTERII

9Ingineria metabolic (IM) poate mbunti n mod controlat proprietile bacteriilor i eficiena lor pentru obinerea unor modifcri dorite 9Aplicaii n industria alimentar 9Celule - culturi starter sau probiotice 9Sinteza anumitor compui bacteriile servesc drept biocatalizatori ptr sinteza de aminoacizi, acizi organici, vitamine, carbohidrati, etc. 9Produii de biosintez pot fi folosii ca aditivi alimentari 9Ingineria metabolic a permis modificarea eficient a unor bacterii lactice (LAB), Escherichia coli, Bacillus subtilis i Corynebacterium glutamicum

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

APLICAII ALE INGINERIEI METABOLICE LA BACTERII

9Criterii pentru selectarea bacteriilor folosite pentru experimente de IM: 9 Disponibilitatea instrumentelor genetice pentru clonare, expresie, disrupie sau substituirea genelor 9 Capacitatea de a metaboliza o gam variat de surse de C cu viteza mare 9 Cretere rapid pe surse de C i N ieftine 9 Includere in lista GRAS 9 Rezistena la atacul bacteriofagilor 9 Cunoaterea comportamentului fiziologic 9 Transportul eficient al produilor finali n mediul extracelular i tolerana la nivelul ridicat al acestora 9 Posibilitatea transpunerii proceselor la nivel industrial
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

APLICAII ALE INGINERIEI METABOLICE LA BACTERII

9Principalele strategii ale ingineriei metabolice 9Directionarea C spre compuii dorii prin blocarea cilor secundare 9Ingineria cofactorilor pentru eliminarea blocrilor 9Modificarea sistemelor de transport 9Supraexpresia sau introducerea de gene noi responsabile pentru producerea compuilor dorii 9Optimizarea mediului de cultur 9 Aspecte economice 9Utilizarea materialelor ieftine modificarea bacteriilor pentru utilizarea diferitelor substraturi care nu sunt metabolizate n mod natural

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE ACID LACTIC

1 Ingineria cii homo D-lactice prin introducerea mutaiilor n genele pta si ppc 2 Ingineria cii homo D-lactice prin introducerea mutaiilor n genele frdBC, ackA, adhE si pflB 3 Ingineria cii homo D-lactice prin introducerea mutaiilor n genele pta i ldhA i exprimarea genei L-lactat dehidrogenazei de la Lb. casei

adhE - acetaldehid/alcool dehidrogenaza ackA - acetat kinaza frdABCD - operon ptr. fumarat reductaza ldhA - lactate dehidrogenaza pflB - piruvat format liaza ppc - PEP carboxilaza pta - fosfotransacetilaza
PEP - fosfoenolpiruvat

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE ACID ACETIC

Strategie IM 1: 9Mutaii pentru minimizarea pierderilor de C si O pentru balanta redox prin inactivarea fosforilrii oxidative, pentru disruperea funciei ciclice a cii ATC i eliminarea cii fermentative native 9Pentru biosinteza n scop comercial este preferat un sistem anaerob care s permit obinerea eficient a acetatului Strategie IM 2: 9Eliminarea complet a cilor competitive ptr. redirecionarea fluxului de C n sensul sintezei acetatului 9Utilizarea tehnicilor IM ptr. transformarea acestor ci ntr-o alternativ viabil ptr. dezvoltare celular prin introducerea de modificri care s echilibreze consumul i formarea de NADH
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE RIBOFLAVINA

9Bacillus subtilis i Lactococcus lactis au fost modificate ptr. producerea de riboflavin 9B. subtilis: supraexpresia genelor rib (cluster; implicate in sinteza riboflavinei) prin nlocuirea a 2 promotori reglatori cu unii constitutivi din fagi 9Genele ribA codific o protein bifuctional cu activitate dihidroxi butanon fosfat sintetazic la capatul N-terminal i activitate GTP ciclohidrolazic la captul C-terminal 9MFA comparativ a tulpinilor slbatice i modificate a artat c fluxul pe ramura oxidativ a cii pentozofosfatului a fost mrit la tulpina modificat 9Lactococcus lactis: supraexpresia genei ribA ce codific enzima GTP ciclohidrolaza care catalizeaza prima reactie din calea de sintez din GTP 9GTP ciclohidrolaza este limitatoare de flux i supraexpresia ribA a determinat creterea productivitii riboflavinei de 3 ori
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE FOLAT

9Lactococcus lactis a fost modificat ptr. biosintez de folat 9Strategii IM: 9Expresia unor gene implicate n biosinteza folatului din GTP separat sau n combinaie cu expresia enzimei heteroloage -glutamil hidrolaza (de la oameni sau obolani) 9Aceste abordri au determinat creterea de 3-6 ori i modificarea distribuiei folatului de la majoritar intracelular la acumulare extracelular

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

GTP ciclohidrolaza I

folE

GTP

GTP ciclohidrolaza II

ribA

Dihidroneopterin aldolaza

folB

2-amino-4-hidroxi-6-hidroximetil dihidropteridin pirofosfokinaza

Diaminohidroxifosfo ribozilaminopirimidin deaminaza

ribG

folE

Dihidropteroat sintetaza

folP

5-amino-6-(5P-ribozilamino) uracil reductaza

ribG

Dihidrofolat sintetaza

folC

Riboflavin sintetaza ribB, ribH

Dihidrofolat reductaza

folA

Riboflavina vit B2

Tetrahidrofolat vit B11


Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE EPS


9LAB - biosintetizeaz prebiotice, n principal exopolizaharide (EPS) 9Tehnicile IM au permis producerea heteroloag de EPS cu ajutorul LAB care nu au capacitatea de a le sintetiza 9Productia de EPS la Lactococcus lactis poate fi mrit prin supraexpresia genelor eps care codific glicoziltransferaze 9Supraexpresia genei fbp ce codific fructozo-bifosfataza a determinat creterea lui Lac. lactis i sinteza de EPS prin utilizarea fructozei (sursa de C) 9A fost evideniat implicarea UDP glucozo pirofosforilazei i UDP galactozo epimerazei de la Lac. lactis n biosinteza UDP glucozei i UDP galactozei, precursori ai EPS ce conin uniti de glucoz i galactoz 9Supraexpresia genelor ce codific ambele enzime a determinat creterea pool-ului intracelular de UDP glucoz i UDP galactoz
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

INGINERII METABOLICE PENTRU BIOSINTEZA DE BACTERIOCINE


9Aciunea conservant a LAB este parial atribuit biosintezei de bacteriocine 9Problema asociat utilizrii bacteriocinelor: dezvoltarea populaiilor de bacterii patogene rezistente -> strategie IM: dezvoltarea de productori de bacteriocine multiple 9Similaritile privind sistemele de producere i secreie de pediocin PA-1 la Pediococcus acidilactici i lactocin A la Lac. lactis au fost valorificate; 9Utiliznd sistemul de secreie al lactocinei, Lac. lactis a fost modificat pentru expresie paralel de pediocin 9Sistemul de expresie heterolog a fost utilizat i pentru producerea simultan de enterocin A i pediocin PA-1 sau pediocin PA-1 i nizin 9A fost obinut i sinteza simultan de lacticin 3147 i lacticin 481
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

Tulpini de bacterii lactice izolate din cereale aflate n colecia MIUG


Conf.dr. biolog Vasilica Barbu

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

Tulpini de bacterii lactice izolate din cereale aflate n colecia MIUG

Obiective: Izolarea unor tulpini de bacterii lactice din microbiota epifit a cerealelor; Selecionarea lor dup criterii biotehnologice; Identificarea lor prin: Analiz fenotipic (taxonomie clasic); Kit-uri API (BioMerieux Lyon Frana); Tehnici moderne de biologie molecular.

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

1. Izolarea bacteriilor lactice

Etapa de mbogire: peste 25g din proba de cereale se adaug aseptic 40 ml soluie de 10% glucoz i se mojareaz pentru spargerea bobului, pn la formarea unei paste, dup care se transfer probele n pungi de plastic sterile, se nchid ermetic pentru a creea condiii de facultativ anaerobioz. Se termostateaz la 37C timp de 18 24h timp n care are loc fermentaia lactic. Inocularea i izolarea culturilor pure: din fiecare pung se recolteaz aseptic 100l i se fac diluii seriale. Din fiecare diluie, dup omogenizare, se recolteaz cte 100l i se transfer n plci Petri peste MRS solid cu Caractere culturale ale tulpinilor 1,5% agar i 1-2% CaCO3. Se luteaz (se rspndete de Lactobacillus sp. uniform suspensia pe suprafaa mediului cu spatula pe MRS cu 1-2% CaCO3 Drigalsky flambat, pn cnd se ntmpin o oarecare rezisten la executarea micrilor circulare pe suprafaa mediului, moment n care se consider c suspensia a fost adsorbit de mediul din placa Petri). Se toarn apoi, cte 4 5 ml MRS semisolid cu 0,75% agar i 1-2% CaCO3 (n dublu strat) i se termostateaz plcile cu capacul n jos la temperatura de 37C, timp de 24, 48 ore. Repicarea i obinerea culturii pure s-a realizat cu ajutorul metodelor prin rspndire: metoda scarificat Aspectul microscopic al tulpinii sau metoda Koch . Lactobacillus sp.

2. Selecionarea bacteriilor lactice izolate, dup criterii biotehnologice


Tulpina 1 Lactobacillus sp. 2 Lactobacillus sp. 3 Lactobacillus sp. 4 Lactobacillus sp. 5 S. lactis 6 Lactobacillus sp. 7 Lactobacillus sp. 8 Lactobacillus sp. 9 Lactobacillus sp. 10 Lactobacillus sp. 13 Lactobacillus sp. 14 Lactobacillus sp. 15 Lactobacillus sp. 16 Lactobacillus sp. 17 Lactobacillus sp. P. chrysogenum Diminueaz sporularea Diminueaz sporularea Diminueaz sporularea idem Inhib sporularea idem idem A.

niger A.glaucus B. cereus + ++ +++ + ++ ++ + + ++ + + + + +++ + + + + + + + + + ++ +++ + ++ ++ + ++ + +++ ++ +++ +++ ++++

Bacterii S. cerevisiae coliforme + +++ + +++ ++ + ++ + +++ ++ ++ ++ + + + +++ +++ + +++ +++

2. Selecionarea bacteriilor lactice izolate, dup criterii biotehnologice

Antagonismul tulpinilor Lactobacillus sp. 13 GAL, 14 GAL, 15 GAL, 16 GAL, 17 GAL fa de Bacillus cereus

Antagonismul tulpinilor Lactobacillus sp. 14 GAL, 15 GAL, 16 GAL, 17 GAL fa de bacterii coliforme

Activitatea antimicrobian a tulpinilor Lactobacillus sp. 14 GAL, 15 GAL, 16 GAL, 17 GAL fa de Aspergillus niger.

Activitatea antimicrobian a tulpinilor Lactobacillus sp.14 GAL, 15 GAL, 16 GAL, 17 GAL fa de Saccharomyces cerevisiae

2. Selecionarea bacteriilor lactice izolate, dup criterii biotehnologice


Lb. brevis 16 GAL a c

Lb.brevis16 GAL Lb.plantarum 14GAL Lb.plantarum 13GAL b d Lb.plantarum 14GAL

Activitatea antimicrobian fa de E. coli (a) Staphylococcus sp. (b), Listeria sp. (c) i Salmonella enteritidis (d) a tulpinilor Lactobacillus sp. 13GAL, 14GAL, 15GAL, 16GAL, 17GAL
Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

3. Analiz fenotipic (taxonomie clasic)


Capacitatea tulpinilor de Lactobacillus sp. selecionate de a crete pe medii cu diferite surse de carbon (auxograma)

Proprieti biochimice ale tulpinilor de Lactobacillus sp. selecionate

3. Analiz fenotipic (taxonomie clasic)


Sensibilitatea bacteriilor lactice selecionate la antibiotice (antibiotipul)
Tulpina 13GAL 14GAL 15GAL 16GAL 17GAL AMP CRO CXM S S S S S R R R R R R R R R R IMP K GEN TOB NOR VA ERY R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R S S S S S OXA R R R R R STR TEC R R R R R R R R R R

Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 00 00 00 00 00 00 00 00 00 00 00 00 E E E E E E E E E E E E +0 +0 +0 +0 +0 +0 +0 +0 +0 +0 +1 +1 1 0 9 8 7 5 4 0 2 6 3 1

Tulpina 13

Tulpina 14

Tulpina 15

Tulpina 16

Tulpina 17

Gradul de multiplicare al bacteriilor lactice selecionate la cultivarea n sistem submers discontinuu

ufc/m l

12

16

20

24

48

Timp de cultivare, h

7 Tulpina 13 6,5 6 Tulpina 14

8 7 6 Aciditate 5 4 3 2
Tulpina 17

Tulpina 13

Tulpina 14 Tulpina 15

pH

5,5 5 4,5 4 0 2 4 6 8 10 12 14 16 18 20 22 24 48

Tulpina 15

Tulpina 16

Tulpina 16 Tulpina 17

1 0 0 2 4 6 8 10 12 14 16 18 20 22 24 48 Timp de cultivare, h

Timp de cultivare, h

Evoluia pH-ului Evoluia aciditii la cultivarea bacteriilor lactice selectionate, n sistem submers discontinuu

3. Analiz fenotipic (taxonomie clasic)

100 90 80 70 60 50 40 30 20 10 0 Tulpina 17 Tulpina 13 Tulpina 14 Tulpina 15 Tulpina 16

24h

3 luni

6 luni

9 luni

1 an

Timp de conservare

Viabilitatea culturilor starter conservate prin congelare la -70C (%)


Workshop Culturi starter de bacterii folosite la fabricarea produselor pe baz de cereale, iunie 2010 PCE-ID_500/2008, Contract nr. 1046/2009

3. Analiz fenotipic (taxonomie clasic)


Rezultatul analizei fenetice aplicate izolatelor GAL 13- 17 20

15

distanta de lincaj

10

0 LDDB LDL2B LDL2A LDL1B 17GAL 16GAL 15GAL 14GAL 13GAL LDL1A LDDA LP2B LP2A LB1B LB3A LB3B LB2B LB2A LP1B LP1A LB1A

Dendrograma (% linkage) rezultat n urma analizei fenotipice prin utilizarea soft-ului Statistica

4. Identificarea cu sisteme microtest API (BioMerieux Lyon Frana)

Lactobacillus plantarum 100%

Lactobacillus brevis 96%

Lactococcus lactis ssp lactis 85% Weissella sp. 82%

5. Taxonomie molecular
Tulpinile de bacterii lactice utilizate n determinrile genetice Tulpina Lactobacillus plantarum 15GAL Lactobacillus brevis 16GAL Lactobacillus sp. L Kituri utilizate: G NOME Kit (Biomedicals) pentru izolarea de ADN total de la tulpinile de bacterii lactice alese spre analiz. High Pure PCR Product Purification Kit (Roche), pentru purificarea fragmentelor genice amplificate prin PCR. TOPOTA Cloning Kit (Invitrogen) pentru clonarea genelor de interes n vectorul pCR2.1 TOPO. BigDye Terminator v3.0 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) pentru secvenierea genelor ADNr 16S. Colectia MIUG Colectia MIUG Colectia MIUG Sursa Grau Grau Secara

5. Taxonomie molecular
Pst 11,5 kpb Electroforeza n gel de agaroz 0.7% a ADN genomic 15Gal 16Gal L

Concentratia si puritatea ADN genomic Concentratia ADN A-260nm genomic izolat (ng/l) Lb. plantarum 15GAL 77,1 1,542 Lb. brevis 16 GAL 82,0 1,640 Lactobacillus sp. L 41,5 0,830 Tulpina A-280 0,824 0,894 0,417 260/280 1,87 1,83 1,99

Primerii utilizai pentru amplificarea fragmentelor ADN


Oligonucleotidele Secventa nucleotidica (Sigma) AL 656 TGACTGACTGAGTGCCAGCMGCCGCGG AL 657 Scop

Amplificarea genei ADNr 16S - forward TGACTGACTGAGAGCTCTACCTTGTTACG Amplificarea genei ADNr MYTT 16S - reverse

Harta genetic a pCR2.1-TOPO (Invitrogen)

5. Taxonomie molecular

Electroforeza n gel a produilor rezultai prin amplificarea genelor ADNr 16S Pst 15Gal 16Gal L

~ 1,5kb

~ 1,5kb

5. Taxonomie molecular

Screening-ul de culoare a transformanilor de E. coli DH5 cu vectorul recombinat pCR2.1 -TOPO - ADNr16S pe mediu selectiv cu X-Gal / IPTG

Histogramele spectrofotometrice ale ADNplasmidial recombinat pentru tulpinile 15GAL, 16GAL i L

Pentru analiza secvenei nucleotidice a genelor ADNr 16S s-a utilizat BigDye Terminator v3.0 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) i programul DNAMAN Versiunea 4.03 (Lynnon Biosoft). Analiza BLAST (Basic Local Alignment Search Tool) a secvenelor a fost posibil prin utilizarea serviciului online al National Center for Biotechnology Information (NIH, SUA), la adresa: http://www.ncbi.nlm.nih.gov/BLAST/.
GenBank: DQ141558.2 Lactobacillus plantarum strain HDRS1 16S ribosomal RNA gene, partial sequence 98% GenBank: FJ824740.1 Lactobacillus brevis strain JH-1 16S ribosomal RNA gene, partial sequence 99% GenBank: FJ429978.1 Weissella confusa strain C5-7 16S ribosomal RNA gene, partial sequence 99%

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.ro

Testarea proprietilor biotehnologice ale unor aluaturi acide liofilizate Nicoleta erban, absolvent 2010, licen BI Prof.dr.ing. Gabriela Bahrim Lector Dr.Ing. Aida Vasile Notie

Iunie 2010 Galai

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.ro

Lactobacillus helveticus (LH-B02) i K. marxianus ssp. marxianus (LAF-4) ca alternativ la fabricarea pinii de secar prin metoda tradiional Mariana Vdeanu, Mdlina Ru, absolvente 2010, licen CEPA Lector Dr. Iuliana Aprodu Conf.Dr.Ing. Iuliana Banu Notie

Iunie 2010 Galai

Cercetri chimice, biochimice i tehnologice pentru valorificarea potenialului nutritiv al secarei PCE-ID_500/2008 (contract nr. 1046/2009) www.nutrirye.ugal.ro

Biosinteza de exopolizaharide n aluatul acid de secar Drd.Ing Ina Vasilean As.Dr.Ing. Corina Neagu Conf.Dr.Ing. Iuliana Banu Notie

Iunie 2010 Galai