!"#  $&%'%
(*) + .
, -0/1+ ,.2 3*1
( 4+6587:9<;

=?>@ACBED<FHGAJILKNM

FOKP>QRTS:UVWYXCZ\[^]_

XC`:]YW
acbcbOde8fcfgOgcghLikjHdcbhmlOnToOpqhsrtfcucv#wxytz
KP{6G|~}€G#>@ACK‚0}ƒ{…„OIP†‡FOˆŠ‰L‹#†‡ŒA†
Ž @OK‘8G>KP|ƒACQ…@K’“#“ 

 

 !#"$% '&)(*(,+.-0/214365!/7148:9;+=</?>A@CB6D
E;>AFHGI>KJLBLMANLOP@ORQTSIUVOR8:WXE./ZY\[]C]^_`C`baCaCacd

eCfcgihCdL`Cjlkmniepo

nloC`Cjlkm

nieqonLorc[]spjtu
&4SvCwIH>Ax

yGzY&)t!{|

|

{:1}~€‚bƒ0„†…€‡L‰ˆ‰Š0‹Œ…€Š~‚‚u
ŽFHGOOvqSFHG>K‘’O†“R”G•DGJqSS

–.

—V‘A>K˜IH•™X˜.

Sšœ›vpSNL•IH•œNL>KFHGIH>AJLBlMž1%‘AO•‰<iS.

BŸU SNL>K šœ¡b1%‘AOFS.

JŸS.

F:G•¢IU S.

S6š¢BLUV•¢@GS.FzNO /?>Kšœ•œ@l£$O¤¥LJl‘A>AšœOŒNL•zE.

F¦NOV8:9.+§Y#8:WrE=/€t¨šœS@lQTS.

IU •©vLBLJl‘A>AšœONOŒvp•œ‘’O WI•¢•z3SQ\G%ªOiI•«W¬SBL@61 NLOiG>KS.

@­™®˜.

•œIHF¯S±°.

u²{0NO/?>Aš¢•œ@L£œOšœS.

U S±Y#OFH•œB³šœIH>KG“¢I>KSCt:´CBO‘K´CBL•œIP˜•œIF¯S7UOi>AFz@lS˜iOl™vLI•¢F•¢IH˜iO@LNLSµOF FH•œ£¢¶6•¢F†·¢@LS¹¸%@˜OiI>’Oi@CGP36•¢š¢G>KS.

@LF:@LSWIHS.

@GH1º&4S‰˜•œI:5»•D6GFœ¨Oi@LN¼@LS¾½Oš¿–.

1º&4S‰˜•œIP5€•DGF$·iu¹+.UVO¹š¢À.

vL>AO¹NO ‘K>Aš¢•œ@L£œOR“*‘KS6šœO‘A>KÁ$ONO:@LS š$OvLMžGBL‘KS7ÂÃğŭ¿.ÆP‰ÇÈ6 Éb¾Ê»Ç¿lˉœÌ E.•¢F•œ@˜S.

‘K˜>ANLO @LS /‚OJpS.

IOiGÀ.

IH>ASPNl•z-¹•œ>ASF.¤€S.

ISFS.

F!•:¤IS.

¥lšœ‘A•¢SRNL•:¤»•œFH´CBL>AFOV•œUÏ&4S.vLIH>A•¢NONL•¢F¦5€•œIHUVSiQTMAF>Kš$OF©Y\[]C]C^_H`C`baaCa4cHj‰s6^]4c#f6ͬoCmrc#Î6hlt •*@LSV9.

@LFHGIBL£œ¯S0Y\[]C]C^_H`C`baaCa4c#eC^qmrc#f6Íomrc#Î6h6t¨?šœSUÏOvpS.

>ASŒNLS &4BlIFSVNL•:¤»À.

FÐ1º8©IONlBO£$¯iS •¢Uώ@Lx.

@l>K˜.•¢@LyOIH>’O -¾•œšœÑ@L>Kš$O¾Y\[]C]C^_H`C`baaCa4c#^¬g6o$snlmrcf6ÍoCmrcÎ6h6t •*NO +.

•¢IFH>ANONl•«W•¢NL•œIO‘­NL•«3lO@GO&OiGOI>K@O†Y\[]C]^_`C`baCaCac#f6ÍoCmXc#Î6h6tu { .

   .

.>=LFEŒHGTŠ~qˆ‰‡‚‡2‡)EJI KœŠˆ‰ °.6 9 : ~qˆ‰?€…<./0'21!345.  !"#$&% ')(*#+-.>=Lµ‡@?:BAp‡DCµ‡D.

už° °.

u²{ °.

u RO V ¤»OFFONLSC<¤IH•œF•¢@G•‰<iW¬B6GBLIHSu*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

už°.

už° ¤rOFHFONlS u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

už°.

u²{ ¤I•œFH•œ@G• u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

už°.

u WBlGBLIHS u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ŽrD6•œU vL‘ASRNL•*S.

J H•¢GS u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

U IH•œ‘KÀ.u²{6už° +.

x.

>ASzu«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .>AF¯iS Nl•œFSIxO@l>AÁ$OiNOP˜.

•œIHFBLF.S.

I>K•œ@G¿OiNOŒO SJ H•¢GS u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

u luž° =>KF¯SRNL•¢FS.

IHxO@L>KÁ$ONO 2u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

u lu²{ =>KF¯SRS.

IH>A•œ@GONOROŒS.

W RO V T *W Y Z p~<[.J H•¢GS €u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u RO 4T T RO V .

ŠG\ˆ‰]\Œ‹_^D\`Ga[.

N\R‚Šb?JEcE {6už° . e JLFHGIO£œ¯S u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6u²{ = f JHT •GS0YÉS.

B†¸%@LFºG¿Ñ@Lš¢>’Ot*u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6uRO &4‘AOFFH•œF†u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6ugX Ž@LšœOvLFBl‘’OU •œ@GS¹u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6uih  e GI>AJlBlGS.

F:YɤIS.

vLIH>A•¢NONL•¢F¿<jV OIH>’¡$˜.

•¢>AFt u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6uRk -¾“GSNLS.

F«Y3•œIH˜>K£œS.

l •¢IO@L£œO Uz¥L‘KG>AvL‘AO u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6uRS ¤€S. l •¢IO@L£œO FH>AU vL‘A•¢F«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6ui6P u²{ .F<WBL@L£œ¶•œFt u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6uiP ¦ l •œIOi@L£$O¾Ym¦l •œI•¢NL>KGOI>K•œNOiNL•‰t u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6ui6P už° .

‘A>KUVS.

To ‡*¬A ŠC pqnrEcs6tunv Oluž° ¸%@GIHS6NlBL£$¯SVOŒUVSNL•¢‘’Ox.Iº FU S u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u L n ?‚Š.

•¢U§SI>A•¢@G¿ONOROŒS.

JHT •GS u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Olu²{ ¤ISx.

IOUVOF)vOiIOŒNL•œFH•œ@LylSNLS.

F!NL>AOx.

>’Oix.IOUOiF+=-¾/ u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO u²{6už° E.

-0/ BLFO@LNLS SRvLISx.IOUVOF)+.

IOUVOPNL>AO u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OluRO -¾SNL•¢‘ASRNL•*S.

JHT •GS.

F"x E.>’OxIOUVOPNL•*šœ‘AOFFH•œF u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO uRlO už° -¾SNL•œ‘KS Nl•:SJHT •¢GS.

F"x /?>Ax.

O£œ¶•œF=u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO uRlO u²{ -¾SNL•œ‘KS Nl•:SJHT •¢GS.

e FFSšœ>AO£œ¶•œF u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO uRlO uRO -¾SNL•œ‘KS Nl•:SJHT •¢GS.F"x .

e x.F"x .

I•¢xO£$¯iSu:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO uRlO ugX -¾SNL•œ‘KS Nl•:SJHT •¢GS.

F"x 8©•œ@L•¢IO‘K>AÁœO£$¯SŒ•z¦ l •œIOi@L£$Ou:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO uRlO uih -¾SNL•œ‘KS Nl•:SJHT •¢GS.

F"x -¾ÀNLBL‘KSRS.

e FFHBL@GS u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OlugX -¾SNL•¢‘ASRNL>A@LÑUV>KšœS u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO ugLX už° -¾SNL•œ‘KS Nl>A@ÑU >Aš¢S{x E.Bu.>’OxIOUVOPNL•:ŽX˜.

•œ@GS.

FÏu«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u O 7-8 LNM OQP OQP OQP O>S O>U O>U O>U O>U X | dNL XQO XQO X>X X>X X4h XQk XQk X4P X4P XQS dNw XQU 6h ° .

h { .

h { hyO hyO h>h hyk h>P h>P h>P .

X  .

SNL•œ‘KS Nl>A@ÑU >Aš¢S ¾ E.>’OxIOUVOzNL•:ŽFHGONLSu:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u -¾SNL•¢‘ASŒQTBL@Lš¢>AS. OlugXLu²{ {x Oluih OluRk OluiP OluRS .

@Oi‘ E.>’OxIOUVOzNL•*š$OiFS.-0/ E.>’OxIOUVOzNL•:OiG>K˜>ANOiNL•Zu:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u +.

F¦NL•*BLFS u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u +.-0/ E.>’OxIOUVOzNL•*vOš¢SG•¢F u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 5€•œFºG¿O@LNlSVS F>KFHG•¢UOPš¢S.

U NL>AOx.

IOUOiFNL•*S.

J H•GS.

F!•*NL•
š¢S

‘’OJpS

IO£$¯S u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
lu luž° +=-0/
E.>AOx

IOUO«NL•*šœS

‘AOJqSIO£œ¯S u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
lu lu²{ +=-0/
E.>AOx

IOUO«NL•*S

J H•¢GS

F u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
®•¢I>K Lš$O@LNlS
SRvLIHS H•¢GSV•:OŒ>AU
vL‘K•œU
•œ@G¿O£œ¯SPš¢S

U S

F
NL>AOx

IOUOiF4NL•*šœSUVvpS

@L•¢@CG•œF¦•*NL•*•D6•œš¢BL£$¯S u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
lu luž° +=-0/
E.>AOx

IOUO«NL•*šœS.

>AOx.U vqS@L•œ@G•¢F u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u lu lu²{ +=-0/ E.

IOUO«NL•*•D6•œš¢BL£$¯S u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OluRU V O RS O RS x )x )x 2x 2x T jT T hyS k.

| k.

| k.

| kl° kl° k{ k>O k>O k>O  k>k kQP kQP kQP k>S k>S k>U k>U P| 6P ° 6P ° .

P { .

P { .

P { .

P { .

P { PyO PHX PHX P>h P>h P>h Pyk Pyk Pyk PyS PyU PyU PyU .

S |

S |
S

|

O RU
2x
O RU
2x
d .ˆ‰‡»‡D\ €‡L‡  „†Š\œŠ~p]o&GmCµŠ6~pˆ‰ ‚Š… C ?«BA¬‡DC ‡
XLuž° ŽFvp•œš¢>K šœO£$¯iS u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
XLu²{ ;e @¡‘A>KF•=SI>A•¢@G¿ONOROŒS

JTH•GS0Yae f f*t u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
XLuRO e f f 14-¾SNL•¢‘’Ox

•¢U NL•*S

J4HT •¢GSF u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO už° ¸%NL•œ@G>K šœO£$¯S
NL•:OFHFBL@GSF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO u²{ ¸%NL•œ@G>K šœO£$¯S
NL•*šœ‘AOFFH•œF u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO uRO ¸%NL•œ@G>K šœO£$¯S
NL•*S

JHT •GS

F¦u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO ugX ¸%NL•œ@G>K šœO£$¯S
NL•:OFHFSšœ>’Oi£œ¶•œF u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO uih ¸%NL•œ@G>K šœO£$¯S
NL•:OiGI>AJlBlGS

F4u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO uRk ¸%NL•œ@G>K šœO£$¯S
NL•*yL•¢IO@L£œOF¹u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO uiP ¸%NL•œ@G>K šœO£$¯S
NL•*U
“¢GSNLS

F u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX uRlO uRS ¸G•¢IO£œ¯S u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
XLugX e f f 14-¾SNL•¢‘’Ox

•¢U NL>K@ÑU
>AšœO u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX ugLX už° ¸%NL•œ@G>K šœO£$¯S
•©QTS

IUVO£œ¯SŒNL•*>A@G•¢IHQÉOš¢•œF³u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX ugLX u²{ ¸%NL•œ@G>K šœO£$¯S
NL•*•¢˜•œ@GSF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX ugLX uRO ¸%NL•œ@G>K šœO£$¯S
•*vLI•¢vOIO£$¯SRNLSF¦š¢•œ@¡iI>ASF u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
LX ugLX ugX &4S

@LFºGIBLO BLU NL>’OxIOUVOzNL•*•œFºG¿ONlS.

FŒu«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u XLuih e f f 14-¾SNL•¢‘’Ox.

•¢U§QTBL@lšœ>AS@O‘ u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u XLuRk ¤IS HT •¢GS NLSRF>KFHG•œUVO u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u XLuiP ¤IS HT •¢GS S.

IH>A•œ@GONLSRORS.

JHT •¢GSÏu«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX ui6P už° ŽXQT•œ>KGS.

F)NLS vLIS HT •¢GSR@LSF¦U “¢GS6NlS.

F u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX ui6P u²{ ŽXQT•œ>KGS.

F)NLS vLIS HT •¢GSR@OiF¦yl•œIOi@L£$OF u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX ui6P uRO ŽXQT•œ>KGS.

F)NLS vLIS HT •¢GSR@OiF.OiFFSšœ>AO£œ¶•œFµu«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u XLuRS ¸%U vL‘A•¢UV•¢@G¿O£œ¯S u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u XLuRU 5€•œFºG•œF u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°‰| -0Oi@B6G•œ@l£$¯S u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°ŸE.SšœBlUV•¢@CGO£$¯iSVNL•*BLU vLIS.

xIOUVO u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

už° E.SšœBLU •œ@G¿Oi£$¯S NLSRF>KFHG•¢UO u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

u²{ E.SšœBLU •œ@G¿Oi£$¯S NLS.

F¦OFHFBL@GSF u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

uRO E.SšœBLU •œ@G¿Oi£$¯S NOF!šœ‘AOFFH•œF u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

ugX E.SšœBLU •œ@G¿Oi£$¯S NOF¦OFHFSšœ>’Oi£œ¶•œFzu:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

uih E.SšœBLU •œ@G¿Oi£$¯S NLS.

F¦OiGI>AJlBlGS.

F¾u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u LX už°.

°.

uRk E.SšœBLU •œ@G¿Oi£$¯S NLS.

F!U “¢GSNLS.

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.F u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u e.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( . .

   .

h .

.

>=Lµ‡L Z.  ' ' / +"/   : ~qˆ‰?€…<.

@LFH>€&)(*( u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u SyX 6h uRO =  BO>KF!OF!@LS‰˜>ANONl•œF!•©˜Oi@CGOx. L 6h už° +¦U vqSBLšœSRNL•*yL>KFHGÀI>’O2u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u S>O 6h u²{ f ´Bl•«“*S{e.

•¢@LF!NL•«&)(:(† u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u SyX 6h ugX 5)>KvqS.

F)Nl•:vlIS.

x.

IOUVO£$¯SŒ•¢U'&)(*( u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u SyX 6h uih 36•¢‘A•¢£$¯SRNORvL‘’ObG¿OiQTS.

IHUO«NL•*vLIS.

xIOUVO£$¯iS u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u SQh 6h ui6h už° 36•œ‘K•œ£œ¯SVNlSVOiUPJL>A•¢@G•©x.

¸©YTJL>AJl‘A>ASiG•œšœOFx.I¡i šœSP148*E.

I¡i šœOF¿tu*u«u:u:u«u:u«u:u:u«u SQh 6h uRk . e UPJL>A•¢@G•œF!NL•*NL•¢F•¢@C˜S.

‘K˜>KUV•¢@CGS¼u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u S>k 6h uiP &4S.

>žQT•œIH•œ@L£œOF!NL•*@LS.U vL>K‘’OI¢¨6‘K>A@L–bOI¢¨lNL•¢JLBLxOI!•*vLIHS ‘A•¢I u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u S>U 6h uRS E.

U •œ@Lš¢‘’OiGBLIO¹Y#¤ f f •«&)(*(*t¹u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u U.

| 6h uRU /‚O$w.

S.

Nl•:BlU vLISx.B6G.

IOUVO u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u U.

| 6h uRlU už° . e IH´Bl>K˜.

S NL•*vLIHSjHT •¢GS u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Ul° 6h uRlU u²{ . e IH´Bl>K˜.

e IH´Bl>K˜.S NL•*š$OiJq•¢£$O‘KyLSRNOŒšœ‘’OiFF•VYC u yt u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Ul° 6h uRlU uRO .

S NL•*>AU vL‘K•œU •œ@G¿O£œ¯SPNORšœ‘AOFFH•VYC u šœvLvtÏu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u U{ 6h uRlU ugX . e IH´Bl>K˜.

S NL•*>AU vL‘K•œU •œ@G¿O£œ¯SPNOŒQTBL@L£œ¯SRUOi>A@2YÉvlIS.

x.

IOUVOlu š¢vLv¬t¾u:u:u«u:u«u:u:u«u U{ 6h už°‰|ZŽrD6•œU vL‘ASRNL•*BLU vLIS.

xIOUVOPS.

I>K•œ@G¿OiNLS ORSJHT •¢GSV•¢U'&)(*( u«u:u«u:u*u«u:u:u«u:u«u:u:u«u U{ \ ‹_^D\`Ga.

[ NR\ ‚Š Z.

 wNM  Z p~<.

[ Š\G ˆ‰]Œ lk už° 36SJLI•:OŒF>K@CGObD6•*NL•«&)(:( u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u UQP lk u²{ &4S.

@lšœ•œ>žGS.

F!J¡iF>Aš¢S.

F!NL•«&)(*( u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u UQP lk uRO ¤»O‘’O$˜IOF!š¿yO$˜•œF.NlS&)(*( u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|.

| lk ugX 9¦S.

UV•©NlS.

F!S.

JHT •¢GS.

F«YÉ>KNL•œ@G>ž š$OiNLS.

I•¢F¿t u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|.

| lk ugLX už° &4S.

@˜.

•¢@L£$¯SvOIOŒ@LSUV•¢F)NL•*S.

JHT •¢GS.

F2u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|.

vOiIOŒNL•œš¢‘’OIO£œ¶•œFRu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|yX lk ui6h u²{ ŽrDl•¢UVvl‘AS.| lk uih E.•¢šœ‘AOIO£¢¶6•¢F u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|>O lk ui6h už° 36•œ@G•œ@L£œOF.

F!NL•*NL•¢šœ‘’OiIO£¢¶6•¢F u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|Qh lk uRk E.• @L>K£œ¶•œF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|Qh M pqG ]\ 9 w 6P už° ¸%@GIHS6NlBL£$¯SVOSRšœS@Lšœ•¢>KGSRNL•©G>AvpS.

F u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|>U 6P u²{ +¦FS NL•©G>AvpS.

F)vLIH“1NL•¢ @l>ANLS.

F)Nl•P&)(*( u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|>U 6P uRO +¦FS NL•©G>AvpS.

F)NLSRBLFHB¡IH>AS u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°`X 6P ugX +¦FS NL•©G>AvpS.

F)NL• @L>KNLS.

F!•œU Jl>AJL‘K>ASG•œš$OiF4•DG•œI@LOFPY#365!/€t u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

° k 6P uih V O@GOx.

•œU NOPG>Avl>K šœO£$¯SPQTSIHG•*NLSV&)(*( u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

° U 6P uRk 36•¢@G•œ@l£$OF.vOIOPG>AvpS.

F u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

° U   ‡*C Š\ »‡*.

[ Š 9Y#9 lS už° f ´Bl•«“*BLU @LOUV•¢FvOišœ• u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °{6° lS u²{ +¦FO@LNlSVSR•œFHvO£¢SNL•*@LS.

• @L>K@LNLS BLU @OU •œFHvOš¢• u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °{.U •œF)NLO JL>KJL‘A>KSG•¢š$OzvLONLI¯iS Nl•z&)(*( YTFHGN¬t u*u«u:u:u«u:u«u:u:u«u °{6° lS uRO E.

{ lS ugX &4S.

U vpS.

@LNLIH“zE.vOIOŒ@OiUV•¢FvOš¢•Ïu«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °{HX e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.@LNLSR@OU •œFHvOš¢• u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °{yO lS uih 36•¢@G•œ@l£$OF.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( . .

k  .

w Z oɇ*\`\œŠ\ lU už° ¤ISiGÀG>AvpSŒvOIOŒNL•¢šœ‘AOIOI)•*NL• @L>KI)šœ‘’OiFF•¢FPu*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u lU u²{ Ž@LšœOvLFBl‘’OU •œ@GS •œUÏ&)(:( BLFOi@LNLS SV•¢Fvp•œšœ>ž š$OiNLS.

I!NL•:Ošœ•¢FFHS u*u«u:u«u:u:u«u:u«u:u*u«u lU uRO &4‘AOFFH•œF¦O@L>K@LyONOiF u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u lU ugX 36•¢@G•œ@l£$OF¦vOIO š¢‘’OFHF•œF u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 9 }Œˆ‰jGa»I …‚ˆ$N\ °‰|luž°Ÿ¤ISiGÀG>AvpSŒvOIOŒNL•¢šœ‘AOIOI)•*NL• @L>KI!OiGIH>AJLBlGS.

F u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|lu²{  e GI>AJlBlGS.

F)Nl•:SJHT •¢GS u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|luRO  e GI>AJlBlGS.

F)Nl•:š¢‘’OFHF•VYɕ¢FHG¡iG>KšœS.

Ft u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|6uilO už° 36•œ@G•œ@L£œOF.vOiIOROiGIH>AJLB6GS.

FNl•:š¢‘’OFHF•¹u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|lugX  e GI>AJlBlGS.

F)š¢S.

@LFºG u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|luih  e GI>AJlBlGS.

F)š¢S.

U UPB6G¿OJL‘K• u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|luRk  e GI>AJlBlGS.

F)š¢S.

U ˜S.

ObGI>KJLBlGS.‘’OiG>A‘K• ¹u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|luiP ¸%@L>Kšœ>AO‘A>KÁ$O£œ¯SzNLSF.

F)NOŒšœ‘AOFFH•:@lS.

F!šœS.

@GIHBlGSI•œF u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °‰|luRS 36•¢@G•œ@l£$OF¦vOIOVOiGI>KJLBlGSF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 9B9 n ƒˆ‰?‚N\ °.

°.

už°Ÿ¤ISiGÀG>AvpSŒvOIOŒNL•¢šœ‘AOIOI)•*NL• @L>KI)UV“GSNLS.

F*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°.

u²{ E.•¢šœ‘AOIO£œ¯SL¨LNl•¢ @L>K£$¯SR•*I•GS.

IH@LS NL•*BLU U “¢GSNLS u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

•œš¢‘’OIO£$¯iS Nl•:BlU UV“GSNLS u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.°u {6už° E.

°u {6u²{ E.•¢ L@L>A£œ¯SVNl•:BlU UV“GSNLS u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°u {6u ¦•GS.

IH@LSRNL•*BLU U “¢GS6NLS±u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°u {6u ¤rOFHFOx•œUÏNLS.

F!vOiIÑU •¢GIS.

F)vpS.

I)šœÀvL>’Ol¨lvqS.

I)IH•¢QT•¢I›œ@lšœ>’OŒ•*vpS.

I)vqS@CG•œ>KIS u«u:u*u«u °.

°u {6u +.FHSVNL•:OIHx.

BLU •œ@GSF)vLI“1%NL• @L>ANlS.

F«YÉ>A@l>Ašœ>AO‘A>KÁ$ONlS.

I•¢F¿t u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

vOiIOŒNL•œš¢‘’OIO£$¯iSL¨LNL• @L>A£œ¯SR•*I•¢GS.°u {6u 36•œ@G•œ@L£œOF.

I@lS Nl•:U “¢GS6NlS.

F u:u:u«u:u«u:u*u«u °.

°.

u -¾“GSNLS.

F!@LS.

IHUOi>AF u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°.

u -¾“GSNLS.

F!šœS@LFHGŒu:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°.

u Z-¾“GSNLS.

F!•œFºG¿¡iG>Aš¢S.

F7u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°.

u -¾“GSNLS.

F!>A@l‘A>A@l•¦u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °.

°.

u Z36•¢@G•œ@l£$OF¦vOIO U “¢GS6NLSF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u RO gX ih Rk 9Y  °{>h °{yk °{yk °{>P 9Y w °{yU °{yU ° .

O | ° O { ° O { ° O>O ° O>O ° O>O ° OyX 9L ° OQh ° O>k ° O>k ° O>k ° OQP ° OQP °`X | °`X | °`LX ° °`X>X °`X4P ° h | ° hHX 9  ° h>h ° h>h 9M ° h>P ° hyU ° hyU ° lk ° ° k { ° k>O ° k>O ° kyX ° kyX ° kQP RO gX ih Rk iP 9Y ]€I Š[.

‡L Ap‡µ‚Š n ƒCˆ$?€]\ °{6už° f ´Bl•«“:OŒFS.

JlI•œšœOIx.

O NL•*U “¢GS6NLSF  u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u °{6u²{ ŽrD6•œU vL‘ASF)NL•*FS.

JLIH•œšœOIxO u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 9 L tuœ\ ¼‚Šb=? p~qˆ$Š.TG ]P\ Š Š ŠC  ~<[QTG ‡D\ ° lO už°Ÿ¤€S.

@G•œ>KIS.

F4u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lO u²{Z&4IH>’O£œ¯SŒ•*BLFS NL•*S.

JHT •GS.

F!NL>K@ÑU >AšœSFšœS.

U vqS.

@G•œ>AIHS.

F u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° 6O u {6už° ¤»S.

IH´CBL•«BlFOI!S.

JHT •GS.

F!NL>K@ÑU >Aš¢S.

F   u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° 6O u {6u²{ &4S.

@GIHS.

‘A•©NORšœIH>’O£œ¯SŒ•*NL•œ‘K•œ£œ¯SRNL•*S.

JHT •¢GS.

F¦šœS.

U§vqS.

@G•œ>AIHS.

F u:u«u:u:u«u:u«u:u*u«u ° lO uRZ O ¤€S.

@G•œ>KIS.

F!š¢S

@LFHG¦•*vpS

@G•œ>KIS

F)vLOIOŒšœS@LFHG u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
° lO ugX &4S

@˜•œIF¯SNl•:vpS

@G•¢>AIHS

F u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
° lO uih ¤€S

@G•œ>KISŒGyl>AF!u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
° 6O u 6h už° 36•œ@G•œ@L£œOF.vOiIOŒvqS@CG•œ>KISPGyl>AF³u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
° lO uRZ
k +¦FO@LNlSOB6GS !
vlGI u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
° lO uiP ¤€S

@G•œ>KIS

F!vOiIOŒUV“GSNLS

F)•:OiGI>AJlBlGS

F4NO
š¢‘’OFHF•  u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
e;@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU
vlG$u BlQTFšiu JlI
e vpS

FºG>A‘AOPNL•:¤IS.

x.

.IOUVO£$¯SŒ•¢U'&)(*( .

P    .

O RS ° lu !•¢QT•¢I›œ@lšœ>’OiFzY  t u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u luž° E.>KQT•¢I•¢@L£$OF!•¢@CGI•:I•QT•œI›¢@Lšœ>AO •©vpS.

@G•¢>AIHS u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u lu²{ ¦•QT•œIH›œ@Lš¢>’OF!vOIOŒvqS.

@G•œ>AIHS.

F u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u lu 36•œ@G•œ@L£œOF.vOiIOŒI•QT•œI›¢@Lšœ>AOF u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u kQP ° kQP ° k>S ° k>U 9M9 ° 6P ° ° 6P ° ° .

P { ° PyO ° PyO ° PHX ° .

S | ° S { ° S { ° S>O ° SyX 9 ° SQh ° S>S ° S>U ° .

U | ° lU ° ° lU ° ° U { 9w ° UQh ° UQh ° U>k ° UQP ° U>S ° U>U ° O iS O iS O iS RO 9 d n ƒˆ‰?‚N\ Z p~<\¢ˆ$i…?ˆ‰¬Š\RŠ0„Š.\ˆ‰b…‚ˆ‰¬Š\ °`LX už°Ÿ¤ISiGÀG>AvpSŒvOIOŒš¢S.

@LFHGIBlGS.

I•¢F.•*NL•¢FHGIBlGS.

I•¢Fu«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`LX u²{Z-¾“GSNLS.

F!šœS@LFHGIBlGS.

vOiIOŒšœS.I•¢Fu«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`lX u {6už° 36•œ@G•œ@L£œOF.

@lFHGIHBlGSI•œF u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`LX uRO &4S.

@lFHGIHBlGSI¦Nl•¢QÉOBL‘žG u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`lX uilO už° 36•œ@G•œ@L£œOF.vOiIOŒšœS.

@lFHGIHBlGSI¦Nl•¢QÉOBL‘žG u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`LX ugX &4S.

@lFHGIHBlGSI¦Nl•:š¢À.

vL>AOŒYɚ¢S.

@LFHG  S.

JT t0u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`lX uRLX už° &4S.

@LFºGIB6GS.

I!NL•*šœÀvL>’OŒ•*S.

JHT •GS.

F!NL>K@ÑU >AšœSF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`LX uiZ h -¾“GSNLS.

F!NL•¢FHGIHBlGSI•œF u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`lX u 6h už° 36•œ@G•œ@L£œOF.vOiIOŒNL•œFºGIHBlGS.

IH•œFu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`lX u 6h u²{ = f INL•¢U NL•*šœIH>’O£œ¯SR•:Nl•œFHGIBL>K£$¯SRNLSF¦SJHT •¢GS.

F u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °`LX uRk 36•¢@G•œ@l£$OF.vOIOŒš¢S.

@LFHGIBlGS.

•©Nl•œFHGIBlGS.I•¢F.

I•¢FRu«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 9  ŠC‡~ .

. ‡ ° 6h už°Ÿ¤ISiGÀG>AvpSŒvOIOŒyL•¢IO@l£$O u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6h u²{ ŽFvp•œš¢>K šœONLS.

I!NL•*yL•¢IO@l£$O u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6h uRO &4yOiUO@lNLSRšœS.

@LFºGIHBlGS.

e UPJL>AxBL>ANOiNL• u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6h uih !•œNL•¢šœ‘AOIO£œ¯SRNL•*UV“GSNLSRS.IH•œF¦NOŒšœ‘AOFFH•:JLOF•:•D6vL‘K>Ašœ>žG¿OU •œ@G• u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6h ugX .

B¹OiGIH>AJLB6GSŒ@ORšœ‘AOFFH•:Nl•œI>ž˜iONO u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° h u 6h už° 36•œ@G•œ@L£œOF.vOiIOŒI•¢NL•œš¢‘’OIO£œ¶•œF:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6h uRk 36•¢@G•œ@l£$OF.vOIOŒyL•¢IO@l£$Oµu:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 9  ŠC‡~ .

e UPJL>AxBL>ANOiNL•=•œU yL•œIO@L£$ORUP¥L‘žG>KvL‘’OPu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6k uilO už°.. ‡ n  To ˆ G <Éo ‡ ° lk už°Ÿ¤ISiGÀG>AvpSŒvOIOŒyL•¢IO@l£$ORUP¥L‘KG>AvL‘AOu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lk u²{ ¦ l •œIOi@L£$ORUP¥L‘žG>Avl‘’O u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lk uRO . l •¢IO@L£œO Uz¥L‘KG>AvL‘AOzšœS.

U§JOFH•«š¢S.

vOIOŒyL•¢IO@l£$ORUP¥L‘KG>AvL‘AOu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lk uRk = f INl•œU NL•*š¢I>’Oi£$¯SR•*NL•œFºGIHBL>A£œ¯SRNLS.UPBLU u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lk ugX ¦ l •œIOi@L£$ORUP¥L‘žG>Avl‘’O:˜>KIHGBLO‘¼u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lk uiZ h 36•¢@G•œ@l£$OF.

F!S.

JHT •GS.

F!•œU yL•œIO@L£$OiF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {|l° ° 6k uilk už° = f INL•¢U NL•*šœIH>’O£œ¯SR•:Nl•œFHGIBL>K£$¯SRNLSF¦SJHT •¢GS.

F!•œU yL•¢IO@l£$OF!˜>AIHGBO>KF u:u«u:u:u«u {|l° ° lk uiP ŽrD6•œU vL‘ASRNL•*yL•¢IO@l£$ORF>AU vL‘K•œF)•©yL•¢IO@L£œO Uz¥L‘KG>AvL‘AO u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {|yX ° lk uRS . e @¡‘A>KF•©NLSF¦•¢IIHS.

F!•œU >KG>KNLS.

Fvq•¢‘ASRšœS.

U vL>K‘’ONLSI u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {|QP 9 M =? ]oaGmC ¬ \`C  Y#9B9 ° 6P už°³-¾“GSNLS.

F!@¯SŒ˜>AIºGBOi>AF:YÉ@lS.

IUVO>AF¢¨l•¢FHG¿¡bG>Aš¢S.

F¿t:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6°.

° ° 6P u²{Z-¾“GSNLS.

vOiIOŒUV“GSNLS.F)˜>AIºGBO>KF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6° O ° P u {6už° 36•œ@G•œ@L£œOF.

F˜>AIºGBOi>AFŒu:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6° O ° 6P uRO &4S.

U SR>AU vL‘A•¢UV•¢@G¿OIS vpS.

‘K>AU S.

IH FHUVS u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6°`X ° P uilO už° 36•œ@G•œ@L£œOF.vOiIOŒvqS‘A>AU S.

Iº FU SŸu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6° P ° 6P ugX -¾“GSNLS.

F)˜>AIºGBO>KF)vLBLIHS.

vOiIOŒUV“GSNLS.F«Y&4‘’OiFF•¢F¦OJLFHGIOiGOF¿t u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6° P ° P uRLX už° 36•œ@G•œ@L£œOF.

F˜>AIºGBOi>AFvLBlIS.

OJlFHGIOiG¿OiF¿tPu«u:u:u«u:u«u:u:u«u {6° S e.@LNLIH“zE.F«Yɚ¢‘’OFHF•¢F.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.

FHG>A‘AOzNL•:¤IS.

x.

.IOUVO£$¯SŒ•¢U'&)(*( .

S  .

P ih 9  jÉG Š~€ ° lS už°¼¸%@GIHS6NlBL£$¯SVOSRšœS@Lšœ•¢>KGSRNL•©QTIH>A•œ@lN u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lS u²{Z&4‘AOFFH•œF)QTI>K•œ@LN u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lS uRO -¾“GSNLS.

F)QTI>K•œ@LN u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lS ugX WBL@L£¢¶6•¢F)QTI>A•¢@LN u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lS uiZ h 36•¢@G•œ@l£$OF¦vOIORQTIH>A•œ@lN u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 9 w  ]€I Š.

[ ‡L pA ‡µ‚Š@E ŠC‡€¬ ° lU už°¼¸%@GIHS6NlBL£$¯SVOŒFS.

JlI•œšœOIx.

O NL•*S.

vp•œIONLS.

I u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lU u²{ = f vp•œIOiNLS.

I•¢F!´Bl•:vpSNL•œU FH•œI!FSJLI•¢š$OIHI•œx.

ONLS.

Fu:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lU uRO 36SJLI•¢š$OIHxOŒNL•*S.

vq•¢IONlS.

I)šœS.

U SŒQTBL@L£œ¯S QTIH>A•¢@LNµu:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lU ugX 36SJLI•¢š$OIHxOŒNL•*S.

vq•¢IONlS.

I)šœS.

U SRUV“GSNLSRUV•¢UPJLIHSŒNO š¢‘’OFHF•«u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lU uih . e ‘Ax.

BL@lF)vLISGÀG>KvqSFNL•*FS.

JlI•œšœOIx.

OZu«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° lU uRk 36•¢@G•œ@l£$OF¦vOIO FHS.

JLI•¢š$OIHxOŒNL•*S.

vp•œIOiNLS.

­ŠR\ ŠC Z.IÏu*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Y  : C  To ŠC Š~qˆ‰‡~€‚ } \`¢\ #[QÉG ‡*.

 {|luž°¼¸%@GIHS6NlBL£$¯SVOF!OFHFSšœ>AO£œ¶•œF!•œUÏ&)(:( u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {|lu²{ . e FFSšœ>AO£$¯iS FH•œU'OiGI>KJLBlGSŒNl•:‘K>AxOi£$¯S u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {|luRO . e FFSšœ>AO£$¯iS š¢S.

UÏOiGI>KJLBlGSŒNl•:‘K>AxOi£$¯S u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Y#9 Z p~pŠj\  Š.\ S YL {yOQh {yO>k {yOQP {yO>S {yO>S Yd9 {HLX ° {HXQO {HXQO {HX>X {HX>X {HX4h YL {>hyO {>hyO {>hHX YM {>h>P {>hyS {>hyU {>hyU {y.

k | {ylk ° {yk { {ykyX {ykQh {ykQh {ykQh {ykQP {ykQP Yw {yk>U {>P | {>.

P { {>.

P { {>.

P { {>PyO {>PyO {>PyO {>PHX ° 6u ŽrD6•œU vL‘ASRš¢S.

UVvl‘A•¢GSŒšœS.

U vqS.

‘K>AU S.

IH LFU S u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6° {6°.

už°Ÿ¤ISiGÀG>AvpS.

FvOIOŒšœS.

@˜.

•¢IFH¶6•¢Fu«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u²{ 9¦•œšœ•¢FFH>ANONl•«NL•*š¢S.

@˜.

•œIHF¯S7u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u &4S.

@lFHGIHBlGSI¦Nl•:š¢S.

@˜.

•¢IF¯iS u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u -¾“GSNLS.

F!NL•*šœS@C˜•œIHF¯SYɚ$OiFHGt u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u Z&4S.

@˜•œIF¯S•D6vL‘A>Kšœ>KGOP@LS.

F!šœS@LFHGIBlGS.

š¢S.I•¢F.

U •Dlvl‘A>Aš¢>KG u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u 36•¢@G•œ@l£$OF¦vOIO U “¢GS6NLSF)NL•*šœS.

@˜.

•¢IF¯S§u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u Z&4S.

vOiIOŒš$OFºG¦NL>A@ÑiUV>KšœS u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.@˜•œIF¯SNl>A@ÑU >AšœOzšœSU Nlw@OU >Aš ¦šœOFHG«u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°u 6už° 36•œ@G•œ@L£œOF.

u &4S.

@˜•œIF¯S•¢FHG¡iG>Kš$OŒšœS.

U FHG¿ObG>Aš !š$OFºG u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

u &4S.

@˜•œIF¯Sš¢S.

U IH•œ>A@G•œIvlI•¢G !š$OFºG³u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°.

už°‰|+¦FO@LNlSV5®wvq•¢>AN u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
{6°

už°

° ®•¢I>K Lš$O£œ¯SRNLSŒG¿OUVO@LyLSRNL•*BLU S

J H•¢GSRšœS

U FH>AÁ¢•œSQRu:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
{6°

už°{ !•¢QT•¢I›œ@lšœ>’OiF¦•V bp ŒÇ VÇbË u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u

RO
gX
ih
Rk
iP
P
RS
RU
`V
YBY 
&

[ Š; ­Š\ 

T

{

{6už°¼¸%@GIHS6NlBL£$¯SVOF)•Dlš¢•œ£¢¶6•¢F u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
{

{6u²{Z&4S

@lšœ•œ>žGS

F!J¡iF>Aš¢S

F)NL•*•D6š¢•œ£œ¶•œF u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u
{

{u {6už° GIºw u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

GyLIHS‰ª u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.{u {6u²{.

{u {6u š$OiGš¿y u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{6u 36•¢.

´ L•œ@Lš¢>’ORNL•*šœS.

@GIS.

‘K•u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{u luž° 36•œ.

´ L•¢@Lšœ>AO Nl•:š¢S.

@GIHS.

‘A•*F•¢U •D6š¢•œ£$¯iS u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{u lu²{ 36•œ.

´ L•¢@Lšœ>AO Nl•:š¢S.

@GIHS.

‘A•*šœSU •D6š¢•œ£$¯iS u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{6u &4S.

vpS.@LNLIH“zE.U SŒ š$ORORvL>A‘KyO†YÉyl•$Ov¬t¼u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u RO gX iO iO RO e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

   .

U ih {>Pyk Rk {>Pyk iP {>P>P RS {>PyS Y L p4ŠC <oɇ6ˆ‰Š\Pq…‡*I€‡LjGTˆ‰]\ Y #9 {ylO už°¼¸%@GIHS6NlBL£$¯SVOS.

FG•œU vL‘’ObG•œF:YTxOJOiI>KGS.

F¿t u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySl° {ylO u²{ ¤ISiGÀG>AvpSŒvOIOPG•œU vL‘’OiG•œFRu*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySl° {y6O u {6už° E.•œš¢‘’OIO£$¯iS •D6vL‘AMKšœ>KGOPNL•©QTBL@L£œ¯S G•œU vL‘’ObG• u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>O {y6O u {6u²{ 36S.

JLIH•œšœOIxORNL•©QTBL@L£œ¯SŒG•¢UVvL‘AOiG• u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>O {y6O u {6uRO WBL@L£$¯iSRG•œU vL‘’ObG•©šœSU S.

JHT •GSR•œFºG¿¡iG>AšœS zu:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>O {ylO uRO &4‘AOFFH•œF!G•œU vL‘AOiG•¢F*YÉS.

B†G>KvqSF)vOIOiUV“GI>KšœS.

vOIOPG•œU vL‘’OiG•œF*u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySQh Y d ©~qˆ$b‡L€‡7Š  ‡É€‡@.Ft u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>O {ylO ugX ŽFvp•œš¢>’O‘K>AÁœO£$¯SŸu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySyX {ylO uiZ h 36•¢@G•œ@l£$OF.

[ ]C Z YM {HLX už°¼¸%@GIHS6NlBL£$¯SVOŒ•œ@GIONOR•*FOMKNOŒNL•*NONLS.

F!@LSV&)(*( u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySQP {HLX u²{ ½4>KJL‘A>KSG•¢š$OzNl•:•¢@GIOiNO •*FOMANOu:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {ySQP {HLX uRO f ´Bl•«“*BLU ‘KS6šœO‘A•  u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>S {HLX ugX e šœ‘AOFFH•¦>KS.

F ! JOiF• u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>U {HLX uih e šœ‘AOFFH•¦>KS.

F u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yS>U {HlX u 6h už° 36•œ@G•œ@L£œOF.vOiIO !>AS.

F  u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yU>O {HLX uRk e šœ‘AOFFH•¦>KS.

UVO@L>Av  u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yU>O {HlX uilk už° 36•œ@G•œ@L£œOF.vOiIO !>AS.

UVO@L>Kv.

vOiIO !>AFHGI•œOU  u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yUQP {HLX uRS e šœ‘AOFFH•¦SFHGIH•$OU u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yU>U {HlX uilS už° 36•œ@G•œ@L£œOF. u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yUQh {HLX uiP e šœ‘AOFFH•¦>KFHGI•$OiU Ïu:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yUQh {HlX u 6P už° 36•œ@G•œ@L£œOF.vOiIOŒS.

FHGI•œOU u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O.

|{ {HLX uRU e šœ‘AOFFH•¦FHFHGI•$OiU  u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |>O {HLX už°‰|C36•¢@G•œ@l£$OF.vOIOŒFºGI•œOU u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |yX L Y  ©~qˆ$b‡L€‡7Š  ‡É€‡@.

[ ]C } …<G pNR\ ‚Š„uGm\ .

[  {>6h už°¼¸%@GIHS6NlBL£$¯SVOS Oš¢•œFFHSOŒNL>KFšœS u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |Qh {>6h u²{ e šœ‘AOFFH•!QTFºGIH•$OU u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

e IUVOÁœ•¢@O@LNLSR•*‘A•¢@LNLSRS.O |Qh {>6h uRO .

JHT •GS.

F u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |>U {>6h ugX ¤€S.

F>Kšœ>AS@O@LNLSRvpS.

@G•¢>AISF)NL•:OI´CBL>ž˜.

S.

F!šœSU FH•œ•œ–Cx¬Y#t¨¬F•¢•œ–Cv‚Y#t¨G•¢‘A‘AxYt¨ G•¢‘A‘Kv‚Yt u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO ° O {>6h uih ) e š¢•œFFO@LNLSOR>KUVvlI•œFHFS.

IOŒ•*O FOMANOŒOiB6D6>A‘A>AOI 'u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO ° k {>6h uRk . e I´CBL>K˜S.

F!NL•*NL>AFHšœS JL>A@L¡I>KS.

F ¦u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO ° k {>6h uiP ŽrD6•œš¢BlG¿O@lNLS•*•œ@˜>’Oi@LNLS šœS.

UVO@LNLSF)vOIOŒS.

B6GISRvLIHS.

x.

IOUO§u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO ° P {>6h uRS !•œNL>KI•¢šœ>AS@OU •œ@GSŒNL•*•¢@CGIONLO •*FOiMANO u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO ° S L Y#9 Y  [QTo ‡D\`\ \ ˆ‰j#G ~&A  {ylk už°¼¸%@GIHS6NlBL£$¯SVOF!FHGI>K@Lx.

F u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O {6° {ylk u²{Z-¾“GSNLS.

F!NL•*FHGI>K@Lx7u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O {6° {ylk uRO 36•¢@G•œ@l£$OF.vOIOŒFºGI>K@Lx.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.@LNLIH“zE.F u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O {>P e.

FHG>A‘AOzNL•:¤IS.

x.

{.IOUVO£$¯SŒ•¢U'&)(*( .

@L¯SŒGIObG¿ONOiF u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {.{6u ŽrD6šœ•¢£œ¶•œF.

{6u ZŽrD6šœ•¢£$¯SVvOIOŒ@L•ª u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {.

vONlI¶•œF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {.{6u •Dlš¢•œ£¢¶6•¢F.

vOIOŒ•Dlš¢•œ£¢¶6•¢F u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .{6u 36•¢@G•œ@l£$OF.

°$|  .

LYw Y M [QoT‡D\`\[.

]C <To Š.

 {>6P už°¼¸%@GIHS6NlBL£$¯SVOŒšœ‘AOFFH•:š¢S.

U vL‘A•D u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O{yU {>6P u²{Z-¾“GSNLS.

F!NL•!šœS.

U vL‘K•D  u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O{yU LBLBL Y  [QTo ‡D\`\  I<\G ˆ œ\ Šˆ  {ylS už°¼¸%@GIHS6NlBL£$¯SVOŒJL>KGF•G u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>O>O {ylS u²{ ŽrD6•œU vL‘ASF)NL•*BLF•:NOŒšœ‘AOFFH•:Jl>KGFH•¢Gzu«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>O>k .

.

.

.

>+-.>L= µ‡ ‹JG I<omTG ˆ‰Š.(*!       77 L*d 9 Y w : ~qˆ‰?€…<.

[ ‡b=? ‡‚ L= ¼‚Š Z.

 .

 p v {ylU už° f ´Bl•«“:O 365!/ u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyLX ° {y6U uK°.

už° &OIOiš¢G•¢IMKFHG>Kš$OF)NLO365!/'u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyLX ° {y6U uK°.

u²{ &4S.

U vqS.

@l•œ@G•¢F¦NLO365!/¼u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyCX { {ylU u²{ ¸%@GIHS6NlBL£$¯SVOS.

F)š¢S.

@G¿O>K@L•œIHF u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyCX { {y6U u {6už° 5)>AvpS.

F)NL•«&4S.

@G¿Oi>A@L•¢I F u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyCX { {y6U u {6u²{ -¾“¢GS6NlS.

F!šœS.

UPBl@LF¦OS.

F!NL>K˜•œIHFS.

F!šœS@CGO>A@l•œI F u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyX4h {y6U u {6uRO 5 wvp•œNL•Q F.vLOIOŒšœS@CGO>A@l•œIF u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyX4P {ylU uRO ¸%@GIHS6NlBL£$¯SVOS.

F)>žG•¢IONLSI•œF:YT>KG•œIObGS.

I Ft u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyXQS {y6U uilO už° 5)>AvpS.

F)NL•*>KG•œIONLS.

IH•œF u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyXQS {y6U uilO u²{ = f vq•¢IO£¢¶6•¢F¦š¢S.

UPBL@lF¦š¢S.

U >žG•œIONLS.

IH•œF u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyXQS L  [QTo ‡D\`\  pŠ[ ˆ‰¬  L9 .

O |luž°³36•¢@G•œ@l£$OF¦vOIOR˜•œš¢GS.

I*u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OQhyk L 9 [QTo ‡D\`\ oaGa¢\ ˆ  Lw lO °.

už°³36•¢@G•œ@l£$OF¦vOIO ‘K>AFHG u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>lk ° L Y [QTo ‡D\`\ V‚Š ­…‚Š  L  LBL [QTo ‡D\`\ \ ˆ‰‡D[   Lw L*d [QTo ‡D\`\   …€Š…‚Š  LNM*L L  [QTo ‡D\`\  €jÉG ¬j\G ˆ ­…‚Š…€Š  LNMBM L  [QTo ‡D\`\ ¢\ ŠCˆ  LNM*w O>lk už°2e šœ‘AOFFH•*vO>AI.u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OQPyU O>lk u²{ f šœS.

@G¿Oi>A@L•¢I¦FH•¢G u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OQPyU LNM [QTo ‡D\`\ 7C … To ˆ Gmœ\ Šˆ  LL L  [QTo ‡D\`\ µC ‡   L O>lS už°³36•¢@G•œ@l£$OF¦vOIO UVOvu:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>SQP LBw [QTo ‡D\`\ 7C … To ˆ GmC ‡  LBw 9 e.@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( . .

   .

°.

° d  } o Ap¬jG\ˆ C ]\Š6~‚ƒCjGm[.

]\ LBwBL X |luž°¼¸%@GIHS6NlBL£$¯SVOS.

F!Oi‘Ax.

S.

IH>KGUVS.

Fx.

•œ@l“œI>KšœS.

Fµu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>O X |lu²{Z&4‘AOFFH>K šœO£$¯SRNLSF.Oi‘Ax.

S.

IH>KGUVS.

F x.

•¢@L“œIH>AšœSF2u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>O X |6u {6už° &4‘’OFHF>ž š$O£œ¯SR´CBO@GSVO U SNL>K šœO£$¯iSPNLS šœS.

@G¿Oi>A@L•¢IÏu«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>O X |6u {6u²{ &4‘’OFHF>ž š$O£œ¯SR´CBO@LNLSVOF!S.

vp•œIO£œ¶•œF!I•œO‘A>KÁ$ONLOF u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UyX X |6u {6uRO &4‘’OFHF>ž š$O£œ¯SR´CBO@GSVO šœOiG•¢x.

S.

IH>’OPNLS.

F!>žG•œIONLS.

IH•œF7u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UyX X |luRZ O WBL@L£¢¶6•¢F!x.

•œ@L“¢I>Kš$OFµu«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UQh X |6uilO už° ¤I•œ•¢@Lš¿yL>KUV•¢@CGS u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UQh X |6uilO u²{ &4S.

U vOIOi£$¯SŸu:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UQh X |6uilO uRO¦•¢UVS£$¯iSu:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>k X |6uilO ugX 5»IHS6šœOF u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>k X |6uilO uih -¾>AFºGBLIOI¿<-¾•œFHšœ‘’OiI¿<i¸%@˜.

•¢IHG•œIZu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UQP X |6uilO uRk ¤»•¢F´CBL>AFOI u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>UQP X |6uilO uiP = f INL•¢@O£$¯iSŸu«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>S X |6uilO uRS &4‘’OFHF>ž š$O£œ¯Su:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>S X |6uilO uRU 5»IO@LFºQTS.

IUVO£$¯iS u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>U X |6uilO už°‰|»-0OiG•œUV¡iG>KšœS.

F)u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>U>U X |6uilO už°.

°5= f vq•¢IO£¢¶6•¢F¦UVOiG•œUV¡iG>Kš$OFš¢S.

U š¢S.

@jHT BL@GS.

F'u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |.

| X |6uilO už°{&. l •œOvLFSIHGzYÉS.

IHNL•œ@LO£$¯S NL•*vL>K‘AyOFt u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |.

| X |6uilO už° €O ŽrDl•¢UVvl‘AS.

­Š \ €‡  pqv dM LX °.F u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |l° d 9 E{I5œK Šˆ‰]\ …€~<.

už°¼¸%@GIHS6NlBL£$¯SVOS.

F)SJHT •¢GS.

F)QTBL@L£œ¶•œF¦NO 365!/ u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |QP LX °uK°.

už° WBL@L£œ¶•œF¦OIH>KGUV“G>AšœOF*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |QP LX °uK°.

u²{ WBL@L£œ¶•œF!NL•*š¢S.

UVvLOIO£œ¯SŒu:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |>S LX °uK°.

uRO WBL@L£œ¶•œF!‘KÀ.

x.

>AšœOF u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |>S .

 b(6$(6 %    u(*   q+  .

>L=   t s6v-ÉG ~­…  †t ~ G d9L CX {6už°¼5€•œIHUVS. +/  d Yb: ~qˆ‰?€…<.>L= µ‡@:? BpA ‡DµC ‡D.

F!•*šœS@Lšœ•¢>KGSF)BlG>K‘A>AÁœONLS.

F u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u LX °`X CX {6u²{ f J¡F>KšœS NLSV8:9.+=</?>K@BD ¨L+.@L> Du:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u LX ° h CX {u {6už° &4S.

UVO@LNLS.

I•œxBL‘’OIH•œF ¹u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {.F!NLSRFHyL•œ‘K‘?¥lG•¢>AF u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u LX ° h CX {u {6u²{ ŽrDlvlI•œFHF¶•œF.

{ CX {u {6uRO ¤IS.

x.

>KI•GÀ.IOUVOFG•¢‘A@L•G!•*Q\Gv u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {HX CX {6uRZ O E.

IH>AS.

F¥6G•œ>KF!vOIOŒvLIHS.

x.

IOUOiNLS.

I•¢FŒu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yk CX {6ugX ¤ISx.

IOUVOF)¥lG•œ>KF)vOIOŒvLIHS.

x.

IOUOiNLS.

I•¢F u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yk dNL © Gm.>l=  ‚Š 4p Š ­ˆ‰  C ‡D[QŒ\ Š : dYw XQlO už°¼¸%@GIHS6NlBL£$¯SVOSR•œNl>KGSI)•œUVOšœF¦u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yU XQlO u²{Z&4S.

UVO@LNlS.

F)NLS •œNL>žGS.

l •¢‘Av u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yU XQ6O u {6u²{ -¾S‰˜>AU •œ@GSRNLS šœBLIHFS.I)•¢UOš¢Fu«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yU XQ6O u {6už°.

I«YTBLF•:OF!F•G¿OF¦NL•*NL>KI•œ£œ¯SCtZu:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQ.

O | XQ6O u {6uRO &4BlG<&4S.

@LNLS±u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQ.vwL<i¤rOFºG•‰<i+.

O | XQ6O u {6ugX ¦•¢UVS‰˜•œ@LNLS ‘A•GIOFœ¨LvLO‘’O$˜IOF!•*‘A>K@LyOF†u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQ.

e IH´Bl>K˜.O | XQ6O u {6uih .

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.SFu:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQlO ° e.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( . .

°‰{  .

XQO6u {6uRk ¤»•¢F´CBL>AFOV•*FBlJLFHG>KGBl>A£$¯iS u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOl° XQ6O u {6uiP -¾¥L‘žG>Avl‘’OF TOi@L•œ‘AOF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOl° XQ6O u {6uRS Ž@Lšœ•¢IIOi@LNLSVO FH•œ£$¯iSVNLS ŽUVOšœF u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOl° XQOluRO &4S.

UVO@LNlS.

F)NLS •œNL>žGS.

I4˜> u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQO{ dBd2E \€bB¬A ‡DC ‡D\  G »‡lˆ [ GÉ~»‚Š~qˆ dNL  X>XLuž° f vLIS.

xIOUVOPNL> u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOQh X>lX uK°.

už° 36•œ@G•œ@L£œOF.vOiIOŒSRNL> u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOQP X>LX u²{ f vLIS.

xIOUVOPvOiGš¿yu«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQOQP X>LX uRO f vLIS.

xIOUVOP>A@LNl•œ@G u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQO>S d  Z ]C  GaTo ‡~»‚@.

[ NC A][Q[ <A dBd 9 X46h už°Ÿ¤ISiGÀG>AvpSŒ•:vLOIÑU •¢GIS.

e I´CBL>K˜S.F)NlS xšœš‰<bxC(*( u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>LX ° X46h u²{ .

F!x.

•œIONLS.

F!vp•œ‘KSŒx.

šœš$<ixC(*( u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>CX { X46h uRZO ŽrD6•œU vL‘ASRNL•*BLFHSVNlS xšœš‰<bxC(*( u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>CX { X46h ugX 36•¢@G•œ@l£$OF¦vOIO SRšœSUVvL>K‘’ONlS.

I4NOŒx.

@CB2u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>XQO d  n ‡ ¬Š dBd  XQlk už°Ÿ¤ISiGÀG>AvpSŒ•:vLOIÑU •¢GIS.

F)NlS UVO–i•u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>X4h XQlk u²{ +¦UÏOI´CBL>ž˜.

SRNL•*vLIHSjHT •¢GS u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>XQk XQlk uRZO WS.

IHUOiGSPNL•*BLUÏOiI´CBL>K˜S-¾O–• ‘A•«u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>XQk XQ6k uilO už° &4I>AO@LNLSŒ˜iOI>A¡$˜.

•œ>KF)•œU BlUÏOI´CBL>ž˜.

SV-0O–i•¢ ‘K• u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>XQk XQ6k uilO u²{ &4I>AO@LNLS O‘ž˜.

S.

F)•¢U BLUÏOIH´CBL>K˜S-0Oi–•¢ L‘A• u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>X4P XQlk ugX ŽrD6•œU vL‘ASRNL•*BLU OI´CBL>ž˜.

SV-0O–i•¢ ‘K• u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>X4P XQlk uiZh 36•¢@G•œ@l£$OF¦vOIO SRUVO–•§u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X>XQU d 0M ‹JG I oaÉG ˆ‰Š.

[ ‡D\ d9 X46P už°¼¸%@GIHS6NlBL£$¯SVOŒUVS@CGOx.

•¢U NL•*JL>KJL‘A>KSG•¢š$OF u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X46h ° X4P uK°.

už° OI u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X46h ° X4P uK°.

u²{ IO@l‘A>AJ u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4.

h { X4P uK°.

uRO @LU u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hyO X4P uK°.

ugX S.

JHT NLBlUVv³u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hHX X4P uK°.

uih ‘ANLN u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hHX X4P uK°.

uRk ‘ANLš¢S.

@l x u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4h>h X46P u²{Z&4S.

@˜•œ@L£œ¯SvOiIOŒ@LS.

S.U •œF!NL•*JL>KJL‘A>KSG•¢š$OF u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4h>h X46P uRZO ½4>KJL‘A>KSG•¢š$OF4BLFBOi>AF2u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4h>h X46P ugX -¾S@CGO@LNLS BLUVOŒJL>AJL‘K>ASG•œšœOz•œFºG¿¡iG>Aš$O¹YT‘A>AJL9.

U •u Otu«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4h>h X4P uRLX už° +.FO@LNLS BLUVORJl>AJL‘K>ASG•œš$O«•œFHG¡iG>Kš$O u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hyk X46P uiZh -¾S@CGO@LNLS BLUVOŒJL>AJL‘K>ASG•œšœOzNL>A@LÑUV>Kš$OYT‘A>KJ9.S.

U •u FSt®u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4h>P X4P u 6h už° +.FO@LNLS BLUVORJl>AJL‘K>ASG•œš$O«NL>A@ÑiUV>Kš$O u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hyS X4P u 6h u²{rV O@G¿Ox•œ@LF<iNL•œFº˜iO@G¿Ox.

•¢@LF.NLORJl>AJL‘K>ASG•œš$O«NL>A@ÑiUV>Kš$O u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0X4hyS X46P uRk 36•¢@G•œ@l£$OF¦vOIO JL>KJL‘A>KSG•¢š$OF§u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQlk ° d  v Ga‚I ˆ‰­]o dL XQlS už°¼¸%@GIHS6NlBL£$¯SVOSR‘A>KJlGSS.

‘ u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQk>O XQlS u²{ WS.

IHUOPNL•*BLFHSVNlS ‘K>AJlGS6S‘ u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQk>O XQlS uRO &4IH>’O@LNlS BlUOPJL>KJL‘A>KSG•¢š$OPFH•œU S ‘A>KJlGSS.

@LNLIH“zE.‘ u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQkyX e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .     .

   .

° O XQSlugX &4IH>’O@LNlS BlUOŒJL>KJL‘A>KSG•¢š$Oz•¢FHG¿¡bG>AšœOŒšœS.

U SR‘K>AJlGS6S.

‘ u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQkyX XQlS uihZ&4IH>’O@LNlS BlUOŒJL>KJL‘A>KSG•¢š$OzNL>K@ÑU >AšœOzšœS.

U S ‘K>AJlGS6S‘u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQkQh XQlS uRZk /?>A@l–iOi@LNLSR•D6•œš¢BlG¿¡$˜•œ>AF u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQkQh XQlS uiP ¸%@LFºG¿O‘AO@LNLS OŒJL>KJL‘A>KSG•¢š$O u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>k XQlS uRS -¾SNLS.

F!NLSR‘K>AJlGS6S.

‘ u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>k XQlS uRU 36•¢@G•œ@l£$OF.vOIOŒSR‘A>KJlGSS.

‘ u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>k dNw„Š4rI …&A .

„Š r…‚‡‚pŠ\ „Š4»I … AB¬A ŠCH\ dw XQlU už°¼¸%@GIHS6NlBL£$¯SVOSRNL•¢JLBLx.

•¢I u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>U XQlU u²{Z&4S.

UVO@LNlS.

F)NLS x.

vOIOŒSRx.JqN u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>U XQlU uRZO ŽrD6•œU vL‘ASRNL•*BLFHSVNlS xNLJ u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>U XQlU ugX 36•¢@G•œ@l£$OF.

NLJ§u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P| ? b Éo ŠC .

A »  d M 9   : h |luž°¼¸%@GIHS6NlBL£$¯SVOSRx.

vOIOŒSRvLIHS ‘A•¢I u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P6° o Š‚Š„uGm¢\ ˆ$HG »I …<Ga.vLIHSQ©u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P6° h |lu²{Z36•¢@G•œ@l£$OF.>L=   ÉG ~€‡D 6h °.>L=  d M*L  9 :ŠCH\ L= ¼‚Š„Š r…‚‡D.

už° ®V •¢IF¯iSVNL•¢JLBLxL¨IH•œ‘K•$OFH•:•*NL•*NL>KFHGI>AJlBL>A£œ¯S u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyO 6h °uK°.

už° ®V •œIHF¯S NL•œJlBLx u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyO 6h °uK°.

u²{r®V •œIHF¯SR @O‘ YTI•¢‘A•$OiF•‰t.u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyO 6h °uK°.

uRO E.>AFºGIH>AJLBL>K£$¯SŒNlS.

F!vLIS.

xIOUVOF•*JL>KJL‘A>KSG•¢š$OFÏu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyO 6h °.

vOIOŒNL>KFHGI>AJlBL>A£œ¯SPNL•*šœÀNL>Kx.u²{Z36•¢@G•œ@l£$OF.

SPQTS.

@G•u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4Pyk ? B¬A b‡*C ‡D\{tuœ\ ‡~€€ ŠCb‡*C Š~qˆ‰‡D\  t s*v ÉG ~­… d MBM  Y „#[ … C Š~qˆ‰‡D.>L=  €Š « .

h {6už°¼¸%@GIHS6NlBL£$¯SVOŒNLSšœBLU •œ@G¿Oi£$¯SRNL•*vLIHS.

x.

IOiUOF u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P>P .

h {6u²{ E.SšœBlUV•¢@CGO£$¯iSV•¢UPJLBlG>ANOP@LS šœÀNL>Kx.

SŒšœS.

Uye V<e ¦ E *f & u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P>P .

h {u {6už° ¤ISGÀG>KvqS.

F)Nl•:BlFS NLSŒQTS.

IUVOiGSye&V<e ¦ E *f & u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P>P .

vOiIOŒNLSšœBLU •œ@G¿Oi£$¯S/T O$˜iO ! NLS6š u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyS .h {u {6u²{ 36•œ@G•œ@L£œOF.

h {u {6uRO ŽrDl•¢UVvl‘ASRNL•*vLISx.

IOUVOPNLSšœBLU •œ@GONLSu*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyU .

h {6uRO 5€BlGSI>’Oi‘­NL•*šœS.

@6 x.

BLIO£$¯SR•*BLFHSVNLS E f *  8:Ž®9 u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQSl° .

h {uilO už° ŽrDl•¢UVvl‘ASRNL•*NL>’Oix.

IOUVOFx•œIOiNLS.

F)vp•œ‘ASRNLS$Dwx.

•œ@ u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>O .

h {6ugX E.SšœBlUV•¢@CGO£$¯iSVvLIHS FHF>AS@O‘­š¢S.

U FxUV‘’<D6UV‘XY#/  *tu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQSyX ? B¬A ‡DC ‡  t dM  L  Š € Š~ [QÉG ‡µ€Š n q~pˆ‰‡*¬A ŠC ‚Š tuC « hylO už°¼¸%@GIHS6NlBL£$¯SVOŒvLISx.

IOUVO£œ¯SŒUPBL‘žG>Avl‘’OiGOiQTS.

IUVO©šœS.

UÏ8:9.+ u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQSQP hylO u²{ Oš¢‘ASš$O‘¾u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>S hylO uRO >žQT@OU •œF u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>U hylO ugX OB6GS.

FHš$O@ u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>U hy6O uRLX už° ¦SiG•œ>KISŒNLSVOBlGS.

FšœO@ u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQU.

| hylO uih OB6GS.

u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQU.yL•œONL•¢I.

| hy6O u 6h už° ¦SiG•œ>KISŒNLSVOBlGS.

yL•œONL•œI u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQU.

| hylO uRZk OB6GS.

vOiIOŒS OBlGSUO–i•.UVO–• u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQUl° hy6O uilk už° ¸%@GISNLBL£œ¯SVOS OBlGSUO–i• u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQUl° hy6O uilk u²{ 36•œ@G•œ@L£œOF.u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQUyX hylO uiP OB6GSšœS.

@lQu«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQUyX hy6O u 6P už° ¸%@GISNLBL£œ¯SVOS OBlGSšœS@lQ©u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQUyX e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.@LNLIH“zE.

FHG>A‘AOzNL•:¤IS.

x.

.IOUVO£$¯SŒ•¢U'&)(*( .

° X  .

hyO6u P6u²{ ¤ISGÀG>KvqSŒNLS OB6GSšœS.

@lQ u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQUQh hy6O u 6P uRO¦SiG•œ>KISŒNLSVOBlGS6š¢S.

@lQ»u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQUQh hy6O u 6P ugX ŽFHGIHBlGBlIORNL•*BLUÏOIH´Bl>K˜.

S šœS@l x.

BLIH•u >A@ u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQUQh hy6O u 6P uih ŽrDl•¢UVvl‘ASRNL•*BLUÏOIH´CBL>K˜S š¢S.

@l xBLI•iu >K@¹u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQU>k hy6O u 6P uRk -0Oš¢IS.

F!NLSVOBlGS6š¢S.

@lQ¦u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQU>k hy6O u 6P uiP &4S.

U SVOivLIS‰˜.

•¢>KGOI)S.

F!I•¢FBL‘žG¿ONLSF)NOF!vq•¢F´CBL>KFOF¦I•œO‘A>KÁ$ONOiFvq•¢‘AS OBlGS6š¢S.

@lQ†u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |.

| hy6O u 6P uRS &4S.

U S Nl•¢ @L>KI˜iOI>A¡‰˜•œ>KF)@LSVš¢S.

@l xBLI•iu >K@¹•*BLFOI!@LSRUOi–•¢ L‘A•u OU u:u«u:u«u:u*u«u h |l° hy6O u 6P uRU V OI>A¡$˜.

•œ>KF*NL•¢ @l>ANOF«@LSOiI´CBL>K˜S0š¢S.

@l x.

BlI•u >A@µ•V´CBL•VF•¢I¯S¾FBLJLFºG>žGBLMKNOF:@LSOIÐ1 ´CBL>K˜S-0Oi–•¢ L‘A•Ru*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |l° hyOluRSZOB6GS.

IH•œšœS@lQu:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |>O hyOluRU u²<išœS@l x.

BLIH•0u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |>O hyOluž°‰|C&4S.

U SR>A@Lš¢‘ABL>KI4>K@LFHGIBL£¢¶6•¢F¦NlS ‘K>AJlGS6S‘ •œU F•œB¹vOš¢SG•*x.

@CB u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |>O hy6O uK°‰|6uK°qŽrDl•¢UVvl‘ASRNL•:OI´CBL>ž˜.

SRUVO–• ‘A•iu²OU BLFO@lNLSVSR‘K>AJlGS6S.

‘ u:u*u«u:u«u:u:u«u:u«u:u*u«u h |yX hy6O uK°‰|6u {‚ŽrDl•¢UVvl‘ASRNL•:OI´CBL>ž˜.

SRšœS@l x.

BLIH•u >A@¹BLFOi@LNLS S ‘K>AJlGS6S‘ u:u*u«u:u«u:u:u«u:u«u:u*u«u h |yX hylO už°.

°ŽrD6•œU vL‘ASV&4S.

>L= µ‡L Z p~qˆ‰]Éo Š¾‚Š :Šj\  Š.U vL‘K•¢GS u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |yX  d : ~qˆ‰?€…<.\ Z ]C  Z     w hHLX už° f ´Bl•«“*SV&-*V 3  u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u h |>U hHLX u²{Z&4S.

UVO@LNlS.

F)NLS š¢˜F u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h °‰| hHLX uRO 36•¢´.

L•œ@Lš¢>’ORNL•©GIOJO‘KyLS u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h °{ hHlX uilO už° ¦SiG•œ>KISŒvOiIOŒšœIH>’OI)BLU I•œvpS.

FH>KGÀI>AS u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h °{ hHlX uilO u²{ ¤rOIO >KUVvpS.

IºG¿OIS.

F!OI´CBL>ž˜.

S.

F!NL•*FH•œB0vlISjHT •GSVO@G>AxSŒvOIOŒNL•¢@GIS NLS I•¢vqS.

FH>KGÀ.

I>KS 6h ° O hHlX uilO uRO ¤rOIO JLO>žDlOIS vLIHSjHT •¢GS0YTš¿yL•œš¿–iS.

BlG¿t u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h °`X hHlX uilO ugX ¤rOIO š¢I>AOIU À6NLBl‘AS.

F u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h ° h hHlX uilO uih ¤rOIOVObGBO‘K>AÁœOI4S.

F¦OIH´CBL>K˜S.

F!@LSRI•œvpS.

FH>KGÀI>AS¹YTšœS.

U U >KGtXu:u*u«u:u«u:u:u«u:u«u:u*u«u 6h ° k hHlX uilO uRk ¤rOIOVOiNL>Aš¢>AS.

@OiI¿<iIH•œU S˜•œI)OiI´CBL>K˜S.

F!•©NL>AIH•¢GÀ.

I>KS.

Fµu:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h ° P hHlX uilO uiP ¤rOIOVObGBO‘K>AÁœOI4S.

F¦OIH´CBL>K˜S.

u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .F!‘ASš$O>KF©YÉBlvqNObG•‰t u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6h ° U hHLX ugX ®V •¢IF¶•œF¢¨G¿Ox  F)•*I•¢‘A•$OiF•œF.

h {| hHlX uRLX už° Ž@CG•œ@LNl•œ@LNLSOF)˜.

•¢IF¶•œF u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {| hHlX uRLX u²{ ¤rOIO š¢I>AOI4G¿Oix  F.u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {6° hHlX uRLX uRO ¤rOIO š¢I>AOII•¢‘A•œOF•  F u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {.

{ hHlX uRLX ugX ¦•¢šœBLvp•œIO@LNLS U À6NLBl‘AS.

F•:OIH´CBL>K˜S.

F u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {HX hHLX uih ¤»OIOP˜.

•¢I>ž š$OI!NL>žQT•œIH•œ@L£œOF!•œ@GIH•zOIH´CBL>K˜S.

F u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {HX hHLX uRk ®V •¢I>K Lš$O@LNlS SR•¢FHG¿OiNLSVNlSVIH•œvpS.

F>žGÀ.

IH>AS u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

l >KFHGÀI>Aš¢SŒNOF¦O‘žG•œIO£œ¶•œF u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .h {>h hHlX uilk už°.

h {>h hHlX uilk u²{ -¾•œ@lFOx.

•¢@LF¦NL•*‘AS.

x u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {>h hHlX uilk uRO.e @LSiG¿O£¢¶6•¢F u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yk hHlX uilk ugX®V •œIH>K šœO@LNLSRS FHG¿ObGBLF!NLS.

F¦OIH´CBL>K˜S.

F u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yk hHLX uiP ¦OU S.

F•«-¾>AFºGBLIOF«Y#½4IO@Lš¿yL>K@Lx O@LN0-¾•œIHx.

>A@lxCt u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {>P hHlX u 6P už° 5»IOJO‘KyO@LNlS š¢S.

U IOU S.

F u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yS hHlX u 6P u²{ -¾•œFHšœ‘AO@LNLS{z˜.

NL•*BLUÏOIH´Bl>K˜.•œIHF¶•œF.

SÏu:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yS hHlX u 6P uRO -¾•œFHšœ‘AO@LNLS SRIOU SŒNL•*GIOiJO‘AylSŒšœS.

U SRIOUVSŒvlI>A@lšœ>AvLO‘ u«u:u«u:u:u«u:u«u:u*u«u .

h {yU hHLX uRS &4S.

@6 x.

BLIO£$¯SRNLS š¢˜F¦@LSRF>KFHG•¢UOŒš¢‘A>A•¢@G•1F•¢IH˜>ANLSI  u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yU hHlX uilS už° V OI>A¡$˜.

•œ>KF)NL•:OUPJL>K•œ@G•©u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u hy.

O | hHLX uRU &4S.

U SRJO> DLOiIvLISx.

IOUVOF)NL•©G•œIš¢•œ>KIS.

F)BLFO@LNLS S š¢˜F u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u hy.

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.O | e.

FºG>A‘AOPNL•:¤IS.

x.

.IOUVO£$¯SŒ•¢U'&)(*( .

   .

° h hHXLuž°‰|WIS@CG•œ@LNlF u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hyOl° hHLX už°.

vOIOŒSRš¢˜F u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hyOl° hHLX už°{.°b36•¢@G•œ@l£$OF.

+¦U NL>’Oix.

IOUVOzš¢S.

U S.

F!šœSUO@lNLS.

F)NLSRš¢˜F'u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hyO>O Š Š  ~ [QÉG ‡D \ ‹JG I oaÉG B¬A  ^ .

z \ €Š «? ƒ :? #.[ ‡D\  L  #+/"5# 8 7 } „uÉG Šˆ‰jG Š.

[ Š\`œ\ ‡‚¬  d 9 e už° ¸%@GIHS6NlBL£$¯SVOF!NL>KI•¢GI>KÁœ•œF)Nl•:vlI“*vLISšœ•¢FFONLS.

IŸu*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHLX ° z e u²{ &4S.

U vL>K‘’O£œ¯SPšœS@LNL>Aš¢>AS.

@LO‘»u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHLX ° z e u {6už° >KQ0u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHLX ° « e u {6u²{ >KQÐužuKu •œ‘KF•Zu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHCX { « e u {6uRO >KQÐužuKu •œ‘K>KQÐužuKu •œ‘K>KQÐužuKu •œ@lNL>KQ¦u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHCX { « e u {6ugX NL•¢ L@L•¨¬>KQTNl•¢QШL>žQT@LNL•¢QШlBL@LNL•Q u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHCX { « e u {6uih -0Oš¢IS.

FPu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHXQO « ‹ Z p~<.

[ Š\G ˆ‰].

\ ˆ$Š.u²{ -¾SNL>ž š$ONlS.Ga\J=? ‡L‡ «? B¬A ‡DC ‡D.>L= µŠC Z  d  ½.už° &4‘AOFFH•œF¦NL•:OIUVOÁœ•¢@OU •œ@GS u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHX4h ½.

I•¢F¦Nl•«Oišœ•œFHFS u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHXQk ½.uRO ŽFš¢S.

vpSVNOiF!˜iOIH>’¡$˜.

ugX 36•¢@G•œ@l£$OF.•¢>AF u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHXQU ½.vOIOŒš¢‘’OFHF•œF!NL•:OIHUOiÁœ•œ@LOUV•¢@GSL¨ •¢FšœSvqS •*UVSNL>K Lš$ONLSI•œF)Nl•«Oišœ•œFHFSVu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>.

h {  L Z E ŠC‡‚pŠ\ &.už° ¸%@GIHS6NlBL£$¯SVOS.

u²{ = f vp•œIOiNLS.F)Svq•¢IONLSI•œF§u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyO &.

I•¢F!NL•*BLFS x.

u²{6už° = f vq•¢IONLSI•œF¦OIH>KGUV“G>Aš¢S.•œIO‘ u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyO &.

u²{6u²{ = f vq•¢IONLSI•œF!NL•:OiGI>KJLBL>A£œ¯S¹Y*t u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hHX &.u²{6uRO = f vq•¢IONLSI•œF!š¢S.F*Y#(Œ¨ 1¿¨ C ¨²<6¨ t u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hHX &.

UVvpS.

FºGS.

F:Y#(P¨l1Œ¨  P¨¬< *t¹u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hHX &.u²{6ugX = f vq•¢IONLSI•œF!IH•œ‘’Oišœ>AS@O>AF=Y *¨ P¨.

*u P¨P¨:t u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>h &.u²{6uih = f vq•¢IONLSI•œF!‘KÀ.

x.

>Aš¢S.

u²{6uRk = f vq•¢IONLSI)šœS.F*Y   ¨²¨K¨P¨:t u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>h &.

@LNl>Ašœ>KS.

u²{6uRS = f vq•¢IONLSI˜6MKIx.u²{6uiP = f vq•¢IONLSI)>A@Lš¢I•œU •œ@GSY#(:(*t4•©NL•¢šœIH•œU •œ@GSY\11ºt u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyk &.@O‘Y  tu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>h &.

uRO = f vp•œIOiNLS.Bl‘’O†Y#O6¨ J¬t u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyk &.u²{6uRU = f vq•¢IONLSI)UVÀNLBL‘KS¹Y tZu:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.

uRlO ugX = f vq•¢IONLSI)F>AÁ¢•œSQr•*F>AÁ¢• ) G§u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.uRlO uih = f vq•¢IONLSI)NL•*I•œFHS.uRlO už° = f vq•¢IONLSIG%w6vp•œNl•¢Q7u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.I•¢F!NL•*BLFS •œFHvq•¢šœMK LšœS u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.uRlO uRO = f vq•¢IONLSI)NL•œ‘K•¢G•u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.uRlO u²{ = f vq•¢IONLSI)@L•¢ª u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h>P &.

‘ABl£$¯S NL•*•œFHšœS.

vOiIOŒS.vpSYW ²W t u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyS &.uRlO uRk 36•œ@G•œ@L£œOF.

vp•œIOiNLS.

I•¢F u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyS e.@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.

FHG>A‘AOzNL•:¤IS.

x.

.IOUVO£$¯SŒ•¢U'&)(*( .

`k °  .

]o Z „ L hyk>O hyk>O hykyX hykyX hykQh hykQh hyk>k hyk>k hyk>k hykQP h>PHX  M  h>P>h h>P>h h>Pyk h>PyS h>PyU hyS.

|   M hySQP hyS>S hyS>S hyS>S hyS>U hy.

U |  wBL hyU>O hyU>O hyU>O hyUyX hyU>k hyU>k hyUQP hyUQP hyU>S hyU>U  &9 .

k |l°   L .

k |>O .

k |>O p ~qˆ‰ Ɋ  Ezuž° >žQ¼u:u:u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu²{ >žQÐuKužuKužu •œ‘AFH• u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu >žQÐuKu¢uœuœužu •œ‘AFH•*>KQÐuœu¢uœužuKu •œ‘KF•*>KQÐu¢uœu¢uKužu •¢‘AFH• u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu Fºª!>KGš¿y uKužuKu š$OiF•*u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu •DlvlI•œFHF¯S 7Oi£$¯S )˜•œINLONL•œ>KIO O£$¯iS )QÉO‘AFOl™ u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu QTS.

š¢S.I:Yr>K@LMAš¢>’O‘K>AÁœO£$¯SV™lG•¢FHG•V™Oi£$¯SL°«t)O£œ¯SC{6™ u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu ª!yL>K‘A• Y\G•œFºG•$ t ‰O£$¯Sl™ ™Vu*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu NL S Oi£$¯S *ª!yL>K‘A• Y\G•œFºG•$t™ u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu JLIH•$O–u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezuž°‰|.

@G>A@CBL• u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezuž°.

°!36•¢@G•œ@l£$OF¦vOIO š¢S.

@GIS‘A•:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u RO gX ih Rk iP RS RU …»~ Ž)uK° Ž)u { Ž)u Ž)u Ž)u Ž)u  iO RX h ik  W .­Š\ ?=‡L‰ˆ‰Š : : +¦FS NL•:OIx.

BlUV•¢@CGS.

F)vLIH“1%Nl•¢ @L>KNLS.

F«YÉ>K@L>Aš¢>’O‘K>AÁœONLS.

IH•œF¿t u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u e QTBL@L£œ¯SRUOi>A@‚Y#t•:OR•¢@GIOiNO @LOR‘K>A@LyLOPNL•*šœS.

UVO@LNLS u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u WBL@L£¢¶6•¢F!I•œš¢BLIFH>K˜iOF u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u +¦FS NL•*•œ‘A>KvLF•Œužužu•œU QTBL@L£¢¶6•¢F  u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 36•¢@G•œ@l£$OF¦vOIORQTBL@l£œ¶•œF±u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ŽrD6•œU vL‘ASF)NL•©QTBL@L£œ¶•œF u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ?=p~qˆ‰ŠGTN\ z?=‡L‰ˆ‰Š : : W4už° = f vp•œIOi£œ¶•œF!šœS.

U vqS.

@G•œ>AIHS.

F:Y(*<1Ðt u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4u²{ ¤€S.

@G•œ>KISŒ˜.

vOiIOŒvqS@CG•œ>KISP˜.S>AN u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4u²{6už° 36•œ@G•œ@L£œOF.

S>AN7u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4u ¤€S.

@G•œ>KISRvOIOŒvqS.

@G•œ>AIHS:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4u ¤€S.

@G•œ>KISRNL•©QTBL@L£œ¯Su:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4u 36•¢@G•œ@l£$OF¦vOIO vpS.

\ŒŠ©~­… C ŠCb‡*.­Š\ 8ŒuK°Ï¸%@GIHS6NlBL£$¯SVOF)•¢FHGIHBlGBlIOFzYÉFºGIBlš¢Gt u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°uK° E.@G•¢>AISF u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u  RO gX ih \¢ˆ$i…?ˆ…‚‡D\  t†~ G  Š.•¢ L@L>A@LNlSV•¢FHGIHBlGBlIOF u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°u { &4I>AO@LNLSRBLU SJ H•¢GSVNL•*BLUVOP•œFºGIHBlGBLIO u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°u )šœ•¢FFOi@LNLSObGI>KJLBlGS.

vOiIOŒ•œFºGIB6GBLIOF u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8Œu { +¦@L>A¶•œF:YTBL@L>AS@¬t u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8Œu Ž@CBLU •œIOi£œ¶•œF«Yɕ¢@BlUV•¢IOiG•œN¬t)u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8Œu 6uK° 36•œ@G•œ@L£œOF.vOiIOŒ•œ@CBLU •œIO£œ¶•œF u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u iO iO e RX h ik iO  ‹JG I oaGɍˆ‰Š[.F)NL•*BLUVOR•¢FHGIBlGBLIO u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°u ŽFHGIHBlGBlIOF¦•=QTBL@L£¢¶6•¢F u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°u ŽFHGIHBlGBlIOF.O@L>K@LyONOiF u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8ŒuK°u 36•œ@G•œ@L£œOF.

‡D\«€Š l«už° ! šœUVOiGy.

 : ?=¬‰ˆ‰‡*I<GmoaGÉ€‡‚Š ¸¿už° ¸¿u²{ T Z u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ¸%@GIHS6NlBL£$¯SVOŒvqSIHG¿OiJL>A‘K>ANONl•¼u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 36•¢@G•œ@l£$OF¦vOIO NL•¢F•¢@C˜S.

‘K˜•œI.vLIS.

xIOUVOFvpS.

IHG¡$˜.

@LNLIH“zE.•œ>KF.vpS.u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

   .

P ° &AFs7„Š4I»… A    f ´Bl•«“*BLU JlBLx u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0k.

|Qh f ´Bl•«“*NL•¢JLBLxOI!BLU vLIS.

xIOUVO  u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0k.

|>k RO +¦FS NL•:OFFH•œIHG u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

k |>k gX 36•¢@G•œ@l£$OF.vOIOŒ•˜6>žG¿OI)JlBLx.

F7u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

>L= 2‚Šb«? B¬A ‡DC ‡D\   w ŒuK° 36•¢@G•œ@l£$OF.vOIOŒS.k |>k EŒˆ GaC2G ‡D.

J6G•œI)BlU vLISx.

IOUVOPSG>AU >AÁ$OiNLS u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

k |>U v uoT]\`\ L^ jTG   9B9 n v #G ~ #\J=? ‡L‡  \G ˆ‰ŠP\ ŠC Z.

 Y#9 -µuž° 8*9.+ WI•¢•:E.S6š¢BLU •œ@G¿OiG>AS.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.vpS.@LNLIH“zE.@¹/?>Aš¢•œ@LFH•u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0k {HX ‹Œ… luž° lu²{ lu lu   e.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

@LNLIH“zE.`S ° e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI  .

e.vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

 °   .

r   O>O 6h ° .

h { hyO hHX hHX h>h hyk hyk hyS hyU  ¤€S.

I!S.

@LNL•*šœSUV•¢£$OI .

u u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° 5€•œ‘AORNlSVvLIHS.

x.

IOUO:ª!>KGy¹šœ‘AOFF¢u»u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Olu²{ f vLIS.

xIOUVOŒE.¸ e UO@l>AvLBL‘AO@LNLSzBLUOP•¢FHGIBlGBLIOV+=-0/ š¢S.

¸ e«uŒu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OlugX E.>AOx.NL•*š¢‘’OFHF•œF¢u OluRO +¦U vq•¢´CBL•œ@LSVyL•œ‘Kv†vOIOŒBLFHSVNlSE.U IH•œvLIH•œFH•œ@G¿O£¢¶6•¢F.

>AOx.IH•œvLIH•œFH•œ@G¿O@lNLSš¢‘’OFHF•œF¢u u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluih E.IOUO«NL•*šœ‘’OiFF•¢F.

IOUO«NL•*šœ‘’OiFF•¢F.IH•œvLIH•œFH•œ@G¿O@lNLSBLUVOŒ‘A>KxO£$¯iSLu0u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OluRk E.>AOx.

IH•œvLIH•œFH•œ@G¿O@lNLSOFHFSšœ>AO£œ¶•œF¢u u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OluiP E.>AOx.IOUO«NL•*šœ‘’OiFF•¢F.

IH•œvLIH•œFH•œ@G¿O@lNLSOxI•œx.IOUO«NL•*šœ‘’OiFF•¢F.

O£œ¶•œF¢u)u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OluRS E.>AOx.

IH•œvLIH•œFH•œ@G¿O@lNLSyL•¢IO@l£$OF¢uzu:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u OluRU E.>AOx.IOUO«NL•*šœ‘’OiFF•¢F.

IOUO«NL•*•¢˜.

•¢@GS.

FPYÉNL•*F•¢´CBL›œ@Lš¢>’Otu u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž°‰|ZE.>AOx.

IOUO«NL•*•œFHGONLS •*S.

F!NL>KQT•¢I•œ@G•œF)G>KvqS.

F)Nl•:U •œ@lFOx.

•¢@LFœuu«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž°.

°ŸE.>AOx.

IOUO«NL•:OiG>ž˜6>KNONL•i¨LSR´CBL•«SšœSII•©Nl•œ@GIHSVNL•*BLU UV“GSNLSLu®u«u:u*u«u:u:u«u:u«u:u:u«u Oluž°{ E.>AOx.

>AOx.IOUO«NL•*š$OFHSVNL•*BLFHSLuu*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° ZO E.

IOUO«NL•*vOšœSiG•œF¢¨pOFFHBL@GS.

>AOx.F¢uÏu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž°`X E.

IOUO«NL•*šœS.

‘AOJqSIO£œ¯SLu u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° h E.>AOx.

IOUO«NL•*S.

JHT •¢GS.

Fœ¨¬>K@LFHGÑ@Lšœ>AOFœu u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° Zk E.>AOx.

IOUO«NL•*šœS.

>AOx.U vqS@L•œ@G•¢Fœu u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° P E.

IOUO«NL•*•D6•œš¢BL£$¯Slu¹u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u Oluž° S =f BlGIS.

>ž˜.-0/u?u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XLuž° E.F!•œ‘K•œU •œ@GSF)NOV+.

•¢IFOiF.•G¿OvOiF¦Nl•:Nl•œF•¢@˜.

S.

‘ž˜6>KUV•¢@GS NL•*BLU FSiQ\G%ªOIH•«•*S.

F)NlS6š¢BLUV•¢@GS.

F!x.

•¢IONLSFœu?u:u«u 6h už° e G•¢‘’OPNLSVE.•˜¾&)(:(§Y\[]C]^)_H`C`baCaa4c#άjCggo‰[Lnc#eLn]¬`6n¬`6npm^C^c[6].

u:u«u:u:u«u 6h u²{ e G•¢‘’OPNLS –CNL•¢˜•œ‘KS.spjtu.

v¼Y’[]]^_H`C`iaCaCa4c6nln6jg^cHgihd6tu u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h uRO 36•¢´.

L•œ@Lš¢>’O NL•*x.

•œIO£$¯SRNLSRvLIHS.

x.

IOUO6uZu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lk už° &4S.

U vL>K‘’O@LNlSP•*•D6•œš¢BlG¿O@lNLSvLIHS.

x.

IOUOiF)@LSV36yL•œ‘K‘uVu«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u P6už° 5)>KvqS.

F)Nl•:NLONLS.

F!•*NL>AU •œ@lF¶•œF:YÉFH>AÁ¢•œSQtu u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|luž°³&4S.

U SŒ š$ORSRS.

JHT •GS J¹@LO U •œU À.

I>AOluXu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|lu²{Z&4S.

U SŒ š$ORSRS.

JHT •GS @OŒUV•¢UVÀ.

IH>’Oz´CBOi@LNLSVORš¢‘’OFHF•©G•¢UÏOiGI>AJlBlGS.

F)•¢FHG¡iG>KšœS.

F¢u»u:u«u:u:u«u °.

°.

už°2e šœ‘AOFFH•*5!¤»•œFHFSO6uŒu«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u²{ e šœ‘AOFFH•*5!¤»S.

@GSlu u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lO už°³&4S.

U SRNL•œš¢‘’OIOI)•*BLFOiI)BLU vpS.

@G•œ>KISLu§u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °U kl° kl° k{ k{ k{ k>O kyX kyX k>k SQP S>U U.

| °‰|QP °.

°‰| O ° .

| ° l° `X O ° ° C{ ° 6° h hyS .

{i|  .

  `X 2e šœ‘AOFFH•*5<e.‘ABL@LSlu u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° PHX ° 6h už°2e yL•¢IO@L£œO •¢@GI•*5!¤€S.

@GS•©5¦&4>KIš¢BL‘ASLu6u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° S>k ° lk už°)l¦•œIOi@L£$ORUP¥L‘žG>Avl‘’Oluu«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° U>k ° lk u²{Z&4S.

U SŒ š$OiU S.

F)S.

JTH•GS.

F¦J­°.

¨lJ¬{R•©N¹•œU BLUOŒyL•¢IO@l£$ORUP¥L‘KG>AvL‘AOlu±u«u:u«u:u:u«u:u«u:u*u«u ° U>k ° lk uRO ¦ l •œIOi@L£$ORUP¥L‘žG>Avl‘’O«š¢S.

U JOiF•*šœS.

UzBLU¾u«u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° UQP ° lk ugX &4S.

U SŒ š$OiU S.

F)S.

JHT •GS.

F¦J|l¨lJ­°.

¨J¬{P•*N¾•¢U BLUVOŒyL•œIO@L£$ORUP¥L‘žG>KvL‘’O:šœS.

U JLOF•*šœSUPBLU¹u ° U>S ° lk uih ¦ l •œIOi@L£$ORUP¥L‘žG>Avl‘’O:˜>KIHGBLO‘u?u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u ° U>U ° lk uRk &4S.

U Sz šœOU SFS.

JHT •GS.

F)J|6¨LJ­°.

¨6J¬{z•©N•œU§BLUO«yL•œIO@L£$OŒUP¥l‘KG>KvL‘’O*šœSU JOFH•©½|z˜>AIºGBOi‘uA{|.

| ° lk uiZ P 36•¢´.

L›œ@Lš¢>’ORNL•*šœS.

@lFHGIHBL£$¯iS•©NL•¢FHGIHBL>A£œ¯S NLS.

F!S.

JHT •GS.

F!•œU BLUOŒyL•¢IO@l£$OluLu:u:u«u:u«u:u*u«u {|l° ° lk uRS ¦ l >A•œIOI´CBL>AOPšœS.

U yL•œIO@L£$ORUP¥L‘žG>KvL‘’O:@LS.

IUVO‘­•©˜>AIºGBOi‘u‚u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {|{ ° lk uRU ¦ l >A•œIOI´CBL>AOPNL•*šœ‘AOFFH•œF¦5!¤»S.

@GSlu u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {|yX ° 6P už°¼¸%‘KBLFHGIO£œ¯SRNOŒ‘A>Ax.

O£$¯SzNL>A@ÑiUV>Kš$Olu u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6°`X ° 6P u²{ ¦ l >A•œIOI´CBL>AOP5!¤»•¢FFS.

e ‘KBL@LSL¨l5!W¬Bl@Lšœ>KS.Ol¨q5 .

e ‘ABL@LS.@OIH>ASL¨65<.

W¬Bl@Lšœ>KS.

@OIH>ASLu u«u:u:u«u:u«u:u*u«u {6° S {HLX už°ŸE.>AOx.

IOUOz+=-0/ NLO JL>KJL‘A>KSG•¢š$OzNl•:UVO@L>KvLBL‘AO£$¯SzNL•*•œ@GIONOR•:FOMANLOlu u:u:u«u:u«u:u*u«u {yS>S {ylU už°³&4S.

@GO>A@L•¢I F!F•œ´.

L•¢@Lšœ>AO>AF«Y\˜.

•œšGS.

I¢¨¬‘A>AFºG$¨6NL•œ´CBL•$tu u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyXQO {ylU u²{Z&4S.

@GO>A@L•¢I F¦OFFHS6š¢>’OiG>K˜.

SF:YÉF•G$¨UPBl‘KG>KF•G$¨lUVOv­¨lUPBL‘KG>AUVOv¬tu?u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyX>X {ylU uRO -¾“GSNLS.

F!šœSUPBL@LF¦OS.

F)Nl>K˜.

•¢IFHS.

š¢S.F.

@G¿O>K@L•œIHFœu2u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyX4P {ylU ugX -¾“GSNLS.

F!´CBL•*I•GS.

IH@OU >žG•œIONLS.

IH•œF¢uVu:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OyXQU O.

|luž°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOP˜.

•¢š¢GS.

Iœuu:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OQh>h Ol°.

už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒ‘A>KFHGœu u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>.

k | O{6už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒNL•¢´Bl•uu:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>k>k O>lO už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒFHGOš¿–¬u§u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>k>U OyLX už°³&4S.

@GO>A@L•¢I)´CBL•œBL•iu u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u OQPyO O>lk už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒF•G$uu:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>.

S | OQ6P už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒUPBL‘žG>KF•¢Gœu­u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>S>O O>lS už°³-¾“GSNLS.

F!NL>KFvpS.

@L>AJl>A‘A>KÁ$ONlS.

FvLOIOŒUVOv­u®u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u O>SQh XQlO už° f •œNL>žGS.

I)NL•©G•DGS •œUVOšœF«YTS.

JLF•¢IH˜•«SRMKG•œU§NL•*UV•¢@B0&)(*(*tuZu:u*u«u:u«u:u:u«u:u«u:u*u«u0XQO>O .

h {6už°¼¸%‘KBLFHGIO£œ¯SRNOŒyL>A•¢IOIH´Bl>’OŒ5¦-0OiGI>AÁ©NLORJl>AJL‘K>ASG•œš$OŒ/?¸Ð½ ¦ /€-0¤5©u u«u:u«u:u:u«u:u«u:u*u«u0XQS>O .

h {6u²{ ¸%‘KBLFHGIO£œ¯SRNOŒyL>A•¢IOIH´Bl>’OŒNOŒšœ‘AOFFH•:5 !SGBL‘’ONlS.

I .

O E NOŒJL>KJL‘A>KSG•¢š$OP/?¸Ð½ ¦ /€-0¤5©u u*u«u0XQSyX .

h {6uRO ¸%‘KBLFHGIO£œ¯SRNOF!NL•œvp•œ@lNL›œ@Lš¢>’OF¦NLS OIH´Bl>K˜.

SR5 !SGBl‘’ONLSI .

O Ezu u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQSQh .

h {6ugX f F>KG•*NLS /  zu6u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u0XQS>k hHLX už° ®V •¢IF¶•œF!NL•*BLU OI´CBL>ž˜.

u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .SLu.

h {| hHLX u²{Z&4IH>’O@LNlS BlU G¿Oxlulu:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {6° hHLX uRO &4IH>’O@LNlS BlU I•¢‘A•$OiF•u‚u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

h {yO hHLX ugX &4S.

U SŒ š$OiU S.

F)IOiUVS.

F¢u u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.h {>P e.

FºG>A‘AOPNL•:¤IS.

x.

° Luž° .IOUVO£$¯SŒ•¢U'&)(*( .

/?>KFHG¿OŒNL•:Wr>Kx.

BLIOF {6° hHXLuih +¦U QTIS.

@L> D2YÉS šœ•¢IH˜>AFH>’Otu u«u:u*u«u:u:u«u:u«u:u:u«u yh Ol° hHLX uRZk +¦U QTIS.@G•œ@LN¹vOIORS š¢˜F!@LS8:9.+=</?>K@BD ¨L+.

@G•œ@LN¹vOIORS š¢˜F!@LS >A@LNlSª!F¢uVu:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u yh O{ hHLX uiP E.>AOx.

IOUO«šœS.

U SF¦š¢S.

UVO@LNLS.

F)NlSVš˜6F¢uu«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u yh O>O luž° +¦U JLBLxLuzu«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

vpS.@LNLIH“zE.k |Qh e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

{{ e.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI /?>KFHG¿OPNl•«W»>Ax.@LNLIH“zE.

BLIOF e.vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

I´CBL>K˜S.        e.

F)QTS.

BLFBOi>AF)NLS.@G•iu.u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lO ° h6už° ŽrDG•¢@LF¶•œF.

F¦OIH´CBL>K˜S.

F!@OF!NL>KQT•¢I•¢@CG•œF!vL‘AOiG¿OiQTSIUVOFœu)u:u«u:u*u«u:u:u«u:u«u:u:u«u .

>žQT•œIH•œ@L£œOF!@O @lS.U | h6u²{ E.

NlS.à .UV•¢@Lšœ‘AOiGBlIOPNO ¤ fzf •*NL•«&)(:(PuŒu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lU ° kluž° ¤»O‘’O$˜IOF!š¿yO$˜•œF.

*(*(PuŒu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|l° klu²{ &4S.

@˜•œ@L£œ¯SvOiIOR@LS.

U •œF)NL•*S.

JHT •GS.

F¢ulu:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|{ kluRO ŽrD6•œU vL‘ASF¦Nl•:Nl•œšœ‘AOIOi£œ¶•œFœu€u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °‰|Qh P6už° 5)>KvqS.

F)•*>K@CG•œIº˜Oi‘AS.

F¢u u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°‰| P6u²{ E.>žQT•œIH•œ@L£œOF)NL•=G¿OiUO@lyLSŒNLS.

FSJHT •¢GS.

F)vONLIH¶6•¢F)NL•:&)(*( @OiF)vL‘’OiGOiQTS.

IHUOF NL•Œ° Pk •O {zJL>KGFœuÉ°.

°.

° ° Oluž°³&4S.

@˜•œIF¯SNl•:vpS.

@G•¢>AIHS.

F)S.

JHT •GS.

F¢uŸu«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° k>O ° h6už°2) e š¢•œFFHSyL•¢INOiNLSLu©u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° S>S ° 6P už°³-¾“GSNLS.

F!šœSU ‘A>KxO£$¯iSP•œFºG¿¡iG>Aš$O6u u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6°.

° ° 6P u²{Z-¾“GSNLS.

u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {6°{ ° lU už° = f vp•œIOiNLS.F!šœSU ‘A>KxO£$¯iSPNL>A@LÑUV>Kš$Olu.

I•¢F!´Bl•«vpS6Nl•œU FH•œI!FSJLI•¢š$OIHI•œx.

ONLS.

F¢u u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {HXQO {HLX už°ŸWr‘AOx.

FvLOIOŒS UV“GSNLSŒF•GQÐuu*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {y.

U | {HLX u²{Z-0Oi@L>AvLBl‘’ONLSI•œF)NLO!>KS.

UOi@L>Av  u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yUyX {HLX uRO &OIOš¢G•œIH•œF¦NL•*•œFšœOvp• *u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u {yU>U {>6h už°³-¾SNLS.

F!NL•:OJp•œIºGBLIOŒNLSVU “¢GS6NlSŒS.

vq•¢@ u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |>k {>6h u²{Z-¾SNLS.

F!NL•*vLIHSG•¢£$¯SRNLS U “¢GSNLSŒS.

vp•œ@ Y#ObGI>KJLBlGS.

F)NL•:OI´CBL>ž˜.

SCt ©u«u:u*u«u:u:u«u:u«u:u:u«u0.

O |>k {>6h uRO -0Oi@L>AvLBl‘’ONLSI•œF)FH•œ•¢–Nl>AI!vOIORSF¦U “¢GS6NlS.

F)F•¢•œ–Cv0•*F•¢•œ–CxLu®u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0lO °`X {ylU už°¼¸G•œIOiNLS.

I•¢F!•:vpS.

FH>A£$¯iSLuÏu«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0OyXQk XC{6už°ŸE.>KI•GÀ.

IH>AS.

F>KUVvpS.

IºG¿O@G•¢F)vOIORSRvLIHS.

x.

IOUOiNLS.

Iœu u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u CX {yk XC{6u²{ ¤ISx.

IOUVOF)¥lG•œ>KF)vOIOŒNL•¢F•¢@C˜S.

NL•*FSQ\G%ª4OI•:@LS OUPJl>A•œ@G•:8:9.‘K˜•œNLSI•œF.+=</?>A@CB6Dqu'u:u«u CX {>P X46P už°Ÿ½4>KJL‘A>KSG•¢š$OF4BLFBOi>AFœu u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4hyk XQlU už°³&4S.

UVO@LNlS.

F)NLS x.

NLJ­uÏu:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4P | hylO už°³36•¢´CBL›œ@Lš¢>’O!•D6•œš¢BlG¿OiNO¦vp•œ‘KSvLIHS.

x.

IOiUONlS.

I vOiIO)UVS@CGOx.

•¢U NL•vlIS.

x.

IOUVOF­UPBL‘žG> 1%vL‘AOiG¿OiQTSIUVO BLFO@LNLS SRvONLI¯S8:9.+«uzu:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>S hylO u²{Z36•¢´CBL›œ@Lš¢>’O •D6•œš¢BlG¿ONLO vp•œ‘KS BlFB¡IH>ASLu!u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS>U {yO ° .

jX { /?>AFHGOPNL•:5rOJp•œ‘AOF &.už° ¤I•¢šœ•¢NL›œ@Lš¢>’O NLS.

F!S.

vp•œIOiNLS.

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI h>hyO e.I•¢FœuZu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u e.vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

I´CBL>ž˜.   ° ŽrD6•œU vL‘ASRNL•*BLU ‘A>AFºG>K@LxLu.u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ŽrD6•œU vL‘ASRJ¡iF>Aš¢SP1 .

vL‘A>Kš$OšœOSLu y­u u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ŽrD6•œU vL‘ASRJ¡iF>Aš¢SP1 .I´CBL>ž˜.S 5 .

I´CBL>ž˜.S 5 .vL‘A>Kš$OšœOSLu šœvLv uµu*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ŽrD6•œU vL‘ASRJ¡iF>Aš¢SP1 .

S vLISx.

•¢šœ‘AOIO£œ¯SRNL•*S.IOUVOlu šœvLv uu«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u luž° +¦FO@LNlSVFOMANOŒvOiIOPG•¢‘’OŒ•©@LS‰˜iO ‘K>A@LyO6u u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u lu²{ E.

J H•GS.

F!•*BLFS NL•*šœ>K@†•:š¢S.

BlGœu u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6už° 5)>KvqS.

F)@CBLU “œIH>Aš¢S.

F!NL•«&)(:(Pu u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6u²{ E.>žQT•œIH•œ@L£œOF!@LSVBlFS NL•*>A@G•¢>AISŒš¢S.

U FH>A@O‘YÉF>Kx.

@L•¢N¬t4•*F•œUÏFH>A@Oi‘®YÉBL@lF>Ax@L•œN¬tu‚u«u:u«u:u:u«u 6u ŽrD6•œU vL‘ASRvLIH•œ‘K>AU >A@OI NL•*NL• @L>A£œ¯S NL•*šœ‘’OiFF•*NLSRBLFHB¡IH>ASLu†u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6u ŽrD6•œU vL‘ASRvLIH•œ‘K>AU >A@OI NL•*BLFHSVNORšœ‘AOFFH•©˜.

•œšGS.

• @L>K@LNLS •:BlFO@LNlSVBLU @OU •œFvLOšœ•iu u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.I!NORJL>KJL‘A>KSG•¢š$OŒ365!/ u*u«u:u:u«u:u«u:u:u«u luž° E.

°.

už°Ÿ¤»OFFO@LNLSVvOIÑiUV•GISF)vqS.

I˜iO‘KS.

Iœ¨6I•QT•œI›¢@Lšœ>AO •©vpS.

@G•¢>AIHSLu¼u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u²{Z&4‘AOFFH•:š¢S.

UÏOiGI>KJLBlGSŒ•*U “¢GS6NLSR@LSIUVO‘u u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u &4‘AOFFH•:š¢S.

UÏOiGI>KJLBlGSŒ•*U “¢GS6NLSRš¢S.

@LFHGœu u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u &4‘AOFFH•:š¢S.

UÏOiGI>KJLBlGSŒ•*U “¢GS6NLSR•¢FHG¿¡bG>Aš¢SLuŸu:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u .I´CBL>K˜SV• 15!¤»S.

@GSlu y­uu:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

I´CBL>K˜SV• 15!¤»S.u .

@GSlu š¢vLv­u)u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u °.

°.

u +¦FS NL•*UV“GSNLS.

F)•:OiGIH>AJLB6GS.

F)NL•*BLUVOPšœ‘AOFFH•uŸu*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° luž°Ÿ+¦FS NL•*vqS.

@G•œ>AIHS.

F)vOIOŒšœI>AOI)•*BLFOiI¦SJ H•¢GS.

F!NL>A@ÑiUV>KšœS.

F¢u u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu²{Z&4S.

U vOIO@LNLS«SzBLFHSPNL•¦˜.

•¢GS.

¨lNL>K@ÑU >Aš¢S.I•¢F)•œFºG¿¡iG>AšœSFNL•=&.

FNL•*&)(*(P¨6š¢S.

U OBlGS !vlGI NL• &)(*( •©˜.

•¢š¢GS.

I!NO FºG‘#uZu«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu Z+¦FS NL•*I•¢QT•¢I›¢@Lšœ>AOlu*u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° Luž°Ÿ+¦FS NL•*šœS.

@LFºGIHBlGS.

I!NL•QÉOBL‘žG!•:Nl•:š¢S.

vL>AOlu u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° Lu²{ +¦FS >A@LNL•˜>ANLSRNLSRšœS@LFHGIBlGS.

I!NL•*šœÀ.

vL>AOŒ•œU S.

J H•¢GSF¦š¢S.

UÏOiGI>KJLBlGSF)NL>A@ÑiUV>KšœS.

I´CBL>K˜SV• 15¦&4>AIš¢BL‘ASlu y­u u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u²{ .F¢uu«u:u:u«u ° 6už° .I´CBL>K˜SV• 15¦&4>AIš¢BL‘ASlu š¢vLv­u†u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u Z+¦FO@LNlSV•¢Fvp•œšœ>ž š$OiNLS.

I!NL•:Ošœ•¢FFHS•*NL•*yL•œIO@L£œOluPu:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° 6u ŽIIHSROSPNL• @L>KISŒšœS.

@lFHGIHBlGSINL•¢QÉOiBL‘KG4•=BLU šœS.

@LFºGIHBlGS.

I)FHS.

JLIH•œš$OiII•¢xONLSŒš¢S.

U >A@L>Kšœ>’Oi‘A>AÁœOb1 NLSI•œF«Y .I´CBL>ž˜.

S •°‰|6°¢1ÐOUzJL>Ax.

Bl>ANONl•u šœvLv¬tuu:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° luž°³36•¢´CBL›œ@Lš¢>’O NL•*šœS.

I´CBL>K˜SV• 1%¤®IHS.I´CBL>K˜SV• 15!Ž®‘K>AvLFH•u y­uu:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu .I´CBL>K˜SV• 15!Ž®‘K>AvLFH•u šœvLv uru*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu .@LFºGIHBL£$¯S •*NL•œFºGIHBL>A£œ¯SR•œU yL•¢IO@l£$ORUP¥L‘KG>AvL‘AO«˜>AIºGBO‘#u«u:u:u«u:u«u:u:u«u ° lu²{ .

x.

IOUO6u š¢vLv­u u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu .I´CBL>K˜SV• 15¦&4>AIš¢BL‘AS.

Ž®‘K>AvLFH•u y­uŒu:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu .I´CBL>K˜SV• 15¦&4>AIš¢BL‘AS.

Ž®‘K>AvLFH•u šœvLv u?u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u ° lu ŽrD6•œU vL‘AS0NL•U •œ@LFOx.

•œU NL••¢IIHS•œU >KG>ANO†vq•¢‘AS¾šœS.

U vL>A‘AONLS.

I*xC(*( YÉ@lS78:9.I´CBL>K˜SV• 15¦&4>AIš¢BL‘AS.+=</?>K@BDt=1 .

Ž®‘K>AvLFH•u UVFHxLu u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h6už° h6u²{ h6uRO k k e e T P S P e P RO P gX O RO gX ih e Rk e iP O SQP QS P T O RO `X `X k h 2e h e h RO h gX 4T SQP QS P k e k RO e k gX e k ih e k Rk e k iP e e O>O U>O U>O UyX °‰|.

| °‰|>k <e <e SQP SQP SQP SQP SQP QS P >h { °.

°.

° °.

°{ °.

° °.

° °{.

{ `X k >O S °`XL° °`X4h °`X4P ° 6h ° ° hyO ° hyO ° .

k | ° kyX ° kQP ° PHX ° .

S | ° SQh ° SQP ° S>S ° .

U | {|{ {|yX {|yX {|Qh {|QP {|>S {|>U ° .

Hk { /?>AFºG¿OŒNL•:¤IS.

xIOUVOF P h ° 6už°ŸŽrD6•œU vL‘ASRNL•*BLFHSVNlS vpS.

‘K>AU S.

I´CBL>K˜SV5!¤€•œFHFSOlu šœvlv­u?u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.I´CBL>K˜SV5!¤€•œFHFSOlu y­uŒu:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6° ° 6u .IH FHUVSlu u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {6° ° 6u²{ .

‘KBL@LSLu y­u u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.I´CBL>K˜SV5 .{| ° 6u .

‘KBL@LSLu šœvlv­uu*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.I´CBL>K˜SV5 .{6° ° 6u .

{.

{ ° 6u .I´CBL>K˜SV5!WBL@lšœ>AS@OI>KSLu y­u0u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{ ° 6u .I´CBL>K˜SV5!WBL@lšœ>AS@OI>KSLu šœvLv­uu«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{ ° 6u .I´CBL>K˜SV5 .‘KBL@LSWBL@lšœ>AS@OI>KSLu y­uu:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

‘KBL@LSWBL@lšœ>AS@OI>KSLu šœvLv­u u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.{ ° 6u .I´CBL>K˜SV5 .

I´CBL>K˜SV• b1šœ‘’OiFFº1 .{ ° 6už°‰| .•¢IO@LšœOb1º-¹BL‘KG>AvL‘AOlu š¢vLv­u u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

{ ° 6už°.

I´CBL>K˜SVUVO–i•¢ ‘K•©vOIOŒ•Dl•¢Iš¢MAšœ>KS.° .

F!• l°¨L• {¨• luu«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { { ° 6už°{3lOiMANOPx.

•¢IONLO vp•œ‘KSŒUO–i•¢ ‘K•*NLS.

F)•D6•¢IšœMKšœ>KS.

F!• l°.

¨• {6¨L• lu u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { ° luž°Ÿ+¦FO@LNlSVš¢‘’OFHF•œF)QTIH>A•œ@lN­uu*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { ° lu²{ +¦FO@LNlSVU “¢GS6NLSFQTI>A•¢@LN­u6u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { ° luž° .I´CBL>K˜SV• b15!¤»S.

I´CBL>K˜SV• b15!¤»S.@GSlu y u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { ° lu²{ .

@GSlu š¢vLv­¨LG•¢FHGO@LNLSORFHS.

JLIH•œš$OiIxORNL•*S.

vp•œIOiNLS.

I´CBL>K˜SV• b1%¤®IHS.Iœuzu«u:u«u:u:u«u:u«u:u*u«u { ° lu .

x.

IOUO6u š¢vLv­u u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { 6° {|luž° .FFSšœ>AO£$¯iS š¢S.

u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {6°.UÏOiGI>KJLBlGSŒNl•:‘K>AxOi£$¯SLu.

už°Ÿ+¦FS NL•*šœS.

@LFºGIHBlGS.

I!š¢S.

u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { .U •D6vL‘K>Aš¢>KG$u.

| {6°.

u²{ +¦FS NLSRNlw@OU >Aš1š$OFºG$¨lG%wvp•œ>KN¾•*•D6š¢•œ£œ¶•œF¢u u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {6°.

u Z+¦FS NL•©G%w6vp•œ>KN­uru:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {.

>K˜>AF¯SRvqS.{6už°ŸŽrD6šœ•¢FF¯iS 4E.

I)Á¢•œIHSLu u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {.

{6u²{ ŽrD6šœ•¢FF¯iS 4E.>K˜>AF¯SRvqS.

I)Á¢•œIHSVš¢S.

U šœS@CGIS.

‘K•©F>KUVvL‘K•œF¢u u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {.

>K˜>AF¯SRvqS.{6u ZŽrD6šœ•¢FF¯iS 4E.

I)Á¢•œIHSVš¢S.

U •D6š¢•œ£œ¶•œF¢uu«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { 6° {.

{6u ŽrD6šœ•¢£$¯SV•:Nl•œF•¢UVvl>A‘AyLOUV•¢@GSLuPu:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {.

{6u ŽrD6šœ•¢£$¯SVvOIOŒ@L•ª*u u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { { Luž°ŸWS.

IHUOiGO£$¯iSPJ¡FH>Aš$OŒNORFOiMANOŒNL•*NONlS.

Fœuu:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { l° { Lu²{ WS.

IHUOiGO£$¯iSPNORFOMKNOPNL•*NONLSF¦BlFO@LNlSV>KS.

UOi@L>Av­u'u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { { Lu ZWS.

IHUOiGO£$¯iSPNORFOMKNOPNL•*NONLSF¦BlFO@LNlSV>KS.

UOi@L>Av­u'u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { { Lu +¦FS NL•*FFHGI•œOU YÉSFHGIH>A@LxFHGIH•$OU •:>KFHGI>A@lx.

FHGI•$OiUtu u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

FºGI•œOU NL•¦NL>AFHšœSYT>KQTFºGI•œOU •.| { 6už°Ÿ+¦FSzNl•.SQTFHGI•$OiUtXvOIO:•¢Fš¢I•¢˜•œI)•¦‘A•¢I •¢U OI´CBL>ž˜.

S.

FNL•¦NL>AFHšœSLu .

| { 6u²{ /?•œ@lNLSVBlUÏOI´CBL>ž˜.

SRšœSU NONLSF¦•*š¢S.

UV•¢@G¿¡IH>AS.

F¢uu:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

| { 6u Z/?•œ>žGBLIOŒ•©x.

IO$˜iO£$¯iS Nl•:SJ H•¢GS.

F.FH>AU vL‘A•¢FBLFO@LNLS I•œON¬<bª!IH>KG•iu0u:u*u«u:u«u:u:u«u:u«u:u*u«u l°‰| { 6u +¦FO@LNlSVIH•$ON­¨ ª!I>žG•©•*F•¢•œ–CxLu u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l° { 6u ŽrD6•œš¢BlG¿O@lNLS•*•œ@˜>’Oi@LNLS šœS.

UVO@LNLSF)vOIOŒBLU S.

BlGIHSRvLIS.

xIOUVO†Yɚ¢S.

U S.

vlQTFºGIH•$OUtuRu*u«u l° { 6u Z+¦FO@LNlSVIH•œNL>KI•œš¢>AS.

@LOUV•¢@GSŒNL•:OIH´Bl>K˜.

Slu±u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l° { luž°Ÿ+¦FS NOŒšœ‘’OiFF•*FºGI>K@LxRNL•«&)(*(Œu u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u {.

BlU vLISx.{ { lu²{ +¦FS NL•*FHGIH>A@LxR•*FFºGIH•$OU vLOIOŒ•D6•¢šœBlGOI.

IOUVOPNLSRFyl•œ‘A‘#u!u«u:u«u:u:u«u:u«u:u*u«u { { 6už°Ÿ+¦FS NL•*šœS.

U vL‘A•Dqu u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l° { luž°Ÿ+¦FO@LNlSVJL>žGFH•¢G1ŽrD6•œU vL‘AS†° u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { lu²{ +¦FO@LNlSVJL>žGFH•¢G1ŽrD6•œU vL‘ASV{ u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { lu Z+¦FO@LNlSVJL>žGFH•¢G!šœSU ˜.

•¢š¢GSI.u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

|luž°Ÿ+¦FO@LNlS ˜•œš¢GS.

I0u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l°.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI HX >h yk >P yS yO yO>O yO>k yOQP HXQk HXQS >h >hHX yk yk>O ykQh yk>U yk>U >P >PHX >Pyk yU yU>O yU>U O >O O >k O >S O O `X O P O U O O yk O>O O>O>O O>O>k O>OQP OQh>P O>k O>k>k OQP e.už°Ÿ+¦FO@LNlSV‘K>AFHGœuŸu«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { {6už°Ÿ+¦FO@LNlSVNL•¢´CBL•u­u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u luž°Ÿ+¦FO@LNlSVFºG¿Oš¿–¬u0u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u | P e P RO e P gX e P ih e P Rk e P iP e P RS e P RU e P >e e e e e U>O P e P S S U 2e U e U RO e 2e RO RO gX ih O HX HX HX RO HX gX >h >h >h RO >h gX >h ih >h Rk yk yk >P yS yS yS RO O U l `U `U `U>O `U U U>O S>U S>U S>U *W *W *W T O O>O e.@LNLIH“zE.vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

>P OyXLuž°Ÿ+¦FO@LNlSV´CBL•¢BL•u­u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0OQPHX O>kluž°Ÿ+¦FO@LNlSVFH•¢G$u u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>lS ° O>Služ°Ÿ+¦FO@LNlSVUVOv­u u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u0O>S>S X|luž°Ÿ+¦FO@LNlSO‘Kx.

S.

IH>KGU S.

F x.

•œ@l“œI>KšœS.

F¢uqu:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |l° X|lu²{ +¦FO@LNlS ˜•œš¢GS.

I¦šœS.

UÏOi‘Ax.

S.

IH>KGUVS.

F x.

•¢@L“œIH>AšœSF u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |>O XL°.

už°Ÿ+¦FO@LNlS QTBL@lš¢G>KS.

I´CBL>K˜SV•œ|>k.@O‘#u.u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X |>S X>XLuž°2e.

I´CBL>K˜SVNl> 01B­uZu:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQOQP X>XLuRk e.I´CBL>K˜SV•DC1˜.I´CBL>K˜SV•œ|>kJ61yL•œ‘K‘ASLu šœvlv­uqu:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQO>k X>XLuRO e.I´CBL>K˜SVNl> 01šu u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQO>k X>XLuih e.I´CBL>K˜SVNl> »uXu«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQO>k X>XLugX e.Ob1yL•œ‘K‘ASLu šœvlv­u»u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQOQh X>XLu²{ e.

•¢š¢GS.

I´CBL>K˜SVUVO–i•¢ ‘K•u¹u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X>X4P XQklu²{ ŽrD6•œU vL‘ASRNL•*BLFHSVNlS vlIS.Iº1°¢1%>K@LNL•œ@Gœu š¢vLv­u u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQO>U XQkluž°2e.

x.

IOUVOPUO–i•VYɚœSUV•¢@CGONLSCtu u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X>XQS X4P6už°³3lOiMANOŒNLSRšœSUO@lNLS OI41.

1%yl•œ‘Av u:u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4.

e I´CBL>K˜SVUVO–i•¢ ‘K•©šœS.h { X46P u²{Z3lOiMANOŒNLSRšœSUO@lNLSR@LU§11%yl•œ‘Av7u¬u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4hyO X46P uRO 3lOiMANOŒNLSRšœSUO@lNLSR‘ANLN¾<iBLFHI¿<iJl>A@¬<i‘žwD u6u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4hHX X46P ugX .

U Jl>AJL‘K>ASG•œš$OiF•œFºG¿¡iG>Aš$OiF)•:Nl>A@ÑU >AšœOFœuu«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4hyS X46P uih .e I´CBL>K˜SVU S.

e I´CBL>K˜SV‘K>AJlGS6S‘¬1.FºGIOi@LNLSRSRBLFS NLSRUOi–•¢ L‘A•u?u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQlk ° XQlS už°2.

1yL•œ‘Kv­u u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQk>O .

h {6už°ŸŽrD6•œU vL‘AS¦NL•šœÀNL>Ax.

@LS.QTS.S!NLSšœBlUV•¢@CGONLS.

IHUObGSye V<e ¦ E *f & vOiIO!BLFS=š¢S.

U S¦vLIS.

xIOUVO NLS$Dwx.

•œU¹u u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u X4PyU .

h {6u²{ ŽrD6•œU vL‘ASRNL•:OIH´CBL>K˜SVNL•*š¢S.

@l x.

BlIO£œ¯SRNLSVNlS‰Dwx.

•¢@0šœSU šœSUV•¢@CG¡I>KS.

Fœu©u:u:u«u:u«u:u:u«u XQlS ° .

h {6uRO 3lOiMANOŒNLSRšœSUO@lNLSRNLS$D6wx.

•¢@¹11yL•œ‘Kv­u u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u XQS { hHLX už°³3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1.

1%yl•œ‘Av1%S.

vlG>AS.

@lF:u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h °‰| hHLX u²{Z3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1.

1%yl•œ‘Av1%šœSUVUVO@LNLF0u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h °‰| hHLX uRO 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜FÐ1.

1%yL•¢‘Av61FHw@LS.

@wU Fu:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h °.

° hHLX ugX 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F¦>AU vqSIHGRu:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h ° O hHLX uiZh &4S.

U SŒ š$ORSRI•¢vqS.

FH>KGÀ.

I>KSŒOvpÀ.

F¦OR>KUVvpS.

IºG¿O£œ¯S u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h °`X hHLX uRk 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1l š¿yL•¢š¿–S.

B6G u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h ° h hHLX uiZP 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1l š¢S.

š¢S.UVU >KG u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h ° k hHLX uRS 3lOiMANOŒNLSRšœSUO@lNLSRš¢˜F.

U UV>žG)OvpÀ.

F!ONL>K£$¯SRNL•*BLU UVÀNLBL‘KS«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h ° k hHLX uRU 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1l BLvpNOiG• u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u 6h ° U hHLX už°‰|C3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1GOxŒ@LS.

U • u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .

h {.

{ hHLX už°.

°b3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F¦šœS.

u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .U U >KG1I¦{.

h {yO hHLX už°{3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜FÐ1%NL> u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .

h {>h hHLX už° CO 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1%‘KS.

xP‘A•¢>’OU •u GHDG u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .

h {>h hHLX už°`X 3lOiMANOŒNLSRšœSUO@lNLS*W š¢˜F)1%FºG¿OiGBLF)‘A•¢>’OU •u GHDG¾u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u .

h {>P hHLX už° .

h +¦FO@LNlSVSRš¢˜F¦I•¢UVSGOU •œ@G•¹u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hy.

O | ½.už° -¾SNL>ž š$ONlS.

u²{ WBL@L£œ¯SR•*•œFš¢S.I•¢F¦Nl•«Oišœ•œFHFSLu u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hHXQk ½.

uRO WBL@L£œ¯SR•*•œFš¢S.vpS« e u¾u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>h | ½.

už° +¦FSŸNLS.vpS½.u7u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>6h ° &.

FVS.

vp•œIOiNLS.

I•¢FNL•š¢S.

U vOIOi£$¯SL¨4>A@Lš¢I•œU •œ@GS¼•NL•¢šœI•¢UV•¢@GSL¨!•NLSFS.

vp•œIONLS.

IH•œF š¢S.

UVvpS.

FºGS.

uRO +¦FS NLSRS.u²{ +¦FS NL•*F>AÁ¢•œSQÐu u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyU &.F¢uqu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u h>hyS &.

vq•¢IONlS.

I)NL•:>A@Lš¢I•œU •œ@GSLu†u«u:u«u:u:u«u*u:u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u hy.

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e vpS.k | e.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( . /?>KFHG¿OŒNL•:¤ISx.

IOUVOF {     .

HS { /?>AFºG¿OŒNL•:¤IS.

xIOUVOF gX  hyk hykQP hykQP hyk>S hyk>S h>P h>P h>P h>Pyk h>P>P hyS hyS hyS hyS>O hySyX hyU hyUyX hyU>S & u +¦FS NLSRS.

vq•¢IONlS.

I)UVÀNLBL‘KSŒ•*NLSRS.

vq•¢IONlS.

I .

uLu«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l° . Ezuž° +¦FS NL•©QTS.

Iœu?u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu²{ +¦FS NL•©QTS.

I)•œ@LšœONL•œONLSLu u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu +¦FS NL•©ª!yL>A‘K•u.u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu +¦FS NL•*FHª!>KGš¿y­uru:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ezu +¦FS NL•©ª!yL>A‘K•¨L•Dl•¢UVvl‘AS†°.

uPu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u | Ezu +¦FS NL•©ª!yL>A‘K•¨L•Dl•¢UVvl‘ASV{6uPu:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 6° Ezu +¦FS NL•*JLI•œO–¬¨šœS.

@G>K@CBL•¨NLSluKu ª!yL>A‘K•¨L•*Fºª!>KGš¿y u u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

{ Ž)uK° WBL@L£œ¯SRUOi>A@•:OŒ•œ@GIONOR@OŒ‘A>A@lyOPNL•*šœS.

UVO@LNlSLu¬u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ž)u { WBL@L£œ¯SRI•¢šœBLIHF>K˜iOlu u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ž)u WBL@L£œ¯SRšœBLJpSLu u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

| Ž)u WBL@L£œ¯SRšœS.

U§˜.

S.

>KN­u†u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u l° Ž)u WBL@L£œ¯SR•œU ‘K>A@LyLO†YT˜.

S‘ABLU •©•œFºQT•œIO.

tu u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u { Ž)u WBL@L£œ¯SR•œU ‘K>A@LyLOP•D6•œU vL‘ASV{6u u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u Ž)u ŽrD6•œU vL‘ASRNL•*BLFHSVNLORJl>AJL‘K>ASG•œš$O !š¢FHGNl‘A>AJ :uVu«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u W4už° +¦FS NLSRS.

vq•¢IONlS.

I)NL•*•œ@LNl•œI•¢£œSV•:FH>AÁ¢•œSQÐuPu:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

| 8ŒuK°'+¦FS NL•*FHGIHBLš¢GœuVu:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u 8Œu { +¦FS NL•*BL@L>AS@­uµu:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u «už° +¦FS NL•©QTBL@L£œ¶•œF!UVOiG•¢U¡bG>AšœOFœu?u:u:u«u:u«u:u*u«u:u:u«u:u«u:u:u«u:u*u«u:u«u:u:u«u:u«u:u*u«u .

|l° /?>AFºG¿OPNL•*vLIHS.

x.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI k e.IOiUOF RO gX ih Rk iP iO RX h ik P l e.@LNLIH“zE.vpS.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

     f NL•¢F•œ@˜S.

‘A>K˜IHS*G•¢˜•.šœSUVS«vLI>K@LšœMKvL>AS*O:I•œBl@L>’¯S:NLS.‘K˜>AU •œ@GSzNL•¢FHG•.

FšœS.

@lšœ•œ>žGS.

F NL•.vLIS.

xIOUVO£$¯iS:•¢U & (*( vp•œ‘AS«vLIÀvLI>KSzOB6GS.

I¢¨6BLUVO«•¢Fvp“œš¢>A•=NL•.I•¢FBLU SzvOiIHG>KšœBL‘AOIœu S.

J H•¢G>K˜Sz•œIOzS.

IHxO@L>KÁ$OI®S.

FšœS.

@Lš¢•œ>žGS.

•:šœI>AOI)BLUVOVOivqS.F ) Nl•P&)(*(.

FºG>K‘’OPNL•:šœS.

@lFBL‘žG¿ORI¡vL>KNOl¨•¢UÏ´Bl•zO F>A@GObD6•«NL•z&)(*( F•¢I>AOVOvlI•œFH•œ@G¿OiNONL• QTSIUVORFHBLšœ>K@G¿OŒ•*NL>AIH•¢G¿O6u &4S.

U S S±>A@G•œI•¢FFH•¼vq•¢‘’OŸvLIHS.

x.

IOiUO£œ¯S³S.

I>K•œ@G¿OiNO O±S.

J H•GS š¢I•¢Fšœ•¢B FBLJlFHG¿Oi@Lšœ>AO‘AU •œ@G•i¨=NL>ž˜.

•œIHFS.

F Oi‘ABL@LSF)NLS/€-0¤ 5 UV•©FHS.

‘A>Kšœ>KGOIOiU§OŒIH•$O‘K>AÁ$Oi£$¯SŒNL•*š¢BLIFHS.

I¡vL>KNLS.F.

F!OJpS.

INLO@LNLSV&)(*(Pu &4S.

U O«OvLI•¢F•¢@CGO£$¯iSPNL•œFºG•¢FšœBLIHFS.

F¢¨l>KNL•œ@G>ž š$O$˜iO:OFUVO>KS.

I•¢F Nl•¢ š¢>A›œ@lšœ>’OiFNLSF4O‘KBL@LS.

F¢¨6•i¨lOiS«U •œFHUVS G•œU vqS OU vL‘K>’O$˜iOPOROvqSFHG>K‘’Olu &4S.

U S.vLOFFOIrNLSFrO@lS.

F&)(*( •¢˜S.

‘ABl>AB­¨išœ•œ@G•œ@OFrNL•4@LS‰˜S.

Frš¢S.

@Lšœ•¢>KGS.

F»QTS.

IOU ONL>Kšœ>KS.

@ONLSFœu U •œNL>KNO ´CBL•z&)(*( •¢˜S.

‘ABlM’Ol¨lOVOvpS.

FºG>A‘AO«G¿OiUPJq“¢U •˜.

S.

‘KBLM’Olu ¤rOiIO=S=NL•¢F•¢@C˜S.

‘K˜>KUV•¢@CGS©NL•œFºG•)‘K>K˜IS¦QTS.

IOU š¢S.

@LFBl‘KG¿OiNLS.

FXNL>ž˜.

•¢IFSF‘A>K˜IHS.

F»Nl•vLISx.

IOUVO£œ¯S.S.

IH>A•¢@CGONO ORS.

J H•GSL¨Nl•z&)(*(P¨L•*NL•*vLIHS.

x.

+=</?>A@CB6Dqu .IOiUO£œ¯SŒvOIO 8:9.F¦IH•¢QT•¢I›œ@lšœ>’OiF¦F¯S šœ‘’OiFF>ž š$OiNOF!ORF•œxBL>AI¢u f T T &e T  &T >U UyU `U>U>O   &T >U U>O UyUQP `U>U>O U>UyX +=-0/¨.

 ¦BLUzJOBLx.

y¹•¢G¦Oi‘už¨­° U>UyX6¨p&4SON¹O@LN  S.

BLIHNLS.

@L@¾/u >A@CJL‘’OiN­¨ ° UyU>O ²-0OiIHG>K@¹O@LN0-¾š‰&4‘KBLI•i¨?° U>U>O u 365!/¨ Žš¿–•¢‘¨p{|.@­¨ ° U>U>O¨De.

||6¨¬E.•¢>KG•¢‘‚O@LN¹E.•¢>KG•¢‘¨¬{i|.

|l°¨¬½#T OI@L•i¨?° U>U> U u 8:9.+=</?¸Ð9.+P¨ O‘K‘¨{i|.

|l°¨ .ONLO TH•¢ª!FH–>€O@lN0Ž®ONL‘K>A@L•i¨ ° UyU>6S ¨ V OiFBLNL•˜iO@­¨q{|.

|l°œJ ¨ V OFHBLNL•˜Oi@­¨p{|.

|l°$O6¨ E.>A•GÁ¨?°`U>U>S ²&4SS.

vp•œIœ¨?°`U>U>U6¨ .O$wUVS@LN­¨¬{||.

|6¨&4•¢NL•œIH´˜6>KFHGœ¨€°`U>U>6O ¨ .

OIxOiFœ¨­° UyU>6U ¨8©IObGG>#¨ ° UyU>.

U O6¨$&4>AFH@L•œ>KIS.

F¢¨?° U>U> U  9¦S.

‘ANL•¢@0Oi@LN *Nl•¢˜.

•¢‘AS.

v1%5€•$OU¹¨?° U>U>S ¨¬-0O@l>A–bOl¨­° UyU>6U ¨p8©IOiGHG>#¨q° UyU>.

U O #u >A@LNLS‰ª!F¢¨ ŽÁœÁœ•¢‘¨?° UyUl°‰O6¨$Ž®Á¢Áœ•¢‘¨?° U>6U °$J ¨‰½S.

I‘AO@LN­¨q° U>U>.

k O¨‰½4S.

IH‘’O@lN­¨ ° UyU>k J­¨œŽ®Á¢Áœ•¢‘¨‚° U>U>O ¨$¤€•œIIºw.

¨‚° U>U>ih J  ¤€•œIIºw.

¨‚° U>U>hO6¨p36š¿yl>A‘AN6G$¨­° Uy.

U |6¨¬3CªO@ ¨€°`U>UyX  >K•œ@L•¢I.Oi@LN0¤>K@LFS.

@ ¨­° U>lU °i¨p3G•˜.

•¢@O@LN08©IS.

BLv ¨­° U>U>O ¨¬¤rOvlvOF¦O@LN0-¾BLIHIO$w.

¨?° UyU> O #u ¤®IHS6š¢•œFHFOU •œ@GS¤rOIO‘A•¢‘ASL¨ ¼O‘K‘¨6{|.

>K•¢GÁi¨­° U>Uy6S ¨B.|6°¨¬E. l Blx.

l BLxyL•œF¢¨€°`U>UQ P  ¦ONO HT •ª!F–C>€O@LN¾Ž®ONL‘A>K@L•¨ ° U>U> S u &)(:(P¨  ½ OI@l•¨?° 6¨-0OiIxOIH•¢G¦O@lN0½ OiI@L•i¨?° ¨$E.•œ>KG•œ‘#¨¬{|.•œ>žG•¢‘¨­° ¨‰E.•¢>KG•¢‘‚O@LN¾E.yLF¦O@LN .•œ>KG•œ‘?Oi@LN0E.

|l°i¨ • 2O@LN ©œ• >žGy­¨­° 6¨ 3G•˜.

•œ@O@LN¾8*IHS.

BLv­¨?° 6¨ ¦S.

)KJ 58@ML6NON9P?QROR0SOS9S:TU>V PON?TXW Y Z9[\T]6^&E yU { ."-.2.4365758 ..').'0/1+-.@).I.95<-.D%('"(E F 5HG.Jp•œIºGS O@LN¾W•œIH@O@LNLSl¨­° u   e      "! $#&%(') '+*.9:.9."= -2583 '+365>?5(-."-.0ACBD. /573 .

O| 3S.

JLI•*SR‘A>ž˜IS   .

  T ŽFHG•¹‘K>K˜IS¾QTS.

>NL•¢F•œ@˜S.

‘K˜>ANLO2š¢S.

U S7S.

J H•G>ž˜.

S7NL•šœS@Lšœ•¢@CGIOIRS.

FŒš¢S.

@LyL•¢šœ>KUV•¢@CGS.

FRNL•¿H .

   7±!#"$%¾•F•¢IH˜>AI«NL•JOiF•vOiIO0BLU š¢BLIFHS>A@G•¢I@LS@lS/‚OJqSIOiGÀ.

I>KS¾NL•-¾•œ>KS.

FP¤€S.

IS.

FHS.

FP•  ¤IHS.

vLI>K•œNOiNL•œF!5€•œIU SQTMKF>AšœOF*YÉ/»-¾¤®5¦t)•*@LS 9.¥Lš¢‘A•¢SVNL•:¤€•œF´CBL>KFO •œU'&4S.

¤ &)tu S.@lFHGIHBL£$¯iS&4>ž˜6>K‘®Y#9.

J H•G>ž˜.

S=“vOFFOIXOiS.•œFºGBLNLO@G•¨COiFr@LS£œ¶•œF»NL•¤ISx.

O =J H•¢GSL¨.IOUVO£œ¯S =IH>A•œ@GONO.

NL•BLUO!QTS.

NL•œFH• ¡$˜.IUVO JLOFHGO@G•I¡vL>ANLO¦•NL>AIH•¢G¿O6¨iFH•œ@LNLS.

•¢‘LS=Oš¢S.

NLSFr•œFºGBLNlS.U vO@LyOiUV•¢@CGS.

FrvpS.

I€BLU vLIS.

xIOUVONLS.

I‚š¢S.

U •D6vq•¢I>A›¢@Lšœ>AOlu ‘K>K˜ISŒ•¢FHGO NL>ž˜>ANL>KNOz@OF!FH•œx.

NL•¢FHG>K@OPO*GIOi@LFU >KG>AIS.BL>K@G•œF¦vOIºG•¢F f T f T f W /f T ff W °u!"!#%$&! %'()(*.+-&.0/21!!+22Y#¤ :t L3•.

FšœS.

@Lš¢•œ>žGS.

F J¡F>KšœS.

F NL•¾¤ P¨ Oµ>KNL“œ>AOl¨O7 ‘KS.

FSi ¬O2•¾Oµ@lS.

UV•¢@Lšœ‘AOiGBlIOBlG>K‘A>KÁ$ONO6u 9¦•œFHGOµvOiIHG•¹NL•¢FšœIH•¢˜•1%FH• O‘Ax.

Bl@LF•D6•¢UVvL‘KS.

FNL•SJ H•¢GS.

Fœ¨¦SŸ´CBL•7OŸ¤ I•¢vLI•¢F•œ@GO³•¢U IH•œ‘’Oi£$¯SŸOiSŸvOFFONLSC<bvLI•¢F•œ@G•µ• QTBlGBLIHSzNO*vLIHS.

x.

IOiUO£œ¯SLu ©F U •œš$Oi@L>AFHUVS.

F®J¡iF>Aš¢S.

F •.S.

F šœS@Lšœ•¢>KGSFš¿yO$˜•œFNL•.vLI•¢F•œ@GOb1%FH• O*U SNL•œ‘AOx.¤ Œu .

•œU S.

IH>A•œ@GONO*O©S.

J H•¢GS*BLFO@lNLSz+.-0/€<i5¦.Pu-¾S.

FºGIOb1%FH•¦š¢S.

U S©UVS.

NL• BLUO .@GOIS*NL>’OxIOUVO.& 3(4 AˉŒV¹!#"$ÐY *t BlFO@LNlSROzUVSNL•¢‘’Ox.

vLIH•œF•¢@G¿Ob1F•*OF •¢G¿OivOF)NL•=Nl•œF•¢@˜.Œu .•¢U +=-0/€<i5¦.

S.

‘ž˜6>KUV•¢@GSRNL•=BLU§vLISx.

IOUVO rOz•œFHvq•¢šœ>K Lš$O£œ¯SL¨OŒO@L¡‘A>KF•.SI>A•¢@G¿ONOzOPS.

J H•¢GSL¨lS vLIS H•GSVNLSF>KFHG•œUVOl¨¬SvLIHS H•¢GSS.

IH>A•œ@GONLSVOVS.

J H•GSL¨qOV>KUVvl‘A•œU •œ@GO£$¯SR•:G•œFºG•i™­OVUVO@CBlG•œ@L£œ¯S• ORNlS6š¢BLUV•¢@G¿O£œ¯SVNl•:BlU FSQ\G%ª4OIH•u fzf T jT f fzf T ae f f jT 6W T f f 4e f 6e bf Wze T {u56'78$'90:&.=<">'?)!*+)&&@>A/B1!!+2DCE!0*F"HG6IJI .vLIH•œF•¢@G¿O0OLKpH .

 0b Z#"$%³ NMOM)u =BO>AFOFšœOIOšG•¢IMAFºG>Kš$OFVNL•BLU vLIHS.

x.

IOiUO2S.

I>K•œ@G¿ONlSŸO S.

J H•GSŸBLFO@LNLS &)(:(Pu 5)>AvpS.

FVvLONLI¶•œFRNL•0&)(*(P¨4G>KvqS.

FŒNlSµBLFHB¡IH>AS2•¹G>AvpS.

FRNO 35!/®u&4S.

U S2NL•œš¢‘’OIOIœ¨ NL•¢ L@L>AI •µBLFOIœ™zšœ‘’OiFF•¢Fœ¨©S.

J H•¢GSFœ¨*OiGI>AJlBlGS.

F•2U “¢GSNLS.

F¢uÏ&4S.

U S³>AU vL‘A•¢UV•¢@G¿OIO³yL•¢IO@L£œO FH>AU vL‘A•¢Fœ¨=O yL•œIO@L£$O UP¥L‘žG>Avl‘’Ol¨SVBlFSNlSVvpS.

‘A>KUVSIH FHUVSL¨6ORFS.

JLIH•œšœOIxO NL•*S.

vp•œIOiNLS.

I•¢Fœ¨pORšœS.

@˜.

•¢IF¯SNL•*G>KvqS.

F¢¨ S.

FG>KvqS.

FVx.

•œ@l“œI>KšœS.

FYTG•¢UVvl‘’OiG•œF¿tu .vLIH•œF•¢@G¿Ob1F•2O¼•œ@GIONO¼•FOMANOµNL•NONLSFšœS.

U OFš¢‘’OFHF•œF ¦>KS.

F !JOiF• *¨ ¦>KFHGI•$Oi U *¨ !S.

FHGI•$Oi U  •ŒOVšœ‘’OiFF• !FFHGI•œO U *u*&4SUVSVI•$Oi‘A>AÁœOI!S.

vp•œIOi£œ¶•œF=š¢S.

U OI´CBL>ž˜.

S.

vlI•œFH•œ@G¿O1%F•«BLUÏx.FNl•=NL>AFHšœSPBlFO@LNlSROF4š¢‘’OFHF•œF !QTFºGIH•$O U *¨ !SQTFºGI•œO U  • !>KQTFHGI•œO U *P u GQ#AR!TSCUA VXWFY .

IHBLvqSRNL•*š¢‘’OFHF•œF¦vONlI¶•œF!NL•z&)(:( •:´CBL•:@¯S F¯iSV•DLObG¿OU •œ@G•*š¢‘’OFHF•œF NO365!/u šœ‘AOFFH•NL•VFHGI>A@lx.

F«vLONLI¶•œF«NL•&)(*(ÏO !FHGI>K@Lx *¨»•O0šœ‘AOFFH•vOiIO¹GIOiGOI:@¥lUV•¢IS.

F šœS.

U vL‘A•D6S.

F !šœS.

vlI•œFH•œ@G¿O1%F•VO†3GO@LNOIºG©5€•œU vL‘’OiG•Œ/?>AJLIOIHw¼Y35!/»t¨­´CBL•R“PBLUVOJL>AJl‘A>ASb1 G•œšœOVNL•:S.+['8!0CU.U vL‘A•D :u 4T WDe  T e e O6uZR*.=<"\ VQW]Y W e.

JHT •GS.

F¦•œU &)(*(PuE.•œFš¢I•˜.

•1F•ŒS.

F¦šœS@Lšœ•¢>KGSF¦JL¡F>KšœS.

F¦NL•:šœS.

@G¿Oi>A@L•¢IF!•«>žG•¢IONLSI•œF¢u-V®Sšœ› ˜Oi>¬OvLI•¢@LNL•¢I4O*BLFOiI BlU ˜.

•œšGS.

I )G  vOIO=˜.

•¢GS.

I•¢Fœ¨6‘A>AFºG )G ±vOIO:‘K>AFºG¿OFNLBlvL‘’OU •œ@G•¦•¢@Lš$OiNL•$ONLOFœ¨ ´Bl•œBL• !G  ´CBL•I•¢vLI•¢F•œ@GO*BlUO) ‘’O6¨FHGOš¿– )G ³´CBL•I•¢vLI•¢F•¢@CGO=BLUVO.vL>K‘AyO:Yɚ¢S.

•œU BLUVO.BLUVO: ‘AO«š¢S.“.šœO‘Aš¢B61 ‘’ONLSIO .¤ t¨6BLU O !NL•œ´CBL•  ´CBL•.U S.

šœ‘AOFFH•œFvOiIO:GIOiGOU •œ@GS NL•*šœS.U NLBOF•DGIH•œU >ANONl•œF4•.

@ HBl@CGSVNl•:NLONLS.

F!šœSU š¿yO$˜.

•¢FŒY !FH•¢G *¨ !UPBL‘žG> ¦FH•¢G :¨ !UO v :¨ !UPBL‘KG> !UVO.

tu zl jT Xlu56'78$'90:&.•¢Fš¢I•¢˜•«š¢S.v .=<"_^"A'9@`acbed Y *fC"gEh*E.

@Lš¢•œ>KGS.

F)NL•KpH .

 P Œ ŒÈ6pÂÃÄi&j Êr\È?k.

vLI•¢F•œ@GO2BLU I•œFHBLU S2NLOFPQT•œIHIOU •œ@G¿OiFŒNL•†vLIS.u2e.

xIOUVO£$¯iSNLSµ8:9.+=</?>K@BD ¨®š¢S.

JLI>K@LNLS xC(*(Œ¨‚UVO–•i¨€OBlGSUO–i•¨‚OB6GSšœS.

@lQШ‚‘K>AJlGS6S.

‘#¨qNlS6š¢BLUV•¢@G¿O£œ¯S¾š¢S.

U NLS$Dwx.

•œ@ ¨»š¢S.

@GIS‘A•ŒNL•Œ˜.

•¢IFH¶6•¢F šœS.

U'&-© V 3†•*vLIHS.

x.

IOUOiFšœS.

q<vw( GxdyG6IJIzhPE.U SRNL> »¨LvObGš¿y­¨>K@LNL•œ@Gœu humln^Eo!*.A)p8(qhrGO*]pR([+Bs$&('0t"^f'88$%'0u.•¢Fš¢I•¢˜•1F•ŒO‘Kx..

BL@LF)š¢S.

@61 šœ•œ>žGS.

FRx.

•¢IO>KFŒNL•†vLISx.

IOUVO£œ¯S•œU &)<.

&)(*( šœS.

U S* W NL>KI•GI>KÁœ•¢FŒNL•†vLI“1%vLIHS6š¢•œFFONLS.

I¢¨4š¢‘’OFHF•œF NL•  OIUVOÁœ•¢@OU •œ@GS¦• UVSNL>K Lš$ONLSI•œF‚NL•Oš¢•œFFHSL¨QTBL@l£œ¶•œFœ¨ivqS@CG•œ>KIS.

F¢¨iIH•¢QT•œIH›œ@Lš¢>’OF¢¨.

vpS.•œFºGIHBlGBLIOFœ¨iBL@L>K¶6•¢Fœu e.@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

Ol° 3S.

JLI•*S ‘A>ž˜6IHS e)S ‘AS@Lx.

SŒNOROvLIH•œFH•œ@G¿O£œ¯SNlS.

FG•¢UOF¢¨F¯SR>K@Lšœ‘KBLMANLSF•D6•œU vL‘KS.

Fœu f O ‘ABL@lS Nl•¢˜.

•:‘A•¢I4GSNLS.

F!S.

FGÀ.

vL>KšœS.

F)• ˜•œIH>K šœOISzQTBL@lšœ>AS@OU •œ@GSPš¢S.

U S.

F4•Dl•¢UVvl‘AS.

F¢u³>KUVvpS.

IºG¿O@G•¦šœSUVvL>K‘’OI®S.

F4vLIS.

˜.xIOUVOF •.

•¢I>K Lš$OISPF•¢B QTBl@Lšœ>KS.

@OU •œ@GSlu     e   NN  .

  P  nR  `f .F!‘K>AFHGOx.

•¢@LF)NLS.

F)vLIHS.

x.

</?>A@CB6Dq¨+.@l>žDq¨p-0Oš :3 P¨l•œFHG¯S NL>AFHvqS.+.IOUOiF)vOIO 8*9.

@lMK˜.

•¢>AF)•¢U []C]^_`C`baCaCacHj‰s^]c#f6ÍoCmXc#Î6hL`ie6h6n6`C^¬go] k.

j !lhLgidCh"bs#lm$6gC`CjLko]Cd6niepoc].

hcd&%¬u •*vOIO E :3l< >A@LNlSª!F!•¢U []C]^_`C`baCaCacHj‰s^]c#f6ÍoCmXc#Î6hL`ie 6h6n6`C^¬go] k.

IH´CBL>K˜S.j !lhLgidCh"bs#lm$6gC`CjLko]Cd6niepoc'%¬k$^­u f W >We 5rOiJq•¢‘’O° .

F)QTS.

@G•u /‚>KFHGOx.

•œ@lF¦Nl•:š¢À6Nl>Ax.

S.

F /‚>KFHGOx.

•œ@lF¦Nl•:š¢À6Nl>Ax.

S.

IH´Bl>K˜.F e.

S ‘K>AFHGOx.

•¢@LFœu G¿OI¢u xÁ ‘K>AFHGOx.

@LNLIH“zE.BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI ¤ ‘’ObG¿OiQTS.•¢@LFœu Áœ>Kv e.

vpS.+=</?>K@BD ¨L+.IHUO 8:9.@L> D ¨-0Oš E *3q¨ >K@LNLS‰ª!F f e.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

O.

{ &4S.

UVSŒ‘K•œI)•¢FHG•:‘A>ž˜IS      N     .

  ¤rOiIO2QÉOišœ>A‘K>KGOIROµ‘K•œ>KGBLIO7NLS¼‘K>K˜ISl¨O‘Kx.

BL@LFRGMžGBL‘KS.

FŒG•œU BLU šœÀNL>Kx.

Sµ>K@lQTS.

IHUO@lNLS O2vLI>KS.

I>KNONL•†NLS U •œFHUVSlu†Ž®FºG•QTSIUVOiGSQTS.

> ONLSiG¿ONLS¾vqSI«vp•œIHUV>žG>AI=O0‘A•¢>KGBlIONLS0‘K>K˜IS¹vpS.

I«vlIS.

x.

IOUVONLS.

IH•œF*>A@L>Kšœ>AO@G•œF¢¨ >K@G•œIHUV•¢NL>’¡iI>ASF4•:O$˜Oi@L£$ONlS.

Fœu Tˆ‰… T YT¸%@L>Aš¢>’O@G•$t >A@l>Ašœ>AO@G•.@OPvLISx.

IOUVO£œ¯SP•œUÏ&)(:( 9  NL•¢˜•«‘K•œISFGMKGBL‘ASF©YÉ5)>žGBL‘KS ¨l5)>KGBl‘AS  tu =FGMžGBL‘KS.

F {:• «vpS6NL•¢U >A@Lš¢‘ABL>KII•QT•œI›¢@Lšœ>AOFO«šœS@Lšœ•¢>KGSF´CBL•.O>A@LNLO:@¯iS:QTS.

IOU OvLIH•œFH•œ@G¿ONlS.

F4•¦FÀPNl•¢˜.

•¢U F•œI ‘A>ANlS.

FvpS.

I)´CBL•œU G>K˜.

•¢I!•D6vq•¢I>K›œ@Lš¢>’OŒ•œU'&)(*( SB¹@CBLUVOŒF•¢x.

BL@LNO ‘A•¢>KGBlIOPNLSR‘A>ž˜ISLu Tˆ‰… T YT¸%@CG•œIHUV•¢NL>’¡IH>ASCt 36•©˜.

Sšœ› ¡Rš¢S.

@LyL•¢šœ•z&)(*( •*´CBL•œI¦F•:Ovp•œIºQT•œ>A£¢SOI¢¨L‘A•¢>’O«GOUPJp“œU S.

FGMKGBL‘AS.

˜.F4NL•*@LMK˜•œ‘€{6u Tˆ‰… T¼Y €˜iO@L£œONLSCt 36•.

Sšœ› ¡«vLIHS.

x.

IOiUO:OPO‘Kx.

´CBL•¢I)Ovp•œIºQT•œ>A£¢SOI F•¢BLF)šœS.BLU G•¢UVvpSz•¢U &)(*( •.

@lyL•œš¢>AU •œ@GS.

F¢¨l‘K•œ>’O*S.

F GMKGBL‘ASF)NL•«@lMK˜.

•¢‘ lu =F)GMKGBL‘ASF)NL•z@LMž˜.

•¢‘ OJpS.

šœSU S.INLOUÏOFHvq•¢š¢GSF.

F¦´BLO>AF!˜.

Sšœ›*˜iO>‚F•:NL•œvOiIOI NL•œvpS.

>AF)Nl• ¡ŒG•¢IQT•œ>žGS O‘AxBL@LF)vLIHS.

x.

IOiUOF¢u 5»OUPJp“œU QTS.

IOiU Oš¢I•¢Fšœ•¢@G¿ONOiF»NL>Kš$OF?x•œIOi>AFœ¨‰Nl>Aš$OiF­NL•®vq•¢IHQTS.

IHUOi@Lšœ•X•Nl>Aš$OiF­vOIO!•˜>KG¿OiI­JLBLx.

OiJO>žD6SLu „ .F¢¨BlG>K‘A>AÁœO@LNLSb1 FH•«SF)vONLIH¶6•¢F.

‡  )S ‘AS.

@lx.

SŒNLS.

F!š$OivLMKGBL‘AS.

O‘Kx.F4F¯SVOvLIH•œF•¢@G¿ONOiF.

BLUVOFNL>Kš$OF¢u .Š ¬ ‡~ .

Š :3l¯S³NL>Kš$OF†NL•2šœS.

U S±OBLU •œ@G¿OiI¹S³NL•¢F•¢UVvp•œ@LylS NL•2F•¢BLF¾vlIS.

x.

F¹NL>Kš$OF†NL• vq•¢IHQTS.IOUVOFœu .

È pR ¦ $b  Ç¿« ­ÈË© bËœÌ ‹ :&4BL>ANOiNLS.IHUO@lšœ•©F•¢I¯S I•¢BL@L>KNOF!@LS ® K\#qÈ 4A .

F vOIO:•¢˜>KGOI O«vLIH•œFH•œ@L£œOPNL•.JlBLx.

F4•¢U F•œBlF4vLIHS.

x.

F4NL>Kš$OF vOIO«•¢˜>žG¿OI®S.IOiUOF¢u .

FJLBLx.

F •œU FH•œBLF¦vLISx.

IOUVOF)•¢FHG¿¯iS FH•œ@LNlSI•¢BL@L>KNOF)@LS ® K\#qÈ 4A  !ÈbËu ¤»OIO´CBL•†S2O‘ABl@LSvqSFFO lDlOIŒSF š¢S.

@Lš¢•œ>KGS.

Fœ¨ OvlI•œFH•œ@G¿O1%F•¾OS‘KS.

@Lx.

SNLSG•DGS2vLIHSGÀG>AvpS.

FzNl•0&)(*(P¨ •D6•œU vL‘AS.

F!•*‘A>KFHGOx.

•œ@lFNL•*vLISx.

IOUVOF¢u 5 '70+ .

+  ^E.h0ÆP ® : Ë\ k6««% Œ\pÇ¿b p   Kl¿Ç¿P \ 3(4 Ç¿Ì  ?Š  T   ŽXD6•¢UVvL‘KS.

F)G•D6GBO>KF)vqSNL•œU F•œI¦OvlI•œFH•œ@G¿OiNLS.

F¦šœS.

U SRMKG•¢@LFœu  nbs^¬jgor_ ` lo n  nbs^pjCgoZe 6g o 6g ^6hLgdCh bs#Lo mCg‰s^¬j.

n.

]g o  o 6g ^n   g6o lnZ^6hgidCh bs lorc .

^Lne"lo k.

jfpob]h bs ln]ln.

hs­k$e"   m .

h lm]Ln.

h o]qkm  j6k‰e6d.

f".

dlnbs n o‰f# ok‰e]  n c Lo n  nbs^¬jCg6o o 6g ^6h6nlone] Lg6o nbs Íge]ln ͬk  ®c `  nbs^¬jgX_ k‰e] "!$#&% ¢ˆ É~ *&4•¢IšœO NL•R° R‘K>AFºG¿Ox.

•¢@LF)NL•*vLIHS.

x.

IOiUOF4šœS.

U vL‘A•GS.

F¢¨L@OŒFBLO UVO>ASI>’O*QTS.

IOiU G•¢FHG¿OiNLS.

Fœu &ONOVvlIS.

x.

IOUVOR“:NLSšœBLU •œ@GONLSL¨¬OFHF>KU¾¨SVO‘ABl@LS ˜iO>?•¢@G•œ@lNL•œI=S ´CBL•:š$ONO ‘A>K@LyOŒ•œFºG¿O QÉOiÁœ•œ@lNLSLu ®• O¹OJO> DlSBlU •D6•œU vL‘AS†NL•R‘K>AFHG>A@Lxl¨­@L•œFºG¿O†‘A>KFHG¿Oix.

•œU OvLIH•œF•¢@G¿Ob1F•BlU vLISx.

IOUVOQTBL@Lš¢>AS.

@LO‘¨­S GIOiNL>Aš¢>AS.

@Oi‘¬”Ðyl•œ‘A‘KS µS.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.vpS.@LNLIH“zE.I‘KN6—¿u p <o f f "O p <o T p <o e T T O f uGa[ e ?  jC [ Jt f <O e e C o ]\ v Ga\ G ]A \ V T Oyk e.

FºG>A‘AOPNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

O>O ŽrD6vp•œI>K›œ@Lš¢>’ORNLS OBlGS.

I [ U&W Z N ^ V N V Z N Q Q6[ W N U V\W   "!$#  ^ N W ^   .

            (' % ) >W /‚>KFHG>A@Lx° ®ŽrD6•œU vL‘KS Nl•:BlU ‘A>KFHG>K@LxLu &%  Š~qˆ‰Š~ .

‡D\ "OQh 36•œ@G•¢@L£$OiF4F¯iSzI•¢x.

IOiFœ¨C•D6•œU vL‘KS.

F®•¦Nl•¢ @L>K£œ¶•œF šœBLIºG¿OF •!NL>AIH•¢GOFœu ®Sšœ›)˜iO>•¢@LšœS.

@GIOI šœ•¢Iš$O*NL• | F•œ@G•œ@L£œOFœu  36•©˜.

Sšœ›:•œ@Lš¢S.

@GIOiI!G•œIHUVS.

F)Nl•œFš¢S.

@LyL•¢šœ>KNLS.

F¦NL›*BLUOŒS.

‘KyONOP@lSVx.

‘KS.

FF¡I>KSLu  e V  !T 36•œ@G•¢@L£$O NL•*@LMK˜•œ‘€{PFÀ NL•˜.

•:F•œI!‘K>ANOPFH•*˜S6š¢› ¡Œš¢S.

@LyL•¢šœ•z&)(:( •*´Bl•œI¦F•:Ovp•œIHQT•¢>A£¢SOIœu  &O  36•œ@G•¢@L£$O NL•*@LMK˜•œ‘ ŒFÀ NL•˜.

•:F•œI!‘K>ANOPvpS.

I)•D6vp•œIºGFœu »W >Ax.

BLIO°ŒUVSFHGIOBLU Nl>’Ox.

IOUVOS.

@LNL•P˜S6š¢›RvqSNL•P>KNL•œ@G>ž š$OiI*OUV•¢‘AyLS.

I.F•œ´.

L•¢@Lšœ>AO¹Nl•Œ‘A•œ>žGBLIONL•¢FHG• ‘K>K˜ISlu ¸%@GISNLBL£$¯iSVx.

FFHS6š¢>’O£œ¯SC< .x.•¢IO‘ &4‘’OFHF•¢F ¦•œIOi@L£$O .

I•¢xO£$¯iS W•œIIOU •œ@G¿OF 5»•¢UVvL‘AOiG•¢F¿<.

8*OJOiI>KGS.

F ½4>AJl‘A>ASiG•œšœOF Ž@GIONO<bFOMKNO 365!/ &4S@CGIS.

‘K•*ŽIISF¿<E.•¢JLBLx ¤»S.

>ž˜.IºG¿OJL>K‘A>KNONL• E.

•œIHFS.

F e l He Wr>K‘AS.

FHS ¬OzNl•z¤ °.

¨²{ l¨ l¨ l¨ O gX O gX O gX X ff ¤ fzf BLFO@lNLS&)(*( 6¨ l¨ 6¨ l¨ž°‰|l¨ž°.

°.

¨ž°{6¨ž° L¨ž° l¨²{6° ° 6¨ž° l¨ž° {| ° l¨ž° l¨ W { { ‰1º{ b1Ð{ { L¨²{ { 1 L° {.

{6¨ ¸ ¦1 «¨ /®¨²- h Rk iP iS U `X U h k P O S yO >h yk >P HX >h yU X e l - yW ¤IHS.

x.

IOiUO£œ¯SR/?>A@CB6D {6¨ 6¨ X RXQh RX>k XQOl¨gX>XL¨ih|l¨ih6°.

¨ih.

{6¨+* *6¨gXQS X46P ¨gXQS X>U hHO -  Wr>Kx.

BLIO° ®¤»S.

I!S.

@LNl•:š¢S.

U •œ£$OiI u .-0/ N 21 43e     P65 e)SR‘AS..

@lx.

SRNLS.

F)¥L‘žG>AU S.

F)Oi@LS.

FGIOJO‘KyL•œ> @LSVNl•œF•¢@˜.

S.

‘ž˜6>KUV•¢@GS NLS.

F!vLISx.

IOUVOF W  GaC2… To ‡lˆ =¤IHS.

x.

IOiUO NL•zFH>AUPBL‘AO£$¯iSVNL•:GIO@LFHQT•¢I›¢@Lšœ>AONL•PšœO‘AS.

+.I!•«BLUV>KNONL•:•œU'G•¢‘AyOiFœu.U'vLISx.

IOUVO vOIOE * f 3q¨ š¢S.

U Ošœ•¢FFS¹ORG•œ‘AOl¨p>AU vLI•¢FFSIOl¨qFOMKNOV•¢U NL>KFš¢S•zFOMANO x.

I¡b š$Oluf vLIS.

xIOUVOV•¢FHG¿O NL>AFHvqS.

BLOIHG•«½BL•œ@LSŒ1®ª)ª)ª*u ‘AU vlG$u BlQTFšiu JlI e.@l>AJL>K‘A>AÁœONLS«•œU aCaCa4cj‰s^]4cf6ÍoCmrcÎ6hL` ie Ch6n6`^lhgidChis#loC`6okœs6fpj ie #777 cºn  nu e.@LNLIH“zE.vpS.

FHG>A‘AOzNL•:¤IS.

x.

IOUVO£$¯SŒ•¢U'&)(*( .

OHX ŽXD6vp•œIH>A›œ@lšœ>’OŒNLSVOBlGS.

I DGaC }~‚‡  ©¤IS.

x.

IOUVO•œNLBLšœOšœ>KS.

@O‘4NL•¹O@¡‘K>AF•NL•†>AUVOx.

•œ@lFPNL•†UV•¢>AS.

FzvqS.

IHS.

FSFœ¨ •œFš¢I>žGS7BLFOi@LNLSµO7Jl>ž1 JL‘A>KSG•¢š$O f / Y = f JHT •¢š¢G TO@L•œ‘AOFœ¨®MKšœS.

@L•¢FR••¢GšiuFf >K@LNLS‰ª!F*/?>AJLIOIHw¨ NO†½4S.

IH‘’O@lN¬tu*+¦U vLIHS.

x.

IOiUOvLOIO >K@LNLS‰ª!Fœ¨?š¢S.

U Lv IHS.

x.

IOUO@L¯SQTS.

>4 @Oi‘A>AÁœONLSL¨BlUO0˜•œIF¯SµO‘KQÉO•¢FHG¿ONL>KFvpS.

@LMž˜.

•œ‘)•¢U aaCa4cHj‰s6^]4c#f6ͬoCmrc#Î6h` ieh6n6`^LhLgidCh"bs#lo`.

e"¬kœs^c %¬k$^qu : C *‡ A¬ *¤IS.

xIOUVOvLISi FFH>AS.

@Oi‘NL• O@¡‘K>AF•Nl• >KUOix.

•œ@LF?Nl•U •œ>KS.

F­vpS.

IS.

FHS.

FœurE.•œFH•œ@˜.

vq•¢‘’O)•œU vLIH•œFO Ž3l3L3Y\[]C]^_`C`baCaCacÐnloCoCoXcmg‰st®š¢S.S‘K˜>ANLS.

š¢S.U S.

NlS=Ž@LxLuX-0OIš¢S.UOi@LNLS.

Fr&OJLIOi‘lE=OiUV>AO@L>u‚E.•œF•¢@˜.

S.

‘ž˜6> S.

F)FBLJ1%F>KFHG•œUVOF!NL•©NL•¢G•œIHUV>K@O£$¯iSŒNOŒvq•¢IU •$OJL>K‘A>KNONL•¦vq•¢‘ASŒU “¢GS6NLSŒNlS xIOiQTSŒNL•*š¢S.

@L•Dl¯SRFH•œI>AO‘ •:Nl•:Nl•¢G•¢IU >A@Oi£$¯SŒNOiF¦š¢S.

Nl•:•¢´CBL>A‘KMAJLIH>ASLu -0O>ASI•œF‚>K@lQTS.@l xBLIO£¢¶6•¢F.

IUVO£¢¶6•¢F?FS.

JLIH•4S¦¸%UOix.

S!@LS.

F€F>KG•œF?[]]^_H`C`iaCaCa4cÐnLoCoCorcmCg‰s)c#Î6h`6kœs dLgC`lk‰e 6n  c#[]sqj6u ‹  *+.UVO¹JL>KJL‘A>KSG•¢š$ONL• FBLJ1%F>KFHG•œUVOF«´CBL•VšœS.

JlI•VO0¡IH•$O¾Nl•O@L¡‘A>KF•RNL• >AUVOx.

•œ@lFY\ ‘KGIS.

F¢¨ š$OIOš¢G•œI>KÁ$O£œ¯SL¨LIH•œš¢S.

@LFHGIBL£œ¯S•©FH>AUPBl‘’O£œ¯SŒNL•*vLISšœ•¢FFHS.

F.•¢U U •œ>ASF)vqS.

IHS.

FSF)I•œš¢S.

@LFºGIBlMANLS.

Ftu v : v n ?qp P  e     5   .

.

.

  .

.

 !   #"$.

%&(') .

0/  12 435.+-&.*".

6*127 /8')& 4"9 : .<.

.-/  =>?.@  ..-B<.#A)&.&.

C')%.-+<.

#D? /<D?.

 +<.

./ :HG 1#IJ.FE.

K L..

<..

CEF.

 .<.

0/<I-..

.%& %- +/@MN.K O?"$.

%-&*DP &Q.

%R/K>O6C8>O.K S .EF.

T-UN&WV ..7 . .

YX%.- /-X.

. :  .

.Z .\[N.

Q.

.]/ ^ %_>g 6`P.

.

6C& %- 6ah6C3i Q.

_.KjR +-Y.-c.6b.

/&3i%%.6ck_.

_UN! &Q.

6b..

L%+d.K6b 1-.*#l8 .

-6aI-<.

.

.@ .

 #/2Em .

KV   ?&W'hVe..

6C1 .K.

 &5C[N.

6C7 Q_.

.&0WVJf  f >g P 6C<.

.-+. g>?& 6b.

"n .0/<>O.<.

V.&.7 G bIJ.

-/ : .

1.

b&127   &..o/35%-d>g &W!bpPrq &_Xs-. /<"$.

%&b').

 : .

R/t  = *MO&Q..

.]/JtPe  #Ie%6b.

/2'h.

kf >g .&l.- ^ %_"8bU7 ..

&ru>O.O>g. =v .&%.

6C/i'h.

 & Ol8%<.

 w"$.

&.+x/R[O wIJ.V.

-/BYk.&8IeL+<.

%y y@8 UN&..V .

-/Kp?. %P').

T-P_.

 <.

 x/@X .

bIJ1B../e3i%..zEm.\Y%7 L. .

{V zA) k.x/eI-..

%&_%- +-/ te. #p?|B6b^.

]/<t 127 #Ah...

.

 f >~} : I'O/}?.<.WV .kk $X%-.

 : - .

&izI-.

.K L.

b'h.

 L.

..

-Y .V  ?YDO}O€3i.-/- .KV  &WVen6C%-P % f >g .@%Jz.KV &.

=..

*b ‚ „ƒ).

+- z  1._3i.Vef >g P6b%P 1 .+<..

/>O&.

..

-/B>?. ={.

-/>g K.

.&-/<>O&.

-/"$.

… ..

&Q.-/<>O.

J/<†„ .

…q 12&0/>O..

b"9.

%&Q.

J/_.

&x/JA).1.

-/EF.

-J&Q..

*zY%- L.

{V/ ^ %z   .K L.

6‡#!%- %f ˆ  J   5‰ f  5 >g 6C%<.

./<AT..

Y[O%.CA)%-.CY>O&.

 zAT%.-f >Š B .

#Y‹&+<.

g6b.

.g6c.

.

{VJ.&+ .

 ^ %-z%6a+ 6C6a2e Q.

 / :$G .6c.

-/-Xs&.Q.

*zIJ‹.

 =[O%.Jf >?.

 zAT%.q.ƒgƒgƒYfŒ&6C- {fŒ%-!f1- >O2 7 &.

*_"8  .

6b.

Z{Ž6'gY .

  .

                 !#" .

.

                 .

- h{.       M.eTV G .

%&?<.d.

.

/N.@ /@hO!%J % <.

O    .

6c.

ZŽf5>   %./K.

…  .

{V=H<.

.

.\h%6 & V. G &.

-+g $ .6b 5V  ^ %)V e G  .  H1 G   $)  ..

6b.

@ .Z{Ž?  .

<.

.

D?_‹<.z 1  f.<.

&2*.

.dW %&.

K L.- .

q„.

.<.

K ?.6C.

)r L.

.

)1 G .

).

 .

Ve6C._* .KV &.K  -z%6   .

6b.

*%.

C  ..

6b.

K L.ZŽ ..

<.

#.

+.-.)/-#& M\.#1   f  !"$#&%'%'(*)%".

6C ].Q..

B .Ve h .&.

&Q.

VeQ. .-g%6 2 %P-\ 6Cg..KV &.

%6    .

6c.

T\.

5 . .

i 6 .

 ^ %<.

?    .

6c.

- ?-.

V.

c&.<.

KV &./R-rV rq #6b *.V %-6`  .WV -f[O2 ./* %4%.

6b.

<.*‹<.

&.K NVe &%6*1- .6b.

…q  ^ %z Y2.

6b .C-C!%- %-f 021302140 576289862:.. O> ).

.%<.\&.

 .)?  .

6b.

ZŽ .

6 1<.

7 L.

.K Os7 .

h? 1.K.

{V.

6 *  .

6b.

).

 .+z6 rJ  .

Y.

 .

{.r d7 .

N-+.

-ƒ).

  ^ % .

V.

w% .

f}P6    ..

6c.

   .

.

 .

O%-6  ^ %<.

6b.@ N BdW‹<T .

?re  6b.

6b.K ) 6C& -?h.@V &.Vf\U9  .

6b.

n.

 %. P6‡&..KV  &WVJ.6 -.

 .-hY  .

6b.

ZŽY1<.

 -.V &i 6C#C.-d.

f ') 6 <. 6*1&.

  .

O N.

KV  &WV  . /R ..

 V.6q„ .

N&.. %<.

P*   ..

6c.

Z{Ž/ ^ %.

Jq %&Q.6‡7Ve.

.\-  .

6b.

.z+.

-ƒ).

 f.l8.K r L.

. ^ %<.K /J.

@V &.K z..Ve.6b.@ *P+<.

 -ƒh.

PP<.

{V.

.

#<.

  &.

KV &.Ve6C. /#.K bY ‚ „ƒh.

P7 L.

{V.

b.

…  .

 .

C.

C <>=#.

- f 0213021@? 5BADCE8CEFHG9C O> &...%<.

N#    . .

6c.

ZŽ6b.

O6be .<.

N2 6bW 6 ^ %#%6 -  .

6b.

cI.

 6b-&Q.

c  J.

K ?-&Q.! .#6`-.

 .

! 6b.

.f Em6Cc6‡c%- . %.@ b-z&.6b.

 .-P-z   .

6c.

Z{Ž#6b :    .

]/B'O/2"$..

{.

&x/2.

O ^ %2 -C-  .

6b.

V.Z{Žc6C * .

6b. 6C- 1&.6 .

N<.

 .

K  %Y    .   .Ve6C.KV &.

6c.

f J .-z 6C ^ %-P.

 $-k Y<.

 .

N-.6b.KV  &WVJ. V Y  .K Yg%6 .

6b.

-/ %.

 V. .

C2 %# e / G  .KV  &WVe f !LK .. 6%.

!   .

&)-/.0-/12.    "!#$!" %'&)(+*.

Ve.@V &.@ b.(43 5768&:9.6b.6)9<&)-/=>- )'  6`#.

g =..

Y  .

6b.

ZŽ7 %J %.

<.

-/<   1&.6b.

6b..e%- .h.

6mf DO.

C  .

6b.

ZŽ# %- % .

<.

c.

P!%.Z7?J? .

1<.

&.+<.

6`  1 z ?<.

/6c.

<Žb 6‡%6b.?.

K.b&.

K 6b..ZŽ d.

 6`&.f U .-! ^ %_<.

#  .

6b.

ZŽ7 %J %.

<.

b=YC6C&6b.K L.

 h_  .ZŽ_6 e%&.

6b.

 Y6C e &. ^ %_ Ž -.KV  &WVJ.  .

 6CA @o12  ƒhq„% B* C% @  eq„ ƒ . B fz"9.

 .

%-6c.

Z{Žw6b&.c-. .

c<.

 =..

Y  .

6b.

Z{Ž %- % .

<.

z.C . %&.

QE. !4 .

D Em.

. .

mEm{')&% </ FHGG !)I f %'&)(+*.0-/12..&)-/.

(4(+&KJL3 M.6H-/=<-0-N(+OQPR3S6H( "$.

 .

 .K .

?  &%-.<.

gC 1-&6b.

C1<.

WJC.

. V.

K C_e -/-  6C %w2.6C.

#=Q.

.

"8    .

6c.

K L..ZŽUN.

.

.

Žw=. V.mUN1 r 0T0"\UYUVUrf]> "\UYU .

J/i%<.

! 6%&Q.

ZŽ<.

… L.

WFHGX>=-/  .V.- r! .

6C.K b%- .&k.

<.

.

F<.

7 .z.

 YG =-f4pP  6 ..

-/$ J<.

*.

z  .

.-*6b-.

.-!  6 G . .

VeC %P‚ „ƒ).KV &.z 6` .

:ZP%.

.b.

  .

6b.

.K L.Z{Ž .

.

C.

 1   -f >Š    .

6c.

ZŽ  .K .

<.

#.

K <. 1   b=YW! .

#    .

6c.

ZŽ7  %- %.

<.

-f DO.

w    .

6c.

.ZŽw .K L.

<.

m.

7Z ?JC<. 1  r /5!%.

 _7 LŽ*  %.K  /9!  6c.

.wm1   fwl8 L.

.

1B  <.

 6  Q.

g%6b.

g. V.

h!  6c.

g\.

..

&. .

/   r L.

KV &.i\.V$-  .

6b.

fn[O.%6b.

h! 6b.

g6c.

 ..

1  .

 .

= {.N .

J/ ^ %N2 6bW O%-6 6b.

\ {.

L.- V .

@ * ) e )? .6b.

&. ..

z.

6b.

ZŽf UN1 V ^ %-#.@%- ..

6be&.

 6b>   .

6b.

@ .ZŽc  .

<.

.

1   .<Ž =*  6b.K *%6b.

. V.

c! 6b.

-_-  .

6b.

h=Y%6b.

- V.#.

! 6b.

.*Y2.

%6`  1&6c.

J/-!  6c.

.

1- .

 L.

J/<%- .&k.

 ..W   -b6*%-.#.

&iY.-W   6b-%- L.<Ž# .

. .

f DO.

(    .

6c.

K .ZŽ4  .

<.

(.

W ( 1    -V F. 1      .

6b<.

+<..

6b.KV  &WVJ.K c-C ‚ „ƒ).* J  &( -.

f > "\UYU L.

&.%dB%-6c.6*12=6 ..

.- V.

 L.*.

 O2S T<.ZŽ*N -.

 N#.

..

&. L.

€  .

6b.

K # .H .-+rq 6C.

C. L.

ZŽC T .

  .

6c.

#..  1 G .[ Urf \ ') . _"\UYU Žb-%- d. g.

d. %& <ef 1   b%- .

-c..

6C e &.  .

}NEm3 =Y W L.

.C{.

-d. %-& ! f \ > 6Ce&.

K . 6   .

<.

#.

@V &.&#Y.@ b-_%-6`‚ „ƒ).6b.   ]f \ J e#.Ve.

 _=_.

- .K L.

c6` .

#{.&+-.

ab b )A .-d.1&. %-&^ 0213021`_ G A. {.

#4 1   6 G .

 B.

&.k{.

<.

/g%-<.

-  .

6C.+.K   .

<.

/O7 L.

Ž .-d.2q .V *.

 .

F.

*%-B 7  .

-  .

6b.

  6C.- *‹< {.

 f UN*-  .

6b.

  6C .K L.

 Ž  % -  .

6b.

C..g%..

11-& .

h J  .<.

O 6‡.

g1    ^ %Y%]/< %wI. %.&.

-/BeŽ#6b.@ .

  %<.

?.

&.{.

RZ ?eh.

.

K .@ .6b.

C6`6 e%&.. h = .

1.{.

- f UŠ%% G ‹<..

&RV  G e ggd.g .

&Q..

)<.

* &.

* 6C 1 r  g_.

 e.

 G .

 %<.

#.

&.  .

Z{Ž .

#6b.

-%&Q..

ZŽ- ? 1     6`.

%<.

   .

..{.@ d..

f l$J6C&/e%6 d.6b   .O.

K ..

 G .

6C    .

z% 7 6b.

 6b-%- L.

. .

&NB7q 6C.  G .

_ -%ZŽ-?%6b.

Y6C Ž/@.

Z{Žz_ L._ &.

6b.

.+-_.

<._ G  .

J/K.K  ? %J  .

\B .

7Z ?JT 6  z 1   -f >O- .K L.

q„C.

  %.  {.%6  J6C& 1   -6%.

&H* .

krq„ %6b.

.

G &.. *#.

 %6b.&.

 -_ %<.

P{.

.

  d .

 =[O%.f >?.

 zAT%.ƒgƒgƒYfŒ&6C- {fŒ%-!f1- >O2 7 &.q.

*_"8  .

6b.

Z{Ž6'gY .

 "     % )  >   .

6b.

Z{Ž   .@ .

<.

.

 1 r  m= 1<.

 {.

<.

6 %6b.

Fm .  =.-W  bL+<.

*'h.{V / %-F Ž -W  T.

d. %&<Jf$M\.

6b 8 .

k\%6b.

z.

.gP%6  1 r z{. G &.

&2V W‹<{.

 ^ %N.

Y  ^  .

6c.

ZŽ .K L.

<.

#.

# 1 r #=Y1<.

.

<.

+6b f 021 ? 140 ADC .. t ._%4&   .#6` .   ^ %  G  .b-%&.c 6C*.

.

..

‹ %- %*6C 6bb=%6  1  r  {.. G q &fhM.&.

&0/ %^ Y&.+N G .

&. %6b.

-! 6b..).

Z7?J)6b+ .

-/J<.

 L.

J/Q.

z<.

6b.

<.^ .

J/J^ 6`  . 6C /-.

&Q.

6C e7 L.

. .-!  6c.

Z7?J. Žz.

  1%J   ^ %OŽ6b.

%&...

z &   -/  %c   . H2&.

-/ 9>.6H(. (+OQP7368( 6H3 . -6H&KJ O9.5 f U  &  F .

%6C.6*12=6 6 12 ?J/) 6C %-6 1B LŽ(w&.<.

ZŽ/8%6 1B Ž(<.

.

 .<..( &.

# .

… .1%-  .

(CVe7 /\%6 12 LŽ .

 .

.

 .

C.

+ .

-f "9e6C #k ^ %F .

 .<.

@ (7  12 ?J2 .6b.w.

 .

 .<.

@ Fc%6c.6b.

  6b.<..

<.

=>(.w!%.5 >O&. 9>M>1 Q3 5 .Z{Ž4 &  f3i  / 9. (+O PR3S6H( 683 .=6 )12 [?e/- &   Y L. 68(.

6*1B=6 6 %-6c.

_{.

 .

<._re .

*?%6b.

 .z%&.

J/J %bI .

-/-%6  1     &   =!  6c.

9.4-/=<( =<3 (. (+O PR3S6H( (.6H&)( 5^(+OQP7368( 5 f : .=<3 5R3& (+&K.Y %-  g 1   f .

&Q.

6b T_%6`&  6CJ.-/ 6.

&Q.

 6bhz .-S 6br    Em.

#.?%-6`&   .

K .-! oq 6b. # C ..

{V.

_.

+ .

%dWq g<. e[O%6 &   .N1B&rV  &.

 .

&   . Hg-%& /K<.

.

Y &   H<.

 /e.

 .

 &    6 .

&Q.

S 6C   Yc. 6b/5 6 .

6 2 YQ..

K /5 %   ..

=>3 3 .<Ž F=c%-6 6 G ^ % .<3 &)-/M>1E . 9. . &  #% . 3 <J 576)JL& J`M. -/ & fD / . & &  = m+ -/ 6 F%6 &  w... 6 ZŽ _%6 &  Ž / 6 + -/ #+ -f\D r 6 & /%6 1  C+ 6 6 . (+OQP7368( (.(+&K=<( (.J/ 9>. ..6H3&K-.6 ZŽ w ..% 6 1  &  -f % (.=<3 ..( `9>J & =<3 .4..

1 Q3 543 M 6H&)3 ( 5 (+O PR3S6H(. (+OQPR3S6H( (.=>3W9>5R-.1% %6 & / + -/ % % & / %  -/ 9.5 }?6 .

L-/58573 W9.4.6H&)( 5 (+O PR3S6H(.3 & 9>3W9>.5 f M  6*12=6 1 ^ %  N%6 G 1 & /e.5'=<3 (.4(.4.9. G 1 Ž .&Y-6H&KJ O9.5 . % &  f -/. 6 Z7? .6H(..

^ .O>&KJ . 6 . 6 ZR? 6 #6 . . 1  -f .=>3 (+OQP7368( 5 =?.

6 .+ ^ Y= ^ PFIBXO$>‘JH>‘L z :>[EFWL 6Q L•JHDhOPD 4JHL_J4L % ) 6 .k 6 6 . -fg' 6 ^ WV cs-. q . Z{Ž . . 4Q FWD_FWL m5 VFWL H?I>3>GB 4[ED'F > ND Z UD   %'E # (   % # -7  # %'(!)/7   >bB 6QIL$M'FI> . ‹<. ZŽ .6 / ^ FID'M@F > Z . . ZŽ #6b= 'D'x 'L$F “”> 'D@x 'LPFoD?WL z 6 @D z ˆ >@?K[ED'F G>@?J4L JHL$?WL z YD WLPQ D 8 . 0 21 3% $# 4# 1 :9 . 6C= B HO$x > '& € ƒ‚ > ?WL 'M'BND L$?RQ L_O`>@?WD >@FI>G>YO$L$FRQS>@Fd> l? > jQIF > W~ Z KJHDCFIL >@F >_>@O$LPFWQS>YFD H?WQIF HBNFpD_FIL ?WL_L HO$D  $B :> 6i j[ED'B D^O kQ > ?WLoO$D HFIB D^JHLA>-Q F >Y? >@F Z HD'FI>UOPL$FWQ > 65 =.k LFIL$>@xXB `> jz 6b= ^ Z{Ž 6 6 6 Z rq G V / . . . ZHz jz L > QS>YJHD'FkL•OPD 'LPBX? a>•[ D'F ^z _D @DL z jz @D’JHL z > UL `>h>GJHL :>@x GL 6Q L L_LPxXL|O$D HL$OPLAL ˜ ™mšW›vœnKž-Ÿ KšWžP¡¢šRž-£¤šRž-£/ž-¥‡£¤¥K£¤šƒœn¦ ¡v/£/$›]œ ¥S¡¢šRœ §S¡¢¨©RP›Wª «‡/©R¬ƒ£/šR«Pšƒ­®šW¯]šW›°¡vš±š ²/šRœn³¤­-´]µC¶P·-š¨®œn³@‡¯v¡¢¥K¦ƒ©R‡ž-©RšR¨®¡v ¥ ¸@‡¯u£¤¥‡£/Y´ >?.KV . T LCFWL`>@xNB $L>‘B 6Q LPM'F > B 'D cFIL HB :> HFWBXO`>_L$?WQ @Db>@?nB 4[ED'F > C%ut . PV I 6 .ƒgƒgƒYf 6 {f f1 >@FWQIL z L HD ¹x Z Q z [E?IO 4F > Z D'?WQIBXxX>AJHL  6 Z{Ž 6'gY FID'M'FI> G> @D•L . q.-Z{Ž YDJ $FWBXO$>bJH>b[ ‹" ^Œ FILPO$BX?I>  h€‡† Z{Ž HLP?WQ >?WL z 87 )1 s967 GD 'M'BXD UL gB 6Q LPF >@M'B hO$D >-Q FIB G?WL I> HFWBXO`>JHLmFIL br ^L$?nJHL|OPD WLPQ D @.KV WV 6 ..9 )>@?A>CB L$FR[EL$B\QS> Z OPD c> FWL +< ED'F G> ]L NL @D Z 'M'BXD OPL$FRQS> H? >YJ:> Z 8L 'M'BND HD@F >COPL$FRQS> HDGJHDFWL L$?RQ LL eL TO$D 'M'BXD fD {>@?B 4[ED'F > @M'BXD G>_[ 6D HD …„ FIL$?WL 6QS> ‰?IL Z 021 _'140 @D UD 'M@BXD'? 4L$?WQ >A[ h* 6QS>@F}DGD …q 8D'xX> Z ‰?WLCJ4L$?IL FID'M@F > 4! @DbJHL 1  f >@FI> Z 'xXBNO`>^Š ”O G>@JHD'FdJHLP?ID'FWM6>  zsZ FID'M'FI> L|DGO eJ4BXM'D G> z 6 "R FID'M@F > G> HB `>@JHDB UL$JHBX>YQS> }FWBy> z –>@F jz >@FI>UFWL`>@xNB $>@F >bB 6Q LPM'F > Z ^z @D Z Z >@JHF YD gDGD 'M@BXD WLPQ D > 4D'F > eLP? >@F > Z :>_OPxy>@?W?IL Yw _ 'D'x ^B UL 6Q DJHL UL 6QIL_?WL 6QS> HBXOPDGD LPxXD 'M'BND FIL v9 z 6 jz @D ‡Q D^JHDbJHL HL—>@? eB Z ?ID G>k?IB Z L Y>@FWB Z xXL$? .ZŽ _<‹ . . =[ HJHF z zA .6 . . k . .KV WV G 1 u b 1]f m U 6 . % !G   K$    %      !" $# % '& )( +* -.V 6 >@F . A 62F 62:. . dŽ Z > 4QID+JHL …€ 6 ^ k f Bf B f ./. : CE89. aDGJHD HD'FI> HLmL 4BN?WQIL Tq .

 WV f 6 .= ]  ' 6 .ZŽ f F / L<e/.@V . G . w6C= GV 6 k . ‹" ^Œ …> HLG>@B 4J:>3? >—JHL|B jQIL$M'FI> HD 'D uUr/ L< T RF / <J/ ! / 6 . C G9. 6 V G V T C. . " ZŽ Urf U 6 V . 6 6*1 6 .<Ž .Ž w6  r‹<. A 3CEF G 62: 6 6 . . / [ 6 6   G . Z{Ž g.. .fWf.. .f °DC>J:>L ƒ? HD 8 . V / J4D > GB :> o? EL$xNL @D B 6Q L$M@F > UL$?|J:>@? ? > z Y>@FWB Ž FT V SUrfC[ r‹<.V 6 6 A 6m/ 6 Z Y. G 6a. . SU fcU _.Ž 61 'LPBX?|? @DC> >Y?mJHL$B H>hJHL HBNJ:> @D FID'M'FI> Z kL HD G> D'BN?oJHL Z >YM'D'F >•JHLP?IL }L [ HOPBXD z z z UL `>—Q JHDUJHL z HD z HFI> D'BX? Z UL|O$D >YBX?kJ4D YD @DbxXL  4" UD HF >•D L|?IBXM jz Y>@FWB FID@M'F > QIF >—[ z > jz |L>@F G> Z G>•D z ƒ? FWD'M Z UL—JHD >@F > Z ƒ?    K$ Z{Ž U / ! T m1+U / :] T 8Ur/ ^ ]4T!V _..

F . .‹ Y>@xND'FmJHL kL @DhxNL FWD'M'F > Z ED :>YF HLPxXLmJ:>@F P?mL$xNL @D'x @L$F HOPD 021 _'1@? J @>YB   Q     . 6 6 ^ .

$   ! 0  ^.

6 .. Z{Ž .V 6 . 6b= 6b= 6 ^ Z{Ž ^ ^ . . W‹ 1 .  . G . 1 6 (= 6 . G z.KV WV 6 .= -f <efg> / Z 6 / 6 . 6b= 1 ^  6 6 .Z{Ž 1  1 6 u TQ.Z{Ž .V /<6 6 6 d 6 6 6fH> . = .$  @D > 'LPBX? …> ?I>@J:>@? z $L :>@F G>L•D ED HD EDCO PQ D^JHDJHL 4DUJ4BXFIL‡Q 'FWBXD•JHB 'LPFI?ID@? 4JHL•DhM >@FWJHD z L z FWL$OPBX? > Z @D z HB :O$>b> :> dŽ .6 f Ff 6 V W‹ 6 k ^ ^ -f U ^ ^ = . f > . .V 6 1 6 *s.V 7q d. f > + 6 WV . 6b= ^ 6 k WV 1 6 Jf$> ^ ZR? 6 \6 . .

. Z{Ž ?I 6 .6 †„. V JBfY> 6/ . / 6 I /]. W‹ 6 1  .‹ $6 .]/ = fg† .+ J = / I 6 . 6 .= ..1 6 . / .  Urf$' 6 Z{Ž 96b= n. W‹ . Z{Ž .ZŽ 6 mu T‚. 6C= -/ 6 1  . 1  / 6 1 .]/ f 6 6 6 6 . 6b= .

ZŽ ^ 61B=6 V i6  ^ .ZŽ f . 6 -/ V .V xf ]-fg> 6/ 6 Z rV 6 6 dxf k 6 . ^ Z{Ž V 1 1 . d .ZŽ k .L YD—JHL @LmFILPO$L 8L$F DAD Z $?WBXD Z LPFIBXD@F z eB @D ?I? WLPQID—[ @D—L z ?ID Z UL$FWD z D  6QID'? $FWBXO$> z ‰J4L 6Q B :O$D PQIDeJ4DsJHLhO z D@? Z 8L$JHLPO$L>—[ED'F G> F > D'F > L jz G>@BN?JHB @L$FW? >@? HL$OPBXJHD@? z4Z UL 6Q D@? ‡Q D^JHD'? $FWBXO$DJHL•B 6Q LPM'F > $?WBXDUL_D Z D'?b>YQ FWB WL‡Q D—B jQIL$M'FI> Z ?ILPFp>Y? G>@BX?ƒO$D :> 6Q DJHL z 4[EL$FWBXD'F xXB UBNQIL –D z D^JHL Z ? FWL$xX>@O$BND z OPD z ^L$? z GDxXB GB\Q L QIFID WL‡Q D'?dLm?IL L•L 4BN?WQIL k?L WL‡Q D'? ]D jz Z xXO z xXD z jz L DeJ4L$FnFWL`>@xNB `>YFp> @D z @D'x ^B GL jQIDJHD QIBXxXB `>@FpL|JHD H>@FIJ UL $DG>•L$?WO$FIL 'LPFkD G>—L > Z D'F ? zz HFID PFIBNO$D'?±BXJHL 6Q B HO$DkD@? >YQIFIB z YD 6Q LP?J4L•B HBNO$By>YF DhJHLP?IL >@M'L FWD Z z BNJHL 6Q B :O$D3>@xXM @D•L z z ‡Q D^JHD'? J:>)[ED'F > @DbJHL$?RQS>•[ >@F >•BNJHL 6Q B :O`>YF D'? D Z G>@?}O$>@F >@O‡Q LPF X?RQ BNO`>@?nL {O$D z k?I?WB z xNBX?WL PFIBNO`>JHLP?IO >YF >mFILP?ID'x 'L$FD Z WL‡Q DJ4L_B jQIL$M'FI> WLPQIDs[ G>•> z xNBX?IL @D >@D'? LGQIL z B 6Q LPF Y>@xXDGJ fD JHD z QIBXxNB `>YJHD'? z }D z {LP?WQ z G>@?}Q L f>@xNM [ > $D –xXB eFWDJHL—> ?IL$F @L$BN? “ M HxNL G> HBXOPDbLB GLPJHBy>-Q D LP? z FWD Z LPO$LPF•JHL3JHD^O jz >•D z Z z FID'M@F > Z }>@FWL jz FID@M'F > G>—L g? UL 6Q >@FQ QIF >•J:>YQ > JHDeO G> JHDsD z UL 6QS> z 8JHL @DCOPD LL$?RQS>bJHBX?  ^z D Z L z H?IBNJHL$FI>@Fm>@?mO$>@F >YOPQ LPF N?WQ BNO`>@?kJ:>3xXB @L$x z QIBXxNB `> z L[ED'BK[EL$B\Q D @D•QS> Z Y>@B > >@F > HDYQS> L jz UL|> z @D Z J:>@F z HBN[ED@F UL D'?I?I>sFIL`> :>•L‡QS> Z FID 'LPBNQ >@F_D Z >bJHLmQ LP?WQIL_L @D WJE% 3&)3 M>1-/53 .k b+ -ƒ ^ .. Ur/ 6 1 _u /$ 6 6C= G ^ r .V . . ZŽ .-Z{Ž 6 dxf. &K3^7L-/12. / V " fDOŽ V 46 ^ 6 6 6 -f..ZŽ f DeJHD‘D‘JHL$?WL FWL$?WD'x @L$F z FWD Z FWB UL$B\Q D  L jz M'L 'D'x ^B UL 6Q D2J4D HxNL G> @D L$O$B :O`>YFdOPD Z L$FWD jz [EL$B\Q D‘JHL[ED'F G> JHBN[ELPFIL 6QIL –B 6Q L YD HO$> z C>+JHL FIL$?WD'x @L$F {OPxy>@FWL `>•D G>’B jQIL$M'FI> z L jz L$FID ^z YD PFIBXO$> z D@F Z >@x jz LPF jz ‡Q D^JHD2JHL >2L z > ^z @D PFIBNO`> ?WL$M BXF e[°> z DhD'x :>YF D^JHL Z ? z ?I?  ”FWL$xX> z D L eL$O @D QS>b>_[ z B 6Q LPM'F > L OPD z L jz kM'D'FI>•?IB 4OPD @DsJ4L 'D FID'M@F > Z JHL 'D ULUL$? z z QIL z HxXL > H?oD z ?WD Z 2“{[ D Q D@?_OPD z eB jz > ^z [ YD z z L3QIL WL‡Q DhM'L D'F QIF > Z >@F > 'xNBXO`>D Q D'? z Q FID z .d.6 .@V .> 6 . 6 f 6 . Y6 . ZŽ . .Jq ! fg>O.U 1  . 6 ^ V .

< 5 J 5R2.( .

ƒgƒgƒYf 6 {f f1 > 6 Z{Ž 6'gY \ m?D WLPQ D@?d? @DUFIL m?D WLPQ D@? H[ m?D m?|JHBX>@M'FI> M'F > HJHF eLP? L z WLPQ D@?h?IL [°>@O$BNxXBNQ >@J:>JHD FIL$?WL 6QS> Z FILPxy>@OPBXD Z FID'M'FI> >Y?kJHLP?IL ^L$?kJ4LOPD HOPL$BNQID'? Y>@FWB 'LPBX?nQIL HD :> J:>2[ED'F >+L$? jz L OPD UL$? OPxy>@FWD'? L Z L$FI>@J:> z HL $D FILPO$BN?ID'? Z Z FWD'M'F > >@J4D'FB HBXOPBy> 6Q LQ LPF z G> G> @D'x ^BXJ4D'? :>hLPQS> Z >hJHLU> xNBX?IL_[°>@O$BNxXBNQ > fDL 6Q L HJHB GL jQIDJHL•Q D^JHD G> z >@FWQIL z L HD ^BN? @D ¹x Z Q z [E?IO 4F Z D'?RQ BXxX>—JHL  FID'M'FI> G> @D•L Z D Z FWD . .6 .V Y.KV . Z7? NV G V 6‡. . 6 6 -/ 6 6 . 6 f \ U 1  .+ Z f 1  / . G 6 . G 6 V Ž \ U 6 -f 6 . .( =>3 5R(+&)*+-/MJS-/=<-  U 1  Ž . q. ^  G . .. =[ zA . ZR? . q \ U 6 -f ?> .

=[ HJHF   ! N  ^.  ' J \ >?.

ƒgƒgƒYf 6 {f f1 >@FWQIL z L HD ¹x Z Q z [E?IO 4F UD z > ]. 1 / 6 6 4JHDDsFIL$> 'D'x ^BXJHD'? :>@x 4D JHL$?WL 'D'x ^BXJHD Y>@B6?WL$F±? >@x 'DdO$D zA . q.$    Q F > z H>@x HDCJHL$?WL 'D@x ^BXJHD JHDeO z UL 6QS>@J4D …[°>@OPBXxXB\QS> V 6 .

V 4= 6 .1 D^JHDsD)QIF > JHL$?WL \   Q   $ . .KV . / .KV WV f U 1 + .F   K$ 1 + .KV WV OV WV 6 6 g1 .

$    HB HxXBND@Q LPO`>nJHLD > Z Z FID @L$BNQ > WL‡Q D'? @L D'?WQIBXxX>AJHL  UL 6Q D z  JHD@?AO ^JHBNM'D'? xXD^O`>@x'>@JHL ^ f jz >YJHD 6 Z{Ž 6'gY FID'M'FI> G> @D•L .

ƒgƒgƒYf 6 {f f1   Q     . =[ HJHF z >@FWQIL zA . q.L< ]  ' >?.

$   ! 0  ^.

$  z L HD ¹x Z Q z [E?IO 4F > Z D'?RQ BXxX>—JHL     K$ 6 Z{Ž 6'gY FID'M'FI> G> @D•L .

               .

/.   *D V Ž ^ _d V  V  G   V  *V Ž     ZŽZ{Ž f  > !"#%$'&)()&*&+-.0#$21 T43PUYUVU 5  76    ^    .

5 5 W‹ .

   5 fC[ V rq  8.

G  G 5 .

 :9 .

ZŽ 9 .

 :9 9 .

59 <=6 59 < Z  7‹ 7 f ! >  )E# 8?  D  G @3 76 :9 .

Z{Ž  W‹    Ž  59 ^  :9  5 .

 .   .

     5  55  5 G q ^   .

 Z{Ž fA3 :6 . 75   4{ .

‹    9    . ZŽ -6  .

5 f  .

 9 .

‹ Z{Ž . Z{Ž B6 5  .

 G    5 fC3  G 5 .

     oq @ ^  .

 86 k9 5 5  kfD3 .

V F  Wq  5 . ZŽ G 5 5 E-d.

Wq .

     .

 q      9     …q  G.

.

J (7E)AK (ML ON UP. f ! H % ) I .

 Ž Q   .   %  R : 9    5  W‹ 9 ^   :9   :9  9  Jf }S .

 5  .  .

 fV3  .

 Ž ^ W   k T9 ^ .

Ž f 7 k 5 U U .

    G  5  ZŽ  RZ ? ^ 9 k 7  RZ ?  .

[Urf$U .

 .

 X<Ž Ž WR 59  ^ Z7?   5 Af T =3PU_U@9  .

 .

 Y6  ZR? 5 s ZR? ^ s f .

8Z6 59  [9 s ^ LP?WQILCO$> > z ^BX? @D NQ Z ^z xXD z L Y> UD'?•JHLP?IOPFIL @L$FGO`>@J:> @DeO OPD HLPO$LL > z UL$O`> HBX? GD AQ L >JHLPxXB 4L`>@FmOPxy>@FI> >?ILPM BXF|D'?O$D z >-Q FIB QID'? HD@? z .

– ?WL I> FWBXD H> D :> WLPQID .

BXJ HJ:> L_LP?WQ @D jz GD@??WL $By>nJH>d> Z Z HBXJ:>Y? HD z >YF >@FD'?L$xXL GL 6Q D'? H?WQIF > GL jQ >@BX? 4?WL z >@FI> @D KBXJHL jQIB :O$>@F HJHD•D^O$D@FIF HO$BX>@? YD WL‡Q D bD > FWDeOPL$?I?WDCJ4LUBNJHL 6QIB :O$> Z L$F GB\Q L>@D Z > Z FID'M'FI> H?WQIF > G>@JHD'FO$D @D?ILJ WLPQID'?nOPFIBy> ‰?IL L O$D z @DJHD@?D WLPQID'?|LU?WL HO$L jQIF >@F ‰?WL JHB\[EL$FWL 6Q LP? HD jz ? z 'LPBX? …B 4BXO$BX>@x 6Q D—JHLkO$xy>Y?I?ILP?nFILPxy>@OPBXD z L z H>@J:>@? HB HxXBND@Q LPO`>AJ4LOPxy>@?W?ILP? }€ L$JHFI> G>—O`> z 4JHD)FWL`>@xD z HL‡QS> z {O$D JHL‡Q L$F GB :>@J:>Y? FID Dm?WL 4?WQ FI> 6Q D•JHL D z z WLPQ D2QIL eLP? O$D FID Z FID GDmLPxXLDm[°> lO$D z 6Q DUJHL|O$xy>Y?I?ILP? OPFIBX> OPD WL‡Q D L>YxNQ LPF >  >@BN? HxNL G>_Lo? >@FKL zHZ WLPQIDH#4J4L ? Z Z WLPQID•B 6Q LPF >@M@LkO$D >YxNQ LPF > >Y? FID Z WLPQID'?A? @D)OPD'BX?I>@?AJ4D F z >}[ED@F G> z H?IBNJHL$FI>@FBX?WD'xy>@JH> JHLPQIL$F GB :>@JHD l UD HB :O`>—OPD xXBN?IL|D'FWBXL 6Q >@J:>>UD H?RQ F >YB ‰?WL DAD . UL 6Q D@? jz z z > z D Z Z FWBXDbD D jz ?WL FWL$D^O Z Z Z WL‡Q D ±> ‰?WL >YF >3> Z F @D LC> jz ?FIL$xX>@O$BND z H?WQIF > :> > D WL‡Q D‘J:> eBNxXBy> z >@? UL 6QID'? ±D)D >@? z Z FWD Z FID^O Z @D z FWBXL$JH>@JHL$?[ Z GL 6Q LoOPD'BX?I>@? HxXL >|L 4B >nJH>?WD'x HJHD WLPQ D L$?W?ID6>@? Z kLP?IO$FWL @L ‰?WL …>@?O$xX>@?I?WL$? …D'? z FI> z .

>@F G> z PL :>@JH>@? HD QID'? 4FWL`>@xNB `>_JHLPQIL$F UB H>@J:>@?}> ^L$? @Dm? YDoL$?RQ YQIBXO$D@? 6L$xNL$??WD@[EFIL D WL‡Q D z >bL 6QIBXJ:>@J4L WLPQ DbL>@?FIL$> HBNO`> ^L$?d>@?L 4OPBNQ > jz ] ^L$? ! L_FIL jz HL•>YQIFIB L|?ID@[EFWL z Q D@? L ‡Q D^JHD'? ]D z ?IL I> aFWL HL . OPD H>@x:JHL uxXD'?aJHL > j?WL O$D z >> D'FWBXL jQ >@J:> HO$LPBNQID'? WLPQID'?_LU?IL WLPQ D @D @D D@xXB UD'F :? UD Z @DU?IBNM xXBN?IL—D@FIBXL 6QS>@J:>h>D L [°> UL 6QILm> J4L `>@?L|D > > Q D@?>@O$BNJHL 6QS>YBX? z >YF >>C> FWL$xX>@O$BND Z xXBN?ILbD'FWBXL 6Q >@J:>>D H?RQ FI> LdM'xXD D@?nL$xNL UL 6Q D'?}L$?I?WL HOPBy>@BN?nJHL  z FWD'M'F > ? PFIBNLCJHLOPD HxNL G>3L>BXJ4L 6Q B :O`>@FmD@?D 4L$F > F PxXBXD z UL 6QS>YBX?LKO$D@xXD^O L>YQIFIB > FWD'M'FI> Z n‚ >@FRQ B UD'?KJHD_L 4[ED Z HJ:> z FID Z ?IBXOPD'?J:>C> PQIDeJ4D'? :>Y? DbJHBNO$BND [ GL 6Q LbD HO$LPBNQ D@? J:> ^BX? @DU>@?I?WDeOPBy>@J:>b> L$?RQS>@JHD z gDUQIL z Z cD FWBXLPJ:>@JHLP?dJ4DGD D E?IL z D Z FWD Z FWBXLPJ:>@JHLP? JHL Z ?>YQ FWB z z Q D'? YFIBXD jz L Z DeJHL GD@?_JHL>@xXM >3[ED'F >BXJ4L 6Q B :O`>@F z G>A[°>@J:> FIBNL$J:>YJHL$? {D UL$BNDALmL l[ z B >YM'B z L ^z D2O`>@FI>@OPQIL$FWB `> WL‡Q DU? @DUO :> @D•JHLoL eO$BNQ > z m?>YQ FWB ^L$? QID'?…J4L z nL jz G>@J:>Y?>@B HJH>bJ4L_>-Q FIB z jz ”D Lm?WD@[EFIL WLPQID Ls? YD.

"   f8†    6  ]]      5   . .     9 D   .

  =  ^ %R .

 9  5  .

‹ f 6  7  .‹  WV  5  . d.

6)J`=<-/=<3 3 5 U . f 7=<3 M.

 .   4 ^ r 5 [9 . 5 5  s fw[ .

 Ž  @ 7 ^ .

‹ . I  59  [9   s  .

 f 5  TV   9 5 .

 7 R 7     f J  q %$3 &K58J 576  M SJ -  .

R   r   ZŽ  -f   5  =6 7 k  5 5 ^  !d  ƒ  W  f 3 V   5: 9 .

T  7 ^   6 ^ 5 E  7 [9    T .

 U f  D > Q FWD z HJ4DQIL UD'? z 4D GL L?IL|J jz  m?D D >mB H?WQ z U>@DbD WL‡Q D BNJHL 6QIBXJ:>@J4L WLPQID'?•? YD‘J4BX?WQIB 6Q D@?  ±9 F @FWBXD L > jz z Z ! HD O$D z UD z z F > z GD> Z Z WL‡Q DUL$? LPO Z HO$D LPF UBNQILmBXJHL jQIB :O$>@F Z 4O$By> TB HJHL ?G>-Q FIB z WLPQID_JHLP?WQ >_O$xX>@?I?WL Z BNM O$D z >@BN? D z 4O$By> UL 6QIL L 4JHL 6Q LGJHLU?IL QID'?—?IL I> z HB 'D^O`> z H?RQ fD z WLPQID 6Q L HJHD ?IL I> z z D'BX? pL 4BN?WQIL z WLPQID D z WLPQID 6Q L>—L 4LPO G>@BX?|JHL D^JHL HJ4Do?ILPFTQ L Z @DUJHD z Y> z :> FID'M@F > Z 6QS>@M@L FID'M'FI> Z @?IBNQIDbJHL|J:>@JHD'? Z L jz D z {D z FWBy>L eBX?RQ B HO HLP?WQIL$F D@F Z gJHL F LhQ D^JHD'?—D@?•?IL jz ^BXJH> JHL 4JHDb? bL eBX?RQ LmJ ?WL$F•>@OPL$?W? >@JHD@? J:>YQS> Z D JHL Z '?Q L GD'? FIBNL$J:>@J4L Z > >@F >•O`>YJ:>UD UL$BNDo[ X?IBNO$D|O$D D^JHL FID Z D@F_? GLP? UD Z D QIL G> L z >|O$xX>@?I?WL z :M@L$F >Yx UL 6Q Lo?WL_FWLP[ELPFIL> z WL‡Q D'?_?ILUJHBX?RQ B HM HBXOPDbBXJHL jQIB :O$>@JHD'F .

HO$BX>mJHL G> TD L$F >  JHD@?pD G> LPF G> z—Z 4L 6Q L WLPQ D@? LPxXD z2Z D'F @FIBNDdD Z > jz HL jQIL HJ4D |>YF G> L$FW?IBX?RQ L jQIL$? Z GLP? UD FWD'M'F > Z L LdD'? jz >L $L :>@JHD GLP? UD'? G>)D z D Z QIF > z HOPDGJHL|J:>YJHD'? /E%' W~ ”  .

  * 59 5k :.

9 B  9   .  T nV 5 .

[U#9 f U I :9  V  ^ .

   7 .

  5 9 6  A 7     .

 f R 5 .

Z{Ž . 5 r‹% . 9  6       ZŽ .

E=6 V 7R Z{Ž   .

 ^ f 3  6  Z{Ž  .

 :96   ZŽ .

 9%6  X k .

 59 6  4R.

.

 f8}<  .

6  6  ‹ R -f   7 Y=6 Ž  L-/5858J -/12.

( U .

   7 5  f J .

d 9 .   65  45  .

=>9 -. ^ 5 f   r‹% R f 3 W‹ ZŽ O6  J J -/12( 3   5 .V KV ? f  ^     f  (.

&KJ =>-.

 5  5   { Z Ž  f  L-/585R3 5-.=>3  3 Z{Ž   r % ‹  . { Z Ž .

O576H&)-6H-/5 }S .

 AT46   4R.

UY6  .

U f^ }<   Q  .

  V6  Z{Ž . . M<Ž T6  Z <Ž .

=  6    6 -f   5 .

 %'(!)   k  Ž   5 f J   r 5 J V Ž 9 ^ 5  ^ ^     =.  f ( M &)3S6H-/5 ! (ML  .

[? ^ . 7 5   .

.

ƒgƒgƒYf  {f f .  rV ^ Ž  9   "9 V  9 f 3S 6[  5 q.

JHL 6Q J:>@JHD@?hL O$D G>CFIL‡[EL$F z D'? HOPBy>sB GLP? UD'? PQIDeJHD@?3? @D x XO$B\QS>h>)? Z >sO$xX>@?I?WL z LPxXL –D'?Q B D'?JHL_J:>@JHD'?dJHL Z YD’JHL xND'?}JHD z G> Z O$FWBy>@F D H?RQ F >-QS> HD >YQIFIB Z L$xND ? z @FWBXD z BXFn>Y?dJ4BN[EL$FWL 6Q LP? OPxy>@?W?ILP?dL|FWL$?ID@x 'LPFd>@?O$D z ^J HFIBNO`> HBXJ4D'? FID'M'FI> > Z Z > LPx Q D@?L z jz z G> Z HJHD L jz >UB D^JHL Z > Z >@F > z B :O`> Z @D A> 'LPFI? eLP? BNxy>@J4D'?p?WL Z >YF >@J:> Z GL jQIL @D UL$? > >OPxy>@?W?ILb> PQ D^JHD'? ?WL$F O$D xNL UL 6QS> QIB @D 4?WQ FI>YQS> OPD Z >’OPxy>@?W?IL xXLPQ >L Z D^JHL•? M'L z FWM'BXF @D :>YQ $FWBXO$> ^D z Z D^JHLUO$FIBX>@F F >@x GL jQILAD z GL 6Q LsOPxy>@?W?IL$? WLPQ D@?   B Z ƒL$xX>QIL WLPQIDUQIL$xXL ^BX?ID@F z WL‡Q DsOPD @DUJ:>@?O$xX>@?I?WL$?JHL|? G>CO$xX>@?I?WL D^JHL Z HB >U[ UBXM'FI> Q z L$FRQ L 4O$L Z OPFIBy> $?J:>  HJHF By>Y? >GO$xy>Y?I?IL z G>k[ z G>)O$xX>@?I?WL  WLPQID'? >YQ FI> D WLPQID'? >@F >YF >•JHL 7 . 3  Z{Ž  gY   > z HJ4Dd[°>@xX> UD'?=JHLO$xX>@?I?WL$? @xXL J4LCOPxy>@?W?IL$?UJHLD D WLPQID'?TOPD D WLPQID'? D'? >YF >3>h>  B HO$x z L L$xND HB Z 6Q z 7 >@M'F o?hD >@JHD'?_L z4Z 8L> z   ? z >@x?IL ?IL I> z UL 6Q D'? ->@x PQ D^JHD'? JHD'? –O$D z HFIBNO`>oJHLD :> @D|JHL UD'xXJHL z WLPQ D@? D‘JHL zHZ D FWD'M'F > @D Z D z >mO$xX>@?I?WLnQS> > G>@BX?D z >@F >b>•O$FWBy> Z M'F z GL jQID'?=OPD jQIDhJHL—O eJHBNM'D'? JHL >YF >|>OPFIBX> Z WLPQ D @L$FWQIL HFI>@JHD'? O$xy>Y?I?ILJHLP?IO$FWL @L GLP? UD'?ƒFILPxy>@OPBXD z 4L$O$LP?I? @FIBND'? G> z °D@? ”QIB L jz WL‡Q D DmJHL Z QIFID'? WLPQID'? @DbJHDbD z z HBXJHD > UL$? G>2L$?RQ F DeJ4DsD Z •OPD UD FWL$?IL 6QS> Z @D•JHL ±9 | DeJHD@?D@?L QIL$xNL ^BX? @D jz z >@FWQIL z FI>.

jz YDGJ:>—[ED'F >—J4DGD >YO$BXJH>@JHL|JHDb?IBN?WQ L >•JHBN?WQIB HM Z z 9 z k?dO$xy>Y?I?ILP?kFWL ±7 D D'FWQ > Z WL‡Q D WL‡Q D'?O$D >YxO$xy>Y?I?IL jz 9 O`> HBNL$F >YF Q D'?LJHD'? {Q D^J:>•>•JHL$?WO$FWB  …9 °1 }JHL HB >@BN? YFIBXD z ? > UD'?=J4LpOPxy>@?W?IL$?T?ID^O$BX>@BX? -J4LpOPxy>@?W?IL$?±JHLp> Q D'?ƒLO$D z @DJHD'?>YQIFIB G>YQ FWB }M@L$F >YJHD'F >mJHL D ? FWL $> z @xXBN?ILD'FIBNL 6QS>@JH>3>D >JHL > H>YQ UL$? UD'?±>YQIFIB O$xX>@?I?WL|O$D z WL‡Q D'?UJ:> HF > > GL jQID'? z ^z z Z L jz L jz L? @DUJHL|?IL L HD Q BXxNB $> z L HDsOPD z ¹x z GD@?T? @DA>YxNQS> 6Q DJHL B 6QIL$FILP?I?WL Z Q z [E?IO ]O$D 4F GL jQIL L HO$> aDYQ ^L$? UDbDbO`> jz LGx HL :>Yx HD 'D@x Z ? xy>@J4D'? z Z LPF UBNQIL z UL Z D G> ULO$D HB ZHz UD|L eL xy>YFkD'?_>YQ FWB :>Y?dOPD'FILP? D'?RQ BXxX>—JHL  FID'M'FI> G> @D•L Z xXD>|? z z Q D'?mJHD > .

$ !       $        5  R ?    7   Ž " 9   6 9 <Ž Ž R  5 .

 .

 9 5 {Ž = R O <Ž .

3 .’1…7L(. 9 Ž   3   {Ž 5     =  5 5  5  9 U  7 =6 @<Ž Ž ?WL$xNL$O$BND Lm[ z G>@? D ? z L  'D'x 'L—>•?WL z @D•? > J4D)L 4O`> Z aL @D ? z WL‡Q D D eL HO$> WL‡Q DG>YQ @D .5 ? xy> z Z z ( 'D^O xXD Z L Z GL jQID)? HDJ4D UD z Z FWL$?RQ D FIM'L z xNL eD)L Z Lh>@D z z QID'? kD•>YQ DAJHLoL$?WO$D Z @FWBXD—B 4[ED'F > eLP? z z ?IL I> z HDbL HO$> HL$OPL$?W?IBXJH>@JHL3JHLG?IL GD^JHB HO`>@FmQ D^J:>@?_>@?D FIL$D^O Z ? z L_FWL`>@xNB`>—J4LPQ LPF UB :>YJ:>—D UD GL jQIL|O$D HJHD)DeOPD'FIFWLG> ?IBN?WQIL G> 4JHL$F JHD  FIL‡QS> ? Z xy> z L Z UL 6Q D WLPQIDGJ4D'?B  ^BX?%" 'LPBX?& gD z > z D^JHL JHD UL 6QILO$D FID^O$LP?I? >YJHD'?Lp>@xNQIL$FI>@JHD'? o?T>YQ FWB Z >•O$>@B 4> 8L$F :L 4>YQS> UL$? UDb?IL –?WL >@OPL$?I?#"$ @L$BX?U>@D ? @D UL 6Q D >bOPD FILPO$BX?I>•? > Z L eQIFIL > Q D'?ƒB jQIL$F HD'?±? @D z Z z OPD'xy>-Q L$FI>@BX?  ) i WLPQID)Q LPxXL ^BN?ID'F HJ4BXJ:>@?dJHL 'D^O  xX>@J:>@? :L$?WO$D :L xy> D'FAL eL  GLPx HD'FI>@FnDGJHL$?WL PQIDeJ4D'? ? 6    5  r  .

    Ž .  .

   7?   5  G6 W :9  . R 7 .

 9 .

  .‹ R? .‹  =   . r      [9 5  5  B Z .

‹ 5 G>d? $FIBNLpJ4Ln>YQIFIB z " ]   .      5 :9 5 O .

 UL 6QID)JHDsD >@FI> YDGJHD@?dLPxXL GL jQID'?! ^BX?#"$ 'LPBX? JHL Z G>L eBX?WQIL 6Q L >@F > :> B 6QIL$FILP?I?WL @FIBND z ' @> jQ >@M'L Z H>@x HO$BND z @xXBN?ILdD'FIBNL 6QS>@JH>—>—D @Db? @DbJHL|?IL FI> YD M@F > L3D[ z HD @DoO`> z >YF >•>—> L z :>@F 8L.

 ^L$?dB 6Q LPF :>@? LP?WQ @DGL HO`>   .

>@? 'D^O 3?I>      >@FdO$D z4Z KL$xNL$? Z L$F > ^L$?AB  eBN?%" 'L$BN?_J4L Z fDGFIL$?RQ DGJHD DeJ4L GD^JHB HO`>@F ?IL$F Z D z G> FID'M'FI> Z UDeJ4B :O$>@JHD'?_?IL z }D O`> FWD WLPQ D GDUL$?RQ L$? z ? >@F•L‡[EL$BNQID'?  }S  C6  .

 r 5  5  r 9 R . 6 9 =  9 = .

  „ƒ   9  @6  7 :9 I 8    † \ 3   3 3        T = bŽ 9  5 9    SU <Ž    75   Z  Ž 9   {Ž T . O6 . S6 7U  <=U 6 @3 "9 \ 3 0R AT .

 9 Ž .

5R Ž Z6 R  Ž  59 <Ž . 7? 59 R  7 R 7 0R 9 *‹   .   @ R @   / 9   7  \ {  PR 6  {Ž  Z6 {Ž P 7 3  {Ž Ž  .

Z6 .  @  :B Z6R r 7 .

 .

 J 7 7  J    TR R B<Ž .

) LI $#  # %'7%'  # %  N 5  {Ž    . =6 9 ‹  ! > )E# -.

 .

9 ^T .

Ž [U ‹% S   :3 9 .

 .  7    .

.     .

C 6 5  .

5^=>3 -/5R5R3 ( L3S6)J .5 6  5 G \ {OPD DUQIL$O$xX>@JHD D D QS>@J4D'F Z4z 4D Q BNxXB$`>@F z z 'FWBy> k? FID Z O @xNO _DGD >@? z ?WDGJ4D z 8>@? >@F >D  ? z FID Z EFIL$?WBX?RQ @FWBXDCD1 z Z 9 z z D'xXB .  9 6H&KJLO9.(. Z G>: FID'M@F > Z UBXD8 z JHL$OPBX? @DhJHL>  YD+JHL L> z xXLk> FID eB G>o> Z @FWL`>oD ‡Q D^JHD3JHL—O$>@xXO >-Q FIB QID‘B 6Q L$F HD‘D z F# Y> z O`>@xNO z xNDC @>YB?IL$F +D z ^BX?WQID T€P QIDeJHDhD 4D'F > QIBXxNB`>YJHD  WLPQID a>J:>-QS> 9 > Z >YQIF >< z z Z H>@JHD'?JHLm[ED'F >—B HJHB$ ^BNJ G s967 .6H(.(I9 >@F >PL :>YJHD L$xXL z z 87 FWD Z @A  > z .

6H(.5^=>3 (. 6H&KJLO9. z Z FID^O$L$?W? >@J4D'F z z  YD xXDbJHL? z xND z 4BN?WQID >Y? z FWD Z L$xNDD Z ? z z YFIBXD @DC? > > @DmJH> z WL‡Q D @FWBXD‘L ^Q LPF HD+O$FIBX> z YDCB jQIL$FWL$?I?I>s>@? D^JHLo?WL$F FWL`>@xNB`>YJHD Z B ±> HJ4BXJHD PFIBXO$>kJ:>oL z 8 z FIBNL$J:>YJHL$?? YDD'? Z HL$OPBXJ:>Y? :O`>bL$?WO$D xNDAB 6QIL$F 4D z PQ D^JHD'?dJHL QIB$ ^BXJ:>YJHL—Q PF UBXO`>5$  7 9 D+D HD'F G>@x= D@F G>@xTL WLPQ D 8L.O PR3S6H( 3S 6 HJHF 0 z  5 >@FWQIL z D'FRQS> Z j?IL I> L jQIB  z @L EQIL$x :> L_D'? /.

 E5 z …€ OPD'xXL‡Q B @> @FWBXDbD* z HJ4BXJHD G> YDGD'FWBXL jQ >@J:>U>D >@xaD ? z Q >@JHD'F P?KJ:>oB 6QIL$M'FI> @D ‰xXB UBNQIL<?KFIFWD :O`>bL$?WO$D D^JHL UD'?kFWL$xX>@O$BND FID'M@F > > HD'F >@x jD•O`>@xNO xXD @>YBT?WL$F B 4[ED'F >hDCxXB UBNQIL•JHLUL$FIFWDsLU?ID'xNBXO$B\QS>hD)O$>@xXO . z D'F Z >Yx 9 D@F G>@x PQIDeJHDJHL T€&Eˆ z Q D'? € FWD Z 8D'?k>YQ FWB Z FIBNL$J:>YJHL$?  9 QID'?d? @D3J4L z DhLFeL HBNJHD'? xNDhJHDhFILPx 'M@BXDh> Z :>GOPxy>@?W?ILALA>@F G>PL WL‡Q D'?  HJ4D z >-Q FIB z pJHB ^BXJHBNJHD L 6Q FWLQIDeJ4D'?ƒD'?ƒD QID WLPQID'?±O$FIBX>@JHD'? :>bO$xy>Y?I?IL ( J M>=J < 5 J =9<-/J 5-.   WLPQID D HJ —FWL`>@xNB$>@J:> ? z 5HJILKNMLOP3QISROUTLVWYXZO[\X5H][H5M^_N`OLa\RJ[N`WXOLacb G L_B z xy>@O$> Z FWBXL$JH>@JHL$?O$D Z @FIL$>B xXDJ:> WL‡Q D L$xND'? D Z UL$? G> 4?WQ F ƒO$D QIBXxXB$`>@J4D z H?m>YQIFIB z ZHz Q D'?LDO @xXO z  :>@Fk>@xXM -.

FWL$?I? @D Z ?o>YQIFIB z @FIL$>—J:>—O >@x z z LmO$>@xXO z ?ID z G>YQIL$FIBX>@x=JHL_O$D 4O$By>>hO$D LGB 6Q LPFIL$?W? >)? @Ds>Y? z >YF >•D Z >5 FWD'M'FI> FIBXLPJ:>@JHLP? ? @DU?IL Z 4>[ED'F >|JHL –J4LPQ LPF UB :>YJHD z FIBNL$J:>YJHL$? Z G>@? 4o?dL$xXL GL 6Q D'?dB  ^BX?#"$ 'LPBX?JHDGO$D  gD ^QS>@F+-.GOPL UD_D xNL eD Z > eLP? 8>@?8 Y>@FIB  @L$BN? B 6Q LPF UL$JHB @FIBX>@?}L>—[ED'F G>•JHL|O @xNO z z FWD Z WLPQID ‡Q D^JHD'?& [ 32 UL 6Q L|O$D 4B HL‡Q L ?ILmL|DbM6> z FWBXLPJ:>@JHLP?d[6"N?IBXO$>@?dJHL Z Q L$x :> UD ?WD@[ Q }>@FILoOPD nQ HxND @DU>@x\Q L$FI> xNDhJHLb? z WL‡Q DUL ^Q FWL G> HB\Q D'F eD z 10 z GL L& UD {D z  L HD>d8d8de¹x Z Q< z .

[E?IO 4F z  > HJHD z  .

>YQ FWB z 6  B HJ4B$ ^BXJ QID 3 Z z D'?WQIBXxX>AJHL >@x LPxXL  6 7  >YF G>$L :>@JHD  FID'M'FI>  G><f@D•L  HD 8geg .

]X S 5HJILKNMLOP .

NO[5W  !  .

FILP? ?IL I> z >@B  z 0 BXM6>&f@D .+ 1 HLPF > WL‡Q D)QIL z L 4xXBXOPD'? J:>•O$xX>@?I?WL <f@DGJHD z > UL H?I>@M'L 4?>A QS>@J4D'?& z LFeL$O FIDYQ D^O$D'xND Z /t JHD D z  OPD'xXD'FWBXJ:> "FeL$xO$D@xXD'FWBXJHD—L Z WLPQID3FIL$>@M'L_>@D WL‡Q D D JHL Z'& LFeL$O .O$D D'?IB$<f@DdJHD'? HBXJHD)J Z Z FID@QIDeOPD'xXD GJHL L_?ID@[EFWL z UL H?I>@M'L H? ?ILPF)>@OPL$?W? >@JHD@? ?IL I> ‡Q D^JHD'? –>@?dLFeO$B\QS> eLP?- FWL$?IL 6QS>@J:>Y? FID^O$LP?I?WDoJHLBXJHL jQIB!:O$>@FT> Z GBNO`>D)L HJHL$FWL&PD 4JHDC?WL•[°>@xy>3JHL –>@B HJH>GD3JHB\Q D Z L >CxNBXM6>&f@DJHB 9 z ?3:x HD'? HD QIL$F#"X?WQIBXO$>@?JHD HJHF z $>ULP?WQ >UFWL$xy>YO$BXD :>@J:>•>@? z "FeL$x=OPB $> Z J4LPQ LPF UB :>YJHD'?—>-Q FIB UL 4? >@M'L O$D 21 O$D H?3JHLsOPB $>2>@x\Q L$FI>+D2LP?WQ >@JHD2J:> Q D WLPQID—>@?pLFeO$B\QS> eLP?p?%f@DAFWL >sxNBXM6>&f@D)LP?WQ YQ BNO`>)D 9 > DJHBX>>J4By> z D .- v9 Z D z HJHL pD Z LPxXD Z ? z D@F Z @FWBXD z U Z  6  5 7?   9 R 9 *6      Z6  5  5  U FIBXLPJ:>@JHLP? _L Z L DeJHL Z  Z z dD Z :> L z > L HJHL$FWL&PD‘J4D'? 3JHL PQ D^JHD'? JHD'? Z PQIDeJ4D'? D'F}L7F4L F > z BXxND> z Z D G> L HD>d8d8de¹x z HBNL$FI>@F% L ZHz Q< z BX>@?nL>@?FILPxy> eLP? L 6Q FWL_D'?D `>?ILUFILP[ELPFILU>3Q FI> H?W[ELPF HLPF > |JHD z Z >YB FeD z HL$BNF >•M'LPF >@xƒ>@? Z L$xXD 4>@D—O$xNBXO$>@F ? z @FIBND z kD 6Q D z JHL jQIL>sO$D BNxy>&f@D Z UL 6Q LGJ z FI> 6Q L3> T€ xy>@F Z4z xXD L ?+f@D ‡Q D^JHD'?±> ?WL$FWL HBXJHD)?ID G> h€ z sD. 59   WYX5W [5H5M^_  Q D^JHDbD WL‡Q D k?n> ^L$? D  \  \  \  D'FWQ >   \ D'FRQS> Z KNOX5H O G>•[ z f> Q D@? JHDbD z   5   'L$x=QIL {DbOPD   Q D z {OPD  QS>@J4D'F JHL Z4z   UL$BND  D'FWD'?IDbJHL Z @xXBN?ILdD'FIBNL 6QS>YJ:>•>AD LPxXDbD WL‡Q D OPxy>@?W?IL>YQIF >< P?bJHD'? Z B z > Z  UD 'L$F   FeDJHL B G>@M'L %$ v> eLP? ? L  ^By>@J:>Y? > D UD 9 87 z G>@?I?I> °9 FWD'M'F > Z 0/ *) 9 >YD'??IL FID'M@F > Z 0 z > z z UL$BND >@FWQIL 6Q D Z QID'? z D^JHLk?WL$FnM'LPF >@JH> FID Z L_DL  @D'x$ @L—JHL_>@O$D@FIJHDGO$D PQIDeJHD@?B J4L D.D WLPQID.

JHL  'LPFWQIL HJHDO`>@J:> ^O$D z >@F > G>@?& UL$J4B<fYDUJ4LFWL`>@xNB$>@F UL 6QIDUJ4L ‡Q D^JHD’JHL)O$D  Z Z  WLPQ D PQID PQ D^JHD'?AL?WL$F 'L  5    Z 5B6 9  5   . 5    5    \   5 7  .  ‡Q D^JHD'? ( G>’B >@M@L z G>|D@FIBXL 6QS>@JHDA>D z jQID z L UL$JHBNJ:>@?  ?WL  O$D L—DGD z FID'M'FI> Z z D'B[°>@xy>@J4D 8L z  'LPFI?%f@D.

. .

T  3 M>5R-.

*+3 M5  T 7? U#9  7?    .

  U.

    5=   .

   5  R 9 6    *=6  %'&)(/6H( ( ( Z6    .

 5 5 .

  I :9 6  JL*.-.

12.

( 3 576 6)J .^=J M .

J -  R  @=6 6       =6 86  ! % # (M?  I % # %' )/ # %'7%PN 3   :9   - O  7? 5    ..

 . 9  [9 86  @ B 9        G  .

5  3S 6  5  .

3 {L Z P=6 5 WL‡Q DbJHL  HFWBXM'D L$F GB\Q BXFpD#" :>•> gDbL$?RQS>@J4DGJHDbD UL 6Q D•J4L?WL|xXD^O$D FID'M@F > .

 G>bLPJHB!HO`>&f@DbJHL|J:>@Fd> H> .

 7? UL 6Q D@? :> eLP?LFWL`> eLP?& D'FRQS> Z G>@J:>@? 4BXJHD'? °>@xNQIL$FI>  5 FID^O$LP?I?I>@F Z JHL WLPQID D'FRQS> Z HaJVWY[SRHY[VWb {?ILPF# ^BPDU[ED@F HLPO$BXJ4D z  "!       5  5 9 7? W  7 C % R .

 5 G 6 G=6  .

+.5 ) i  OPD z xX>@F}L>@x\Q L$FI>@FnD'?d>YQIFIB ZHz \ ZH TˆG€ D^JHL GD'? FWL$xX>@O$BND Z z o?•O$D HB  `YO]VHJI IZW NO[5W  J4D'? ]>@?W?IB G> [5H5ML^_N`YOb )   I % # 5?H  .3 .  SU WLPQID'?n?+fYD•O :> <f@D z O :>@FpJHLPQIL$F UB H>@JHD'? OPD WL‡Q D'?•?%f@D GL 6Q D'?_JHD'?bD  T   %' N  UL 6QIDAJHD'? D ‡Q D^JHD Z .-7(B?  .’1…7L(.

  7    .RT? 9  Z 6  G6   5  :9 .

     .

 % .

.

 T  33 XH I $   [E?IO 4F Z D HO$BX>JHL FWD Z >@?I?I>G>•?WL$FJHD4:x HD Z Z WLPQ D@?& >@B 4 z L$?I?WD6>@? ? > L—?WBXM 4B!:O$> 8L z z ZHz D'?RQ BXxX>—JHL FeD z  z  Z >@B  SA  7C  U6 9   L—D5:x HDUQ L >@? LD6Hx HD Z FWBXL$JH>@JHL$?|JHL Z D Z FID'M'FI> GLP? G>@?dO`>@FI>@O >YB G>@? ZfYD G><f@D•L |L$xNL 8geg .

 5 7    %  R   9   Q6   7  . H$      U  .

 .   .     <=6 .

 5 5  X=6 . 5 5   . 3    .

5    6 7      %  R? .

Q L z 'FWBy>AO$>@O HL xNL$?nL|M'L Z UL >bQIL$O 4D'xXD'M@By>AJHL $FWBXO`>Y? Z >@F >•O$xX>@?I?WL$? G>  ? 1 140   HJ4D .3 . R S  6 <  D  Z K ]   R    $ c  J4L_?WL zZ Q D z G>YQIBXO`>  $> `> LPF > @?IBNO`>@?  0 FIL$?WL 6QS>3J4LPQ LPF UB :>YJ:>@?kO$>@F >YOPQ LPF%"N?WQ BNO`>@?dJHB\[EL$FIL 6Q L$? Z FID Z z UL$O$> QID'? JHL|? z HBN? UDCL >UOPxy>@?W?IL z Z JHL G>@BX?}?IB L jQIB   /.’1…7L( ) i \  xXL UL 6Q > L‘?IL‘> z .

 L> z $>UM'L HL$FWJ:>G>Y? PQIBXO$> FID Z  FWBXLPJ:>@JHLP? JHL Z Z z C A 62F 6 .

’1…7L( ) i   L$FI> IG 6 l  e" o xNQIB & xX>ADeOPD'FIFWL Z  $>—JHLkOPD 4BXO`>•OPxy>@?W?IL &  > z `>@JHDUJHD•Q BNDbLLP?WQ z HJHD UL 6Q D JHBXD@?IDbJHD BNQ >@? G>@BX?}JHL 5 @L&PL$? JHB$$L UD'? z L z  z 54=<33967L-/585R3 GLP? G>•[ED@F G> 4L "NxXBy>dD'? G>m[°> 9dz z HBXLPF >@F# G> z :x 4D'?L PQ D@?pOPD z z G>@?p>@O$FWL$?IOPL 6Q D UDeJHLPxXD'?n> L> 6Q LP? By>—JHL|O$xX>@?I?WL$?D'? HD Z ZfYDUL7FeBX?WQIBy> Z z ? >@BN?& Z >@B= UL HB HD 4L$FIJ4D DA?WL z z 5  WL$B\Q D_L HM'FI>J ”D@? 4D GLP?JHL ?WL GLP? JHL @L f?ILPF?IBXM ?p> z 5 9   HOPL$?RQ F >YBX? jJ:> HB!:O$>YQ B 'D'? H?IL GLPx :> LLP?IOPxy>@FWL$O$LPJHD'FWL$?&  ƒ1  -967 4BXL$FI>@F% :> ’1 G>_?  BX> z $?JHD'? OPD D'FIBNL 6QS>@JH>U>bD L$FIOPxy>@?W?IL >•D'FIBNM'L  °7v< >YQ FI> zHZ m>_O$xy>Y?I?IL :>@?ILkJHL k?mQ PO HBNO`>@?mD@FIBXL 6QS>@J:>Y?|>3D WL‡Q DbFILPJ `> HLPF > x JHL z _>•O$D^JHB!:O$><fYDUL g[ z z G> HBNL$F >YF% By>_JHLoO$xX>@?I?WL$? z o>—OPxy>@?W?IL G>@BX?p>@x\QS> WLPQIDh[°>@O$BNxXBNQ > >YBXD'FO$D &f@DUJ:> fDO$D >@FRQ BNx :> Z Z >@FRQ BNx :>  %R  UL 6QIDGJHLbO eJHBNM'D UL 6QIDAJHD•O eJHBNM'D•>b> >@BND'FnOPxy>@FWL&`>•JHD@?dJ4By>@M'FI> HJHF 0 z  5 >@FWQIL z  L HD>d8d8de¹x Z Q< z .3 . 3   = $> HLPF > .

[E?IO 4F 3 Z D'?WQIBXxX>AJHL   FID'M'FI> YxXBX?WL G>@?}JHLP?IL  @D'x  eBNJHD'?  3S 6 jQIL$? @F# @D'FIL  J:> HOPL$BNQID'? JHL z >@BN? z FILP?IL jQ > >@B= Z   5 . 8 >@FWQIBXx H> Z HB$ ^L$? L$O&" :O`>Y?& Z H? PQ BNO`>@? J4L?WL 5  G>•O$xy>Y?I?ILmQIL >@FWQIBXF3J4L‘J4L Z   < :  6      E      7 7 :9   G C  5  9   X 6  .

   9 6 P  9 3 & L-/585R3   = WT46 5 OR 8U   .

>-..        5   (.

43 M 6H(  3 6 5 6  X  V3 65      5  5 .&H6)J <-/.

.   G  E(. G L$FI>  5 L 6Q B  G>@?n[ED'B> FWL$?IL 6QS>>•B jQIL$FR[°>@O$L Z ^"R o >•O$xX>@?I?WL z HJHDhD'? Z >YBX?nOPD  ? 1 1@? \ HD Y>b> C A 62F 6 8  > z f@L xy>@O$> Z •L7F4BN?WQIBy> 'FIBX>_O`>YO HL xNQ BuQ HFIL$>@JHB 4M z >@FWQIBXx :> Z >@B= Z Z DeJ4L$F UD'?3OPFIBX>@F3O$xX>@?I?WL$?3 Z lQIDeJH>@?}>Y?pO$>@F >@O‡Q LPF%"X?RQ BNO`>@?JHD v> G>CO$xX>@?I?WL5:x :>COPD z  GL \ L >@B= FWBXLPJ:>@JHL Z D xNL UL 6QS>YFkO$xX>@?I?WL$?|JHLP?IO$L HJHL jQIL$?—B Z J:>UOPxy>@?W?IL ‘> $> HL$FI>       W T G  5  W 7 R @ 5   5  7  9  <  O X  .3 .  9%6  O \  :x HD3> L—D z PQIDeJ4D'? L>YQ FWB L$F GB\Q L•B Z LOPxy>@?W?ILP? .’1…7L( ) i WL‡Q D GL jQILkQ D^JHD'? D@? L?IL|JHB\[EL$FWL HOPBy> z LP?I?ID'>? Z @xNBX?WLGD'FWBXL jQ >@J:>>)D HLPF > UL$? > >@B  >C> 9 > Zf@D3?%f@Dh> ?IL I> z  G><f@D•L 8geg .43  F   z  z >@B  Z kxXM 5:6  5 :9  D'FRQS> Z QID'? z 5    A3  9:C   S U   > > 4DU ^BNJ:>@JHLe G> z xXBX> FILP?ILPF# Y>@J:>@? Z xNBy>@J:> HLPFIJ:>U>@?O`>@FI>@OPQIL$F#"X?WQIBXO$>@? M'L UL HB HD z PQIDeJ4D'?mLU>YQ FWB xXLF4>@? L|LP? Z Zf@DbLFeBX?RQ BX> 6QIL$? CE8  z  6 :9   5 .

]   .

  .

  U!9     5  T     4T   8 6 5      5       6 -/M±93^7 -.

3 . CT FILP?IL 6Q >bD_[°>YQ D—J4L Z >YF >bO`>@J:>#:x HD Z GB HL$FWL 6Q L>@D Z  EQ B Z  .J .’1…7L( 4O$L$B\Q DJHL UDeJ4B!:O$> :?IL ) i  FIL `>)DCO$D LPFIO$LPJHL$? ? > >@BN? HO$L      Z6 =Z6 V  :9             5 T U#9   J M>3&)*. D•J4L @L&"XO z SU  xXD 5  5 9 FWDeOPL$?W?ID)J4LJHLP?IL  @D'x$ ^B UL 6QID PFIBXO$> z ? ? WL‡Q D > G> L$?WQ > >@BKOPD 6Q B z Z LPFW[EL$B$$D6> Z  HJ:> z OPD G>CJHLh?WB 0 D Z GL jQID'? L>@?I? HD Z ?WDsJHL z z  z D'?WBNQIB$ 'D> Z FILP?IL jQ >J‰?WL Z ? HDGO$> 3S 6 HJHF "\Q z 0 Z z 4D LDbL$? z >?  5 >@FWQIL Z z  |[ D^JHLu?ILQIL$F•>sL 'D'x Z >@F >•D WLPQ D PQ D^JHDbJHL G>@BX?_?IB z HJ:> Z UL 6QS>Yx K>YQIF >< >@F >U>b> P?—JHD1 <f@D z L z …D'?_?ILPFIL$? >@F >bD Z B HJHD z LUQIL z ‡Q D^JHD'?_JHLhB 6Q LPM'F ><f@D J4D'? ?WD Z UL$? UD3 D@xXB UD'F :? UD Z eB xNL$?•LhL @D'x Z WLPQID'?_J4L$?IOPL HJ4L 6Q LP? L$FWO$xX>@?I?WL zHZ LU>h?ID  >@?bD'?•OPD H> D 5 UD^JHB!:O$> ^L$?  >@x WL‡Q DH#:? Y> UD'?JHL$?WL  'D@x$ 'LPF @xXBN?ILD'FIBNL 6QS>YJ:>A>AD WLPQID•> G>hJHD'?|JHB$ @L$FW?ID'?|O$D HO$LPBNQ D@?mJ:> Z ?I?  z HO$LPBNQID'?bJHD ?IDY[EFIBXJ4D @xNBX?WLmD'FIBNL 6QS>@JH>U>bD z |> ‡Q D^JHD•JHL FWL$?IL 6QS> HD'?W? > z >U> xXBNO`>&f@D•?IL Z HBNL$FI>@F% LP[EL$B\Q D_JHLk?WB HLPFIM'BX> z elB Z xXBNO`> z VFWL$? z BX>CJHL z °?WD G>_JHL xNQS>YJHD >@BN? LPF >@JHD F <FeB UD O`> Z >Y? .. n> D^JHL V?IL$FA? Z HO$LPxy> z UL 6QID >@x$ H?RQ B\Q z 5 Z D'F L$F ±J4L 'L z "NJHD'? z L z 4O$> >@F > Z 5 .43 M 6H( DeOPD'FIFWL$F O$D  O$L$xX> Z 6 z HO$BX> ?IL$FAL ^BNQ >@J:> Q L$FWL !  Z   D'FWQ > Z HJHDDO`> G?IL G>   5 5   GL jQID z UL 6QID UL 6Q D Z  GL 6Q D•JHB\[EL$FIL 6Q L|JHDUL$?  O‡Q LPF%"X?RQ BNO`> > HJHD z > 9 L 'D'x :>YQ L z D@Q Z o? z .

xND z L Z HD Y>@? [ED'F G>@? m?pO$D 4O$L$B\Q D'?pJ:>—> >@xXBNJ:>@JHLP? $?IBND D HD@?D UBXJHD z Z z D'xNB UD'F:? GD OPxy>@?W?ILP?&  JHL $FWBXO`> z FI> >@FWQIB HJ4D V>L7FeBX?WQIBXF > HOPL$BNQIDGJ4L UL 6QS> xy>&f@D z ‡Q D^JHD•JHD UD'? z Q 6 =6 O=6  . J   .

   X   .

 5  5  5 V 9  7   O 7 VT  7 U  6    5   %  R  9 6   R 5 .

 B 3 5.

7R G>AJHL‡Q L$F GB :>@J:>O`>@FI>J z G Z  6    9 OZ6   .

5  B R? 9 5 5 .

G  Q        T M  3    ]   $"& :&  :& &M1U(  W# 1  5 U#%$ 51= (   .

 1 7& =&   J FID'M@F > Z  HLPO$LP?I? YFIBy> UD@Q B 'D z D^JHL Z L$FI>@JHD Z }?ILPF J4BN[EL$FWL 6Q L D'xNB UD'F:? GD Z  xXBy><f@D_J:>@? QS>@FWLP[°>@?8 Z 1  \9 z [ xND z D'F Z aL f>•JHBN[ELPFIL `> 8L °> Zf@D ZfYD PQIDeJHD@? B\QS>@?[ED'F >@? eL FIL z UD@QID'F JHD* 'L&"NO HO$BX>UJ4D JHL.D'xj? L|JHL 4B!:O$>  4 :>hO$xX>@?I?WL#:x HD QIF > z L$FW[ED@F G> Z  @L HBNL 6Q L ƒ D'xNB UD'FH? UD?WBXM Z D'FmD Z HJHDb>_Q >@FIL‡[°> UL 6QS>YF > z  7  8  9 ET   = U 5  M  .

.

 5  5B9   >@xy>< ^F > Z > DeJHL•?WL$F|O$D UL 6QILGLPFIF >YJHD >@B Z >@F >•LF^QIL H?%f@D Z z HJ4D?ILJHLP?IL I>G> 4O$L$xX> 6Q BNO`> HO$LPxy> >@FI>AFILP?WQIFIB&f@D Z >    R    : 9 5 T  ET   @6  R U#9    5 7  8U    5  5 5   9 U = 6 8  .       U 6 .

‡Q D^JHDhJ:>hO$xX>@?I?WL WL‡Q B$ @D'? O$> B 6QIL$?D HOPL$xy> 5F  Z 6  5 G> z  #   ‡€$ 3 > D'BN? {O$D z z eO$> B$<f@DhJHL z >@FI>UD@QIB UB$><f@D UL 6Q D  'L HB O$D H?RQ B\Q z {D'??ILPM FWL`>@xNB`>YJ:>@? L$F > .

U>h?   Z "NQ z xXD >  UDeJ4L$xy>YM'L D'FIBNL 6QS>YJ:>n> D   L HD>d8d8de¹x Z Q< z .

[E?IO 4F    WL‡Q D  z 3  Z ? > HJHDd>@?     ULPQ D^JHD'xND'M'BX>@?  D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg -  .

           LP?WQILmO`> 9 "\Q z Z    xNDAJHLP?IOPFIL @Lu?IL    @ UBX?RQ D_J:> z GL‡Q D^JHD'xND'M'By> J   LoJ:> '@ -   - > B HM 5 >@M'L z  D^JHL FID WL‡Q D'? J4L  5  .    J @9  55  P.

   9 6 D @ .

.

9 FHGG] I 6  5     .  5 .

         4 5   7 R 5  .       .

     5 .

 .FHGG ! 953S ! .   45    9    5 5 5 5   D     9.

9 FHGG ! D .9 F8GG !KI 5   Y] #  " $ & : &  :  &  & = 1 ( W    #    1    U #  %  2 $ G 1 (    1   & =  & 9 G  7    9  5 5    * .   .

 5 5  J (*)E#& 7-M?    %  %  # %'(!)/7   % ) 5 5 .

4(..   " Q9<3 .=<3 -.

(+OQP7368($# 3     ..  -  . (+&KJ 3 M 68-/=>.*+3 .

5   .

FHGG !:I   .   .4( 589>&)*.J 9%# 3  8   9  9 5 5 D    9.     5  ..  5      5       5   (.

 9  -=6    .

 59 5   9&  9  9' @.

L$FWL UD'?  ’JHBX?  HDbO$> z "NQ z Z xXD z * L$?WQILsO`> > z D b I z z "NQ z Z xXD pO$D }D'>@J> Z HJ M L HO$BX>  WY[ "$ 'LPxTL b I  xNL UL 6QS> Z  |„ ` ZOLa  D  FID'M'FI> Z z FWL$? JV2 LV 5VVK!P b#O[_   b[5WV `YOJTW5Mb z HOPBy>@?JHL - FIJ4D z GD z O[N`WN`a QIF >@?FIL‡[EL$F    4JHD+LCJHLPQ >@x H> HJHD z   4D BNQID'?G>@? Z  B Hxy>@J Q FID'M'FI> z Z UL$? UD—Q L L$O‡Q D'? z LC?+f@D  …€ WLPQID O$D 4?IBX?RQ L _ UDeJHLPxy>@M@L VD'FWBXL 6Q >@J:>)>CD UDeJHLPxXD'?pJ:>AFWL`>@xNBXJ:>@J4L >@M'L H?L$?RQ F Z LVVK8P ^7 FIM'B GL jQIDbJ:> Mb%ROUI8b 5[ D D^JHLPxy>@M'L B   k? >@F >UxXB 4M  —Q D^J:>@? >@? QIBXJHD@?> J4L$?IL  'D'x eB GL 6Q DJ4L DU? LVLVK!P BXJH>GL cB HM'x P? LP?WQ >3JHBX? 6Q FI>@J:>@?ƒL  FIL‡[EL$F  n‚ L gJHLP?IL  @D'x$ @L$F Z Z L pD.xXB$ ^FWD >L7F4OPL$xNL 6Q L z G>@BND'FILP? JHLPQ >@x HLP?L FIL ~ r HOPBy>F H>@FIBX>nJHLK?ID@[ Qd}>@FWL?%f@D L 4O$D O }x 4FIL @L UL 6Q L_JHBX?WO z   GL‡Q D^JHD'xND'M'By> LPQ >@x= M 4B HBNxXB$>@JHD D Z `R >‘FIL$xX><fYD’JHBNFILPQ >+OPD z H> z G>GFIL‡[EL$F M [5HaO 5[ZRYHa >@FRQ B C> JHL‡QS>@x HL$?3> bJHL z L UD^JHL$xX>@M'L LKL 4M'L  FIL 4JHL$F3L Z WL‡Q D'? Z YKNOLaUV4`YMYWJQ ROI >  }>@?IL$>@JHD'?‘L JH> KBC 4B!:O$>@J:>  z G>@?nO$D FWB UL$BNF >@? FI>@J:>@? aOPD GD Z B H?WQIF z UL 6QIDA[ z z HJ:> GL jQ >@x >@F >—D Z >@xXBNJ:>@JHL :>@FWBy>sJHLh?WD@[ Qd}>@FIL3[ED'FI> GL‡Q D^JHD'xXD@M'By>@?|JHLL HM'L ]L_?%f@D3> G><f@DAD'FIBNL 6QS>@JH>U>bD WLPQ D@? JHL$?WL  'D@x$ ^BXJHD@?UL> WLPQID'?& :>@?WL`>@JH>—L gD LPFW[EL$B$$D6>YJHD'? Z D'F•>  FILP?IL 6Q >@J:>@? L Z WL‡Q D'? :? z z FWM'BXFI> Q D'FWL$?•O$D ]SG {D'? GD }D6>YJ >@FWQIB > HJ PQIDeJHD@? JHL D z FIJH>  O }x z JHL$?WL  'D'x ^BXJ:>@?  FWL GD^JHL$xX>@M'L }D^DeO  }D z D'FWBXL jQ >@J:> :> z M .  9  xX>@M'L   @DeO sJHLP?IL I> eL  - L I D'FRQ M z b/XOLR $? z HJ .

4-/J 5 ( M <3 SJ =<( 5V3 9.6)J `J S-/=<( 5 # 9 O  5  5     " O 3   5  5   59  " 6 5F ."=     [9 5  "9   pxy> :> 58 U UD^JHL$xX>@M'L - > 4M 5 9 FIL UL$FWxy>  JHBN[ELPFIL 6QIL >@M'L  z  ?KJHJ 4B U  < G    > z U BNBXB p>•FILPJ :>)OPD >Y? 5 z Z 5=  HB :O`>YJ:>@? z :>  G> L 6QIBXJ:>@J4L}[6"X?WBXO`>d> G> - Z z 9 UDeJHLPxy>@M@L L_> JHB eBNJHBXJH> ULPQ D^JHD'xND'M'BX> HB!:LPJ  JHBy>@M@F > ±< Z  G>d[ED@F G> z L$xND z UDeJ4L$xXD@? 'L M'LPF > z >YDUD z G>AJHL|L @L 6Q D@? JHBy>@M@F > G>AJHL|L$?RQS>@J4D HOPBXD z ‡Q D^JHD'? J4D'? ]> G>AJHL " :>ULP?  Z - >YQIFID|JHBy>YM'F > G>@? ! !U E?IL <f@D   HOPBy>GJ4LL 'L jQID'? z z Q D'? JHDbD °?WL&&f@D WLPQ D :?IL   7 °?IL <f@D L$?RQS>@J4D z ! ] < U    :>@BN? -D D•JHL Z " G>AJHL LF^Q L HJHL ?IL I> z EJHLPQ >@x H> @?WLnO$D FID@M'F > Z z   >  ^L$?  xNL UL 6QS> Z   Ln> HLoD@? JHBy>@M@F > FeDUJHL|J:>@JHD'? [ED'B z z E?IL <f@D ‡Q D^JHD'? G>@BND'FB Z D@FWQ  G>@? GD^JHB!HO`>@JHD•L >@OPFIL$?WO$L jQ > HJHD Z z Q BNxXB$>@JHD'? >Y?I?ID  :> >•?ILPF O H> z 4DU @D'?dJHBy>@M@F >  HO$BX>J4L G>—JHLP?IL  @D'x$ ^BXJ4D D'BN?nJ:> Z {>@? [  z  5  [ED'F > FWL$xy><f@D L  FWL$?ILPF# Y>J Z >YJHDbJHL|JHBy>@M@F > G>@? ^?+fYDGLPxXL$? G>AJHL L$OPB!:O$><f@D JHBy>@M@F > :>UJ4L :>@?I?WDeOPBy> eLP?L|>@M'FILPM6> eLP? PQIDeJ4D'? UD•L$?RQ@f@DUD'?d>YQ FWB EO$D FeDUJHL|J:>@JHD@? z L HJHLPF J4DbQIB Z L H>@?DUJ4By>@M'FI> Z >-Q B$ ^BNJ:>@JHLP?& QID'? z °>YQ D'FWL$?L|?IL [ED'BaJHL$?WL  'D'x ^BXJ:>•JHL ( 0 >@BN? :>Yx UDeJHLPxXD'?ƒ?%f@DkD'FRQ D'M@D Q FWD* Y>@BJ4L z GBNO$D JHBy>@M@F > o?±Q F P? G>@BND'F HB\[ED'F UL Z6 E  9 m?JHD'BN?  ( 0 UBXJ:>Y? z H>@x YBXB ƒ> HD@Q ><f@D ?IDsJHL °7  e9 UDeJHLPxy>@M@L HD|JHL$?WL  'D@x$ ^B UL 6Q DJHLnQIF $? v>-Q FIB JHBy>@M@F > GD^JHL$xND—[ D@JHL$xNB HM WL‡Q D'? G>AJHL|O$xX>@?I?WL$? GD^JHL$xND•JHB  DeJ4L l?ILPFnFILP? Z ?%f@DUL$xXLP? GD^JHL$xND•JHL|D  ULPQ D^JHD'xND'M'BX>GJHL .

 9 \   T .

59=6 U!9 7? 7? YT    9 \   5 T 5  U'T ! ] F)U   T  .

.

 :9 UVT    "9 \   YT    R? Z6 U"T ! " U     5 9 I :9  5 5      5  5 3  5   J J @9 59 5 V3      "   59 W  F J \   T ! XU  %  \   T ! KU   \   .

R? VT ! U  5   5 Z \      T ! G F)U  3S 6  5  .

=<(.3 .  .5'.=<3^7 -*.5 =<3 .’*S6H(.    . P  7 5 % "9 U S  5F 5 T Z  7 HU!9 6Q >@M'L 4?nJHD—JHLP?IL  @D'x$ ^B GL jQID•JHL z   ^. 3  Q BXxNB$>@JHD'? 4?+fYDG>   K$  T Y  z’z UDeJ4L$xXD@? 6Q LP?JHLnx HL}JH>@F L$?W?ID6>Y?—L  'D@x$ ^BXJ:>Y? xNLFeBXJH>@JHLoJHD@?d?WBX?RQ L G>@?   9>-/J 5 (.4(.

$  QID'FILP?mJHL$?WL  'D@x$ 'L z UL$? >@?•[ED'FI>  5 5 k? Y>     JHL$?RQ L$?_> z HBNO`>&f@DL 6Q FWL3>@?_JHB$ @L$FI?I>@? <fYDGJ:>bO$D z n>@J:> ”   < # 3  5 >YBXD'F[°>@OPBXxXBNJ:>@JHLJHLpQ L$?RQS>@F [°>YO$BXxNBXJ:>YJHL  D'FIL H?IL D'?WQIL$FWBXD'F GL jQIL Z  9>-/J 5589<-/5A5-/M 6H-.

*+3 M>5 B ±>     9  Z  L "  ! '    G>AJHL HB$<f@DbJHD@? >Y?I? JHBy>@M@F > G>AJHL E?IL&&f@D ?WDGJHL|O$>@?ID'? z Z z jQID'?  Z  >@O$DYQ L$? °?IL <f@D >@OPD@Q LP?    HDUQIL$?RQ L|x 'M@BXO$D JHBy>@M@F > G>AJHL|O$D@xy> 8D'F > ^L$? :>UBNJHL 6QIB!:O$><f@D•J4D'?O$D JHBy>@M@F > HJHF 0 z >@FWQIL z G>AJHL|O$D D Z Z L HD>d8d8de¹x D HL 6Q LP? LmJ4D HL jQIL$? Z E?IL&&f@D Q< z °?WL&&f@D [E?IO 4F   :>YFIJd}>@FIL   7 Z D'?RQ BXxX>—JHL  FID'M'FI>  G><f@D•L 8geg .

 "    mC E.    3S z   7 G>AJHL|LFeLPO JHBy>@M@F > 6Q L$?|JHL—> ?WL$F   .

  Z FILP?IL jQ >@F UD'?mD'?kJHBy>@M@F > Z QIBXxXB$`>@J4D'?   ! G < U TE?IL&&f@D &f@D z  W UD'?oJ:>@F >GF z  'D^O >Y? >@?W?IB BNJ:>D'x :>@J:> Z DeJ4LhJHL$?WL Z HD'? $#  #    #  %'E%'(     #   . >YF > Z   5 G>@? N Y> M'L$FI>@F•D'?•JHBX>@M'FI> xNB$ ^FID ~ "F oC" !…C  7   5959  B9   R 5.

- GD > $  6Q >@M'L JHD'?…J4By>@M'FI> Z LVVK!P >@M'D Z BNQ OPxy>@?W? D FWL$?IL 6QS>Ju?IL z H> $ >YO$D@QIL Z BXM Z z z  5 >@FWQIL z FID Z BNM G>@?  L HD>d8d8de¹x Z Q< Z Z LPF UBNQIL?WB :?I?WBXD :>YxkL  z XN`W G>@? 9    z > Z DeJHL 6Q D‘x hD -JHL jQIFILpD'? >YBX? z F D^JHL7‰?ILO$B\QS>@F Z . „ 5 ?cFeBX?WQIL \ € |„  FWD'M'F > Z >@? z >@x  .

GOPL|JHDbM b/[5WYV HJ4BX? QIFID     _YTNOUINH >YFWQ LmJ4D 6Q >@M'L gJHD'?dJHBy>@M@F > >YO$D@QIL Z Z HJHF GD  b/_YTNOUIZHb#O[L_  H>@xoFID@?IL {J:> z . [E?IO 4F Z Z Z >YM'D FWD'M'F > L$xX>•JHD b%a LVI Z z Z FID'M'FI> >@OPD@Q L‘LF^Q FWL G> Z xNQS> z M G> L& Z z L HD ^?IB Z xNL$? UL HD z >@FI>UJHB 'LPFI? >Y? ! F F J F > z N`RH `YOUTWMb%ROI  _>—QIL$xy>•JHD FI> $ 0 Z " 'LPx D O >YO$D@QILD.

  LVVK8P ? >@FL >YQIBXD 3S 6 -  5 >YF > Z L z   _ >Y?- G>@?AL   9    U#9 6    T U 6  5    5   " 9 .

 5 5   !  59  T  3     .   6  O  5 9   59 7  7   5 .

  ! F JHL \ g JHB 'LPFI?ID@? T JHBy> \        FWD'M'FI> Z :>YFGD'?•J4By>@M'FI> HL`> UL 6QIL|>UB Z UL 6Q L FID Z :?I?WBXD :>Yx - z L xNL UL 6QS><f@D—J4D'? O eJ4BXM'D'?  xy>YQ >Y[ED'F G>@?  LVVK8P b I `R[O_OMX b%ROI 5`<T5XH b VYI  FID'M@F > G> 7 dBNQ OPxy>@?W?& 3 Z D'?WQIBXxX>AJHL   FID'M'FI>  G><f@D•L U M  >:dB\Q O$xX>@?I?  8geg .

"    " GLP? UD z 4OO G>3JHBX>  9 ?RQ F >YJ:> z @DeO |O$D > HL$OPL      0 $ :> BXM - z  xX> ZHz D Z HJHD FWD'M'F > Z L|D'?JHBX>@M'F > WLPQIB$ 'D2> Q BNxXB$> z D Z HJHDJ‰?ILCD " 'LPx—L aD@FIJ:>@FUD b#M ZaWVZO[ z b#M5` 8b%aH FID@M'F > Z G> LVVK!P ?WD. DA . ..JHD !b FWD'M'FI> Z WMMW > L XN`W ]>GFWL z LG>hxXBN?WQS>3J4LUOPD z FWL$?IL 6QS>&f@DJHLAOPxy>@?W?IL$? Z 4L 6Q LP? -  Q z F > z JHBN? z HB HBXxNB`>YJHD'? D Z OPD L_?%f@DbM'L$FI>@JHD'?  gFWL >@?  Y> Z D Z Q BNxXB$`> HD JHBX> LVLVK!P 4L 6Q LP? -  HD@QS><f@D HJ4DG> FID'M'FI> Z  5  9   >@FI>M@L$F >YFpD'?JHBX>@M'F > Z >@? H?WL$F 'L. AD6 6 : 36  " ! :9  p    z _YTNOIZH    z L& Z 3  Z FID@M'F > _YTNOIZH L HD z  Q LPxy>hJHD BXM H>@J:>  kM@D'F >e  !     mC    .86 F :."<          K   '_ 1 ? 140  6 A 6 628  b.

D >—LP?WQIF z >  F > z >b>J4BXFILPBNQ > 4B jQ >@JHD'? G>@?)J4BX?  M 3     2 7R :    J G> GD HD'?W?ID2D {LP? 8D5PDGJHD@?dOPD z xXD’[ED'FI> z LVLVK!P YXN`Wb LVYI bBNx "NQ Z f@D 4QIBXJHDGL HDJHBX>@M'FI>  F > —D  M O`> G>@BX?)JHB$ @L$FI?WD'?‘JHBy>@M@F > JHD'? `Wb%a 5VYI G>—JHBy> 7? FWL$?WL 6QS> eLP?kJHL|OPxy>@?W?IL$?   UD'?JHL$?WO$FIL 'LPF D'? UD^JHL$xND'? % ) .

  #   % L E%'  %  7%   W~ X H?ILPF# @L HL$?RQ L jQ >@M'L M`<T FID'M@F > Z L z  BXM ULPQIDeJHD@xXD'M'BX>  ~ $ :> ! <[F F > z 3= JH> >YxTJHD z FWL$?WL 6QS>@J4D'? Z GD N`RYH FID@M'F > Z  O .  d   5  M  *6  .L I> - $ Z O > > >YF > !b VZO_5W WY[5Hb+ROI LP?WQ >?ILPxXL$OPBXD   -  G>  M b#O[_  .

     .

  5      :9     U 7 Y6 .

5 .

        P.

 GM 6  Y :9 ! <[9 .

    5 Z   5  .

E  ! !  7.

/.1-/ . 81S # &#"1 & U#%$ 1P#%$/ X& P( #W5&  S   5  6  S 5 -    9  5 . o?3JHBX>@M'F > >@? J4By>   € „ _ }  U 5 1 ( #    1 (   1 / .[W$ )1&# %$W'#$ &)15( ( . #  2 $  1  )5&)( 1 &+( W#! 1 ( 1 1.E$4!& 4. 0 .0#$21  ( Q  # &#"1 & U#%$ 1   (#4& & W W& =&ZW1 1 U1!( %W#1 &:"#$" & & E&& W#1 #& 4W&#%W$W ' &))( +*&.

   P. \   .    5  \   G6   9   G   O  .

 B . ! ]  5 5 Y   9  .

 . .

B=6 59      7 :9  . =6 59  .    3 5          > 9  G>@BND'FIBX>nJHD'? LD@?dFWL$xX>@O$BND }D D H?WL$F 'L z |OPD :> $ H?WQIBNQ BXM 3S 6 HJHF G>@? 0 z Z Z  5 >@FWQIL GD^JHLPxXD z Z  FIL L$F GB\Q L Z z >@F > z G>UFWL Z      >YBX?ƒB  Z D@FWQS>   jQIL D'BX?ƒFIL Z Z FILP?IL jQ >oLpBNJHL 6QIB!:O$>dD'?±D WL‡Q D'? Db?IBX?RQ L > D^L L|?+fYDb[°>YO$BXx GL 6Q LoFWL$O$D G> >YBXD'FpO$D FIL$?WL 6QS><f@D‘JHL Z FWL$?WL 6QS>&f@D DeJHL7‰?WLJHL‡QS>@x :>@F|D'? G>•O$xX>@?I?WL z  ‘> "XJ4D'?& pD L|O$D "XJHD•J4LmL$xXL GL 6Q D'?8 z z F > z Zf@DU?ILPF B HO$x z UL$? >[ED'F G> >YB HJ:> FID'M@F > Z UL 6Q D@?! LPxXD'? JHLP?IL  @D'x$ @L$JHD@FIL$? Z  GD :>   z G> z O$xy>Y?I?IL HL$OPBXJHD@?Q > HBXO$><f@D 'L I> z LD'?b>YQIFIB G>@BX? J4LPQS>Yx :>@JH>UJHD@?k>YQIFIB PQIDeJ4D'? ±B HOPx z B HJHDD'? Z 6Q D Z L$xND'? O$xNBXL 6QIL$? O$D HDbJHLP?IL  @D'x$ ^B GL jQIDJHD z Q D'?AL z Q D@?dB HO$x z B=?WL PQIDeJ4D'? QIB z GL‡Q FID@?_LGD)FIL‡Q D'F HD >@F Z Z Z GD >5 FWD'M'FI> DeJHL DULe Y>@xXD@F HJ:> Z FILP?IL 6Q >J‰?WL GL‡Q FIB$`>@JH>  L HD>d8d8de¹x Z Q< z .

[E?IO 4F 3 Z D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg .

           K$    oC  $ "! ." .

.: C . : C$. C G9.   Componentes UML do programa dia Classe Classe dependência nota generalização associação agregação {restrição} realização pacote pequeno pacote implementação caso uso mensagem tempo vida objeto Ator Componente note estado estereotipo ramo inicio fim ! ! F   U _'1 _'140  .  8  6  EC 8 $   J4L Z  FI> z   .

L I> 7 D3FWL$xy>YO$BXD 9 :> LPFWQ L HO$L_> Z ?FeL @L >sB 6Q LPF >&f@D 9 Q L 4?+f@DUB 6Q LPFW[°>@OPBy>@x= HO$LPBNQ BXM  FI> z WLPQID'? Z >•BNx z DeJ4LQIL$F±?IL DeJ4L UD'? QIL$FkD? Z JHD D z G> Z FID Z WLPQ D@?& ? z F Z z G>mxXBNM6><fYD  FIBND'?±>YQ FWB Z Q D'? YJHL HD z D^JHL ?WL$F Z UB :>YJHD'? G>•xXBNM6><fYD z FWM'B UL 6Q DGJHL z G>YQIFIBG? 'xNBXJ:>O$D WLPQ D Q L H?+fYDGB jQIL$FR[°>@O$BX>@x  5 . L& Z L HD z HLPx >@FI> ZZ LP?WQS> 7 FWL$?WL 6QS>@JH>m>YQ FI> aLPxXL$OPL $?TJHL z >O$xX>@?I?WL c.

  4 .

9       5  . @ .

5^=<3 J *+-/12. 9 >@x]L 6Q FWLkD z ?RQ F ><f@D•JHL WLPQID'?D'FIBNM'B H>@BX? ^? GL7FeBX?WQILe –J4D'?D z OPD z HLP?WQIL}?IL 6Q BXJ4D $ H> UL 6Q DUJHL—JHD@BX?dD HL xND Z 4LFf@DA[6"N?IBXO$>mD >|O$D z 3  0 ?IDUJHD z —" !    5 6  9 9  9 I = -68&:JLO9<6H(.

( !"     5  .

 5  \  G 5:  .

  9 4  F  .

    \ 5  D3  . 6  `JL*+-/12.

:. 8  898. C G9.C . : C$. 6  CE8 _     " 6     .( G>  FWL BNM > z FID Z Z FWBXLPJ:>@JHL: z Zf@D L 6Q DUDeOPD'FIFWL_>•B jQIL$FI><f@D > D WL‡Q D" D z BNJHD ? z FIM'L> Z FID Z FWBXLPJ:>@JHL FIBXLPJ:>@JHLmJ4LxNBXM6><f@D '1 _'1@?  .

  .   5 X . .

.

    . 9  .

 T.

.

 . 5 5 59     \  .

5 .

   :9          %  R  7    \   5  %R I G X    P.

.

   9 5 5  !    :9%6 =6   = 3S 6  5  .

3    -/585R(9SJL-/12.

( R? G> H>@?L$? LHO$BXO$> ^L$?dJHD Z WD'M'DbJHLm[  > z HJHD z $ :> HJHF Z z 4O$L$B\Q Q L aD@xpL z BXM  —O$D UD•FIL Z F > z FIL$?WL 6QS>YJ:>O$D 0 z >@FWQIL z z HBXFmD [ z FILP?IL jQ >@F Z > Z z z Z $xX>•? Q< z WL‡Q D'? …M'LPF >@x GL jQILU> 4BXJHBNFIL$OPBXD HO$BND [E?IO 4F z >@FWL$O$L O$D UDB @L$F aD'? e[ED'F > z 4JHD G>@?A?WLJHLP?IL I> z GD'? z G>U>Y?I?ID^O$BX><fYD >dJHLPQIL$F UB H>@J:>dQ >@FIL‡[°>?cFeBX?RQ L @FWBXD >•>Y?I?ID^O$BX><fYD L7FeL$O HJHD L 4JHL 6Q LP? Z @FWBXDd>kFWL`>@xNB`><f@DdJHL HO$BND z :> Z H>@BX?  WLPQID'?AB HJHL WL‡Q D'??WL_FWL$xy>YO$BXD LPx…JHL•O$>@J:>hO$xX>@?I?WLC G>—?ILPQ > L HD>d8d8de¹x UL 6Q L aD'xX>?%f@DsJHD@BX?AD > M@L$FIL 6Q Ln?WD'xXBNO$BNQ > > z >YxL 6Q FILGD z G>—L|?+f@DbB jQIFIB H?ILPO`> Q L aD@x=Q L$FWL UD'? L$?RQ LP? JHD@BX? D D^JHL HJ4D‰?WLb>@B HJH>JHL [ED@F FIL G>xNBXM6>&f@DO$D >b>@?W?ID^O$BX><f@DbL jQIFIL|DUM'L$FWL 6Q L|L|D•[ z Z Z WD'M6>@JHD@F_JHLU[  .L I> z FID@M'F > QS>@J:> z L Z H?ILPF# @L: >@FWQIBXOPB Z z L>b>@?I?WDeOPBy>&f@D•FILPO$L aL >UJ:>>@?I?WDeOPBy>&f@D eL z z 4D GL G>3>@?W?ID^O$By><f@D :>•JHBXFWL&&f@DbJ:>•?ILPQ > Z D'?WQIBXxX>AJHL  FID'M'FI> G><f@D•L 8geg .

Classe de ligação atributo: tipo = valor +metodo(): tipo  3 ."    5  4JHDOPxy>@?W?IL$?  FWL$?WL 6QS> Z Classe  Diagrama de classe simples Nome da classe Classe Nome dos atributos Diagrama de classe detalhada com atributos e métodos."]   $ BXM ! ] F  F > z        d K   0 BX>@M'FI> >_JHL|O$xy>Y?I?ILP? FWL    mC    . +atributo +Método() Nome dos métodos NomeModelo:tipo «estereótipo» Classe Classe Diagrama de classe Parametrizada +atributo +método() $ BNM +atributo: tipo = valor +Metodo(P1:Tipo=valor): Tipo ! "F  F > z  0 By>@M'FI> G>—JHL|O$xy>Y?I?ILP?FIL Z 5  FIL$?WL 6QS> Classe A HJHD  G>—xXBNM6>&f@D z Classe B nome: tipo = valor nome: tipo = valor ligação Representação de atributo e classe de ligação.

  .

3    3 5 6H&KJ`1 Q3 5  V    -  -.  %$.

  5  = 3. ! X B  > F > z 6 O  xNQ B z P?_JHL  O3 6O UL$FWD'?>@?e & > z 6Q BXJH>@JHL$? xXBNO$BNJ:>@JHLJ:>O$xy>Y?I?IL Z z R? k? >@?W?ID^O$BX> ^L$? YFIBy>Y?& HB 0 z Z z L$x }D >@F}L :>LbJ:> >_>@?I?WDeOPBy>&f@D z Lm>_OPxy>@?W?ILoL7FeL$FIOPL z '& QID'?L xNBXM6> eLP?& x\Q F > Z > DeJHL GD@?QIL$F Z G> Y>@B8>YQ z GDA>_O$xX>@?I?WL lO$xX>@FIL `>D UD_L7F4L L_LP?WQ > xXD Z Z HLPxy> UDeJHLPxXD3J4L•D  WLPQID'? L @L 0 :>—>Y?I?ID^O$BX><fYD aLPxXLPO$L cFWL$xy> ^L$? [  5 z DeJHL GD@?OPBNQ >@F>_FWL$?WQIFIB$<f@D >@?I?WLmJHLPQIL$F GB :>@JHD> Y>@xXD@F H>•FWL$?WQIFIB$<f@DbJHL|? Z I> >@xNB!:O$><f@D+B 6Q LPF uFIL$xX>@O$BND H>bL7F^Q FIL GBNJ:>@JHL .&K=>J`M<-:7 J`=<-/=<3  JHLGO$>@J:>D 5  WL‡Q DL  O$xy>Y?I?IL  > Z Q L$F z O$BXD 6 LPx Z HD UL ?I>@JHD z LDbFI>@BXD•JHL z Q L$F z  WLPQID 5 z LoBNJHL 6QIB!Z gO$BXFWO z Zf@D xND z FIL z BXM .

%R z z z @FWL`>3OPxXBXL 6Q L—JHL G>  FIL$?WL 6QS>YJ:>@? Z L O$D WLPQID'? BNQ D@?& z  z  5 >@FWQIL z 4D Z UD^JHL$xND•JHL|D 5 D^JHL l?WL$F}QIL$F  L HD>d8d8de¹x ? >@J:> :> Z Q< Z :>•FIL Z Z DeJ4L$F JHLP?IL aL JHLP?IL  @D'x$ ^BNJHDCJ4L 'L z @FIBX>@?pD .

[E?IO 4F z Z D D z G>@BX?LPxXL Y>@JH> 3 Z Z >@FI>’JHBN?WQ B HM z BNF HO$BX>@? J:>bO$xX>@?I?WL Z  z  9   5 :9[  7R 8 ?WDJHL 6QIL$BXFWD'?& JHLkD@FIJHL eL$F 'L FILP?IL jQ ><fYDJ:>@?B H?WQ xXL GL 6QS>@J:>Y? OPD WLPQID'?O$D WLPQID'?& O$xX>@?I?WL$?3JHL)D     .

   7R   R? |LPF >@x GL jQIL•>@?m>Y?I?ID^O$BX> ^L$?m?%f@DB HJHF $ > 9 >YF >_B HJHBNO`>@Fp>[ED'F >|O$D Z 3 M 6H3 M>1-/5G1>-.

&)-0-.

      :9 5  P   .585R(9SJL-/1'&Q3 5 3S 6 8U xNBXO$BNJ:>@JHL B HJHBNO`>h>YQIF >< Z BNQS>Y?nFILP?WQ FWB eLP?& 9 D \ xNQIB z WL‡Q D'? eOPxy>@?W?IL$? 4>-Q FIB :>@FmJHL 6Q FIDJ:> \  z G>>@?I?WDeOPBy>&f@D GD^JHL$xND•JHLAD z :>@BX?KL 6Q FIL D JHLe  z "$ 'D^O$D z ?  '&  9>-:7 TED .

 59  &)3 5 6H&KJ`1 Q3 5 .

5 R? .

 9 9 .

 59  MR 7?       . 7?    9   G  .

 .

     .

  . J -/=<(+&  .

 Z   O  .  ^7.

 H1  O$>@FIJ4B :>@xNBXJ:>YJHL D jQIL$BNFID'? G>@? D'?RQ BXxX>—JHL :> Z  Zf@DhJHL 'L ?IL$F >@? F YQ BNO`>A>  FID'M'FI> >@BND'FIBX>o?+f@D  G><f@D•L 8geg .

" . msg Class A 7? HJHD>@?I?WDeOPBy> eLP?& FILP?IL 6Q > Z NomeAssociação papel B nb "" .           K$ $ BNM ! [X F  FI> z    oC  $  0 By>@M@F > G>AJHL|O$xX>@?I?WL$?dFIL 5  Representação de uma associação. A Classe A papel na Classe B A seta indica a direção de execução da associação. +atributo +método() +atributo +método() Os colchetes {} incluem restrições relacionadas a associação.

  Class A Class B Class B {restrição} 7 %  R 5 9      .

  9 R?  R? F F F9  5 6  AF F = F F  9   .

    .

.

 9 <         .

.

C G9. \ R? ? ^B\QS>@F|>@?W?ID^O$BX> ^L$?mQ LPF O$By> ^L$? \ ? >@xXB :O`>YJ:>@? D z \ HJ4Lo[ED'F ^B\QS>@F>@?W?ID^O$By> ^L$? >@?I?WDeOPBy>@JHD }D GD HD DeJ4LD Z HD z z G>OPxy>@?W?IL ? >@F>@?W?ID z >>@?I?WDeOPBy>&f@D z |D HB!:O$> j?IBXM z HJHD LdD_D z WLPQ D f@DbLFeBX?RQ BXF  z > Z L$x Z DeJHLdFIL Z FILP?IL jQ >@F Z >YQIFIB z Q D_JHDAD z WLPQID Zf@DAJ4L 'L Q L$FpD 4LPxXL UL$? GD WL‡Q D Q D'? JHDUD z Q D'?mJHLbxNBXM6>&f@D3L z D@?I?%" 'LPx  Z ^M@L$F >Yx UL 6Q L LPxy> UL J4L ULmJHD'?d>YQ FWB Zf@DC> UD 6Q D6>YFm>YQ FWB YFIBy>Y? '1 _'1`_  .C . : C$. 8  DA C 26 2. :.    R .

   .

 X  9    :9  .

6      6H(Q=>( -.

&H6H3   5 .

    ? 5   9.4I =  7? >-.

B ! K   :9 M69 O3 6   6 9 \ 5  =3 6 T6  3 V  6     =  6 : 9  :9 3 6  9  \ .&H6H3 =<3  9 @ 6H3 . 9.

 4 5   .   -.

*+&)3*+-/12.

(   .

   .

 &)3 S9>&K58J .

9 \ _    FWL Z HJ4D HB UD'?( z >@M@FIL$M'><f@D > z > z FWL$?WL 6QS>)DD YFIBXD@?…D ! …QS> WL‡Q D'?K?WB JHL HD WLPQ DO$D D'?WQIDhL Z G>>YM'FILPM6><fYD  L 6Q@f@D N? f>@xNM ?IL   eL z Z Q B z G> 'LPF…J z & eBNJ:>?IL z \ eL$F z HJHF 0 z z  FIBNL$J:>@J4Lo> D   z pD z z Z >@BN?…OPD >@FWQIL Z >@FWQIL$?e H?WBNQIB$ Y> 6Q B‰?WB LUDOPD z xXLFeD Z B$‰?WL 0 UD'? QIBXxXB$`> z z L I1 ^L B Z @L$?WQ > 4JHD L3Q D^JHD D^JHLbJHB$$L$F|>YB HJ:>  FWL$?IL 6QS>@F >@M'FWL$M6> eLP?& BX?RQ D ±?IL PQ FWBXO$> 'D Z ?WL I> z DeJ4L gQIL$FLFeBX?RQ Z  L HD>d8d8de¹x Z 7? Z z >@FWQILbJHL HB :O`> z 4?IL L HO$BX> ”L Z >YFWQ LbJHL D z ..

[E?IO 4F z Z z [°> >@FRQ L JHL Z z z G>d>YM'FILPM6><fYD JHLD FILP?I?%f@D LPF > eLP? L7F4LPO Z Q< Zf@D ?I>@Fd>•LF Q FID  5 Z GDbFWL ^BN?WQID_?WBXM 5 WL‡Q D G>b>@M'FILPM6>&f@DG?WLA>Y?dD >@FWQIL OPD WL‡Q D'?? ^9  7R  DGD 3S 6 Z G>b>@M'FWL$M6>&f@Db?IL 'D^O z >3JH>@? z FI> WLPQID  .

 <6    7R  eL$F z FI>sQ D^JHD z FIBXLPJ:>@JHL•QIF > Z FID Z 3 M 6H3 M>1-/5G1>-.

&)-0-*.&)3*+-/12.

L I> 1 xXLP? Z ! Z >@FWQILkJHL jQID'?& WL‡Q D Z D^JHLO$D QIFIDJHL 'Lu?IL 6Q LPF ? >@F z z D z WLPQIDAJHL  G> >Y?I?ID^O$BX><fYD >@FRQ LmJHL .( \ FID Z D^JHLd?ILPF D Z 4D G> BNM H? O$>@?ID'?D'?JHD@BX? D z G>   Z $ Q z D z - >@FWQILmJHL G>—>@M'FWL$M6>&f@D  \ z >@FWQIL Z :> Œ >YF >oO$FWBy>@F Z UB :>YJ:>)L$?RQ F @c.

T9 5 @.

65 Q >@J:>@? ?ID 4FIL {L7FeL$O H[ED@FIL {Q > z 3 Z D'?WQIBXxX>AJHL   FID'M'FI> z .

QS>@J:>Y?k?ID  G><f@D•L HFIL 8geg .

"X   $ BNM ! KF  FI> z        d K   0 By>@M@F > G>AJHL|O$xX>@?I?WL$?FIL Porta regra_A na regra_B nb Parte +atributo +método() Todo  7R  \  7R  \ z eL$F '1 _'1 _ R? .

8 WL‡Q D'?[ED'FWL 7? {?IL z Z FWD 4D'F G>@x UL 6QILoO$D Š >@M6> Z >YF >bDUD Z 4?IBXJ4L$F >YJHD'??IL Q FWD z >@F >YJHD'?& Z CEF."    HJHD3>@M'FILPM6> eLP?& 5   5  7  5  Q >@J:>@? L z   No exemplo.C .  . a multiplicidade 2-6 indica que um carro pode ter de 2 a 6 portas. C C A 6 F 6    . C G9. :. um carro tem portas.C A 6 6 2. +atributo +método() L$FI> ^L$?L7F4LPO Z G>b>@?I?WDeOPBy>&f@D•?ILD'? JHD@BX? D z  aŒ R"  3 . : C$.

  S  6 :9 7  S6   .

  5  Z    : 9  5   I P 5 D  X.

.

6  56 :9 !  7? X.

L I> . 3 @6 @  B H?RQ F ><f@D > J4B$ 'LPFI?WD'?kD .

+hora +Hora() «Estereótipo» NomeHerança RelogioCronometro Derivada_A Derivada_B +atributo +método() RelogioAlarme +tempoCronometro +TempoCronometro() +ZeraCronometro() +atributo +método() +horaAlarme +HoraAlarme() +SetaAlarme() RelogioCronometroAlarme  3 6 5 M'L HLPF >@xNB$><f@D  G   ZZ6  . G>b>@M'FWL$M6>&f@D•?IL_>@? D eL$F  mC  Representação de uma agregação Carro +atributo +método()     FILP?IL jQ > Z +atributo +método() 2-6 NomeAgregação  $ :> ? > z z WLPQ D@? BNM  FI> z 4JHDAD_O$D L_O$D O$D HOPL$B\Q DJHL D^L g> Z GDk> -  >Y? O$xy>Y?I?ILP?JHL$FWB$ Y>@J:>@? ?%f@D•L$? HLPF > FIL `> 4L$F > `> HLPF > LPO$BX>@xXB$`> eLP?nJ:>•O$xX>@?I?WL Z DeJ4L$FID@? > LPF UBNQIB HJHDmJ4L$?WQ >@O`>YFpD: Z ]?IL cJHL$BFH>YFdJ4L_xNL Y>@FL fOPD FILP?IL 6Q >>Y? Z Z $>@?&  4?IL$F 'L :>@?IL z 6QS>>Y?d? z L >kOPxy>@?W?IL O$xy>Y?I?IL|JHLPFIB @>YJ:> >@? L z >@FWQIBXO Z H>@?IL z l>@D'? z xy>@FWBXJ:>YJHL$?  >@BN?TM@L Q B z dO$D PFIBXO$> D—J4L mJH>bOPxy>@?W?IL Z H>@?IL $ BXM z ! F  F >  0 BX>@M'FI> >_JHL|O$xy>Y?I?ILP?FIL Base 5  Y  FIL$?WL 6QS> Z HJHD Relogio +atributo +método() `>@?  HLPF > Representação de uma herança e exemplo.

6)J ( =<3   C9>.   ! 9     G6    G=6 9    5R58J`M<-6)9<&). 5      E9. 6  7 -=6  G   3 M>3&)-:7 J S-/12(  G>COPFIBX><f@DCJHL k? 967L-/585R3 5 = 3&:J 5.

-.

=>-/5 Q L < z Z D^JHLdQ L$F {FWL$x @M'BXD•OPFID  kD HD >@OPL$?I?WD HD z Q B z PQIDeJ4D GD j?IL ? z * 3S 6 HJHF 0 z  5 >@FWQIL z >@FRQ BNFJ4L Z ‡Q D^JHD'?ULs>YQIFIB D °1 z * z G> z Z PQ D^JHD'? J4L 'L {Q LPF > >@F GL‡Q FID@?pLkQIB D_J4LoFIL‡Q D'F HD Z UL$? >b>@?W?IB H>YQ z  T.

9 D—L7F4L  Z :>@?IL Q D'?UJ:>’OPxy>@?W?IL  T L-/585R3 O>-/5R3 967 D•JHL|FILPx 'M@BXD Z ˜s³¤¯vP³-¥$¥ WŸ /©R‡¯¢¯vš¶$·-¥ ž-£¤}·-œn¥nP³YšW¯¢¥ RŸ‡p¥ ³-­®¨ ©R¥P£¤¥n›°P¸¤¯vš·¤œ P¥ WŸ }¦¨®ž-£¤¨©W¥‡£¤¥}³@‡¯ƒ·¤œ ¥n›vš [U Hx :>@? m> >‘QIDeJHD@?D'? ULkO$D GL‡Q FID UL JHD D'xNB UD'FH? UDAD'? Z HD -/5R5R3 5 =>3&KJE5-/=<-/5 T 967 Z xXD—J:>  >  $ BXM U >@B 7 z F >    >@F >•>B FI> Z xXL GL jQ ><fYD_JHD ‡¸.

EšR¡v ›všKšW›°¡všRžY£/šK³-¥ ¯u¥pP›£/šWœn¥‡¨›W´ ±œn¥n³-¯vP³-¥ ¡¢¥-´  L HD>d8d8de¹x Z Q< z .

[E?IO 4F 3 Z D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg .

&  3^7L3 *+-/12(    5 `9 }D GLPO`>  HBN? UD L$xXD- Z >@x z  .4J`M<-/=<(.         o  6 X  7    WJ 5 &KJ`.

   .L I>•OPD GDbFWL      FIBNL$J:>@J4LAJHL Z Z PQIDeJHD cD z >@F >oD WR 5 Z z Q FWD WLPQID3L$?RQ ?WL HJ4D   z 8D "  J4DCLP?WQS>YJHD)JHL QIL Z DeJHLk?IL$F . ”D z cJHBN?IO$FWB UB :>YJHD'F O$D@?WQ  M'L HLPF >@xNB$>@J:> '1 _'1 _  OPD    .=>9T7L( HOPL$BNQID'? m?%f@D D -/585R9M 68( z O$xy>Y?I?ILP?3 L‘QIL z .. " VD z DbLmQ L {J z L 'L jQID  JHL GL  z {L 'L 6QID  H?WL$F 'L $ :> L$xND>YQ D@F =OPD LP?WQIL_O :> BXM FID @DeO$>@JHD  m>oFWL Z F > PQ D^JHD'? J4LD 7 Z z 3 M 6H3 M>1-/5G1>-.

5 L$xND D@F z WLPQID'?& Q FWD'?D –L 'L 6Q D  >@M'F >@JHD'?L {M'F z4Z z4Z HOPBy> z z z D'? OPD FWD Z Z GL‡Q FID >@F Z  Z HJHF 0 z >@FWQIL L‡[EL$B\Q Dd?ID z Zf@D+Q F > H? Z {L 'L 6QID eL|JHD'BX?}L 'L 6Q D'? Zf@DQ L xXL$?  z H? z JHL  QIFID WLPQID >@F >•D Z L HD>d8d8de¹x Z Q< z  .3 M 6H(.&)-0365.

  D UD D'FWQ > ? z @FIBND•LoO$D z jQIFID'xNLoJHL [E?IO 4F GD z ]> Q D'? 9 5 ?IL z HD'FI>UL   "\Q L z :>@x    R?   5 .

&)&)3 M 6H3 5@w 9 D'FI>@x'L 6QIFILL$xXLP? 3 :>YF L$F >YO$BXD Z L 'L jQID G>@BXD'FWBy>sQ FI> Z JHLPQIL$F GB :>@JHD =>@D?IL$xNL$OPBXD H?ILPF# @L ?I>@x=L$xNL$? ?%f@DbO :> G>dFWL$xX><f@DQ L GD^JHB :O`>&f@D H?W[ELPFIB 4JHDbB 4[ED'F > ^L$?& HQ F > >@?>  .  H? W5   Z F•L WLPQ D  DeJHL Z ?WL$F 5 6 LJHL‡Q L$F GB :>@JHDUL @L 6Q DhD^O$D@FIFIL Z G>@JHD'? D'FRQS>2>YxXM 5  D'?WQIBXxX>AJHL #TED'FIJ4L  z  QIB D’JHL Z (.     LGD^O$D@FIFILbL H?  GL 6Q D  @ FWDU @DeO$>•> Z L$xXDb?WBX?WQIL G>—D zZ    9 O  9C  z Y>@xND'F& z G>AD :>YFoD L z z =J4BX?WQIB 6QS>GJ:>@?oJHL >YBX?& >YQ FWB z G>C>&f@D3 z Q FID @FIBND—L FID @DeO$>DhL  eBNDJHL Z Y6 9    .  z z z L ”L @L 6Q DM'L$FI>@JHD z >@F >3DhD Z  >@?oD'?kL 'L 6Q D'?   .M±9(.

  BN?WQID Zf@DdLFeBN?WQ L QIFID   R z >dJHL L @L 6Q D@?& JHBX>@M'FI> z z ? z FILP?I?WBXD Z FID@M'F > Z FWBXL$JH>@JHL$?OPD Zf@DbFWLPQ D@F :> z  L$xND Z FIL$?WL 6QS> Z Zf@Db?+fYD•FIL$xX>@O$BND :>@J4D'?nJHLo[ED'F >—O$> z HFWLpDdD   >YB HJ:>_B 6Q LPFW[°>@OPLoO$D @FIBND>@D z Q DbJHDbL @L 6Q D m?L 'L 6Q D'??IB    FIL z UL D^JHDL 'L jQID3D^O$D'FWFILL fJHL‡Q L$F GB :>@JHD f>YQIFIB ? {D HBXO$> & eD FID 'D^O`>@J4D Z  G>DeOPD'FIF z $?JHLG>@xXM GLP?JHL+OPxy>@?W?ILP?CL  5  R  M   .

 :9     5  5  P.

   B 6   4 5   :9 \ J  .

 =  . =   \    5 U 7   <   \   5 .  5 5  .

9  3S 6  5  .

C 2CEFHG9.28  LP?WQ+" z :> GBNO$D UDeJ4L$xXDAJHB  5  .   . \ Z 5 gD "\Q L JHD z D  z z FWL$?IL 6QS>&f@D_J4L GD>3?WL$xNL&<fYDJ4L > Z DeJHL|?WL$FL  ^By>@J4DGJHL Z z Z o? :>b?IL&&f@D >YO$D@QIL$? Z  {L @L 6Q D  FID 'D^O`>@J4D Z DeJ4L?WL$F   " !  DeJ4L—?ILPF Z 4D  xNDALF^QIL$F 4D z WLPQID'?  G>@BX?kD z FI><fYDPL$FID Y?IBXOPD >YQ FI>< 6 2A 6 6 :.

  5    \    5 5  \ P.

<5 9  ! G    W  G=6 .

 Z z HJHD  LmL  @D'x$ Y>—B 6QIL$F ><f@D•LkQIL z  L @L 6Q D z LG?WLGFWL$xX>@O$BND jQID '1 140  . :. : F  QIBXxNB`> z UL 6Q D @>Y?I? xXD z 6Q D@? z D'FRQS> Z eJ z FID^O$L$?W?ID'? aJ4L 'L|Q LPF  G> €  G>: FID'M'FI> OPD   _ Z FID Z UL 6Q DJHLbO$xX>@?I?WL$? > z4Z xND'?nL>@?W? z _  DeJHD  >@x  =6  .C .

 z k UL$? GD z jQIL$?L ^J h€    FWL$?IL 6QS>@F Z >@M'F z >Y?I?ID^O$BX> ^L$?JHL 'L f?IL$Fd?IL GLPx :> Z z >B HJHBNO`>@F z <f@D|JHL z 6   5   6   R?59    5    5         5 .

0#$ 1 W1 1 $  %1  W 1 :& W1 1 W1 %$4W1 G()&T [  1M   1W1 1G( #$'& %W@()&T [  1 -  W#%$"&B&Q 1   1 ()&  [  1Z( 1  1  & =&  &   W %1#$"&Y( 1  1 7& =&U& 1@ #%$21 #7&)( 1 %#1  :!"1  5  5 :9    R  J 9  .%R B     <    - !K   %   (MK L   U 5 1 ( #    Y 1  (   G  W1  )5&)( 1Y&T( W#! 1M()&  $/ &: 01  =&#%$WG( 1T1./.

      ~ H?R[EL$FIL>oL7FeL$O WL‡Q DoQ FI> .b  88 b FHG9. C G9.   "K   FID'M'FI> JHLLFeL$O z U <fYD   G><f@D•L z 8geg .C . . : C$. :. 8  :$b .

":  $ BXM ! :G F  F > z  0  T°JHL|?IL >_JHL|L 'L 6Q D'? BX>@M'FI> 5        m   SU7 HOPBy> z Diagrama de sequência (de eventos) objeto_2 Class Name objeto_1 Class Name Nome Ator classe evento objeto_3 Class Name recursiva método duração método %R X6    7 6     5 O=6 6 12.

(   U6    V3 R?  7 < O   3 R?   7?    5  .

  \9 D'?W? >> z \ z @xXBN?IL LB 6QIL$F G PQ D^JHD* Q D^JHD L 'L 6Q D 8 ^L$?B 6Q LPF :>Y? z > f@D QS>@J4D.

: C 8LG962:. :..  . : F _ "   " . {D z Q > z WLPQ DUD HL$> FWL$?WL 6QS>@FdD Z " ! z UL 6Q L L ?IL I> z L L$?RQS> '? >@?W?ID^O$By>YJ:>> L$FI> ^L$?B 6QIL$F H>@?JHL|O$D Z GLP? G>A>&f@D g> > z {O$D z DeJHL7‰?WL Z z 6Q FWD'xXL ^B HO z xy>YFD_L$?RQS>@JHD WL‡Q D'?  6Q DUJHL|D z 6 2A 6 6 .C . z z {L 'L 6QID lL$?RQS>@J4DALFeLPO DeJHLm?WL_J4BXFIBNM'BXFp> Z '1 1@?  .

    :D WLPQID gDULP?WQ >@JHDUJHDbD z 6Q D^JHL {FWL Z fL 'L 6Q D3JHLL$FWFID z gL$FIFWD >U><f@D   5   9 I :9 D .    5  5 5 R?  7  .

   7 9      .

 >@?WL_B H?WQ > z k? > ^L$? J:> z 4?IB eLP?pJ4L HJHDA>@?QIF > UD•?IL 4JHD |LFeL$O L z   fJHL‡Q LPF UB :>@J4DUL 'L jQID3L z UB :>YJHD•JHL><fYD |JHL HD  4?W[ED'F > UD'?nDUL 'L 6Q DOPD FILPQ > Z LQIF >    .

5  3 B9   5 .

  5 5 I 8   5  :9 .

! F=   Y6 T 57 U D 5     R?   7?    \ 5  .

 5 9 5  R 5 " "  6  R  .

 .

 5    W T  GR SU "  5 5      \            .  9   PR " " T SU T  S U 5  .

\ 9      .

 %  3S 6  5  .

3   o? @>YxXD'FWL$?±>@?I? z ?I?WB z JHBy>YM'F > z LdD^O$D'FWFIL B UL$? GD L$xND'?±>YQ FWB Z $ :> BNM z '? D@F Z  F > z Z FID@Q @Q B WL‡Q Do>YD xND HM'DJHDQ L Z DmL L7FeL z Z LbDD z LmFIL z D FWL Z xXDJHLJHBy>YM'F > {D'?}LP?WQ >@JHD'? Lo?WLPQ >@?! FIL$?WL 6QS> Z D z FWL$?WL 6QS>D'?|JHB$ @L$FI?WD'?|L$?RQS>@JHD@?: Z |D LmFIL QID'?ƒJHL z G>JHLbLP?WQS>YJHDCFWL .L I> k[ED'F G>@JHD FWL$?WL 6QS> Z WLPQID>@?I? L$?RQS>@JHD z GLbLbD'?|L @L 6Q D@? G>oJHLdL$?RQS>@JHD FILP?IL jQ > Z z Dd?IL H?ILPF# 'L ^D z L D H?IB$ ^L$?}L 6Q FIL f>@?pQ F > °L 'L 6QID'? 7 LP?WQ >@JHD'? –L$?WQ >@JHD  FIL z FIL$?WL 6QS> Z E? 'xNBXJ:> 7 >Yx HOPL$BNQ ?+f@DUDeO ’OPD ?IBXM 0 z 9 xNQ >@JHD'? H?WQIF >@FWQIL z z YM z >@xeJHDmD Z Z LPxXD'? }D Z >@xNBNQS>-Q B$ Y>@?L> z z >@x$ >)JHL WL‡Q D 'OPD z 6QIBNQS>-Q B$ Y>@?  > z L$FkJ4D'?o>YQIFIB PxX?IB z ?& z Z 6QIL$FIBND'FILP?& L 4JHLmJHL  WL‡Q D Q D@? JHDGD z Z z >@?mJHL L$FI>YQ z z z YM z D'F LFeL  >@xXB\QS>YQIB$ Y>hFIL F >oJ:> HJHB$<f@D G>AOPD G>3>@x\Q LPF >&f@D  G>s>@xNQIL$FI><f@D1 UDm>m>@xNQIL$FI><f@DkJ:> Q L xND•>@O$B >|D•L$?RQS>@J4D—JHL L 4JHLbJHD'?mL @L 6Q D@?A> Z >+JHBy>@M@F > z HB!:O$>YQ B 'D z z FI>)J:> D—LFeL LP?WQ >@JHDJHL  L$Fk>@xNQIL$FI><f@DGL z L$FI>YQ Z >@xNQIL$F ><f@DoOPD  DeJHLA?ID@[EFWL$Fm>@x\Q LPF > eLP?- Z <f@DsJH>CQ L HJHF UBXJHD'? Z L$FI>YQ 8>3>@xNQIL$FI>J xND FILP?IL 6Q > Z °x$" >oJHL z °>_Q L Z 6Q B\QS>YQIB$ Y> > z z BXJH> F >_JH> >[ED'F >GM'L$FI>@xD'?oL 'L jQID'?_> > z >@F > Z @M z > 7 6Q L$FWBXD'FWL$? D'?WQIL$FWBXD'FWL$?& G>@?•JHLCL$?WQ >@JHD'? H?IBNJHL$FWL> L HD>d8d8de¹x L :>@?d>YQIFIB Z Z Q< z [E?IO 4F >@FI>+O$xX>@?I?WL$?GJHLCD Z z Q D'? FWL$xNL Y> WLPQID'?OPD 6Q LP? >YDUJ4L Z HBNF z O$D Z D@FWQS> GL jQID JHB GBNO$D {L$?RQS>@J4D D'?RQ BXxX>—JHL  FID'M'FI> G><f@D•L 8geg .

cambio de um carro «create» «destroy» Ponto Morto ré recursiva retornar 1 send   5 \ }D 5F    W R? HJHB$ ^L$? 5HJILKNMLOP XHVHY[I 3 \ YD I QI\XHVHY[I LPF >&f@D Z z z  QIB  O[5HJI HT5XO I H?ID 4 5 .       $   o BNM ! F =:F  FI> z "G    0 BX>@M'F > Legenda 5 >—JHL|LP?WQS>YJHDGLmD@?dJ4BN[EL$FWL 6Q LP?dQIB  5  UL H?I>@M'L H?& D'?nJHL Z Protótipo msg msg estado Início msg estado Fim mensagem Exemplo.

 X5H HJHB&f@D >•O$D FWL Z FWL [5HLW5M5` 5WXO\aH `a 5H`VWacb 5 ULmJHL‡Q L$F GB :>@JHD•QIL aL`aUVHJIZW   =6   aHY[  WLPQ D Z D Z >@F >?WL$FoL7FeL$O QS>@J:>hL—LP?WQ >>Y?  z YHab H  ZW  3 M 6H3 M>1-/5G1>-.  aWV   L•O$D 3 DbJHL|FIL$?RQ FWB<fYD>@DbD Z H HTLVZO\a^   HaOM 5HJILKNMLOP  `<TWYXO {L$?RQS>@JHD z ?^Lm>@xNM Z YHa >D z ?ID^O$By>YJ:>b>  `<TWYX5Wa\ROUT5XN` FS6   nQ B$ ^BNJ:>@JHL  4JHB&f@DbB G>•O$D  ?IL 6Q >@J:>GL 6Q FIL|OPD'xXO HL‡Q LP? 2   .

&)-4=>JL-.

*+&K-.

 .L$FIB Z z   5  5 {LP?WQS>YJHDGOPD  L_>UOPD Z xXL7F4D z {OPL 3 \  5%R  @FWBXD  Z R?  :>@?WL|JHL @LA?ILPF?IL >•O$xX>@?I?WL|JHL$FWB$ Y>@J:>—JHL 'LJHL$?WO$FWL 'LPFo?IL 5 DeJHL>  %R J z    .4-/5A=>3C3 5 6H-/=<(   \ ”JHBy>YM'F > G>AJHL|LP?WQS>YJHDGJH>bOPxy>@?W?IL \ ”JHBy>YM'F > G>AJHL|LP?WQS>YJHDGJ4L  \  \ ..

  3S 6  5 \ lJHBy>YM'F >  G>oJHL L$?WQ >@JHD FIL`>YxXB$>nJHLPQIL$F GB :>@JHD'? DGD HJHF 0 z WLPQ DbLP?WQS>b?IL >@FWQIL z Z Z Z D^JHL FWL  L HD>d8d8de¹x Z Q< z |FIL`>YxXB$>@J:> FWL$?WL 6QS>@FpO$BNO$xXD@?pJHL Z FID^O$L$J4B UL 6Q D'? ¤L FIL ^B$ 'D 4DU @D'?dL$?WQ >@JHD'?  >Y? .

[E?IO 4F  . 9 G>@?nJHL KLPxXB GB :>@JHD Z .

?dD'?>YQ FWB Z 'L$FWB!Z z Q D'?  z 5  L?ILD'?L @L 6Q D@?oO$D >@FRQ B Z C  5 YT  U   [9[   .

 @6 9 5  . 59  L$xX>@? ^BXJ:>  z " 'L$xB 4[EL$FWBXD'F  G>@?nJHLL$?RQS>@J4D 5  <  6 5  5 9 E6 . J‰xNDb>•L HOPD 6Q F >YF k?dxXBXM'> ^L$?nL 6Q FILD'? JHB 'LPFI?ID@? JHBX>@M'FI> JHD'?&   HOPBy>bJHD'?dJHB$ @L$FI?WD'?dJHBy>@M@F > H?IBN?WQ >@F >@J4DGJHDbJ:>bO$xX>@?I?WL|JHL$FWB$ Y>@J:> Z DeJ4Lm?IL$FdJHB eBNJHBXJ4D—L {J4By>@M'FI> Z x :>@J4D'? L$?RQ@f@DUO$D^L$FWL 6Q LP?& \ . .

°L 'L jQID'? O$D GL H? >YM'L H? HD_O`>@?WDAL D^JHLFIL 3 Z Z z L D z FIL$?WL 6QS>YFTxX>$D'?OPD D'?WQIBXxX>AJHL  FID'M'FI>  6Q+" Z WL‡Q D z >@FRQ BNx :>J dO$FWBy>@J4D D'? J > z  G><f@D•L HJHD 8geg .

>= X S "!>    k        mC   $        X 5  A      5    9     Z 5  .

.

   .  .

 F       \ 5 3  6  5  . 7 5 5  59 @ G6      6  5   @ .

 WJ 5  =Z6 < U .

 -3  6 5 @=6  5 9  7?  5  .

 5 .

 9%  .

6    %  >-7(ML  (7 .

F 3 7   \ I = F8]        .0#$ 1  X(4& 7& =& X( W# 1  4( 1 W1 %$'& W1   %    W#%$"& 1  1WWW1  & W1 % W  W#%$"& 1 [1U(  ()&)( 1      5  8 Z  6 9    PZ6 9 6  5 0R 9 5    5  5 5R    1 WWW1 F J  7  59    C=6 \  [1 FV 5 \    5 \ $21  W & 1././.0#$ 1  &$4 1) .0#$ 18&$/ 1) ./.   #   %  )  %  [$4 U1 U15( #1<1  #"1 &   )5&)( 1 :& &T( W ## 1Y()&M %$2# &# 1B( 1G( # 1 #$ 15( 1=()&  # & WWV( W#  81 [1Z( X()&)( 18#%$4  1.)F  # $21 & 1.

  #   % L E % -7E 3 3 5 3 SJ -/12.

(   =6 .

 .  9  5  \ 0   9 5 .      .    :9   B6   7? 9       = F <   :9 Z 7 .

  3  5 5    .

? Z HB 'L$xX>@JHD'? K G>dJ4L}L$?RQS>@J4D'? z >  >’?WLPQ >A z >Y?>YQ B eBNJ:>@JHLP? DeJ4L gOPD Z O$D HO$D'FWF HO$BX>‘JHL 6Q FID+JHL Ls?ILsJ4B$ ^BXJHLCL z  'LPFIM'BNF H> z G>’xXB z 4D@QS>&f@D m> :> 4B f@D z J:>@??IL‡QS>@?    °9 L$?WQIF Q z F >—J4L z m? L @L 6Q D'? D^JHL f?WL$F FIL Z L$?WQ >@JHD'?mJ4L D z L 'L 6Q D'?b?+fYD ?ID >@BN?AL7F   Z  xy>@F GL jQIL  FILPDeO Z .    5     By>@M@F > ?IL•JHBX>@M'F > L$?WQ >@JHD }D HO$D@FIF 6Q L>•? 6QIBXx H>@J:>_M@FID'?W? > D HB$`>&f@D JHD'BX?  D z UL 6Q L L$?RQS>@J4D z HB 'L$xX>@JHD3FWL G> WLPQID HDYQS>&f@D D@?WQ LPFIBND'F UL 6Q Lo>@?nJ  G>@BX?aJHLPQ >@x :>YJ:> n>YJ:>3L$?RQS>@JHDJHDhJ4By>@M'FI> HD’B jQIL$FWBXD'F•JHL aJ4B$ ^BXJHLCD.L$?RQS>@JHD’L z FWL$?WL 6QS>@F Z FWL$?WL 6QS> Z HJ4D ? > z ? z 5 z L‰FIDYQ B H>@?& z HO$BX>+L?IB HO$FWD D^JHL7‰?ILKFWL HB 'L$xX>@JHD'?  >@?dJHL•LP?WQS>YJHD'? :?WL UL$x :> L$?WQ >@JHD.L I> BXM   FI> z z >•FWL  P1 Z  JHL L @L 6Q D z Zf@D z Z J4L L HJHL Z ƒ€‡ˆG€  .

         FWDeOPL$?W? > Z     D1 ‡Q D^JHD'? ±OPD UL 6Q D@?LnO YxXO z L z xXD'?TFIL`>YxXB$>@JHD'? Y?WL HJ4D :>@FWBy> xXD'?}JHL_L HM'L xXL GL 6QS>@JHD@? PQIDeJ4D'?& LPxXD'? Z JHL …9 FWL$?IL 6QS>&f@DJHL Z z G>JHLbO`>Y?IDJHL L$OPB!:O$><f@D z n>@JHBNO$BND :>  z $L fL|O$D H?WD UL {J:>YJHD'?& z F G>$L :> € „ e9 JHBy>@M@F > J4LLP? LhDsL‡[EL$B\Q D z By>bJHL z WL‡Q D'? Co? LP?WQS>YJHD z >@FI>kJHL$?WO$FWB<fYDmJHD'? Z   ~ D'F% Z HBNL$F >YF% UDeJHLPxXDGJHL—D VD'?e Y>@xXD@FIL$?JHLUL 6Q FI>@J:>LG?I>"XJ:>JHD'? >O$D FID^J   $ zHZ WL‡Q D'?  UD^JHL$xNDUJ4LAD WLPQID'?& UDeJHLPxXDJHLkD  gD'?J:>YJHD'? 4?+f@DUB H?W[ED@F G> H>  ? >YJHD z   lD GD @L {D'?J:>YJHD'?&    HDUJHLP?IL  @D'x$ ^B UL 6QIDGJHL|O @xXO FI> z gJHL|?IL € |„ HD :>YJ:>OPD 6QIDhJHL•FILP?WQ FWB eLP?oJHD PQIDeJHD@?  | ‡Q D^JHD  ‡Q D^JHD'?  :>@xK?IL QIBXx & z LhD'? z UL 6Q L FILPxy>@OPBXD OPD G>@?nQS> 4O$BXD z GD   6Q LPO$L JHL 6Q FIDmJ4D z WLPQID  UDeJ4L$xXDh[ >@FWQIBXO    >YO$D z }€   Z kLP?WQ FWL$B\QS> B @>YxXL 6QILb> FIL$?W?IB 'D'?   GBNO$D FIL$?WL 6QS>YJHD'?mO$D Z —L& WLPQID UL 6Q L|J:>bO$xX>@?I?WL|JHDbD +D ~ GD^JHLPxXDJHB z gJH>@JHD'?  G>AJHL>YQIB$ ^BXJ:>YJHL gJHBy>@M@F > z  FID'M@F > Z ?ID FID 'L HBXL jQILGJH> Z HJ4D A>GJHLP?IOPFIB&f@DJ4D3D G> >@?bL$? Z -  L LPO$B!HO`> eLP?bQILF^Q z Z WL‡Q B$ @DL_JHD.

D^JHLb?IL$F >@BX?U>@xNM z z z L_?ILALP? QIBXxNB`>YJHD3J H?•O$>@?ID'?bJHL FI> z ?WD z Z L$FI>JHD 6Q LULU> JHD Z Z Z FWD'M'FI> >5 @?_>hL‡QS> FID'M'FI> G>s> Z > ?IL$F J4L$?IL  'D'x eBNJHD .L I> $ :> BXM R? J4L$?IOPFIB$ ^L$?dJHL ~   0/ 3S 6 HJHF :> 0  .

L I> z z FI> z $ BNM  >•JHL_O`>@?WDJHL z ?ID aD GLP? UDGB HO$x z Bƒ>@xXM z H? >YQ D'FWL$? UL H?I>@M'L H?kL  #   %  L  )%' € „  FU>bFIL FI> z  5 >@FWQIL fJHBX>@M'FI> ?ID z    FILP?IL jQ ><fYDJHL Z  L HD>d8d8de¹x Z Q< z .   G .

[E?IO 4F z  Z >@O$D@QIL 3 Z D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg .

   <.

Bin. true false Ativ. No exemplo um método de binarização  0 BX>@M'FI> >—J4LO$>@?IDUJHL z ?WD Diagrama de caso de uso Mensagem . Ativ. Executa binarização de imagem Cinza Img. Executa método direto direto O que ocorre dentro de cada método importante. Executa método iterativo iterativo? aglutinação $ BXM F FI> z <[F Img. Cinza Img. Ativ. Binaria Atividade Binarizar img. Img.$$^  .o     ' $ BNM   <C F FF FI> z d    oC" E    0 9 >—JHL>YQIB$ ^BXJH>@JHL BX>@M'F > eD*   K$ C    L_D^O$D'FWFILmJHL 6Q FIDUJHL z XF  =6 PQIDeJ4D z Img.NomeAssociação Descrição das atividades Ator %' )/(7    )%  LH L   #  ?  3   J  R 5%R D   5     ~ €  |   B HOPx HO$BX>GJHL|L @L 6Q D@?- \ z z B @FWBXD'?OPL xND Z G>—?IL  GD^JHB!HO`> eLP?  z HOPBy>bL L|D % ) % 7%  Z G> FID'M@F > Z  :9  7 FID'M'FI> G> R . Bin. Bin. Color separação O diagrama de atividade se preocupa com os detalhes de implementação dos métodos. Img.

AD6 .  @FIBNDb> z HFWL z f>@F# /D'? GLP? UD'?ƒBXx  ?WQIF >  . JHLPQIL$F GB :>@J:> 9 B$ 'DbJHDbJHBN?IOPD z B 'D z z 7  HFIL$>@xXB$`>AJ4LPQ LPF UB :>YJ:>@? 6 AD6 6 : C  . 6 .   ? z  ?IDdJHD z <f@DGJHD z GLP? UDUL|?I>@x$ Y>—DG>@F% HD '1 '140  _  h€ |„ YFIBXD@?JHL :>•LFeL$O L|DeOPD'FIFWL  F  D5 5  7? C O 7 ?FeL   #   7%  A n‚ GD^JHLPxy>@M'L ?WL&  " !  aŒ   3   .

 7      P.

 .

.   .

  5-   5    :9    .

 6  G F8]     .

3S 6  5  .

3    -  QIL$?RQ L$?_O$D [ED'F HL$OPL‘D.JHL DeJ4LU?WL$F ?WD>YQ FI>< $? WL‡Q D'?  ULPQ FWD'?nQ FWDeO$>@JHD'?L jQIFIL|D'?D z L 8D'F >&f@D D'?WQIBXxX>AJHL  FID'M'FI> G><f@D•L 8geg .J4By>@M'FI> 4O$L$B\Q z J4L$?IL  'D'x eBNJHDO$D JH>UB HO$x z ?+f@D•J4D'?D .L I> HJHF UD 0 :> z $ >@FWQIL BNM z 5 F > z O$D@xy> 8D'F ><f@D G>LF^QIL H?%f@DCJ4DhJHBy>@M@F > WLPQID'?L|J:>@? z G>+JHL UDeJHLPxXD'?mJ4L$?IL  'D'x eBNJHD'? 3 >YBX?|JHD'? z GL H? >YM'L H?dL >•FIL L HD>d8d8de¹x Z Q< z [E?IO 4F GLP? UD z Z G>UJ4L•O`>@?WDJ4L >@F FILP?IL jQ ><fYDJHL Z  H?ILPF# 'L Z D^JHL ?ILPF LGDJHBX>@M'F > z ?ID z ? >YJHD >3JHLbOPD'xy> JHLPQ >@x :> {J4By>@M'FI> G>AJHL|O$D'xX> Z z G>2LPQ > 8D'FI><f@D HJHD3DhO$>@?IDJHL z Z Z >.

28 " !  .X  <  < $ $ BNM  :F  F FI> z  <C   0 BX>@M'F > >—JHL  BNM F F8] FI> z  0 BX>@M'F > metodo(par) metodo(par) objeto_2 Class Name objeto_3 Class Name   :>@?WBXO$> 6 AD6 6 : C$. C G .

L I> :> $ BNM  Fb>bFIL $ Q D'?>@?W? z  G>•LPQS> z FI> z  59  G>•JHLO$xy>Y?I?ILP? J4L$?IOPFIL 'LhD'?e Y>@xXD'FWL$?JHD'?_>YQ FWB J4By>@M'FI>   .  G 8D'F ><f@D G>@?nJHL|O$D@xy> .

G  GL 6Q LADGJHBy>YM'F > >@? > UBXJHD@? z z [F F F > 0 Z 5 7     .

  .

 FWL$?WL 6QS>h>@?dB 4?WQ Z  {J4By>@M'FI> z  BX>@M'FI> .

  5 HO$BX>@? J4D'?kD WL‡Q D'?  D'FJHLPQIL$F UB H>@JHD'?|D >•JHLmQ L$?RQ L Z FILP?IL jQ ><fYDJHL Z BXM 8D'FI><f@D Diagrama de colaboração. Use para fazer testes lógicos do funcionamento do programa. objeto_1 Class Name Nome Ator Classe .

>—JHL|OPD'xy> evento '1 '1@?  .

  jQID'?& z Classe D $ _  «estereotipo» Objeto inativo instancia simples [estado explicito] HJHF 0 z  5 >@FWQIL z  Z Q< z .

[E?IO 4F FeBXxXBX>@FmD'? z .

assuntos. de instâncias simples ou múltiplas. Um pacote agrupa classes com comportamento semelhante.o       ' Diagrama de pacotes.  >_JHL|D HOPBy>@?  WLPQID'? :B H?WQ Objeto «estereotipo» Objeto ativo instancia múltipla [estado explicito] atributos L HD>d8d8de¹x Z >@FI>C> WL‡Q D'?  G>AJHL|D «estereotipo» Objeto inativo instância múltipla [estado explicito] atributos 59 Z69 WLPQ D@?kO$FWBy>@J4D'? ]BX?RQ D eL$F 'L Representação de objetos simples. 3S 6   K$ W     . ativo ou inativo. Um pacote pequeno Classe C  mC C   59  «estereotipo» NomeDependencia Classe B  >YO$D@QIL$? ]>Y?I? Z «estereotipo» Um pacote Grande Classe A  3 atributos Z D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg . 59 .

        ^  "k K$   R   <      m  C C  dC   ^    " "! '   ~   5 T€   R 9% .

.

FID@M'F > Z $ :> " ! G>|Lk? LP?WQ YQ BNO`>@?  F > z    n‚  } FID WL‡Q DL•J:>3L7F4LPO Z  _ n‚  JHBy>@M@F > G>mJHL OPD >@?}B jQIL$FI> ^L$? z HB HxNBXD@QIL$O$>@?nJHB eJ xXD'?JHD z BNM [F 5 FHX  G> ?cF4L  0 By>@M@F >    xXD'?pJHLkOPD Z '>< Y> HL 6Q L$? HL 6Q L$?p?+f@D D Z Z D    .

.

módulos do programa. . :9 6 . F CEFHG9CE8  FHX     5 59  7 . comunicação No «estereotipo» Um componente '1 '1@?  _     ?WL   L 4[ED5 z OPD Z L z  G D'?RQ D  G :> $ .  R? 5T49  9      SU   BXM  <fYD z  .L I> €P _ D^JHL7‰?ILb>< Y>@xNBy>@FdL$xNL UL 6Q D'?mJ4D '1 '140    J4D o  4L 6Q LP?kL|JHL|LFeL$O _   % # TL (77  #& % ) %  % '% (*)/8?  L    #   % L   (%'(*)%' % 7% % -% L -M?  5 5    h€ |„  '  D Z HL jQIL$? HB HxNBXD@QIL$O$>@?   5 G>AJHLO$D D Z HL 6QIL$?& Diagrama de componentes. .L I> :> $ 5 F F >5 F > D BNO`> BNM O  aD'FWJ:>@F O$D J4Ls> Z [ED@F > 3S 6 HJHF :> z FI?IDAJHL z HOPL$B\Q D'?oJ4L WLPQID—J:>AxNB HM O 4L$M6>@F Z z UD ^BXJHD'? z  D    5 >@FWQIL z dxXD  Q 5 Z z  O H> FI?WD z  L HD>d8d8de¹x 8geg Z Q< z 6Lo>|LF HM@D UD@Q B 'D 4JHBXOPL$?& Œ D'?ƒ>@? BXFD3OPD G>AJHL|L7F4LPO HOPBXD 6Q LJHL   >O$D zHZ Q FWD'?L$xXL GL 6Q D'? f@D[ z D'FUL$?WQIL >@F >b> Z z 8geg 8g gC >@M'L  {JHBy>YM'F > z >@FRQ L|B 6QIL$FILP?I?I> FWL HJ4B`>YJHD 0 K   6 F > z   . 59 6      9  5     5      8  . UL$? UD|JHL$?WO$FWL 'LmD@?pJHB 'LPFI?ID@?}O$D 4L 6Q LP? ^D FID'M'FI> Z D Z F > z D Z UBXO`>Y? 4J4xXxX? 4OPD $    z X  &f@DJHDh?IBN?WQ L >3OPD D@?oJHBy>YM'F > G>@? JHL•O$D z 6 AD6 6 : C  .

    T  6   U 9   G9    J 9  .7RG  @ 9      FILPDeO Z L 'L•B HO$x 0 '?B 6QIL$FIxNBXM6>YJHD'?& BNM :F  .

.

L I> 6 AD6 6 : C$C 'C  b 2.   6 CYD   JHBy>YM'F > «estereotipo» Um componente L$FIB :O`>AOPD 4[ z Z HOPBy> ?WD }D D'xNB UD'F:? GD_L .    5 W <5     0 &f@Dd?IL z   :>YFIJd}>@FIL D'F Z " ! G>}JHLL7F4LPO AD .

[E?IO 4F BNQILPQ z F >nO$D LPFIBN[ PFIBNO$D'?  Z L$xX>  -  z z GD'?RQ FWD  QS>@OPBXD ZHz :>Yx@L$?WO$D'x HBXJH> >•JHL—L7FeL$O JHBX>@M'F > L B HBNO$BX>@FKO$D LPFIJHL7‰?ILb>3FWL$xX><f@DJHL—D  Z z z <f@D &f@D z Q D^JHD'?bD'?UO$D z QS>@J4D'F ]D'? Z4z QIBXxXB$`>@J4D'? Z LPOPQ D@?TJ:>>@F# Z UDAD & - WL‡Q DhOPD HO$LPBNQ GLPFID—JHL O$D :DG>Yx z HD HO$LPBNQ D@?GFWL$xy>-Q B$ @D'?U>‘xNB HM 3 Z UD^JHL$xX>@M'L ”LkJHL z >@x 4O$L$B\Q D'? Zf@D•QIB z >@M'L D'?WQIBXxX>AJHL  GD^JHLPxy>@M'L HD 'D'? :> kM'FI> G>@BN?nO`> JHL Z  FID'M'FI> FID@M'F > Z D@BX? Z nOPD HJHL H>@D >@O$BNJ:>@JHL G>&f@D  G><f@D•L 8geg .

   X:] $ BXM    ^  "k K$   R <   '      oC" E    $  $ " "! KF F F > z  0 By>@M'FI> G>AJHL|LFeL$O    ' <fYD z Diagrama de execução. Computador Boro Servidor Físico Programa simulação HD <<«TCP/IP»>> CDROM Computador Silicio $ BXM z F F F > Programa simulação <<«TCP/IP»>> Servidor Lógico PVM MPI <<«TCP/IP»>> Programa simulação Computador Mercurio  Computador Uranio <<«TCP/IP»>> 5 5 QIFID'?L$xNL UL 6Q D@? J:> z  Programa simulação  Ícone de classe. Outras entidades da UML limite controle entidade um ramo Todos os tipos de conexões agregação «estereotipo» dependência «estereotipo» generalização «estereotipo» interface associação implementação {restrição} 3S 6 HJHF 0 z  5 >@FWQIL z  L HD>d8d8de¹x Z Q< z . conexões. drives. inclue aspectos de hardware.

[E?IO 4F 3 Z D'?RQ BXxX>—JHL   FID'M'FI>  G><f@D•L 8geg .

  .

   .

 .

   .

!"        & #  .

-.>.p.tE>././x/aHNql+W?m7®¯W °S±³²µ´ 8˜3›£+¦H-› ±³¶  ¤“ ¥ j£I·D¸<› ¶ £º¹ ')1I»HB?=C.0.¯Øsg/.L13P<N<BQP<.L1>g/NH1V2-*D4HE+N<.K4 .-.ƒ*-.>A](>*-N<:H*D4HAF4+^_.L.ed-4HAfE>NRg/./132DN E+./.+2-N<.H^“./.+.-./AS.‚P<.-.0./132D4HE>N<.L2-=?P<NSE>. 4J2D*0=CZ>.-.L^ÎE>NH.G2DN`.>132DN<.Ž4H.94 .ƒAF¾G2DNRE>N<.LxuaHNSl>WӋ3®GW Ú  ± Ö ¶ › ± ¡R¢ £Û¤º£TšÎ¦Œ£•§+¦/ µ¨Ã µª X™ZRd0.L.-./=Q2DN<.LB…4HxLs.L./^+N<.MZ>=CZ>B?=CNH2-.L2DNH.>AS.M(>*-NH:<*D4HAF4Hx/aHN>Ä_‰I4H*-EsÅ~4H*0.oE>=QP<././132DNTE+.-.L.L2D4H(I4H./gL=?½Ig/4Hx/R./:<.L­4H./Aw./* (+*-N<:<*-4HAF4+WYX[Z+.0./*0.Ž.L254J(I4H.+:<‰ .0.0.H^mu‹<‹<•”–W —™˜Gš›7œHŸžKœŒ ¡R¢ £¥¤ £šk¦Œ£7§>¦/ I¨© Iªn« .-.T.FUV.>. .0.G254H(I4J./.LAÆ.LBCN<./*0„/1>gL=…4H./^ÞEI4H. ./^IN<.@1IaJNS.0g/N<B?‰I4qEI4 (>B…4J2D4J€N<*0A94cE>./. E+.L2-=?PHNM.-.‚././*D4Jg/=CNH1I4HBŠ^+BC=C1+:<.02D.M.ƒ.G€./.@*-./132-.ƒASÏJ6 E>./.02D./g/4H./.LA94`N<(.q4c.L./AS(>*-./(N<=C.>=?EI4H.0254J*~NK(>*0N<:<*-4HA94M*-.02D4SN`(>*0N<:<*D4JA94ngLN<*-*0=C:<.ME+N<.-.@‰>./Afg/ÏRE>=C:HN>W³Ð8132D.I4HB?UV.L./132D=Q½Igu4H*ƒN<.0(“./WÙ' AF./.>./13PHN<B?PR=CE>4YEI4H.\2D.@*-.0.0€NH*-AF4HxuaHNcE+Nc(>*-N•d0./xuaJNFl>WÓÒ3®¯W Ô ›<˜ ¶ ››Õ¤º›LškÖ¦/ “¡R¢º£>ªqr ./.L*-./BC4Hg/=?N<1I4HAS.-.>.0g/N<B?‰>=CEI4s^>A94J=CN<*~E+.t.L.LE>=CEI4cUV.Ogu4J*D4HgG2D.pE>.F.>B?N  Wh}k4J*D4`A94H=?N<*-.+=C*Î4H(“.LxuaHN@l>WQmŒÜ3®¯W ÝÉ£VœHÖ¨Õ› ±³¶  ¡s¢º£º¹q« 4J.LA94K4q.ed-4S4H./13P<NHB?PR=CAS./AF4H.L^ÎEI4J./*\P<.L.L*-*-NH.OUV./*0vC./W_Ž*0=…4Hx/aHN`E>NS4H*-UV.ƒg/BC4H.02D*0.~E>NS(>*0N<:<*D4JA94 ¬€.0.™.q.ƒE>N@UV.ƒA94H1V.>A94 BC=?.+2-N<.-N<.‚g/N<1+g/.02D4H.L=Cx/N<4HAF. 4J2D*0=CZ>.>Af(>*-NH:<*D4HAF4+W r NsEI4J./gL=C.L*D4@E>N@(>*-NH:<*D4HAF4`¬­./.0./(g/=?N<1I4H=?./.L*0€.02D4 E+.[2D.OEI4Ê(+B…4J2D4•6 €N<*-AF4n./AF4cg/N<A¼NSNHZRd0.L*-./._254H*0.\25aHNb(>*-.`E>N<.tAFNRE>.-./4HBC=?×u4H1>E+Nn4H.-(.-./^Ig/NHAF(>=?B…4H*L^sB?=C1>ѕ4H*™¬­.Ž4HNq.>=?*@.-.L2-=?PJ4™=C1+g/BC.qgu4H(+v?2D./132-NcE>NS€./Wh'jik=?:<.%$   )' (+*-.S.G254Sg/N<AwN<.ƒN<ZVd0.0.+*-.G2p4HBŠWQ^ mŒ‹H‹Hl+^ŽN34JE 4J1>E _NH.MAS¾L2-NsE+N<.@=CE+.q¬­.LxuaHNFl>WÀË<®GW ̕¨ š ´ ›<¨Í› ±³¶  “¡R¢ £¥¤º£TšÎ¦7£7§+¦u I¨© IªMr *-4H1>.D4J.>=QP<NSE>.~.L*~=CAS(>B?.`.L.-=C.L.-./13P<N<BQPR=CAS.L^<g/N<*0*-=?:<=C*Î(>*-N<Z+BC.\2D=Cg/4H.@E>.-./x/aHNSl>W?mHm7®GW Ç3ß .-gL*-=Cx/aHNME>N@N<ZRd0.LxuaHN l>WÀÇ<®GW Áq¦Œ£/¸<› ¶ £È£>¦J-› ±k¶  ¤º£Â j£I·5¸<› ¶ £“¹ 'ogL*-¾/./^+.-./xuaJNFl>WÀ¿<®¯W Áq¦Œ£/¸<› ¶ £Â¤ £˜J8˜ ¶ ›<¨Ã ¹™« .L254JBC‰I4HAS.~E>=?PH.ÉE>./:<.M1>NOE>. rpy X@zH{ y| 4J(>*-.I4J=C.MgLB…4H.I4H:<.q¬­.0.>.0.02D*-4n4H.-./132-NcEI4H.[E>N`(>*-N<Z+BC. UR./13254JEI4H.0.+.+A94SBC=C:<4HxuaHNcE+=C*-.p.)4H.ƒ./13254HE+N>^3.~=C1s€N<*-AF4Hx/R./132DNcE+NF(>*0N<:<*-4HA94¬­.t1>N`gu4H(>vQ2D.-=?.0.oE>.L:<*D4H*oNH.>AnZI4H.‚*-.+*D4`E>.q¬­./A.0./^ AS.-aHNnE>N<.0g/=?AFNY44H1>»HBC=?.>.>*-4Kl>WQm[=CBC./B?( .0g/*0=?254J.G254H(>4H.L132DN<.+2D.p.0AFNcUV.>*-E>NH1 ^mŒ‹<‹<R^>')1+1 | W>‘’=C1VZ>BC4HE ^“mŒ‹<‹<7” † y 4H*\2D=?1 4J1>E y gŒŽBC.L.-.L.I4J=C.>BCNH./13254768.[N<./^E>NH.@4H.)1>.+1>g/=?N<1I4HAS. †ˆ‡ .+BCN`2D.LB…4J2-=?P<NH.~¬­.

ÇHÇ    .

>*D4ql>W?mHÄ « =?PH.L(“NH=C.0.+./.>A ./13P<NHB?PR=CAS./*0PH. doc Implementação Iteração Imp.L2-N>W[X™Z>.hE>./*-v?.L*-.>.qE+./Af€./4HBC=?×u4H*o.-gLN>` W \s.0.qN`./*-.).L./g/=Q½Igu4JEI4H.>(“NH.L132DNSE>.‚E>./=Q2DNc.L254J(I4H.>=?BCNcUV.>AÆE+NsgL.)=C1>=?g/=…4@g/NHA¼4KE+./. E+NO(+*-N<:<*-4HAF4+RW QÙ13P<N<BQP<.@N<.‚(>*-.O=?1>=CgL=…4H*M4H.0NFE>.‚./.L.-(./13P<NHB?PR=CAS. de classes./g/=Q½Igu4Jx/R.+E>N`UR./*\P<.>.02-=Cgu4J.doc doc POO.-./.L*D»™E>.+./.p./1V. de estados.n.L./gL=?½+6 g/4HxuaJNF._:<*D»J½>g/N>^W \s.0./132D.0. de caso de uso Especificações Análise Orientada a Objeto doc AOO.ƒgLN<A N<.>. 4J.0(“.>AS./.-(.M./^ÙE+.-(.Ùg/BC=?.ƒE>=…4J:<*D4HAF4H.>A a Q | } .doc Diag.ME+.0././.>.@N<.\2D*D4 4J.@.@.0./132DNcE+.nE>.@E>.>.-(.¯68.L.-NJ 28Å~4H*0.L1>‰>N>W « .t.L=?2D4H.\2D=CBC4nE>./Aw.LPH.~.MN<Z>*-=?:34J2-N<*-=C4HAF.0(“.G½I1>. NH. de colaboração.-.@.-4H1>E>N).>AS.+2-=CBC=?×u4HE+N<./13PHN<B?PR=CAS.o.@E>.L./*\­4Hg/.ƒE>./*D4J=C./^ÞN €N<*-AF4J2DN E+N<.-gJWÓZ+* Doc./*ÎE>./AÆ./132-NE>.Ùg/N<17d0./132D.LB…4H./E>N<*0.D4•2D=C.Ž.\2D=?*[./.>*D4l+W?mc=?BC./.ÙN<.0.K.-(.ƒE>.M}Ù*-N<:<*-4HAF4HxuaHNc.@UV.L2D4H(I4`E>.@./13PHN<B?PH.G254H(>4+^º4J./gL=?½Ig/4Hx/R.L=?254JE>N<. de atividade.L132D.>.0NH 28Å~4J*-.`E>=?.0.LP<.Lg/=?½>gu4Hx/aHN>W 'ik=?:<.`.SN *0.0NF(NRE>.-/0 XÈE>.6.)NH*-=C./*-.-(.L½I1>=?xuaHNcE>4H../.@. Testes/Bugs Documentação ')(N<.>.>B?2D4HE>N`EI4`.GØs=C. 4T.M4H*-UV././.-4H./A]*0.E>.0.-.L./.L. 7N6?<O67>2<*b>4B7N6 ]9 c9 W= K 4ed D•W[X gLBC=C. A4S>2<O6UWV D 7 D = DYX  X[Z <! D•]W \s./gL=?½Ig/4HxuaJN9¾[.G254H(I4cE>.>.nN UV.-.L.ƒgu4H*-4HgL2-.ŽPJ4H=R./.L132D.™.L*D4HE>NM(./*0.p:H. doc Projeto do Sistema Projeto Orientado a Objeto ProjSist./W Esp.[(I4H*D4`4n.LA .[.Lg/=Q½Igu4HxLs.0. 1>aHN94n€N<*0A94ngLN<ASNc=C*D»n­4H×L„G6 BCN> W 1 3254 6 4 87WWW#:9.doc Diag.L1+½IAÆ2D.>BQ254HE>NH.FN@.-(./Wh')./132-N E>./BCNH.+./AS(“.L254J(I4cE>./AF4™E>.L=C*-4`./.@./^>(N<*0UR.ƒ:<.n./*h:<.L.q¾@N<(g/=?N<1I4HB–^s.0.0.0.+d-4H1>./*ƒZ.0.L.ƒ.G½I1>=CE* D  D?FHG >4AI D J9 DLK < DNM <O6?=P6 WhXÛg/NH1V2-.L132D.LP<.    "!$#&%('*)+%-./gL=?½Ig/4HxuaJN>W ik=?:<.>B?2D4HE>N9E>49(>*-=?AF.L.cPH4J=³./gL=?½Ig/4Hx/R./132DN<.LBC.-NH 28Ŏ4H*-.K.-4H.>13254HAS.-.‚gu4H*-4HgL2-./*ƒ.>=QP<N<.M.LA 4H.ƒE>NsgL.cE>.>A4JAnZ>=C.9 W6G<W= 6?>/3@0#A>B6 C 'Û(+*-=CAS.SE+.>AÆ.@./132DNFE>.>1+g/=…4JE>NqE+NM(+*-N<Z>B?.S4 .0(“.nUV.L./^ ¾qNE>NRg/.ME+=?P<.-(.L*D4HE+N<.>A (>*-N<:H*D4HAF4+WcX™Z>.Lg/.[E>.M4H1>»HBC=?.@N`UR.0.SUR.+./.L½I1>.>AF4tNH.ƒE>NS(>*-N<:H*D4HAF4+^I4HUV.SN (>*0N<:<*-4HA949PJ4H=Ù=?AF(+*-=CAS=C*ƒ.+€.L.>AF./.K1>./x/aHN E>N >/ KSD 9 GA4S> <3@T67W ^Þ4€N<*0A94FE>.LP<./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.-.0(“.LW '). de execução.-.T€N<*-AF4J2-N>W™} NsE>.0.q*-.02DNH.0.L. Componentes.\€.doc doc Testes/Depuração Ciclo de manutenção 't1>E>*0¾ « ./*™./=?*D4™254J*-.Lg/=Q½Igu4HxLs.).0./.DaHNS4cZI4H.>4H*02-.-.~.L254J(I4H.GP<.-.)E+./gL=?½Ig/4Hx/R.~1I4c.LA ihEh .nRA _>BQ2D=C(+B…4H.-./B?.L13254HEI4c4 NHZRd0.gf‚.GØR2DNcE>4n4H(>B?=Cgu4JxuaHN>^VN<.L*/W ').ME>.nN*0./*ƒ.-=?EI4HE>.GP<./.`4 =?132D.>.M*-.L­4q¾)E>.doc Diag.LW \R.@gu4H.n.

   " e   [ .

@4q.-.-.LAf*0. 8 \s.>132-N<./:H.K*0.p*-.-.KASN<.™4H.cE+.sØs=CB?=…4H*hN +( *-N<:<*-4HAF4HE>N<*³1>4™=CE>.L132D.M./.0.-./.-.hg/NHAF(N<1>./W 8 X%*-.~UV.p.LA"Z>=C1>4H*-=?×u4HEI4So {tAF4`=?A94J:<.- .L*-.qgLB…4H.L^Ù4H.-.0254J1V2-=?PHN<.-.L1V2-.b4J2-./*D4J1>xu4H./132D=Q½Igu4J*ŽN<.GP<.0.>A94cN<B?‰I4HEI4n1+N<.-aHNS(“N<./././BC4H./xuaJNYl>WˆlV®F.M4cg/B…4J.>132DN ¾ .02-*D4H*ƒN9UV./1>x/aHNÕ.@g/N<AS(>B?.L1V2-=?½Ig/4HxuaJNME+N<./W ?A@ B 0 $#T.~E>.LxuaHN l>WÀß<®¯W™')(>*0./W 8 XAFNRE>.-.0NH 28Å~4J*-. .`4.>AÆE+=…4H:<*-4HAF4KUV.L.LA N<Zs2D=CE>4OgLN<A NAS=CgL*-N<.-.0./*D4J1>xu4H.L^~N<.M.-NRg/=…4Jx/R.0.L254J(I4qE>NqE>./132D4H*/Ä {tAF4 =CAF4H:<.-./B?N<.M4H.-N<.Ž:<.>v?EI4poI.M}Ù*-N<:<*-4HAF4HxuaHNc.>A E>.K.c.ƒ./B?N`E>.0N>^µ.-.-(.LxuaHNF+WӋ+WQm7®GW 't1>E>*0¾ « .>A.&  Ç3Ë   ( E  T'T"#  0 '#!#" % .K././132D=Q½Igu4JxuaHN[E>.-gJWÓZ+* ')(N<.-.Lg/=?½>gu4HxLs.0./A gu4JEI4./:<*-4H./13P<N<BQPR=CEI4 . f‚NsNRg5‰Y¬\mŒ‹<ÒH‹3®G^4 4H1>»HBC=?.+BCN E+NF(>*0N<:<*-4HA94sWÙ}Ù*-NŒPJ4ŒPH./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.>AÆ4H.0.>A(>*-N<:H*D4HAF4[¾)4'3 4 Z54 '6-<!"4S> 6.@.Lg/.-.o.02-./A"(I4J*02D.sØs=?BC=…4J* PHNsgL„q.pAS¾L2-NsE+N<./A ./^ gLB…4H.-./4+W }Ù*-.@g/BC4H.-./1>¾L*-=?gu4cE>.0AFNq.>(.-. =C1>E+=Cgu4JA (N<B?=CASN<*0½I.+(“.>.t.™E+.M¬ P<.L1V2-.)./13254768.-.n¾q2D*D4•254HE>NFN<.qE>.L*-g/BC4H.L132D*-.>.0.-.0./.0.0.tE>N`. ASNRE>./132-N<.0.ÙE>=?PH.\2D.@.>Aw4H.LE>=CAS./gL=?½Ig/4Hx/R.-./BCNH./1+.@.+1>E>N 4 2-¾/gL1>=Cg/4 E+` E>NF(+*-N<:<*-4HAF4+ÄhX™./.LW .ƒ=?E>.>.+BCN 3®G:W 9p.+2-N<.@./*SE>./:<.LP<.LWŽ{p.02-*-./BCN`4JAF(>B?Nn.L132D=?½>gu4H*oN<./B?N©E>=?<1 . E>.>A94J.>=C*‚.)E>./^>NH.0./*t€.-.>A (>*0N<:<*D4JA94 E>./:<*-4H./:<.LxuaHNÊl>WӐ3®G^pNÕAFNRE>.0.9‰+./^ÙN<ZRd0.>.nPHNsgL„nE>.s2DN<.\2D./13254•6 .-.@.pE[_+PR=CE>4H./=C*-4nE>.G2DN<.OAS./*0=C×u4JEI4po>.-.‚*0.DaHNSgu4H1+E>=CEI4•2DN<./.LAf./13254H*oN`B?.>AF4n=CAF4H:<. ¬€.D4J1>E>NJ6 .-4c4HBC:H.@AF4H=C./. $Y.>=?*)NUV.LAÆ.FPJ4H*-*0.p4H.>AF49E>=?./A (I4H*-44H./.-.L2-N<.-.~EI4S»H*-.L.L./=CNH./.@ASÏsE+.-. >= -.J^I4H.-.0././132-=?½Ig/4`NH./BC.8d-4Í~4H(+v?2D.-.ƒ.LAF.ƒPH.p4H.L^>N<.ed-4`.[2D*0Nsg/4HA An./13P<NHB?PR=CAS.L*p.02D.ƒg/B…4J.>.>AF4c=CAF4H:<./.)=C132D.LA i hEh .0g/Ï<(>=?N .O1>4Í€NH*-AF4©E>.9.>4H*02-g.FE>.>.0./132D=Q½Igu4c.-.pNHZRd0./g/NH1>.>B?N>W }Ù*-NRg/./.>(N E>./A gu4H*-4HgL2-.+./E>./Af(I4H*-4n4H.ÙE>N@(>*0N<:<*-4HA94sWÎ' =?E>.0./*0Z“N<.+AÆE>=…4J:<*D4HAF4KE>.I4HB?AF.É4HZN<*0EI4HE>N1V.-./*0.>BCN<.>AÆgLN<1•d0.ƒ4c.p‰+.ME>. 0'&)( #*" 0 +.0.L2-N<.-.>132DN¬–4`.0.T4J1I»HBC=?./=?.>A:<*-.LB…4HgL=CN<1>4HAF./.p.LNsgL.LBC‰I4H132-.>Z+.>.>E>N+W[{tA4H.u®GW \s.oAS¾L2-NsE>NH.4J.0./^k4J2D*0=CZ>.G2DN<.02-.-.+€./^pNÍAFNRE>.q=?E>.0.K.%C#!D $# ' 0 &)( * # " 0 E1 ')(+*-.-NRg/=…4Jx/R.[¾[. 4•2D*-=?Z>.>BQ254HE>N`EI4`4H1>»HBC=?./B?NF€./.+=?254J.>AÆASNsE+.L.L(>*-./.-N PJ4HASN<.GØs=C.-0/21 ' .M(>*-./BC‰>4H1>xu4J.-./. ASNsE+.02-=CBC4KE>.L=C.0./.0.Ž(I4J*D4K=?E>.L132D.>(I4H1>E+NFgLN<AFN+W 8 '%4J1I»HBC=?. (NsE>./=?2-N<*~.+A ASÏsE>./.-vQP<.0=Š^.L132DN<.c*-.-.0v?P<./.p:<*D4H1+E>. N<ZRd0./B?AF.+A94 =CAF4H:<. f‚.~E>./*0g/B…4J.(NsE+.02D4H.-aHN>^º1V./AS./.\2D.-./BC4J2D=QPJ4HAF./4HBC=?×u4H*p.L.K4J1I»HBC=?.-N<.L.‚N<ZRd0.L=?2-N>^I1IaHN ./*2D*0„/.>132DN+W cdPebfhgjilkEm 8 9t.`.ƒBC=?PR*0N<.@E>.L^kAS¾L2DNRE>N<.0.L1V2-.>.ƒ./.-gL.>132-Nc*-.~*0.@.-.-.6]676 FHG > DS¬­'pX@X@®GW 'Û'pXMXÈ.-.>.-. .LPH.-././:H*D4H. =CAF4H:<.-./B?N©E>.-./B…4Jx/R.@=CE>.ŽgLB…4H.™­4H×L. N ASNRE>.LW ' 4H1>»HBC=?.ƒ./A *-.n(NsE+. g/4H.)*-.@E>.>.L132D*-.0./.L.Ž./*@=?1>=CgL=…4HEI4F4 (I4H*02-=C*™E>4H.0.MNH.>=CB?N9UV.L1V2-.M(I4H*\2D=?*oEI4H.-.-=CAS(>B?=?½Ig/4HE>Nc.`g/BC4H.\2D./*tg/N<1>gL=C.p4H.0.GØs=C.F(N<*-NH.0=CAn.>132-N<.>1>EI4M.0(“./^I4J.0./W FGIH!G>J KMLNPOQSRUTVXW Y[Z]\^LN_W `S`ba OQS\ ` t{ A 4H.t¾@EI4J*o.>1>gL=CN<1>4HB~¬€.GØsN>W {tAF4nZN34cA94H1+.>132DN E+.L2-NsE>NHBCN<:<=C4 rpy X ¬ P<.-g/BC4H*-. 4 AS.D4HE>NS(I4H*-4cN<*-=?.I4H.-.>AfgLN<1•d0.G2D*>n<1>=CgLN E+.+1V2-N<.GP<.™=C1+€NH*-AF4Hx/R.`.+*D4po³.-.¯Øs=C.LW QÙ.-.-.M./132DNqE>.LPH.p(N<.>BC4HEI4+W qrIsMtumMy N<132-.S.>132-NO¾K4HUV.DzJg/NHAF(N<1>./:H.™./g/4H.@Z>=CZ>B?=CNH2-.0.-.2-. gu»HB?g/.HAS=Cg/N¬­./.

ÇHÒ  E .

 " FGIH!G .

   (  KMLNPOQSRUTVXW Y[Z]\^LN_V W `S`bNP` .

-.L1>gu4H= Ø+4H*@Z“./B…4J*og/N<AÆgLB…4H. AS¾L2DNRE>Nc½I×L.+2D*-49UV./A *-.@¾@€*0.L1>gu4J=QØ+»•68B?./.M}Ù*-N<:<*-4HAF4HxuaHNc. \s.LBC=?AF=?1I»•68BC4+^ N<.L*h4Hg/.-.L.@*-.L./*-4H1>E>N<.0.0A94n=?1+€N<*0A94Hx/aHNn.>.Lg/=?½>gu4HxLs.0.L1>‰I4.LPH./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.0.L1V2-.[1I4H.-./1>E+.0.>AF4SNH.™NSAF.L^>P<./.L2DNH.@.L=?2DN`ZI»J.>1>E>R N fŽNsNRg5Ñ ¬\mŒ‹HÒ<‹3®G^R(I4H*-4q.ƒ1I4`.0.~EI4`g/BC4H./B–WÙXÈ1>N<AS.t4q.8d-4F.>=C*h4Kg/4HEI4Mg/B…4J./.q../B…4c¾@.L:<.L132D=CE>4HE>.-4`UV./.Ž.0./132D4HA 4SAS.L(>*-./^>P<.K*0.-./132D.L.-.-. E+.0.‚./(+*-.*.L13254HEI4gLN<ASNF.H^J*-.0.0.-ASNc1V.OA94H=?.0./132D.>4H*02-g.\2D=CBC4nE>.+2-*D4Sg/B…4J.-./x/aHN+WÓÒ+WÀ¿sW 't1>E>*0¾ « .kPH./gL=?½Ig/4Hx/R.G2DN`¾™.>AF4Ã4H1>»HBC=?.0.+*-- m '1+N7PJ4cg/BC4H.@E>.q4F.L./AF4+W 8 y NsE+.>A%gLN<1>gL.-.o4J(“.\2D*D4JxuaHNS.q.ÙN[.\€N<*-AS.@.0=CAS(>BC.-»H*-=C4H.>*-:<=?E>N>W \s./×L.>AF4KgLN<=C.LA94+W 8 X%g/N<17d0.LA i hEh .ƒ4[.Ž4qg/B…4J.+2D*-4H./*ƒ(“NH.0.p*0.+€.\2D.-.L1>g/N<132-*D4H*~g/4H1>E>=?EI4J2D4H.GØs=C./:<./g/.@4JBC:<./(>*0.0.-.>.-.>Afg/N<1+g/.~€N<*³=?AF(N<*\254H132D.pE+.L.+AÆE>=…4J:<*D4HAF4KE>.>AF4™./.o4c=CAS(>BC.MNsgLN<*-*0.o.o./.0254J1V2-=?PHN<.L.>AF4c4HZ>.>g/N`.-.pg/N<.t4J.>.p.q*0.0.0./=?./W e e Mt g t thr Ee      r jsMt s.-1+.[4H.q./.L.>A94™.L*ŽEI4JE>Nn4KgLB…4H.-.LPH.@­4H×[.[1>N`E>N<ASvC1>=?NnE>NS(>*-NHZ>BC.>=Q2DN g/BC4H*D4s^ 1IaHN .L1V2-.-.-NRg/=C4HxuaHN+^RgLN<.K2D.™.-.-vQP<./AF4+W 8 \s.0N<BC= 6 g/=?2D4H*-=C4HAOW e e Mt g t thsMk e t k t Bs.-.L.L(>*-./.-.F(“N<.>AF4K4H.LA94+^“P<NRg/„`E>. .L132D*-NSE>.MAF¾G2DNRE>N<.FE+.-=?:<1>=?½>gu4J2-=?PJ4K(I4H*-4cNSE+N<AFv?1>=CNKE>NF(+*-N<Z>B?. (I4H(.pE>.-gJWÓZ+* ')(N<./.-.-4HE>N@An./Aw.I»H*0=CN<.0./13254J*t.[E>./.-.GØ+4+W 8 'gLB…4H.0.LAF. ./AS.0g/.+2-=CBC=?×u4HE+Nn(“NH*oN<.LPH.+2DN<*L^ºN<. NH.0.h=C.\2D.>gLN<.>132DN`E>.`./.M1>aHN`NF(I4J(“.L254JBC‰I4HE>4ÃEI4H.-.L(“NH=C.L254J(I4cE>.+2-N™g/N<.0NsgL=…4Hx/aHN>W 8 \s.L./*ƒ.-AS./W « .9­4Hx/4Ã./.L1>E>.-.-.>.g/NH1>g/.>.-.pP<./(.@N<.0N<B…4HE>4HAF.n4HgL*-./.>A 4•2D*-=?Z>.~. E>.>AF4`4HZ>.S4 gLB…4H.>AF4`4H.LB…4Hx/aHN`4HN (+*-N<Z>B?.L*-.0.<- t{ A¼N<ZRd0.I4H.02-./=Q2DN>^s./.L(“.ƒg/BC4H.L13254H*p.LW 8 \s.L€./BC4Hg/=?N<1I4HE+N<.-.p*-.@N<.L.J^“(N<.0=C:<1+=?½Ig/4HE>Nc.-.-=CgLN`.>.>AÆNHZRd0.@¾@g/N<AS(>B?.ƒg/BC4H.>AF4•68.L2-N`¾M./(>*0.[€N<*o=C1+E>./13254HxLs.0NFEI4J.).>.q./1>4H.).0.\2D„/1+g/=…4™=?1>E>.-.>AF4HAÆ*0.¯Øs2-N9E>.M.>Z+.>A AS¾L2-NsE>NSE>.>AF4cE>.-.-././(>*0.>.LA 1>NO(>*-NHZ>BC./B?=CAS=C1I4JEI4+W 8 9t.>Z>BC=?1>‰>. f‚.0.>AF4`4H(>B?=Cgu4JxuaHN>W {tA N<ZRd0.>A94`g/BC4H.-.L*-ZN<.L^t./132D=?E>NF1+NSgLN<132D.-./=?2-N>^ .8d-4S.L*[An.L1V2D4H1>E>NO4HB?:<.0/ 21   Xk "! k #$  e Pkuk e &%  ')(*.+./132D.ƒ*-.@N<ZVd0.@gLB…4H./.p.>.+AÆE>=…4J:<*D4HAF4KE>.-.~1IaHNM4H(.F.`PJ4HB?N<*/^H.-.g/BC4H.HW 8 ŽN<1>g/.L.0.L.-(.LPH.q.L1I4H.@(>*-N•d0.L2-N>W qrIsMtum@y NH1V2-.LB UV.L132D=CE>4HE>.G2DN>W qrIsMtum@y NH1V2-.+*D4HB?AF./*-gL.0.-./^s(“.>=Q254H./.J^2-*D4H1>.>v?E>N<.L=?2-N<./Af1I4J2D.+1>E>NN 4J.0(“./W 8 'gLB…4H./1325aHN .™4J2-*-=CZ+.-.iIt e     .0.L13254Hx/aHNcE>./UV.L132D.0254Fg/B…4J.-.¯Øs./1+g/=…4J*oAF¾G2DNRE>N<.L:<.ilt e BsMk e t  f t %› ¶   ´ ¹ m 8 \s./132D4H1>E>Nq.-.tNK.ƒUV.L.`1IaHN 2-=?P<.-.‚./.LxuaHNF+Wˆl>W 8    FGIH!G H  ' KMLNPOQSRUTVXW Y[Z]\^LN_\  >=@?   NXQp\ ` 3 4  "576 &8 69# :(*.LBC=CAS=C1>4H1>E>N 4H./*ƒ=C1>gLBC.pN<(._1>vQ2D=CE+N<./132-.L.-.q1V.)E>NH.0.>A94`N<.02-*D4Hx/aHN>^+4HBC:<NKg/N<A BC=?AF=Q2D.+2-*D4+W 8 \s.

 E .

 "  FGIH!GIF .

pAF¾G2DNRE>N<.ƒAF./(>*0.L.™NH.@¾M4`4H.ogLN<ASN¬ >H<O6 F 6 4 de6 K 6?<O6 ^ 7N6 6.LP<./×L.[4H.rIt Xe BsMk e t  f t › ¶   ´ ¹ m 8 « .0.    ( Ç<‹  KMLNPOQSRUTVXW Y[Z]\^LN_W `S`b\VXR W Y  NP` \s./.>1+E>=CE>N`gLN<AÆ.)¬ @T6 4 6c6 ®G^s4M(N<.-.‚4H.+g/N 4HZ>*D4J1>:<.M4H.ƒ./^Rg/NHAF N \4@g/N<*hEI4Mgu4HE+.-NRg/=C4Hx/R.-.L=C.h4J2-*-=?Z>.0.L./BC4Hx/R.>AnZI4H.[. E+.qNSE>=…4J:<*D4HAF4nE>.-.k(NsE>.>=?2D4H. E>.oE+=C*-.02D4H132D=QP<N<.`€NH*D4HA E>.-. 4H.ÞE>.LA¥./.t4H.-NRg/=C4HxuaJNS¾@E>.0.>:<‰ > 6 4 C mŒ‹<‹Hl+^HN<.L./(.LP<.-.>AnZ>4H.pPH.G254H.Î.+2-N<.L./^µ.AF4H1>.`E>.LPH.0=CxuaJN¬ G*X 4S> DRZ K 6?<*> J9   7 D 4S>4:9 D = ®¯^s4J./.LP<././*-ZN<.0./.ƒ1IaHNF(“./A AK.pUR.³(N<*³.8d-49.-.u4HB–W \s.*./132D4H*K.-.LA*0.L½I1+=CEI4H. . KMLNPOQSRUTVXW Y[Z]\^LN_W Q pR aQS\ ` = - ™X .-.n=C1+g/BC./.M4H1I»HB?=C.>Z>.GØ+aHN@. (N<*h€*D4H./132D*0.M1>aHNF(NRE>.0NsgL=…4HxLs.L.L*-.t.L./*0ZI4H=C.L^ŽE>.LA%.)gLN<*-*0.q­4HBQ254HAf=C1+€NH*-AF4Hx/R.-.L^>.+2-N<.-.DaHNSE>.L. P<.Lg/.0NsgL=…4Hx/aHN>^>./=C*-4 .Ž4HxLs./*LW 8 {tAÆ.TBCNRg/./132-*-.L*pgLN<1+€.LPH.-.L13254H*³=?1+€N<*0A94HxLs.qE+./^=C1>gLBC.™¬ 9A< 87# D 4 6 ®¯^3g/N<An.>AF4[4H.LPR=C.L:<.>1>E>N ‡ .L*-g/NH*-*D4JAw494H.LA%E+.K4•2D*-=?Z>.-NRg/=…4JxuaHN>WÎ{tAF4™*-.-(N<1>E+.D»J*-=…4sW 8 QÙPR=Q2D.L.h¾o.q¬€P<.>.qg/B…4J./132-./B?NnE>.@*-.-.q€N<*-4HAÆ=CE+.>1+E>N@NMAS.L1V2DaHNF4S4J.L.+.0=?PJ4H.@1IaJNSNS(N<*-UV./132D4HEI4H.LAF.>AF4 (>*-N<(+*-=C.L=C*D4J.ƒE>.-._=CAS(>BC.L2-N>^ E+NFE>NHAFv?1>=CNnE>4S4J(>BC=?gu4Hx/aHNcN<.HW « .3 4  "5 6 8 6 9# :(*.og/BC4H.GP<./.-./132D=Q½Igu4HE>4H./132D=Q½Igu4JE>N<.L*-=?½>gu4H*`UV.L.>=?E>N<.>AF4`4H.LBŠ^Jg/B…4J._PJ»H*0=…4H./.G6 ./132-.0.+2DN<*L^ 4J.L^>N<.-NRg/=…4Jx/R.-.S4H./W 8 \s.Ù.L./.+=k4 (N<./132-. E>NSAn./.c¬ >2=  K 6?<*>  9  ®¯^I./.I4H=?.0NsgL=…4HxLs.LA ./^7A94J.0./W qrIsMtum ‡ .L13254Hx/aHN E+./.I4H.Þ(NsE>.@E>.0.>.DaJN9An./.0.0v?P<.t(N<*  .GP<.-1>./.L.LEI4HE>.~€N<*-4nE>NFASNRE>././*M1>N<AS.>./.>ZE>=QPs=?E>=C1+E>N`4H.GPJ49g/N<Afg/BC4H*-.@E>.L½I1+=CEI4H.LB…4cNsgLN<*-*0.-./*ƒAF4H132D=?EI4H.-NRg/=C4Hx/R./. E>.L.-.t(>4H(“.0/ 21 '     .OA94H=?./^34•2D*-=?Z>./E>=?EI4ƒE>N™(N<.-NRg/=…4Jx/R.>1>E>N`*0.kE+./1+E>„/1>gL=…4H./.-.@4FPH.LW@X UV.-./:<.o4HZ>4H=QØsN>Ä e e Mt g t thsMk e t k t Bt kus.S=C1+g/N<*0*-.0.ƒN<.ƒg/*0=?2-¾/*-=?N<./.o2D./.0.-AF4H.-.-.+1>=Cg/4Hx/R./A2D.Þ4H.+:<‰ >-6 4 C mŒ‹<‹Jl>^µ4H. E>=?€.-.-.0AFN@4J.-NRg/=C4HxuaHN+^IN<.L(>*-.9 D 7 D = ^ M < 4 7#:6 ®¯W ').ƒ.pPH.L:<.L* =?AF(+BC.LB…4Hx/aHN[N<./:<.>1>E>N ‡ .-. E+.™.-g/4H*02D»•68BC4H.L(“N<=?.>=?1>E>N`4H.0g/*-.SE>N N<ZRd0.0=C.L2D4HAS./132D.-.>1>E>NSN<.0.-.p.+A94@4H.L×u4`NSUV.-R./AS./A *-.M.-.-=?:<1>=Q½Igu4J2-=?PHN<.ƒg/BC4H.0.0.>xLs.>=Q2DNVz•(“N<.0NsgL=…4Hx/aHN>W 8 9)4)AS.0g/*0=?254J./*Ù=?E>.L:<./.0._(“NH.0.`g/NH1>.+2DNH./*01I»H*0=…4H.S4H./^ E>.LxuaHN +WÓl3®GW    FGIH!G   .02D»J2D=?g/N<./gL=C.0NsgL=…4Hx/aHN>W \R./132-NF2D*-4H1>.

>*0.-N<* .-=?xuaHNME>NMg/. e4M(N<.oNH .

L*DaHN ./*ÙNHAF=Q2D=CE+N<.LW e e Mt g t thsMk e t k k #t r k BsMk e k  f t › ¶   ´ ¹ m 8 \s./.>.+2-N<.L132D=?½>gu4HE>NH.t2DNRE>N`.³1IaHN[(NRE>.L×/.L2D4H(I4™E>.F.>4H*02-g.`=CE>.GP<./W³X™./* µ4J:>W 't1>E>*0¾ « .>AS. =C1>gLBC.L132D.-.‚4HE•d0.h.0.+2DNT€NH*S(N<.0(“.H^VAF4H.G2DN<.t4•2D*D4uPH¾/.>=?2D4H.@.02-.+2DNH.M./*p.Ž4J2-*-=?Z>./A.I4HB?AF.tNH._4J2D*0=CZ>.-.L^µg/N<ASNc*-NuØsN>^µ4HgL=CAF4+W '~2D*0=CZ>.L*-.G2DN>W 8 QhB?=CAS=C1>. *0.o.+2D*0N<.MUV.q¿nN<.>gLN E>.tEI4`.5WhX™.LA2-./* ./*-4HE>N<.+2-N<./A .>.L.0/ 21 '  0 8$6<  .-./(>*0.0.LBC=CAS=C1>4HE>NTEI4 4H1>»HBC=?.Lg/=?½>gu4HE>NH.oE>.G2D=?PHN<.-./*0=?PJ4HE>N<.H^V1I4[./*`.0AFNÉ(NRE>.L1V2-./.hE>./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.9B?=C:34Hx/aHN E>.M4H1I»HB?=C.I4JBCUV.¯Øs=C.0g/*-=Q2D=QP<N>^_NbAS.Lg/vQ½Ig/N<.~N<ZRd0.K4•2D*-=?Z>.>1+xuaHN E>.-gJWÓZ+* ')(N<.LA i hEh      .+€.L*-=?PJ4HE+N<.L254J(I4cE>.G2DN@(“NRE>. ./A €. N 4J2-*-=?Z>.02-=CBC4KE>.@E>.M}Ù*-N<:<*-4HAF4HxuaHNc.L1V2-.L*KgLB…4H*-4HAF.ÙE>.pE>./1V./.+A94 B?=C:34JxuaHNc.@./.L1V2-*-.³P<.DaHNMN<Z+2-=CE>N<./W Q³P<.L1V2-.0(“.-.h4@(I4H*\2D=?*ÙE>.OA94H=?./^k(N<=?.s2DN<.>AÆAS¾L2DNRE>N>W X™./A%. f‚.+2-N<.o(+*-N•d0.L.3 4  "5 6 8 6 9# (**. - .GP<.+A94™1>NJ254Hx/aHN[E>=?€. ./13254HAwPJ4HB?N<*-.M4J2D*0=CZ>.>v?E>NT1>N (>*-N•d0./._An.ƒ.hE>.

ËJÜ  E .

 " .

/. 8 \s.TUV./.t(“NH*p.pg/N<AS(N<*02D4H*Ù=C.LW 8 \s.-.-.L^s(NRE>./1+. - .-. _+2-=CBŠW 8 r *-4HZI4HB?‰I4H*Ž.0.L.L*-./*0g/BC4H.-.0.oEI4J.0./AF4H=C.>.L./B?./*0=C*~*0.-(.4Jg/*-.@.>AF4`g/B…4J.I4H.L.>.0.L.L1>.L1V2D4HEI4cg/NHAFN`.-./132D4HEI4H.‚E>.+.SEI4 (>*-.\2D*D4•254H.S.>AF4`.>AÈAS¾L2DNRE>No.p.L(“.LWk't.*.qA94H=?.).h.-.-.L.0254`..0.q./BC4J2D=QP<N<.M.ÙUV.-(.L.ƒ4HZ>.-.PJ4H*0=…»uP<.(>*0=CAS.q¬€PH.~ZI4H.n4J2D*0=CZ>.+€.ed-4`.ilt e #t t t  f t › ¶   ´ ¹ m 8 'og/.`.0.[4H.0./AS(.LxuaHNF+WˆlV®GW 't1>E>*0¾ « .>1>.-.-.>(.~(I4H*-4F./*0EI4H* 2DNRE>N<.D4H* ‰>.-NH.L.H^ÎB .-. *-./132D4q:<*0.+2DN<.G½I1>=?E>N<. ¬HQkØs.*.ƒ4HB?:<.L*-./13254S. ‰>.>NJ6 *0.K4JE•d0.>Z“gLB…4H.q.L1V2-./A PH.HAS(I4HEI4=?1>gu4J1>E>.L.-.)4@g/BC4H.L.rIk Et g k jilebfht e e t Mthf i rlg iIt  f t %› ¶   ´ ¹ m A _>BQ2D=?(>B…4+^RP<NRg/„q(“NRE>.0€.L1V2-.+2DNH.pgLB…4H.>.>.>A94cEI4J./g/=Q½Igu4JxuaHNS(“NRE>./1>‰>N+^I./AF4H=C.-./1>.L*p.\2D*D4•254F./W 9)4c.g/BC4H./.tg/4H1>E>=?EI4J2DNH.ƒ.-.ƒg/N<AK.>.-.-.L.0.G6 .0.o./Z+*D4H*ƒAS¾L2DNRE>N<.-.>Zg/B…4J.>.M./1>.+2-NcEI4SB?=C:34JxuaHN>W 8 \s./AF4H.0(“./A AF.>(µ®Ž¾@*-.L=C*-4H.o.ƒE>.-.>Zs68g/4H.DaJNb€*-.-gJWÓZ+* ')(N<. NTE>=C4H:<*D4JA94OE>.L1V2-.L*-gLN<1•d0.L./1>.t‰>.L=?2DN E>.`.L*-E>.t(I4H*0.+A (>4H=Š^I=?.-.0.-./132-./.L*-E>.-././.L1>E>.>(“.L132D.<-       6    ./*-aHNF=?AF(+BC.H^3(.Œ®GW '¥.-.-.-._(“NH*Ù.0N<.@.L(“N<=?.t.ƒ(I4H*D4n.8   # .ƒ‰>.>(.L*-./132D4Hx/R.ƒUV.-.0.L.-.p=?E>.I4H.-gL.0.‚E>.LAF./W 8 \s.M2D.L*D4H1>x/49R .o.-.+A94B?=C:34Hx/aHN>^“. *-./.0=CEI4HE+.LP<./1325aHN 4 AF.0g/.@ZI4H.>AÆ.¯6 AF.>Zg/BC4H.-./4HBC=?×u4HEI4q=CE>.މ>.L1V2-*-.-.-.KUV./W e e Mt g t t k[i s./E>4HE>./*-gLB…4H.LAF.nAF¾G2DNRE>N<.Mg/*-=C4H* 4`1+.0(“N<1+.0.@E>=QPR=CE>= 68BCNH.p*-.L.L=?2DNME>.M}Ù*-N<:<*-4HAF4HxuaHNc.0.0.LA¼2D.@NFE>=C4H:<*-4HA94qE>.p./132D=Q½Igu4J*)AS.-./(.D4H*Þ2DNREI4H.\2D=CBC4nE>.tg/N<AS(“NH./g/./*0g/B…4J.cE>.L1V2-.-.0./.L*DaHNpE>=?€.0.-.-./13PR=CNpE>.@€*D4J./AS(>*-./WƒÐ8.Lg/=C4HBC=?×u4Hx/aHNO¬­ZNH2-2-N<1s6 .-.>Zg/B…4J.L*D4HB?=C×u4JxuaHNc.L*-.-. gLB…4H.L./1+E>./132D.h(“.pE>.L./*0g/BC4H.M*0.L.>4H*02-g.02D4SE+.[N<(“.LBCNƒ. .ed-4T.0=Ž(>*0Ï<(>*0=…4+W {tAF4 .@UV.@E>.-NHAF.LPR=C.L./*-4H1>xu4`E>.L=C*D4J.@(“N<*ogLB…4H./*-»n./BCN=C1>gLBC.ƒE>. ‰+./.LA i hEh     8 .Þg/BC4H.c4.KNH.0.).L.0.HAS(I4HEI4 >. A94H=?-./1>.Lg/=…4JBC=C×/4HEI4K./*0.0.-.02-NF2-N<*-1I4S4F./B?.>Aw4•2D*-=?Z>.0.-.LPR=C.0.0./:34JxuaHN ¬€2-*D4H1+.>Z+.-4H:<.™./^I=?1>g/B?./13PHN<B?PH.-./gL=…4HB?=C×u4JxuaHN>W ':<.0254J1V2-=?PJ4H./132-=?½Ig/4HEI4H./132D=Q½Igu4HE+N<.L*t4c./AS.).FE>.ÞE>=?€.0.0.-.\2DNF(“NRE>.0=CE>N`E>.-./B?‰I4H132D.9AS¾L2-NsE>NH.>.HW qrIsMtum ‡ .-./:34JxuaHN`(I4H*-4`4H.)4[g/*0=…4Hx/aHN[E>.L1>N<./A¼.>132DNFEI4`.@.-g/*0=?2-N<./*-4H1>xu4J.-./AS.t.    8$ 0   "5 6 &8 69# :(*.ŽgLB…4H.L*-gLB…4H.LAÈ.L.JWtÐ8.p(>4H=¾@NS:<4H*-:34JBCNnE>NSE>.-.-.>(.>A AS¾L2DNRE>N EI4SgLB…4H.>(./AUV.0254J./.-.LAwA94H=?.Mg/NH1>.L*pPH.    "5 6 8 6 9# :(*.0g/.T.0.L.ƒ4S./132D.D4HZ>=?BC=?EI4HE>.M.>=?1>E>NTN /g NH1>g/.L(>*-.@g/B…4J.~.>AF4Ã.p.02DNF¾H^µ‰>.@EI4HE>NH.>(“.L./4HBC=?×/.-NHZ>*-..D4H1+E>NFAS.ƒ.L*D4HB?=C×/4HxuaHN ¬ 2DN<(s6 E>NŒÅƒ1µ®G^(NsE>.+2-N<.5®GW 8 9tN<.M.hAF././.L*-gLB…4H./*0EI4HE>N<.-AF4(“NRE>.-.`¬­(I4J= ®Ù¾)AF4H=C.M.-(.-.>1>. ¬€PH.-.MAF¾G2DNRE>N<.L.K.-4HEI4H.0(“.D4J:<.LU >.t(N<* E+=?P<.0.).-.0.+A94MEI4H./.+Zs68*0NH2D=?1I4H. f‚.MAS=C:<*-»•68B?N<.LUR./g/4H1>=?. .M4J2-*-=?Z>.h=CAS(N<*02D4H132D.>=C1+E>NN<.4HZ>.L1V2-.-ASN<.L1V2-.LA .-.HW qrIsMtum ‡ .KE>.O(N<132DN+^_(NRE>.0.>.>ZR68*-NJ2D=C1>4H.L*@=CAS(>BC.>./*0.-.‚E>./.L1V2-=?½Ig/4H1>E>N•68.-.+.L^_=?1>g/B?./gL=…4HB?=C×u4JEI4H.-./*D4J1>xu4+W ‡ .>A94 (>*0N<(>*0=C. ./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.o­4J2-N<*D4Hx/aHN[.`EI4 gLB…4H./.L=C.‚gu4H.L.L*D4HxLs.    (  s.ÙUV.‚.MEI4./W³{tAF4K.[‰>./BC=?AF=?1I4H*~(+*-N<Z>B?./*-aHNM4Hg/./AS(>BCN+Ä[B .>(“./*0=?½Ig/4HEI44J2-*D4uP<¾L.G6 .-.)E>.>(“NH.02-./W 8 QhB?=CAS=C1I4J*cN<.Þ(I4H*-4o4H./W 8 Ð8E>.0.LA E>=?PR=CE+=C*o4cg/BC4H.oE>.L*D4H1+xu4+W e e Mt g t t ebilt k t s./1+xu4 E+.L.L132D.L2-=?P<NH. 4H.JW 8 X g/NH1>g/.-./(+*-.@E>./=?*-NT4 :H.0N<B…4HE>4HAF.>=C1>E+N`4H.>(.>(./×ÉE>.É.>4H1>E>NSE>.0.0.>.@E>./*0g/B…4J.L.-.t4J2-*-=CZ+. UV./1+./xuaJN +WÓl3®GW 8 \ FGIH!G KMLNPOQSRUTVXW Y[Z]\^LN N p W]OYXW ` 9t.-.ƒ4S‰>.0.-./*0g/B…4J.-.0.)4J(>*-.0N<.[4JNO1+N<AF.Þ½>gu4H*-aHNtAF4H=?.G½I1I4H*cN ASNsE+.€NH*D4HA=CE+./g/.0.0.0.-.>ZE>=?PR=CE>4~.0./13254H*c1+N7PHN<. UR.[€N<*-AF4nE>=?€.

 E FGIH!G .

 "  .

/Af.>.L×u4+W 't1>E>*0¾ « .02DNH./132D=Q½Igu4JEI4H.~2-.-(N<1>E>.-.-.\254HE+N<.G254H(I4J.-NRg/=…4Jx/R.D®GW 8 ')*-AF4H×L./.p4H.L*-„/1+g/=…4ÉE>N ASNsE+.0=C.-.p4HZI4J=QØsN`.L2-NF.ƒE>=QP<.L./*-=?N<*-AS.02D4S.0.>A 1>NŒPHNqAS¾L2-NsE>N[UV./132-.LP<./.-.[*-.-.0.D®GW 8 h. .L13254+W 8 h.L.>1>xuaJNSE+NFE>=C4H:<*-4HA94qE>.c¬–sWÓl>WQm7®¯W 8 \  FGIH!G K QSN p W]Y[Z \ Ù.>:H‰ >(6 4 C mu‹<‹HlV®¯W 8 }h*0N•d0.L./*-=Q½Igu4J*o./*-=Q½Igu4J*o.)4H132-.LAw4J2D*0=CZ>.>AÆAS¾L2-NsE>N+W 8 « .02-=CBC4KE>.3 .>AF4`‰+. gu4HEI4`g/BC4H./(.L€*0N<13254H*ÙgLN<A 4@4HBQ2D./.-.I4ƒ1>N)E+=…4H:<*-4HAF4~E>.L./W 8 h.ogLN<AÆ.>.o1>N`E>=…4H:H*D4HAF4KE>.@./*01>N<. E>.-.    ( Ësm  KMLNPOQSRUTVXW Y[Z]\^LNXQS\L \ ` ' =?1>g/B?.-.>AÆ(I4J*D»H:<*-4J€NcE>N`UV.H^VgLN<1>.02D.-gJWÓZ+* ')(N<.s2DN<.>AÆE>NH.-.L€.02D4S.0.K¾c*-.L^>AF¾G2DNRE>N<.\254H132D./B?=CAS=C1I4J*K.G254H(I4`=C1+g/BC.-.u4JBC=C×/4HEI49gLN<A Z>4H. I.>1+E>Nɬ ‡ ./*ƒ(I4H*\2D.ƒE>=QP<.LAÆ.8d-4t.M.02D.o.c.t.ƒ4J2D*0=CZ>.L./*-=Q½Igu4J*`4 gLNs._A94H=?.DaJNSgLN<AS(I4J2DvQP<.0254JE>NT¬­+WQmŒÜ3®Ž.-(N<1>E>.™(NsE+.LAf­4H×L.L.-.@2D.DaHN E+.M¾M.>.-.0NsgL=…4HxLs./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.L.~1I4H.L*-.ƒ.L.tAK.-»H*-=C4H.-.M1IaHNc2-=?P<.>.0.-=?.F.ƒN<(.L2-=C*ƒ4H.>BC4™EI4HE>NH.-.L.0.-N<.MN<.GØR2D.ÞUV.+2DNH.L*/^>.+AnZI4H.L2D.>Zg/BC4H.-.>AKZI4H.L2D4H*ƒN<.L1>.0./B?.cAF¾G2DNRE>N<.-.-.pE+.~E>.>A¼AS¾L2-NsE>N`1>N`N<ZVd0.pgu4JAF=?1>‰>N<.@2D./BCNKN<Z+2D=?E>N>^>(>4H*D4nP<.0/ t 21 k ' k Bf k Ek #sMk e k  m  4 <  .0.-./*-4Hx/R.@g/B…4J.[E>.K¬ ‡ .M4H.¯Øs2-.‚./*01I4J2-=?PJ4)E>./*0*-N<.L2DN+W 8 'ox/R.q.o.u4JBC=C×/4HEI4H.S.G2DNSg/N<*0*-./*-=Q½Igu4J*o.>A d-»[./W 8 r .-.oAF¾G2DNRE>N<.>:<‰ >(6 4 C mŒ‹H‹HlV®‚1>.s2DN<.0g/*0=CxuaJNF.o1+N<./AS./W 8 h.02-„/1>gL=…4c./W 8 h.q4c. .MgLB…4H.@g/N<AS(>B?.L2-=?P<NSE>./132DNH.q.  s.M.+.LAw.ME>4HE>N<.p4J2D*0=CZ>.M4`.@*0.>AÆAS¾L2DNRE>N N<.L=C./gL.L*[*-./A¼*-.FgL*-=…4J*[.L./xuaJN[+WˆlV®GW h.L1>g/NH1V2-*D4HE+N<.L^I.JW 8 \s.L2DNH.p4HAS(>BC=C4H* .ƒE>.M}Ù*-N<:<*-4HAF4HxuaHNc.LPH.M./^ g/N<A"N 1>NHAF. AF¾G2DNRE>N<.-UV./gL.G254H(I4`g/NH1>.DaHNF1>.@g/B…4J.0.+AÆAFNRE>Nc:<.hEI4M(>*-Ï<(+*-=…4[gLB…4H.LA i hEh Q      .`E>.L2D4H*h.-.0./^ÞP<NRg/„SE>.0.sØsNFE+./.L2-=CEI4J./.\2D./1>x/4FE>.L.MN<.@.M4H.02DaHNS­4JB?254J1>E>N`4H.‚gLB…4H.t(NRE>.n.>./.o*-.L.OB?.n¬­AF»•Øs=CASNc<ÜcBC=?1>‰I4H.+A AF¾G2DNRE>N@A94H1+=C(>.-.t4SAF4H=?.-=CAS.>A E>=CgL=CN<1>»H*-=?NE>.>./A¼g/B…4J./^>¬€P<. N<.o. PH.0.-.ƒE>.D4J./*-=Q½Igu4J*ƒ4S(>*0.ƒAF¾G2DNRE>N<./*0.)N<.@.+AÆAFNRE>Nc:<.oUV./4HBC=?×u4HA2D*-4HZI4HB?‰>N<.K:<.-=?E>.@:<.L1>g/NH1V2-*D4H*S./(>*0.@E>.~E>.-N>^µ. .-NRg/=C4Hx/R.L*D4HB–^+g/4HEI4c€.L^>g/NHAÆNFNHZRd0.q4•2D=?PR=?EI4HE>.>EI»•6 BCN E>.MN<.M4cE>.ÙE>NMUR.s2DN<.q4H.MN<.+.o.ŒzJNHZRd0.GØs(“NH./(.>AÆN<ZRd0./.L.ƒ(“NRE>./.>AF4c.Lg/=CE+N<././=Q2DN<.-./*-4HBC=?×u4HxLs.-N<.L132DN9./BC‰>4H132D.`N<ZVd0. f‚.L*D4HB–^+g/4HEI4`.p.ƒ./AnZ+*D4H*n(N<132DNH.I4SgLN<1>.0./1I4H*ƒgLN<AFNS4J2-*-=?Z>.>./:<.HW qrIsMtum Ð81>gLBC.L13Ps=C4HE>NF4c.@N<.D»H*0=CN<./132D./Ac68.01>.ƒg/NH*-*-./*-=Q½Igu4J*o.ƒE>=…4H:H*D4HAF4H.L*-=Q½Igu4H*ƒ.c¬€.+€.L1>.0./Aw4HgL.0./W e e Mt g t thsMk     e  .L1V2-.I4J1>E>NM./*D4J1>xu4+W 8 }h*0N•d0.>4H*02-g./*-4HBCAS./.og/N<1>gL./.h€N<*D4HA¥./=Q2DN<././.>A _+1>=CgLNSNHZRd0./*ƒAS¾L2-NsE>NH.LPH.q./*0.JÄ 8 Ð8E>.o*-.L^‚E+.GØs=C.ƒAF¾G2DNRE>N<.t.~E+NFASNsE+./.-.u4JBC=C×/4HEI4492-NsE+N =C1>.L2-=?P<N+W 8 « .4c./BCN+W \R.-.L2-*-=C4H.kN<./*0=?½IUV.-./AÆ4H.@.`EI4HE>NH.HW 8 QÙPR=Q254H*oAS¾L2-NsE>NH.

.

ËH¿    .

%C#!D $' %D .   & -.-   ? @ B 0 $#T.

TE>.É.`4J2D.-(.L1V2-N9E>NFAFNH.td0.TE>./AS.0s.0./.GP<.o(“NH./gL=?½Ig/4Hx/R.>A94 =?1V2-.L.+(“xLs.L132D*D4JEI4FE>./AOW qrIsMtum@y NH1V2-.-ASN<.0.GP<.MAn./.G2D*-NH.pE>=QP<./AS.G6 .JAF.>132D4H*™N<.0.q.L*0PR=C*pE>.-.@.q4c.@E>=C.-=?2-=?PHN<.MZI4H.+*-./1I»J*-=CNH./^µ(>*-.q¾@:<.M(I4H*-4F4`ASN<13254H:<.L^™EI4H./AS./Bs¿s^7.0.I»H*0=CNFg/N<AwNF(>*-N<:H*D4HAF4O¬­.h1>v?PH././1V. .KN I.qE+.L.GØs=C.>=?2-N<.0.>.KAS.@.L*)=C132-./*-1+N<.-.L*0­4HgL.J^J.HW 'j=C132D.Ž._¾h.sØsN E>.M4uPH4J1>xu4HE+N<./*\­4Hg/.>.nEI4H* 4JN<.-.\2D./132DN<.L*0­4HgL.t.>A¼g/N<1•d0.'1 | .I»H*0=CN<.o.-.02D.>.-.-=?x/R.GØR2-.0N<Z>*-.>4HAE+.™.L./^µ2D*D4J1>.@UV./*D4JxuaHNSE>N9./^4HxLs./*0AF.LBC.L.-.LP<. ./* BC=?E>No(“NH*.L1V2-N<.>B?NoE>.LPH.cg/NH1V2-*-N<B?./.t./13254768.É(>*0N<:<*D4JA94H./W ™X ./AÆ2-NsEI4`.ƒE>./gL=CAS.`(>*-NRg/.ƒAF.-N<././*0­4Jg/.I»J*-=CNH.LW y .>.F.>.LAÆE>N<.LP<.\254H*p4c=C132-./.qN`E>=C4H:<*-4HA94qE>.oE>=?€.L1V2-.H^“.+1V2-N`E>.0.~PJ4HBCNH*-./. ^ .ME>NO(>*-N<:H*D4HAF4+^E>N g/NH1>‰>.0=CN<1I4JAF.L132DN<.M2D.8d-4S.G6 .™=?1>g/B?.-./BCNKE>=C1<./BC‰>4H132D.+.c­4H×/. =?132D.   +    'T%-.GP<./^=C132D./.I»H*-=?N<.’(>*-NH:<*D4HAF4+^o(I4J*0254©E>4©=C132D.tE+.>=C*ƒ.-ÏpE>.~.oE+N<./BC‰>4H132D./W hNRg/„nE>.L.L*-*-./gL=C.MN<.-.L.>AÈ2DvQ2D.n.-.LE>=…»J*-=CNH./. (>4H*D4c.L.-./*0.0=CAS(>BC.Lx/R.ƒ(I4H*D4c=?AF(>B?.>. N<.-ASN`.n¬€P<.qN<.L*-.)E+.GP<.MUR.0.@.GP<.@E>=Cg/4H.-./132DNOE>N<.ƒ.ƒ(I4H* .>.-vQP<.qEI4HE>NH. gL.JAF=?g/N>W FGlFG>J KMLNPOQSRUTVXW Y[Z]\^N\ FGlFG KMLNPOQSRUTVXW Y[Z]\^LN_N NPOQS\ `   W]Y[Z \ L N_R OQSN  W]V[NP` k} 4J*D4ÀN<*0A94H*94©=C132D.L1V2-N<.J^?WLW/W5®¯W « ./13254JxuaHNnE+NFASNsE+.L:<.-.0.K€N<*-AF49./W ')(+*-.o1>N<AS.L*D4HE+N<*D4`E>./.`NOA94H=?././x/aHN9sWÀ‹3®¯W  FGlFG H KMLNPOQSRUTVXW Y[Z]\^N  N W p W YXZ \ L \ ` VXNPO.0(“NH.-.L*0­4HgL.LBŠW « ./AnZ+*-.>4HBCUV.L*@.L.

>./.0./1I»J*-=CNH. E+.o1V.@N<.q.L*p.L132DN>W e g t e f rIt t<fht Ee e 2e k g t t sMt EthsMe  rIkEm }Î4H*D4cg/4HEI4`g/.-.0N<.M. ‡ .0.+.-UV.L*-AS=C1I4JEI4H.L(>*-.9.¯Øs.-N<.L­4H.+=CE>Nc1>N`E>=C4H:<*-4HA94qE>.ƒ.p./AÆE>.02D4HE>N<.0./:<.>.ŽE>.M.0NcE>Nn(>*0N<:<*D4JA94+^VN<.ƒE>=?PH.L2-N<.p1+NFE>=C4H:<*-4HA94nE+./.LPH.ed-4s^+4K./1>»H*-=?N>^+gL*-=C../1I»H*0=CN<./1I»H*0=CNcgLN<*-*0.>./*-.F*0.-.qE>N<.0./xLs./A UV.[E+=…4H:<*-4HAF4H. .¯68.)NnN<ZRd0./1I»H*0=CNqE>.L*-=Q½Igu4H*KN<./W r 4JAnZ“¾LA E>.02D4H1>E>NcNH./*ƒN<.LBC._PH4JBCN<*0././(+*-.ME>.-4HA .qE>=…4H:H*D4HAF4H.~E>.@N<.F4gLN<1>./*0:<.9.>.@.L./132-N<.0=C.n(N<132DN<./A .0N<BC=?g/=?2D4HEI4H.Ž.>./W r NsE>N`gL.-4HE>N<.S4HB?:<.0N<.L*-.-.LP<.>.LW « . E+.02-*-.>AnZ>4H.@.n4(I4H*\2D=C*qE>N<.FN .>A¼N<ZRd0.FP<.02D4HE>N<.0AFNH./*pg/NRE>=?½>gu4HE>NH.K./.L­4H.[NSE>./:<.I»H*0=CN gLN<AS.ƒE>=…4H:H*D4HAF4H./13254J*~.\254HE>NH./:<.-N+^µ4H./gL=C.)./AKZ>*-.[254H*0.M(I4HE+*-R.G2DNn.0.Q  a W a   4/   LR W  W      W LN_NP`.02-.L.L.pUV.¯68.s2D*-N+W   FGlFGIF  6  9.OgLN<AS(I4H*D4J*qN<.>AwE+=…4H:<*-4HAF4nE>./.+=C*ŽE+=Cgu4J.L.0.)=?1>=CgL=…4H=?.ngL.u4HB?=C×u4J*[4H./^³g/4H.-.-NSE>.-.@./gL.[.+xuaHN`E>.@g/4H.-.>A.>x/aHNÉE>NTE+=…4H:<*-4HAF4OE>.0N<.KE>=?PH.`N<*-=?.-.>AS./g/.ƒg/4HAF=?1>‰>N<.L132DN<.>:<‰ >./*pAFNH1V2D4HE>N<.LPR=C.[254H*0.@.0N<./132D.L1V2-N<.SN .>Afgu4HAS=C1+‰>N`4n.nNH1>E>.LU +„/1>gL=…4K2Dv?(>=Cg/4ME+.  \ O `./.QpW L\]` 8Ð 1>=?g/=C./. . gL./.5®¯W | .>./W qrIsMtum ‡ .@./1>»H*-=?N<.MUV.oN<ZRd0.ed-4n4K.9UV././^IN<.LP<./*-.L1V2D4H*n4J.8d-4+^ E+.qE>=?PH.q./A ¬­.ŽAS.GP<.LW h.q4c.0.>.+./A UV.0.ƒg/.  R \ ` {tAgL.ME>N<=C.GP<.L2D.0254JE>N<./A*-.-.-(N<1>E+.[*-.Ž(>4H./AF4 1IaHNOg/N<1>.9.oE+=?P<.L2D4HBC‰>4HAF.0.-.LPH.>AF4K./*-aHNcN<./*-*0N>^ gu4H.L2D. (+*-.>1>E>N<.ŽB?=C.¯Ø+gL.L2-N`(I4H*D4cN<.LPH.q(>4H*02-.

LA i hEh  .\254HE+N<./g/.>A E>=…4J:<*D4HAF4@E>.>.6 4 C mu‹<‹Hl`(I4H*-4`gLN<1>.L2-NF*0.-.™.@.>4H*02-g.™E>.LPH././(I4J*-. f‚.™N<ZVd0./13PR=…4sW 't1>E>*0¾ « ./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.@./132DNqE>=C<1 .\2D*-.@.@.LW 8 }h*0.+xuaHNSE>.[.~(I4H*-4Kgu4JEI4ng/BC4H.pUV.L2DNH.02D4HE>N<.>AÆE>=C4H:<*-4HA94qE>.ƒ.\2D*D4J1>E>N`N<.0.-gJWÓZ+* ')(N<.>.+€.~g/N<A g/NHAF(N<*02D4HAS.LZ“././132DN<.`¬­1IaJN`2-*-=QPs=C4HB ®¯^sASN<.\2D=CBC4nE>.JAF=?g/N =CAS(“N<*\254H132-.MNSNHZRd0.M}Ù*-N<:<*-4HAF4HxuaHNc.

.

  E .

L*-=?½>gu4H*c4 g/N<1>.-.rItum « .02D*0.0.L1V2-=?½Ig/4HE>N>W 8 \s.K.L./x/aHNsW?mŒÜ<®GW 8         .L.MUV.L(>*-./*-4H*oN<.-.[2-NsE>NH./*-.>x/R.>.L­4H.s2D*-N`N<ZVd0.ƒ.ed-4s^•PH.ed-4`.L132D=?½>gu4Hx/aHNFE+N<.M*-.\2D„/1+g/=…4 E>NÉAF.-.L*-=Q½IUV.K.L132DN =?1I4HE>./^µ­4Hx/4F.>A N<ZRd0.L(>*-.[4qg/4HEI4M.I4H1>E>N ./W 8 }k4H*-447d0./.02D4HE>N<.GØsg/. ASN<13254HE>N N E+=…4H:<*-4HAF4OE>.-.>AF4M=?1>.L2-N>W k2fhg t e e [e k e e k e k g t t 2e r jsMt t sMk r s.M1>NSN<.D»H*0=CNn.L1>‰>./(.I4HE>N>W qrIsMtumMy N<132-.-.L./gL./*_.t€N<*_E>=C*0.³P<.-.0254TgLN<AS(>BC.ƒ.o(N<*oBCNRN<( ˆ.t1IaHNq.>.0=C.>x/aHN t Mtum .0254JE>N<._4H.Þ.L.LAnZ>*0./(N<=C.c¾91>.K4S.>AF4F4J1I»HBC=?.0.nN<.c¾ngLN<1>./*0./.-.L*-*0N<.02-. .-.p(NsE>.o.02D4HE>Nn.)1>N<*0A94J=C.\25aHNS*-.0N<.JW h./BC4`€N<*0A94c.02-*-./*0=?½IUV./132DNF(I4H*-4SN<.ƒE>.LA ASN<AF.ƒ½I1>=Q254H.n./AS(>*-.9.LPH.@.I4`.>A ./gL.-v?PH.E>=?PH./.-.-ASN>W h.+B?2¯®¯^>g/NH1>.0254JE>N<./132D.)UV.0N<.-»H*-=?NTP<.LPH./132DNH.L2-N>^ N<.L.L*-=Q½IUV.L2DN+WpX[.-=?E>.+2-N<.LU +„/1>gL=…4H.=C1+.LUV.-.LU +„/1>gL=…49(>.M.+A 1+N<AF.t.>Z>./*-=Q½IUV.L*t*0.+2D*0N`N<ZRd0.G2DN<.LPH.-.ÞN<ZRd0.p./.@.-AF4~1IaHNƒ*-./W 8 | .>AwB?NsNH( -W \R./. =CE>.L1V2D4HE>N<.@.@.02D4HE>N¬€PH.-.G2DNK(NRE>./.ƒE>.L2D4HAF.>AÆ.\2D=Q2D.0=C1>gL*-N<1+=C×u4JxuaHN>^“UV.+A949.>.h.-=?.L132D*D4JEI4NsgLN<*-*0.0./.G½I1>=CE>4HAF.L132D.@./132D4H*tE+.L2DN+^>.>.s2DNSE>N9N<ZVd0.q(N<.  "  ËH  R   « .L2D=?EI4F=?1>E>.0.™.pNH.>EI4J*t1I4S=CE>.>.t1>N`E>=…4J:<*D4HAF4KE>.q4J._4oAF.-.0=C:<1>=Q½Igu4•2D=?PHN>WÙXÛ1+N<AF./B .-.-=?E>.L.L.t4•2D*-=?Z>.L(>*-.ed-4s^>P<.+E>.-.qgu4HEI4F4J2D*0=CZ>.G68./*‚1>. .+2-*-NMN<ZRd0.).0./132DNK(I4H*D4MN<. t Mt 1>NH.@E>.cE>.-.~.-.c¬€gu4H.@¬€E>.-.>.™E>.Lx/R.L132D.MN`E>=C4H:<*-4HA94qE>.L.L(“NH=C.LA ./132D4 .@gLN<1>./././*p.-./*0*-NV®¯W 8 « .G2DN .L*-=Q½Igu4H*q.

-.L132D*-.>.LP<.L.@E>.L(“.>.MN`E>=C4H:<*-4HA94qE>.@./.ME>4HE>N<.@AFNH.)N<./BCNo€.ƒE>. I.% XYASNsE+.L*D4HE+N>^ .-gL*-.L1V2-*D4HE>4H.>1+x/R.+€./A gLN<AFNF=CAS(>BC.LW XASNsE+./gL=C.G2DN<./gL.L132D*-.8 4  0  / .-N<.L2D4H(I4KE+NKE>=C4H:<*D4JA94™€.+2-./._(>*0.@g/4HEI4`AF¾G2DNRE>N>W k pk k rlt t<fht Ee Eduk e t k 5m XjE>=…4J:<*D4HAF4KE> .LW q7e s r k k 'f k Ek m 9t4q.L.L1325»•6 B…4+W~'t132D.0=CE>.OAS./.02-*-./AS./AÆ.LPH.+1>g/=?N<1I4HB~Z+.GP<.)NKAF¾G2DNRE>NM­4J×H^ 1>aHN./W Ee r jsMt k e t<ilk e Eehe t Et e t Etum ŽNHAF.-  ?A@ B 0 $#T.+2DN9¾F4JB?2D.LAF.0.%C#!D   % 'T0'Y.[(“NH1V2-N<.>1+g/=CNH1I4HB3./W qrIsMtumMy N<132-./1+E>„/1>gL=…4H.h.02D*-4H* gLN<ASNONO4J2-*-=?Z>.F=?E>././*Ù(>*0¾G68gLN<1>E>=?x/R.sØsNFE+.sØsNFE>./A".0s.t pk m hNRg/„nE+.>(I4p.D4Hv?EI4H.-.LW`}Ù*-NRg/.OE>./A¥E>.-.0./132-*-.¯68.@.q.L2D*0N<.D4HE+N<.        -././x/aHNF+W?mHm7®GW 't1>E>*0¾ « .-.L*D4H1>E+N 4 .  4/   ./*pNH2D=?AF=?×u4HE>NH.-aHNt(+*-NRg/./(. E+.LP<.[E>N (>*0NJ6 :H*D4HAF4nUV./1s6 2-*D4HE>4S.‚E>4HE>N<.)E+.[E>.cgLN<1>gLBC./NRg/.p.L./*0./* E+=?PR=CE>=?E>N<.>.0.[E>4HE>N<.o.ed-4`.M¬€PH.p2-./.[(I4H* .02-*-=?xuaHNb¾ . f‚.LPH.-4HvCEI4sW c g ebs.0./1>E>„L1>g/=C4b€.Lg/. >.-4HvCEI4cE>.02-=CBC4KE>.ÞPJ4HBCNH*-.p./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ./^<E+.HAS.h./.-g/4 ?= E>.™(NRE>.)E>.pN<ZRd0.)1>NnUV.-.r jsMt k e s r rIk e k r fhr .L1V2-*-.LU >„/1>gL=…4+^‚2DN<AF4HEI4ÉE>.>1>gL=CN<1>4HBŠ^Vg/NH1>g/.@E>./.@EI4HE>NH.Þ.qAS.K=?1>=CgL=…4H*p4F=?AF(+BC./.-gJWÓZ+* ')(N<.0.`N<(.>4H*02-g./*-4Hx/R.-ASN 4 .Mg/NHAF(>B?.>=?*tN E+=…4H:<*-4HAF4nE>.`4H./132D4HxuaHNSE>NFAF¾G2DNRE>N>^µP<NRg/„KE+./.LA i hEh    .L^VE>.M4J2D=QPs=?EI4HE>.L1>E>„/1+g/=…4J.>*D4 E>N<.h(I4H*-4™.>./.M}Ù*-N<:<*-4HAF4HxuaHNc.[€.0gu4H*\254HEI4@4H.S.>.>AF4bE+.c=CE+.L./W³{tAAS¾L2-NsE+N[E>./(.M.I4H=C.-gLN<1>.LW Ee r jsMt k Ee e r ue he e k e k 5m {tAF4 *0.L./132D=Q½Igu4H1+E>N N<.¯68.G2DN<./132D=Q½Igu4J*™UV.c.L1V2-*D4HE>4`.`N<ZRd0./132-=?½Ig/4H*ƒ4H./BCNT€.ƒE>.GØsN<.>1>gL=CN<1>4HB ./*³gLN<ASNtN<.

  9.8 4   21  . 4    <  2  6        0   '   0   .     0  .   21  0 6$21  2 21        /   21 21  .

˕l . J   ( c .

L*0­4HgL.ogLN<AFN+Ä 8 « .LA94n.>1+=Cgu4JxuaHN`.>AnZ>4H.)*-.q.>=Q2D.0.-=?.-.-R.L1V2-N<.@¬­=?AF(>B?=Cg/4HA.cE>.`./.~1+NSE+=…4H:<*-4HAF4KE>./AS(“N>W 8 Ð8E>./g/=?.[4HB?2-Nn1>vQP<.0=C./.G6 .-.•6 AS./AF4H./1>.H^Î4 2DN<AF4HEI4 E>.GP<.L2-N<*-1>NbE>.‚E>4n4H1I»HB?=C.@g/N<132-*-N<B?.L.Mg/N<AS(“NH1>.OE+NÃ.L1>‰>N>W \s.ƒ.LBC.-N<B?.>1>x/R. E>.@€N<*0A94HAf4c=C1+€*-4•68.`EI4 =C132D.>*-4H.I4J=C.[:HBCN<ZI4J=C.L^_(>4HE>*-R.LW 8 Ð8E>./.@.L13P<N<BQP<.cg/BC4H./AF4K¾[4n.L*-1>N<./.n¬€=CAc6 (>BC=?gu4HA .[EI4HE>NH.\2D=Cg/4H.L:<.+2-./AF4H.LA94J.G254H(I4J.LA94 C QÙ13P<N<BQP<.G½I1>=C*K(I4HE>*0s.DaJNOE+N .GØs.[.  _0( *# "  $Y0 0   'Tu" #!D   E +  .L2-*-N<.>*D4cE>N`(>*0N•d0.o.-.5®¯W 8 « .02-.+2D.I»H*-=?N>^Žg/4•6 *-4HgL2-._.0.9EI4H./*0vC.LNsgL.t4H*-UV.Lg/./* NS(>*0N<Z>BC.pE+=?P<.0.LA¥AFNRE>=Q½Igu4HxLs./.-4H:<. (I4H* .>1>E>N ‡ .>AF4c.@B?NsN<(+.G2DNnE>NK.'1 « .-=Q2DN<./^Î4 4HB?Nsg/4HxuaJN E>N<./132-*-.02-*-.-.GØR2D*0.L.[2-.>xuaHN3®GW 8 Ð8E>.t¬­=CAS(>B?=Cgu4JA .0././13254JxuaHN>^Ù1+N<AF./.Ž1+NnE>=…4J:<*D4HAF4qE+.ŽUV.-.[E+. E+.+Z>.L^~gu4J*D4HgG2D.0N<.\2D.n(>*-=?N<*-=?EI4HE>.™./B“(I4H*-4n*-.ƒ.qgLN<An.L.L^~(I4HE>*0s./AS(“.L2-N>W « .02D.L½I1+=CxuaJNFE>.>xuaHpN o+P<NRg/„ME>./132D=Q½Igu4JxuaHNcE>.@g/N<1+g/N<*0*-„/1+g/=…4J./.[(N<BCvQ2D=Cg/4H.t.cE+.\2D.0=C.LB…4HZN<*-4H*~.>Z+.5®¯W 8 Ð8E>./. (I4H./132D=Q½Igu4JxuaHNSE>.>.L*-.-(N<.-= 6 2D=?PHN<.L1V2D4HEI4q4qN<ZRd0.c4JBCNRgu4Hx/aHN9E>NH.M./.\2D*0./13254Hx/aHNoE>./AwASNsE+=?½Ig/4Hx/R.-gu4JB…4H.-./xuaJNtEI4ƒ=CAS(>B?.oE>./=Q2D.-.L.nE+./.LA".LPH.L.>.L./132D=Q½Igu4JxuaHNt.K¬­gLN<ASNFE>=?.Žg/NHAFN 4 .@(>*-.+1>x/R.LA €./B?.>1+.0./132D=Q½Igu4JxuaHNSE>.KNH.@.L2 n<1>=?gu4H.‚E>.L1>.~gLN<An.L.\2D.02-.-=?.pg/N<1+g/.M4HNO‰I4H*0E+Å~4J*-.cE>./W 8 Ð8E>.L2-NcE>Nc.LAF.GØR2D. *0./(Ï<.oE>.[.>:<‰ > 6 4 C mŒ‹<‹Hl+^+Nn(>*0N•d0.-.tN<*0=C.-N<.-.G6 ./.G2DNnE+.L(“N<=?.H^IEI4H.hg/NH1V2-*-N<B?.+Z“E>=QPR=C.>Z>.-=C./AS.02-=Cg/4H.L½I1+=CxuaJN9E>NS(>*-NJ2DNRg/N<B?NcE>.\2D*-4J2D¾L:<=…4KE+./*0vC.LA94H.p.-=C.5®¯W 8 Ð8E>.>(I4H*ƒg/NHAÆv?2-.0./gL. E>NRg/.LA¼ASNsE>=Q½Igu4Jx/R./^EI4H.`E>.@NK(+*-N•d0./AF4O.[4J2D=QPR=CEI4HE+./132D=Q½Igu4JxuaHN .>*0./W .0N<B?PH.>AS.t.1>NpE>=…4H:H*D4HAF4 E>././132D.)g/N<1>E+=Cx/R./.@E>. €.~E>./132D=Q½Igu4JxuaHNSEI4H.

/.>.-.-./13254H*t4H=?1>EI4n*-NJ2D=C1>4H.LA94J.+2-=CBC=?×u4H1+E>Nc4H.M}Ù*-N<:<*-4HAF4HxuaHNc.M*-.>AwE>.+2D4HE>N<*LW } NsE+.0.ƒg/NH1>.L254JBC‰I4HAS.TUV.-(.+2D.L^h4 AS=C1+=CAS=C×u4JxuaHN E>N 2-./NRg/.q(I4H*-4SN<.É./A gLN<13254n4J.‚E>.L.h.>*-4H132D./13254HE+N49N<ZVd0.\2D=CBC4nE>.pg/NH1>g/.>4H*02-g.tE>./gLv?½IgLNT(I4H*-4 4Jg/._UR.L.-=?. « N<')*0UV.s2DNO.-=?E>.LA¼4 .>.L.qgL.94JBC:<N<*0=?2-AFN<.+(I4qgLN<AE>.0g/.nZI4J.L2-NKE>Nq. 0%&)( #*" 0 X (>*-N7d0.G254H(I4FUR._1IaHNq.L2DN+W 't1>E>*0¾ « .D4HBQPH4J*F.L2DN9N<*-=?.‚EI4F4J1I»HBC=?.LAF(.o.0./AS(“N E>./13254H*K1>NŒPH4J./gLv?½IgLN<. EI4JE>N<.LA E>=C.L2D4HBC‰>.ƒE>NS(>*-N7d0.G2DNPHNsgL„9=C1+g/BC.+A AS¾L2-NsE>Nb(I4H*-4©.@(>*0N<Z>BC. E+N<.‚.G68.+.>A4J2D*0=CZ>.6 K24 6?>B6O@ D <*=P6 7 D 4 d :9.-g/N+^kg/*0=…4 .6 W}Î4H./.q„L1+­4H. ./BC4H.+€.-./.GPH4@.-.0N<BC.02D*0./1+‰>NFE+NF./.I4H:<.-gL.\2D.-gL.L.-.-(.>=?PHN>^sAF4H. _0( *# "   0 0% 'T#! " .D4H*qNE>=?.%$Y0 .-gJWÓZ+* ')(N<.>.ƒE>.-.n./g/.-gLN>W }ÎNRE>._BC.ŽEI4 BC=C1+:<.p1I4`4H1I»JBC=C.tAF¾G2DNRE>N<.™.>.-./.L2-=?P<NSE>./.0=C.+2DN<.-.n(>4H*D4 4Hg/.0.L.K4Jg/*-.L.og/N<A¼NSNHZRd0.LA i hEh .ME>./&W QkØs=C./*-4Hx/R./.-.ƒE>./AS(>BCN>Ä 9t4©4H1I»HB?=C.L½I1+.J^ AF4H./g/4H.+xuaHN>^“E>.ƒE>=…4J:<*D4HAF4H.94H.0.-R.L½>1>.D»H*0=…4H.02-N<./BCNÍAF4H=?N<* E+.OPHNsgL„ÉE>.+./.>A 4H*0UR.+2DN@1>NHAF.LAFÏ<*0=…4c.02D.@AS.>A 4J2-*-=?Z>.+xuaHN`E>.T./.M4`4H1I»HB?=C./BC‰+N<*D4H*ŽNSE+././.6  6 7N6?<N67> <*b > B7N6 9./13P<N<BQPR=CEI4H./132-NKE>NM€.)(+*-. 4 NH2-=CAS=C×/4HxuaHNÉE>4 .+. f‚.L1>E>N>^Î(“N<*\254H132-N>^k4Jg/*-.0./AF4+W \s.6 4 A4 M?X 6 M = 9 `K < DNM <O6?=P6UWV D 9./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.>1>g/=?N<1I4HAS.L=?2DNH.LA W <»1>N(+*-N•d0.HW qrIsMtum hNRg/„@E>.L½I1>=?E>N<.+=?P<NÍ./132D4H1>E>NS4J2-*-=CZ+.0.0NH 2uW 8 }ÎN<*.G2DN E>N.).-4Y(./gL._E>NK(>*0N•d0.qg/N<AS(>.>.L½>1I4H*ƒN<.0g/N>^RE>.q.¯Øs.GØs=C.LA94 C'6 FHG > AI 6P67< 7 4S>B6?< 6]6?4 Z54 9 4SI D 4 I :9. 4HUV.cN9(+*-N•d0.@1>.qgLB…4H./=C4F1I494H1I»HB?=C.0.Lg/=?.qZ>=CZ+BC=CNJ2D.L:<./^µ1IaJNSE+.-(.L2DN9¾c4F.J^+.\2D./gLv?½IgLN<.`.-./132-NKE>Nn(+*-N<:<*-4HAF4+^V4Hg/*0./13P<NHB?P<.+*D4bE+.¯Øs.HW QÙ13P<N<BQP<.MAF.-N 4JNE>=?.0.\PR=CN9E+.GP<.\2D.

.

.

    .

.

.

 .

.

.

  .

.

.

 .

  J   ( FG G>J & # e.

G2DN<.-.-.I»H*-=?N>W 8 9)aHNS=C1>gLBC.LAf.L.LW 't1>E>*0¾ « .0.LPH.>.Mg/B…4J.L2-NF'qW Q³PR=?2D.-.~2D./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.SE>./*DaJNK=CAS(>B?.D4JE>N<./132D.ƒ(I4J*D4`4Hg/.`4g5‰I4HAF4HEI4E>.LE>.-ASNn€.c.>×/=?*~Nn1 _>AS.L*[g/N<B?Nsg/4HE>N1>.L.>A®¯W {p2-=CB?=C×u4JxuaHN E>./.>B?2D4HE>N`E>.D®GW ')Z+.-.LA . .p(“.GP<.@./AS.DaJNS1+.0.G½I1>=?E>N<.I4H.>AS.@.ƒ¾~./g/NHAF.L*-AS=C1I4JE>N`(I4HE>*-aHN`N<.GØs=C./.-.L.I4H.MNH.L2D*0N<.¯68. 1>aHN>W \s./.L*DaHNK.GØs=C.@2D.oE>=…4H:H*D4HAF4H.>4 B?Nsg/4HBC=?×u4Hx/aHN>W©' (.+=?2DNH.p(>*0N•d0.L*-AS=C1I4JE>N AF¾G2DNRE>N>^“N AF¾G2DNRE>NE>./g/.-»H*-=?N<./N<*0:34H1>=?×u4Hx/aHN EI4H./Aw4JBC:<.o.D4H:<.L2-*-N<.@BC=?AF=Q2D.>AF4 ‰>.-.\2D.@gLB…4H.LBC.L2-NFE+NSNHZRd0.LB ®GW ? « .HAS.>.F¬€g/*-=C4H*@AF¾G2DNRE>N<.oN[N<ZVd0.02D.0254J1V2-./:<4HxuaHN (I4H*-4OgLN<AF(>4H*02-=CBC‰>4H*[4 =?AF(+BC.LPR=C.L132DN<. E+.@gLB…4H.02D.-4H*tE>4HE>N<.L€./*0NcE>.L.LW 8 \sÏFNJ2D=CAS=C×L.SE>N<.S=?AF(+BC./E+.-.L./132D4H*™g/NHA4O.~UV.LAÆ€.+A94)B?=C./AS.>.0.>AS.LW³').0.L*-*-4HE>N<.oE>=…4H:H*D4HAF4H./*-4Hx/R./132DN<.-gJWÓZ+* ')(N<.L2DEN fÍ4Jg/.L1>EI»uP<.S. LAn./AS(>*-.-.>AF4 *0.+A94KAS.0.L½>1>=C*`.oN<ZRd0.u4JBC=CE>4HE>.0.L.-=?E>Nc2D.>A AS¾L2DNRE>N .L=?2D4H*ƒg/ÏRE>=C:<N+^+1IaHN`*0.¯Øs=C.02D4 gLB…4H.q(>4H*.L2D.>A(>*-NRg/.0NsgL=…4HxLs.-.-.>AF.L(“NH=C.L^µ.-./4HB¾™­»Hg/=?B =CE+.0.o*-.+./g/.L½I1>=?*‚1>4@­4H./W « „@(>*0.M.LP<.c  NPR Qp\ `:L \  \ NXQp\ O\ `  Ë<ß   ( ? XQS\L\]`  « .L1>¾/*0=Cg/NH./*ƒ./*-.\254H:<.G6 .>A E+=Cg/=?N<1I»H*0=CN>^ UV./.u4J(>*-NŒP<.o(I4H*-4S4•2D¾M<ÜcBC=?1>‰I4H.L./gL./132D=Q½Igu4H*o.o./AS.\2D.-.0.-.0.GØs=?.-./.-NRg/=C4Hx/R./132DN<.‚.LBCNc.G2DNS*-.‚4H.™€N<*02-./././1>E+.)N`(>*0N<:<*D4JA94nE>./*-:H.L2DN[E+N[N<ZRd0.M1IaHN`(“NRE>.)E>.G2DN<.GP<.L^+E>=QPR=CE>=?1>E>NK.0.0AFNcUV.0N ­»Jg/=CB–W5\s./././BC4HxuaHN E>.K(NRE>. UV.LW qrIsMtum ‡ .‚(>*-¾¯68E>.S./*-4HB ./.kN<ZRd0./1+.@g/BC4H.L*ƒPJ4HB?=CEI4JE>N<.SA94H=?.pAS¾L2-NsE+N<.-.+€.[2-.L*-AS=C1I4JE>NAS¾L2DNRE>N E>.L2-N[' 4Hg/.L.+2-=CB?=C×u4JxuaHNE+.[4H*0:<.>A E+. Ç3®GW 8 ‡ ./.ƒE>.L1>:<BCNHZI4HA AF¾G2DNRE>N<.0.LBC.@N`N<ZRd0./BC4Hg/=?N<1I4pN<.>13254b¾ N<1+E>.L*[g/N<B?Nsg/4HE>N 1>.LAFÏH*-=…4sW 8 ‡ ./*0g/B…4J.L.0.02D4HE>N>W   FG G  NPR Qp\ `:L \  \ NXQp\ OW `   N  W O Y[W ` FG G H  NPR Qp\ `:L \  \ NXQp\ OW `:W `b`S\V[R W]Y  PN ` ? ‡ .[4H*0:<.L132DN g/NHAn. f‚./*@1I4O*-.S4J€./*0.I4J1>E>NS*-.L2D././*ƒ4J.ÙE>N<=?.LAN[.>×/=?*ƒN`2D4HAF4H1>‰>NcE>NH.91>.`.0./W 8 QÙPR=Q2D.-.@N`AF.L132DN<.-.LA .-=?A ^<N[NHZRd0./13254HE>4H.ƒ4Hg/.>.Lx/NFg/N<*0*-./AS.-.MgLN<A (I4H* ./Z.@E>.-.JW Q³PR=?2-.>(.I4c4•2D*-=?Z>.>.oAF¾G2DNRE>N<.LE>.0.LPR=C. ¾ E>=?€v?g/=CB‚E>.>1+.-.L*qgLN<BCNRgu4JE>N 1I4OgLB…4H.L1>E>.+2-*-N`AF¾G2DNRE>N>W  e e Mt g t thsMk      0 6 r f k Ek  4 <  k k m  .G254HE>4O(N<* E+.@g/BC4H.HAS.MAS¾L2DNRE>N<.0.G½I1>=C*[.S.MNH./A 2-.@AS¾L2-NsE>NH.8$6$   {tA¼AF¾G2DNRE>Nc¾@*-N<Z>.-.@N<.[1IaHN`­4HB?‰I4+^+AS.-.@UV.L2-NKg/NHAFNq4H.p.Ù4J. J^Þ(NsE>.\254HE+N>W 8 _4HBC=?E>.>A ¬­E+.u4HB–^+(I4H*-4c*-./*0g/N<*0*-.LAÆN`.c¾c./^3.@AF.q. ª qrIsMtum ‡ ./AS(>*-.+A¼N<ZRd0.-.9.GP<.+2-N<.G2DN[E>=?g/=CNH1I»H*-=?N UV.~E>.02-.~E>.0.cgLB…4H.tN<Z./.>4H1>E>NOP<NRg/„9gL*-=C4O.`.-.L^IA94H.0.F4HB?PHN>`W \s.>A E+.>.L2-NME+=Cg/=?N<1I»H*0=CNp.-NRg/=C4HxuaJN[UR.™¬­1 _>AS.t.L./*0Nc4H*-:H.-. AF¾G2DNRE>N <W QÙA :<.F.LA UV./xLNqgLN<*-*0.>AF4 .ƒE>.ƒN<(.`.0.LA PJ»H*0=…4H.0.L132D.L*-„/1+g/=…4S4`4HBCNRgu4JxuaHNcE>=?<1 .-.+.M}Ù*-N<:<*-4HAF4HxuaHNc.>.>4H*02-g.LA i hEh   .™E+.c.L2D.>1>x/aHN`E>NF*0.D4@N[N<ZRd0.HAS=Cg/4KE>.@(.0.02DNS.ƒE>=?.-.-4MN NHZRd0.L2-N f)^H.>A94 gLB…4H.LP<Nbg/N<B?Nsg/4H*n.LAÆ.>./132D4HxuaHNb¬€UR.\2D.>1>g/=?N<1I4H*o.G2DNS¾M./.ƒE>.@.LAwg/N<AK./.@:<.02D*-4HxuaJN E>N g/N<AS(N<*02D4HAF.02-=CBC4KE>.o.-./*-4H1>xu4 =?*-*0.0.S.+A AF¾G2DNRE>N E>.o.LAjE>.

@Nc2D=?(“NcE+.MNHZRd0. N<ZRd0.~E+./E+=CEI4 UR.Ž.L*pNH.>B…4J*pgLB…4H.I4H:<./13254ՍŽ' \eQ¼gLN<AFNÃNՑ’=Q2D‰ ŽBC4H.@.>=C*ŽAF¾G2DNRE>N<./132D4 N©gLÏsE+=C:<N>^~4H.ËJÇ    [D  ! #!D ! # #"     +  ] [ . (I4H*D4 4É=CAS(>BC.L.+.ƒE>./BC4Hg/=?NJ6 1I4HEI4H.SE>NO(>*-NH:<*D4HAF4  PHNsgL„qE+.D®GW 't1>E>*0¾ « ./.0=C.o[( _>Z+BC=CgLN<.@*-.I4HB?=C×/4HE>N>W[' AS.+254 .0=CEI4HE+./.\2D=CBC4nE>.~.@AFNRE>= 6 ½>gu4H*ƒN`(>*-NH:<*D4HAF4ng/NHAÆN`N<ZRd0.H^‚(I4H*D4É254JBo(“NRE>.M<ÜcBC=C1+‰I4H. .L. 2D.L^ÙA94J=C./AS.L13P<N<BQPs=?E>N>W  #&u" #&  X 2-./W }Ù*-=?AF.-aHN./1>NH.~E>.DaJNc*-.S.cAF4H132D.>.@EI4J*o*-./*™(N<.-.0./(N<=C.0.@=C1>. 4J.L./.SN 2D.-/E0 ŽN<A NÍg/ÏRE>=C:<NÃ=C1>=?g/=…4JBtE>NÍ(+*-N<:<*-4HAF4Ã:<.M.0.>AF4À.M}Ù*-N<:<*-4HAF4HxuaHNc.~E>.@EI4HE>NH. B?=C:34HxLs.T=?AF(+BC.\2D=C1+:<.GØs=?:<„/1>gL=…4H.0(“NH.>*0.L=C*-NO2D.YN ')(>([Q³Øs(./.T€.LA E>.>.o4J.>.02-.0.ŽE+.L132D.5®Ž.o.L=?2-N<./1>¾L*-=?g/N>W 8 y 4H132D./=Q254HE>N+5W Q³Øs=?:<./:<*-4H.`(>*-.‚¬€2D*-4H1>.sØsN<./A ASN<13254H*t.ƒ1>NŒPJ4H.\2D*0.-.02D.+(I4HxuaJN E>NAS.¯68.0254S4H.9¬ ‘’=C1VZ>BC4HE >-6 4 C mŒ‹<‹<3®¯Ä 8 Qh1+gu4H(>.0(“.@.+*D4H132D././.ƒ1>.-.`.n¬€g/N<AÆAS.0.G2DN<.L.-4HZ>=?BC=CE>4HE>.L.-.kE>./W « .L*™N (>*0N<:<*D4JA944•2D.I4H=?.L*[N<.ƒE>./.-=CE>4HE>. NH./*0=Q6 NH*-AS.8d-4+^<4H.-./*02-NbE+N<.c(.[AF¾G2DNRE>N<.cN g/N<1+g/.-=?AF(+BC.\2D*0./gL.0.‚.>=?1>E>NoN<.>4H*02-g.n*0.M4`1+.L=QØ+4H*oN`(>*0N<:<*D4JA94nAF4H=C./132DN BCÏH:<=CgLNE>NO(>*-N<:H*D4HAF4+^ E>.L.+2D. g/B…4J. 1IaJN._.\2D.   " !# Y.0254J*cN<.‚NH./.L2-=?PHNFE>._EI4HE+N<.L*-./*ƒAn.0.-NSE>./g/.-NRg/=C4Hx/R.t(>*0N<:<*-4HA94J./W 8 QÙPR=Q2D./E+=CEI49UV.-._4p€N<*0A94~gLN<AFNt4ƒBC=C1+:<.>x/R./1+N<.Mg/4H./132DN<.LP<././gL.cgu4H./W 8 X[gL.>1+g/=CNH1I4HAS./AS(“N (>4H.G6 . @.-.+.I4H:<.-.~.94JE>AF=Q2D=?E>N<./*\29E>N fŽN<*0B…4H1+EihEhn^Ž(>4H*02-./.L.cAF¾G2DNRE>N<.qE>.L2-N<.F¬€.L.-ASN.LP<./=Q2DN E>.[.G2DN>^[AF4H./.I»J*-=CNH.0NH½µ4ÕN<*-=?./W 8 QÙPR=Q2D.>AF4 _>1>=?gu49€.tE>N`.Mg/N<1>.L13254HEI4`4cN<ZRd0..\2D.[(>*0=?PJ4HE>N<.Ž:<. ot(“NRE>.0N<.c.02D4H*`gu4HEI4 g/BC4H.02D4 .\254H*Fgu4HEI4 ASÏRE>. >.LA i hEh ./*-4HE>NÕ(N<*./AS./.-.>A(+*-N<:<*-4HAF4Fg/NHA4(+*-.o(“.LUV./.LUV.‚(“. f‚. Lg/4H.pAS¾L2-NsE+N<./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ./.L^_gLN<A]NH.T.GØsN<.>.L1>xuaJNO.L*-gLN<*-*0.JW qrIsMtum[« .0=C13254•Øs.-.-./gL=CAS.-ÏYN<.LW e e Mt g t t t fhe t )t e t rIi r t e r ilt j› ¶   ´ ¹ m '*0.c.>./.>.L13P<N<BQP<.[Nc(>*-NH:<*D4HAF4HE>NH*ŽE>. E>=…4J:<*D4HAF4H.>AÆ(>*0N<:<*D4JA94K(+*-NRg/.>1>x/aHN N<.0.-.‚.-./4H(>*0N7PH.L. g/N<1+‰>./.LBCN<.AS¾L2-NsE+N<./132D.tg/NR./1>gL=…4H=?.+.\2D*0./*0*D4HAS.+€./W « .ƒN<.>.cgu4H.[2D.¯ØR2D.oBCÏ<:H=Cg/NH.02D.>.2-./.-.‚g/4H./NRg/.>=Q254H.ÎE+.-.5®¯W  @ % . E+.L.@(“.@gLÏsE>=?:<NV®¯W 8 y 4H132D./13254o4ƒ(>*0N<:<*D4JA94Hx/aHN NH*-=C.G254HB?‰I4H*ÞN<./=?2D4HAS.G254H(I4 .MNHZRd0.LAF.>»H*-=?N>W }k4J*D4n­4Hg/=?BC=Q254H*Ž4`.u4JBC=C×/4HEI4H.-.-.L13254Hx/aHNÉE>N (>*-N<:H*D4HAF4+W 9t./13254JEI4Y4ÊN<ZRd0.-.L2-N>W 8 « =C.`N2-.-NtE>.K.-.0NF./1>NH.M¬€.0.KN<.+2D.G68./132D.LAÆE>=…4J:<*D4HAF4H.cg/NHAF(>B?.L.Lg/=?½>gu4HxLs..>1+x/R.9E>=QP<.Þ*0.+AF=?1>E>N PH4JBCN<*0.-gJWÓZ+* ')(N<.>B?2D4H*o.qE>.DaHNFE>.G2DN>W ' AS. EI4ͽIBCN<.D4J.-4+^I1>NŒPJ4H.-N>^J=C1>gLBC.GP<. gL*-=C4H*o(“.@. EI4ÕBC=C1+:<.LNsgL.GØR2D*0.-.G6 .L*-=Q½Igu4H*ƒgLN<1>g/.-/E0  ' AF4H1V.0N<.>(I4 g/N<A N €.>BCNcE+.>*-4H.-.GØs. (+*-N<:<*-4HAF4HxuaHN+WkX™.LAÛ=?AF(>B?./*-.ƒE>=…4H:H*D4HAF4H./ASN<.@P<./1+.0N<Z>*-.\€N<*-AF4H* N<.

     6     6 8   ' .

*.8  (*.

.

- .

0v?PH././B?‰I4H132D.‚./g/.oZ>»H.0.oE>.`.\2D*0.-.~2-.0.L.-.0./B?./*)1+N<AF./132DN`.0.`(N<.u4HAS.u4HB?=C×u4J*~N<(.pAS¾L2-NsE+N<.0=C.™.-.-NRg/=…4JxuaHNF.[(+*-N<:<*-4HAF4H.0=CEI4JE>.L2D4HAF.>AF4nE>.HAS.+A94 Z>=CZ>B?=CNH2-.>AF4FgLB…4H./B?.ÎUV.)E+.pAF¾G2DNRE>N<.FAF¾G2DNRE>N<./1>‰I4J*g/BC4H.Lgu4cE>.M€NH*\6 A94J2-N<.-(./132D.>A94S4H.K.@gLB…4H.M(./132-./1>¾L*-=CgLN>^µg/N<A 4`g/BC4H./.L*ƒ.-.0.0.>.MN`AF¾G2DNRE>NcNSA94H=?.o€N<BC‰I4J./13P<NHB?P<.-.9g/NHAn./*0.LBCN<._(“N<B?v?2-=Cg/NH./(N<=C.G254HAS./1>.+2D.0AFNc1+N<AF.³g/BC4H.0./.Œ®¯^ 4H./.0./W 8 « .LAfUV./*-»`4`1+.L.-=CE>4HE>.-.og/N<*0*-=?:<=CE>NpN[ASNsE>./A (N<.LAF.oE>NH.-.L.F4HB?2-.L2-*-N<.L*D4HA g/B…4J.+A N<ZRd0./*D4Jx/R.-.GØs(N<13254•6 1>.oAS¾L2DNRE>N<.L*D4H*‚N`1>N<AS.q4J.pE+=?€.ƒg/B…4J.@UV.-./AwAF4H=C.L*™N<.>A94c€N<B?‰I4+^Hd-»F.K.-4 ././AS./g/=?.>*-4FE>./*-AS=?2-.¯ØR2DN9E+NS(+*-N<:<*-4HAF4+W e Mt g t thf eSi Ek t Bk Bg k kPsMk2iIk  r iIt ¥› ¶   ´ ¹ m 8 « 4H*K1+N<AF.ŽNRg/N<*0*-./AÆ.+2-N<.-4HE>N<.FAK.-.™PHNsgL„[2D.+2D*-4H.0A94c1IaHNS.0.)¬­4HUV.+1>=?€N<*0AF.-. .q4 AS.ON<1>E>.LBC=CAS=C1>4K.-.S.pg/N<1>.`¬€AF¾G2DNRE>N<.L./.-./13P<N<BQP<.t½>BC‰I4H.@*0. g/N<AÆNH.-.Lg/=?.)=?AF(>B?.\2D*D4J1>E>N`4`BC=C:<4HxuaHNK./.M(“NRE>./*-4Hx/R.pg/BC4H.0=CEI4HE+.L.L./Aj€N<B?‰I4H.>.¯68.ƒE>./.+A ./Aw./B?‰I4H132D. AF4H=C.I4H1>E>N./13PHN<B?PR=CE>4+^µ(>B…4H1+.0.™E>./1325476 xuaHN¬–4HUV./132-=CE>NB?Ï<:<=?g/N>W 9pN<*-AF4HB?AF./gL./= Ø+.M.p4J2D*0=CZ>.-.o./*0.~4H:<*-.L1>.+A94K€N<B?‰I4+^>ASN<.‚E>./.LA"€.-=?AF=?B…4H*0.-.@.0.>.>=Q2DN=?AF(N<*02D4H132D.LBC. 4H(I4H*0./.I4H:<./.-.L1>¾/*0=Cg/N`(N<.LBC‰I4J1V2-./g/vQ½Ig/N3®GW 8 X[.-4H:<.LA .LPH.SAF¾G2DNRE>N<./AS.-.q4JB?2D./132DNc.+AÆAF¾G2DNRE>N>W 8 QÙPR=Q2D.L.Lg/.-=?g/N<.>1>xuaJNE>.>BC4HEI4KgLN<*-*0.LE>=CAS.oASÏRE>.9E+.LAF(>4Hg/NH2D4HAS.t(>*-.KZI4J.L././AS./13P<N<BQPR=CE>N<.L*-g/BC4H.L.-.+*-:<.>./A%4HBC:<././13P<NHB?P<./.M.+./132-.+(“.~:<.>A¼(>*-NRg/.-.9¬­.k.@g/N<132D=?E>N<.@B?=C:34Hx/aHNnEI4J.™.LA¼4M2DN<AF4HEI4@E>.t.@./.©gLN<AS(“N<*\254HAS.-.L./WÙ} NsE+./* UV. E>N<=?.ed-4HEI4s^µ4SAS.Lgu4nE>./.[N<.>1>=?gu4•6 ./.>BCNH.[E>N g/N<132D.³E+=?€. A94H1+=C(>.-.0.‚UR.o.0././132-.ƒg/N<AÆNcAS.>A NHZRd0./*p(I4H.LBCN>^J(“NRE>.>A94Og/BC4H./g/4n./(I4J*D4H*‚AF¾G2DNRE>N<.L.ME+. E>.~:<BCNHZI4H=C.\2D.-./13PR=…4JEI4ÊE+=C*-./=Q2DN E>./.F4 1>.0.kE>.D4`.+(I4H*³4J.@UV.0N34H.Î(+*-N<:<*-4HAF4HE>N<*0.L.D®‚E>N<.oAS¾L2-NsE+N<.p.-./.o1>.D®GW 8 \s./W 8 {tAF4SZ>=?Z>BC=?NH2D.G2DN .>AF4ÍAF.0.0.0=CAS=CBC4H*-.D4Õ.0v?PH./132D.>.0.8d-4 g/N<AS(>BC./132D.HW   +    e    e           # 6           e      9   .-R.>.Mg/BC4H.L.ƒ(I4H*D4c*0.>.qUR./*O.L1V2-.)¾q4HB?:<NF:H./*@.[N<.>.GP<./gL.)E>. ebfhg t<sMk t<fhe k ./g/.-.@(“.<Ë Ë 8 y 4H132D.>EI4HA".~N<.É(I4H*D4Õ.q=?1+€N<*-AF4HxLs.-./BC4H.-.-.LW e Mt g t t t fhe t khebfhg t<sMk t<f e k r iIt ¥› ¶   ´ ¹ m 8 « .\2D=?gu4HAS.-./.-.@N<.G2DN>^º(I4H*D4UV./132-N E>*D4H./W 8 Xfg/N<1+g/.>AÆZN<AÆ.-.-Ï 4H(>4H*-.0.>1>=C*[E+N<=C. E>.[€N<*0A94n.L.L.+.L.-.0.L132D.k(“N<* (./.©=CE+„/132D=?g/N<./*pE>.0.+2-=CB?=C×u4JE>N9gLN<AFN .u4HB?=C×u4JAf./Wh{pA94 BC=C1+:<./.pUV.pgLB…4H.GØs(I4H1>.`. LW e Mt g t thf k t ebf Ee r jiIrIk ebsMt r iIt j› ¶   ´ ¹ m 8 An./BŠW 8 {tAF4SZ>=?Z>BC=?NH2D.L2-NY.S.[.ƒ(I4J* .~E+.\254`1>.ƒ.JW 8 « .D4J:<.-.™.L^µ4HBC¾LA¼EI4c./BŠW 8 9)aHNF4Hg/.L1>.-.q./.Ù.0.LA 2-./132D*0.L^ N<.

8    .

8 :(**.

-  :(**.

-   8 8    .

* -  .8  :(*.

 .

 .

  ! #".

$%".

 ".

.

-gJWÓZ+* ')(N<.LA ihEh .gf‚.M}Ù*-N<:<*-4HAF4HxuaHNc.>.02-=CBC4KE>.-/) " 102) "   34)5'(%687/1 #*-/) " !) * #9 't1>E>*0¾ « ./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ. &%'( ) * .>4H*02-.+.+€.

ËJÒ  ? c .

E $  # e .

/.-./.™€N<=4H(+*-=CASN<*-4HEI4+^R4H(.@(>*0N<:<*D4JA94Hx/aHN>W 8 }h*0NsgL.cAF4H=C.0g/N<B?‰I4`N<./ AF¾G2DNRE>Nn¾[.\2 .ŽE>.LA UR./Aw‰>.9 D !#  " e  &%< 21 t<fhe k 9.LW 8 Qh.ƒUV./13254HBµE>N (+*-N•d0.oB?./.LAw.02 .L.L^AS¾L2-NsE+N<.‚.-.>AF4`gLB…4H.L.-.Ùg/BC4H./A NbAS.0.™N<.L1>.>AN<.+.>AS.s2D*D4J.M.q=?1>.0N<Z>*-.o.-vQP<.L.t.0.oE>NSAFNRE>.pAS¾L2-NsE+N<.Lgu4ME>.t.ƒAS¾L2-NsE>NH./132-.    ] !& +   ¥› ¶   ´ ¹ m {tAF4niI*D4JAF. $ ./g/vQ½Ig/NH.™PJ4H*0=…»uP<./AjP<.-.L1>‰I4FNH.DaHNKNKN<ZRd0.0N<AF.0.LW 8 « NsgL./1+.G2D*-=?×/.DaJNSE+./4+W³').o=C1>.LłN<*-ÑV.02-NS­4HgL=CB?=?254J*D»K4cE>=QPR=C.>1+EI4HAS.L1V2-N`E>._€*D4HAS.0AFNH.³(>4H*D4)NH.™*0.-N`E>NS(>*-N<:H*D4HAF4n(“.M¬­*-.LłN<*0ÑR.@AS¾L2DNRE>N<.‚.L.L.o.GŎN<*0ÑF¾[.og/BC4H./W 8 {p2D=?BC=?×/./AS(I4HgLNH254J1>E>NS4H.Ž(>4H*D4™4t(>*-Ï<(+*-=…4pg/BC4H.o1>N<AS./.-.LA94J.-.O.D4H:H.4HB?:<.L132D.og/NHAF(>*0.-.>132DNH./13PR=…4JEI4H.>1>.Lg/=Q½Igu4HxLs.MgLB…4H.02-=?2-./W 8 i4Jxu4cAF¾G2DNRE>N<./132-.-.02D.0.JW 8 y 4H132D.0.-.SE>=?PR=?E>=C*™gLB…4H.D4HAS.LE>=?2D4H*-=?.5®ŽE>.-4H:<.L2DN+^I(“N<*o*0./4HEI4H..+2DN[E+./W 8 Ð8E>.-4H*ƒ(I4H* .LW 8 Ð8E>.GŎN<*0ÑV.0.tZI4J.>./*0.>B?N<.ogLN<AnZ>=?1I4HE>NH./(>*0.G2D*-NH.L.>.>*-4HAS./132D=Q½Igu4J*tgLN<1•d0.JAF.L.³(I4H*-4)N<./*0AF=?1I4HEI4q»H*-./.@N<.0NsgL=…4HxLs.LW³Ð8.D4JAw.-.-(.>Z“gLB…4H./AF4J2D.\2 .LAwg/N<AS(N<1>./^µ.>gL=CN<1>4H* NH.@4Jg/.L.0.+.L=C*D4J.0.³.LAF.>Z>.L×oE>.™./1>./^µg/BC4H.G2D=QP<NK€.G½I1>=CE+N>^>*-.FUV./=?.pgLN<AS(“N<1+.L.GØs(>BCv?g/=Q2DN<.-.-./.+2-*-N<.tE>.L.L*-./^I4•2D*-=?Z>./*-.ÎAF¾G2DNRE>N<.+2-*D4H.q.\254H*oAF4H=?./*\€.@4H.-=?E>./132D.-.L(“NH1>E>N9AS¾L2-NJ6 E>N<.>./13254H*0./132D=Q½Igu4J*q.0N<BC.ƒ4Hg/.-.o.G2DN<./:<vQP<./A N`1>v?PH.>AOWkŽN<1>.+A94nZ>=?Z>BC=?NH2D.G2DNSN<*-=?.L=C./.0.HW \R./. E>=Q€.ƒ(I4H*-4`NH.oE+.D4J*t.M4HZ>.L1>.u4JEI4H.-N<AS.@N<.-N<AS. =C1>./132-.H1>gL=…4)gLN<An.-.oAF¾G2DNRE>N<.>*-.H1>gL=…4n./W e e Mt g t t g k t<f t k ebf t Ee e sMt<ilt r ilt j› ¶   ´ ¹ m 8 9)aHN`=C1+=Cg/=?.@N<ZRd0.q./BAF4H=C.L2-.).p4H./132D=Q½Igu4J*F./B?NnE>./=C.ƒg/N<A¼AF.-/0   $Y# D   r   iIt ./=?./132D.>A94ME>.oAS.~PH4J*-=…»uPH.L.L:<*D4J.>EI4H*oNH.LAF(+*-.+A94H.I»H*0=CN>W e e Mt g t thf k           0`% t ebf  9   .~4HB?2-NcE>.o./W 8 i4Jxu4c.+AF.q4H.Îg/B…4J.[NH1>E>./*0=…4HA./E>.>=C* €*D4HAS./. ZI4H./132D.-.FAF4H1>.-=CE+.F4HBC:<.>A 4•2D*-= 6 Z>.‚Z.-./EI4HE+.>AÆE>NRg/.L.L132D.L.™E>=?*-.[g/BC4H.ƒg/.L././13254HE+NF4cN<ZVd0.0.LBCNc.D4HA.q(I4J*D4S4Hg/./132D.MAS¾L2DNRE>N<.H1>g/=C4+W 8 Qh13PR=…4J*kAS.0./.+2-N<./1>.>A 8 Ð8E>./*-4H*h4)AS=C:<*-4HxuaJN)E>.Ž(>*0N<Z>BC.@E>.~.™N`(>*-NH:<*D4HAF4n(>*0.-.Ž(NRE>.p./132D.L.ƒ.0AFN AS¾L2-NsE>N E>.05.p1+N<AF./.0.o(I4H*-4`(>4H.0(“.+=CEI4HE+N<.O=CAS(>BC.Lg/N<1+.@gL*-=…4J*oAFÏRE>.+2D*-4H.M(N<*o€*D4JAF. o An./=CxLN34HEI4q(I4H*D4c./AfBCN<g/4•6 BC=C×/4HE>N<.02-*D4Hx/aHN>W W \s.HW 8 {p2D=?BC=?×/.ƒAF¾G2DNRE>N<.

*.8    :(*.

- !70%C%.%D .

8  :(*.*.

.

/.\2D=CBC4nE>.L1>.LA ihEh  4621 0   .-gJWÓZ+* ')(N<. f‚.@E>.0.- .p4J2-=?PR=CE>4HE>.oE>.L.-./.L(>.L132DN`EI4 e dueSs k E>4H././Ä 8 ŽN<AF(+*-. sMk k2iIe EI4H.>4H*02-g. g iIt e t<f e k W 8 'og/N<AS(I4H1>‰>4HAF.DaJNF./B?N<.L13P<N<BQPs=?EI4H.oE+./132D4HxuaHNSE>.L:<.>.L1>.t.>1>gL=CN<1>4HAF.L13254Hx/aHN>^V2D./.+€././1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.M}Ù*-N<:<*-4HAF4HxuaHNc.DaJNFE>N`€.LAF.@.>AS.-. '¥E>NRg/.@E>.@.o././.pAFNH2-=?PHN<.\2D.-./1>gL=…4HBÞ(.L.p4J2D=QPs=?EI4HE>.>*D4JxuaHN>W 8 ŽN<AF(+*-.L.-.LW 't1>E>*0¾ « .@=CAS(>BC.>AÆ(+*-N<:<*-4HAF4K¾@.L132DNcE>NS(>*-NH:<*D4HAF4K.>=C132-.

 ? c .

E  +] [A.

  $ J !  +  ËH‹ }h*0./.-. .+g/=CNH1I4HE>N<. Z>4H.>=QP<N<./A .0.0.[E>N`.+2D=?BC=C×/4HEI4H.0.0.ÙE>.L254J(I4H.-.LBC. .q¬­=CE+.-./.M.L.>AF.02-.0.¯68.JWÓB?N<:>^>Ð 9 \ r ' |Þ| W '¼E+NsgL.[4H*-UV.LPH./132D*0NSE+.L1VPHN<B?PR=?AF.+*D4cl>WQmq=?BC.LA94J./13254768./.™NH.5zJ.n.L13P<N<BQPs=?EI4H.D®G^+4H*-UV.ƒZ>./AF4+Ä \s=?.-./*DaJNc=C1>gLBC.ƒE>NRg/.o4H.)*-.>=C*ƒ.L1V2D4Hx/R.-./gL=C.0s./132D.LA .-¾L*-=?.HÄ ./.-.0N<BC.>=?PHNE>.KE>.-N>Ä fŽ=?Z>BC=?NH2D.Ù./13P<NHB?PR=CE>NH.L13P<N<BQPs=?E>N>W « ./g/4H.02-. .-.[E>NS4H.k4)g/NH1>g/B?.u4+Ä « .L1V2-N<.Lgu4H.[EI4cgLB…4H.02-.M.>v?EI4H.-.L13P<N<BQPs=?AF.LÄ ‡ /.>Aw(>*0N<:<*-4HA94`.L.Lgu4H.8d-4+^49E>NRg/.qE+.L1V2D4+Ä 'og/.0.E+./Ä fŽ=?Z>BC=?NH2D.o=C1>gLBC.0.0.‚./*™E+.LÄ FG J J]GIH  \VXa  NPO]QpW Y[Z]\ L W ` V W `S`bNP` 9tNHAF.q4Jg/.LP<.ME+.LÄ iIN<*-AF4H.L1V2-N[E>N<.+AF.LP<.02-.ƒ4J(“Ï<.KEI4H.@E>N EeSilg E>N`(>*0N<:<*-4HA94sW 8 }Î./132DNÉE>N(>*-N<:H*D4HAF4 .L*³E>.-././(I4J*D4Hx/aHNFE+N<.+:<./*\Ps=?*nE>.>Z+.>AF4n.0.-.0=C.LWTXÆ4H*0UV./AF4+^EI4H.-./.LA94H.-N<.T.DaHN E+NF(>*0N<:<*-4HA94sW '%ik=C:<.LW 8   6  # 6< $21 FG J J]G J  \VXa  NPO]QpW Y[Z]\ L \ `bR `.\2D.[E>=C*0.>=QP<N | QhÐ8' y Qo^µg5‰I4H1>:<./=C*0N<.0=C.L13254Hx/aHNɾE>.).QSN  W 9tNHAF.0./*0AF=Q2D=?*o4 fht e pk .0N<. fht Et<r .tE+NsgL.L(>*-.I4H=?./W « ./.-.>.>AS.FgL*-=…4J*t./*-4HE>N<./132D4HxuaHN EI4H./.0.-=C.o(I4J*D4)N[E>.+AF.LÄ FG J J]G  \VXa  NPO]QpW Y[Z]\ L \ ` W `S`ba OQS\ ` 9tNHAF.>./1>4HE>N<.h2DNREI4H././*0.G2DN>W {pA 4J*-UV.M4HB?2-./^J.™.>132-N9N<.ƒUV.GP<.>. E+.-.q4c.@E>.ME>.02D./132D=Q½Igu4HE+N<.L.LW ')(+*-./Aw./.>AF.L1V2D4HxuaJNE>N.-.-.MN<.LAF.L:<.pE>=?PH.L132DNE>.™./.oN<.-4HZ>=?BC=CE>4HE>.\254H*ƒ1I4H.t.t4HN(>*0N<:<*-4HA94s^NH.+AfE>=?*-.>.)Z>=CZ>B?=CNH2-.L.ME>./*0.>.~E+.M*-.0N<./*D4JxuaHNcE>NS(>*0N<:<*D4JA94n(N<*~2D.L*-gL.F(>*-N•d0.L./.L.LB…4J2-=?PJ4H.Ž=C1+€N<*e6 AF4HxLs.>. UV.L132DN<.-g/*0=Cx/aHNFE+NSUV./B?(bE>N (>*-NH:<*D4HAF4+W' E>NRg/.™gLB…4H.L2-Ï<*-=?N9N<1>E+.LÄ « =QP<.pE>.0.O»H*0.L.-.>AE>=C*0.D4H.-.-(N<1>.F‰>.³AF4H1V./*p:<.GP<.>=?PHNFgLN<AÆN<./.L*DaHN 4H*0A94J×/.)E>N (>*-NH:<*D4HAF494.G2DÏ<*0=CN « XM~{ y Q 9 r 'pXn^NH1>E>.-N<AS./13PHN<B?PR=CE>4É4HNTBCNH1>:<NE+NÉE>.\2D*D4S4H./13P<N<BQPR=CAS./.L2-Ï<*-=?NKg/*0=C.

/1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.0.@¾M4H*-AF4H×L.0€NH*-AF4Hx/R.-g/*0=Cx/aHNFE+NSNHZRd0.LAÆE>=?.M}Ù*-N<:<*-4HAF4HxuaHNc./.LĈ” † Qh.)EI4H.-gJWÓZ+* ')(N<.-.LA ihEh .I4H:<.02D4F*0.>AS.L2-=?P<N+Ä ').ƒ*0.-.02D„L1>g/=C4¬€.>132-N4cUV.-=?./B…4Jg/=CNH1I4HEI4+Ä \s. « .sØs=?BC=…4J*/Ä ” 't1>E>*0¾ « .-././13254JxuaHNS4H.02-=CBC4KE>./Ä ” † ŽN<1>g/NH*-*-„L1>g/=C4+Ä ” † r *-4H1>.0(“.0N>Ä † ~4H*-E>=?1I4HB?=CEI4HE+.>(.HÄ 'og/.+€.LA Ä ” † }Î.>.tE>4`B?=C1>:H./B…4Jx/R.L.@.-g/N3®GÄ ” † r 4HAF4H1>‰+N>Ĉ” † ')Z>.>./.>=QP<NSE>.-.Lg/=Q½Igu4HxLs./*0.L.\2D*D4•2543z<ŽNH1>g/*0.L254sĈ” † ')*-UV.L.>4H*02-g.0.@E>NRg/./1I4HE+NS. f‚./*0g/BC4H.

ÒHÜ  ? c .

E FG J J]GlF  \VXa  $  # e .

-gJWÓZ+*  ')(N<.-./.LA ihEh .+.0AFN 2-.\2D*-././x/aHNß<¿sWÀ¿<®G^t.-./AS(“NÃUR.LWŽX™.L2DNH*-1>N>Ä }k4J*.-N<.-g/*0=Cx/aHN>Ä ~4H*0E>=C1I4JBC=CE>4HE>.-.-:<ASB zŒØ+ASBk¬­.E>.\254J2-=CgŒ®¯Ä r 4HA94J1>‰>N>Ä    FG J J]G  \VXa  NPO]QpW Y[Z]\ L \ ` 9tNHAF./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.M}Ù*-N<:<*-4HAF4HxuaHNc.L2-*-N<.>AS.0g/*-=?xuaHN+Ä = r =C(N>Ä _4HB?N<*~=C1+=Cg/=C4HBŠÄ _4HB?N<*~ASvC1>=?AFN>Ä _4HB?N<*~AF»•Øs=CASN>Ä ‡ .-.9E>N©*-.02-*-=?x/R.>.>./.@(>*0N<:<*-4HA94J./.02D4SZ+=CZ>B?=CNH2-./xLs.I4H:<./4H(>*0N7PH.>.-4H1>E>N©2-¾/g/1+=Cgu4J.0=C./AF4c.L.+€.‚(+*-N<:<*-4HAF4H.TN<./132DN 4J(I4H*-.>.FUR.+./Ä ')Z+.02)zJ.02D*-4J2DN35z 9tN<*0A94JBŠÄ QkØsg/.-4HAS./132D4HxuaHNÕ.)./.-.D4HE+N>Ä r =C(NcE>.>4H*02-./=Q254HAS.0.ed-4Õ.-.s2D.>.0.LA"¬ €*-=C.>*-4HEI4H.\2D.0g/*-=?xuaHN+Ä XQS\L \ `  ‡ ./=?*-N<.JÄ « .D4H1>E+NÉ}_XMXÆgLN<1>.0(“R.LAf4MAF./.tN<.0.ƒA94H1V.HÄ '~2D*0=CZ>.I»H*-=?N`NS.+AF=?*DaHNONAS.L.>.-4H1>E>N |   ®GW « =?gu4+Ä « ./132DN>Ä r 4HA94J1>‰>N>Ä « =?gu4+ÄÍ}Î4H*D4ÕE>NRg/.L.L1>Eµzng/NH1>./*0./.L*-=?PJ4HE+Nµ¬ @z59™®¯Ä | =C1>:H.0.LE>=CE>4MUV.LB…4Hx/aHN>Ä « =QP<.0N>Ä }Ù*-¾¯68g/NH1>E>=CxLs./gu4n.>4H1>E>NMP<NRg/„hd-»ME>=C.LP<.ÙPHaJNK.+A94 Z+=CZ>B?=CNH2-./.L13P<N<BQPs=?E>N<.L1>E>NnE+././Ä ŽN<1>gLN<*-*0„/1>gL=…4+Ä r .I4J=C.\2D=CBC4nE>./AS(“N`E>.¯68. (>4H*D4 ASN<13254J*oN<.NH.ƒE>.L./1>.L*)N`(>*-NH:<*D4HAF4c4c(I4H*\2D=C*oE+.[(NRE>.*-.@*-.L1VPHN<B?PR=?E>N<.L.+2-=CEI4Í.LÄ 'og/..@(>*0NsgL.LÄ FG J J]G   \VXa  NPO]QpW Y[Z]\ L \ ` W Q pR aQS\ ` 9tNHAF.0.    ] !& +   NPO]QpW Y[Z]\ L W ` W `S`b\VXR W Y  PN ` « .~E>NS.LAnZ>.gf‚.-. NÍ€N<*0A94•2DN H' k' « XM ¬€PH.@E>.q.HAS.M./gu4sW  't1>E>*0¾ « .-./13P<N<BQP<.LW¥').s2DNS4J2D*-4uP<././.0.n(+*-=CAS.JÄ « .D4JB?254J*qUV.9PJ4H13254J:<./Ä « .>.Lg/./. .L.>.

#   # .

 !    Ò+m .

.

/13P<N<BQPR=CAS.+BCN 4H(>*-.+.>g/N EI4‰>=?.[E>./132D./132DNS.ŽN<.L.n4H.02-.KihEhnW ™.gu4H(+v?2D.0.-.9UV./Z+. E>.L1V2D4•68.~E+.>A (“NH.MNH.¾9NT't1>.0.pE+.I4H=?.ƒ4HAnZ>=?.o2D=C(N<./A ihEhnW ŽNH1>g/.pE+.././WŽN<ASN©¾TNÍB…4 .-=Ži hEhÆ.I4H=C.        w!        9t./AO^~E>.Tg/NHAF(>=?B…4Hx/aHN>^~B?=C1>ѕ4H:H.M(+*-N<:<*-4HAF4HxuaHNK.i hhn^³NUR./1+. PJ4H132D4H:<.>:<.L=?2DNH.L.L.02DÏH*-=…4 E>./*0.

/1>NS./132-. .+2E+.HN<.+AÆ(“. ½>1I4HBCAS./A ihEh.>A (+*-N<:<*-4HAF4b.É.LUV.>.LAF(>B?N>W ]   D !$0 Y%(0 $Y#'u"'T.M.GØs.

LPH.\2DN@.L.\2D./A 1I4 BC=C1+:<.02-Ï<*-=?g/Nc(I4H*-4F4cB?=C1>:<.0.>AF4 =C132-.K‰I4H*-EsÅ~4H*0.>4H:<.FmŒ‹<ËHÒn€N<= .c)W QÙ.\2D.LA f ¬€E>.>13254JAF.0N .-=?:<1>=Q½Igu4 UV.KN<(.>./Aƍ)^I1>.LA94[N<(.+2-.MgLN<ASNT{t1+=Qؓ^ 9){™z | =?1V./.>=?2-NSv?132D=CAF4+W   .n:<*-4H1>E>. ./*D4JxuaHN AK./13P<N<BQPR=CEI4`(“NH* « ./13P<N<BQPR=CEI4 (“NH*[./.-. oz<i hEh .LA.>A 4H1+NF‰>=?./A mŒ‹<ËHÜ3®G^ €NH=E>.L.0.cE>./*-4Hg/=?N<1I4H=?.LB…4`E>=?PR. .I4J:<.-.L1>EI4H:<.-=C.sØ .0=CE>N.s2D=CB?=C×/4HE>NS.HWqÛ2D.LPH./E+=?254JE>N`NFB?=?PR*-N  d   < DNM <O6?= A4 M 4 6?4 M?X 6 M 8^IUV.`4HN9­4J2-NE>.LA"mŒ‹3Ë<¿RW X4H1+NSE+././W ' BC=?1>:<.02-*-.>B?:34Hx/aHNFE+./*-4Hg/=?N<1I4HBs{t1>= Øn€N<*-4HAE>.0(“N<1+.I4J:<.94HAnZ>=?.0.LA./1>E+.SNH*-=C:H.LPH.hgLN<1•d0.02D./A./.K4H1>Nc€N<=./1 r ‰>N<AS(>./132D.0.oN[./.LB³(“.>. ' BC=?1>:<.0./(.L.>*D4HE+N<.I4H:<.M2D.@P<.-N<1º^.D»uP<./A (+*-N<:<*-4HAF4H./Aj2-.`È. y 4JgŒEX \  2-.L1V2-.M€N<=ÞNF*0./A%Í.L*™=C1+E>./13P<N<BQPR=CE>N<.cE>. ‡ =?g5‰I4H*-E ./132D.>g/.HW³Ð8./1>=?.

.

ÕNTihEh¼gLN<AFNO. gLN<13P<.H^ 1+N<.L1V2D4HE>N>W Xi hEhÊ4H(>*-.\2DN<.>.`gLN<13254H.L.L1V2D4t.-.LA94JAF.~PJ4H*-=C4HE>N<./*qj. \R2-*-N<.>.>4H.-.Mi hEhn^ÞN<.L.-./132D.+(“.ME>./AS.L½IgL=C.-4HA ihEhcWŽX™Z>.L*-g/NH1•d0./13PHN<B?PH.Þ.ÙPH4J1V2D4H:<.L2-N (I4H*D4Oi hEh ¥X gL*-=…4JE>N<*™E>N  hEhni^ fÞd-4J*-1>+.-.M(+*-N<:<*-4HAF4HxuaHN+W y 4H.L.-.L.~g/4HAS(“N<.[4H.>A.LBC‰>NH*c=C*cE>=?*-.+.[:<*-4H1>E>.).LPHN4J(>*-.ÙE>.>(4J½>*-AF4+^ 8.>.>132DNTE+.M4J½>1I4HB³E>./AS./B…4JxuaHNƒ4HNt)^Œ./(N<=C.MNFN<(./1+g/=CE+N©E>.[UV.  ÙQ A mŒ‹<Ò<Üs^fÞd-4J*-1>.%.+(ÃE>.`E>.L1VPHN<B?PH.>.L.™.-.0. \R2D*0N<._ASN<.LAF./132-.L2-Nb(>4H*D4 i  hEh .OUR.\2D*0.b=?*™E>=?*-.n2-NsEI4J.D4H.-.¯ØR2D*-.oE+./.>AF4~./A .SE+.c.q=?1>g/*0.L1V2-.cg5‰I4HAF4HE>NOÈg/N<Ag/BC4H.M.L1V2-. ¾OAF.-.\2D*-./*-4HE>N<*hEhn^I¾MNFN<(.L1>.ʽI*-AS.ƒA94H=?././A E+=…4+^“UR.S€N<=Ù=C1+=Cg/=C4HBQ6 AS.Ù.-¾L*-=?./*-4HE>N<*oE+.\2D*-NH.L1>E>./W a N7d0.L*0PH.0./.-=?A ^Iihh¾qN ’=C1>gL*-.0NH 28Ŏ4H*-.>./AÈ*0./132DN>^µ4J.Ù.KUV./AS(>*-.L.

5^ † fÞd-4H*01>.H^mu‹<‹<‹•”–W i Ò< .

 .

   ÒJl         J # 0  Y ' .

L.LBÙg/N<A N ' 9 \sÐ~ihEhc^I(NRE>./*ƒgLN<AF(+=CB…4JE>Nn(N<*oE>=?€.L.qihEh (>4H*D4cE>=Q€./=Q2DN<.+.L./132D./gL.`N<.c.SE>.L1VPHN<B?PH.%C#!Y $# .L132D.0254JZ“.-=?g/N<.L1V2-./*0./.0=C132547Ø+.[g/N<1+g/.>.™2D.G€./*n.-.L*og/.+A g/NHAF=Q2D„nUV.ƒg/NHAF(>=?B…4HE+N<*-.LBC.-.g0` ' $Y.+A (>*-N<:H*D4HAF4 g/N<AS(I4J2-v?P<./.LBC.L×u4`E>./*-.+Z>BC=?gu4HE>NMNM ' 9 \RÐ\zJÐ \>Xo‹<Ò<‹H‹MUV.[./*\2D.LA ihEhnWc}Ù*-=?1>g/= 6 (>4HBCAS.%$Y#& #  .SPHNsgL„9E>.L.>.[EI4B?=C1>:H.M.ŽE>.t¾tNM' 9 \sÐ_)W QhAwmu‹<‹<Ò[€N<=4H(>*-NŒPJ4HE>NMNK ' 9 \sÐ\z•Ð \>X  hEhnW i ]>=  .[(NsE+.I4H:<.E'T .L*-./132D.`N<.M*-./W QÙAwmŒ‹<‹<Ü[€N<=I(>.p(>BC4J254J€NH*-AF4H.c4O. X '9 \RЙihEh  ¾c.[Z>»H.@UR.9ihEhcW\s.' " .

>=C* 4J:<*-.@AF4H=CN<*‚E>.M*0.ng/BC4H.>BC4Hx/R.cE+.L1>g/=C4HAS.>AS.Lx/R.ƒE>.>./132DN<. =?1>BC=?1>./W k2fhk t t e e  ebf eSilt k t k  g k ebfhk s.L1>.O4H*0:<.KAS.Œ®G^+*-.>AF4 E>4H.L132DN>W qrIsMtum ŽN<Awi hh.nZI4J=QØsN1>vQP<.™./.L€.L*D4HB (N<*o2DNREI4n.GÅtzJE>./132DN E>. AF4H1V./.n491>vQP<./.G­4H.M:<.GØR2D./1>gL=…4H*o./:H.p4HB?2D4HAS..02D4Hgu4JA.-.pE>./^ (N<B?=CASN<*0½I.Mg5‰>4HA94JEI4H.L1>.J^ AF4H=?N<*`*-.>.L*-„L1>g/=C4H.L.L.q€N<*0An.-.t:34JZI4•6 *0=?2-N<.DaHNÕ.-(I4HxLN<.p.0NOE+.DaHNS:<.DaJNÃE>./*-.L1>.u4HB?=C×/4HA 2D4H*-.>(“xLs.L2-.g/ÏRE>=C:<N+^~A94J=CN<*`UV.L.O.>1>x/R.L.q(“.LAi hEhƾF.0NFE+.tNH.I4H:<.-.™€.¬€:34HZI4J*-=?2-N<. .)g/NHAFNFg/B…4J.KgLB…4H./.@g/ÏRE>=C:HN>W ]  '!$0  $Y# !70%C^.LUR.-.\254H132D.-NFE>./^µ.L.\2D.+=C(./=Q2DN<.>.%D ./132D.L.q.L*\6 AS=?2-. .+AF.-NHZ>*-.I4HB?=CEI4HE+.>A 2D*-4HZI4HB?‰>N9E+./*0=?½Ig/4HxuaHN E>./.L^ºE>NF(“NHBC=CASN<*\½I.L:<./132-.D®t. €.u4J(>*-NŒP<.LBÎE>./*0.L=?2D4HAF.c(I4H*-4 :H.0AFN+^³2D.0.02D*-4J254J.5®¯^_2-*D4J2D4HAS./*-4HE>N<*0.>.>.LAFÏ<*0=…49¬­1>.H^ÙgLN<13P<./.+.0.L=?2-N<.L132DN©E>.+2D=QPs=?EI4HE>./1>x/aHN>W y 4H=?N<*~g/NHAF(>*0./.T¬€1I4HAS./B–^ gLN<ASNSN`.9E+.u®GW « .™gLN<1>g/. 1>NHAF./W k2fhk k Er t Ee e   eSf ebilt k t k  g k EeSf k 7s./gLv?½Ig/4H.ME+.MUV././*-4HE>N<*L^+.L1V2-NqE>4M(>*0NsE+. 2D=?(“N+^hPH./.p4HBQ254HAS.n(N<*Mg/N<1+./B?‰>N<*-.[AF.(/0 #!D .>BC4Hx/R.@E>./^ UV.-NHZ>*-.GØs=C.c4HB?2-N91>vQP<.:<.+1>g/=?N<1I4HB?=CEI4HE+.L. ' BC=C1+:<.KNH./Aw./AS(>BC4J2D.L.>A _>1>=?g/N`(>*0N<:<*D4JA94HE+N<*~g/NH1>.+2-.>AF4cUV.ƒUR.02-.>.ME+.qB?=C1>:H.L*-*0.-./13P<NHB?P<.Lgu4H*0:34nE>.qE+.0.@=C132D.r t m X ./.-.Kg/N<1>gL././^>gLN<1>.L*-.)UV.I4H:<.-././^“€.Lgu4H*0:34nE>.[N<(.-aHN9NF.-ASNn.GØsg/.>.n€NH*-An. E>.L13P<N<BQPs=?AF.L2-N>^o­4Hg/=?BC=?EI4HE>.L.KAF4H=?.K4HZ+.+1>xuaHN+^ŽN<(.L1V2-.>(>4H*).I4H132D=?EI4HE>.™1+N7PHN<.g.-(.0.>AF4S€.LB~¬ 2D*D4JZI4HBC‰>4•68.9(>*0N<:<*-4HA94JxuaHNO./132DN E+./.r t m ').L*D4HBpE>N©(>*0N•d0.>1>xLs./B?.-(>4Hg/./.

L13254HEI4`4cN<ZRd0.L.t€.[E+.p4[(>*0N<:<*D4JA94Hx/aHN NH*-=C.>1>xLs./W k t<f t e t khe s r k ebf  m {p.I4HB 4S=?AF(>B?=Cg/4HxuaHNqE>.6?= 4S>B6 4 9 7 4 6 C 0"132!4#"%$5$&2 76)5 .>=?132D.+1>./.L.oE>.~€N<=>E>.0=Cg/NH.>(./*D4J1>xu4H.0.L€.@E>./=Q2DN<.~.‚./W‚X™.‚g/N<1+g/.H^Rg/NH1>.L(I4H*-4H*ƒg/N<Af(>*-N<:H*D4HAF4H.>132-NqE>.L.>(“NH*02D./13PHN<B?PR=CE+Nq(I4J*D4[EI4H*Ù.>A .Mi hEh hNRg/„™PJ4H=./*-4H1>xu4`E>.-.D4[N<.ƒ4Hg/*0¾/.Ž.0.L*-„/1+g/=…4J.Ãi hh g/N<ASNÕg/=C1IzJg/N<.0.0.-.q .qi hEhnW k t<f t t e t Ek ebf k e k t k  m {p.-N>^I€.O.0.ƒg/B…4J.OE>.ƒ./(I4J*D4•6 E>N<./:<.L.02/^*0.G2DN>W ™.D4S‰>.L=?2DNH./.02-N>^Ri hEh¾o.ÙE>.ed-4+^I.0.+. g/N<1>gL.>1+.ƒ.0254JE>N<.D4S4HBC:<.-.o1>N<.LWÙÐ81>g/B?./*-gLN<1•d0.o‰+.>= g/N<132D*0N<BC.@)^sEI4HE>NH.+1>x/R.q4Jg/.ŽE>.o€*-=?. ŽN<ASN™PR=C./.D4nN<.hg/NH1>g/.‚ZI»H./././Ä k t<f t e t khe s r k ebf m {p./=Q2DN<.D44JBC:<.0.tÕ./1>E W 4 7 4 X D 7 D 4 7 A> D @ X 4 9.p=?1>BC=?1>.s2u^ .0g/=CASN<.>1+x/R.-.0Ń=?2-g5‰ ^I€.

+ #!+ ) " ' )5 .! # "#)9)58:5 '()5 * )  ) '() .

! ")1"+.  &)6( !+# (9 ' " +. &6    # ".

)  *' *) )1'(. #'( ' )1+..+ .+ ./ 9 ] -     .

 .

/ /     9  .

  .

  .

21 .

9   6<36    2  . 21 <  <          .

 .9   6<36    2  .

 .9 8   8 4 6  .

.

't1>E>*0¾ « .gf‚.+€.-gJWÓZ+* .>4H*02-./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.>.

 .

.

.

M}Ù*-N<:<*-4HAF4HxuaHNc. ')(N<.\2D=CBC4nE>.LA ihEh .

/=?2-N<.  e  L_./*-4HE>N<*0.>=C*ƒN >.L=?2-N9E>.>./*0.q=?1>g/B?.gLN<1>gL.c./W5 4 7 4 X D 7 D 4 7 A> D @ X 4 9.cEI4 \ ƒr | g/NHAFNTgLN<13254H=?1>.M(“NHBC=CASN<*\½I.6?= 4S>B6 4 9 .qN9gLN<1>g/. .=?2-.-N E>.3Ò ß t<f t k rle t Ekht k e k ebf   m Ð81>gLBC./.-ASN>^+(NRE>.

9 . " [   +    J &    .i k  .

8 4   KSD 4 A= D <32 .

.

= D C .

 .

.

>./.ƒ.-./A¼.-NO=C132-.+1>x/R.~E>.ƒE>N<=?i .\2D.@=?2D.-NOE>.L. rIsMt ebf .@g/N<13254J=C1>.  m Ð81>g/B?.9 t<f t 21 k '9 e  ./.M:<.@(>*0N<:<*D4JA94Hx/aHN>W k  .+./W 4 7 4 X RD 7 D 4 7 A> D 9 7 9 MDgM 4 < B7 D C QÙ.L*-.O€NsgLNc1>N<.S€./1>.Ž2-=C(N<.0=?P<N E>.MBC=?PR*0Nn2D./1+¾/*-=?gu4H.L*D4HE+N<*-.>.`N . _>B?2-=CASN<.@EI4+\ rƒ| ^Þ.

.

 ! .-/E0 $Y. " ] P#  .  0 . T#&.

D . .

  .

+.-gLN<BC‰+.-.>.>./W }k4J*D4qE+.-.Lgu4K:H*D»J½Ig/4S.@. N  « Qo^>P<NRg/„@PJ4H=º2D./132-./*Ž(>*-N<:H*D4HAF4H./13P<NHB?P<. *D4H(>=?EI4HAS./.+A4HAnZ>=?.D4H1>E+NF‘’Ð 9 « Xƒ‘ \ .'D  . 4H(>*0.M(>*-N<:H*D4HAF4HxuaJNn.+./^RN y 4Hg™EX \  ^VN [1>N<AS..qE+./.+1>.>4H:<./1s6 PHN<B?PR=?AF. 4HAnZ+=C.-.@€N<*\2D*D4JA ^>(>4H*D4`./*t.0.02D4E>./132D./.02D.>.Ù.>Aw(>*0N<:<*D4JA94n(I4J*D4`NF}_Â./*`. (“NRE>.-.`UV.tE>./A].L1V2D4•68./A E>.>A94cZ>=?Z>BC=?NH2D.Lgu4H.-. NH./A .-4H1>E>N \VE \ r Q y  .-.-=?.L13P<N<BQPs=?AF.H^µN`./*-4Hg/=?N<1I4HB“.>=?*c.0.-.D4H1>E+N9N « XE\ .+.L13P<N<BQP<./BC4H. 8 .L132DN>W 't(>*-./././132-./.Mi hhn^I(I4J*D4 y 'pÂ.-/E0 {tAF4c(>B…4•254J€N<*0A94ME>.LA94cN<(./.L13254•6 .L13P<N<BQPs=?AF.>Aw4HAnZ+=C.@2D*-4HZI4HB?‰>N .+2D*0N<.D4H1>E+N { 9pÐ  .M4SB?=C1>:<./132D*0.L:<.n:H*D»J½Ig/4H.-.>. E>./W « .K(>4H*D4ÉN E>.0.-.T4É.q)^I.>.qN`‰I4H*-EsÅ~4H*0.G68./132D.>A94ÉB?=C.L132DN>W *G *G>J N NPY[Z]\ L\ W R NPOQSN  TV[\   K R R \ QpNPV[W `   T VXW ` .L13P<N<BQP<./*/Ä 8 .L1V2-NÍE>.L. (+*-N<:<*-4HAF4HxuaHN+W‚} NsE+. Z>=?Z>BC=?NH2D.+2-=CB?=C×u4JEI4H./.T4HBC:<.-4H1>E>N)^I(I4H*-4SNF}_ .   $#  ! % 0 C%.ME+.É(>*0N<:<*D4JA94H.9g/N<A d-4H1>.MNH.L.ME+.-4H1>E>NF { 9pÐ  .\254HxLs.p:<*D»•½Ig/NMg/N<ASNMNM‘’=?1>E>NŒÅƒ.-4H1>E>Ni hEhc^µ(I4J*D4cN9}_Û. E+.L*ƒE>././(N<=?.

-4H1>E>NJ6 ./132D.Ùg/N<AS(>.>./.sØ`gLN<A =?1V2-.n.LA g/N<AS(>././^VAF.t}‚ ) r ^}‚Û' r ^.L.³.h(I4J*D4@4HAnZ>=?.K. gLN<ASNqNq}_oz•‘’=C1>E+N7Ń.\254HxLs./g/.t.o./13P<N<BQPR=…4•6 .>. :H*D»J½Ig/4S(>4HE>*DaJN y X r Ðei‚^IN<.GØs=?./^QW/WLW o+.L^<vCgLN<1>.LB…4H././AS./132-.-‹  z 9 r z  }Î^V.0./13P<N<BQPR=CE>N<.L132D. NH. AF.L.+A (+*-N<:<*-4HAF4`.+2D4HE>N<*0.q./*\­4Hg/.02D=C4HAd-4H1>.¯ØR2DN>^ 1>aHN.LW y 4H=?.L132D.>.L1V.L.)*0.nvCgLN<1>. '%4HBC:<.M2DNRE>N<.-.)4J1>N<.0.+2D4Hg/=?N<1I4H=?.L.p*-NREI4H1>E+N y 'pÈEX \+\ .-aHNME>._(+*-N<:<*-4HAF4H.‚E>.-.-ASN y 'p Ó.-4HA d-4H1>.ƒ2D*-4HZI4HB?‰>N@*-NREI4H1>E+Nq{9tÐ  ^ 9){)z | =C1V./.pE>.H^Þ(>*D4•2D=Cg/4HAS.+1>./.LB…4H.LAASNsE+NF2D./132D.>A  <  = = = J4 AnZ>=C.

>A (>*0N<:<*-4HA94 eiµNH*ƒ‘’=?1>E>NŒÅƒ./13PHN<B?PH. .R./A  W « .\2D./*™.L.-.

G254H132-N>^ (I4H*-49UV./W a N7d0./.>A 4HAKZ>=C.>.L13P<N<BQP<.L1V2D4HEI4c4nN<ZVd0./^Þg/NHA"An.Ã(>*0N<:<*-4HA94sW hNRg/„`(NsE+./*[E>.>A(>*-N<:H*D4HAF49(I4H*-4.>./*D4J*-UV.L. .@g/N<AS(>*0./^AS.HW QÙ132D*-. E>.+2D*-4H.L=C*D4 g/4HB…4JAF=?EI4HE>.>=Q254 ­4Jg/=CB?=CEI4JE>.L./*M.`N<./*\­4Hg/. ./132D4HEI4 4N<ZRd0.L^ZI4H*0*D4H./BC4H./*M=CAS./g/4H.q./*ƒ4c(>*0N<:<*D4JA94Hx/aHNnN<*0=C.LPH./132-.T2D.-.c.>.+A(>*0N<:<*-4HA94`(I4H*-49.>.+A94 ‰>=?.q€NH*-1>.n€. AF4H=?./A 2DNREI4 . NՑ’=C1+E>NŒÅƒ.cN<ZVd0.>1>xLs./*0EI4HE>. d-4J1>. =…4©.0=CAwUV.KN<.>./B…4J.td-4H1+./E>=C4J254HAS.>.cg/*-=C4H*_d-4H1+./1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.-./gu4J.MUV.02-=CBC4KE>./gL=…4Õ4HB?:<.G2DN>W hNsgL„c.+2-*-N<.KPHNsgL„n(“NH.0.-4H=C.-=?13254•Øs./.I4JBCUV./A E+=…4+^ E+.>./* (>*D4J2-=Cg/4HAF.L2DNH.D4E+.L132D*-.+€././^UV./.s2D=CB?=C×/4H*/W X AS.[E>.L.‚€N<*01>./.LA i hEh     .@(“.c. .L*-EI4HE+N<.[NHZRd0.>AF4`PH.oZ+=CZ>B?=CNH2-.-.0ÏÊ€N<*01>.nE>./.q:<*D»•½Ig/N UV.ƒE>.M}Ù*-N<:<*-4HAF4HxuaHNc.LA .L.)½Ig/NH.™sWÀÜ`.L*-*D4JAF.LBCN ./1+E>.L1V2D4H.D^4H.-.-.):<*-»J½Igu4J.-4HZ“.>A4HAnZ>=?.LA94J=C./^Þ.SgLB…4H.>4H*02-g./132D.K‰>.J^t(N<=C.-Ï PJ4H=kgLN<1>.+E>NYNÕUV.0. 4HAKZ>=C.-gJWÓZ+* ')(N<.  hEhnW i 't1>E>*0¾ « .L*[(>*-NH:<*D4HAF4Hx/aHNN<*0=C.Ž.K.t­»HgL=CBŠ^“:<*D4Jxu4H.>=?*[‰>./:<.L2-N<./1V./*0EI4H*[.>AF4H. Z>»H.9€. f‚.L2DN`./^ÞZNH2DR./*[.L1V2-./gL=CEI4H. ./B…4J.>.ONF‘’=?1>E>NŒÅƒ.L1V2-. E>.K=?1V2-.-./*L^P<NRg/„nPJ4H=k2-.0.tgLN<AFN94Xo‘ | ^“4 t | ^“4 r ^“.s2D=CB?=C×/4H*~4H.>./*-4F.@4c. NY(+*-N<:<*-4HAF4HE>N<*92-=C1>‰>4ÕUV.L132D.L1V2-*-.-=?gu4H.S(NsE>.>=…4E+.L13P<N<BQP<.-gL*-.-. 4FZ>=CZ>B?=CNH2-.@E>.-ASNÕNsgLN<*-*0=…4ÃgLN<A N<.Lg/.L.

ÒHÇ   ( # .

.

  .

  ].

0. Q³ØV6 (.pgLÏsE+=C:<NS¬€g/N<ASN@NM't(>(SQkØs(“.@4H./gu4 y i΍¬ y =?g/*-NH.+Af4JAnZ>=C.0NH 2 ™=C.>BQ2D=?(>B…4J2D4J€N<*0A94+W Q   D &Y'#!#" ]  $# $#&"#! ' 0  `' D ! #  " #& 0 « .)gLN<AF(+BC.p4HB?:<.L2-NK.Î1>NM4HAKZ>=C.0254J1V2-.L:<.+*D4KE>RN fŽ.L.I4HBÞi hEhn^4HAnZ>=?.~E+.L2-NqgLN<A.~.L*D4HE+N<*-.>AF4H.   # ( ÙA ¿HÜHÜ3¿s^<4J.¯68.O¬€g/N<ASNTN ŽBC4H.cg/N<AS(>B?.-NJ 2 )=C.L2DNH.LBC(>‰+= ® .‚E>.-NSEI4SZ+=CZ>B?=CNH2-.>=CB?E>.I4q4H. B?=?PR*-. (.u®ŽAn.Ù.>./*ŽUV./B?NT(>*0N<:<*D4JA94HE+N<*/W ŽNH1V2D4HA254HAnZ¾/A g/NHA]4HAKZ>=C.Lgu4H./*e68*0./132DNFE>.hEI4KASN<13254J:<.LgL2‚‘’=C1>E>NŒÅ | =CZ+*D4H* ./.D®GW 8 fŽN<*-BC4H1>Ei hh¥ßR^+4HAKZ>=C.tPR=?.)=?132D.>=Q2DNcZN<A¼¾@N « Q ti hEhcW 8 y =CgL*-N<.DaHN@4 t | E>NfŽ.~An.>*-NH./.L*D4•6 .u®GW « „@(>*0.Lgu4qXƒ‘ | ¬ŠX™ZRd0.G68./g/=?EI4H.-(N<./*‚i hEhÈ=C1>gLBC.I4HBg/NHAF(>B?.+A94™P<.-./132DN+^>(“NRE>./*D4JE>NK4[(I4J*02D=?*³E>.ÙZ>=CZ>B?=CNH2-.>./g/4H.>4HB‚)Wj9pNÉ4HAnZ>=?.+2D=?BC=?×u4HEI4J.Ž‘’=C1+E>NŒÅƒ.LA ihEhnW r Ek $  ÙA 2-./g5‰I®M.-.L132D.™4HBC:<.L*025®G^R.-NH 28Ŏ4H*-.G2DN`g/N<Aw.@(>*-NH:<*D4HAF4H.-.sØÃ4H.4 Z+=CZ>B?=CNH2-.+2DNHA9»J2-=CgLN<.³*-././WMŽN<13254JA g/NHA:<.>1+EI4•6 2D=CNH1ŽBC4H.L.KZ>=?Z>BC=?NH2D.LPH./A E>N (+*-N<:<*-4HAF4q.cA94JE>.kAF4H=C./gu4n:J2DÑɬ€E>N %9t{™zJ:<1+N<AF./*~¬­.>1+.Ù€N<*-1+.-NH 2piIN<./g/4H.n4`./*D4JxuaHN EI4H.0. 9){™z | =?1V.L. 4HB?2-.0.0(“.ngLB…4H.™.0.L*-.L1V2-./*0„/1>gL=…4S4cZ>=CZ>B?=CNH2-.-4H1>E>Nn.L€./B…4Jg/=CNH1I4HE>N>WÎ{tA(>*0N<:<*-4HA94 @} | ¬€./.-N.-aHNn€.L1V2-.o(I4Hg/NJ2D.nE+.)E>=C×L.[4HAKZ>=C.‚­4Jg/=CB?=CEI4JE>.-g/*0. « .Î.>=C*ƒ4JBC:<./.L1V2-.ƒ(I4J*D4cE>. E+./*0AFN<.[gLN<AS(>BC./.-.0./13P<NHB?PR=CAS.>./132D.02D4H.+.-NKEI4qZ>=?Z>BC=?NH2D.0.L1V2-.™UV././.>=CB?E>.-.™2D4H132DNnNRfŽN<*-BC4H1>E ihEh¥g/N<ASNKN )=C.-.-./13P<NHB?PR=CAS.DaHN (+*-N<:<*-4HAF4H.>.I4HBٍihEh .>./132D.94 y i E>N y =Cg/*0N<.0.™E>.)ZI4J.+2D./A UV.@U32 ¬€EI4O2-*-N<B?BÙ2D./*\2¯®¯5W Qh.ƒNMg/ÏRE>=C:<N[¾o:H.

-. | =?Z>*D4H* .>®¯W 8 fŽN<*-BC4H1>ETi hh fŽ./g/4 t | ¬ )=C.>4HB ŽB…4H.L2DN+^µ2-=C(N ‡ ' «  gLN<A .0.-NE>4Z>=CZ>B?=CNH2-.>=?BCE>.>./132D.L*/^“4HAnZ>=?.qg/N<AS(>B?.

+®GW 1   .

Lgu4 r W 8 ŽNsE>.      ^‚(I4H*-4 NOE>.+.-=?:< Z>BC=?NH2D.G2D*0N7łN<*0ÑR.0.q.L./1>‰>NÉE+././*\­4Hg/.D4H1>E+NÉ4OZ+=Q6 8 UV2\68E>.q:<*-»J½Ig/4H.F=?1V2-.L!^   .n‘Ã4H*0*-=CNH* y .L.

L132D.   "#$#% &(')   ^h4JAnZ>=C.>.ngLN<A .0N EI4Z>=?Z>BC=?NH2D.[Å~4H*0*-=?N<*/W  9t{q*^  .Lgu4 g/NRE>.

 +  -.s2DN<AF4HÑH. M} | W 8 1 I  010o2^   .µ^™.+2-NsgLN<1+e^‚BC=CZs2DNRN<BŠW QkØ+=?./A 8 \s=C./AF4 % PH»J*-=…4J. /+.H^o4H.Ž:<*-»J½Ig/4H. .oZ>=CZ>B?=CNH2-.J^o4H.: hhn^~AF4HÑJ.02-.\2D./g/4H.

.T.L.9EI4  9){MW~X™1>E+.FPR=C.>.D4Í4H./*0*D4HAS.Ã:Ä  ./13254J.0=CAS(>BC.L1V2-.$5+68%95s^ƒ4HAKZ>=C.qE+.  435 +6#'  674..LUR.D4J*/^ .+.0./1>NÉ.S€.0=?2-./1>gLN<132D*-4H* 9tN©.I4HB‚(“.>.

+*D4 ßsWQm942-. +  43(  +6#'%674./B…4 E>N « .JW h.ME+N .02-*-.02D4HB…4H* \s=C:34 =?1>.0=?2D.ed-4 1I4 ik=C:<.LP+i hEhnW Q      .L.>xLs.#$# 6$9#+68%95 %(sWOŽN<AFN =?1>.

  .+'( '( #+ .< 2 =*$& 8 + .

?> 1 @>  .

/1>Nc6hÅoÅoÅ@WˆBCAS(+2uWˆ.M}Ù*-N<:<*-4HAF4HxuaHNc.+€.gf‚.LA ihEh .>4H*02-.*A - '(9 't1>E>*0¾ « .\2D=CBC4nE>.-gJWÓZ+*  -  "#) ')(N<.>.

.    ] ..

.

 .

 .

e .

!    # ( Ò3Ë ik=C:H.LB…4cE>N « .>*D4`ßsWQm<ÄÙ'¥2D.GP ihhf¬   .

  435 +6#'  674.S‘©4J*-*-=?N<* y ./^)  .$5$68$95$68$9( 8%(3®¯W At<s 8 8 8 Ž NsE>.L2-*-NŒÅ‚N<*-ÑV.

L132D./g/4ng/NRE>.J^V4H.0NEI4 Z>=CZ>B?=CNH2-.-=?:<1   .\2D.   "#$#% &(')  ^o4JAnZ>=C.H^V4H.Sg/N<AS(>BC./A%PH»J*-=…4J.L.Lgu4H. M} | W UV2\68E>.Î:<*D»J½>gu4H.+2-NsgLN<1+e^<B?=CZ+2-NsN<B…®GW QkØs=C.\2D.[Å~4H*0*-=?N<*/W \s=C.kZ>=?Z>BC=?NH2D.s2DN<AF4HÑH.G2DNOg/N<A./AF4   9){¥¬€: hEhc^HA94HÑJ.>.

Lgu4 r W   r Pd  r d ./.L1>‰>NTE+.K:<*-»J½Igu4J.-4H1>E>N4 Z>= 6 Z>BC=?NH2D.F=?1V2-./*\­4Hg/.L.      ^Ž(I4H*D4 NE+.>.q.-.

>1>.H^ B?=C.h¾pAK./W 8 Ñ ./13254H.\254•6 .L:<.I»H*0=CN<.>×L=CE>N+^RB?./=?.L.t4HAnZ>=?.  6 7  - X™.L*-NME>.>.H^“4HB?:<./E>NM.hE>=?.02-./132D. E+.>=C*L^>Z>*0./. % 9t{™z | =?1R./.>=?2-NM:H*D4H1>E+./*0NÃE>.9E>.-.02D4H.L132D.³¾ƒ*0.Rغ^Ž{t1>= ؓ^ y 4HguX \  (NRE>.L./1+:34H1>N>WÙXÂ1 _>AF.Ž(+B…4J2D4J€N<*-AF4H.-.@4c./.oE>.F.ON<(x/R. Nb1 _>AS./E>.-(N<1>vQP<./*-*-4HAS.-.LAF.+.S1>NŒP<NH.ƒ€.LP<./A 4Hg5‰>4H*FUV.

RB?=QØ   .

| =CZ>*-4H* .  435$+.9gLN<AS(>BC.9E>NO2D=?(“N ‡ ' « ^ g/N<AÆ./gu4 t | ¬ )=C.-.68 (+W 'tAnZ>=C.>4HBލŽB…4J.G2DN .L132D.-.86  (+&  .+.-NSEI4SZ+=CZ>B?=CNH2-.

+®GW 8 ŽNsE>.S‘©4J*-*-=?N<* y ./)^   .L2-*-NŒÅ‚N<*-ÑV.

0NEI4 Z>=CZ>B?=CNH2-./g/4ng/NRE>. # >1 > & .+. .!) '( )5 7 & #1! #+ ' '( .Sg/N<AS(>BC.>.[Å~4H*0*-=?N<*/W   - 96 4)5%) 8 5:  -/)54)   & 6 "! '( +!"6  ' )*)-)5 $" # '(  @> !9 %&# ('.   "#$#% &(')  ^o4JAnZ>=C.G2DNOg/N<A.L132D.) )< > + 4) '() *+ & 6  0 #' 8 :5-.0 6 %) & +.

! -/)54)/ *   6  1' 0 23254 68737 9:939 .ML EONP.$<>=@?A:B2>C@D E3F>AHG3I JK.Y43034 Z / 9 ["\^]^_0¾ a« `^b _HcOdgf ` d:\^egfhÅoÅoiÅ hkjml-n c3h ` ( oOpVhrq _ [anKeoHcOsmj b ]^dMt} _Oeu_ b l bXv3w egd5l i hEh   .RQ < 7:=5D 75S3T3U:7:C>B:B AHGCG 2 =>B57@D = B@= G3?>E3F@?VAWNX= G 2 EK.

ÒHÒ  ( #  .

 .

 .

  ].

   # ( "!# $ b l q^sYd:\ c d]^d ]^d:oHd:\&%eXj'%sml-d:\ c e p5el-n^jmd@c e d l-e] d:_O\ e($ p:el ` oHe] b q^sYq^jmsYeXc d5p b*) c e ` Ñ ]^dVh }d5_Ol-sYc d+%smo ` b jYsC× b _ eo b _ ) ` s..%eo d b o p5j b oHoOd5o ]^d-]^sQ(d:_Od5\ c d:o (e_Ol b o:h.` sYcOe/q d5l ]^ep ` l-d:\ c b ]^e^h0/ \^]^did5\^p:e\ cO_ b _ 9 egoOsYcOdcÄ) .

 +  &868$98 +. h el)e-sm\ oHc b j b _ ep/„ nKe]^d q b s Ø b _ e n b p5eXc d _On l d sm\ oHc b j b _ d5l o ` b lF» ) ` sY\ b $ dGØ“Ä _Hn^l f21s% ‰ Ñ] d3%d5jmenf4%d5_Oo b e^hk_On^l h d65 b \ b87 smu ` _ b ßhÀ¿ b cOd:j b ]^e`Ñ ]^d9% d:jYen h ) c&f ]^d5oOsYu\   .

b p:d5o uX_D»J½ p b o ` o b \^]^e b q s f q^jmsYeXc d5p b >= h ij b ]^d)¬   .        : n b _ b e ]^d5oOd5\>‰^e] d-sY\ c d:_<.

3®?$ b l q^smd5\ cOdp5el)n jmd5cOe ) ` d ` c sYjms?× b e"cOejCÑ sYc*]^eauXcDÑ hEh  .%. +.5 # + .#%68  .

8 9 .

I .

4 D8K .

   .

 &$ .     8 8    . C 8 « Q  ihEh¬  .

#$#+68%95<®9$ b l q^smd5\ c d@%sYo ` b j nKd ) ` d5\^e doHsml-n^jmd5o]^d ` o b _A$ ` o b-b o .(d:_H_ b l-d:\ c b o ] b 9B1 h 8DC D X < 7 . +  43(  +6#'%674.

4 6?I M 6?> D < < .

 EFGHE.

"I(J(.

` \^]^sm] e($ l b ot\ w eic d:l b l-d:oHl b p b n b p5sm] b ]^d"] d"e ` c _ b o jYsm\^u ` b ud5\^oba?$ e]1 4 K d c_ e oOd5u ` \^] e l b smot]^s.(e_Ol b o5h k t<f t k Er t<i 7 W q m [ n^_Heu_ b l bVv3w eX%smo `^b j \ w eT¾ \ d:p:d5oOo b _Os b l)d5\ c d e_Hsmd5\ c b ] b b eqf 5Hd@c eo5h  \^e_Hl b jYl)d5\ c dgl b smoY­.2$ jmsYq c eej ® Qh Pe]^d@fMoOd"]^d:oHd:\&%ej.(e_Hl)sY] b ]^d \^e)]^d:oHd:\f %Xej'%sYl)d5\ cOei]^d"oHd ` o n^_Heu_ b l b o3$ n eXsmo eil)d5oOl-e d5oHc b n^_Hd:oOd5\ c dad5l n^_ b c smp b l-d:\ c d cOe] b o b o n j b c b .. b p5dO$*d:\ c _Hd5c b \ cOe($+d5oOp:eX\^]^d ] en^_Heu_ b l b ] e_ p b _ b p5c d5_TYZ oHc sYp b o[% s c b sYo+d ]^d:s Ø b eipLÏ]^sYue l b smeX_:hPe]^d:l oHd:_ ` cOsmjms?× b ] b on b _ b n^_Heu_ b l b on d )` d:\^eo d lS¾@f ] smeoŽ¬ \ w eaoOd d:o ) ` d v:bR) ` d c e]^eoPeon^_OeuX_ b l b oPsm\^sYp:s b l nKd ) ` d5\^eod ]^d:nKesYooHd c eX_O\ b l u_ b \ ]^d:oD®@h « d5\ c _Od eXo n^_Heu_ b l b o% smo `^b smo b c ` b smotnKe]^d@fMoOd p:s c b _te]\ X 6 4(^ 6 B7`_ eil b sYot]^s'.H&9KF EF G#HLJ  h 8 \smo&c d:l b %9M1%¬(u hEhN$l b ÑVOd $ bX` c eXl b ÑVOd $ bX` cOep5e\ . »Xp5smjt]^d-n^_OeXu_ b l b _ b sm\ c d5_.%d5_ eo n^_OeuX_ b l b o p:el d5]^sYcOe_Od5o ] d cOGd Øc e oOsml-n^jYd:otd ` o b _ e l b ÑVd n b _ b p:eXl)n^sYj bXv:w e bX` cOel b c ?s × b ] b h =*d:l e p3%on b _ b p:e\ c _Hejmd ] Rd %Xd:_HTo Sd:o:(h QkØ sYoHcOd:U l %J»X_Hs b o q^sYq^jmsYeXc d5p b o uD_ »•½ p b o RP@V h  / q^oOd5_%Xd ) ` d ` o b _ae)oOsYoHc d5l b %9M1 u b _ b \ cOd ` l b l b sYe_ n eX_Hc b q^smjYsm] b ] d d ` \ s'. ` \^]^sY]^e($ q b oHd b ] e \^e b \ c sYue`P b oHp b jda9$ ee&^ X 4 9 < ` o b b jmsY\^u ` b uXd:lgif hh di/h q b oHc b \ cOd)p5el-n^jmd@c e($ _ 8  .

867 ( 3 / %+68  ?.8684%(& a hjP b _ b %9M1>kOV sY\ `#l c d5l e*m`n 4 poq_  .  35+$.

678%(& a h Pe t<fhe t W c msrl smo&c d5l n^_Heu_ b l b o>f [>t r n b _ b e ]^d:oHd:\&% eXj'% sml-d:\ c e] b b \FXu jYsmoHd e_Hsmd5\ c b ] b b eqH5 d5c e/p5el)e ewv s cxyf j b oOo _ 8  . +  43(++.67   &#?.

68% &aa d e/_ b cOsme\ b j _HeoOd _  . +67   ( .  4  $.

% sml-d:\ c eg] b b \FXu jYsmoOd _ ] s b u_ b l b o ] d b \FVu jmsmoHda?V$ e oHd:u ` \^]^e li| ] ` jme n d5_Ol-sYcOsm_Os b b p:eX\^oHcO_ `^v:w e ] b sY\ c d:_<. bO{ e/]^s b u_ b l b ] b o p5j b oHoOd5obk b c _Hsmq ` cOeo k l8@h c e]^eo d ] eo_Hd:j b p:sYe\ b l-d:\ c eXo ] b o*p:j b oOoOd5o:h[/ n^_OeXu_ b l b p:e\ c b p:eXl ` l li| ] ` jme ) ` d uXd:_ b e pA| ]^smue ]^e"n^_OeXu_ b l b d5l ]^s.    -$K .(. d:s c b o bX` c eXl b cOsmp b l)d5\ c d d5l cOe] eo eo b _ ) ` s.^8*   ("@a h!9"d5oHcOd:o egn^_OeXu_ b l b ]^eX_z.% eo5h H† # ˆ.‡ ) 6 %)- ‰ 6 #)! . b p:d@% smo ` b jml-d:\ cOd d eac d5_Op:d5sm_Heali| ] ` jme nKd:_Hl)s c sY_Os b b b j c d5_ bXv:w e ] e p3| ]^sYue ]^sm_Hd5c b l)d5\ c dXhP b _ b‚) ` d-eoHsmoHcOd:l b oHd25 b d3ƒ p5smd5\ cOdO+$ e n^_Heu_ b l b ] e_ ] d3% d/nKe] d:_acO_ b q b j„x b _ d:l ) ` b j ) ` d5_ ]^eo li| ] ` jmeXo"d b o p:e_H_Od v S d5o oOd5_Od:l…(. d:_Od5\ c d:o jmsY\^u ` b ud:\^o b n b _HcOsm_ ]^eo ]^s b u_ b l b o]^d5oOd:\&X% ej'% sm] eoA$ e ) ` d}h ` l b u_ b \^]^d>% b \ c b uXd:l h 9"d5\(x ` l ]^eXo b l q^sYd:\ c d5o b c ` b smoh p:eXl)n^jYd5cOe^h~1 l b l q smd:\ cOd ]^d ]^d:oHd:\&% eXj'% sml-d:\ c e p5el)n jmd5cOe _ d sY]^d b j+a c d:_Hs b c _T5€ o li| ] ` jmeo5h@/ n^_OsYl)d5sm_Oe li| ] ` jme n d5_Ol-sYc sY_Os b e ]^d:oHd:\&% ej.

- !) 6 # + 7 Š1‰  '( #+ 61 .

oOpVhrq _ [anKeo&c smj b ]^d`tP _Oeu_ b l bXv3w egd5l“f ”R”  .m43054Z/9 ["\^]^_h `^b _HcOd}‘ ` d:\^egf@’ ’ i’ hkjml-n c3h ` (.YQ <>7:=5D 7:S5Z" 7:C>B:B A&GC G 2 =>B57 4 < E3:Ž < C NVCL@C:E . ) < > + 4) '   & 6  0 .'( 8 :5‹1Œ 9 03232:4 687:7 93939 .9 21 / )6 "5 -  .ML EON*. < =5?A:B2 C:D E FAHG3I J .

  .

%  .3   .

 .

 .

   !"#$ %&'  % 2.354 .

7698 (*) 7 smu ` _ b.1] d3%d5jmen _   .+ h.-0/t[ c d:j b ]^e.

  &68%98  + . b oOd-]^d/n^_T h f n^_Hep5d:oOo b l-d:\ c e‚h ` l b oOd )wv €:\^p5s b ] d-oZml qKejYeo ) ` d pbx b l b l-eo ]^d ` \^sY] b ]^d ] dicO_ b ] `^v3w e h x9WT^U'y{z|[fijWZV // p5el-n^smj b ]^e_td5\^p:e\ cO_ b eo d:_O_Heo] daoOsY\ c b l d ]^e n^_OeuX_ b l b d"_Od b jms 3{ b b c _ b ] `^v:w e ]^e p3| ] smue d5l jYsm\^u ` b ud5l ] d lu ) ` sm\ b ha d:nKesYo ]^d p:eXl)n^sYj b ] e e n _Oeu_ b l b n b oHo b/b cOd:_ ` l b _ ) ` s.(.ƒ p b b o sY\^oHcO_ `^v Sd5o ]^d p5el-n^smj bXv3w e n b oHo b ] b op:el e oOsm\ b j"t uRPt_Osml-d:sY_Oe o w e sY\^p:j ` Zm]^eXo)eo b _ ) ` s'%Xeo d l cOd:_H\^eoA$"]^d:nKesYo o w e n _Oep:d:oHo b ] b o b oil b p:_Heo:h/ _Hd:o ` jYc b ]^e ] b .% el b 1Vd3ƒ jYdXh " d:nKesmo ]^d jmsm\‡1 b ]^e ` l n^_Heu_ b l b c d5l ` l b _ ) ` s'% e d l d:p ` cbu X% d:jj} hrd l d \^e`v sm\^]^e’ o3$ b hke ` c \^eˆ€B1>kIPV s f \ `l hc/ o d:_H_Oeo ]^d jYsmu bVv3w e o w e/]^d@c d5p5c b ]^eo nKd:jmegjYsm\]1Vd:_5h'‚ d25 b \ b = b qKd:j b. eX_Ol b o:h ‹ gwŒ'YZgoV /@/ ] d:q ` uXd:_ch ` l n^_Heu_ b l bY) ` d b 5 ` ] b e n^_OeXu_ b l b ]^eX_ b d:\ p:e\ c _ b eo d:_H_Oeo ]^dan^_Heu_ b f l bXv:w e(^$ eo . b l-eoHeo q ` u]Žko:h h ’^l n]‘”“Xu*‘5•—–~• ) ’‡˜•c5 ’]™f••9š›™]˜>œw”š'fƒ žh•—‘“*ŸS “*œ5“*Ÿ¡™]“¢ ]‘”“—£*‘5•—–~•¤o’‡˜"žh“*œ‡Ÿ”“¦¥  V\Wf'z{gwVw_ / n‡‘OeOƒ jYdh‘0" §¨œ]™]‘h  ’]•—‘c”˜}¡‘ ’]˜hœ]“¢¥@’ ’ ’ ©«ª›–¬ ‡p©«’|. e_Ol b-` l e ` l b smo b _ ) ` s'% eXoQ} hkeq#5 _ } hre&a d5l ` l b _ ) ` s. b oHd ] b p:el-n^smj bXv3w e($z%Xd:_Os.>=>?@BA =>.% e ]^d)n^_OeH5 d5c e e ` d5l ` l b _ ) ` s.+ hŠ‰ b o d l c d5\^oTS d:o ]^eXo b _ ) ` s.a p5el-n eo&c e ]^d ` l e ` l b sYo b _ ) ` s.>CED"?@BAGFEHIKJ<L9?@MHN:E@O6QPK=RHS@ ad5oOp:_Hd3%Xd@f oHd b oOd5u ` sm_ b jmu ` \ o p:e\^p5d:s c eo ud5_ b sYo oOeq^_Hdin^_OeuX_ b l b o:h <T UOVXWZYZV\[]T^[`_. d:_Od5\ c d:o n^j b c b (.% e~} hreq5 _ } hke)\^ei1 \^s l Z$ €B1BkOV sm\ `l @a hƒ‚ d65 b87 sYu ` _ b.%eoid5\^p b ] d b ]^eXo:hi1"l b _ ) ` s'%XeXh-p5el-n eo&c e nKe_ ` l p5e\ 5 ` \ cOe-] d sY\^oHcO_ `^v Sd5o ]^din^_OeuX_ b l bXv3w e _ d:l [Yt(f!bcb<a@h d [fehgijgkUOVXl*m5UjVXWn*goepeh[fTqg0rsW / a b n^_OsYl)d5sm_ b .% e d l d:p ` cbu % d5j hY/ o b _ ) ` s'X% eo ) ` d oOd:_ w e ` \^sm]^eXo o w e ]^d9ƒ \^sm] eo d5l ` l b _ ) ` s.% eo uXd:_ b ]^eo \ b o ]^s.„h y…r†ZgoV /j/ jYsm\]1Vd:_ c _ b \^o<(.+ h.a@h :<. Ÿ”ž¦©®­‡‘ § “*Ÿc”š›ª›•ˆ™]˜`.

P ‘”“*£*‘”•—–~•—¯p°—“¢˜>–“f ”R” .

) o  &ƒ%B%'K"  %ˆƒ  jB.

cpp compilador Prog.0/2131 H 4657578 §  •—­˜hª›• + ©.'&¦HS@OHC)(S?+* % F<HNCE6ˆ8 HC).cpp lib class2.o Prog class2.!=>?-jJE@'? ..™]“~ ‡‘”“*£*‘”•—–~•‡© class1. Bk    0t  šŠ£*’]‘”• + ©.•—‘c¤w’]š—“¢™]˜ ]‘”“I!c˜>5“  •Ÿ”˜>£*’]šŠ‘SŸ5°—“ ž>‘”š›•—™]“*Ÿ“*ŸB•—‘c¤w’]š—“*Ÿ™]˜žp•—­˜h¯h•—ª ]“ }w© !Q ˜ “—Ÿ¨•¦‘”¤w’]š—“*Ÿ™]˜š›–¬ ]ª›˜>–~˜>œ •—¯h°—“ }©®ž> ]  R© „x _ xFa h’]•—‘c”˜}‘¡’]˜hœ]“¢¥@’ ’ ’©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ §¨œ]™]‘ _ a “f ”R” § “*Ÿ 5š›ª›•™]˜C.o Prog.h linker compilador class2.3$# .o class1.h compilador opcional class1.cpp _ a 'x –¬˜h–7– •¦š›ŸO”˜h–¬  “ “*œ]™]˜“ ‡‘”“*£*‘”•—–~•˜hŸ  •Ÿ”˜>œ]™]“Qª›˜hœ”“ Ru™]˜ “*ŸcŸ”˜™]˜hŸcŸ5•š›œ|“—‘”–~•—¯p°—“¨  “o™]˜ ¥ Ÿ”˜–¬˜hª ]“*‘”•—‘ •Q¤w’f•—ª›šŠ™f•—™]˜™]“Q ]‘c“*£*‘5•¦– •˜•Ÿ”’]•*˜>ª›“ožhšŠ™f•—™]˜¦©ƒ§ ˜hœf•¦Ÿ!‘”“o™]˜“ˆ ‡‘”“*£*‘”•—–~•™‡˜¨™]˜>œ5‘”“ˆ™]“ˆ ]‘c“ fªŠ˜h‘%˜•¦œf•\¥ ªŠš›Ÿc˜“*Ÿ‘”˜hŸc’]ªŠ5•—™]“*Ÿ™‡˜”˜h–¬  “.„0/ 0˜h¤ v ˜>œ]žhš›•~™]˜£*˜>‘5•—¯h°—“.™]˜˜ ˜>žh’]¯h°—“ ™‡˜Qžh•—™f•|’]œ]¯h°—“]© l Oƒ rl 5˜hœ‡Ÿo˜hŸ’‡Ÿ”’f•—šŠŸ™]“*ŸB•—‘c¤o’‡š*“—ŸBœ]•—Ÿ™]š|˜>‘”˜hœ”˜hŸ ]ª •\ •|“*‘c– •¦Ÿh© t0š 5’f•¦¯p°—“ ™]“*Ÿbkv š›œ]™]“ ’ Ÿ Bœ]š l  € Bk š›œw’ l •—ž •—œ5˜>Ÿ¨™‡˜Qž>“*–¬ ]š›ª›•—‘ œ]“*–¬˜—© x¦k œ‡“*–~˜¦©®ž> ]  œ‡“*–~˜¦© xF¦k œ]“*–¬˜—©«žh ]  œ]“*–¬˜—© x¦k œ]“—–~˜¦©®ž> ]  ™]˜h “*šŠŸ™]˜žh“*–¬ ]š›ª›•—‘ œ]“*–¬˜—©«“*­"! œ‡“*–~˜¦©®“ œ]“*–¬˜—©«“ ™]˜>  “*šŠŸ™]˜ª›šŠœ]1\•—‘ œ]“*–¬˜—©«˜ l ˜ œ]“*–¬˜ œ]“—–~˜  •—­ ˜>ª • + © ‰*/ 2.|’]œ‡¯<o˜hŸ˜=¦•—‘”š >*˜hšŠŸh©S‚%“*’ ž f•—–~•—‘™]˜+|’‡œ]¯p°—“ •— ˜hœf•—Ÿ¨•—Ÿ |’‡œ]¯<o˜hŸ£*ªŠ“*­f•—šŠŸ˜?|’]œ]¯@0˜>Ÿ"™]˜ ©‚%“*’ ž f•—–~•—‘™‡˜– R5“o™]“ •¦Ÿ |’]œ]¯@0˜>Ÿ"¤w’]˜¢Ÿ5°—“ š›–¬ ]ª›˜>–~˜>œw5•—™f•—ŸBžh“—–~“  ]•—‘c”˜™]˜’]–~•ˆžhª›•—Ÿ”Ÿc˜—©BA “—­"!c˜>”š*“ •¦ ]‘”“ š›–~•—‘!“—ŸSžh“*œ‡žh˜hš 5“*Ÿ™]•CBA=A ™]“*ŸS™]˜ ‡‘”“*£*‘”•—–~•—¯p°—“ˆ˜h– © yf ”R” 2.–¬“*Ÿc”‘5• •¦Ÿˆ™]š9|˜h‘”˜>œ]¯p•¦Ÿœf• œ]“—–~˜>œ]žhª›•¦5’]‘”• ™f•  ]‘”“*£—‘5•—–~•—¯p°¦“ “*‘cš›˜>œw5•—™f•G• “*­"!c˜>”“G˜ • œ‡“*–~˜>œ]žhª›•¦5’‡‘5• ™]˜ © €B˜hŸ 5˜Eª›š9o‘”“G ]‘c“0ž>’]‘”˜>šS’]Ÿ”•—‘Ÿ”˜>–~ ‡‘”˜E“*Ÿ¢œ]“—–~˜>Ÿ“*­"!c˜R5“  •¦”‘”š›­‡’‡5“G˜E– >”“0™‡“]© •—Ÿ˜>–M•—ª›£*’‡– •—Ÿ“ožp•—Ÿcš:o˜hŸ’]Ÿc“ “*Ÿ¨“*ŸB”˜h‘c–~“*Ÿ.3$D E^?GF69JH- wf FEHNJK8 +h bx l :E@O69L@ƒ?Q8 „u 8h ih bx f ”R” ? 9ƒ A ™]˜hŸc˜hœ0*“*ª9oš›–¬˜hœ5“¢™]˜’‡–  ]‘c“*£*‘5•¦– Q # • š›œ]šŠžhš •Qžh“*– •™]˜ fœ]š›¯h°—“¢™]“.

‘”“*£*‘”•—–~•—¯p°—“¢˜>– .

.™]• C A=A7˜™]˜  . " ' %BK )‡‰ @ }f ”R”©  •—­˜hª›• + © -o/ š|˜>‘”˜hœ‡¯p•—Ÿœf•¢œ]“*–¬˜hœ‡žhª •\5’]‘”•.w .

 .'.   "!#! %$'&( )* $'&* +* .' .<=3 .- /10+*23 4 57698: 0)*.-.23 du §S5‘cš›­]’05“ §S5‘cš›­]’‡”“  ¦•—‘cš >*˜>ª /1  .

 >9?2123 %@( 576 t0’] ˜h‘cžhª •¦Ÿ”Ÿ”˜ .- B23 .'. .

C '.DC E2 G H 72.

DC I223 JK .

LC E.

5)6 A MONDPQN-R  .

Z 3ƒ !ª •¦Ÿ”Ÿ”˜­f•¦Ÿ”˜ F { A •—‘”¤w’]š9*“™]˜ ]‘c“ !c˜>”“™]˜ fœ‡˜B¤w’f•¦š›Ÿ.- SUTVOW?X(Y[Z]\?^`_ TaZb9^c.'.   $3 .

’ lahR© { A| Tu e MONDPQNwv 9ƒ ‘ ”R” SUTVOW?X(Y[Z]\?^yx{z[|B^"}z[~*?Z€\ zx~*z[‚:‚.žh“—–~ ]šŠª •—™‡“*Ÿ  “—’ Ÿc˜ !”•  ž>“*œedh– ’]– •GªŠš›Ÿ  • ž>“*– “*Ÿ¢œ‡“*–~˜>Ÿ¢™]“*Ÿ.™]˜Ežp•—­˜h¯h•—ª ‡“gf }w© ihˆ˜E™]˜ šŠ–~ ‡ª›˜h–¬˜hœ5•—¯p°—j “ f }©®ž> ] ihj˜S• |“*‘c– •Bžh“*–¬““*ŸO–~˜>Ÿ”–¬“*Ÿ'Ÿc˜h‘”°—“"žh“—–~ ]šŠª •—™‡“*Ÿh©§ “—‘”£•—œ‡š •¦¯p°—“B™]“*Ÿƒ ‡‘”“*£*‘”•—–~•—Ÿ Ÿc˜h f•¦‘5•—œ]™‡““"ž o™]š›£—“˜h– ™]š9*˜>‘”Ÿ”“—Ÿ%•—‘”¤w’]š9*“*Ÿ {•—žhšŠª›šŠ5••– •¦œo’05˜hœ‡¯p°—“"™‡“" ]‘”“—£*‘5•—–~•¨˜¡  “—Ÿ”Ÿ”šŠ­]š›ªŠšŠ5•’‡–7–~•—š›“—‘ ˜>œ5˜hœ‡™]š›–¬˜hœ5“E™]• ˜hŸ 5‘”’05’]‘”• ™]“*Ÿ ‡‘”“*£*‘”•—–~•—Ÿh©  “o™]“  ]‘c“0ž>˜hŸcŸ”“E™]˜9žh“*–¬ ]š›ª›•—¯p°¦9 “ k¦‘”˜>žh“*–¬ ]šŠª •—¯h°—“ fžh• – •—šŠŸ ‘ — ]šŠ™]“]© ¨– •—‘”¤w’]š9*“K™]˜~ ‡‘”“ !c˜R5“<5˜h– •<+˜ lo”˜hœ]Ÿ”°—“ }w©«š›™‡˜¬“—’ }w©« ]‘ ! f{œ‡“ !“—‘”ª •¦œ]i ™ h  }w©«– |m ž f{œ]“  Fnh  }w©«1w™]˜R¥ —˜hªŠ“*o   f{œ]“ 1w™]˜'*˜>ª›“*i   h  ˜ }wq© prf{œ]“ ¨˜@s  F #h   “o™]˜hœ]™‡“ Ÿ”˜h‘.•—‘c¤w’]š—“*Ÿ {• ˜>–  f•¦‘c5˜!™]“ ]‘”“*£—‘5•—–~•˜S˜>– ¤w’]˜Ÿ”˜>¤ v ˜hœ]ž>š •™]˜@—˜h– Ÿc˜h‘.Ÿ”˜h£—’]š›‘>© „x x ƒ 3ƒ „x •—‘”¤w’]š9*“*Ÿ ™]˜ žp•—­˜h¯h•—ª ‡“ žh“*– x •^˜‹l0”˜hœ]Ÿ”°—“$}w©  *˜ !”• “ Œ:Œ.•¦š›œ]™f• ’]– •¦‘”¤w’]š—“ – •¦1—˜ ]ª›I˜ tf|œ]“ Bœ]uš l  € ?  kš›œw.•—‘c¤w’]š—“*Ÿ.^„ƒ…†N‡‰ˆ { § ™]˜ fœ]šŠ¯p°—“ ™]• žhª •¦Ÿ”Ÿ”˜Šd •—‘”–~• ˜hœf•—™]•^˜h– ˜‹l0˜h–¬ ]ª›“¬•.999:9999:9999:9999:999.

Ÿ.Ž9:’‘”“•—–™˜:ša–›iœž3Ÿ : ’œ[¡L¢ Œ.£9£ .

a–.¤aœ¥’Ÿž¢i–o¦a–U§.

¨:.Ÿ°ªž3Ÿa 9 ’œ ©  –¯3‘aœ®±`œo.Ÿ›—Ÿ –:ª‘›—œ’«:¬Ÿ¥’­–®¨.Ÿž¯¦.œ.œ3.

.œa ’œ.§.

Ÿ ²¤{“I¤iž“3–¬œª3Ÿ ™ ¬Ÿ.«:¬Ÿ £9Œ Œ:Œ © œªžŸ3.Ÿ¥’­–®¦.

«¦.œ9Ÿ.œy¹a“3–.œµ9¶:¶ “I«¸ª9ž‘. ¬:.¦.Ÿ3¬´³‹ µ¦.

–®¦.a–9ž3œ`¦.Ÿ¥’­–®¦.œ`Ÿª’œa 9 – §:‘9¤iž.Ÿyª9ž3Ÿ 9 ’œ ª9ž3Ÿ 9 ¯˜:Ž3§¸ž.“ª’Ÿª3Ÿ.›—º · Œ:Œ © œªžŸ3.Ÿ¥3­.– » Œ:Œ’–«:¬.“ªK¼ Œ:Œ9Œ © œª9ž3Ÿ3.œ`Ÿ’¬:i“¤9‘:¬—– ¬{“I§i–¯«i–›—œŽ¬:i“I¤:‘:¬—–½ ¾'¿—À‡ÁDÂOÀ*ÃÀ-ÄÆÅÇÉÈnÊÀË‹ÌwÍ7ÎÏqÐ+ÈÆÄOÂ+Ñ+À'ÒÇÉÀKÓÂOÔLÀ-Õ-֋ÈÆ×)ØÙ ×Ù  }‘ @’ ’ ’©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ §¨œ]™]‘-d ’]•—‘c”˜ ¡’]˜hœ]“¢¥ ”R” § “*Ÿc”š›ª›•ˆ™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚF .

Ÿ¥3­.)*- w Œ:Œ9Œ ©  % " O %B"  B % ]¢ \ !k¡  = œª9ž3Ÿ3.–®¦.œU›—±’¬—–.

– (§aŸ3.Ÿ.¦—– ¬{“I§i–U«i–›—œ ‘9«¸ª’Ÿ.

  .›—œ’¬:a–.

999:9999:9999:9999:999.z[}[Z\ z€x~*z[‚. ½ ˽ MONDPQN SUTVOW?X(Y[Z]\?^yX _~*^^†c.‚:^„ƒ…†NDx¸_?_‰ˆ § Ÿ™]˜fœ]šŠ¯<o˜hŸB™]“*Ÿ– dR5“o™]“*Ÿ™f•—Ÿž>ª •—ŸcŸ”˜hŸBŸ5°¦“ •—‘c– •>˜hœf•¦™f•—Ÿ˜h–M•¦‘”¤w’]š—“*ŸB™]˜š›–¬ ]ª›˜>–~˜>œw5•—¯p°¦“¢žh“*–  ˜‹lo5˜hœ‡Ÿ5°—“ f }w©«žh ] —h  *˜ !”•¬“.˜‹l‡˜>–~ ‡ª›“¬•¢Ÿ”˜h£—’]š›‘>© • Œ:Œ.

Ž9:’‘”“•—–™˜:ša–›iœž3Ÿ : ’œ[¡<ª§:§ Œ:Œ7›:§ižœ›—œ.

œ §.«:¬aŸ™Ÿ  ‘9«¸¥"!3œa ¯¦Ÿ™ªžŸ 9 ’œo˜:ša–›—œž3Ÿa 9 ’œ Œ:Œ$#¸“I¤iž“3–¬œª3Ÿ o¦.œy¹a“3–: ¬..Ÿ›—Ÿ¦a–.œ9Ÿ›—º · Œ:Œ$#¸“I¤iž“3–¬œª3Ÿ o¦a–¯¨93‘9§i–µ¦.œo9¶9¶ “I«¸ªž‘¦.a–’¨9.

–o¦—–: s›i±’¬—–..œ  “I«¸ªž‘¦.œ&%+˜:ša–›iœž3Ÿ : ’œ[¡L¢% · Œ:Œ © œ i“«{“¥’­.

 ¯¦Ÿ™ªžŸ 9 ’œ ¬{“I§i–¯˜:ša–›—œ9ž3Ÿ 9 3œ[¼9¼L«i–›—œ 3‘9«{ª’Ÿ.¦a–.Ÿ’›—œ’¬:i–:  .–' '§aŸ3.

–®œ›€ :“ ½  MONDPQN)( f SUTVOW?X(Y[Z]\?^yX _~*^^†c.-ËTz/zN‡x{_ _Bˆ ‚%“o1ž 0¦•—š0 ]‘”˜>žhš›Ÿ”•—‘ƒ™]˜!’]– •—‘c¤w’]š—“žh“*–7•"™]2˜ ]œ]š›¯h°—“™f• |’]œ]¯h°—“–~•—š›œ`© a ’]– •—‘c¤w’]š—“žh“*–7•"˜+lo5˜>œ]Ÿ5°¦“ }w©«žh ] ihS˜¤w’]˜Q’]Ÿ5•. » ‘9«¸¥’­.•—Ÿžhª›•—Ÿ”Ÿc˜hŸB™]˜2]œ]š›™f•¦ŸB ˜hªŠ“¢ ]‘”“—£*‘5•—–~•—™]“—‘h©'‚%˜ !”•. }[Z&z[X ƒ+_?TZ.999:9999:9999:9999:999.z[}[Z\ z+*W.Ÿc˜h£*’‡š›‘h© Œ:Œ.“¬˜+l0˜>–~ ]ªŠ“¬•.

a–.Ž9:’‘”“•—–y§.

i“«¸ª:“I§aŸž “«:¬µ›iŸa“I«.– §.œ&%+˜:ša–›iœž3Ÿ : ’œ[¡L¢% · Œ:Œ9Œ3‘9«{¥’­.Ÿ›—Ÿ[¡eª§9§ “I«¸ªž‘¦.¨:. .

» ˜.Ž3§iž.–`Ÿ.“ª3Ÿª’Ÿ.

§Æ½ Ÿ’§O¡43‘9«/ .

3«65K½  2. ½ œ’¬‘.31798 :<. H8 :K=R6 F<H J<8 :E@O69L@ƒ?Q8 ? 6@'.RHC-j?9FE6 ? 6QI>=H-6 H8 4 575 ”R” § ‡‘”˜hŸc˜hœ •X¥ Ÿ”˜ • Ÿ”˜>£*’]šŠ‘9’]– ˜‹l‡˜>–~ ‡ª›“K™]˜ ’]–  ]‘c“*£*‘”•—– •<Ÿ”šŠ–~ ‡ª›˜hŸ˜>– F ©K€¨˜>Ÿc5˜~˜+l0˜h–¬ ]ªŠ“ ˜hŸ  °—“  ‡‘”˜hŸc˜hœ5˜>Ÿ ’]–~• ­]‘”˜'*˜K™]“ožh’]–¬˜hœ •¦¯p°—“ ™f• •— ]ªŠš›žh•—¯p°—“  ™f• ž>ª •—ŸcŸ”˜<š›–¬ ]ªŠ˜h–¬˜hœ •—™]• ˜E’]–~• ™‡˜hŸ”ž>‘”šŠ¯p°—“ ™]“*Ÿ •\5‘”šŠ­]’‡”“*Ÿ¨˜9– dR5“o™]“*Ÿ>© C.

‘”“ožh’‡‘”“*’0¥ Ÿ”˜9š›œ]ž>ª›’]šŠ‘¨•~– •—šŠ“*‘”š›•™]“*Ÿ@?Š5˜>œ]Ÿ ‡‘”˜hŸc˜hœ5˜>Ÿ˜h– ’]–M ]‘”“—£*‘5•—–~•.Í7ÎÀËÂ+Ì Í7ÎÏqÐ+È7Ô{ÊÀËÅÌLÈ2H+Ìw‹ÄnÂ+Õ-֋È[À-Ä<I>J À'ÄU†À'ÃKJLÀ'Ó.‘”˜p•¦ª © A ˜‹l0˜h–¬ ]ª›“~˜hŸc5• ™]š90šŠ™]š›™‡“¬˜>– 5A‘ 0>Ÿ"•—‘c¤w’]š—“*Ÿh© A •—‘”¤w’]š9*“  §¨ ]ª›šŠžp•—žh•—“]©CB ™]˜>žhª •¦‘5• •¬žhª›•—Ÿ”Ÿc˜  § ]ªŠš›žp•¦žp•—“¬˜9“ •¦‘”¤w’]š—“  § ‡ª›š›žh•—žp•¦“]©®ž> ]   ¤w’]˜™]˜ fœ]˜9•¬ž>ª •—ŸcŸ”˜  §¨ ]ª›šŠžp•—žh•—“]© A •¦‘”¤w’]š—“~ ‡‘”“*£*‘”•—–~•‡©®ž> ] <š›œ]ž>ª›’]š`•|’‡œ]¯p°—“ –~•—šŠœ`© DFE G ÔDÀ-ÌLÐ)À.

ÔLÖ+È?Ù L.À[ÊÀ/IMNM §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ ÂOÀ'Ã1J À'ÓÔ Ö‹È?Ù L*ÅÅPOuÊÀ/I ÅÇqÎÔ"ÅÇqÎÔRQ(Ù § “*Ÿ 5š›ª›•™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

  %  " O %B"   % ‡"¢  @\ !  = )*„ € °¦“Ÿ”˜ ]‘c˜h“ožh’] ˜˜h–7˜hœ5˜>œ]™]˜h‘%“ |’]œ‡žhš›“—œf•—–¬˜hœ5“™]“ ‡‘”“*£*‘”•—–~•‡©O§¨  ˜>œf•—Ÿ.

 ]‘c˜hŸ 5˜B•¦5˜>œ]¯p°¦“œf•™]šoš›Ÿ”°—“  ™‡“*ŸB•—‘”¤w’]š9*“*Ÿ˜œ]“ |“*‘”–~•¦5“ˆ’‡5šŠª›š h•—™]“]© A  ‡‘”“*£*‘”•—–~•š›œ]šŠžhš •9žh“*– •|’]œ‡¯p°—“¬– •¦š›œ fLh˜5˜>‘”–¬š›œf•¢•—“Pfœ]•—ª™]˜hŸ  •|’]œ]¯h°—“~ž>“*– ’]– ‘”˜>”’]‘”œ"f h ©  šŠŸc5šŠœ]£ + © ‰*/.l0˜h–¬ ]ª›“.­—Ÿcš›ž>“.¥§¨‘”¤w’]š—“  §¨ ]ª›šŠžp•—žh•—“]©CB`©          .

.

 .

 .

 .

 .

.

 .

 .

 .

.

   .

 .

 .

.

 .

      .

   "!.

#$% '&(#)*++ !.(-.#/("+*0 123 4465.

7.

8<.8291313 : .

= 2 91>   ?"@.

0A)A.

!B!CD!.

&E F.

GABH.

.

E.

F  I : 9JLK<.

MN/O-P Q P *R S  .

T.UD!% VW-+*0.

!%*%(X!.D%\D$+.0!Y(#BA ! DZ% %L!LA ![X.

FG+ !^%D! &Z_!`(a+0- R š›Ÿ 5š›œ‡£ + © -o/K  l0˜>–~ ]ªŠ“.­—Ÿ”šŠžh“¥§‘c¤w’]š—“  § ]ªŠš›žh•—žp•—“‡©®ž> ] `©         .+*!+X ] !+0!^X.D0L.

.

 .

 .

 .

 .

.

 .

 .

 .

.

   .

 .

 .

.

 .

      .

b.

 c 9ZMD12< J dGe#9: 4fg d3Zh i j.D*k&*!6lA !.

#$%.

E F.

`A)*++! c 9ZMD12< J dlm5.

7.

82 9.

1313.

: npoXm *R R q ("@ 0A`r &.

.s!+%D!U#!t&(#u(X!. \0!*$ R I : 9JB5. + v!(L.

78*2 9.

13 13.

*)A'("@. -.:>>kK<MwN/O .

0A D+0Ayxx&D0l!+*%D!UD!t. \0!*$ -&D0 z 6&D0 4f.

JH>>$1:<.

f)e e`m{ dZhD| ID9$M J.

: | 3: |.

}~~€$mue eG4f.

JH>>/dM J 2€P Q *R ]  UDA.

 A !Dx  .

 .

.

 .

A. j.#D& + F .

!B‚ .

‚D0!.

+t-.

D#&*A !`‡ +0Z%*!( ˆ ‰  ŠAtX% ‹0!* +*0AŒxx&D0)‡‡uŽ#!(‹U*Z. A.A% ƒ !+LAL„…… † .

YY„*….

…*.

Z  q R  ‚‘ !.

0‹&D0`@.& + .

UD%’%  0.AtX% \!Z.

!%D!+^X% 6B0!*- *R yx”“*% \$(_DZ%)!+*0!Y%*•&DU'. ™ U VLBA %*! 0š%DY(‹Y%*•&DU*G!›œ- H  .&CH™. )– ]#—  ˜D$. ‚% G&(a0!%("Z.

A 6 ‚ C _x v-……6.Xb’!l!CD! &0! B$(.

6!›œ- H.

  "b R §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ § “*Ÿc”š›ª›•ˆ™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

)   .

      .

­—Ÿ”šŠžh“¥§‘c¤w’]š—“~ ]‘c“*£*‘”•—– •0©®ž> ] `©  €        .„.+Kl0˜>–~ ]ªŠ“.! " #$ % &'  š›Ÿ 5š›œ‡£*)0©.

   .

 .

.

 .

 .

   .

.

 .

 .

 .

.

 .

 .

 .

  "% v % Z(k #j.*Dk&*!LY%*•&#U*) $.

 .

DE./_t•Z&*!Y0!(‹YA !/[-.

F `AB*$++ ! c 9ZMD12< J dlm5.

7.

82 9.

1313.

:€n oXm ( =   .

EFu(D. . L[ &.

D0!.W&(aZ.™W%*! 0%.$.

(# Z.\!W. F.% y™t+ !Y (#.

*!.B0!(s.

-$(X! 0% 9$M.&(lŒ%.

fGh*3 9$MHN/O  X„%B ‚‘ !.

0)A\0bX‹ $H.

   5 782913 13 :`38P  / C#!.

&#0.'("@.

0A.

BAB ‚‘!.`r &.

0Bk 38HnbK<.

*%G&( g df<.EF)A !ZUD!G%D! 0%.MN/OŒP  L[ &.

A ‹•&*!.&)‚.6›Y.0! % .gM0ŒP Q .^"% v % Z()0!%(X.

!( *R ]  UDA.

 A !Dx  .

 .

.

 .

+D0%.   .

&E.

D#&*A !`‡ +0Z%*!(ˆ6@u& + AtX% \.F  † .DD&D%`l !+.

+  B‚ .

‚D0!.

 X  .

A% FBA.

!B!.0%  A.

`!.+  ŠAlA.

!LA.

A+)AY„……*  . +D0%.

&E.

F  † .D#&*A !l.

H  .

& + ."€ @.

AtX% \.A  "%*/(-!.#D&D%G&( "%  & %.

 X 0Z AB$(X‚ .% '. BA %*! 0š%Dl% %*!.!6A !bX +Y.0!.

A.!.#0!.

!YA !+!.

#0" %•&*ZU -™ "!/[-.#E.U*U#/(-!.

F `Au[ &. EF.

EFG(# Z.  `[ &.(# Z..\@u^"%*(X!.

% W[ &. EF.

‹•Z&*!`@l!CD! &0.

A  Œ!*$^#% Zv % (Œ™ @G.

^"% v% Z(l.ŠL•Z&D!.*y `("!+(#Y%*! 0%.

0! % l•Z&*!l.["%(..21("!% s.)!CD! &*E.'&(‹.+ !.

F.

`A "% v% Z(^[# u&( +&D !+ + 43Z%!.

0$&.

%. › 65B&\A !Z&‹# v &(Y%  ‚D!/(3$%! 0$&.

q ‚+!%U#!`•Z&*!. EF`(# Z. F6%!!. ++ .%..l.[&.

D0Z% lAu[ &. &(lŒ%-Z(X! 0% " !Z.*!Z.‚!6.

.)@l%A. EFG( Z.

Yl ‚‘ ! 0 !'L+ !v &*% !CD!.

&#0.

A.

GW("@.

0A.

_  q œ 65_ H.6r &.

   %*! 0%.

GAu[ &. EF..

%!..(# Z.

0$&.

s›  yx”“*% \$(_DZ%6^"% v% Z('.&C vy…… %v %$("b H  . )– ]#— ˜#Z.%.

"b “*% \!CD!.

)– ]#— ˜#Z.&C  *X&D0 ‰  ŠAŒx  .&#0%6^"% v% Z('.

.

 .

 Ž#!(‹U*Z.AYL„*….

…* R ‹ y{n*[`_ ˜+lo”˜hœ]Ÿcš¦•—–¬˜hœ5˜G’05š›ªŠš h•—™]“ h˜ – •— ]ªŠš›žp•¦¯<o˜hŸ.žh“*– “.žhšŠ˜hœ ? fžp•—Ÿ  ˜h– *£ ‘ ]žp•¢˜žh“*– –ˆ’]šŠ5•š›œ5˜>‘5•—¯h°—“.] ’ Ÿc’—‘cš›“]© FYZ[Zrd §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘  ]‘”“—£*‘5•—–~•—Ÿ¬žh“*– šŠœw”˜h‘ {•—žh˜ § “*Ÿ 5š›ª›•™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

  .

4  "   .

!  #@$ %  ( =  ) C ‘”“*£—‘5•—–~•—ŸB™]˜˜hœ‡£*˜hœ B]•—‘”š›•   ?›Ÿcš›ž>“*Ÿ¨˜ˆ– •¦”˜h– ¦5šŠžh“*ŸBŸ5°¦“ ­ ˜>– ‘c˜h ]‘c˜hŸ”˜>œ •—™]“—Ÿ˜h–rFYZ[Z     “*šŠŸ"•—Ÿ ‹ y{n*[`_ .

™]š|˜>‘”˜hœ”˜hŸ —‘”˜h•—Ÿ.™f• – •¦”˜h– ¦5šŠžp• Ÿ”°—“ {•—žhšŠª›–¬˜hœ5˜ –¬“o™]˜hª›•—™f•—Ÿž>“*–¬“ ž>ª •—ŸcŸ”˜>Ÿ~˜>– FYZ[Z¢© b Ÿ 5“ d  {• R¥ Ÿ”˜’]–~•¬•¦Ÿ”Ÿ”“ožhš›•—¯p°¦“¬ž>ª •—‘”•˜hœ5‘c˜9ž>“*œ]ž>˜hšŠ”“*Ÿ–~•¦5˜>– ¦”š›ž>“*ŸS˜žhª›•—Ÿ”Ÿc˜hŸ™]˜BFYZ[Z¢© § “ ]œf•—ª.

™]˜~žp•—™f•<žp•¦  ?Š”’]ª›“<™]˜>™]š›¤w’]˜~žh˜h‘cžp•K™]˜ )<–~šŠœw’‡5“*Ÿ f•¦‘5•H{•h˜>‘9’]–~•<‘”˜@ošŠŸ5°—“K‘ — ‡š›™f•<™]“*Ÿ ‹ y{n*[`_  žh“*œ]ž>˜hš 5“*ŸB•— ]‘c˜hŸc˜hœ •—™‡“*Ÿh© §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ § “*Ÿc”š›ª›•ˆ™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

    .

      .

! " #$ % &' §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ ( = § “*Ÿ 5š›ª›•™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

  .

 .

 .

  .

  §  ‡‘”˜hŸc˜hœ •X¥ Ÿ”˜ œ]˜hŸ 5˜ žh•—  ? 5’]ªŠ“ •—ªŠ£*’]œ]ŸQžh“—œ]žh˜>šŠ5“—Ÿ9­¦Ÿ”š›ž>“*Ÿˆ™‡˜ FYZ[Z©<§Ÿˆ ]•—ª •>o‘5•—ŸQžFBf•>*˜>Ÿ¢™]“  ž>“*–¬“ —“0ž209™‡˜@*˜Qœ]“*–¬˜p•¦‘SŸ”˜>’]Ÿ¨“—­"!c˜>”“*Ÿ¨˜ž>“*–¬“¬™‡˜hžhª›•—‘5•¦‘˜Q™‡˜2fœ]šŠ‘“*­"!c˜R5“*Ÿ>© !#" $&%(')+*-.. * .  FYZ[Z 575 ˜>Ÿ”žh‘c˜@—˜h‘O”“0™‡“*Ÿ“*Ÿ™]˜R •—ªB]˜hŸ™f•Ÿcš›œ •l0˜%™]˜´FYZ[Z ˜>– ]‘c“*£*‘5•¦– •—Ÿ“*‘”šŠ˜hœ •—™‡“*Ÿ•“*­"!c˜>”“Qd.0/ 1. 2*43* 17 4 .

•— ]‘c˜R¥ Ÿc˜hœ •¦™]““*’~’]– +˜ l0˜h–¬ ]ªŠ“ˆ“*’~•—ª›£—’]– •šŠœ|“*‘”–~•—¯h°—“+˜ lo5‘”•‡© •QŸ”˜>£*’]œ]™fB • d•— ‡‘”˜hŸc˜hœ •¦™f••— ˜hœf•¦Ÿ!•QŸ”š›œ5• l0˜  Ÿc˜h– šŠœ|“*‘”–~•—¯@0˜>Ÿ•—™]šŠžhš›“—œf•—š›Ÿ>© CO“—‘BŸc˜h‘ °¦“¬ “o™]˜h‘c“*Ÿ5•  •¬ªŠš›œ]£*’]•—£*˜h– FYZ[Z ”˜h– ’]– ‹˜ l0žh˜hŸcŸ”“~™]˜‘”˜h£—‘5•—Ÿ  “¬¤w’]˜Q“ožp•—Ÿcš›“*œf•’‡– •— ]‘c˜hœ0¥ ™‡š p•¦™]“.’]–5‘”•—­f•—ªB]“ ž>“*–¬ ]ª›˜‹l‡“¨˜!¤w’]˜¡ª›˜@¦•—‘cš •.>*?.– •—šŠŸSª›˜>œ5“]© •¦ŸB˜>Ú – FYZ[Z7“*Ÿ ]‘c“*£*‘5•¦– •—Ÿ¡5˜h– ’]– £•—œ B]“.™]˜¤o’]•—ª›šŠ™f•—™]˜˜ —˜h‘”Ÿ”•¦5šŠª›šŠ™f•—™]˜šŠœ]™]š›Ÿ¥ ž>’‡ ?9*˜>ªj˜>– ‘”˜>ª •—¯h°—“.˜h– “*’05‘5•¦Ÿª›š›œ‡£*’f•—£*˜>œ]Ÿ™]˜ ]‘c“*£*‘5•¦– •—¯h°—“]© § ™]˜>Ÿ”ž>‘”š›¯h°—“E™f• Ÿcš›œ • l0˜¢™]˜ FYZ Z Ÿ”˜>£*’]˜¢™]“*šŠŸ–¬“0™‡˜hª›“—Ÿ B“E ]‘”šŠ–~˜>š›‘”“ d¢™]˜>Ÿ”žh‘cšŠ5•E• Ÿ”š›œ5• l0˜˜.>%+*C3* 4 65 879 46575 § ‡‘”˜hŸc˜hœ •X¥ Ÿ”˜Q•ˆŸc˜h£*’‡š›‘•—ªŠ£*’]œ]Ÿ¡žh“*œ‡žh˜hš 5“*Ÿ!­—Ÿ”šŠžh“*Ÿ!™]˜‰FYZ[Z¢©.•—Ÿª›šŠœ]£*’f•¦£*˜hœ]Ÿ!– •—šŠŸŸ”šŠ–~ ]ªŠ˜hŸSž>“*–¬“ U!•—Ÿ”šŠž  CO•—Ÿ”žh•—ª  ‚š›Ÿ”’]•— ª US•—Ÿcš›ž˜ S˜>ª›  B]š…© S :9 !#"<. -@%?*A'B*.—‘”š›•—Ÿžh˜hœ”˜hœf•—Ÿ'™]˜! ¦£*š›œf•¦Ÿh© C'•—‘”•¤w’]˜!˜>Ÿc ••—  “—Ÿc5šŠª •œf°—“fžp•¦Ÿ”Ÿ”˜!–’]šŠ”“¨£—‘5•—œ]™‡˜  •¦™]–~š 5˜ ¥ Ÿ”˜¤w’]˜B“Qª›˜hš 5“*‘O5˜hœ Bf•Q“9•—ž>“*–~ ]•—œ Bf•—–¬˜hœ”“Q™‡˜B’‡–  ]‘”“*£—‘5•—–~•—™]“*‘' f•—‘5•˜>Ÿ”žhª›•—‘”˜>žh˜>‘¡Ÿc’f•—Ÿ™ oš›™f•¦Ÿ  “—’ ¤w’]˜! ¢5˜hœ Bf•¢+˜ l0  ˜>‘”š 0hœ]ž>š •. =%(/).<.

˜h–ÚFYZ[Z acb ’]Ÿ”•G“*Ÿžh•—‘5•—žR5˜>‘”˜hŸ Zd œ›:§iž:–K¼ Œ.£®ª–›—œ.Ÿ 5˜hŸž>“*œ]ž>˜hšŠ”“*ŸSŸc˜h‘5°¦“¬–¬˜hªB]“*‘žh“*–¬ ]‘c˜R¥ ˜>œ]™]šŠ™]“*Ÿ  “—Ÿc5˜>‘”šŠ“*‘”–¬˜hœ5˜  žh“—– •—Ÿª›šŠŸc •¦£*˜hœ]Ÿ™‡˜Q ‡‘”“*£*‘”•—–~•—ŸS¤w’]˜Ÿ5°—“~•— ]‘c˜hŸc˜hœ •—™]•—Ÿh© D2EGF`1HJILK@MON ’]– Q(KRTSVULWYXZE[H\K]^M 8P 5˜‹lo5“¬žh“*œ5˜>œ]™]“~ž o™]š›£*“|“—œw”˜˜h–ÚFYZ[Z  –Nž>“*–~˜>œb—‘cš›“ ˜>– B ˜hœ]ž>˜h‘”‘”•—‘B“¬ž>“*–¬˜hœb—‘cš›“]© acb i“3–:£Œ žh“—–~˜>œw —‘”šŠ“.

™]’f•—Ÿ­f•—‘c‘5•—ŸBfLk3k3hR© œ›:§iž:–K¼ `e  `_< f•—‘”• š›œ]šŠžhš›•—‘“ k _ žh“*–¬˜hœb¦‘”š›“ ˜ .“¬ ‡‘<dR¥  ]‘”“ožh˜>Ÿ”Ÿ”•—™]“*‘>© ’‡Ÿ5•.«:¬ B– F ˜ž>“*– •¦œ]™]“*Ÿ f•¦‘5•.

k  ]•—‘5• .

—–.    Ž.’‘{“ ±¯§.

¨9.Ÿ›iŸ ½ 6d Œ9Œ’Ž:’‘{“ Œ:Œ˜—–.

“I«9¢—Ÿ (  (  < % G #.¦a–y–¯.œ ¬—–µ¦. ( G .Ÿyž.

 ±™ª9–›—œ.

«:¬ §—Ÿ 9 ’Ÿ`Ÿ™ 3œ3µ‘9›ª–›—œ.

«:¬ R :Œ K \K]^M .

ª›˜R5‘5•¦ŸQ™‡˜ fœ]šŠ™f•—Ÿ ˜hª›“< ]‘c“*£*‘”•—– . f•—‘”•¢œ]“*–¬˜p•—‘’]– “*­"!c˜>”š—“]© "!:SVE K E Sc][ M  ›–­“*ª›“—Ÿ.™]“*Ÿ 2 •¦5‘cš›­]’‡”“*Ÿ˜– Rd 5“o™]“*ŸehR© acb Zd 3i“3–K¡   ( = b   b     `IE ]Q`ISV] +  °—“™]˜’]Ÿc“"š›œ5˜>‘”œ]“B™]“  5˜h– Ÿcš›£*œ]š fžp•¦™]“ f•—‘5•¨•¨ªŠš›œ]£*’]•—£*˜h–   f•—‘”•B“¨ ]‘”“ožh˜>Ÿ”Ÿc“ ™]˜žh“*–¬ ]š›ª›•—¯p°¦“]© ¨ 9 °—“.l0š›Ÿc”˜h– žhš›œ‡žh“ 5šŠ  “—Ÿ ™]˜ ŸA?Š–­“*ª›“*Ÿ¬˜h– žFBf•>*˜  *“  ˜h‘”•—™]“*‘c˜hŸ  ªŠšŠ”˜h‘5•¦š›Ÿ!˜Ÿc˜h f•—‘”•—™]“*‘c˜hŸehR© 0 ’]–  ‡‘”“*£*‘”•—–~• i“3–K¡ FYZ[Z |š›™]˜>œw”šfžh•—™]“*‘c˜hŸ   f•¦ª •>o‘5•—Ÿ f •¦™]“*‘ |f œ]“*–¬˜¬™‡“*Ÿ“*­"!c˜>”“*Ÿ  œ]“*–¬˜.  “o™]˜h– Ÿ”˜h‘’]Ÿ”•—™f•—Ÿ ˜hªŠ“¬’‡Ÿ”’—‘cš›“. ScUW H| K EGSV]^M ˜h¤ hœ‡žhš •K™]˜.

žh’ !”•’‡5šŠª›šŠ™f•—™]˜ !  B™]˜ fœ‡š›™f•  ˜>ª›“  —˜ !”•Q“*Ÿ¡“—  ˜>‘5•—™]“—‘”˜hŸœ]“Q§  hœ]™‡š›žh˜  œ›:§iž:–K¼ “«:¬ ½ Œ9Œ œ FYZ ? #%$'& acb  BFYZ[Z 0 ?F Ÿ5°—“+  )( %s¹®º ½®³y¼ Z 2 #d “*Ÿ“*  ˜>‘5•—™‡“*‘”˜>ŸB™‡˜jFYZ[Z  ’­.œ.–™“¦.

«:¬{“ i“ª’Ÿ¦a–.

Ÿ3¦a–.œ  ¡ ŒK¡ œ›:§iž:–K¼ ¶y±`–`–§aœ..

y¦.Ÿ3¦a–.œ° –›iŸ[¡ £µ±`–`–§aœ.

œ¯›:‘iž.y¦.

ž ¨– ] œ “*–¬˜ ™]˜>œ]“—5•^’]– “*­"!c˜>”“  ’]–~• |’]œ]¯h°—“  ’]– žhª •¦Ÿ”Ÿ”˜  ’]– –¬“0™‡˜hª›“  ’]– ¦•—ªŠ“*‘S“*’<’]– ª •—­˜hª…© D WYEGH|Œ'1H. « ›—œ3—– Œ9Œ3Ÿ™ž3œ’¬:.Ÿ.:<ZK1M>= ’f•—œ]™]“¬Ÿ”˜Q•—‘c– • h˜hœ]•¬•¦ª›£*’]– ¦•—ª›“—‘Sœ]“¬“*­"!c˜>”“]© S A B6E :<6K@M š E¤w’]˜E˜ 0š›Ÿc”˜E’]– “*­ !c˜>5“ ž>“*– œ‡“*–~˜ |’]ª •—œ‡“ ? @ ˜hœw’]–¬˜h‘”•—™]“*‘  ’‡– ”š› “  ’]– –¬˜h–­]‘c“ ™]˜  S  ‹l ™]˜hž>ª •—‘”•—¯p°—“.>© * acb b'-'.“¬œ3Ÿ.–Ë¡ HJWYS E+6H ]^M  š› “*Ÿ™]˜—•¦‘”š >—˜hš›Ÿ ]‘c˜@oš •¦–~˜>œw”˜.“¬œ3.¬™ŸK½ b DCK½  ¬:3‘¸ª¬ œ ¬œ33«€ª–«¸ ¬“I«:¬ “«:¬ EFiÄ ‘9«¸¥’­.™]˜2fœ‡š›™f•—ŸQ ˜hª •EªŠš›œ]£*’]•—£*˜h–   f•¦‘5•<‘”˜h ‡‘”˜hŸc˜hœ •¦‘ˆ“*­"!c˜R5“*ŸQ™]˜ ’]Ÿ”“¬žh“*‘c‘”˜>œw”˜+.“¬œ3Ÿ.ž ±¯‘› ž“¬œ3.– .Ÿ 0 –3­.¬¸“I§iž. 2¡ 1`±¯‘›ž. œ›:§iž:–K¼ “«:¬ ª¢aŸ3 - ª KRTS M .“9ª’Ÿ¥’­. ¡21˽ -4365  —ž9–3Ÿ’¬ / ½ ³-ŸK³9½ –3­–o±¯‘›ž. “0™‡˜Ÿ”˜h‘B‘”˜>  ˜R5šŠ™f•‡© acb b ™]˜  •—ª  – •¦Ÿœf°—“ ž>‘”š •G“ “—­"!c˜>”“]© B– • œ›:§iž:–K¼ œ ¬œ33« “I«.ž Œ9Œ9–U« ›—œ3—– 87 ª¢aŸ3—£²«i–›—œ 9 0 Œ9Œ -'.Ÿž .– ´½ Œ9Œ 5 ±¯‘9› ³-ŸË³ ž.

i“I¤9‘{“U•Ÿž9–. HG ½ Â+Ç H)ÎÓԗÀ'ÃÀ'ÄOÅÇqÈ)Ô +ŒÈIÊÀ'Ä I ÔDÀ-ÓÊÈnÊÀ-Ô4L*Ì Ï JLÈÙ 8G ª ½ Œ9Œ«a­.–®Ÿ’¬.

 ªž3Ÿ : ¯š—–›—œK½ ‹ÅÂ+ÌLÀAL*À-Ì  ¬:3‘{ª¬  ½ 6I L*È+ÓL*À'Ï JLÈ7Ôi‹ÏqÓÊÂKÓ.

֋È[ÊÀ'ÒÓÏ ÊÈ)Ô-Ù NMËÏ ÊÀ'Ó1J À-Ô)JLÀËÀ*ÃÀ-ÄÆÅÇÉÈ ÈÆÏqÄOÅ.

È)Ì)Jw‹Ó1JLÀ §¨œ]™]‘-dTS’]•—‘c”˜VU¡’]˜hœ]“¢¥XWYWYW©«ª›–¬ ‡p©«’|Ÿ”ž¦©®­‡‘ À-Ô)JLÀ<Ô JG L'Â)ÔDÈ7Ô )ÔDÀ K .L  JLÀ-Ó ÂË‹ÈXJ +ÅÏ L'È[Í)ÎÀ À-Ô)J Â Ï ÒL-‹Ì"ÈnÍ7ÎÀËÔLÖ+ÈOÈ)ԔÇqÏCJ À'ÌwÂ‹Ï Ô'Ù § “*Ÿ 5š›ª›•™]˜C.

‘”“*£*‘”•—–~•—¯p°—“¢˜>–ÚFYZ[Z .

 ( G.  (  (  < % G# .

– . ‘9«¸¥’­. S U+H:<6K@M  “*’<– •¦š›Ÿ“*­"!c˜R5“*Ÿ˜‘”˜>Ÿ”˜>‘$¦•¬–¬˜h– *‘cš •‡© ¨–~•™]˜2fœ‡š›¯p°¦“~œf°¦“¬ “o™]˜Ÿ”˜>‘¨‘c˜h ˜>5šŠ™f•‡© F acb b  &P !‘”š›•.’‡– ?  ( = œ›:§iž:–K¼ “«:¬o¤Æ½ œ ¬œ33«€ª–«¸ ¬“I«:¬ ª .

.

3« “«:¬ Q B ] ]8SV] S Z E[R `SVU R ScUWYK +  ½ Œ9Œ3Ÿ’¬:¸“I¤9‘aœ®•Ÿž9–.œ3¬‘.»3.

 ½ K½ ¨˜2fœ]˜Q“¢5˜>–~ “.™]˜0šŠ™f•¢™]˜’]– CO“o™]˜9Ÿc˜˜hŸ b¦”š›ž>“¬“—’K™‡š›œ—–¬š›ž>“mfc˜h£*šŠŸc c“  •¦’‡5“*– ¦”š›žh“hR© “*­ !c˜>5“‡© /S ]  K !:K1M ¨˜2fœ]˜~“*œ]™]˜¬’]– žhª •¦Ÿ”Ÿ”˜“*’K£*ªŠ“*­f•—ª…© “—­"!c˜>”“ S H :K] +U  RTSVULW  H ] + acb b .

–   ª9–›`«¸–›—œ œ’¬—–°“I«.œaª:“ ’­.ž  ª–›y«i–›—œ  ª9–›`«¸–›—œo   +  š› *Ÿ™]˜fœ]šŠ™*Ÿ  ˜>ª *£ ¦™`ž.ž œ’¬—–  “I«:¬aœa“a–™ ’œ›€ :“I«—Ÿ.¬œa“a–yž9–«.¨a–yª–›€ :“I«aŸ. ! d oš›ŸA?9*˜>ª © CO“o™]˜¬Ÿ”˜Q’]–  š› “*Ÿ™]˜“*­ !c˜>5“—ŸB ”˜@oš›•—–~˜>œ5˜™]˜2]œ]š›™]“—ŸB ˜hª›•ª›šŠœ]£—£—˜h– + œ›:§iž:–K¼ “«:¬ ½  —ž9–3Ÿ’¬ ¦—–‘9¤iž3œ ž:–«. >  hŸ  ]œ‡¯< hŸ   *œ hš!*Ÿ  @A0hœ‡žhš"¦Ÿ   .¨ 5 œ’¬i–™“«:¬œa“—– Œ9Œ:–¤ ½ Œ9Œ:–¤ “I«:¬y[½ ‘:«¸ :“¨3«—œ3¦“I«:¬ 5 Œ9Œ:–¤ ½  “*­ !c˜>5“Kª›“ožp•¦ª  ™]˜ |’]œ]¯h°—“  ™]˜¬• ”¤w’]š9*“  ™]˜ Œ9Œ9–¤   ½ 5 Œ9Œ9–¤ H :K] S E[HJI K] 5 5  —ž‘:¬‘aŸ’«:¬œ œ’¬i– b ª–›y«i–›—œ  ª–›`«i–›—œ œ’¬i–yª9–›™¦‘9§iž3Ÿµ§..

5&[½ ('œa 9 –3Ÿ  6d 6d “«:¬®•aœ’¬—–. ! ž *œ]Ÿ #—œ >Ÿ  žhª —Ÿ”ŸhŸh© acb œ›:§iž:–K¼ %$ .

 Œ9Œ.

•œ’¬—–.

 hœ >œ  ™/0 ”š‡©1. ± ‘›y¬¸“I§i–µ¦a–²‘¸ ‘ 3¸“3–  ¬:3‘¸ª¬ Œ9Œ œ 9 –Ÿ`± ‘›y¬¸“I§i–µ¦a–²‘¸ ‘ 3¸“3– )' »aª¢aŸ3—£U«i–›—œK½ “«:¬ “¦.Ÿ3¦.*­"! R   d-h£*š› + ° ~ ™ .œK½AK½ &P I  *@SV]^M  .

“¦µ›—Ÿa“I«. )—ª!‰d/‹l0 >Ÿ”Ÿ5°) ¤   Ÿ2@23*­"!>4 ‡œ]¯p°  f>”œ d2—ªŠ£\5š 9hR© C5o™. 2.ž*œ]ŸcBœf°)¬Ÿ”° ¬ª)—ªhŸh© * \K K]^M <    ­]ªož9š›œ]šŠžhš"ž=?> @A1¨ ¬š›œž BC>)DA5© A"­"!R *ŸSž”š—™*Ÿ™hœ™ˆ­]ªožQŸ5°  1 *­"!>*Ÿ5 ‡   ¦”š›ž*Ÿ  —Ÿ%0hŸ—ŸŸ5° + ‡\5š›ž 0hœ ƒ™hŸc ?Š™*Ÿ¤7—œ]™+­]ª!0ždE>œ]ž—™]© A­ ! >  —Ÿ¨ž ”"š ¦™*Ÿ™>œw¬™.œf°)¬ o™ Ÿ1—žhŸ”Ÿ—™*Ÿ1+lo”œ >œ  fhŸcž* 9h © acb œ›:§iž:–K¼ •i–.—  hž6>Ÿ”¤7”™ ™ Ÿ”š›œ—ª`š›£ —ª[f*8‰h   0™>œ]™¬Ÿ+¦ªŠ  —™]© A"­"!>*Ÿ9hŸc :>žhš]ž.­]ªož.—™—Ÿ¨ž.

? » Œ9Œ.“I«{“9ª:“3–o¦a–²¤iž9–:ª–  Œ9Œi“7› ¦a–U¤iž9–.§œ  —£*šŠ œ *)L*© §¨œ]™-dTSM cVUNhœ¢¥XWYWYW©«ª¬ ‡p©O|Ÿ”ž¦©®­ § *Ÿc”š›ªˆ™CE*£ —¯p° KÚFYZ[Z .œ9Ÿh¯h° .ª– H\E S W E[H`SV] S +! EGFH !+E K  SV] ] 6RTSVULWYK@M °  šŠœ —¯@I  >Ÿ k¦šŠœ]Ÿc ]¯@I  >Ÿ¨¤7ˆŸ5°   —Ÿ”Ÿ—™—Ÿ"   ~ž¢¥   ]š›ª—™žBŸ ? ­*ª2J ©%œhœ]™K2‡Ÿ¢™—Ÿ!™]š> cš hŸ!™" <d ¥  0žhŸcŸ  0hœ .

L>  .

    (    .

“I«:¬°±y–µœ §aœaª:“ i“ª3Ÿ3¦a–.—™  ™  5š›    h Ÿc :> žhš]ž.—™ B™=‡œ]¯p°    >Ÿ” hž>šfž—™ o : @©  acb b œ›:§iž:–K¼ “«:¬ Œ:Œ.! ( = ] !:S@`H  KE M N    —ª>IhŸ$)—™ ™ ª›š›œ‡£—£ ¤71d2‡Ÿ —™    ¦ cš›­]š!¨™> ¬š›œ¦™—Ÿ  * ”š>™—™>Ÿ  *ŸB5šŠ :*Ÿ+G™fœ]š!6 5šŠ :~™4*­ !> ‡©‰F +lI¬ ]ª!4 hŸ” hž>šfž—™š›œ]ªŠš›œ   hŸc :>žhš fž.

 ½ X .

“«iž.“I«iž.“ i“ª’Ÿ¦a–.“I«aœo•—–“¦ 7 Œ:Œ.“«aœy±y–µœ §aœª.

 7 »ª–‘.¬°¹Æ¹ i 3Ÿa“¦.Ÿ a¹Q¹oœ.

* / .«¦až½  ¬ !#"  §aœ3¦. 0.ž½ .œ" —ž9–3Ÿ’¬y.Ÿª:“–«aŸ. &) .

. *G* 3% 4   §aœ¦.   Œ:Œ¬ .œ °±y–µœ §aœaª:“ i“ª3Ÿ3¦a–.

2##    =>#*  %+10/1 =:% ? -+ "  938"!  $@+30-"0)0/ -=*">  3+FB>      >" )+)#     &2A+ #"&  *+#" & #. L. " $ "/">  "    0 21 ")  2 FYZ[Z  3"4  #" "-5*6     7+   8"!  $&   "&-+1? 1+. >" $4>#Aª.x«KA+Ld -#- @  A0-"9  8Lc $ "-. " ´ L  )" *± <) <$  "K°d 3>#·. b 5  Q 6E^W SVE SV] I6X H K]^M  Q 6E^W SVE SV]&H ULIZX H K]^M P6ts. !#" % * 3% %(' * @% X Y :Z >= :[ ]\ /[K^ . 575    !   #" +l%$  #"&9' (  $) ")  "   )* " + ">  "." 1+ <-d.- #" 0-#+ " D)  0 $"  #" 0-#+ "/ + $  &#.……‡† Ž9 ‘ _ 8 + 7 & 5 J @DJ. µN¶M" # ¸º¹¬»½¼L¾¿#ÀTÁ‡Â›¹*ÃÄPÅLÆÁLǬÈÉ  q:ÊM  $/ËN-A6QÌeÌeÌ.R6ihIuP6 . ZM6 *v <gE. "-gd ic33© 8-Aª.+FB  -" .83* / @. "&-+- 1+.  nYZ[Zo #>p  "&+""  ) #" +#"-g C"icg1RMRrq? >p-J$  -T. F   8"! B$49 C  +=. T .Í)$!. . - 8%cB$ )  d /+ .²R³"- !)/" ±  0 " $  " ±> Ÿ    !3       . 3% )+* A\ B_(` 9[a . 6 A $  ‹lI)# d)  > 7  H C IJ$  " d K:L$-!  H  H  +"  M  =  ##< -"N"&># 1+.€3.fGlB‚„ƒ  8 8ooˆvvU‰Š‰o‹Š‹Œ‹M8‰+8 … 8m6 8 _)8 8 ov Œw `_ _ ++ +Nv ’I“Q”–•Q—˜”D™›šQ“œŸž #žˆ”M“7¡—˜¢'£M—‡“¤e¥L—§¦T“N¢  p + >>$#)9@    >$  = U  g -"F$#8-!-+B6 "K=+Ld -#- 5 <+"M8Lc $ "Ÿ  d  ¨ ) = 0.)6  ##-  % F$ *5  B # % F$ *G.Î8 RM# "F$4<  RD ¨  ! KÏn …… .URM":*">  "+FB> T 9 "#. e+ AB$  5fP6 *g#R6ihjg ## &" +kMlB.  8- . xw 1y<z|{~}x .* "? *+ +W"  S FYZ[Z."/">  "  "D">  *"?+FB  -":$ "D  $&E6 > * . . Rm>#*  .F +lI)#! @>I =+FB>   % ! $   0-"@% .R " - /¬ d%>    "7   "&+  d 6 >D  + " . RD "- J$#¬ 6 "6:  "  #  =$2®­I)##g78"Fd  ?¯1::"-!)<°d%  -" M:" ! :" ±> .Op"&+*.  ° d) H 9  p  $4>>s.ÆF  2 " $ "9">  *" ! :$  . O  >" $ P6 "M"Q*">  " +FB  -"A (R   "K-"F$V (+-"*"&"& 1+.

L°uL  .

Í)$!.Î8 RM# #+B$ $ T > $)  #"* $ " $ ##! "&>s  p    "&*+ ®­T#>+->$ #"&># +)  # " $&:  RD   p  - ¨ $&·#"  ! KÏn …… .!Lµ © "!d  *"+V·°d -"M .  " $&"  "F$  d   "P $4!  $  2$ 8#!  $ %- Bp . -+-" " n &>d)*$ $-+ $-  . …… " ©e I 8 ) +V·  -ke$ F$ Ì7+V· "&·  >L$ 2*$  # #8#!  #A  "&>  ##"   Ì9·#> #8  d > 3 % #E¯1+.0/. # %   "F$ *$&+k9+ " $  J$ & $!k9+" $  96I " 8 ­T+ - °Ì $ F  Jd &"76I " )=>+k9+.54 $ # *$!k9 # §k1 ­I H Bp #>$ p 8 P  7  $& + L$&  8#E$#   I k9 H H  + " ´  " $ *$4>+ L$! n "FÌ9>$&+V·  B­%$ & + #" $   8#>$ ­ &P p  " -k9 H  $  $ 3  &  Ì   $  J$ .1 ¨ .   " + " Ep . $&· + P$4+V· &"" ÊD>d  "  *$   ­T:  $ B " +  " " :  0 #> $ %  q:ÊM  $/ËN-A6QÌeÌeÌ."F$ + #"F$!k9+ "F$ #8#>+  n  .Op"&+*.+'-.       !"#%$#&'  ( *) 58-)ªT.

L!uJ«     .

© A  8%cB$   "e+#" $ J$  "-µ    !d 1.x«TµNn Jd #!)U 3 "e  8%cB$ " .  ?  + " " "  "-µ 1. Ê ¹°»%ŇÈ|Ç#¹°»  . -)  q $T  "VvPp # 6 -" µ R]$&  8 $  " µ R]$  8 $ "9- "F$*$&+ "-µ 1.     '   '  !" %$#&' (  ) 58: "3ª.  ?  + " " "  " & Ed) " µ  ©e 9 9 9 *$A 30 n © 9 7 9+0  ^7 7 3 V5  "  V5  " 07 ) 5  " 07 M©²RŸÊ b b °n– "&" > "&+  "!fGl => "&+  " € => #"&+ # " MBd?<8 ) )+ "" "8".

  "!$#%'&)("*.?bDc5*d&?!@/7A/*.  <=>&?!@/-A&B!C()&)&D Ä*Å%À 11¬¼Ã¿%ňÂ#Â32*Å%Ã78-EGF)FIHJ6L»G6TÇK2:.Op"&+*.!e(&&JDgf a 7 ^'A5+Y__"KA$hGhjiA" a ^7 k'l)l'mGJn<YiTo +-&.Í)$!. "!:.  ALM! Ä*Å%À 11¬¼Ã¿%ňÂ#Â32"NÁ¬ÈO2  U)+)VJW:7 A57( Â#ÂQPR6LÅLP'ÂÂM25S|¹°»TÀ%à HT2:. ÆTÁÅJ¿%ÆL»$XY.%/%-0 Ä*Å%À 11¬¼Ã¿%ňÂ#Â3256J»NK6J»TÁ96L»*È:6J»G6L»)S'6»|¹-6J»J»'6L»%ÀG6L»TÃ6»'6L»TÇ96»TÃG6»'6L»-EGF)F76J»=H6J»@2:.TApDc5*$9"*'&^G7&A*B!qA)(cf ^'A5+Y__"KA$hGhji?r&?!sibhGhWA=h9htiGu%/%9+)vm-i%o w (5^G&5*)]&3#%'&t^7Wix-&)T!c&@ib!q^ Dc^Q+"TDn^yDc5*3"!zDU@T]7*933{G*^9& &|5 An}^ Dc^$^'/ !D=&^~Dc5*3!d-'/)Q)*997A-&"*'&€ [ '[  ‚+)Y_ `7`-`-`7` x7&K)T!U& A"ƒkGl)lKm r&?! u%/%9+-Um r & ! u /  q:ÊM  $/ËN-A6QÌeÌeÌ.+-&./%-0 Ä*Å%À 11¬¼Ã¿%ňÂ#Â3254#Á¾¼JÃPȽÁ76»98:2.+-&.Î8 RM# "F$4<  RD ¨  ! KÏn …… . Z '[ \ 5]K/)+-7+&5^U_ `7`-`7`-`-`7`-`7`-` ^  +-&.#%K&)(*.

L°u  * ' $ &'( &   +    k9ll m [  A>#+ "A#+ #># 038#8#>$-+3 4)= :n  b  .

.6.589038%*" .%8#>+10gA. !#"%$'&)(R $:./.:.-+6074#"-038%0(903. L$:.@":0±+890=8%..-0+B$-.-Jd%+.6032(‹ .5R 8#"/.?*C4#"/*58%*J*K.:0)":0±+8%0.62)#L*Ÿ#+ +4##0>%890>0p4##!E*M.-"9903.‰I‰g b H n …… ‰9+*"i6 4%.-038%0<.:0./.1032C‹Œq54%2 0C8#8+**$-. d3. ..@2 ‰9+*"F$-.6.-"F$-.-"+10E.6.:038%* .B­A.

K>$N"%.

PORQ!ST b :C‰9"F$  C‹?g=>#· .

@.-03Y`-.*B]%.-05Y6* [L*AY603.@Y6XE¯9Y10 Y@* 2C* .:U90EU%8%*B]%03.@[+.-03Y@X+* U90E[K*/d30E[+* .:]%.3S7¶v250l8%.?0pc:.:0k0k`:.:032 0AS b n%c:.:*3_ .6[Z070=2C.6Y6[+03.:*)8902p4%U%V1WE*)2503XLUºgb.6UJd#XZ07]903.6UGc-03_ .6c/].@U`-.Y603.@`-038%* c@S]¶v250J8%.MU%*:¯9U90E[890 [LX+c‚`q03_ .:0<0. ¯9U%XL.:03Y@`:.dgfh.Mi!`ŸqB4Gc-038%* ]903.:0=0=`:.@. H …… p4%UGV1W3*>2503XLU:q0Mp4GU%V1W3*DX+U%XLY6XZ0E[8%. dE0 2C.6[Z0k0 2C.]903./.?iEUqC4Gc-038%* b ]%03.:. +6.62Ïn †5‡-ˆ S …… ‰zŠ9`F‹@ŒŽ{ŒFJŠ…‘ ¶v25058G.:0h8%.…Y@* 25*p8G.@ULd#X+0. g p*3.@.B./.6c:.@Uay%[L`:X+250=[LX+U#·%0).6c/c:*JU90B. #"-03.8G.-03250 S ÊD.&%.6UJd#XZ0k]903. d . iEUAj-S Y603.6c…* c….6c/.F4G2 025.@c>U%* 2C.:.6[+Y@* 2C.>*?*8%c/.@Y64%V6W3*J8%*l]%.X+U`-.]903[Z0!d#.@.@c:– S —?˜ ™9š-›%š‚œZb™ž<Ÿ¡ g¢9£q¤¥ ¦\¤:§¨#©uªv«l£q¤¬­§3ª/§¨#©uª-® Ÿ€ g¢9£q¤¥ ¦\¤:§¨#©uª-¯P£q g¢9£q¤¥ ¦\¤:§=©J°±¥²¢9© ¨#©7©3³´1£°µ©3¶ «l£q¤¬­§3ª/§¨#©uªq¯F·l©C¸¹©uº £?¨#©w©3³´1£°g©3¶ »A¼A½u¾#¿“À#Á á à À ÄGÅaÅÇÆ9ÁAÈ1ÉAÊ€Ë Ì#ÌAÈ1É#Ê#Í9ÁEÎ ÏAÐÑϾÒɓÁ ¾“½ÓÎA½ à À Ä%ÅaÅ3½ ÊAÔ ¿%½ ÎA½ÕÖÈ É#ÊÖ×Ë Ì#ÌAÈ1É#Ê#Í9ÁEÎ ÏAÐÑϾØÅ#È1ÉKÙ!ÉÈ6¾KÁ'¿%ÄÍAÄÚÈ É#Ê È É#ÊѼ€Ë Ì#ÌAÈ1É#Ê#Í9ÁEÎ ÏAÐÑϾÛÁ!Ü%Ý#½3Ê9ÁÞÎ%ÁÇÊÈ1¿“ÁßÈ1É#Ê #"%!"9â ã%~1.@U`-.@2sd`:*5n …… jB. .62zdFËF.`-*#g“03]K.62903.MdFËF.-+0Uf +@* 4$ nI* 4$VlB.l4%250 ma4%.:0B0?$:.-0?.:0C*5* n%c/..-0EY@`-.@2ƒY@* 25*<¯%Y6* 4./.v4G2 0J`q03n%4G[Z03V6W3*5. d3.:03V1WE*J`:./* _ .-"/25*/qD4#":038%*<90E.6.0)25.@`:* .6c/c:.:X+0B]903.€0.p4%U%V1WE*B2503X+UJ. Y10E890.p.6Y@[Z03.B.:03V1W3*JU9WE*5.@Ua`:.6Y6XE¯9Y10E8%* . 0)]903[Z0!d#.?4%250=U%*°d30)[+XLU#·90 z iEU z S7T|y%[L`:X+250w[+XLU#·907890Cp4GU%V1W3* 2503XLU=qv0!!u~}gA0?2C. $:*<" $:8ºµEµÎ+@* 4$!gA*B2C.>X+U%8GX+Y10c:4%Y@.6c 8G.6n%.6U%03cv8GXsŽma4%.-0E2 0g.…* n%c/.6]K* X+cp890k]903[+0!dA.-0E8%* .\4%2^]%.6U`q0!„gc:.6Y6[+03.-0 dFËP.62e4%2e]%.62pjC.®­AX+c/`:.6cv.6[+Y@* 2C.6.0Cc:0±+8%0GS TD]G.:.-0wd   X+U%8G*o03*n …… X+U%8%*uj b Y103.®­G.6_ 4GX+.@U%c-03_3.-0 *Bc:X+c‚`-.6U`-. X+U%8%*ujqS=xD0)].-0kY6* [L*AY603.6Y@[Z03.:*3_ .:.@2tc/.62”8G* X+cY@* 25]K* U%.62C’ .-0EV1W3*CX+U`-.:0¯9U%03[+X>s103.M*3c8G.@`:* c….-0E.@c:•>./.=[LX+U#·90o8G.jqSNTrc/.@.6[+0.6Y6[+03.@c:]K./* _ .62edgfh.-03250J./*A8G4#s?4G2r*34o2 0EX+c…U%* 2C. JdT+03.`:.@2tiu`  0.6c/2 0qv4Gc-03890]903.@_ 4%X+.@2 j4g{XLU%Y6[L4%X+U%8G*#g.7ug#m#4G.@2 0B*3].:0.6U%c:03_ .@.

-03.ŽY103890Ad .±$Näå±#3æŸnF* U%c/X+c/`:.62”8%. s3S ç‚èKé±ê3ë/ì‚íïî3ì‚ðñ!òóôë/é/õö{é÷ë/éêEë:ìµíøîEì‚ð@ñ òóôë/é÷í²ùuñ íúì‚ðûüòFýí²êEò…þÿ!ùuñ!ðûFë/ù6ýôðuðì²ð@ééë ë/ñ!ð@ñ ë/ébñ ò6é÷ò  ë‚ýò6ébñ ë/ì²ðóôð@ñ ò@é .`-*C8%.Ž.@Y6[+03.4G2”* n%c/.

  ñ ë¡ðRóôûð‚ë/ùuðRû\ë/ù@ýôòPò@ÿ>òÿ ýôóôð@é÷ê!óò@ê!óôí ë:ìúðRó ðñ ò@óë:é‚õö{é{ñ ë/ì²ðóôð@ñ òóôë/ébë:é±ê3ë/ì‚íïî3ì‚ðRûÞòDù!ò@ûFëFñ ò@é{ò ëµýôò@éëFòê ìµí²òùEð²ûFë/ù6ýë€û\ò ñ íøîEì‚ðûÞòýôíøê3ò>ìµòûÞÿuû.

û'ñ ë/ì²ðóôð@ñ òó¹êEò ñ ë  à Á ¾ÒɓÁ ¾9½à¼ ë:é±ê3ë/ì‚íïî3ì‚ðRó÷ÿ!ûqð²òóbí²ù!í²ì‚í²ð êuðRó ðPòí²ñ ë/ù6ýíøîEì‚ð@ñ òó6ÿ!ëë/é±ýôðéë‚ùuñ!ò\ñ!ë/ìúðRó ðñ!ò.

TvU%8%.:032503V1W3*p. q:ÊD4%03.:* _ . TD]K* c/`:X+[+0B8%./ËP4%./`:.@2Ïn …… .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG. ¨ .

  * u  $ &(&  »A¼A½u¾#¿“À#ÁÂ È É#ÊѼ€Ë !.

Ž.Ž4%2 0py%UGX+Y10<d3.-s3S #"%!"9â ã%~$ á »A¼A½u¾#¿“À#Á Å  Õ9ÀaÁ Ä3ÊÒÍ á Ê€Ë  #"%!"9â ã%~ K$ .`-*C8%.62”8G.-0E.6Y6[+03.äå±"÷æDnF* U%c/X+c‚`-.:X+*3c\* n%c/.]d5E.

±å.

±.

±"%.

`-*Ž.6c‚`-.Ž* n%c/.`-*%S »A¼A½u¾#¿“À#Á  ¡Ë .…03*M2C. "9â ã%æDnF* U%c:XLc/`:.@Y6[+03.6c/25*M`-.{4%2Û* n%c/.å4%2 d30E[+* .-03.:X+nG4%X+.@25]K*Ž0E`:.62Û8%..0J.

.

PY6[Z0E.@[X+U%XLY6XZ0E.6c¡Y@* U%c/`9f±Y6*3U%c/`-03U`-.6.-0p2 0EX+* .62”ma490E[+ma4%. 21 ñ í43@òPò@ó536ðRù!í /ð@ñ í²ù1ÿ vêEðRó ðPñ ë/í !ðó¹ò…ì TvU%8%.:032 0lS  b nLc/.:XL89038%.Ž8%.6c:]K.6Y@[Z03.6cv.6c…Y@4%. f±]K*A8%.-0J034G25.P8%./`:.6c…[+*3U%_ * c]90E.@`:* c…].ŽU%* 2C.@c:.p* .@`-*Cc:’C]K*A8%. 03c]90E[Z0!d#.@25*3c6S b  ¶v2”* nLc/.ò=<>< .[LX+U#·%0GS »A¼A½u¾#¿“À#Á Ì#Ì Ã Í“ÈEÄ È É#Ê Ä  ÞÄ È1ÉAÊ Ëo½ÚÈ1É#ÊàÜPË ÜFË ! Ì#Ì!ÏKÅ3½ßÁ'Õ9ÁEÍ3¾9Ä3ʓÁIÄ3Ü%Ä%È!¼%Á ÓÄË ¾9Ä%ÈÅ Ã ÀÄ Í%Á È É#Ê È É#ÊIÜFË  .…0pY6[+03.62C]%.Ž2=q`-*#8%* c]K* 4%Y6* 4%c-038G* c6S  xv*.U%* 2C./`-./* _ .:.@c/`JE`-XLY6* c…c-WE*5XLU%X+Y@XZ03[LXs10E8%* c¡Y6* 2 %'& ) ò ( & +*-.…c:XL8%*J8%.62C]%. 2C*A8%XE¯9Y10E8%* cY6* 2 …… ]*#8%.62C]%./`-*J8%.-0EV1W3*%S  .`-* c…U90pc/490C8G.:03U%Y@*50EUa`:.Ž]K* c:c ±>d .…. 0.:03890Jl®g%c/`-0E`-XLY)f±8%4G.6Y@[Z03.B­#`-.n * c…* n%c/. /.M]903.:038%*%S  b nLc/.F* c…* n%c/.:03c]903.-0J* n%c/.6Y@[Z03.Ž4%c:03.4G2”* n%c/.:03./`:* c…]903.M4%250J[LX+U#·%0l.:.6.-03.-0p* n%c/.-03.:03250gEUG*.62C]%.@Y6[+03.ŽY@* [+*#ma4%.Ž4%250J8G.:.6./X!d .6Y6[+03.103[ºqŽ8%.ES X+8G.:250lX+UG.6]K* X+c8G.@X+cU%*DXLU#±+Y@X+*…8%*D]G.@Y6[+03.62”n%.:.@`-*3c.Ž* c…4G`-XL[+Xs603.@2”2l4%8%03.nh`:..…4%c:038%*C8%.Žma4%. ò uGS @ò ì 6êEò ñ ë 73 989ë ±ðéë$:2. Ë È É#ÊIÏ Õ9ÀaÁ Ä3ÊÒ¼  e—˜”N¦—˜”M™§žQ¢'œŸž #žˆ£M—iž #žQ™e—˜¢ Ž9 ] ‘  .:.`-* c…2l4GXL`-*J4%c:038%* c.@.Ž* UG8%.@U`q03V6W3* " S $#   nF* [+*#ma4%.*3c*3n%c/./ËP4%.6c8%.62C* c{ma4%.:X+8%038%.8%.>8G*5Y@’A8%XL_ *%S ¶vc:.@Ua`-03.@2 c/.:* _ .-0EV1W3*%S  .…X+8%.`-*J]*3.6.:.@`:* c….®­G.…]90E.3S  .Mc/.Ž4%c:03.62C]%.@Y64%V6W3* 8G*5]%.:03.-03cåYV·90!d .62C* c8%.6c/]903V6*3cv]90E.`-* c.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG.6Y6[+03.-032ƒ`:*A8%0C0p.6.@`-*3c]*#8%.gU%W3*M2l4%890lBg*d3* [Z0u`-X+[L.`-*#8903cå03c dE03. 6U`-. q:ÊD4%03.Ž`:.

?.

:032503V1W3*p. ÿEéðó¹ò\ê!óôò @óôðûð¡í²ùuñ ë‚ù6ý TD]K* c‚`-X+[+0l8%. ¨ .@2Ïn …… .:* _ .

6cŽ8%.C03.6U`-*hc:.®­G]K* .M.M* U%8G.@[ lS * 4']K.J8%.6c:c/*<U90 c:.@U9032C.]%03.5Y@* Up4%UG8%X+.‚`.p8%. p.h03ma4%.B¯9U%.(dAXL890h8G* *=.@c:2C* c6S  >#  *AY CU%W3*78%./2 03UG.]903. 03.@`-*3cM[+*#Y103XLc-g“Y6.6c/c&±>d3. d3.6V6W3*UËvS «AS  ¶vc:.6c:Y@* ]K*C8G*l* n%c/.6X­`-* c8%.B­#`-.`-*%SlTØY@[Z03c/c:.:U9032C.B4%2tnG[+*#Y6*f* 4p4%U%V6W3*Ll…U9W3*7c-WE*wX+U%XLY6X+03[+X>s1038%*3c6S >#  *AY B]%.6.6U`:*7Y6* 2 03.@.:250s@. * n%c/./2 0*s6.`-*³f `-.v]*#8%.@`:*LvEY@[Z03c/c:.62C]K* .!lBg  cN* .:0 YV·%0°d3.6U9032C.k* n%c/.h0~]903[+0°d#.6[+.:*78%.:0J*3c25.:.6Y@X+c-0 ]903c:c:03.@c:Y6.3S   9—O¡Œœ i“Q¢ Ž9 ] iž #žQ™e—˜¢ £D—‡£M— .°vu2=q`-*#8%* qN03Y@.ic:0l4%250B8%.@Ua`:.6c/Y6* ]K*<890Ec?dE03.J25*#8%X>¯%Y1038%*3.-0 X+Up*3.@c:Y6*3]*=8%*)* n%c/.o./X+V6W3*p8%* c Y6* U%Y@.503Y@.:2503./XZ038%*3cD8%.Ž07Y6[+03c:c/.…4%2.CY6[Z0Ec:c:.6.N.@c?8G. ma4%.6U`-.J3.:250s6.6U%0325.DqDd#X+c&±Ed .6[L.@X+cŽ./X+* .>c/.6U`:.6[ .    ' "#   b u nLc/.:.4G`:X+[LXs10E8%*Uf* U%8%. 03* `-.dE03[L* .`-*p8%.@U`-*#g./.@25]K*N8%.@./X!d ./.

 `:X+]K*U%* 2C.‚ ƒ `-XL]* ±U%* 2C.6U`q0!„gc:.!lG l$ `-X+]K*pU%* 2C.6U`q0!„gc:.:X+0?]90E.6c@S  8 ©XL]*p.w4%2 ./.:03V1W3*   `-XL]* U%* 2C./U90p*C`:X+]K*  p4%U%V1WE*Cma4%.©{0En.@`-X * XLUa`-0P­A.:* ]%.B­A.6X+. c/.Bp.6Y@[Z03. E038%0C0lma490EUa`:X+890E8%././Xsv8%.-0l*p* n ..:0p2 0E`:. m#4G..6c/.62C]%[L* Y6* 2  x* 30E25. :0l.Mc:.®­G.“0p25. ¯9UGX+V1WE*.6X+.@.:X>s6. `-XL]*JU%* 2C.#G l `:X+]K*å  U%*325./Xsv8%*C`:X+]K* `:X+]K*pU%* 2C. *h]%./U90p]*3Ua`:.Ž890p8%.B¯9U%XLV1W3*<p±0sDY6* 2 .@U%* c…ma4%.62C’ .6XL.…2 0E`:.-03V6W3*8%. - /.@25]G[+* c¡8%./*5]%03.6Y@[Z03.`-* ./* c…]903.:0p`:X+]K* ]K* U`-.@`:*=q4%250p8%.6Y@[Z03..6_ 4GX+. 6UGY6XZ0J]903./U90p]*3Ua`:.`-* .@m#4%03890p8%./* c…]903.`-*p.-03250 X+U%XLY6XZ0 XLU%Y6[L4%X+U%8G*h0  8%.?Y@* U`-. 96  gU%Y@[+4%.6XL.@Y6[Z0E.°lB‚„ƒ `-XL]*JÚU%* 2C.-03V A. l `:X+]K*!  U%*325.:U90p*p`-XL]* '&)(+*6FJŠ…‘ †5‡/† ‰zŠ ¶v250B8%.@`:* .:.:X>s>8%*p`-XL]* # .@25]%[L* c…8%. :0Ap.‚ï*ƒ 2 0E`:.@`-*3c6S 6 p4GU%V #.62C.:0p*J`:X+]K* p4GU%V1W3*Jma4%.6U#·90 ¶v250p8%.Ž8%.@c€8G.:.6c/.@Y6[+03.:U<.6c.vU90.6[L.:X>s>8%*p`-XL]*pY!vCp.…8%./Xsv8%.:./* c6S  6 8 ©å03nK.@U#·9054G2s./.6X­`q0pma4903[+ma4%.:03V #.6X+.Ž]* U`:./XZ038%0GS /.6c TD]G.Ž]* U`:.@Ua`:.>2C.:03V1WE* .6X+.Ž]* U`:.6c/.…8%. p.‚ ƒ 250E`-.6X+.v* n /.:*p`-XL]* ¨ ­A.`-* .:03V1WE*C8G.6[+0AªGS²Tµ ­A.6U`-*3c  X+U`…Y@* 4%U`°‚ ƒ    « X+U`…Y6*34%U`°‚ï*ƒ ½vvu   X+U`?  Y@* 4%U`°‚ ƒ X+U`?  Y@* 4%U`°‚ ƒ XLU` !  Y@* 4%U`®lB‚„ƒ XLUa`4 Y@* 4%U`! XLUa`…Y@* 4%U`" l X+U`B  Y@* 4%U`" l XLU`  Y6* 4%U`%G l&l$ X+U`  Y6* 4%U`VlG l ]* U`:.B­#`-.:.@25]%[L* * U`:.@[Z0ªGSø.:*p`-XL]* p4%U%V1WE*Cma4%.‚ ƒ l `-XL]*!  U%* 2C.ŽU9WE*C`:.6XL.-0l`:X+]K* XLU` ?Y6* 4GUa` 250E`-.?. % 0Nc/.:.6S TD]G.:*J]903.?4%2ƒ* n 4G2”X+U%XLY6X+03[+X>s1038%*3.@.:0p`:X+]K* 250E`-.Ž038%./*J]903.6.@.…X+U%XLY6XZ0E[+Xs603V1WE*B03]G.:* _3.6Y@[Z03.-0<p4%U%V6W3*Jma4%.#G l&l$ `:X+]K* !  U%*325.

`-*%S 8%038%* c b0‰…X+* c‚`-.@c:Y6././.:03890l8%.-0?.1032C‹  ]%03.B*J4%c/*58G*C*3].6.c:0±+8%0h8%.:W3*h8G.Ž0J.@U`-.1032C‹ p* .6.:03890~.l*w* n / .:0h. q:ÊD4%03.‹Š‹Òma4%./.o* n /.6UG.6.U90B`:.@U`-.oc:0±+890h8%. n …… ]903./ËP4%.o. ¹0‰…X+* c‚`-.@2Ïn …… . 8%038%* c@S10>n%c/.-03890 .Ž* n / .-0l./U%..2 .-038%*3.6Y@.1032C‹ŽSŸnF* 2C*w8%X­`-* 03U`-./25.6[Z0ASTŒ‰…X+*3c/`-. 89038%*3c6S n%X+nG[+X+*E`-..6U`-.  p* ./. 3.6Y@.6U`:. 8%.:* _ . TD]K* c/`:X+[+0B8%./`:.@`-*3c7..ŽXLU%8%X+Y60903.6Y60 ]9038%.@./X+* .6c‚`-.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG.@`:*pc/`-8§µ>µïY6XLU/Gma4%.M03X+UG890?*l*3n TvU%8%.6U`-.:032503V1W3*p./X+*JU%./2 0*s6./U%.-0E890C8G*54%c/4G3.`-*7c‚`-8ºµEµøY@* 4G`M4Gc-038%* /. ¨ .qv4%c-038G*p]903.

ŽY6*34G`1S X+c‚`-XLU%_3ªGSx«TµQÊD.@`:* c….4Gc:*C8%.ŽY6X+U=.:03V1WE*C8G.*3n ¸º¹¬»½¼L¾¿#ÀTÁ‡Â›¹*ÃÄPÅLÆÁLǬÈÉ ¹°»%ŇÈ|Ç#¹°»     .6Y@[Z03.   ' "#  uª ´ /.

 .

 G!V/%KA    .

!QY_)i Ä*Å%À 11¬¼Ã¿%ňÂ#Â32 J»%Å%ÆTÁ98›¼ìÈK8ÇI1T2.*5!: '&'*d/"A-&-/"*G^ \ T!U& G+7 '( '&7A'o  \ q%/%-09$7(7/ Gƒ$A/Dc ¹¬»%Å  !|A/DcbD'*  $A)&'Wi 7A%*G&. a !:  +9&-T*G )/RDY '+- '( G&7A +7&?{c/%'/+) ` &"-]':<]& - ÇO. 3/GAUf y9!c&B    U&^G5*'&]& ft^9&*]'&zDU5*.          .

#'&ƒ&5^GA )ƒ^9&%G+)d+&7K%*97+-)^ ! Ä*Å%À 11¬¼Ã¿%ňÂ#Â32 J»%Å%ÆTÁ98›¼ìÈK8 Ä*Å%À 11°¼%¹°»ˆÉ#É . "  7^)+)   ( G&7A^. ¹¬»%Å .]‚"* Y% Dc)+&B^9&"* !¼U.  G^ DY&*Q#'&yB9^ *'/)M+7/ :/-A& B]9:5*d+-&y & !V&KA&*v€  @*"!@ G&"GBy]G5*W+9/ :/A7+-t.7( 9&7A5ƒ Ä*Å%À 11°¼%¹°»ˆÉ#É Ç  .

n1T2. # . Dc5*ƒ^'&RDU*9* L.

 !  ']&"*K/ {c/7B.*"!: G&"G-+7  -^GA5ƒ^G/ K/{c/7ƒ#%K&y &%9+:t(*G/ '  GdA&'d/!c&+9/GAT!U&:A)&€  &<!V"KA:€ /%-0 !* 95]9 zD:*9 9*GT!:y$&5^G5*'&"]K&"* Ä*Å%À 11¬¼Ã¿%ňÂ#‡ÄPÅTÀ=11 Á»TÀT¾I.A)/Dc  :&ƒ&KA )$*"!: G&"Gy3*K&5^O"A-+- rÇyF ÄìÈ|Ç  U&^G5*'&]& v.  :&M+9&5^'*7*'& KB  +* .^7!:   Â#ÂmÄìÈ|ÇV.- +-&B(Kf $A)&'MM*'&^Y5A7+-3+-&3^7! Ä*Å%À 11¬¼Ã¿%ňÂ#Â32  U&)]'/ "9+7&.+&7K%*97+-)^bDY&*'Aƒ+-&  K3^9&"* 7^)+)^n€ ¹¬»%ōÄÃPÈ|Çv.A)/Dc %$ & +-&j:f .     w (5^'&"*)]&M#%'&35^$9( '&7A)^3^ )./)^KA*'&)T!e"KA .{@/9t+-&W%/-0  (%5{@&*. ÆTÁÅJ¿%ÆL»$XY. ' $ )( LìÈ|ÇG8 @2  K. Z '[ \ 5]K/)+-7+&K_ / 0 A"*97+-3+-& ` ` ` w    `7`-`7`-`-`7`-`7` &7KT*9 -3+-& `  7‚+) +-& &):/  .)T!@5G+7ƒ&%9+:  ^&.&'&"^WT!U& 7T! (7/ 9d+&7K%*9B]G*'/ ]K&b+$A/RDcƒ/GAUfy!Q9!@&3^7! !.( T7^7)+-$7(7/ G ! Dc5*9M.%!DY9A)‚"]K&7/5^M*K&@/ 9jM^7! &<!.

.

( G&A^ +))+)^ +))+)^ -3+-& "A5 !  3  7( G&-A5d/ nfy+&-T*9-+7t.*'#"K/"]G t7^7-+) .

TD]K* c‚`-X+[+0l8%. ¨ .*"!: G&"G*.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG.:* _ .:032503V1W3*p./`:.+M^ *K/@€z-/% j^7)+)3e/%-0O_ TvU%8%. 21 h/^GA%*'&! Dc5*. q:ÊD4%03.+))+)^./ËP4%.+/ @/7A-+-)^jdA-&-T-+7 &<!$!V7( G&-A5.@2Ïn …… .

!QY_.    ' "#  ^'A5+Y__)/% [ u 11 tKo '[  ‚+)Y_  `7`-`7`-`-` 5'+*'& !U&"*'"7*K/ƒk5RD 7A%*G&.

:032 Y@* 25]GX+[Z0E8%* cl.b*v]%.€890ŽxD¶S ¨ *3.8%.@.>(G  "¹(­KbS .6.62 4%2 ¨ n 4%c-03UG8%*ŽxD¶Dv ´ X+Ua4T­S 0tY6* 2C]%XL[Z038%*3.  U : `  .:XL**3U%8%.:2CX+U90E[!"  v]90E.6Y@4G`q03. ® .-03250>8%XL_ XL`-0u„gc/.F0ASø* 4A`1S ¨ 03.(c_  !: `    /"A K& W€ Kc€"KA [ 0>cJ]%.®­A.032ln%XL. 6 Y A 4 q ` 3 0 \ . * € c 2 03Ua490EX+c   ¨ 8G.  0 6 Y * C 2 % ] + X + [ 3 0 .F*v]%.B­A. ? 0 G ª S S 3 0 .Ž8%. 4A`-X+[LXs6038%*:qM*p_ …?…  *pY6* 2C]%X+[+038%* . 3 0 5 2 Ž 0 % U p * 3 0 l 2 G n + X 6 .:* _3.:*#89038G* cJ.=.-0Ž. 7A%*G&.:*3_ .!.:*3_ . p±034G[L`!A*pY6* 2C]%XL[Z038%*3.:0vY6*325]%XL[Z03.@`:’ .@U. ? * % ] : .-0325003n%.@c/`-0?[+*#Y10E[+Xs6038%*v.€*Ž]%.:0l4%2 . D .-03250 .@c:.6Y64A`! .:*3_ .64.r  K$N  !“  !"9$N"¹(L ää€S ¨ 0E.-0v*v8%X+. : 0 L X _ % 4 .?c/. Ó f L X % U % 8 ° * … Ì F c @ Y * % U : c G 4 L [ ` v .8GX+_ X­`-.€8%0ŽxD¶à_ .-032503c<p* ./.@[ A Y@* 2ÚU%* 2C. 3 * _ .6U`-. A ­ 6 .M8%.-0…4%2ß`-.

@Ua`:*%S  X+_34%.3  * [ #  XL25.-0AªGS µNnF* 2C]%XL[Z03U%8G*l./ËP4%.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG. ·%.:032503V1W3*p.  TD]K* c/`:X+[+0B8%.B­A. q:ÊD4%03.@2Ïn …… .Ž.6Y@4G`q03UG8%* ]%.:* _ ./`:.6[L[ôS ¨ .:032 0Ec\U%* TvU%8%./* _ .

@2Ïn …… . ¨ .:* _ . q:ÊD4%03.    ' "#  u TvU%8%./`:. TD]K* c‚`-X+[+0l8%.:032503V1W3*p.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4pc:YESønG./ËP4%.

  .

    .

6c/`-W3*~.@_ 4%XL.6.B­AX+c‚`-.74%c-03. .B­#`-.58%* .@2sn%X+nG[+X+*E`-.®­A. ¯9UGX+8%* cŽ]K.@c-µ¡Y6[+03c:c…YV·90E. :0oUG*  0>cM`-X+]K* cM]%.@.6[+*NY6.Ô Ì#Ì Ü%Ä%Èu¼%Á  Ë GÄAÀaÁ3ÍA½GŠà ͓È3Ä Î%Á#Å .:X+038%* .lY6* 2C* Y6.62C]%[+*k0 c:.Y103]#±­`-4%[L*   ‡ b ¶v2 `-X+]K* = Œ FŠ 7Š Ž4%250p03n%c/`:.0  xv.<m#4G.@25*3c *Mm#4G.-03V6W3*C8%.6.B¯9U%XL8%* c….  *#Y #ESÚTDc:c/X+2…]*#8%.@V1W3*  * c`-X+]K* c8%."  */.62”c/.@[+*p]%.6V6W3* ASx«PƒS  © ´ ‚ïc/.3S ¨ *#8%. R„g8%. .0 2. S .6c78%.‚`-XL.  * c`-X+]K* c]%.B¯9U%XL8%* c…].B.X+U` 2%*0E`!b8G* 4%n%[L../XZ03.. …… XL2 0E_ X+U90E.Em#4%03X+c*3c{`-XL]* cå]%.p4G2 * n / .@2 <CED CFD CFD S IH/J »A¼A½u¾#¿“À#Á K È É#ÊÓ¾“Ä%È1É ML ON Ì#Ì ÚÀGÈ1É %ÄÒÄEÜ%Ä9È!¼%Áà½GÅ!ÊGÄ Ì#Ì Ã Á ¾ØÁ#Å  ML EP US ML È É#ÊѼ = à ͓È3ÄEÉAÎ%ÁÓÎ%ÁAÈaÅIÁ!Ü9Ýa½3Ê9Á#ÅÞÎ%Á'ÊKÈ1¿KÁÒÈ1ÉAÊ É“Á ¾9½%ÅǼ߽ Ô Ô¡Ë RQ TS Ì#Ì ^Å ½ ÏÈ!ÍàÏKÅ ÄÒÁ#ÅàÁ!Ü%Ý#½3Ê9Á#Å ¼ Ì#Ì Ä Í3¾9ÄÐA½EÉ%ÄEÉGÎ%ÁÚÁ#Å €Ë.‚ c:./* _ .$#6c…_ .62 c/.M`-XL]*3c\8%*C4%c:4GE.0J8G.6Y603cF.6Y10Ec\.B¯9U%X+8%03cw]K.6V6W3* 0 AS ƒS <"= >" ?A@ @ '& (+* 7Š B‘ 7Š )Y6* 2C*=n*#* [¹YV·903.62  * c`-X+]K* c8%.:U90Ec “Y6* 2C*J0 …… 5 6 " 7 */.®­#`-. #X+c‚`-* c Y@* 2C* Y6[+03c:c/.6.l8%.`-* 0o]903.6c/Y6* UG8%X+890Ec78%. \4%2Ú`-X+]K*. ¯9U%XLV1W3*C8%. 98+:. G  Y6[Z0Ec:c…X+U` G  Y@[Z03c/c % 2 *0E` %  Y6[+03c:c…8%*34%n%[+.  ./U903c  Y@* 25*C0  © ´ .6[+0=[LX+U%_34903_ .@2ƒ`-. ¯9UGX+8%* c…890p[LX+U%_ 4%03_ .03[+_ *GS 1 2 ±YV·%03.Ž.@c/`:.„ c:. ?‘  ASø*ƒôS  ‡ * c{`:X+]K* c{8G.Fma4%.    3.:. ¯9U%XL8%* c ?‘ 0>c`-X+]K* c\]K*#8%.. „ 8%.…Y6[+03c:c/X>¯9Y6038%* c…. „ 8%." 1 ‘ 7Š 7 ‚ïc/.74%2 `-X+]K*o]%. ¯9UGX+8%*k8%.@2e03c…Y6[Z0Ec:c:.9XLUa` 29*0u`!%8%*34%n%[+.:X+*GS ±   ( !#"%$ '&( ) +* (%* *.:032 0E8%* .62”nGX+n%[LX+*3`:.B¯9U%XL8%* c 8%.6.:4G]* c µ  43 …… …… B „ 8%.

ѽ  = ÉKÁ#ÅIÁuÜ%Ýa½3Ê9ÁAÅӼѽIÔ Ã Í“ÈEÄÞϾÛÁ!Ï#Ê#Í9ÁàÁ!Ü9Ýa½3Ê9ÁÓÎ%Á'ÊKÈ1¿“ÁßÈ1É#Ê Ì#ÌaÁ!ÉAÎA½ÒÄ Í ¾9Ä ÐA½EÉ9ÄÑÄÚÅÁ ¾“ÄÓÎA½I¼Ñ½IÔ WVEX  à Á!¾ÑɓÁ!¾9½^ÅÁ ¾9Ä GCED 1 .

WV   È É#Ê #  '  !  (  ' "#   ' $ .

.

Y603. „g8G.230E[+*M8%.Ž8%XL25.@[Z0 nGXL`-c@S ¨ 03.6U`-03V1W3*7.@. ¯9U%XL8%* c  .:ma4%X 3*ŽY6* U` @2 *3c[LX+2CXL`:.  ma4%.@X+./* cU903c]%[Z0u`q0"* .:.6c n*#* [ 2%*0E` S µ©X+]K* c.-0pma4903X+c03c8%X!.9  [L* U%_p8%* 4Gn%[+.6c…`-X+]K* c\Ua4%2 AS  S  890M[LX+U%_ 4%03_ .B¯9U%XL8%* c…890J[+X+UG_ 4903_ . ¯9UG. R„g8%.6.3S¡Y Ec/X+U90E[  ]%.62ÛY@* 25*M*ŽXLUa`:.-0E8%* c  03[L* .@2tna`-.:. char.6Ua4%2C.6* 6 XL_ 4%.-0 E03.…8%.@X+.„ « …  GS .@Ua4%2  na`:. unsigned short 1 2 3 4 1 2 3 4 int. unsigned char 1 2 short int.6./` X+U`-./X+Y@* c…8%.:./.:0 8  # 9ë ±ð?ù!ò?ûðù6ÿEð bñ $&%'% .:*p_ 8G.@8.:.:03Y@`:.6cF]%03. unsigned long.„g WV P­AX+2C* 0E[+* .@U%V10Ecv. unsigned int./*pc:. long.@Ua`:.6. :0w03X+UG8905U90 6.62  E  . I¼IÔ¡Ë ÅaÁ ¾9Ä  # 0>c `-XL]*3cUa4%2 1 @.@U%*%S¡cEc/X+U90E[ « X+U` X+U`-.@U%c #.:*J]K.6Y6XLc-W3*Jc/X+2C]%[+.6c ©{0En.@8.@X+. … … «AS AS0  J«  GSΪ AS «p2C* c/`:.6XLc c/`:.@[Z0 nK* [+.S  c/4%]K* ./`-038%* c V V „ p8#±L_ XL`:* c p8±+_ X­`-* c J8±+_ X­`-* c .@ccJc/X+U90E[ c ·%* .  …… X+_34%.nGX+n%[LX+*3`:.-0 nK./* « 4%U%c/X+_ U%.c ·%* .-0EY@`-.@c  ]%. Y103.6ma4%. …  «  V „µJ« ª „i«AS AS0 GSΪ  „i«AS AS0 GSΪ J« *ª     V 0  … V S E.XLU` X+U`:.@2.:. ±+c‚`-X+Y603c 8%* 4%n%[L. . 2%*0E`!G  8%* 4%n%[L.62 - AS  ©X+]K* cnG3c/X+Y@* c c:X@.:* cX+U`-.-03Y`-.* cU#yG25.:.@c>8%* `-032503U#·%*  4 S …… #4%250M* [·%03890DU%*03.6U`:. E03[L* c6S \0E. 4%U%c/X+_ UG.6XL.@Y6XLc-W3*J8%4%]G[Z0 [+* UG_C8G* 4%n%[L.@Y6XLc-W3*J8%4%]G[Z0 ]%.@c 4%UGc:X+_3U%.:XLY6* c¡]%.v0E.:. double 1 2 3 4 5 6 7 8 9 10 long double #S µ©XL]*3c8%.6.@X+.6c AS 4%250 .6Y10?‰…[+X+2CXL`:c-‹/S 8 Ê  1 bool.@2”c:XLU903[ [L* U%_ X+U`-. int* float 1 2 3 4 5 6 7 8 long long.\2)±+U%XL25* « « #  ª#E «AS AS0 GSΪ %Sx« %Sx« AS «AS AS0 GSΪ %Sx« %Sx« AS GS43  .Ž89038%* c….„g „i«AS … …  X V X X EV VEV X X VEVEV V 4  X S u.@c:.ŽX+U`-.@. … 4  J« AS0 GSΪ GS 3.:.603U%* YV·903.-0p* c`-XL]*3c\]%.6.M* c`-032 0EU#·%* cU9WE*C2B4%89032)S Tr©{0En.@.:*3c 4%U%c/X+_ U%.:X ! .-03U%8G. E03[+*3.6[Z0 8G* c…8%X.‚` X+U`-.6X+.68=YV·903.:.@X+./ma4%X 3*8G.:*p_3.@]%.:.@c/`-W3*7[+XLc/`q0E8%* c…U90@©å03nK.@./2 0Ec\8%.\2 AS .68)[+* U%_ XLU`-.

í²ù1ÿ ë:éý Rò\ë‚û !í²ë‚ù6ýë>ñ * ÿuéó * . %'% . /./ËP4%. & 1 ò ( & +*-. ë>ñ ë/éë‚ùò 1  í²û\ë‚ù6ýòŽò@ùuñ ëDë/é±ý òBðóûð/ë‚ùuð@ñ ò@é€ò@éFðRó 6  ÿ!í @  ò@éPñ!ð íøùuìøÿEñ ë * 3 TvU%8%. òlé±ë/ÿ5ðRû ./`:.6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG. :ÊD4%03.

TD]K* c‚`-X+[+0l8%.:* _ .?J« ²í²òRýë:ì‚ðBñ ë .@2  …… . ¨ uí  ªC.:032503V1W3*p.

_ .#   !  (  ' "#   ' 0ØY6* 2C]%X+[+038%* .

± "÷æ á '   8907_ Ua4 …… $ .

.

@U`q054G2”X+U`-.@X+.?.:X­`-*=U%*  m#4G.  p8G.6c:.?ª Jn%XL`:c6S ./././*p8%.6c:Y@.6]%.

6c/25*wc/4%]K* .÷*=2C.:.6UGV103c…8%./`-0=*7`:X+]K*w[+* UG_w[+* UG_. \03]#±­`-4%[L* ) #S «TµÊDX.M`q0E2 03U·%*p8%* c* n.@.

6c/./XZ0N0kX+UGY6[+4Gc-W3* 8%.6Y@.CU90=[+XLc/`q0E_ .@Ua4%2   œµš  Ž« ª  Ž« ª „µJ« ª 4%U%c:XL_ U%. A.-  µQ©X+]K* cUa4%2 6.<.@c8G.:. /.:XLY6* c8G.  ma4%. U9W3*k`-. ©å03nK. U%.XLUa` X+U`   «AS AS0 ASxª GSΪ  AS0 ASxª „i«AS «AS AS0 GSΪ  AS0 V #E X X %S « %S  ª ASx«  76 X  TD]G.)89038G* c \U%W3*hc/.-3..62t07c:.62C]%[+*  lX+U%Y@[+4%8%.6c/cJ3.M4%2z]%.-03250wma4%.6c8G. 0>n%c:. 6#.®­A.6U`q0!„gc:.6U%8G*  lS  .@8.:* _3.@.@`-*3c]%038%.J4%c-0=* cM`-XL]* cD]9038%.6_34%X+.@2  ¹°»%ÅmÈ|Ç#¹¬»|  XLc/`-XLU%_ /DU^jDU7+* 9&5^ .6[+0 V ..6c‚`-.

lS +q/" ' @& ! /DU$()-@&G B   :A)&5*)]G@T  ÃLÃT¾T  ¾LÇ  AS  c:0±+8%0  .

:UG* c6S ´ .6.B­#`:.6U`:.-03890 8%.     .:ma4%X * c….03.

@2  . /DUe5 e+)"'('&  :A)&5*)]G@TƒlT  ( KA&"^ ¾Jû 1 ÀTÿ #¾JÁ.095*  :A)&5*)]G@T  `   ` 1    yl $     (  "!  (   ** -.-  jXY.:* _ . ¨ .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG.¾LÃJ» ` € U&'lT LÀTÃJ¿ 1¾%Á d+/ :/7A^ ` JÆ Á TvU%8%.62 U%. ¹°»%Å~¹°»%Å  ` #¾JÁˆÀÿ $+9/ @/7A)^M+-&~D@*'&7-/5^ - ` 1¾LÁ #Á I.Ž«pnGXL`-c@S  œµš „i«AS ª „µJ« ª U903c]%[+0E`q0"*3.62 ªJ.  . ¾%Ã%ÇJÅ  :A)&5*)]G@TƒlT  € `  W( KA&5^  ` Bl {IT)A  :A)&5*)]G@T T¾JÃ%ÇÅ l ` ` O.-     *   (  !  '98): $ 674+0674326.4 9< . TD]K* c/`:X+[+0B8%. -!   ($   ./%A  d( KA&5^ ƒ(-/-A^ Uf :A)&"*-]G@T  W( KA&5^ W(-/-A^ Uf :A)&"*-]G@T /DU lT /DU  +9/ @/7A)^M+-&~D@*'&7-/5^ - ` +-"'('%& K€ 9&'lT ` ( KA&5^ À%ÿ €5&'lT I. …?…  $ M( KA& . -! !=   (   + * " ! "'  "' > $ 62?4 A@"6B   M( KA&  |P LP)./ËP4%. ¼ ÇJƍ¼  /DU. /DU./`:.:2503cF8%. \U%. :ÊD4%03.( !#!    !  1 1 $!%$!    $!&  '( * $ )+)") ."!-   * .4+0%6.:032503V1W3*p.-  . &'/ 1 $ 03254674+ . +-&~D:*K&--/^ 7 Y.

.

 «  #   ' !  (  ' "#   ' $ .

.

Z '[ \ 5]K/)+-7+&K_ `7`-`-`7`-`7`-` ^ ƒ+)^WA/Dc^jDU-+* 9&5^ a 7  (5K'fy%07"*Ifj/GAcf !! k*G/   +-&3kGll  7AOft+)"K('%&cf." e+)5'('%&  )OfyGA*K/-(/  ‚+)Y_  { -3+-&B]G@T*K&5^  & `7`-`-`7` 9^GA)& & K&!D %j )$/%'KR'&ƒ^7‚+) [ . ÆTÁÅL¿%ÆJ»dXY.

:*pY@* 2”c/X+U903[  ±c:XL_ U%.ŽX+U`-.@X+.:. 7^7ƒ+-&ƒ( '&7A^B75! 5*'/7^U€ +-&M+)-+)^I€ 0>n%c:.6.6_ 4GX+.?U%*J.Žc:.68)X+U`1S XLc/`:X+U%_ ´ ASx«TµQÊDX!.*J4%c:*C.®­G.@.@U%V103c…8%*3c…`:X+]K* c\XLUa`….@25]G[+*C0Cc/.Ž4%UGc:X+_3U%.6U%V603c…U%*54Gc:*C8%.62sc/X+U90E[  S ¸º¹¬»½¼L¾¿#ÀTÁ‡Â›¹*ÃÄPÅLÆÁLǬÈÉ ¹°»%ŇÈ|Ç#¹°»  .-3.03c…8%X.@8 ±4%UGc:X+_3U%./.68 .@.

.

Z . Á%¾TÄÁ C.:032503V1W3*p. 8 ( @ v / . 9/'8c!Á(g18+<)X)X9 I1T2@. TD]K* c‚`-X+[+0l8%. T 8 ( F1v M / .:* _ . @ /I. :ÊD4%03. Â#ÂrÄPÅ%À 11 Á»TÀ¾ ÄPÅ%À 11¬¼Ã¿%ňÂ#Â32 L»%ÅLÆTÁ98›¼ìÈ:8›¹°»%ÅG8 ÄPÅ%À 11°¼%¹¬»ˆÉ#É ÄPÅ%À 11¬¼Ã¿%ňÂ#Â32 L»%ÅLÆTÁ98›¼ìÈ:8›¹°»%ÅG8 ÄPÅ%À 11°¼%¹¬»ˆÉ#É 2 TÁÅL U. $ $ +8 $ 9( %@ / $ ÄPÅ%À 11¬¼Ã¿%ňÂ#Â32T¹°»TÅ98 +8'8 -89(K8)F-89/'8 @2 Â# 8oÂ#ÂmÄPÅ%À=11 Á»TÀ¾ .*'&7A*-G É $ $ ` `  !-+"U$+ .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG. ÄPÅ%À 11¬¼T¹°»  +/{c&"*K& - V./ËP4%. ÄPÅ%À=11°¼Ã¿%ňÂ#Â32 L»%ÅLÆTÁG8½¼ìÈ:8¿T»½ÄT¹7L  »1ÁLÀ-8›¹°»%ÅG89'/ 8c!Ág ( 1J8 )< X)X9 I1%2@. ÄPÅTÀn11°¼T¹°»ˆÉ#É /n. ÄPÅTÀn11°¼T¹°»ˆÉ#É (v./%A€ TvU%8%.%  »#ÁLÀ78½¹¬»%Å98+'8 8 -8 9( 8%%@ 8 '/ 8 @2 Â# o 8 Â#ÂmÄPÅ%À=11 Á»ÀT¾I. ÄPÅ%À=11°¼Ã¿%ňÂ#Â32¿%»½Ä¹. ÄPÅ%À=11°¼Ã¿%ňÂ#Â32¿%»½Ä¹. &@+@+@"@+@"@+@+@"@+@JÉÁ#ÄÅÇJ»ÀTÃ-8L¿½ÄÃ78ÀLÁ988#¿T»½Ä¹.   9*5!: G&'jd/"5{:*"!@ ¹°»%Å~Ä%¹°»ÇT¾v.    ÄPÅ%À=11°¼Ã¿%ňÂ#Â32 7 ¿T»½ÄT¹ L»1ÁLÀ¹°»%Å %$ %$   1      ( / 8$ ( @ / 8$ / @ (  !   '  '^& ¹ v      $A&"^GA&ƒ7(7/ 9Of  '^& Vh  $ $ +-&z{:5*!ƒ3*K&7A*)'*M  *'&7A*-G . (I. ¨ .@2  .  ÁÅn U.  9('8c!Á(g18+0)X)X9 I1T2@. /I./`:.%  »#ÁLÀ78½¹¬»%Å98+'8 8 -8 K( 8F-89'/ 8 @2 Â# o 8 Â#ÂmÄPÅ%À=11 Á»ÀT¾I. ÄPÅ%À 11°¼%¹°» $ 8$1( 8 1(MF /I. ÄPÅ%À=11°¼Ã¿%ňÂ#Â32 L»%ÅLÆTÁG8½¼ìÈ:8¿T»½ÄT¹7L  »1ÁLÀ-8›¹°»%ÅG89'( 8c!Ág ( 1J8 )0 X)X9 I1%2@.L»1ÁLÀ-8›¹°»TÅ@2 Â#ÂrÄPÅ%À 11-Á»TÀT¾ 1( -/ 58I. ÄPÅ%À 11¬¼Ã¿%ňÂ#Â32T¹°»TÅ98 '8 -8 G8 %8 '8 @2 Â# 8oÂ#ÂmÄPÅ%À=11 Á»TÀ¾ .  / &@+@+@"@+@"@+@+@"@+@JÉ#Á#ÄÅÇ»#ÀTÃ)8T¿½ÄÃ78TÀLÁG88§¹°»%Åc2 ÄPÅ%À 11¬¼Ã¿%ňÂ#Â32 1( ¹°»%Å 8 .  ¹ v 1 (É / 73+3^/TKfy(5^'&"*-]K&M#%K&B^9/9 B+dA/DU.

2 .

. 78 8+9( 8%@%8+/G8 :2 ÄPÅ%À 11°¼Ã¿%ňÂ#Â32TÄT¹°»Ç%¾98ÀLÁ89G ( 8@%8+/'8 :2 ÄPÅ%À 11°¼Ã¿%ňÂ#Â32¹¬»%Å8|ÆÁ#Ä*¿1¾JÅÇLÀÃ"# ' ¼ÃJÆTÆÁLÅÃG8 ¹°»%ŌÆÁ1ÄP¿|¾ÅÇ%ÀTà ÄPÅ%À 11°¼Ã¿%ňÂ#Â32 ÄPÅTÀn11!Á»TÀT¾  ^77‚+) 7 ¿T»½ÄT¹ L»1ÁLÀ¹°»%ÅmÅ @"6K.#   '  %$ %$ !  (  ' "#   ' 6 F Ä%¹°»#Ç%¾ Á%¾TÄÁ Ä%¹°»#Ç%¾  Uk*G/  $ )$  $  $ ( 9&-A5Q/KA Dc*$*5!: '&'*M3*K&5^O"A-+- '¼ÃLÆ%Æ#ÁJÅà ˆÄ%¹°»#Ç%¾ 8q. @+6B. 6K. Z Â% ÄPÅ%À 11-Á»TÀ¾ Â% ÄPÅ%À 11-Á»TÀ¾ -8›ÄT¹°»Ç%¾K8 58 98 @2 Â# ÆÁ1ÄP¿|¾ÅÇ%ÀTà  "8 $ $ #@+6 #@ @ $ ÄPÅ%À 11°¼Ã¿%ňÂ#Â3288¿T»½Ä¹ L»1ÁLÀ-8§¹¬»%Å98LÅ'8 )8 ÆTÁJÅJ¿%ÆJ» 8 ‡ÄT¹°»Ç%¾  $ . . )$ w (^G&5*)]K&t  .

$ .

.

'[ \ 5]K/)+-7+&K_ a ^7 ` w . . T8 É58PÅK8 -8)8@2% . '¼ÃLÆ%Æ#ÁJÅÌÂ# ŌÂ#ÂmÄPÅ%À 11-Á»TÀ¾ .

1    ((    **  "       1.!V/%KA "& n_ _ /%KA dl /%KA ` ` -&5^'A5'+-j7^M+-& -9^G/ K&)+ƒ/%KA ` `-`7`-`-`7`-`7`-` 7 7A%*G&.& TD*G&"^-^ )If & D:*'&^-^ -  '5*9M  Dc*d5:A*G:T* (!!    * (!!  + ! * !!    !!  D:*9 9*GT!:U€ %^9/ '&+ )5:A*9@&3/<{s€)€-€&'?^9& A&?!Qƒ/<{s€)€-€&'?^9& 5& %D@*'&5^7^ 7  ) o &'?^9&  \  ) co /<{s€)€-€&G<^&cfz^&B$& D:*K&5^-^ -b{*ƒ]&"*G+--+9&-/5*9 ^&z{:5*y{:?^7Q& K&-"Ajƒ U€ )  !! & K&7Ajƒ ) 'f  ‚+)Y_ !  ./<{ +-& t^7)+) w /<{e5]9%/ & K&-"Ajq%/%-09 /<{ (  * ^9&?!W^9/%9:   & &-" ^&yt!@&"^%!:t{:5* 7^G/ &+ Y€ 7 ]&"*G+--+9&-/5*9  (7/ 9Yfz^&B$& %D@*'&^-^ 7b{5*y{KK<^-IfDKUTM.  Q€ @€""KA -&5^'A5'+-j7^M+-& /%KA `7`-`7`-`-`7`-`7`-` 7A%*G&. :ÊD4%03.!V/%KA "& n_ _ 7A%*G&.         ((   **  "       .@2  .!Q-9^G/ 9K&)+ƒ/%KA "& n_ _ 7A%*G&. (  * +   `7`-`7`-`-`7`-`7` +-& 7( 9&7A5$+$A)/Dcƒ/GAUfy!./`:.!& =7!= "+ =                  + `7`-`7`-`-` 5'+*'& !U&"*'"7*K/.:* _ .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG.^9/%9: a ^7 `  + +.!Q-9^G/ 9K&)+ƒ/%KA 7^G/ &+ƒ/%A 7^G/ &+ƒ/%A "& n_ _ $l ` ` ^9/9t+-& ` ` /%KAB*K&5^O"A-+- K)*-*K&7A 1 B^9/9j[ TvU%8%./ËP4%. ¨ . ` TD]K* c/`:X+[+0B8%.%/-0$7(/ 9 ) € o /J{=fz]9 $A5!@( ! /<{ & M^'&-# -/3+-& 5!.:032503V1W3*p.?D  &"*G-+-*  DO&"*G-+7*.

.

'& '9A/%]9Yf t{@/).  * #    7^G/ &+   `'` ^77‚+) +-& /%KA3A ` 1 ' !   #  '( %   ! &=7!= +  =  MA                 .!%= " &= "  ( )  *  !  =.T!Qy]9T5* #%'&3^G/ / {c/7:_ jl ` [ ( .^9/%9 @f 3 -~Dc)+& ` ` *"!@ '&G*3]9T5*.! &=7!= "+ = ! &=7!= "+ =     >+  1 !  "=!  = + =    + ! &=7!= "+ =     ! &=.!= +"9= 9 :"/5^'&t+ƒ^7‚+)Y_ w (5^G&5*)]&3#%'&y `  D:*'&^G&"At!Q]9T5*q&5^'#/5^G/Ac_ /"^GA 5*)*G& Dc5*G#%K& #%'&j]97/B+-& ` !: !: !C/:A)&7/"*93^9&?!.

.

± "÷æ á  9&* `:./4G`-4%.62   4G2zY6*3U /4%U`-*)8%.p* ]K.:03cŽ8%./.6.:* [L.3S  G„  .J.6c‚`-.pY6*3Ua`:.:038%* .p8%.6cM.

6.Y6* U`-. ./X+*C4%c-0EU%8%* * M Y@* U%Y@.-038G* .?4Gc-03.ES  .6[+*M4Gc:4G3.03cå* ]K.6*#Y64G]. R„g8%.6c>]90E.-03.@./.…* c `:X+]K* c…]%.6c/Y6.:038%* .:.:2CX+U%038%*w* ]K.?]G.C[+.:./* [+.?8G..62503cMU%*  .6.:* nG[+.6XL`:*58G.….B¯9U%XLV1W3*J.@`:.-W3*p`q0E2ln @2ƒc/.?.@Ua`:.0 "= $ $ ‡ ‘ 7Š ?‘ =‘ M / *  94%2”.…Y@* 25]K* .:038%* .* 4o.@_03.6.6.Ž4%c:*C8%.`q03[>·%.6UG`:.6U`:.?Y@* U#·%.* cv`:X+]K* c…8%* 4Gc:4G3.62)SFxvW3* c/. „ 8%. 1 Jc-W3*Cn903c‚`q03U`:.®­G0E`q032C.-0w8%.BY@* 25* 4%U%Y6XL* U90C8%. 5 6 " 7 */.w8%.6.6XL`:* cM8%. R„g8%.6.`q03U`:*.@c:2C* c * .:*7U%* .:X+03.F8%.p*wc/.Ž8%.M0E[+_ 4%UGcD* ]K.DY6*325*l4G2 `:X+]K*B]%. ma4%.U%.:.…8%.ES F* U`:X+Ua4%. .6. ¯9UGX+890M]K.@c/`:.@XL`-0 Fc:.C`:X .@25]%[L*J]%.-032zX+U%Y@[+4#±L8%* c>U%*<03] #6U%8%XLY6. ­G0E`-032C.B¯9U%XL8%* cD8%05[+XLU%_ 490E_ .:.?c:.@. ¯9UGX+8%*l8G.B* ma4%./* [+.“U%* Y603]#±L`:4%[+* .603[+X103890EcY6* 2”*3c\`-X+]K* c8%*J4%c/4G3./2 0E[+2C.@Y6X+8G* c:•%“* c25.6c/. ÷  0±c:XL2)K  8 # 4%2 0p* [>·903890lUG*=±­`-.6U%8G* .:.:.*)[+X#.‚`q0>890M2C.@c   .103[LX10E8903cY6* 2Ú* c{`:X+]K* c]%.Y@[Z03c/c:.B­A.:.SLS­S F* 25*7*3cY@* U%Y@.3S * ].62s8%.Ž4%2ƒ`:X+]K*p8%*C4%c:4GE.BY6* U`-.@Y-±>¯%Y6*CU%*C03] @ # U%8%XLY6.6c.@V1W3* 0I*3n /.:.:./.:X+*GS ( TD]G.„ 8 U`-.-0EV # 6 .@c/`:.B¯9U%X+8G* c ± c/* 250 .6c/].@c:]K* c/`-0  3 S  *#Y ? # `-.….6c:250 X * .@c6S  .6U`-.6U`q0!„gc:./2 0>ma4%./.@.D.‚`-.:4G`:4%.@c/`q0Jc:.@U%8%X+2C.6U%8G./X+*Žc:.-03cv8%.6UG8%*.­S6S6S #]*#8%.6cvY6* 2C*CY6.@[+X+2CX+U%03.@.Ž]%.M.@XL`:*  E032C* c…8%.64o`:X+]K* c:.6Y10E.:4G`:4%.6c‚`q05c/.6U`:*78%.BU%W3* ./X+* Tß.92l4%[­`-XL]%[+XLY103V6W3*./.-0 ma4%.…4%250>Y6[+03c:c/..@`:X  *  2C* c/`:.6U`-.62 .Bc/* n%.pY@* 2C]* .

603[+X103.€4%250?c:*32 0Y6* 2|*B* n.:. lS ¨ 03.:0B.

6U`-03.6.6./_ 4%U`q0vm#4G.:.@`-*p8G*l4%c:493.6. c/* n%.:.  c/4%nG`:.@U%8%.]*#8%.6.-03V6W3*  UG* +  1 WX  \03]±L`-4G[+*  S X+c/`:X+U%_ ´ #S²µ 8 ! ¸º¹¬»½¼L¾¿#ÀTÁ‡Â›¹*ÃÄPÅLÆÁLǬÈÉ / ¼¾LÇÄLÄ  .@_0u„ c:.:XL*./ .P.6.6Y10E./.@Y103.?   *#Y # E 03X÷0E]%.…0lXL25]G[+./_0l8%.M4Gc-03.Fc/./.:.:038%* .M* ]K.:038%* .0pc/* n%.62C.M*p* ]K.:.6c  ¶v250v]K.

.

L¿ ! & {c/"K/ -3+dA/DU 9(  +M^) *K/ ETÃ*È .

|¾LÁ #à #¾¹J¼v1  ­A.8G*C4Gc:4G3. :ÊD4%03./`:.Ž8%.'T^)^9&U_  *'&<D:*K&5^G&"At!Q-"!@&*.ò¡í²ùuì²ÿ!ë‚û øí²ù @ÿuð @ë‚ùuébñ ëê!óôò @óôðûð TvU%8%.?DO&5*97+-*Kl ç#ò ñ!ð@ébðé 1 3 3 73 7:2.ŽY6[+03c:c/.P8%.:.62C]%[L*C]G.B¯9U%XLV1W3*C8%.6[LX+2CX+U90E.T!D "& G    ("*K&-)* 3+./X+*%S & !D TbD:*K&K/!c/"G*ƒ+-&ƒ+9& {c/"K/   -3+-&j!CA)/Dc  kT!5Dn%& G f +-&y7^ 5*G/OfyGA*G5] ^M+-&j"!:. òê3ë‚ó ðñ ò@óë:éKë ë:éýôóÿ!ýÿ!ó ðé÷ñ ë¡ì‚òù6ýóôò ²ë .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG./ËP4%.

:* _ . TD]K* c‚`-X+[+0l8%.:032503V1W3*p.@2  . ¨ .

.

 #   '   ( EÃPÈ .

#¾JÁ   '( %   '7(v. ' 7^7)+) %ÁÅV°À%ÿ  cA*'/7(:A^ Z #  . Dc*$+&{c// '( 1¾JÁ -3+)^ 'À%ÿ :'7/ ]G@T*'&5^  +-&  $& #¾JÁ  $& L. '7v / .|¾LÁ à    ^7&AUf ¹°»1¾¹°»Á TÃ1¹PÀ ) $ /)$ ( .      ! (à ' Y.  ! 1(  / À%ÿ .

#ÁJÆ#ÇJÅ#ÃJÆ9FdEÃPÈ .

|¾LÁ Ã 7A5)+) .

)T!D=& GM"G+7&ƒ*"!@ '&Gy3^! ( ( EÃPÈ . Z !   ! K& !D %y+-&ƒ+9& {c/"K/   -3+-&j!ƒ!   -A5)+)$+$'^)^9&Qk)T!D & G   U#%'&ƒ*G/3!Q9"]93)"!@&"*.

|¾LÁ Ã ( 8 $  % ) $ ( )$ / +8 22 (/ .

EÃPÈ .

|¾LÁ Ã 8@LÉ( 8L@ É/ m»#Á .EÃPÈ MF MF  ÆTÁJÅJ¿%ÆJ» Z .

. L.

L. .

(  2 '' 2 Ç LÁÅ| .

 LÁÅ| Ç   0 -A5-+) < 4 .

   &B(B+$A)/DcQk%!D=& ' v.  .

 K@€ 9 O.9( G&A)^B ' O.  &-AB+)^.  :(€ .

7( G&-A5$+dA/Dcd%!D=& ' ( EÃPÈ . Goy@€   &B(  !  :o3(€      Uk*G/y!Q9"]9.

|¾LÁ à $   5^W%!D "& '^ rÇyF ¼ ¼c. &   !: @l%r 7B&j7^7M+-&j!q( 9&-A5.+dA/Dcdk)T!D=& G 5^d( G&7A^3 EÃPÈ .

|¾LÁ Ã  Uk0T!y!  (ÃY. .

1¾LÁ  K& !D %y+-&.5*'/ ¹°»%ÅmÈ|Ç#¹¬»|  Uk*G/ +-& .

@ ƒ U.   9( EÃPÈ .

|¾LÁ ÃL11-Ã .

1ÁJÆÇLÅÃLÆFQ"ETÃ*È .

ÆTÁJÅJ¿%ÆJ»$XY.|¾LÁ #à L. &5ƒ&B(3&  K^GA%*ƒM*K&5^)Y"A-+7 Â# ÂÂj2ÇY"2 Â# ÂÂj2 I"2 Â#  " ¼ Ç   *"!@ '&GM&<!e  dA&'T ÄPÅ%À 11°¼Ã¿%ňÂ#Â32L¼@"2 !Q9!@& 2 (Â#Â32 2 ( Â#Â32 2 ( Â#Â32  T2 ÂÂ³Ç T2    $ ¼ 2 /ˆÂ#Â32 )8 -8:2 32 ˆ / Â#Â32 )8F-8:2 2 /ˆÂ#Â32 82 T2 ÂT‡ÄPÅ%À 11-Á»ÀT¾O. Z '[ \ 5]K/)+-7+&K_ /   .

.

:032503V1W3*p.'^)^G&Qk%!D=& ':€ -3+-&ƒ( G&7A^M+dA/Dcdk%!D=& 'ƒ!d9!@&y:f +)^$9( '&7A)^.:* _ ./ËP4%./`:. TD]K* c/`:X+[+0B8%. `7`-`7`-`-`7`-` &7KT*9 ` ` k"*'/) ` a ^7 -3+-& '^)^9&    +37^ 5*'/Ofz. ¨ ."*K/7+-^  jƒly( (Kf :€  ‚+)Y_ 1 TvU%8%. :ÊD4%03.@2  .6U%*p„QÌeÌe̎Sï[+2C]G`1Sï4(c:YESønG.

.

  ª  :f [ ' !  ' "#    \ %  $#&'.

€* ]K.6.P* ]K.6c…U90pc:. `7`-`-`7`-` 5'+*'& !U&"*'"7*K/  #   j cf G"*GA& $lB(  xv.6c…8%. 6#. .:038%* .  .:_ 0v8%.-0E8%* .6Y603.6XL`:*v8G.:_ 0C8%.:.P. .6.Žc:* nG.@XL`-*v8%.@c/`:.Ž* ]K.®­G.6.@25]G[+* W€ K@€""A ` Of WX * X4G`-XL[+X1038%**Y6*3U%Y6. :0…*DY@* U%Y@.:038%* .:.Ž4%c:03.6c #3l.@V1W3* U90p]G3_ XLU903«  S 3*AY># pc-0En.…* c\`-XL]* c]%038%.Ž8%. (&    å ) (  *   ( !+* (  - *.¡c:* nG./.6S ./.6Y603.

6_ 4GX+.6.62C]%[+*wma4%. ± 4Gc-0J4%2 0pn%XLn%[+XL*3`-.62”XL8 6X+0l8%.l8G. 8G.@Y10 ?‘ p4%2 AS nGX+n%[LX+*3`:.0 "   ‡ ‘  7Š 250wn%XLn%[+XL*3`-. E032C* c  .®­A. YV·903.6Y6[+03.D4%2t.@Y10B.®­ S>TÛc/.6Y10Ec\U%*JY103]  ! '  .‚`8%.9X+U`! 2%*0E`1S­S­S  p`:.6.6Y60Bc/`-03U%8903.-0   ÓU90p]G3_ XLU90 U%0Cc/. F* 2C]%[+./X+*  0 Y6[+03c:c/.6V1WE* 5 6 " 7 */. ¯9U%./U90  0pn%X+n%[LX+*3`:.®­#`-.lc:.ŽY6* 2C*pc:.   © ´ S ± TD_3* .-05.p4G2r`:X+]K* 8%*w4Gc:4G3.

62C]%[L*l0?c/. DS ' " S   /) *  * )‹* Š \Œ‘sŠ  (=Œ?‘ . A.  [LX603890J].6_ 4GX+.  lS xv*?.@[Z0 8G.

/* c6S¡. “03c2C.`-* cŽ.6S 3 0^]G.:* _ .@.@U  * [AXL8903c\]K* .Ž4%c/*5890pY@[Z03c/c:.6c:.:5<"<)=><@?A:>B:C=EDGFEB):H:I=I<":"JKHL:MH=NHL:LHLOK< PRQ.5*<4%c/4 #cDUG*5. * 4w4%c:03.  nG4%X+V A.6S+*{0E.6U`-.bdc 45476e8f:5<L<=MH=hge=F>O>Be=]<ijH5OCkLO>D[F5:l]D9=]BNge=LkFKO>B PRQ.:* _3.:XL*.…Y6./.-0E.:X„ " 03]%. T  *#Y #   L890?.:03.@c>.Ssrnt u 454A6EB)lK:IpEqvg9=LkF>O>BioH5OCF5lw?AOxlnD)FAihkKOfqyDOfqA=g pEqzge="F>O>BCH=Ml]D[F=l]B)O5< 454A6KOfq[OIpEqyge=F>O>Bh?7OLH"={:KB>qG: e=EDe:KBxO| e="FKOL<H=NHlnm7=]Be=]D[F=><CFLlw?AOK< ]k. # ' `:.:03890)8%./* [+.ŽY6* U`-.:03c…8%.6U`-.D Q.M..}":]Bdi~lfDF7im8nO5:"F iZ6LO.@`q0E[$#%.6U`-.   .Pc:4903cP]%.62C]%[L*C]G.M*54%c:* 8%.:’3]%.:X­`q03c…U%*C03] #6U%8GX+Y6.:4A`-4%.S9TLU>VW"XZY[Q]\^E_L`XLa.:X+03cPnGX+n%[LX+*3`:.:[% # ±  U%*BfÓXLU%8%*.@25]%[L*w0Cc:.@c/`-XL[+*   Y@`:./XZ0J4%2 )(3..@Ua`:.  . 3.-038%058%.@`:* .6c  xv*C.Bc/* [+XLY6XL`-0p03* 4Gc:4)(3.  B‘ƒŠ  Y@* U /4%U`:*.6c‚`-.@25* cPY6* 2C*Y6.@`:* .`-* .@Y@`-*3.62C]%[Z0E`:./.@2ƒ`-*#8903c0Ec8%X+c‚`-.@2 4%2 y%U%XLY6*)03.@U%Y6..8GX+_ X­`q0 XLU#4' . A.B0)./m#4GX  *GS¡*AY>#C]K*#8%.  Y@`:.64%U%XL8%* cM.-0 F*32t0JY6[+03c:c/. 890E8%* c*<4%c/4)(3.S"_vc † ! / !   * 1 .6c:2503c…c-WE*C8G.-0.6c…8%.6[LX+2CX+U90E.@Y@`-*3.B0E.  .PnGX+n%[LX+*3`:.8%.:. 0E.F8%.S9TLU>VW"XZY "XTE_"\5`Gc 454 =nmAl]D9l OIH5:ompLD LOZq[:l.pY6.:X+03.6U`-.D9FEBOxH=x€ oOvF5lw?AO:I<=EBIqG:KD9l?Gp‚8.:HOƒ?‚=e8fOge=FKO>B„ ^E_W …5… XTE_"\K`zYNQ.@Y10 " 4547698.6_34%X+.:0 ma4%.:.G4G2 0Y6[Z0Ec:c:.?89038%* c@S \03890CU%*% *E03[L* . 3*AY>#B.6.vyG`-XL[“8%X+c/]* UGX+n%X„ ±* 4   TÒc‚`q03U%8%03.0/BS  X+c/`:X+U%_ #S4132A' .<03Y .@.6Y60l0 E03U%V10E890pX+U%Y@[+4 X 3./X+*505.:.@[+X+2CX+U%0B`-*3`-03[+2C.@.!(B*B4%c/*l890Y6[Z0Ec:c:.C* n 4Gc-03./XZ03.62”8G.>[+XLn%.:03250l4%c-0J.@U9038%*)U%*)3  .S_ZbeaQ.@X+./X+*).@c]%038%.6c:Y@.-03250M25* c‚`-.¡`-.6c:.:Y6.-…c S Tàc/./``:.@U`q03890C.:.6_ 4%XL. Š\ /.:[ Ñ8/GU%* x    8G*  .P*B]%.:0?* c 3 0E[+* .@`-*3.6Y10Ec€8G.:.@cU%* c…Y103]L`-4G[+* c&% „  S 3.v890pn%XLn%[+XL*3`-.625032C.  ! M4%250Bn%X+nG[+X+*E`-.:.6Y@`:* .6Y10Ec L`-4G[+* <"= '& (+* 7Š  .qK? 8E= )O 4545?GB9=k"l><OxlEDKmGOKB>qG:5BMH"=./.:2506. #.

S_xWaK_"ad† ^E_W …5…fT]\]VL_7Y"Y)‡]ˆ\‰Š‹ e‰"‰‰"‰‰‰"‰KV]bG‰[TE_L`U"Œ"8"‰eX5S9TKXL``a5‰"a"‰eXKS_`aW"a5‰WLX‰Wa5W\^ . –•P4%.^.‡G† ^E_Ws…5…fT5Q S“cc~WaK_"ad† '  1”/ TvU%8%.:032503V1W3*p. .2 ‡LYLY)^E_W …5… >X S"WU† ^E_W …5…fT]\]VL_7Y"Y)‡]ˆ\‰Ž5ˆK9‘)Q.@2  .:* _ . .b9‰\‰WaLW\)‰Ar]‡YY  2.( ( !* Q. 0* TD]K* c‚`-X+[+0l8%.6U%*p„3-—-—-ŽSï[+2C]G`1Sï4 D4%03./`:.SL"V ()‰V]bG‰[TE_L`U"Œ"W"‰eX5S9TKXL``a5‰"a"‰eXKS_`aW"a5‰WLX‰Wa5W\^ .Q 8XdrnteY"Yh‡t7….2 ‡LYLY)^E_W …5… >X S"WU† ^E_W …5…fT]\]VL_7Y"Y)‡]ˆ\‰"aT‰"‰‰"‰‰‰"‰KV]bG‰[TE_L`U"Œ"W"‰eX5S9TKXL``a5‰"a"‰eXKS_`aW"a5‰WLX‰Wa5W\^ . (c:YESønG.2 ‡LYLY)^E_W …5… >X S"WU† WL\ u ^E_Ws…5…fT]\]VL_‚YYN‡]’"S 5S_L`"X)‰[TK\.

.

 .

  .

   !" # $%.

TQ.^ &' a)5T 4“rfWa5_"a[tR†  ( ** .   ^E_Ws…5….lKH: Q  rK^E_Ws…5….- #/.S 25"XK_ rnt7† 45410=h:x=]D[FEB):H": m[O>B{g [8.S 2 "\L\5W3rntt 454 9HlklLO>De:I:5OmRlED:[8oH5OIg9=F>O>BNgNOMO"| )=F>OvHL:FK: fp"<":>DHLOMOjq FKOLHLO~?Gp<} 9|L:k32 ‚„  2 V[. & # '(%)+*.TQ.

 .

rnb t7† _ /srntZt ^E_Ws…5….TKU5r XaK`s2 X.=>:]B iFE.b _ /srntZt ^E_Ws…5….T>\KV_vYYI‡K’S98"`9Qfb9X)Q]`\L‰9X"ULX]b9X5S"_\‰"WL\‰ " XK_\K` L$ ‰G‡~YY  2 L`"\>S_ XULX]b9XKS_\L‰WL\‰ " XK_"\5` L$ ‰[‡~YY  2  aT.4 rftIYYI^E_W …5… XKS"W"U† 454 9 OK<eF.pe= =EB:IOhg)=LF]O]B i~:n?7: 9:>DeHOvF>OLHLOK<vO><CO| )="F5O5<{:5B]qR: )=]D):"HO5< „  Q  2.^Q78X rft“† Q5ŒLŒ)t ^E_Ws…5….T"Q.S 2 \L\5W3rnttR† 454[ kL=><L<":o?A:KBeF5=]<yH5OIge=F>OKBxp"<":]DHOZq FKOH"O5<meBO]D9FN=N|K:"k72 ^E_Ws…5….q[:hq F>OHLOyk)8.T>\KV_vYY ‡]‹"‰ "XK_"\5`)‰"DS CL\"‰X^]_"a‰ "9a 8)Q]\A‡~YYI^E_W …5… XKS"W"U† .S"_vQ $ <“†ƒQ5Y  2.T>\KV_vYY ‡]‹"‰ "XK_"\5`)‰"SDCL\"‰X^]_"a‰ "a98)Q]\A‡~YYI^E_W …5… XKS"W"U† 45476E}:.T>\KV_vYY ‡]‹"‰ "XK_"\5`)‰)X^E_"a‰ "9a 8)Q>\A‡oYYZ^E_"W …5…fX>S"W"U† XU"^KX ^E_Ws…5….  (  9QKU5X r>^E_"W …5….T>\KV_vYY ‡]‹"‰ "XK_"\5`)‰)X^E_"a‰ "a98)Q>\A‡oYYZ^E_"W …5…fX>S"W"U† XU"^KX ^E_Ws…5….T]\]VL_RYYe‡ =.‡oYY Q"YY‡5>$R‡Y"Y = Q?>IY)YA@‰B@† 6 ! rft)YYZ‡]’S:eU5_9Qnb[\"‰‰L‰ ^E_Ws…5…fT]\]VL_7Y"Ye^E_Ws…5…nXKS"W"U† Q r  2 X.B:MOZge="F>O>B \K` rKQ.

%  .

 .

qG:KD)HOL< H"=ED9F.= 1”/YXDZ7W \[–•XD[ D] DVDW TvU   (K=. „ N L ) } e l .=A„ N })le8.qG:KD)H"O5< e: [= 9="kEpGFK:KB /` 6U 3-—-—-ŽSï[_^C]G`1S`X p„ RW (c:YESøn K] c/`:X+[_Z"VD[0*aW\] _3W\Z7^&Z3V1W7][b^ TD]  .BOxH5OC|e8fO"k5O@?“=e8fO~qR=.DO5< ge= ‚„ v<=pelEBi@g9=>Belnm7lkL:~:v=E?GBe=K<< ONH=. ^E_Ws…5…. l  D „ e L O L O H  A ? > :  B N : 9 g =]B9lnm7lk5:5B<=h:x=]D[F]B:H": L?M " < N O L H 5 O v < n O “ ? > =  B  : " H K O 9 B > = < 5 H “ O 5 „ .D9F. LRLRL9LRL9LRLRLLRLLL9LLRLL9LLL9L9L9LL9LLLRLL9LL9L9L9LLL9LL N })le8. 8 { = =ZH=jm[O>B L?M  2( *  m[O"lMk5O5BBe=FK:G„ ( *  ED9k"l5:IH=xk5O.L H5OTS U NL}ele8.=v= 9="kEp[F5:~:N<)=9EEp O On?“=]B):H"OKB{H=Mk5O>DGFEB)OG8E=hH5O“„5„.= /Q OPO ?“=]B):H"OKB{H=Mk5O>DGFEB)OG8E=hH5O „L„L„.=>:]B3i L?M <"ONHLO5<hq "F5OHOL<-J ?[p"<5} e|5:"k523i " < N O  H Z = ) < > F # H ? J J K L k .?RBe=><"<+"O*KQ kLO.S 25"XK_3rnt‚† `"X5_5V`5SG<‚† 6 41H I O>g9lLH:"H=KJ L9LL9LLL9LL L?M <"ONH5OCk5OKD[F5:lED[=]BIg9=LkF>O>B „ <l =Aih= q]?‚F$ ihk)8.BOxH5ONL})l98.TQ.

.

    .

P  .

    +   ! # ($%.

!( !  ! * m[O>S B LlED9l"klL:G8El :k5:OKQIF5=><)F5= QlED9k>Be=fqA=EDGFKO „L„]: LOMOEp k5O.D9F.?GB9=><"< Ojm[O>B{S g9=]B)H:"H=l>B:~g):"lx= 9="kEpGFK:KB:N<)=E]p ]D9klL: H=xk5O.D}: I O ?7:K<L<"O  i <=Il €  N=9 <eF>HJ?J5kKO]p9FC€9€l jlM€€ƒ<eF>HJ?J5=.DHG8?Q  :h:Ig):KB9lK g9=98ƒl9ioH5OvFLlw?AOvl.D i p]q[:Be= ?“=FLl OIH={H=FL=>B]qAl]D):"H:N: LOxHl]g9=]B<:L<Zge= =><„ O ?RBOF5OkLOG8.BA8 5Hx=ED[k=]B"B:Z:M=]D[F]B:H":IH=H:LHLOK<„ O.D9F5=[iLB)=w?‚=FL=NO><o?A:5<L<"OK< “i  i !“„ p):]DHLOM:x=.:I: ?  <{O NL})le8E=R„   On?“=]B):H"OKBNH=xk5O>DGFEB)OG8E= m[O>BJ O  LRLRL9LRL9LRLRLLL9LL9L9L9LLL9LL9L9L9LLL9LL9L    q k5O.OIH=opEq kLO.D9FZl *9QIl €  9Q~l * <eF>HJ?J5kKO]p9FC€9€l €9€~l{€€@<)F>HJ?JK=.O/J m[O>B j ( l. ?RBe=><"<+" O .qR:>D)H"O m[O>B ZH5:~m[OKBEq[:J M  .qR:>DeHO m[O>B hp[Fl98]l :"HO?7:>B:NBe=L:G8El :5BZpEq 8fOO ?‚l.DH[8?Q ( l 7* „ I O ?7:K<L<"O !diZlED[k]Be=fqA=]D[FK:Il .qR:>DeHO5<MH"=.l.qG:>DeHOL<Z:v= [=kEpGFK:5B“„L„ U  9=nq5?s8.BA8  C=ED[k=]B"B:Z:M=]D[F]B:H":IH=H:LHLOK<„ O[:"k Ep q k F. & # '(%)+*.( l €  * m[O>Bhm9:98 <:iZ=]D9k=>BB):~Om[O>B„ 0:JKHL:J L9LLL9LL K:>DeHKBe=nq7=]Bek]p"B9l5O):]B)FK= L I I --  z„w49:R„]O]p[F pEq k F.= Q„ O |><)=>BLg[=:@?GB9=><)=]D ":IH=?AO>D9F>OM=hg9J>B p‚8.D9Fk5OfqyOZg):[8fO>B:[„ I O ?7:K<L<"O GiZlED[lklL:G8]l  I O ?7:K<L<"O i@g9=>Belnm7lkL:o<=Nlz€  9„  =k]p[F5:~: 8.- #/.   =]KD EEpe:>DGFKOh:x= . :/ "JN= q{m)Be=.BOvH5ONH5O U/NL})l98.

B)=xkKOfqyO{HL:LHLO.BA8 5Hx=ED[k=]B"B:Z:M=]D[F]B:H":IH=H:LHLOK<„ / O I O 0  ! ""D[D[F.Gl.(*aJ  "D[F.( a* J  ")D[BeF.DLp xpEq k F.($*aJ =xkKOfqyO{HL:LHLO.F.B)B)=x kKOfqyO{HL:LHLO.lnq7B)=x kKOfqyO{HL:LHLO.( * J =l>BOM=[8E=fqA=EDGFKOZH5Oge=F>OKB  8]F5l q[O [= 8E=fqA=EDGFKOZH5Oge=F>OKB   g   ~g     Ng        ge=FKO>BMD LOv=]<)F>:g: )lKO ge=FKO>B =]<)F>:Ig: )lKO O O  Hf4  • [b) ^ 1#X ^&] c ['R[b^5]G[_] c VD[<Yb]3^ ] VD[@Y6[_Z7W Z7WVD[9U%X_W [ XGc Z7W ] c5`:X+]K] cJ]TZ7VDW 9[@c VD[ .

 XD^ `-XL] ] VR] ]DW\] _7W Z7^&Z7VD]3W [w`-XL] ]3c"VD[9U%X_VR] c [ ^ n%X+nG[+X_]E` [6Y Z3c [ '#` [bW:UTZ3cY ]3^ ] Z " Sd/ # XD^&Z W\[#X+c Z5VTZoUD] c ['9[ C ^ ]%[_ ] c[ 3[ \Z?m XD[Z  ]3W\^&Z>Y ]3^ ]Žc\[VD[6Y@[ Z7W\Zc\[VD[9UD[[c [(XGc Z ] c ` W #@c `-X+]K] caVD[] n [` ] c Z ^&[@c\^&ZGS  1”/YXDZ7W \[–•XD[ D] DVDW TvU /` 6U 3-—-—-ŽSï[_^C]G`1S`X p„ RW (c:YESøn  K] c‚`-X+[_Z VD[0*aW\] _3W\Z7^&Z3V1W7][b^ TD]  .

.

 9%Y R%  % a!$%    .

  (  "   /. *  ' #      WX $ .

.

-?Z / ] !RW\].14< 2a^= W\]>$Z?6@ [b^ XD^&Z-?Z5W Z'3A.+:9 [4 ]'1)6aZ.12$bX#_VDZ7VD]/3TZ VD[4$)5_Z7W Z'&)(7]#6 VD[%3#.-3W\Z7^&Z7VD]3W&Z0 ]3^&Z7W&^ Z'.+DX8 ]'1 [ ^ 4 ]VD].+DW .&7(7] [ X81\] VD]'1 ].\W . &) G  "= ? @ @     "!# %$' Z &)(7]  ]7*W  [ ].

_Z ^&Z' ]3W)VD[CBXR[ ]D$4E9V8"-3]3%(7] Z !DW\[41\[)3A ZD!DW\]'+#5_[b^ Z'146F! ]'"1G$ ]7^ H .1 Z7WV W\Z'+TZ'5 T # Z7WO$b]3^W3:SD^ [ W ].0 P   1 Q  1 1 .U.3A\W Z7W ^&Z'"1 Z'$4"5 ^&[43:\[ ]'1[bW\W .-3W\Z7^&Z8<    *K  ML MLNOP . ] 1VD]2!RW\].5 Z7VD]7WJ!K]9VD[ [43#$ ].(7] VD[YX.U>< D[bV$w#DZ7WMBXDZ'3DVD]C!DW\[4$).3 Q 2]T>^ Z %.&7(7]  ]3WI ['6-]$ ]3^C!#.     /.1MBXR[T. Z  "!# %$Z.-.

Z.%.%'[ ZHZ.-.3 ^` "!K] VD] X#1 ) X (7W  ]#6 3 ] X XD^a.\?< \[ [ X#1 Z5WX83#1 D[ V_< .

.! ] VD[XR^ b Z +#.1VTZ^ [ 1\^&Z  3 ) ] W\^&ZcB XD[ XD^R.+#5" ]' 4[ $Z [ '> [bW 3TZ86-[41* Z5W 1\[ WX#1\Z7VD].

! ]d!DZ7VDW..

(5] R V [ .

1 Z7WO\W Z'+DZ'5$#TZ5WO$ ]3^R3>SR^&[bW\].3#."3#-3XDZ'-3[ ^ . ] 38-VD]3# X +#5 [ V#_W [4 Z5^&[43:\[G!TZ7W\Z !RW\].1 1 Z5WYXD^ ].+:9 [4 ] VD]C "!Kd ] 5_.!.\X#5_]CT3]>$)o Z'!DW [)3DVR[ XpB XD[ Zq5.-3W\Z7^&Z'1[ ^ Z'1 1 [ ^c+#5 [ W4< V QfeVg  "!    [)1I [d$Z.1hlTX8 XDZ'3A [)14<&/Y[)1I Z  ]3W ^ Z !K]9VD[Xm1 [!TZ. c<  Q V \[ X#3#1*"-.1*1\X#Z +>\[)1VD[h$ ]3^C!DW  ^&[43A ]#6 ['DZi Z7^ )[ 3A [(Z'1*1 _^jBXR[(]!DW ]?$b[)1 1\Z7VD]3W [ '8[A\ \W Z'+DZ'5$#TZ $ ]7^k3XR^&[bW\].1MB XD[T'(5] VR[ Q  V (H+ [b^ VD[%3# VD]#6F1\[ !DXRVD[ W E K]5_].VD]7X#+#5_[V!K].3R[ V$w#TZ7WMB XTZ'3DVD]C!DW [)$).3A ].1([ ^k!K].

Z'5^ Z7^ [)3A [!DW ]' ]' "!TZ5VTZ8<Jr!DW\[43DVD[bX Z2$ W _Z7W [ # X 1\Z7WXD^ ].+>9 [s ] !TZ7VRW.

(7] VD[ .

] 1).3:)68lT]?Zi <]r!DW\[43DVD[bX Z $ W _Z7W].+:9 [4 ]'1(VD] X#1 X)(7W*_] [ Z X#1!(iXm5 ]. ] +>9 [s ].1G!TZ5VDW![)1)VD[ . Wtu.1VTZ ^ )[ 1 ^&]  ]7W\^&q Z B XD[ .

_]'\[)$ Z'1 ['> [ *W 3T' Z 146v$b]3^&c ] T7)[ $s ]3WVTC Z w  <  n DVDW*x”/YXDZ7W*\[–•XD[)3D]dX3-—-—-<y5_^C!87<`X(z1 r3 # RW $. c<  Z7^c+ ^ Z'!DW [)3DVD[bX Z X#1\Z7W)].1* "5_Z"VD[0*aW\].-3W\Z7^&Z'&7(7][b^}| .+>9 [s ].<{+  K].1)VR[d+#"+#5.

J! .

V .1I.% Z DVDW*x”/YXDZ7W*\[–•XD[)3D]dX3-—-—-<y5_^C!87<`X(z1 r3 ?  RW $.<{+ 9  # c%)  %Y'%  K].

"5_Z VD[0*aW\].-3W\Z7^&Z'&7(7][b^}| .

J! .

  .

_]'\[)$ Zc!TZ7VDW (7] VD[| c<    "! $#%!'& H L /.3# %$Z[)1 !DZ'& ] !TZ7W\Z 3D]3^ [)14< . #3#_W[)X81  & )( +* -. n MP  Z7WXR^R3TZ7^ [)1*!TZ'$b['< ]3^ ] X#1 Z5W ][)1 D ! Z'& ] VD[ |  10 ]3^ ] ]p!DW*E.     [41*\[G$Z'!^ X#5 ]Z'!DW [)1 [)3A ZiX 1\[ ]dB XD['68$ ]3^ ]VD[ 3R]3^&[41VTd Z +#"+#5.!DW  ] 3D]3^ [ V# '6]1*"-.

3A Z 1 [ f X !DW\]'-3W Z7^&Z X?.XTZ'3RVD] T3]>$)o ^ ].

5^T3[bW([41* [!DW ].pLFGNMOFt5=r7TEUMwVYXSdZ=:AFB \ GZ6FDAyx^H87ZHRDWh ].+#5 [ & ^ Z8< w  }| ~ {z '€ € )( ‚€$ '€+& e „ƒ †ƒ … €‡ ˆ* %(  ?‰ €$ ‹ŠŒ Œ =PL Ž ‡ P MP  H  L *Z5W ZX#1 Z5W .$Z'& 9[41 VR[q3D]3^ [)146 "1I ] x'6XR^ ].:=?> @<=:ACBA8D<EF=8GIHKJLFGNMPORQF6KJS7TEUMWVYX67ZHF4[VYX ]\ G^6_D56C`Z=CDFM^H87a=S7Z6bM<=bDc6 7<H^EF=bDedKH5.1* Z. Z'3DVD]+#"+85"_].+:9 [4  ] VD[ #3#_VD] [b^ XD^&Z VT' Z 1M+#"+85"_].5_X#$4_]._]'\[)$ Z'1!TZ7W Z(W\[)1 ."11 [[41* [41 3D]3^ [)1!K[ WI [)38$ [ W [ ^ Zr+#"+#5.T3[bVD]3W [)1VD[)1I Z'1+#"+#5. | 53 45687:9<._' ] \)[ $ ' Z 1- [ '> [bW 3TZ'146.1n1 .+:9 [4 ] VD[%3#_VR]C!K]3WOT7]?$4o'< 2. [)$ ' Z 1 [ '> [bW 3TZ.:=bDgfK6GR7cdK6C`<=bDWh iZHKJjHekCl:mcnNop`K6876KJq`KH^JrLFG:MORQF6KJ?h s^6KJq`KHgL^=bDF7ZH  =gAR=q7:9PEF. [)$ ' Z 1O!K]9VR[Y [ W] ^ [)1\^ ] 3D]3^ [)D V [ XD^ ].!K]#6%"1I ] x>1  MP N   O   H DW\[4$)"1 ] "3#$45_X# WZc!TZ'5_Z7T9W\Zc1*\V[ Zc1 [)-3X# W ]].1[ X#3#& 9[41)< g 3TZ7^ [)1*!TZ'$b[T7[) ]C!DZ7W ZW\[41\].+>9 [s ].!K[ W Z5VD]3W VD[ xG! ‘:‘8’ HFD5HpGJFHFDpGN7ZHpLRGNMOCt5=pf5HIJq`:fgdZ=:AFBGJFH J8`:fW>N>“M=y7Z6F”FG:MACH5=V•X—– ‘:‘8’ HFD5HpGJFHFDpGN7=qvZnN6C`Z= J8`:fW>N>“M=y7Z6N˜bvZnN6C`Z=™– ‘:‘8’ HFD5HAyxZH87ZHFDgGR7ZH_LFGNMPOCt5=pf5HuJ8`:fAN=y7e9ZHFD5š87Z6F`:D^=:J J8`:fW>N>“M=y7Z6FLFG:MACH5=VYJq`:fW>N>›M<=y7Z65˜bv^nN6R`Z=5X—– n  Z'1M5".% Z ?Z .+#5 [ ^&ZVDZ(VDX#!85""$ Z'&7(5](VD[ 3D]3^ [)1 !K]9VD[ 1 [ W$b]3^C!#5_['R]86.!K]. ] 38l%^ .-3[)3#1 VR[$4E9V8"-3]r9!( Z'!DW [)1 [)3A Z7VDZ'1(X81 Z7^ ]."5.5_X#&)(7] VD[ [)1 $b].T3]>$)oO!RW\[)$4"1\Z7W _Zr$ ]'3: Z'$4 Z7W]'1BVD[)1 [)3AT3]'5. ] 5.3DZ7W-]r!DW ].T7[ W ]'1h$b.] 1 ]. ] 146T]3X W\[43D]3^ [Z7WV1 [ X#1].+>9 [s ].1V1I Z'3DVDZ7W*VD[| W [)1 ].FHRf^=bDeM^t5=uJCHbvZ6 \ G^H5.1c! ]VD[b^]>$ ]7W\W\[bW R V X#!#5".

 ..™– 2.%K%  Z  yE M:`e4 – J8`:fW>N> AN=qG:` c6bM:`:D56AR=q7c4„> w– J8`:fW>N> A5EUM p4 – J8`:fW>N> A5EUM h 56F`[VYX—– J8`:fW>N> AN=qG:` e4 j4 IJq`:f‚>N> 6bM5fZ.

((   .

 .

0/ ..    ! "" $#  )+*-. Xm1 .

1*"3#- 3=148 *B/ | .6. 3A .RHFD5H \ G^6pdKH^E GJCHRDI=:Jg=qv^n:6C`Z=:JuJq`KHCM5f5HFDR`cf56 GPJ:EUM gM^H87<6KJy9^HKAF6IJ8`:f[– EyM:`e4 – AN=qG:` c6CM:`:D56IAR=y7I4„> w– A5EUM p4 – A5EUM h 56F`[VYX—– AN=qG:` e4 j4 e6bM5f^.6* * "1* * 1E3 B x'6 / . 6 "36C.T> .:=?> ‘:‘ sK6KAR. T MP  .T *Q. 3AT * /  8R1 ON ..7. 1* ( * . *9/ 1* . .5" 2143 +61'1*>1C$ * 5 * $?143@1 1 *  %&' +>9 .* . 3 6 .T.T * 1 . 1I .6*U.6. 6 !=143>1D>1'5 < 53 45687:9<.* 1VB /6. $)5A143>1.<. 1 .6. 9X1 * * 3=148 !63 *  E'. – '€ !'& & )( +* GFIHIH -#  J  ! J"@" $# J  LK M P+*-.* 1)<WV .. 5148 . 1*!=1'$ .$) *D. .6* 1h$4E * 143*B /   L %&'@  L L . 8 1 *:.6. 1 . 73 . 3 . $4E ".6.. 3 . '( . $)5S1E3>1'&)( 5..&7( '( 143* 1 .  * 1 1I51'3 * .

. Ÿ "1I. "$?1. / 73 ¢ / 8 ..6. "3 . 1 !61'$ .xž-. 81 1 .3 . 3>1'5]!6143>1 < * Y[Z]\=^>_6^a`Sbc\d egf4hRi5jlkfnm5ipoqrhRi5oTf4hRi5jlkfnm5i s tut=v i5mxwyf4zLf|{E}]i5j~ni[f4€z‚€ƒ2„-lq]j…ihR†x‡q2~nq]j ˆ‰k=qUe<qrhRi5Š z5ixlqrz‚e<q…o[qrhRiŒ‹‚„ne{Žnq‘+kf4zL’4hRix€z>q]j@“]Š ” tut=v iŒ•We=–eg~nq…hR†xlq2~nq]j[~niT„nhegf4hRi5jlkfnm5i z5ixlqrz‚e<q…o[qrhRi5o—f4hRi5jlkfnm5i2˜–˜yoqrhRiŒ‹‚„-e{Žnq™škf4zL’4hRixˆz>q]j@“ s›–›–›œ” Š . 9X1C361 5.6*!/ 3 8 * 8 .6..T.! . 82!#5 *B."1I51'V .

< . 1*!=1'$ . < ¤u¤6¥¦§2¨u©(ª]«­¬¯®c§2°c±E²g±E²=³n«J§G´-µ-¶E²6³n«·´r¨¸²¶]¨­§4µ?©+¶¹-§ º¼»½g¾I¿4À6Á-ÂûEÄÅrÆIÇÂIȏÉÊ ¤u¤¼Ë-ÌEÍ=§nÎ4«'¦JϚª]«-Ì|¶ª »]½nÆ'ÐÑGÒ+Ó ¤u¤­¹rÔ=±u¶%´r¨Õ̍ª?«-¹|«Ö²=¶]¨­§4µ]©­¶¹-§'¹|«?¨¸«'²6«?¨¼§×Îu§EµÎu§ ½=ÈrÉgÂ=ÅrØ=È6¾|Â'Æ-ÂÅrÆ- ٠¾4Ä4½gÅrÆÚ»]½nÆ'зÑ%Û+Ó Ä6»EÁÝnǍ»]½nÆßÞ]à­Ó Ü r3 .W£p. 3 * XWâãâãâ<y5A8C!87< / z z1 $.T/ .<{+3 J! * 1I.3#- [8<^Z .T/ 1X1'3 1 *¡.. 1 !=1'$ .[á(/6./ ..*¡.6*U/ 8W3=148 8W3=1E8 . Ÿ 3#"3 38"&7( *U. 3*x £p/ 143* .

"5A1 .) 3 *  -|3X148¡1'&7( *….6. 8}| .

 .

 O O    .

 .

 * 1 *  +#1 .:=?> ‘:‘ K=y7:9=qM5f^=jM^Hb7Z6KJy9^H^AC6KJ MZH87Z6KJy9ZHKAC6. . 8}| .R/ . 8 * $)oG! *-.* .>  ÐÖÃ6Ã'ÅrÆnÁ2 Â4½-Á¿Ó Ã6ÃÆ-ÂÅEÆ-Â/0Ö  Ã6Ã'ÅrÆnÁ2 Â4½Á-¿Ó ÅrÆnÁ Ã6à ÅrÆnÁ Ã6à -1 ¤ 2 « 3g±I³n¶-³§g¬ n«J§G´-µ-«J³n§²=¶¨c§|µ?©­¶6¹n§ ®c§2°c±E²g± < 4 ¶'5|³I¶+¬ 6766676 8 ¶4²³|ԍ§792¨­§Eԍ¹E´-Ôg±u«. Z   ½=ÈrÉgÂ=ÅrØ=È6¾|Â'Æ-ÂÅrÆ- ٠·ÑÓ »]½nÆ   I«%¨¶±² ¤u¤°6´n² »]½nÆ'ɍÈ6»½ßÞ?à Ù ]¾4Ä|ÀnÆ ÅrÆnÁ]¾4Ä|ÀnÆ ÅrÆnÁ]  ¾4Ä|ÀnÆ ¤u¤=´-µ¶¦JϚª]«-Ì|¶ª ?Â4½-Á-¿Ó ¤u¤=´-µ¶¦×³u« ̍ª?«-¹|«·²¶]¨­§4µ?©+¶¹-§ Ã6ÃÆ-ÂÅEÆ-Â>Ð×Ã6ÃÅEÆnÁ2Â4½-Á-¿Ó Ã6ÃÆ-ÂÅEÆ-ÂxÆ-Â6ÅrÆ-Â×  ÃÃ'ÅrÆnÁ2Â|½-Á-¿Ó ÅrÆnÁ Ã6à РÃ6ÃÅrÆ-Á xÝIÇg»]½nÆ(Þ2à+Ó +Ó Æ-ÂÅEÆ- Ç-ÂuÆuÀnÇu½  n«'³u¶°6´I² I«"!ԍ±²gÎJ³u«'²¶]¨­§4µ?©+¶¹-§Îu§EµÎu§  ÝIǍ»]½nÆ Þ?à ¤u¤c³6§2°c±E²g± Ä6»EÁÆÂÅrÆ-Â Ü Ù ]¾4Ä|ÀnÆ ]¾4Ä|ÀnÆ ÅrÆnÁ]  ¾4Ä|ÀnÆ ÅrÆnÁ]  ¾4Ä|ÀnÆ  #%$n½'&IÀn½)(%*nÄ+-ØnǍ»]½nÆ. 1x 8 H $ * 82! * 3 .6. & )( * "1 LN MP *|/ 8¡1'"1O36148 53 45687:9<.6.5EUvQP. 1 !61'& *Q. 3*T .:4¶‚©=< 6 !gË-Ë'>|µ¶4²³n«:?7?A@)BDC‚¤<¶ECE«4´gÎ | F G I«©<Ô=±²gÎJ³u«J²=¶]¨­§4µ]©­¶¹-§ °6´n² G < F 1?¤ +>9 . g B /6.+-ÁIÄ'+½6ÈEÉgÂ6ÅEØ6È=¾|Â-#&ÃÍÅrÆnÁ2Â4½-Á¿šÓ ¤u¤¦×³u«J²=¶¨c§4µ]©­¶6¹n§ Ð Ã6ÃÅrÆ-Á?  Â4½-Á-¿Ó ¤u¤¦JϪ?«-Ì|¶ª Ã=Ã.

&)( * Š€+& (]€ †€ JMON 3  3 * .$ .6. 8C!#5 * < F r3 .<{+3 J! * 1* "5A1 . 3 dT>"1I51 3=1d1 .Tá 38"&7( * . .U. .. 1*$ * ! * . 8}| 1 .‚ž-.R[hNhNhTS?– 8 / JI K< L V * 1 . 3*x £p/ 143* . 1HT?.6* L < 8< ON .$ . .) 3 *  -|3X148¡1'&7( *….+#"5. 1 .6*‘.6. 14<V .[á(/6. 3 * XWâãâãâ<y5A8C!87< / z z1 $. Ÿ . 1 !=1. 1 $ * ! 1'! o)3 <b * . 9X1 *U.1 .

KEUv ?– h:hNh S?– ‡ ( -.KEUEv P – GPJ:EUM gM^H87<6KJy9^HKAF6c.Z   MZH87Z6KJy9ZHKAC6.5EUv R[hNhNhTS?– MZH87Z6KJy9ZHKAC6p7TEUM:x^H5.5EUv R GPJ:EUM gM^H87<6KJy9^HKAF6c.

š.

W —Q O ·  .

 .

-# .

6..6. Ÿ 38A3 *B/ / Q Q . 1   & —( *  LN . 1 !=1'$ . 3A>3 *¡.6.xŸ 3# . MP 3=1E8 $?1 . +>9 . -# JM  ML  3#& MLNOP . 1'1 )š*n. X 1 .* 1 *U.6*  1.  *¡.6.6. 1 *  .

3AX3 .-*/0-*1.('*).( * T>"1LC. 1XC < 3545687:9<.5"! 3#$?1 / 1 .6.:=?> ‘ fEqD56C`EqdKHpGJ:EUM J8fN`‚>N> AR=8G:`w– fK6FL<EUM^6 \ GZ6cJC6CGg95DZ= ND5H87<Hpd^H^EGPJCHFD=g=qvZnN6C`Z=uJq`:fW>:> AR=qG:` 6u= 7<6KJU7=r9<=bf56JC6RDAyxZH87ZHFf^=pf<E8D56C`KH87<6bM:`K6 ENJq`Z= AN=qG:` :4 w– R‘ ‘N‘ f<EqD56C`PEydKH GPJ:EUM J8fR`‚>:> AR=qG:`W– AN=qG:` F7Z6bMPJCH 5687 w–  -# E#  J(    -# J( 143 B 8 Q ^T * 1 1* .T . $ *|/ / 7<   |# $21'+ . .<.+. &?1. "1 3=1E8 . 1 !=1'$ . 5""3!=1 .7.

2435)671.

>=@?<. 1'1OTE143* 7T 1 .T. 1*1>143 . * ./ 8W3 ) 143X1U1. 3 .$ .>=@?. 3IT .—.  M Q .6. $23 A143 8R1 "3H. 1X8 8 1 .A2n * 1T143 B / '7)+D-E/F-E1 2435)6*1 893G)<. +81 .. T .3#A8 / Q M 1 .$ .893:)<.. 3*x .  g Q £p/ * 3=1E8 B /6. 1 !=1. 1 $ * ! * * 8 36148 .6.

3. 1 3# .3 . "1 8W3=148 / .1V3 1 * 143 B / ^T * 1 #:<y$)!8! < .$ . .I .1h$ 3  .xŸ .6. / I I9KIL -|3>1. 8 8W1 .T. .6. 1*!=1'$ . ! 3#& / 1U1'! 1 . 3=1.—/ * 1'1 . 1>1 .6. . 1 !=1. / ^T * 1B#:<C! .—.

1 / z * 1. < .5EUv iTEUMNx^H K. 8W$ * 8 z1 $. 1*1>143GTE143* 7T .6* !6143>1 -|3 / * 3 . 3 *n.7. 1 .6.T*…* ! . !63 .<{+3 3# . 6 / 1>1 Xm1 . 1 1>1E3 1i>3 . &s< MZH87Z6KJy9ZHKAC6R[hNh:h S z 2. 1 * .. 8R36148  M Q !=1E3>1 * JI J . 5 .…* 8¡1 $45S1'1*1 .  "5. / MZH87Z6KJy9ZHKAC6. 3X1 .6. . 1 !=1'$ . $)5S1..6* 3 3 . 1hB /6. 3A5148 8W3 . 8W$ * z . / z / 1 * / XWâãâãâ<y5A8C!87< / . 3A>3 *‘. 3M$23 A1 .T/ 3X8¡148 3#$ .1 1 .U/ 83=148 . *…/ .—/ . 3#&< !=1E3>1U1'$ . Ÿ  * 1 / 8 1'1 1 / 3A * J! 1I. .3#78 8R3=1E8 / * !=143>1 .H. X 1 .$ . "1 3X8¡1.5EUv Cd^6FDZJCH5= F4 [– H z )š*n. 1*!=1'$ . 5 / &7( * t ..6* 1 . 8 H !=143X1‘1.1 / .6. < 1 . 143* . . *B. ?1 .+ ! 8 * $45S1'1*1 .6.6. Q r3 t$#:<%! &J3 * ! 1 . 1 !=1'$ . 1rB /6.[á(/6.

"5A1 <ONm1* * x.6. 8}| 1 .6%!=143>1B3 .) 3 *  -|3X148¡1'&7( *…. / 3#73V-|3 / ! * 8< * .

  .

$21'!6C^ / ! 1 * TE148 5 * * !63 * . ) VY78 £ . 3A>3 * / 3 5 * $21'!6C^ / * $)5A1'1 1 . 1 .

JM   !63 ^T41i .$'6#!3 *  .Q. 3* Ÿ 73 / 5z B /6.E' "! !6143>1 * +#5". V .2. 9X1B1d1 .  . * !63 * . $4 .

.E.

X3 "+  jx$f4€ mˆ‰k=qUe<qrhRi5Š m5qrejx(€‰k=qUe<qrhRi5Š h…„- fuƒ2wAiˆ‰k=qUe<qrhRi5Š 4qrwyf4ˆ–wAi€‰k=qBe<qrhRi5Š &% tut tut tut tut tut f4ˆz‚€ƒ2„n‡q]j…i5jx 4€ m5q]j (~ni < f4€z‚€ƒ2„-lq]j m5qrh tut –e=w –e<iTˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š ]–zx€„f4wcˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š tut '   '  (  '   ' $# )  +*  )   hR†xlq2~nq]j › › m5qrejx j]iL{Žnq › hR†x‡q2~nq]j[i5jx 4€ m5q]j j]iL{Žnq hR†x‡q2~nq]j –e=w –e<i j]iL{Žnq tut '.- ]–zx€„f4wcˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“ › hR†x‡q2~nq]j e<qrzxhUf4Aj j]iL{Žnq tut tut jx$f4€ mˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š * › 4qrwyf4€–wAi j]iL{Žnq †xlq2~nq]j › › f4ˆz‚€ƒ2„n‡q]jh…„n fuƒ2wAi j]iL{Žnq ˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“Rm5qrejxŠ Nl8C! › mxwyfrj5j]i j]iL{Žnq f4€z‚€ƒ2„-lq]j…m5qrejx j]iL{Žnq ˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š ”   ]Š hR†xlq2~nq]j tut ]–z‚€„6f4Aj j]iL{Žnq hR†x‡q2~nq]j › › ]–z‚€„6f4Ajãkg„nz>q]j j]iL{Žnq Z \?<  Š 3*>1'3A ."! 0H B /6. &V3 t *BŸ 3=1'5 . xNB /6. $45S143X148 1VT .T. *  z . .6.‚ž . 1 .:=?> ‘:‘1020202002020202002020202002020202002020201020202010202020102020 l53RM5fK6RD56KAN= h“x .6* 1 1 . 3 * ZGB /6. 3*T . .T*  * 1 H  / / 8 * tut ˆz‚€ƒ2„n‡q]j tut 8R1d$45S1'1*1 . < 3545687:9<. 1L8 8 . 1d!63 . $)5A143>1B1d$)5A1'1 1 .* 1)< 1 1.‘. 3A 43* * "3 * 3X8¡1'3 * !=143X1 €‡‡ (]€ (  V $ * 8 1c$)5A1'1 1 . 8Cx4 *-. 3A51 .6.‘. 1 .6.6* +#5 * $ * B /6. &)( 5S143 !6143>1 1  1 .6. 3#&?1 .6. /.2/ . 6 1 .* . 6 * +#1 . 1'!63 ..

Z .6*¯.* *             !  " $# .U /  * 1 5S1 .

6. 3 . 3 * 1 . 1 $)5S1. 3A . Ÿ *  .X3 "+  5A148 1U8Cx4 *-.* 1 * . $)5S1E3>1'&)( * 3#73 1. 1*1 * < n .>3*"+ *W… s  * 1 TE1'F1 .6* 14< . . L *B.  s 1@8Cx4 *n.6. 8Cx4 *-. f4ˆz‚€ƒ2„n‡q]jD~niDq4ƒ ?ix‡q j]iL{Žnq 1'$ .1 1 .—.6* 8R1 $)5A1'1 1 . 1C. 3A *…. 1 <M| 1 1@1.6* .X3 "+ .6.. < . 1* .2/ .T/ 1.6.* 1>1E3p1'1h!=1'5A17T-3X1'1M$ !=17T . PPMP ¼o[qrhRi ˆ‰k=qUe<qrhRi5Š .[. / /   . 1 *U/ Y[Z]\=^>_6^a`Sbc\d mxwyfrj5j  * 1 12$ * 3A>3 * 5 .

/ . .6.X3 "+ *  ˆ*W… . 3>1'5 "1* . 8 1 38 . 3#$21'!#1 /   x—1 ..! 3  * 146 / . ..6. *9/ 8 .6* * 1)< 3L8R1. 3#$?1'!81 / 1U1.. $45S143X143 N *R* 1 . z 8Cx4 *-.

Z  ' c — .

W('.

 .

W  Ú- p     G.

(-.

 .

x   "   .

 E .

6 EUMAR. . * ã # 8 0 & *n.+. .™* 12&X3%! (6/ & 1. 51 . 8 .41 358 . /=143X14>6 *—. '&5143 * . 3%!<. #3#%! .6* #!"'. . 1 # . 1=# . D. . * ML 3 . # . -.6* # . / !"'& . #%# / . 3!"-#H&51'& . . 8 .  # H 3! !$Kz 4 # )(+* & -. . /-#   -#-" > -#  -# L 1E3>1 ) 1…1 .qGKf56 KJq`:D<EyM AN.28:9—/ # .xž !"#H& . /3 * & . 1E . S148 / .6* .—.412B&>1C .. .& . B& * # / 3%C .6.. 3 .8-T #%!$C)-! Ÿ .2.O& . '& * #?. .21/-# / S148 . # 8 5 -6 P /6. 1R1 5 / 1 5 /. '& *D.‘. 1 1 NP * L.41P& .6. 1 . . 35= . !"# 8 @A. #76 *—. * 1 .OS1#3# . C)! . B& . * 3X3 . # . ! Ÿ . .+!"#LC$. C / A! 3 5 / 12 . 3 .21/-# / S148 .FHKJNJlN3RMKf56FD56KAN= R ‘:1‘ 020202002020202002020202002020202002020201020202010202020102020 `:D<EUv5G:`Z= 9:GNv<.5ERA?> EyM:`_M:GR7Z6FD^= – J8`:D<EUM uDFGZH?– ‘:‘1020202002020202002020202002020202002020201020202010202020102020 i C`Z=bf<=:J EyM:` 56C`RMNGR7<6FD^=VYX– J8`:D<EUM :6F`:DFG^H V•X—– S –  '* ( —!'… &  ‡— € ˆ& ŠŒ Œ !  '€  €  )(ˆ* *  € j  *)€ JM | H"!$# %! '& '& 10 2& #3.—.6*…/ / 43 * < 3L8R1 * .6. * -. * 21 . .6*Q* . 8Q# / 1#.6*U/ &7!$"! 2143/ /-( "!$. & *U.4*—. 6 / 33!$E. # . R S. /63%!<. * 1B1N# .n3>1#.6.8 6 ' ?VXW . . . !$& *…. 1.6. .LK 1#/61S1>.?143 / 8F/63 *2G C43>148¡1 . .6. '& *—.T. 12& . #M/ /-( "!". #%> # 1 .21Y/63 * & . * <. & .?1/-# / S1E8 . #3# . 5 / 1 .8 V . .OS1#3# .6* # . 8 . .™. 8 *n. !"# )(+*L. '.6. -. . ?V+`_. L * MP 1 * *D. /63 *2G ) 1E3>1IA * . !=1>.^S12#%# 6 0 & :T 3# !"C)D! Ÿ .+!"#LC$.?1 5 /. 3 * . .. -. ./ * 8 *  z 2.8 ! 8J/. 1 .

.* # . 1. p # 12-!".‚ž . JM z 8 . & /6. . . # .^!S12 .^!$j! . 1g.9Ÿ .^A143 .28 .6* '&51E3 *‘. . 6 ) 143>1Q1 * / /6. . b/ 1 . 12&>33! (6/ & * # .?143 * !78[/=12.6. . 8 . %# #>1 . D. * 3 # # + . / .6. / /-( $!". 1 1 *n. # . 3E/=143H& .6. 3D1 E/ 1 .6* # 8 9·/ # *U. '&7! Ÿ . & D * . 3aT # \ / Œ3%! . 33 * # . ! ŒC".6* # .U. X / 3 * & .^A1#%# . 3 €12. 8 8 # 8 *-8 /6. .^S12#%# 1 .OS143 . C)! . .  .* 1P&>3>1>.?1/-# / S1E8 . /63%!<.1. *  *-.6* . B& * . 5 /3 * & .J/ €1 *n. . M.9.6* * . * 8 *  / 3%!$.2. 33 / * 8[Z]\ z .E12& .6* # *n.^S12#%# . .š.xž-. #­8 0 & * z C.E1 . 8 0 & # *n.. 3 €1 # *n. # 8 H& =143 . #—8 0 & # . '&51 . t€8 0 & *-. !$.6* .dc & 8 z 8 *‘*|/ 6 *-. 3%!$..& . 1-421# * .6* # . #3.^S12#%# . 33#>1#b. 0 # .6* #M/ *n. < ! & 12&>33! (6/ & * #h/63 * & . # . 3 * . z .6* #!$'& . 8i# . # . 31 . * 8 * /De ( "!$. b.^A143>1E3n.6. C)! .‘. 3 / #X1 . . 3 .6*!. U!$B& 1 . & ..6. 8J/. D.. 1# .O& *U.6. 8 # * . z Š…  k! lh^lm  "  K )š*n. )(B*L. .6.6. ! ž-. 3# #>1 * .*-8YZ+\ .* #O1/63 . 3H . 1f!"'& .6.9.E1 .6* # . # .U.^! .6* 2.  .^S12#%# .OS1#3# 1 .

'&>3 *¡.OS1#3# .FHKJNJ  R pHqsr tvu>wXuOxzy|{v}~3€Pwbx~H{ƒ‚„uw…~%x†H{}tu^xj€Xun†H‡„ˆP‰Štv‹XŒuŽ%X @b .6.!61 N . . 8( 3 @=/ * #H&7!"A1 .6. #to. 0 3 D£p/ 3& 143 . 8 K  ..:=?> AN.  ‘ * G âãâãâ z 8 A8J/D& 8 / o#%.[á(/6.^S12#%# . # 1 . # & 8 3545687:9<.) 3 * C|3X148¡14>6 *….

 .

W(š.

W      c —.

6* M 8Ú8 ) 143X1 8 #O8 * # .O / !73=1 . & * & 8 00/ * )(+*L. <! & *B. * B  &. X# 8 * /=143X1 * # 8 0 & *-. * . 3%!A1 / 8R1 .TP  . * D. # .6* . / -! .. 1 z #/ 2& z # # . ' * @ . 8  * # / K %3 ! .6.  .6* !"-. 3 . # . .2/ 1 .FHKJNJR^EUM:` [– S – ‘N‘ AR. 8 * 3X8¡1 V . # & 8 9 #@12&X3%! (/ & * # 5 /6. Ÿ -!$ .6. .6* J 9 8 . . !$# *|/!*)(B*L..—. .6* # 8 . .* # 8 0 z 8¡1 M  1 / . L8 ( .OS1#3# . . ¡1 # . A1 # „z * /z ! .6* 6 / 3* | C 3>148¡1 * .=0—/ 8 . 8 . 8 .^S12#%# 8¡1 .^S12#%# .*¯. 8¡1 # *-. 12&>33! (6/ & *  # t`. . #76 * 1 5 /6. . !"-O.6* #. . .6.6*B/ 8  * . * J .^S12#%# . # 5 /6. & * .^S12#%# . *-. . . 3# &>1 .:0!/ 8 8 / 9 # 21 &X3%! (6/ & * # 5 /. /6* =1 .E143%! H….OS143X1 .T. €1 0 & *n.  yE M:`e4w– AN. z b. 3 .g/ #>1 # Pš*n. s. . .6*B. e . ‘. L6 *)(+*L.6. .  &5124>6 *U. & * # &3 . / 8 . 8 # t /  4< . *  *L/ '& *U.FHKJNJF6eHCMPEUMNx^HRf5H S – l  ‡ l   ("s  *‚…  k K JMON  I.^S12#%# ..OS1#3# ..T/ L6 / * 8 /63 ) * (  Q # . .6* / 88 0 & *n.

5& 1#.¡P .6. / 2& 3! (6/ & * 8 8Ú1 >3 / . 33! * 3  . B& * # . =1 )(+*L. <! & * # 8 * .. S1 / . * 1 !$B& . . 8 . # 3 . # 8 * z 1 *9. [ 8 /. . 3 8 * 8 / 8 * # . * 7& !$/ *-8 * 3X8¡1 . . . =1 #3!A8J/.OS143X14>6 *9.FHKJNJC6u6FfEqLRA:ER= nNHbM^65.+0—/ 8&7!"/ * . 1$! ?1E3&5143 5 . €1 3X8¡1 '& .O! * =1E8 8 . 3 .  1 #3# * ^ . & !"'& 8 8 1 8 / &7!$/ * . *U.6.:=?> GN7ZHcAN.xž-. *  .‘/ &5148¡1. . / . 3 .6. . . . #  . €1421U12#%# * ^. . 3%!"4^6 .^A1#%# .* 2. .T. -6 * / *n. 1 . $! & * O # 3 . # .2143ã1#n. *  . 3 .6*9* *-.OS1#3# .RH 9<=bDR`KH 5hNh 6gHKJNJ:E7c9<=CDgf<ECHbM:`K6[h 7 8¡1 . . . .6.  #M/=143>1…3 . 33! * 3 8 . # 1‘.6.T/ # *U. # .6.^A1#%# .   !=143%!A1 .6*  # 8 5 /6. n # &7!$/ .6* 3 . '  &5143 3 . / #.6* *9. !A3 .OS1#3# . # .233!S143 # /  1 #1. 63 . 3 / /=143>1 @ 8 @='& .6*9Ÿ =12 .OS1#3# 8¡1I#3X & 3%!"DC)#  N! . ! . 3 . -C .6. '&7! .6.* 1 '& . 81 / #%.6. N.6*B/ # / H433! *-8  * .OS1#3# . 1 8 / @ 3 * 8R1 * z * . 3 -!"4^6 t . !A14 .^A1#%# 8R1 MZ-* $.xŸ * . . 1 . *  L* / '& *B.6. '&%! Ÿ . 12!"# 8 3545687:9<. /6.6./ & .8 8 * M . # # * $.6.6* 1 . @ 5 / 1 5 /. * '& .

.  . 8 . .^/D/ & 8  ‘ * G âãâãâ z 8 A8J/D& 8 / o#%. *-.^!A1"! ?1 .^A1#%# ./ . #3# * 1 * 143 5 / <! . 8J/63 .  ! *B.^!S12#& . !A8J/. tˆ143 5 / !$. .^!A1"! ?143 . z (+*L.6* '& . * # 8 ! & .^A1#%# .  9 8$8 @b  3 D£p/ 8Ú8 3 . 8 *|/ 8 8¡1 3 & . * 8 .6. . L6 * * 3n . & *!. %# #HE3%! *D8  M z 1.OS1#3# .6. 8 !"D!". # . .* 3 .6. * 8 ! & = . *B. 21 &>33! (6/ & * n # .6* . 421"! 3& 143 . 8Q# ..…/ 8 2. 3 . 3# & .6* 7& !$/ . Ÿ t$# 3 . # .6* # 89 M # !$-!".OS1#3# . 1‘.6* . !$#3& *J02. 8 .O!S1$! G . 812.6. #/63 0„Gl. * 8 12&X3%! (/ & * # . *  #H&>3 / & * /. / * !"# 5 /6.412 * 3 . 8¡1 M ?1 . p # 1P&>3%! (6/ & * # 8   Z-. 0 /.2/  *  ^D. B& . 0 & * . 8 / #X1‘1Y. 8( 3 @=/ * #3&%!"A1 . '& # \ / *n.Q* .6.) 3 * C|3X148¡14>6 *…. & @ . . !$#s=1Y.?1 (g. # . # . 3 * . . 8¡1#=# * 8 . 8 K  .^A1#%# . '&514^6 * t # 8 .O/ .]!$#XC<.6. & . * D  #3& /=143>1N!"D!".6.?1E3Ž. &7!"$! 21 / 8 / * . 7! 3 * # .[á(/6. .B* !=1 * 143 5 / !$. * * 8 .xŸ -! . 3 ( %3 !$Cu12& * 3%!S1E8 .

  K 0   / c —.

1  . # K=8 .‘P . . 3H.6* . . 3& 143 5 .   . !=148¡1 . . * .  C.23 . 1 9s( # .?1/-# / D 8R12&X3%! . #%. 0 3 D£p/ /. .

# . * &7!"/ *-8  @b . #3&>1 .6. . * 8 .@.OS143X14>6 * / * 3 5 /6. 1‘. 8 .^A143>124>6 *U.6* #& 5 /6..6* 1U. / * 3D3X1  . . * #3& / 8R1 G # . . .. #%/=124 *B.4*|/ 1!" . #3& *|/Q.89 ! . .41 .OS1#3# . 8 / 8  * .?12# . . 3H. * &7!"/ *p. #Mtˆ1P&>3%! (6/ & * # . 1 ..…K S12#%# ..^A1#%# .6.p. &51'& *-.6. 0 / 8¡1 . 8 \ 3%!A1 ' .. . 8 0 & *n. L6 * 3 .—/ 8  * . Ÿ  .^A143>12 .xŸ -!" .* / # / H43%! *-.xŸ -!$4>6 * / * 3 5 /6. '&>3 . 1k# .2. !$-#3&X3 / 4< . !=1E8R143 .6. 0 / 8¡1 .6. *  *L/ B& *—.xŸ  .. * . # !-!"#H& \ 33!".6*U/ 8 .. 3%!A1 .6. .6.

W(š.

1# / -4< . 1.  ‘ * G . 3% . 8  . S1 /63 * .6. \-./ = .6.xž-. 3%! .W   8 .  . ( ! ( "! * & . . 1 2. * *)(+*L.6. . . K . . /6. * $. z *t &[3 .* 8¡12&>33! 5 /6. # 3 . B. 8[/. tD& / *n. B. 8 z 8C *t & 1 tD& C :# 0 # f 8 Z-. & 8 * * / 5 . 3 . U. 8 K # . !$&>143‘/ * 3 .21 # . . . u1 * z 8 A8J/D& 8 / o#%.+! .6. # . #%# . 1 !=1E8R1 . * $. & * . ˆz @=/ * #H&7!"A1 .) 3 * / / 2C 1 8¡1 .6.6. . . 1# C|3X148¡14>6 *…. . "! C * # # . 1 & * 3%=143 / )(+*L.+! . 8( * 3 8 .[á(/6.xž 1 âãâãâ & .

  .

    †.

.   . !$& .

* 8 *n. * /3 * C|3X148¡1 .6.6. # . '&>3 * .D/ 8Õ12&X3%! (/ & *  * 3X8¡1 .E/ 8 &%!"/ *—. .8GM 8 12&X3%! (6/ & * / *n. t *4/Q.6. 1 .6. Ÿ {‡k Yƒ†!‡—€  l„  # 12&X3%! (/ & * # #76 * . .. 1 . & *-. !=1>. 2. S143X143 # 1P&>3%! (6/ & * 1 # .6.28 / &51 ( . * & . * HP&7!" . ! Ÿ .!*)(+*L.D/ 8Õ12&X3%! (6/ & *U.8  K * 8 8 . * -#3& .8 $!"-C Y[Z]\=^>_6^a`Sbc\d  mxwyfrj5j s tut ¼o[qrhRi ˆz‚€ƒ2„n‡q]j ˆ‰k=qUe<qrhRi5Š jx$f4€ mˆ‰k=qUe<qrhRi tut tut Š ” Š ˆ‰k=q  M | M &%!"/ * )  ¼oqrhRi2˜–˜Ae<qrhRi Š › tut ! f4€z‚€ƒ2„-lq]j…m5qrh › i5jx 4ˆ m5q]j j]iL{Žnq › › f4ˆz‚€ƒ2„n‡q]j…m5qrhh…„- fuƒ2wAi j]iL{Žnq tut 4qrwyf4ˆ–wAi€‰k=qBe<qrhRi5Š f4€z‚€ƒ2„-lq]jD~ni…mxwyfrj5j]i f4€z‚€ƒ2„-lq]j…m5qrejx j]iL{Žnq tut h…„- fuƒ2wAiˆ‰k=qUe<qrhRi5Š              $#   tut m5qrejx(€‰k=qUe<qrhRi5Š .^S1E3>14^6 *¡. .. 8 .xž & . 3%=1 . # .?143 * … %h  s    . A1#%# .ã/ 8¡1 ( ! ( $! * & . . 1#1/=1S1>.…* . [ # .—. '&51 G # . 1 9 … / 1C .T. Ÿ -! . '5& 1 G # .6. Ÿ D! .6. 12&>33! (6/ & * n # . ^.6* .6* # . Ÿ D! .6.  !73—12&X3%! (/ & * # 8 9 5 /6.n3>12#1.^A1#%# . . 1[# . . ?.6.  M  *!.6. O. * #%6 * 21 &X3%! (/ & * # . * 8 * 1 Z-PO¢ 8 @= / 3 . #3&0HP&7!". *  #H& . 3 / 8 &%!"/ * /63 0Gl. 1/6C<& / * 1/63 . 8 / &>1 ( . C / !73 * /3 * & \ &7!$/ * /=143X1 ..6* / . * 8 * ™€‡‡Y(]€ ("s  h ˆ*‚…   /63 * & \ &%!"/ * /=143X1 . * H2&7!$ .. #3& ..6.OS1#3# .p. # .=.6* 3 *|/B/ 8 &%!"/ *—.

f4ˆz‚€ƒ2„n‡q]jD~niDq4ƒ ?ix‡q j]iL{Žnq › 4qrwyf4€–wAi j]iL{Žnq ( ~niŒ•We=Œ{ŽnqU~niDf4€z‚€ƒ2„-lq!i5jx 4€ m5q .

?1 . ..6. * .^A143>1 . 8 .—.xž-. & * . 8 1E3>1‘2 . 2"C 1 / .6. J / !73n!" / #3&>3X1…1 .6* *B/ # *U. '&>3 . * 8 # .*…. C ‘. * 3545687:9<.OS1#3# 1 / *¡. * '&>3 #.T*)(+*L. & *N0T/ 812&X3%! (/ & #3&51P&7!".:=?> EyM:`e4w– 8 /. ! Ÿ .* 3 .6.^A1#%# 1  I J. &%!"/ .—* *¡.‡k Yƒ†!‡—€1 h$€+ƒ z ‡—€ 8Ú12> & 33! (6/ & *….21 G # *….*  . 33!S143 / 8Ú12&>33! (6/ & *….* ‘ 1 #. ! ..6.^A143>124>6 *…. .6* 8 2& %! (6/ & D * 8 1 X3 D#O12&>33! (6/ & * # 8 *n.6.6.. C 9·.T*)(+*L.*U.

     …   O  .

J c —6.

S.

E   x .

FHKJNJ R 9:GNv<.KEF=8`K6KAFHj9ZHFfND5t5=cJq`<.5ERA?> ‘:‘ EUM:` rGN7u`Ey9<=S9ZHFfND5t5=pf56 EyM:`AN=qM:`KHFfZ=bD[– ‘:‘ L^.:=?> EUMAR.qGKf56 CdK6KAq`<=bD AN.qGKf56 ^EF=:Jq`5D56NH87 EUMAR.N=gHbM5`K6FD<EF=CD jGR7c`EU9<=jf^=r95D^= :D5H87ZHFfZ=bD l:3RM5f56FDK6KAR=e6bM5fK6FD56KAR= – ‘:‘ Jq`:D<EyM GR7c`EU9=f56RL<EUMPEqfZ=_6b7 KJ8`:D<EUM J8`:D<EUM gM<=q7Z6?– ‘:‘ ˜j`PEU9<=dK6KAq`Z=CD jGR7u`EU9<=pf5HjvPEUv<.N=FHF` jGR7u`EU9<=9^HFf:D5t5=pf56 LZ.  7 3545687:9<.qGKf56 KJq`:D<EyM EUMAR.R6 d:f[V ^X—– S – ‘:‘ sK6bM:`5D^=pf56r7<H^EUM A8D<EbHu6rGPJCHGN7=qvZnN6C`Z=pf^=`EU9<= d<=5Eqfp7ZH^EUMwV•X R gvW– vh 4 wh P)– vh“M<=y7Z6 Kn5=FH5= w– vh›d:f .N=FHC`c4[– ‘:‘ ˜j`PEU9<=lN3RM5f56RD56KAR=_L^=KESf56RL<EUMPEqfZ=rM=p6F4K687:9<. d^6KAq`Z=bD pf^=qGNv<.

 .

Wh ?– AN=qG:` Rv h 4 jv h 4 pvh“M<=y7Z6 v h“M<=q7Z6?– AN=qG:` _vh›d:f .

3 . . 8 3 .  M .6. & ZnPO¢ -9·( J t 3 & * I9( '(& n9·@ * =1 .*…/ (+*L. 3H.21 *B* & * . >148 /. * 89Ž( # . 1 \ %3 !A1 8 \ 33 !S1 8 . 8 .?1 / *…Ÿ .6.  3X1 8 . . 3  J  . & J * ( 61B8 . 8 * & . . * . * B  &>1 / E3 *Bá * t P =1…8 . rv h›d5f [– S H.  Rt .6* ž .   !"C / !"C / 3>1 . &%!"/ #  ="  -#-"  -"  GFIHIH  &FnHIH   -# · E# -#" -#  J %" %%  %& % 9Ž( # . 3  =1 ./ o. &7!"/ # # H %!  .   8 * . 5 # #&%!"/ #/ # K  o!"'&  P& .* &%!"/ 1 =* *…Ÿ 8 * )(+*L. & *U. 8 * K* 8 . O.

8 K  .6* 3& .]! . Ž  ‡{‡*‚€ k  2& 3! (6/ & * # .‡k Yƒ†!‡—€1 h$*‚…  K !"#3& ..6. 3 . * # .6* =1. âãâãâ C.0/ 8¡1U. & * 8 . & . 0 8Y9 *(+*L.  ‘ * G * . &%!$. & * # 12&>33! (6/ & * # . * . A1#%# .6* 3 D£p/ 143 C. .. 0 !"# 7& !"/ * #  *0*)(+*L.6.  1 . ^.OS1#3# .0 143X8¡1 . * C|3X148¡14>6 *….!*)(+*L.. =1 . ž 1E3X8¡1 @b .6/ 1 .) 3 * t .* #B12&X3%! (6/ & * # .6. = .U*  . <! .^A1#%# . '&>3 *9.6. &%!$. to.[á(/6. & $!  . . 8( 3 @=/ * #H&7!"A1 .6. 1 >3 z 8 A8J/D& 8 / o#%.

     …   O  .

J c —6.

S.

E   x .

& 2& %! (/ & * # .  .[á(/6. 1 . M.6.* . . 2& 3! (6/ & * # 1 >3 /6. C 9·. 8 A8J/D& 8 / o#%. . 3 * @b .  ‘ * G  .p.) 3 * C|3X148¡14>6 *…. 8 * # 12&>33! (6/ & *  /614C"# 0 143L8R1 .6* 7& !"/ *.6* K A1#%# -!$.6. . 3* b @ /  * # . * . 8( 3 \ 33 !S1 5  . /=12!"# . 0 / * #%#3! ( !$"!$&>143 1P> & 3%! (6/ & *[. J !73n!" / #3&>3X1…1 / .qGKf56 NlN3RMKf56FD56KAN=?h“x AN. * & 1'& *Q* 5 12&>33! (6/ & * #3&H2&7!$. & * # 8 . & *™/ o#%.qGNM=:J EyM:`_M:GR7Z6FD^= . 8¡1# *(+*L. # @=/ * #3&%!"A1 .qGNM<=5J– ‘:‘ `:D<EyvNG:`Z=_f56c=qv^n:6C`Z= f^=`EU9<=lN3RMKf56FD56KAN= 1AR=y7uM<=y7Z6e6bM5fK6FD56KAR= l:3RM5f56FDK6KAR=e6bM5fK6FD56KAR= – ‘:‘ `:D<EyvNG:`Z=_f56IAR. .^A1#%# . .6.OS1#3# . 8 \ 3%!S1[/=143>1 * # *)(B*L. O.2148J/E& . . 3 #  8 / .* ‘ 1 #. 1 . . 3H. & *B* =1B8 * zo#%. 33. * # & 8 3545687:9<.B/ #  / 8 .FHKJNJl :MTEydK6FDZJ5Eqf5HFf56 R 9:GNv<. t .M# . w– 9Ž( # . 5 * 1E61  !"C / 3X1  8 Y.21 Ÿ /  / 8 . . 8 9Ž( # .?1‘1!8 . * / 2 1 . 8 * N. âãâãâ )(+*L. 1 ' -# V .6* =1J. 33#%! . @= /  3 .OS1#3# 1 .  7 # 21 &>33! (6/ & * # ..6* ..6*  * 8 . !=1>. '& *[. Ÿ D!"4>6 P& %! (6/ & * # 1 >3 *U.6* # 8 .* # 3X1 * . # * / * 3& *n. & *¡/ -!".:=bD[– J8`:D<EUM el5MPEydK6FD<J:Eqf5HFfK6[>N>“9^HZERJ :D5H^J:EF. . ˆz 1 * 3L8R1 . 1 /=1A1>.^A143>124>6 1 *…. z  !"C z C.6.:=?> J8`KHC`ERAcEUM5`AR=8M:`KHFf^=CD[– 8 /. * 8[/=1E33&7!$"!=1 . .OS1#3#  . * ? # /63 . w– d<=5Eqf_7ZH^EUMWVYX R ‘:‘ RD<EbHgf^=KERJ_=8v^nN6C`Z=5JfZ=r`Ey9<=rl :MPEydK6RDZJ:Eqf5HRf56 l :MPEydK6RDZJ:Eqf5HRf56gG5LZJ:A GNMPENACH87:9W–  5 G  7     7 7  E -#@ -# -#  % F * S ™z ‘:‘ `EU9<=M<=q7Z6 K. X8 .:=?> EUMAR. & * # / o#%. #H&0H2&%!". =  1 . K* 8 * .T. 33. 0 3 D£p/ 3& 143 .6* / . . /6. 3 . 5 / 1'& *¡*R*)(+*L.23%!A1 * (+*L. * 8 *™Ÿ . * ? * * 8 . .6. . 8 / . 4 *D.?148J/ / * . .-3X1 . #H&0H2&%!". @= /  3 . . C / ! . 81 X3  !<. 5 .. / 3>1  8 : .6.6. & *  #3&51P&7!".xž-. 3 * z . !"#>1E8#  uF . 8 K  . 3%!A143   ) 1E3>1 1P&>3%! 6 ( / & *-8 .6* 3545687:9<.5ERA?> ‘:‘ `:D<EyvNG:`Z=_f56c=qv^n:6C`Z= f^=`EU9<=cEUM:` AR=q7eM<=q7Z6pMNGR7Z6FDZ= . Ÿ -!"4^6 * 8  %  !". 1 G # . * 8J/=143H&7!" !=148 .^A1#%# .6.FH^JNJC6 V Jq`KHF`ERA:X f^=`EU9=eJq`5D<EUM AR=q7eM<=q7Z6p9^H^ERJ J8`KHC`ERAuJq`5D<EUM g9^H^ENJ – S – J8`:D<EUM el 5MPEydK6FD<J:Eqf5HFfK6[>N>“9^HZERJ :D5H^J:EF.2148J/ 8N9Ž( # .6* # * #  # . * # 8 1 . .6.xŸ -! . * # .FH^JNJC6[>N>›M<=y7Z6 `:D<EUvNG5`Z= _dKH5.6.OS1#3# .TP M .6.6* "! # *(+L* .

3 / ..   %  '.?1dL6 * / * .  ‘.6..6* ( . . * P1 &>3%! (6/ & * * 3 .I* 3 .T. 1‘. * s # / .=*B* / .  * 8 .^S12#%# . # 3 * #H&0H2&%!".. . 3X1 . # *n.6* 3 . * # . . * B  & *n.^A1#%# . 8 z Z-.6.OS1#3# . #3&H2&7!$. .28 #O8 *B. 8 #>1 -# / / ( $!".. 8 #H&0H2&%!". # * . * *[. $!A8J!"=143 .^A1#%# 8R1 M . # 0T. * . 8 ( 3 * # .

'& . 33=148 . *T. . .E143%! H….6* /63 * C|3X148R1 8 8  M # *U/ #s/=143X1.6*  * (+*L.6. )(+*L.* 8 * B&X3 . # 1!8 .‡k Yƒ†!‡—€1 *‚€ l ‡ MON .6. & * # .7.6. L8R1 & .6*T. $! #nC) *)(  1 !"# 8 *U. %# #X1 * .—.:=?> J8`:D<EUM g9^HZERJ pl:MPEqdK6FDZJ:E8f5HFf56[>:>“9^H^ERJ™–  O¯ãpE   .T..6*…. 3ã1 t .6*  *…Ÿ =1 .B* . 8 / # .‚ž  . & . & *[.6. B&X3 #3&X3 / C . * 8J/=1433&%!" !=143 12&>33! (6/ & * # . X8 4^6 / * *-. * / # .* 3545687:9<.28(á  1 #3&>11/=1#3#>143 12&X3%! (/ & *-8 . #3&0HP&7!". #%. *U. Ÿ D! .

 .

* -#H&51'& . .O/ ( .6. 8¡1 3545687:9<. 9 ) * (+*L.6. &7!$. 3>1 .6* = / 143X1 .6* 8¡1!$## .P/.?–    O  O 7 >L I I & # . * D  #3& 0 * 33 . 3 12$& . 3O8 0 & 8×8 *. 3—1.*-8 2.:=?> AN.FHKJNJlRi^HF`Rx R ‘:‘ `:D<EyvNG:`Z=e6KJ8`KoC`ERAN=_6IAR=qMPJq`KHbM:`^6 ]f^=S`PEU9<=pL^.MPERA5EbH5.E1!?/ *n. 1P&>3%! (6/ & * # .…/ 8 # L6 * . 8 3 * # . . 3%!A1 *-. & *‘/ 8 12&X3%! (6/ & * 5 /.412! / *-. # .6* =1s/63%!78 . *!. * -#H&b/ *n. #%#X143 . 3%!S124>6 *‘. * -#H>& 3 / & * 3 .6* *n.g6uAN=qMJq`KHCM:`K6 ]f^=`EU9=uEUM5` AN=y7eM=y7Z6j7ZHF4 ‘:‘ 9^6FDR`^6bMAC6cH5=e=qv^n:6C`Z= M^t5=r9<=bfK6cJC6RDj7:GKf5HFf^= AN=qMJq`aEUM:`_7ZHF4w– ‘:‘ . * # 8 z 1P&>3%! (6/ & * . s0 .N=FHF` AN=y7eM=y7Z6p9PE ‘:‘ 9^6FDR`^6bMAC6cHcAR. 0¡/ ># 1 . .6* #H&0H2&%!". . A3X1 . / 4>6 0 & 8 *D. . * 1 .N=RHC`glNi^HC`Rx >:>“9PE Wh P )P . &%!$.6* ! . 3>1E3 . # c .6. 1‘. 3!$-!".xž-.O!S1$! ?1 .+*|/ # . 3[1$& . # 8 M 812&X3%! (/ & * .^A1#%# ..6.FHKJNJF6e6jM^t5=r9<=bfK6cJC6RDj7:GKf5HFf^= J8`KHC`ERAuAR=8MJq`uL^.6*  * #.5E KHcHC`:D<EUv:G:`Z=7ZHF4_M<=uAR=qMJ8`:DFG:`Z=CD lNi^HC`RxwV•EUM:`u9^HFD 87ZHF4<X > 7ZHF4 V 9^HFD 87<HF4<X RS – S – AN=qMJq`cL^. -6 * / *n.U. .6.  .6. 3T1 *!*(+*L. M  7 .N=FHC`e9PE – ‘:‘ `:D<EyvNG:`Z=jM<=CDC7ZH5."!$#%'& )(*+ 9*)(+*L.

.O!S1$! 21 . ^. *  #3&>1'& . J/.6* 6  1N$!".6. A1#%# .^!78R1 .233!S1 / 8 12&X3%! (/ & *[. /-!z/ 8 !$-"! . ..* 1.

& 9 1 >3 t 6/ 8¡1 ž *  #H&51'& 0 .6. 3 8 H& .[á(/6. 3X1 .6* *…. 2.^A1#%# 1 t .xŸ -! .?1 . L6 / * *n. 0 3 D£p/ 3& 143 .*  * .) 3 * C|3X148¡14>6 *n.xž-. *n.  ‘ * G âãâãâ z 8 A8J/D& 8 / o#%.6. *  #H&>3 / & * 3 N.6*¡. 3 . #L8 *‘0T. & . L6 * / .-0 !"D!"..N=RHC`glNi^HC`Rx >:>“9PE Wh P )P .6.OS1#3# 1 . (+* & -.6.^! "!/. . 3O1 . #H&512&%!". . ! Ÿ . 8( 3 @=/ * #H&7!"A1  .—. . A1 * 8 ?1 . . 8 AN=qMJq`cL^. D  . *…. 1 *…* L. 8 K p10 xk† u€2xotv{‹…tvu{v~3xzx ~3{v‚uwX~3xv† {v}ŠtvuOxj€P‡x~32H‚ub34P65… @b .P/. # <& .!61 . I. 3 .?– 2& 3! ( & / 3& -. * - .*-8 9 .& .

/ z 8R1  % +. N 2.* 8 . 1 .   @   /=12S1>. & .n3>1Y. &7!$"! 21 . * '& * 33=143!"#H& *N0—. * -#3& * 8 12X & 3%!  ( / & * .. . 8 .6. # . 8 ( . 3 8¡1h. 8 / 8 8 0 & *-. 8 / &51 ( . !=1>. / *-..^A1#%# .xŸ -!A3 * 3L8R1 .

   .

L8 8 *n. 1 . 1$& . L jT   .8`^6FD5HFf^=9<=KERJrLZ=5ESfK6KAR.F6wh d<=5Eqf .  1 #n/ 8 #8 * . #X8 * 8 & 1 ( .FHKJNJlK6KJ8`K6 R 75G:`KHbv<. /. s # . 3 * JI .‡k Yƒ†!‡—€1 *‚€+& & !‡  ƒ'…O M Zn.6.8 .‚ž.6. 3& . * …8 . 8[/D *6.. ?1 8 $C / 8 & 1 ( . / 1 . 3 nHIH 8 3L3 . 5 I& ‘.E1R1 * . . z  * …O. 3 . # # 1 # L  6 # 2$& # * 5  JI  7 O   @ . 3ã1 * &>1 ( / 8 .  .8`K6RD5H F4 V•XRAR=qMJ8`w– S ‘:‘ v^H^E84^= 687:v=bD5HuHjLFG:MOCt5=cJC6Nn:HcAR=8MJq` ‘:‘ 4 eH5.6.8 V . * 8 * . 3>1E3 * #[12&>33! (6/ & * # . *  #H& 8 . *  #H&.6. 33=12&%!$.891 / .?1#H& 8 -6 * / *n. * . * 1 *B. * 8 * / 5 3545687:9<.8 5 / >1 .:=?> AN.FHFDKHFf^=IAR=y7P= 7:G5`KHbv<.¡/ M  …   O: 7 3 * * . * 8 *™/ 8¡1™1<& .OS1#3# . 3 . 2# z -4>6 # 5 .R6EyM:`e4w– d<=5Eqf . 8 +.8`K6RD5H F4 V•XRAR=qMJ8D ` RF4 [– S?– &7!$"!  & ( .^A1#%# . 1.

.6*D. 3>1 >1 / . !61….6.10B/ ># 1 . D#3& & 8 9 z P& ‘0 / o[qrhRi wyfrj5j]iE7kf4zLf4hRix€z5q]jl“B˜ f4€zx€ƒ2„nlq V / .]( 12#3&512 .O!"#>1I# .6* *(+*L.^A143>1 / -4^6 * .^! 2"!2. S1  ~niŒ•We=Œ{Žnq¡~nq™m5qrejx€zx„nlqrz ‘# .6* * >3 / * Y[Z]\=^>_6^a`Sbc\d s z .* 21 .8M 2& 3! (6/ & S1 81 >3 ‰ € €1  ‡k?•ƒ†!‡—€  " *‚… k l €1 *‚€ l ‡k !‡—€ ? / Q# !"-!$. / *-. 3# / * *…. 3>1 . .n3X1.6*U* * 2& 3! (6/ & # 8 . & . * S12&%!" .*¡.6. . . [/D *B. .6. * 8 * * 3I!"#3# * . 3>1 .^A143>1 /=1E3>1 1 . 8¡1# 1 . M    lh 9 # 21 &>33! (6/ & * # )(+*L. / 2& %! (/ & 81 X3 8 1 *n. . Ÿ D!A3 * 1 /6. & *-. 143 . 3  . . 3O1<& . . * 3L8R1I!$ . #H&512& / # . 1 >3 * !$. #: . 1431 .  * / 148 . 8 * * . * P&7!" . A S1P&7!" ..6. 8 /6.* €…{‡Y…O  @ /=1A1….6. *  #H& 8 *!*‘. C * 1¡1 !73 / / ” Š /.6* /=143X11&51 .6. . 8 * . 8 . 143 /. .6. 3%# * #ã12&X3%! (/ & * # . X8 /63 * #.^!A1"! ?14^6 8 . !"-!$. * * 1 .

FHwh ^=y7Z6 V•X™>]H V ^X vwV ^X A—V ^X RS?– S – 3&  ‘G @=/ #3&%!" C 4>6 0 8 J/D& 8 oz #%.*  f4€zx€ƒ2„nlq * N 3 . 3545687:9<. * .n/  * #%!$C)-! Ÿ . 8( &F   |# I# * F @b .:=?> AN.6* # 1P&>3%! (6/ & * # . 8 K  * .‡k Yƒ†!‡—€1 *‚€+& M ?1 &7!<. * /6. ( e­ rf4wAqrzl“ .[á(/6. 8 e--!". 3 D£p/ 143 .!* .FHKJNJ ^=q7Z6 R EyM:`cH 'v A– ‘:‘ sK6b9<=KERJpf^= M=y7Z6gf^=gAN=qMJq`:DRG:`Z=bD6_f56uJF6bGJr9^HFD5šb7Z6C`:D^=5Ju= GJR=jf56 ‘:‘ > 6eHuJF6 FGPEqD=:JpHC`:DEUvNG:`Z=5JeAN=y7 JF6bGJdKH5.^A1#%# 1 *  * —. * * âãâãâ A8 / 3 * A1 .6.?1‘/ . 8  (   6 rf4wAqrzl“ f4ˆz‚€ƒ2„n‡q *D.‚ž. 1 .) 3 * |3X148¡1 *…. 3 *  ( 3L8R1  ›–›–›–›  rf4wAqrz$“ N.N=CD56KJuJC6b9^HRD5HFf^=:Jr9<=CD_d 8D FG<.4.

2.6*-.    2.6* . U0 $! -!". 8Q. 5 /6.6. 9Ž( # .E1 * 3ã1 * 12X & 3%! (6/ & *B.* 5 /. 1 * "! -!$. 3H.^!S12"! 2143 * 1P&>3%! (6/ & *  .O!S1$! 21 .6*B.E1 * 3/=12#%#>1 . *  #H&>3 / & * 1P> & 3%! (6/ !73 * /6.6* 5 . 0 8¡1!"#3H/-! . . '&>3 3 8 / * # .

W(š.

3H.6/ # #H&7!"A1 . 5 . . 1! 3X143 @=/ 5 * / !A1 .6.WB —Qg O J . X8 * * 8 *U. #H&512&%!".RHKJNJC6 V•EUM:` NH UE M5` bvTX RgH NH –'v bv‚– S – ‘N‘ I. /. * . 1 8 # 1 #n.F6bM5`Z=  M  l  ‡ l   ("   ‡k?Yƒ !‡—€  uF I  I uF I  I I E I I I * M …   O 7 E. 8 * ( !"=1E3ã1"C 3545687:9<. X8 * I& 6143>1 z 8 A8J/D& 8 / o#%. -! . . # .T* Z @b .^! Ÿ .) 3 * C|3X148¡14>6 *…. 3 8 * /6. 8 .6. # P& %! ( & z # / 2# 8R1 / #3/ .6* 3545687:9<. K Z-. 8( L6 *n.?14< . X8 8 * . \ /-!A1 .[á(/6. * -#3X& 3 / & * 3 8 / 8R1 .T* 0 3 D£p/ 1 >3 6/ 1 >3 3& 143 6/ . . .FHF`EF.:=?> Z=y7Z6 K. -#H& . # 1 .OS1#3# .6* H I J H  9s( # . / *n.:=?> EyM:`e4w– AN=qMJq` EUM:` [– AN=qMJq`edZ=N. * 3 * * *  ‘ * G 3 * * =* 8 âãâãâ . !"#H& N * 0.F6EUM5`e4[– P& %! ( & z n.RHKJNJC6 V•EUM:` NH UE M5` bvTX™> H?V NH^X vwV bvPX RS – ‘N‘ gD5ob9TEqf^= Z=y7Z6 K. 8 K  .  -.

  .

  .

.

 .

6. .6. g. * 8 * . / * 33 .^A1#%# . #3& .6* # .6* #n * 3X8¡1!$# . '&>3 * .8 -. * .^S1E3>1 . 3 ^D. . C * 1B1 . 43 › ¼oqrhRi  ” 8! ‘. t  /. 3H. 8 / 8R1g. '"h  s   D!A3 * #O8 0 & *n. . Ÿ -! . 6 8~ 7X† ~12H‚„uw…u^x 6rHtu…w…u^xj}€XŒ}€X~ 8~ 7…ˆXŒ‰†H}ŠtvuOx3 :9  . 143%C / / 3 0$G . .- ]–zx€„f4wcˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“ › hR†x‡q2~nq]jTe<qrz‚hUf4Aj šj]iL{Žnq ˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“Rm5qrejxŠ –e=w –e<iTˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š '   '  (  '   ' $# )  +*  )   tut ˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š tut=v & p. .6.OS1#3# .6..T* #O8 0 & *-.9/ * #O143 5 8¡1 / !<. o t * #‘143 5 / !<. 8 0/1/1/1/1/1/1/1/1/1/1/1/1/1/1/1/1/2/1/2/1/1/2/1/ ¼o[qrhRi &% tut †xlq2~nq]j tut hR†xlq2~nq]j tut jx$f4€ mˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š ]–zx€„f4wcˆ‰k=qO‹‚„ne{Žnq-7kf4zL’4hRixˆz>q]jl“]Š tut › m5qrejx j]iL{Žnq › hR†x‡q2~nq]j –e=w –e<i j]iL{Žnq tut ]Š hR†xlq2~nq]j tut hR†x‡q2~nq]j   8 ]–z‚€„6f4Ajãkg„nz>q]j j]iL{Žnq 0/1/1/1/1/1/1/1/1/1/1/1/1/1/1/1/1/2/1/2/1/1/2/1/  45 Š  ¼oqrhRi › mlk|k iŒ•We=Œ{ŽnqU~ni„nhÚhR†xlq2~nqR~uf0mxwyfrj5j]i ˆ‰k=q tut › ]–z‚€„6f4Aj j]iL{Žnq tut s › hR†x‡q2~nq]j[i5jx 4€ m5q]j j]iL{Žnq '. *   #H&51'& .^!S1 .6* # .T.6. \ /-!S1 .6.-".6* # . 5 -! .T. Ÿ K* 8 ¼oqrhRi2˜–˜ ¼„ne{Žnq-7kf4zL’4hRixˆz>q]jl“ ›–›–› –hpkgwAixhRixe=$f|{ŽnqB~nqBhR†x‡q2~nq z5ix€„nzxe­$€‰k=q5“]Š ” 9Ž( # . 1 . Ÿ D!A3 . * # 8  /  ! "s  h" $#&%   M  V   ‘# .6. #3&0HP&7!". .:* ‘8 * 3X1 .6* # .OS143X143 . . # .^/-/ & c 8 . /6143 48 .6* # . / * 3:/ * '  & .6.21/6C$& / * 1/3 .:/ #>143‘8 0 & *n. 8 8¡1 /  tut s * '& * # l„ Y[Z]\=^>_6^a`Sbc\d mxwyfrj5j 8 .^! * =1T1 /61#%#X1C . Ÿ p † u  # 0 & *-. A! 3 *-8 9&/ # *.OS1#3# 1 ..OS143X143 .^S12#%# 2. .6.* # J. #76 * # # 8 . !73 / * /63 * & \ &7!"/ * /=143X1 . .^A1#%# . # .1  . )( *+. X& 3 * # / * 3 . '&51 G # . 8 . * # # .

 )  %7  .

 Q c O     :.

? ‡b  p.

 .

  .

  .

* 1 . '  & .  #/6143 .6*B*  8 * . !/.OS1#3# .6.  #:. * -#H& 4 .OS143X14>6 .2/ !$. S143X14>6 *p.^! * =1 8   !#"%$'&%(*) +%+-.6* # .. I"!$#3&51 / ‘# .E12& .^S1E3>1 *. !08'9. 1 ..6. 3 . !"D"!" . ..6* #:#76 1 % &% 1 .T* & * 3% * .$'( .  1 '& .  . 1=. Ÿ -!$4>6 * .6..  5  O -. .&31/>>6! . . X3 * # . !61….8 . 1=. C 1  2# !73. / *-.6* .6*  #  * 3X8¡1!"# . # ./ & .6.-3X1# .:<90435 ( .  # 1 . 143 5 / 0 & 8Ú8 *n.2/ 8¡1 / .O& 0 !"C / 12 8?9 1. * # .  ž-.  . 38 *-. @ . ! Ÿ ?.6. 10 *-. # . . #%# * 1 *  /633!$.?1 (g. *[. .6.  M 8 0 & 8 M #.         O. .6* . (D>0(E"'1 9E:%@F>(E"C1GH1 JI<K –   @ —–    ML.&31/>> &F R S +%+ $ 2?(#@'A#@B9.^S12#%# .?1 / 9 #:/63 * & \ &%!"/ # *  &  # 8 48 . . ! . 48 & .* *n.OS143X14>6 . + # 8 0 & *n. 0 & #8 0 & *….6.^!A1 @=#n&>143 £ . #H&51#&51E3 . .0&0132 1/465/(7! . .—.. 8¡1#+1 . 421"! * . #3&H2&7!$.6. 3L8 .* 3 n*|/ 3 * C|3X148¡14>6 1 /-ž # 8 ! & 8 !"$!S148 '& * # 0T* / . # . . /63 * & .6*  # %C 143 / 8 .  # *D. . * 8·1# /=1A1>. [!$=1 . (" 3@C( . '&>3 *D. G # to 1 8 * * .6.2/ 3 . *  *L/ '& *U. # . # / /-( "!". # .6.6* + # 8 0 & *n. # . !A3H& / 12!"# 0. 3 .

!$C * 8   !#"%$'&%(*) +%+-. ‘0 ‘ *n. * 8[/-!$S1 E =1J! .xŸ *U. 3X3X1 .6.. '&%! Ÿ 2. 1J.T/ 8Ú8 0 & % &$% 1 !A8J/. 8 ..T.6* 8 . (D>0(E"'1 . / . 0 3 D£p/ W– 2/!6@0Q 23:F1 3I uH S %F  F 3& 143 .  ( " 3@C( . !38'9E:<90465 ( .0&31?>>6! 9E:%@ P))H>0(E"'1GH1 JIK  R @b .6* #/63 * & \ &%!"/ * # 0 5 /6.* #n. >& 3 * # . # .^!$"!<&5148 * &>3X1 ( 1 ! *…. # 1. 8 0 & *-.$+< % & #N -!"4^6 .6. 14>6 *…. @ . .  ‘ * G 1  2# 8 . !=1E8R1 . 1 1 . '&514^6 * . . 1'&>1C . \-.[á(/6.6* # 8 1 3 .6. 1O. 1 . * 8Q/=143 E8 .6* .6.

& * 8 8¸8 . B&X3>1 . $!21 )(+*L.6. =1 +. &5143  (*+% &$ # A/63 * & \ &7!"/ *T.  l.6.p/ 1 .6. >3 * )(+*L.. 8 /   / . # & 8 . > !A3ã3 . *U.6. "h . & * 3%=1 / 8 *)(B*L. Ÿ D!"4>6 *-8 / & 3 * # . 1 / . & *D8 8Ú8 0 & *n.6* 7# 6 *6. & * # .6* 8 * 1 .* .T.

T* #%.-". 8( 3 @=/ * #H&7!"A1 . C 1"!?1 . *n.  =143 48 * . 3 . O( . 3 . 8 KSRTR . ‘ 1 #. $#&%s    !"h .) *….6. . G # . (g. & *  8¡1 & * 33=143O1/ .6* .. . 12#/ * 3 / . . ^. ( ( *+.6. *  *L/ '& 8 8 M  lh   # t /=143 (+*L. 3X1 / &>143 /   # / ã3 . /   M âãâãâ  8 A8J/D& 8 / #%. # . 8 * 4 . .

 %7  .

 Q c O     .

‡M .

   .

.

   .

% * *n.O! Ÿ .$B(=9.:%@ O( I  >0(E"C1G  'K .: @F.0(E"=:'(E"C!D( I  =( I  ++ QB>( .$B( . ( @B9.6* &%!"/ . ( " 6@'( . (D>0(E"C1 .:%@= 9. & 2 !6@0Q/23: >(E"C1 – [– F G% KG – F F F @ K J ?–  S 0 & 8 P+*-.:%@  ++ 02B9-1=(#I  !6@C( . ! .          9E:%@ "'1?9. !D( I  9.6* #%/ .2143 . . & .0( "7:'( "C!  9.0( Q%@ F>0(E"C1 7!-: . 3 % &$% 8 / – L'( J  %.j8 * .: G K R ++ 02B9-1=(#I  !6@C( . ( @B9. * .6.

. —–  LG 3 . & * 33 1  * 8 /  . * .%&$ )#N   . L6 h 5 *  .* .

( <@ 9. (O.$'(O9. & * 3% D * . .. .6.0(E"=:'(E"'! 8D!=. !.6.:%@= 9E:%@78 G 9. *   .31 ( G K —–   9·/ # – . ( QI'&3! > 20@ G . (O>6!#"O2 !6@C(623:'( ++ ( 9 .0(E"O2 !6@C(623:'( .! /6.0(E"O2 !6@C(623:'( . (O. ( <@ 9.:%@D'K +%+ 6@C( . *U.:%@ . . 83Q:B.0( "7$?102 1#"C!6@ 2?( 9.&31/>> &FIF R +%+ 6@C( . (#QI'&3!7'K +%+ 6@C( . 3 . 3 8 / &%!"/ * . .   !#"%$'&%(*) .$'( . ( QIB&3! .

\ /D!S1  .6.6* VF8 67+ 1jT 0 /=12#%#>1 . * & E8 . >3 * # * #3!"C)D! Ÿ . * 8 & * 3% 3 ./ 0 & *-. .21 5 88 . 1 / 8¡1s.

3 * )(+*L. 8 & * & * 3% * 8 . !"#X1U.6* * . 1& K # .6* #M/ . .  !  1 3 . 3%A! 1 .233!S143 8¡1 .. !$'& ("!  . &>3 *D8 / . !"'&. * 8 * /=143 E8 . 3>14^6 *-8  8R1!$# . 3/=1#3#>1 *-. \ /-!S1 . 8Ú3 .OS143X14>6 !$'&  to!"'&  L6 *n. 1 / '& * / * 3 5 /6. ( & !"'& . O.  / 3 .  ! / 8¡1 1<& . & *-8:K* 8 * 0 2. / !=148¡1 .

& * /=1#3#>1 .6*T*  £p. & ** 3%!$C)!"=12DL6 * # * 8¡1 .xŸ t  *4/ / * '& . . \ /-!A1 .^!A1 . 3  -!"4^6  t !"'& £p.u*T*)(+*L. 1 *+ ( *L.21 . A! 3 * 8 s. 0 & 8 /6.6. #%# A1  O-.T* &%    %  % ($  %    . \ /-!S1 . * 8 …K .

(+  %) %.

43&?6 á /6^. .4?.)# t #?681 .  + %  =W FIHIH     9 #/=143 =W – —–  S O .)#C1=6O#?1C. 8( 4 @=/I. & / 33  3 .G-6 ?# .-. 8 @b-4 0D£   /*. G âãâãâ  8 >1J/D& 8 / #%.)# & 8 9s( #?6@4H. (+* 6&. \ /D!9*B-..<-D!>4?6&.E.1=*4>6.<.+!"#H&. .6 5 /26D. (+* 6.^!9*:-.)#3&%!">*5-6KJL4?.&% 1 / *#3#.6* R R .@6O#%#?.1=6&. 476@4*$&?6@4?*4 G6^#H-6O'&.*.4.4</1=*. .4 ..@43!9*..<681 KSRTR ..& .C1 0 &. 5 /6Ž&?6@1A*.)#N+/ *..47. V V3('$3BV)5-78+ 1jT0 + *.y.. /+*#%#?*.C-. * $# 1& ]3 .)C4?*.G-. 8 1=*!"#4H/D!>-.-+*0/213*5476 684 ^D. /F.

  .

# *. F/ .^9* 4.*4^6. 6O# 8  t '*)  K"! *.('*) . -.G-6 ?# .!>-  t . *P&.*$4 .-..('*) t / *#3.H-6O'&.2* &&%  .. . 476@4*<&.+) o.       .-+* .)!>- =W 6O..1=*.5/1 V/.4?. 1 W 032(465 VXW87>T0 + 5 /26 0 /D&7!$"!@*.-.  .684.

.1C.)'&. .)! .b/*#%#?*.1C6 K >*#%#76+.9/+* 4.5. *2&?4.@.6^! 4?. / *.4.-. . 0 # -2. -2...^9* 4.  !      9) % /I.!>.     6$#--!"4^6.-. 6O#%?# *.*4^6. K"! *. (+* 6&.*>.)'&. *P& %   t .* G #?6b.5/21/I. 1  6O.' …# . 8: 6O.6O!>47.. 8 9 .1C6O&?4?.6O!>47.4..**@.^>*. + 0 ?& .*:. .4 .=<  ..1/+* 4 .13* -+* *2& (+!  ) =< t=% ( '?)  .  .)'&.M ( * 6O&?.=/I. (+* 6O&?. 2* &> (   .

# 8 .1=6 K 9*#3#?6@... *6 #L-!$4>6.A. . * /+*#%#?*C681 -6U/+*.*2-.4 1=6&. !" /-#3&?4.4?. =<  . 2* &$>   t 9 # > ("! ) % ( ' + 6 * * * #?6OC/-! 43/1 6*C 681[/.

+.@/-/I6 #76UL6..B&?6^! 4?.43&?6 5 /26:/-#?*J/I..1C6O&?4?. /+* 4 .)#n/I.6O!>47.)# .6^! 4?.6 6*C 6@1J/. #?6 /476@.4.0-6 /I.4 ./.)'&.. 8 * #3#.)# .* 2-. */ED<&.J. 6. 476 684 ^D.)!"#H-6 6@4H.^!9* 6 /F. 6O'&. 4?6O>6^!>*06^#H&. *>.. 8 F !"#3&%!"-C  8  .)'&. -26^/I.J  B  GHG:IJIJIIJIIJIJIIJIII6IJI6IIIIII6IJI6IJI6I6IJI6IJI6IIII6IJI6IJI6IIIIII6ILKMON PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c X8^Q(S6d ^L_6YfeHeTU+]+X_hg X8^Q(S6d ^L_6YfeHeiZ+SYJVg UVWaJ^W^ k  jZJ^L_JZ l X6mEVJQHU:e GHGEn.6^2-6@4 *N/*..

o6p3qTrstr6u6vwyx6o{zL|}|R~6+w6xWw€Tz8oystoWp6oW‚Wo„ƒ…rsE†T|.

oJLsEwW‡ˆƒ.

w+sŠ‰Er1q(w+sŒ‹+TŽ3 Q(S6_ 6]@b3aJ‘’JaJVW]W`”“@QiS_•QTS6_1–.

g GHGEn.

o6p3qTrstr6u6vwyx6o{zL|}|R~6+w6xWw€Tz8oystoWp6oW‚Wo„ƒ…rsE†T|.

oJLsEwW‡ˆƒ.

w+s}s8o—.

o+s8˜LŽ1p6Wr‹@TŽ1H™W Q(S6_ 6]@b3aJ‘šJZ6›ZW`JZS1UQaœ“QTS6_\"•žQ(S6_y8–…g GHGEn.

o6p3qTrstr6u6vwyx6o{zL|}|R~6+w6xWw€Tz8oystoWp6oW‚Wo„ƒ…rsE†T|.

oJLsEwW‡ˆƒ.

w+s{ƒŸwŽ16o6@stw‹+LŽ3EKT Q(S6_ 6]@b3aJ‘ J]HS_EZtQL`E]œ“HQ(S6_Š¡¢•Q(S6_£¡6–Ÿg GHGEn.

o6p3qTrstr6u6vwyx6o{zL|}|R~6+w6xWw€Tz8oystoWp6oW‚Wo„ƒ…rsE†T|.

oJLsEwW‡£pw|œs8o—.

o+s8oLŽ1p6Wr GHGHƒ.

r+sEr¤zL|¥ƒŸwŽ1Wo@stw‹+TŽ1¥Kž™¤ Q(S6_ 6]Lb1a‘HšJZW›JZH`EZS3UJQ+aW J]SJ_JZ8QL`J]¦“HQ(S6_£¡T"•Q(S_§¡L8–…g ¨ g k GHG:IJIJIIJIIJIJIIJIII6IJI6IIIIII6IJI6IJI6I6IJI6IJI6IIII6IJI6IJI6IIIIII6ILKMip&ƒWƒ GHGEn.

oi—.

@Ž3Wu6v6wyx6o{zL|}|.

~6+wWxWw©ƒŸw+s¥‰tr1qw+sŒ‹+LŽ3+ GHG«ª+‡£wE‚+¬8owW‡©­§o„®£‡EoLsJv6wyz+|1r£pH¯*ƒ…r£xWw‡§wJ‚¬toJwH‡„ƒŸrW‡6‡Jrx6wW‡.

M GHGE°q+Wo+sErs¤­£o„®§xJoTŽ3TsJw§xHw{|R~6wWxWw£±tw(|Rr+²…³Tr«qTwsyŽEv6wŠr1q@HoLsJr£w+‡wJ‚¬toHwH‡ˆƒ…rH‡‡Jr6xwH‡ GHG3‰8r+Ž1HrL´Roi|hµ¶ŽtvWwŠr«qLHoLsJr}w}w‚@¬Eo6w©ƒ.

r‡W‡r6xWwŸ· GHG.

xEo+‡H‰8r+Ž«rL´Roi|fµ¶ŽEvWw}r1qLHo@sJrŠw}w‚@¬to6+w{ƒ…rH‡6‡Er6xw‹@xEo?ƒoLŽtxEo¸xHw£€Tz3o{‰Ewp6˜}€Lz8oLsE…M Q(S6_}jZJ^@_Z"eHei]Lb3aJ‘’EaVW]W`¹“HQ(S6_¤ºf•ˆQ(S6_y»1– ¨ Q(S6_œ^+]Tb8a½¼¸º½¾\»:g ºŠ¼¸¿…g »Š¼¸Â…g `Z_WX6`HSÃ^+]Lb8ag GHG…TŽWÀ3H3qE·ÁzJ‡rWxWw§r*ƒoTŽEr‡¸ƒ.

rsJr¸|«wH‡3Lstrs§€Tz3o­Ÿ·(® GHGoL­«Wo@s6ŽtwW‡¤ŽEvWw¥‡vWw}r«q@6o@str6x6wW‡ ÄÆşÇÉÈ+Ê*ËiÌ=ÍOÎÐÏÑÊ¢ÒRÓTÇÔÊ$Õ(Ö×ÍÌÑÊØiÓTÍ.

ü ñ ÿ ù>*0-6KJL4?.õôhöäöäöø÷áù>1ûúJñ÷ / ×üÆý ÷Ðþ24 îúI.1=*.  4?*.4Oñ?6óò /6iï.Ù?È+Ê*ËiÌÚÙÈ@Ù?ÏÚمÊ$Ó(Ì=ÏÑÊÊ$Õ(Ö×ÍÌÑÊLÛ?È+Ê(Ü(ÍÝË@Ü(Ê:ÞßÍOÏtÓLÞ=Ù$Ü(ÊÈLÙ?ÏÚÙÙ*àáÌÑÍÝÏÚÙ?ÏJÊ$ÞEâ&Ù?àãÊ*ÏÑÍOÞEÙ*Ï=ÇäÙ?åOÍÝËLÙ$Ü(Ê$Þ ËTÊäÊ*Õ(Ö×ÍÝÌ=ÊæÙ?È+Ê*ËiÌÑÙ$Ü(ÊLçEètÍßÖßÙäÜ(ÍOÞÑéÏÑÎ 2Oê ÊæÜ(Ê$ÞRÈ+Ê*ËiÌÑÍÝÎãÏ=ÊiÞ1ËLÊæéOÙ?ÈTëÐÌ=ÓLàÐÊìOíLç îï-4Oð /*.<681 RTR ..

 ˆ     h     ä     (     k GHGEn.

oi—.

@Ž3Wu6v6wyx6o¸zL|Š|.

~6+wWxWwpHw|”s8oi—Ÿo@s3˜LŽ3pHr‹+TŽ3„™6 GH G w|œs8o—.

o+s8˜LŽ1p6Wry~ƒŸrW‡6‡Er6x6w¤wÁƒ«sE¯iƒ«s3Hw½w‚+¬Eo6+w GHG«x6oÁ—«w+sL|1r€Tz8o©|Rw6xJ—.

pHrs¸­§oÁ®xJoTŽ3TsJw£xHw¸|R~6wWxWw}±tw(|«r².

Roi—.

o+stoTŽ8pr.

· GHGJ|Rw6xJ—.

pHr¤w}€Tz8oÁ—1wƒŸrW‡6‡Jrx6w« M @‡to}€LzEr@ŽExWw”€Tz8  Eo@s”r«q+Wo@strs½wŠwJ‚@¬Eo6+w¸ƒŸrH‡‡Jrx6w«M Q(S6_}jZJ^@_Z"eHe]Lb1a‘šEZW›JZH`JZHS3UJQ+a”“Q(S6_\6ºf•ÁQ(S6_¤J»1– ¨ Q(S6_^+]Tb8a½¼\º\¾\»:g º}¼¸¿W¿g »}¼¸ÂWÂg `ZH_HX6`HS¦^+]Lb8a:g k GHGEn.

oi—.

@Ž3Wu6v6w x6o{zL|}|R~6+w6xWw{ƒ.

w+s{ƒŸwŽ16o6@stw‹+LŽ3EKT GH G 8wJWoŠ€Tz3ožƒRs8o6p+‡Er¸z‡r+s£K+­§o\K@®{ƒ.

r+sJr£rEp6o+‡‡JrHsyw§pHwŽ1Wo@ÀtxwyxWw‡wJ‚¬toHwH‡ˆƒ…rH‡‡Jr6xwH‡.

M GHG«ª+‡{ƒŸw+Ž«Wo@sEwW‡½K+­£o¤K+®£‡vWw§p@s8Wr6xwH‡¤ŽJr§p@NErT|«rx6ryxHw{|R~6+wWx6w GHG.

wE‚+‡to+sW‰1oy€Tz8o¥r1qLHoLsEr}w+‡Š‰8r«q(wHs8o‡§oL­«Wo+sWŽtwW‡½x6o©­£o„® Q(S6_}jZJ^@_Z"eHe]Lb1a‘ E]SJ_JZtQ@`J]”“Q(S6_Š¡@ºæ•Q(S6_Š¡»«– ¨ Q(S6_^+]Tb8a¥¼\¡Wº½¾\¡W»hg ¡º¥¼\¿6¿¿g ¡»¥¼\Â6ÂÂg `ZH_HX6`HS¦^+]Lb8a:g k GHGEn.

oi—.

@Ž3Wu6v6w x6o{zL|}|R~6+w6xWw£s3oi—.

o+s8˜@Ž3p6Wržƒ.

r+sEr\zL|½ƒŸwŽ1Wo@stw‹+TŽ1tKT™6 GH G @‡Eo}€TzEr+ŽExWwŠ¬§WT‰8oLs\ƒ…w+Ž«Wo6+sEwW‡½o¥xJo‡to+¬ErsÁƒŸr‡W‡r+sœw+‡©ƒ«st¯$ƒRs8HwW‡ GHGWƒ…w+Ž16o6+sEwH‡¥o{ŽtvWw¤z@|«r£p¯$ƒ…r§xo8qLo@‡ GHG.

wE‚+‡to+sW‰1oy€Tz8o¥r1qLHoLsEr}w+‡Š‰8r«q(wHs8o‡§oL­«Wo+sWŽtwW‡½x6o©­£o„® Q(S6_}jZJ^@_Z"eHe]Lb1a‘šEZW›JZH`JZHS3UJQ+aH E]SJ_JZtQ@`J]ÓHQ(S6_£¡Lºf•Q(S6_£¡LE»3– ¨ Q(S6_^+]Tb8a¥¼\¡Wº½¾\¡W»hg ¡ºŠ¼¤¿6¿¿6¿g ¡»Š¼¤Â6ÂÂ6Âg `ZH_HX6`HS¦^+]Lb8a:g k Q(S6_yb8aEQTS “– Q(S6_¥a½¼3g Q(S6_\m} ¼ …g U+]+X_§[E [ @aW¼{[E[„aŠ[E[mJ¼{[E[m[J[¸Z+SYJVg jZJ^@_Z£]+m¢g U+]+X_§[E[HW]Lb8a6¼{[E[¸]+mi6]@b3a‘H’JaJVW]H`¹“*ah•Ém1–\[J[¤Z+SJYVg U+]+X_§[E [   ^ R# U "JaTb8aH$ ` 86]@b3a‘H’JaJVW]H`“?a:•ÆmR–.

%g EaW& ¼ ¸[E[„a¥[E [ HmE¼'¤[J[ˆm£[E[¸ZSYVg l ! .

U+]+X_§[E[HW]Lb8a6¼{[E[¸]+mi6]@b3a‘HšJZ6›ZH`EZS1UQ+a”“iah• m«–\[E[{ZSYV¢g U+]+X_§[E [   ^ R# U "JaTb8aH$ ` 86]@b3a‘HšJZ6›ZH`EZS1UQ+a“?a:•Æm«–…g%a6¼&{[E[„aŠ[J[(HmJ¼{[E[m§[E[¸Z+SYV¢g l ! .

U+]+X_§[E[HW]Lb8a6¼{[E[¸]+mi6]@b3a‘H J]HS_JZ8QL`E]”“&Ja• Em«–\[E[{ZSYV¢g U+]+X_§[E [   ^ R# U "JaTb8aH$ ` 86]@b3a‘H J]HS_JZ8QL`E]“ƝJa•O6m«–…g%a6¼&{[E[„aŠ[J[(HmJ¼{[E[m§[E[¸Z+SYV¢g l ! .

ü ñÆÿ ù>*5-6KJL4?. Q(S6_Š¡ l a½¼©3ag Q(S6_Š¡ l m}¼©Em:g îï-4Oð /*.4Oñ?6óò /6iï..<681 RTR .  4?*.1=*.õôhöäöäöø÷áù>1ûúJñ÷ / ×üÆý ÷Ðþ24 îúI.

                    ¨ U+]+X_§[E[W]Tb3a¼&¸[E[¸]+mi6]@b3a‘HšJZ6›ZH`EZS1UQ+aW J]HS_JZ8QL`E]¦“ l æ a • l m«–¤[E[¤Z+SYJVg U+]+X_§[E [   ` 86]@b3a‘HšJZ6›ZH`EZS1UQ+aW J]HS_JZ8QL`E]:“ l af• l « m –…g%JaW¼&¸[E[„a¥[E[HmE¼'¸[E[m l ! ^ 1U "JaTb8a& [J[©Z+SJYV¢g `Z_WX6`HS…g G8K  w+‰3Wx6rxJo3µ 1 II6II6I6II6II I(°1‚w+sJx6rŠrÁƒŸrW‡6‡Jr@´«o|x6oƒ…rst†(|.

oJLstwH‡ˆƒ.

rsJr¸|.

~Hw6xwH‡ ƒ.

w+s¥‰Jr3qiw@s· ƒ.

w+s}sto$—.

oLst˜TŽ8p6r:·/ƒŸw+s©ƒ…w+Ž«Wo6+sEwyo¸zJ‡r@ŽExWw£s8oi—Ÿo@s3˜LŽ3pHrˆƒ.

r+sJr½wÁƒŸwŽ16o6@stw«M ±JrxWr…µ II6I6II r+Ž8xs8o i|Ÿo@s8p@zs3Hw +r?ƒ.

:I±8@Ž1r­3o œM&G3r.

MLw@z3 r¤‚ ±Jw|«r °Lƒ.

¯H‡p@NJr|1r+s ³r1qw+s‹?r1·W‚„r¤‚ ±Jw|«r °Lƒ.

¯H‡p@NJr|1r+s «o—.

o@s3oLŽ1p6HrŸ‹*r1·H‚+„r¥‚ ±Jw|«r  °Lƒ.

¯H‡p@NJr|1r+s"!3wŽ1Wo@stwŸ‹Æ™Er«·™1‚+„r}‚ ±Jw|«r  °Lƒ.

¯H‡p@NJr|1r+s «o—.

o@s3oLŽ1p6Hr!3wŽ1Wo@stw…‹ ƒ3r.

1C6iïHñ. ð ý ! * 13*.ï ü ÿ ü ñ?6B6@1 *Lñ. úI. ü *Jáþ 6 ý ú4?6NH6ÿ9*.. *6 C 6@û H + * ù . ü ú+*. ü *. ü -6 /21 1 ð*ñ. ü .-. -.-..: @ I Y\4[ 8C&(316@. ü 6@1 *. .1 ..4  /1=6$ïHñ./7698. 1ûð$ñ?.4?6 ü JO 6  ÷ J. -6H-Eÿ 6@476iïHñ. ü J ü 684 .6 ü .1C6$ñ.. d %+ +e ".4ÆÿAþ/Eÿ 4IH *+ù>. ü M .$*.. ü ÷ 1 úEù>. ü ú24Æð*ô -6$#EïEÿ>-.*C1=*+ÿ ü *<-Eÿ>476iÿAñ. ðK* L(/6$ù>6UL(/6K6 ü ñ. -26 ü 684 ý ! *. .6 ÿ ïEÿ ý ÿ>*+ù ÿ *.47. ü ú+*.1C6iïHñ.1=*. ñ.43/7*F #$#$%&%('  G / ü ..: @1 YZ9[ 9.4 . Y] _ ^ K  `      ™– 2 !6@0Q 20: 1ba IcaD.*J÷   !#"%$'&%(*) 9E:%W @ VC(E"C! X/&01/>>6! )%)J8 G 9.4?6 ü úF6 ý ñÆÿPH *.-2.4?6 ü ÿ ïEÿ ý ÿ9*@ÿ ü *..-0/2143$5. . üý . L(/6 -$6 ÿ-C2* -6 ü 6@4 . ü 2ú 4Æð*ô -6$#EïEÿ>-. 1ûð$ñ?.E÷õî üÆü ÿ 1KJ7L(/+*@ï-.4 .G-.4  /1C6iïHñ. -. *+þ+*+ÿ C .. ü ý . / ü * -.9*2AB>@6?>@C>@1$D@>@E1$-?. -6 *..4?1=* ü 6 L(/6K.4Oï6 ý ÿ>-.1=6*ñ. 1ûð$ñ.4  /1C6iïHñ.G-.681 .6@÷ G þ ü 684QH6RL(/6.·?ƒŸ‚HÁr£‚ KG )+* .:03?F<-0/ML=6?>@-0.47. þT7$6 ñ?I S .

Y] _^ (#I  8 G K —– #$#$%&%rq —– – – s&/76t8 /760u1$*v:=1431.&-0..436?.: @/!/> 8?(-23"C1/>) VC(E"C!X/&01/>>6! ( I  (#I  8 QG \\$[kjl[nmm  m?K + + 1 Y\\4[IYjl[ .f6@C( .4æú+*. ( $'( .õôhöäöäöø÷áù>1ûúJñ÷ / üæý ×üÆý ÷Ðþ24 .Ymm  m ++ 1 Y ^^ [IY\j4[ .1=*.1=6ÿ  /+*+ùF*. 1/> >3!i3Q<9. ( .1œï./b3/8..  4?*.1 þEÿ  /Eÿ>-*.õð 6BH6ÿAñ. /*. ü ñ ÿ ù>*0-6KJL4?.4 .<681 RTR ./Jñ.<.4 îúI.6 / ü *.<-6 .$*  wyx H6ÿ-ñ."-?/=8. -2..*.. !D>3!32 h.Y] _^ (#I  8 pG m\CK ++ 1 YZ9[ IY\4[ . þT76*ñ.47. ü ..U-?/ML?6?>@u$. ü *.47.-0/7CD@1431$u$.1C6$ñ. g?1#"C1 . ü J+.4Oñ?6óò /6iï..-6 ü ÷ îï-4O𠗖 -6 1ûð$ñ?.Y] @^ (#I  8 G ^^ [o\j?K ++ 1 Ym\4[IY\4[ ..þT76*ñ ÿPH.

6 ..* 4 ñ. WÁ          wyx 1  RTR 6iï ý .H .+ñ +ñÆÿ úI.. ü .G-+* ü 684?4?.6BH.6@1 G ý ü 684ú+* üÆü *.ïHñ.G-. .4?.4 1=6*ñ.1C. . ï ü ñ÷ w G þT76$ñ.ÿ>6 üÆý ù9*.. ü ú+*. ü  w / ü .  ü ÷G6K. ý .  w ü ÿ  ïJÿA# ý  ý .. ü ú24?6 ý ÿü  w îï+*+ùAÿ ü 6 .ü û 1 ð$ñ.476 ý +6 ÷ ý 4?*+ï-6 ü . ü ÷    . ü 1C6 ü = 1 .1 -6 ú 47. ü 1 ð*ñ.4..G-.

4 4?6 6@4 iï ý ÿ9* *.1 * 6*# ü ..* -. ("..-.6@4?*.þT76*ñ.E÷ J 6@4 .1=*.1C6$ñ.      w 7 G w 7 w 7 :<> $B( ( I  ï . ü úI. ý . G 6@4 *+ù-ñ.*.-2. 13*@ÿ ï ='H65*=6$ïWñ?4. +ï * ü 6  . 1 ð*ñ. ( .40* @ E9 : 8?(-26"'1 3Q?!=(7( I  !6@C( .-* +ï *   ùAÿ ï !  *<-6 ý . ü ÷ < úEÿAù9*. ü ú+* üÆü * -.G-..<.47..4. !O>6!32D1 &#@/!32/1 . 1=*+ï-.47. 6 ü 476 ý 2/ 4 ü ÿ H * ü ï+* *.4 ./1C6iïHñ.6 +ú * —– üOü ôÚù>.-+* * . 4?1=*+ï ý +6 .J2-6BH./D* /21 ..úJÿ9*.-. ü ü ü ÷ 6?C 6@1ûúEù>. ý !  x ÷< J  /Eï $. J *.*./Jñ. -! : @%2?( . H *+ÿ ü    684 -26 ý ù>*.

Ôï .*.õôhöäöäöø÷áù>1ûúJñ÷ / ×üÆý ÷Ðþ24 îúI.4 ý úEÿ9* L(/+*+ï2-. ! 1/. ü ï. ! "B( .*.-+*ï+* B 6@?T *+ Aù ÿ ü $ñ *  681 * ü 6  /Eÿ 4J+*<1C6 ü 13*<*+ú24?6 ü 6iïHñ$*=*0-6 ý ù9*.. -26 ü @6 4/1=*  .4ÆÿAþ/Jñ?..+* ïHñ..E÷  ú4?.4?1=*+ÿ ü ÷ F ÿ ü ñ Aÿ ï   ÷ < .<681 RTR . ü ñÆÿ ù>*5-6KJL4?. 83Q:B.-.4?1=*+ùÑ÷ GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6IJI6I6II6IJI&°Es8€@z3@‰tw10i°q?zWŽEwM$N GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6IJI6I6II6IJI 2«‚3qLWwE6o6pHrW( ‡ +$ G 4353 PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c îï-4Oð /*. 80Q:B.Éñ. ü J-6BH. * ð ÿ>1ûúEù>681=6$ïWñ.4?* .-Eÿ ý ÿ .C-6 ý ù>* üÆü 6 ü JI*@ñ?4ÆÿAþ/Jñ.G-.-J 6 üOü .1C. ü H *+ù .. 4?6 684 $ï ý ÿ>* ý . ./ ý ..61 ( G .1C6$ñ?4?. ü 6  .G-.-.E÷ ô ð /1 4?$6 ñ?.-..C*+þ*+ÿ-C .-. ü ï. *6 C 6@1ûúEù>. "ù>* üÆü 6 ý . -6 /1 1 ð*ñ. .  4?*...0( +%+ fD.4Oñ?6óò /6iï. ü -6$ïWñ?4?.681 *.1C.C-. -. ü .6@1 6  /24.4  /21=6$ïWñ?.ï ü ñ÷ ï **ÿ  /24.1C. 83Q:B.-2.E÷ ô ð ù>+ * ï  * -. G6 H.-. .4Oï. -2.K-Eÿ9*  4.G-. x ÷ ÷ ý * (L /6D. ð ý 4Oÿ9*.61/( G ( 9 .61 . 9 8B90.3!/>>6132F( ( I  6! @'( "'/1 >:C5 ( $B( . 1ûð$ñ?. -.ûúI. 1 . ô ð /” 1 ú+*.$'( F( B 6@T?* * /Eï  .C6 / ü .+ F -* ý ù9* üOü 6.6JH6@T?*C.ïHñ.4?. .4?6 ü ï ..4?1=*+ÿ : ü ü . (7("f3@C( .B*.4H4?6 6@4 $ï ý ÿ>*C.4äúI.4?6 ü ÿ ïJù ÿ ï26 J ü ñ$*@ñÆÿ ý JH6ÿ>4Oñ?/+*+ù ..G-.6$ÿ>4?. ü 6 1 ð*ñ.( :B> @/16:%@/!D! :C5 ( +%+ !/> @?! "<( .1=*.õï2.Æ4 ï2. ü 6 ü úF6 ý ÿA# ý *. ú+* 4 . ü úI. ü ï . (-2 .6  *3-6SL(/6:.0( :B>#@D@B9.684 ý 6@4Ýñ. ï ü ñ.1   !#"%$'&%(*) +%+e !?>E$?!/.4?*.f6@C( .61/( G K —– G *..*+ï @*J.*  ÷  .E.4  /21=6$ïWñ?./ Iú .4 1=6*ñ.. —– ü ÷  ý ÿiï ý ÿ9*úI.=-6 /1 1 ð*ñ.. K ++ X ++ Xaa ( 9 .C-6 /1 1ûð$ñ. ý L(/684ñ.E÷  w . 3&%(  K 4?6*ñ.0-* ý ù9* üOü 6 ü 6@1§ï6$ï ! /1 6 ü úI6 ý ÿA# ý *. ( !#" %$ &%'( Gü 1ûð$ñ?.=*+ùAñ?6@4?*.C6 1ûð$ñ?.4 *.1=* ...õúI..@ñ+ñÆÿ úI. *J÷hî ý ù>* üÆü 6/-J 6 üÆü .ï+*+ù=÷) 681 / ü . *./Cÿ ùAÿ9*    #! "%$'&%(*) +%+ 6> !#"O2 !6@C(623:'(7!=>3!#"7$C132 #"C!3@%2?( ( 9 .ÿ ü . ( $'( .:-6 ý ù9*..%9#8'90.E÷    *+. ý .1 *Lñ...-". þT76$ñ.. /13*0?6 C ý 6  .

 <  6ˆ       ä   TPessoa +nome: string +matricula: string +Entrada(): void +Saida(): void /4?* ÿ  *  ÷  . *J÷ - PRQTS3UWV+XEYZ\[3^L_W`8Q(Sd«c PRQTS3UWV+XEYZ\ [ ZJUL_]H`«c X8^Q(S6d£SEa@b3Zt^ l atUZŠ^L_Y¢g GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6II 8qr‡W‡to G8K °”p8qrH‡W‡Eo 0!«o‡6‡Jwr¤s8o*ƒ«s3o+‡to@Ž1Hr¸z@|1rÁƒ…o@‡W‡JwWrË$zL|¦r1q?zWŽtwŠwLzŠzL|½ƒRsEwT—.:î ý ù>* üÆü 6 J 6 üOü .

o+‡‡JwHs6 x6o¸z+|1r\zŽ3@‰3o@sJ‡tWx6r6xEo1M 0Ho$|§zL|§ŽJwi|«oŸ· z+|1r©|RrE@s86p@z…qTrRM .

| J ~    w 6 x H w  ‡ ‚ .

W  t ‡ 6  pWwH‡ˆƒŸr+sJroLŽ«LsErx6ryo¤‡rxWr}x6o¥x6rWxWw‡M  KG UVWaJ^W^½j6 EZE^^]6a k GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6II?°RLs36‚@z1wW‡ l X6mEVJQHU:e GHGRrE@s8‚Lz1HwH‡½Žtws+|«rE+‡ ^L_W`3Q(S6d§SJ]Lb8Zg ^L_W`3Q(S6d}b1aH_`3QWU@XtV6a…g GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6IIR~Hw6xwH‡ l X6mEVJQHU:e GHG $|1r{—EzWŽEu6vWw£xHwŠw‚+¬Eo6+w…·¸r1qLWoLsJr§r+‡{ƒ«stw$ƒ«s36oWx6r6xEo+‡¥xHw£w‚@¬to6+w G G«oLzsEryx6w‡rELs36‚@z1wW‡œ‹$ŽJwi|«oŸ·ž|RrE@s86p@z…qTr H ]EQ@ Y 6S_`JaWYJa…“i–Ÿg ¨ g G G3±JrHxWr£xWw‡§rELs36‚@z1wW‡œ‹$ŽJwi|«o…· H ]EQ@Y£6aEQLY6ah“i–ŠU+]+S3^L_g |RrE@s86p@z…qTr GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6IIII6I6IIII6IIII6I6IIII6IIII6I6III&°ts8€Lz1L‰8w10i°q?z6ŽEwM+p&ƒWƒ GHGEn.

oi—.

@Ž3Wu6v6wyx6w‡\|.

~Hw6xwH‡ ]EQ@YŠj JZt^6^]a:eH e WS_`Ja6Ya…“i– k U+]+X6_§[E [  HS6_6` Z 1U+]T$ b J ] SE]Tb8 Z YW ] ta6V@X6SJ]"e &«g dJZW_EVEQLSEZŸ“TUHQiS•*SJ]Lb8Z1–Rg ¨ U+]+X6_§[E [  HS6_6` Z 1U+]T$ b J a 6b3aH_`3Q6ULXtV6a YW]taV@XWSJ]"e &1g dJZW_EVEQLSEZŸ“TUHQiS•&b1aH_`3QWU@XtV6aE–Rg ]EQ@YŠj JZt^6^]a:eHeWaEQLY6a“i–¥U+]S8^L_ k U+]+X6_§[E [ .

]Tb8 Z JYW ] ta6V@XWSJ]æe ' îï-4Oð /*.4Oñ?6óò /6iï. ü ñ ÿ ù>*0-6KJL4?.<681 RTR  .õôhöäöäöø÷áù>1ûúJñ÷ / ×üÆý ÷Ðþ24 [[ÁSJ]Tb8Z£[E[{ZSYV¢g îúI.1=*..  4?*.

 WÁ           H  U+]+X6_[E[JaW_6`1QWULX8VWae ' ¨ [[b3aW_6`1QWULX8VWa½[E[¤Z+SYVg k GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6IJI6I6II6IJI&°Es8€@z3@‰twÁ|1rJTŽMp?ƒWƒ Q(S6_yb8aEQTS “– ^L_W`8Q(Sd”VJQ(S "EaE¼'iS«g U+]+S8^L_¹Q(S_ŠSXb1ZH`J] EVX6SE]t^W¼6¿…g GHG @stryzL|¹w‚+¬Eo6+w§xHwH&ƒ.

w j6 JZt^6^H]6a l `J]6›ZE^^]W`g !«o+‡‡Jwr pw|ŽEw|.

oƒRsEwT—.

o+‡‡JwHs 0 U+]+X6_§[J( [  HS6_W`JZ1U]Tb$J]SJ]Lb8Z JYW] l `E]W›JZE^6^H]H`fe '«g dJZH_tVEQLSEZŸ“TUHQ$S • l `J]W›JZE^^]H`&SJ]Tb8Z1–Rg U+]+X6_§[J( [  HS6_W`JZ1U]Tb$JaWb1aH_`3QWU@XtV6a JYW]  l `J]6›ZE^^]W`he &«g dJZH_tVEQLSEZŸ“TUHQ$S • l `J]W›JZE^^]H`Æb3aW_6`3Q6ULX8VWaE–.

g GHG LstHr¤zL|œ‰8o6+ws§x6oŠwJ‚¬toJwH‡½xHwH&ƒ.

w 0!«o+‡‡JwrŠpw|ŽEw|RoŠr1q?z6ŽEw GHG.

pHw|Ž6z@|RoLsJw£x6o£o3q@oi|ŸoLŽ1HwH‡£xWrWxWw‡{ƒ.

ws¥Žz+|.

o+sEw@°q*zŽtwW‡ JZJUL_]`Ÿ[\j JZt^6^]a½c aV@XWSJ]¢“iSXb3ZW`J] EV+XSE]t^–Rg ›]`¢“@Q(S_œUH]SJ_JaWYJ]H`E¼…g„U]HS_Ja6Y]W`}[¸S6XHb3ZW`J].

tV+XSE]E^…gˆUH]SJ_JaWYJ]H`E¾W¾t– k U+]+X6_[E [ JV@X6SJ ] '6[J[yU]SJ_Ja6Y]H`½[J[EZ+SYVg a6V@XWSE ] U]SJ_Ja6Y]H.

`  6S_6`EaWYJa…“i–Ÿg ¨ U+]+X6_§[J[\VJQTS "Jahg U+]+X6_§[J( [ š  .

.

  E 6šJ6šJ    Häe 'W[W[JZ+SJYVg U+]+X6_§[J[\VJQTS "Jahg U+]+X6_§[J[(.

]Tb8ZJYW]  l `J]6›Zt^6^]W`he & U+]+X6_§[J( [ JaW_6`3Q6ULX8VWae ' [J[ [ [ J l `J]W›JZE^^]H`&SJ]Tb8Z£[E[S «g ` Æb3aW_6`3Q6ULX8VWa½[E[+SRg l `J]W›JZE^^]H ›]`¢“@Q(S_œUH]SJ_JaWYJ]H`E¼…g„U]HS_Ja6Y]W`}[¸S6XHb3ZW`J].

tV+XSE]E^…gˆUH]SJ_JaWYJ]H`E¾W¾t– k U+]+X6_[E[¸VEQ(S "Jahg U+]+X6_[E [ JV@X6SJ ] '{[E[½U]HS_EaWY]W`¥[[JZ+SYJVg a6V@XWSE ] U]SJ_Ja6Y]H.

` iWatQLY6ah“i–Ÿg ¨ U+]+X6_§[J[\VJQTS "Jahg ¨ UQ(S &dZH_“i–.

g `Z_HX6`WS"…g G8K1w+‰3Wx6rxJo+‡Ÿµ @‡w¥x6o£W&ƒ.

w‡¸ƒ…r6xsJo‡yx6o 3531·Áx6o£H&ƒ.

wH‡£xHw½zJ‡Wz Hs8Hwyo\x6o£H&ƒ.

4Oñ?6óò /6iï.<681 RTR . ü ñÆÿ ù>*5-6KJL4?.  4?*.wH‡§xHry±  ‡w¥x6o„|Ÿ~Hw6x6wW‡\ŽtwHs@|RrJ+‡M «~+wWxWw  Ž1@sEr6xrŸ‹   ‡w¥x6oy‡3Ls3LŽH´8‡¥x6o îï-4Oð 3 0  8µ 3 /*..1=*.õôhöäöäöø÷áù>1ûúJñ÷ / üÆý ÷Ðþ24 îúI.

  Wˆ        IJIJIIJIIJI6IJI6II6II6I6II6II6I6IJI 1o+‡tHo§oL­1oi|Hƒfq(w{z1H8qTJr…I+‡Jo¤r§p8qr‡W‡toŠ‡tTstLŽ´¹x6o 3531·{xJoi—ŸLŽ1Hx6r¥o*|H‡8TstTŽ´«M  z@|1rp8qrH‡W‡Eo„ƒ.

r6x+sJvWw£x6o4 3533·ˆz163q@J  rx6ržƒŸr+sJr¤|«rŽ3*ƒ1z…qTrspHw+ŽE¬HzŽ1wW‡½x6o}pWrstrJp6o@s3o+‡ ‹ |.

oLŽE‡Jr@´«oLŽE‡6…M !8r+sEryzJ‡r+sŠz@|1r¥‡tTstTŽH´‰EwpW˜ŠxoT‰3o}@Ž3p1q*z3+syw§pHrE‚6oWu6r«qiNEw o H‡tTstTŽH ´  LŽ3p1q*z8xJ ªE‚+‡to+sW‰1oy€Tz8o¤r}xJo6p1q(rHsEr6uv6wyx6o¤z@|1r¥‡tTstLŽ´¹~y‡t|ƒ"qLo+‡ŸM ‡tLstTŽ´œŽ8w(|ŸoL²J‡3Ls3LŽH´  !8r+sEr§rs@|Rr.

8oLŽtrHs}r1q ´3w¤ŽJr¥‡tTstTŽH´£—1rWuWr…µ Ž8w(|.

o@²J‡3Ls8@ŽH´  .

6pHwŽ16oLÀtxwyxHrŠ‡tTstTŽH´.

 !8r+sEr¹qTo@s½z@|1rŠ‡tLstTŽ´¹xHwWop3q(rx6w}µ pWT Ž ©Ž8w(|ŸoL²J‡3Ls3LŽH´  !8r+sEr¹qTo@s£xHwWo6p1q(rx6w}+w6xWr\z+|1r¹qLTŽ6NJr£o½rHs@|«r to@Žtrs\ŽJr½‡tTstLŽ´h·„z‡Eo{´«o3qL@Ž3o3µ ´Ro8q@LŽ1o«‹(pŽ:·ŽtwT|.

oL²E‡8@s8LŽW´E  ‡tWo½~¤‡EoLz{ƒRs8i|Ÿo6+sEwƒRsEw@´EsErT|«rŠws8oLŽ«r6xw¸r}w‚@¬to6+wM ±3i|ƒ"qLo‡ ³wp6˜¥xEo6p1q(rstw+z½z+|1r£p3qr‡W‡EoM p8qr‡6# ‡ 0 !«o‡6‡Ew6rŸMWMWM n.

oi—.

@Ž3@z¥w+‡\|Ÿ~wx6wW‡¥xHr£p8q(r‡W‡Eo ‰Ewx 0!«o+‡‡JwrRµHµ  Ž1Lstr6xr…‹ ¢MWM6M Ls8w@z”wJ‚¬toJwH‡½xHr¥‡zEr§p8qr‡6‡Eo 0 !Ro+‡6‡Ew6rˆƒ«sEwT—.

o‡6‡JwHs7tMWMWM  ‡w+z£wŠwJ‚@¬Eo6+w pw@z3  .

8w|Ro¥xHwÁƒ«sEwT—.

o‡6‡JwHs¢µ.

KG   !#"%$&" ('  ƒRsEwT—.

o+‡‡JwHsŸMŽEw|Ro.

Ǝ.

*.JRï . *+ùAñ?6@4.ï ü ñð ý    )+*+. *+ù-ñ.ï ü ñ÷ î -26 ý ù>*..4ÆÿAþ/Jñ?. ü *Lñ. ü *Lñ.6 .3-+* ý ù9* üOü 6 ï .G-.+ïWñ?.. ?FS d 7+103BANMPO 3 > 9 ? C GIH+3 > A 6 = ..  4?*.47/EÿI.8Q ` A+.. ü -.R4:4 J >0? îï-4Oð 1F78A+7GIH3 6 >K@ .<6*C 6@1ûúEù>.-2.. ?:L >0?KJ = C D0 = DBE . -6 *+ùAñ?6@4.* 4 .õôhöäöäöø÷áù>1ûúJñ÷ / üÆý ÷Ðþ24 îúI.1C.4. ý .ï ü ñäÿ ï ü ñ.5.* . 6 ü ñ$* -.:6 ü ñ.6@4?*=.1 úEÿAù9*. .0* ü 6  /Eÿ>4BJL(/6 * ú+*@ù9* HG4. ù>.-. Ý)ã'"úF. úI. ý *.1=*.-0/210354 1879:9<. ï  .. -2. ?0L 7+1:3BAMPO 6 3 > 9 ? 7+1:3BAC /*. " " 6:/1 1ûð$ñ?.E÷ G þ ü 684QH6 ï2. 6 `= 7+1:3BAC >0?@ D0 = DBE d .-*C*@ïWñ?6 ü -..51 ð*ñ. ý . ð JEï . ü -.þT76$ñ?.<681 TUT .4-6?L(/6 .J ÿ ü ñ?.4.J6$ù>6 -26BH6 ü 684 -26 ý ù>*. ü ñ ÿ ù>*0-6KJL4?.3. ý . .+þT76$ñ?..* -.4Oñ?6óò /6iï.þT76$ñ?. 6SH6D 4  /Eù>*J÷ ý . úF.G-6 *+ùAñ?6@4.<-.þT76$ñ?.4ÆÿAþ/Jñ?. -.* ý ! * H.*C. ý .5.* 4 .

ý . ü 6 1ûð$ñ.<6 1 ð*ñ..G-. .... -6K*@ñ..1 *@ñ.*Lô ü     60* ü 6  /Eÿ 4H/1 6*C 681 úEù . "ù9* üOü 6 ý .4Oÿ þ/ñ. -6 / ü C .G-.4Oÿ þ/ñ. WÁ      îú4?6 ü $6 ïWñ.ï ü ñ÷ GHG:IJIJIIJIIJIJI6IJI6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6III&°Es3€Lz1L‰tw½K8MN k GHG:IJIJIIJIIJIJI6IJI6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6III 8qrH‡W‡Eo UVWaJ^W^½j 6Xb1ZH`J]WšJaHSJY]@b. ï ü ñ÷ üäý  F ÿ ü ñ ÿ ï   ÷ .

Q6U] GHG:IJIJIIJIIJIJI6IJI6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6III&°R@s8‚Lz1HwH‡ ` Q EaH_EZe l 3 GHGE°R@s8‚Lz1Hw¤ŽEwsL|1r1q Y6]XWmEVHZ£`Ja+SY6]Tbg GHGE°R@s8‚Lz1Hw}pWw+ŽJ‡3rŽ1Wo U+]+S3^L_¹Q(S6_”^Z@b3ZSJ_JZJ‘JU]HS3^+_¢g GHG:IJIJIIJIIJIJI6IJI6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6III R~Jwx6wH‡ X mEVJQHUhe l 6 GHG Ww+ŽJ‡3Ls6z1wHs£pw|¥ƒŸrHsE†T|.

o@sEwW‡ j WXb1ZH`E]HšJaHSJYJ]Lb.

Q6U]¹“U]+S8^L_¹Q(S6_‘J^HZLb1ZS_EZ‘EU]S1^@_¥¼ –g k G G «~6wWxWwœpw+Ž‡t¤ŽEvWw{|EzExWryw§o@‡trWxWw§xHw}w‚@¬Eo6w H Y6]XWmEVHZJZH_šJaSEY]@b WXHbEmtZH`Œ“–}U+]+S3^L_ k `Z_WX6`HS`aSY6]Tb g ¨ g U+]+S3^L_¹Q(S6_ZW_8^Z@b3ZHS_JZ¹“–ŠU+]+S3^L_ ¨ g ¨ g `Z_WX6`HSŒ^HZLb1ZS_EZ‘EU]S1^@_:g G GE°RLztrRqLEr\w¤ŽWÀ@|.

oLsJw£str+Ž8x(|Ÿ6pWw H ]EQ@Y  l Y6a_Z “–…g G G:IJIJIIJIIJIJI6IJI6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6IIII6I6IIII6III&°Es3€Lz1L‰tw½K8MHp?ƒWƒ H PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c X8^Q(S6d ^L_6Y"eHe(U+]+X_hg X8^Q(S6d ^L_6Y"eHe(U6Q(Sg X8^Q(S6d ^L_6Y"eHe$Z+SYJVg PRQTS3UWV+XEYZ\[1Q@]Tb8a+S1Q l c X8^Q(S6d ^L_6Y"eHe(^+Z_g PRQTS3UWV+XEYZ\[3UW^L_6YVEQ(mŸc k GHG Ww+ŽJ‡3Ls6z1wHs j WXHb3ZH`E]HšEaSJYJ]LbŸQWU]eHeij WXHb3ZW`J]HšEaSEY]LbŸQWUH]”“U+]+S8^L_¹Q(S_‘E^Z@b3ZSJ_JZJ‘JU]HS3^+_Š–eT^HZLb3ZHS_EZ‘JUH]S1^@_¦“ ‘J^Z@b3ZHS_JZJ‘JUH]S3^+_3– GHG E I Es8op6‡JrŠ@Ž36pHrRqLErs¥w}rELs36‚@z1w£pHwŽJ‡8Hr+Ž«Wo ¨ `aSY6]Tb”¼bg ^L`aSYŒ“^HZLb1ZS_EZ‘EU]S1^@_1–.

g îï 4Oð .

ü ñÆÿ ù 6KJL4?.õôhöäöäöø÷áù>1ûúJñ÷  üÆý ÷Ðþ24 îúI. O4 ñ?6óò i6 ï..<681TUT .  4 1 .

  Wˆ       G G  ƒ.

x6rJHo\´1o@sJr¤zL|ŽEw@‰Ew½ŽWÀ+|RoLsJw§sEr+Ž8xT|.

6pWw\o¥rs+|«r toLŽ8r¥o*|sEr@ŽExWw| H ]EQ@Y£j WXHb3ZW`J]HšEaSEY]LbŸQWUH]heHe  l Y6a_JZ “– k `a+SJY6]Tbœ¼½`a+SJYŒ“–…g ¨ k GHGzWŽtuWvWw\|1rJTŽ Q(S6_\b8aEQ(S “– U+]+X_§[E[6S HS6_W`JZ 3U+]Tb&X+b8aR^ZLb1ZSJ_JZe {[E[¸ZSYVg Q(S6_”^Z@b3ZHS_JZ¤¼W…g U6Q(ScJc¥^HZLb1ZS_EZŸg U6Q(S ?dZ_Œ“–Ÿg j WXb1ZH`E]HšJaHSJYJ]Lb.

Q6U]¥dJZW`JaWYJ]H`¹“^Z@b3ZHS_JZt–Rg U+]+X_§[E[+’aVH]` J  YWa «^HZLb1ZS_EZ¢e &¸[E[{dJZW`JaWYJ]H`  JZH_3^ZLb1ZSJ_JZ¹“–½[J[¸Z+SYJVg U+]+X_§[E [ +’aVH]` R  QTS«QWUJQ+aV¢e '¤[E[©dEZH`EaWY]W`  JZH_6šEaSEY]Lb WXHbEmEZW`Œ“–\[E[¤Z+SYJVg ›6]`ÓQ(S_¥ay¼b…gžaœ[ T¿g aE¾6¾t– k dJZW`Ja6Y]H `   l Y6a_JZ “–Ÿg U+]+X6_[E [ +dJZW`Ja6Y]H` ZW_6šJaHSJYJ]Lb 6XbtmEZH`:“ ¸[J[½^+ZH_  [J[„dEZH`Ja6Y]W`  ZW_6šEaSJYJ]Lb WXbtmEZW`Œ“–y[E[¸Z+SYV¢g ¨ “t–y[E[„a¥[E[6–@¼&¸[E[y^+Z_  “#T¿E– `Z_WX6`HS…g ¨ G8K  w+‰3Wx6rxJo3µ 1 II6II6I6II6II I 3w‡8TsJr}w¤z‡w¤ŽJr§p3qr‡W‡EoŠx6oŠrE@s8‚Lz1Hw\o„|R~6wWxWw 3w‡8TsJr}w zJ‡w¥xHw{|R~6+w6xWw”pWw+ŽJ‡3Ls6z1wHsÁƒ.

r+sErLŽ3p6Wr«qLJ  rHs rtLs36‚Lz«wW‡¥xHw}wJ‚@¬Eo6+wM Jz+|Ÿo@stw 3rŽtxw(|.

pHwµHµ 0 Jz|.

o+sEw 1r+Ž8x6w(|Ÿ6pWw‹Ápw@Ž‡t}TŽ1¸²E‡to|.

oLŽ«Wo@²3pHwŽJ‡3  Á I 0 r pHwŽJ‡8Hr+Ž«Wo3M µL‡8oi|.

o@Ž16oL²3pWw+ŽE‡8«‹²J‡to|.

o@Ž1Wo@²3pWw+ŽJ‡3@ 8· ‡ sJr@ŽEx¢‹(‡8oi|ŸoLŽ16oL²1pHw+ŽE‡8+{o W r sJr+ŽEx¢‹  oyxWw+‡£rJLstW‚Tz3w‡·¸‡toi|ŸoLŽ«WoL²1pHwŽJ‡8¤o¤sJr@ŽExWw(|f·„‡v6w§o@Ž3pWr$ƒR‡Wz…qTr6x6wW‡ ‹TrL´Es6zTƒ…r6x6wW‡6„ƒ.

r+sJr¸—1w+s@|1r+s}zL|Ãw‚@¬Eo6w½´«o+sEr6xws¥x6o\Ž6À|.

o@stwH‡£r«qLoWrEH¯s8WwH‡.

M I 1o@‡8Ho£oT­8o$|+ƒfqw·¸x@zEr‡\—8z6ŽtuJo‡¥xHr§‚6‚1qLHwtWopHryx6o ±JrxWr…µ II6I6II  Ž1Tsto£pw|z@|1r¥‡toi|ŸoLŽ«Wo1µ ³r«qw+sxHr¥‡8oi|ŸoLŽ16o1µ ³r«qw+s¹LŽ16pHr«qEµ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ ´Ro@sErx6wHsŸ M 6oJ 1r+Žtxw( | Jz+|Ÿ‚6o+s:‹ L   L 6  J + L îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ « M .

 o M< 3o  :Mh < to .

M      .

6o :M    6o «Mh  Ho .

«M  .

o  .

3  3  3  3  3  3  3 îú  ü ñ ÿ ù KJ!    "#TUT  .

 HÁ      O …*   ´Ro@sErx6wHsŸM 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ ´Ro@sErx6wHsŸ M 6oJ KG 1r+Žtxw(|Jz+|Ÿ‚6o+s:‹ L 1r+Žtxw(|J  z+|Ÿ‚6o+s:‹  1r+Žtxw(|J  z+|Ÿ‚6o+s:‹ .

.+ 1r+Žtxw(|J  z+|Ÿ‚6o+s‹. @7 1r+Žtxw(|J  z+|Ÿ‚6o+s‹. '   ï    ûð$ñ E÷   ý  = 354 )+*+. E  7  !#"%$&"   ' '   ú EþEùAÿ ý   Jú   ü #  ý  Æü ü  ü #   þT$ñ  ý ù üÆü  J:þ ü ñ ý ù ý     ü ù    üOý  ú  Ý.@7 1r+Žtxw(|J  z+|Ÿ‚6o+s‹.-.h 7 1r+Žtxw(|J  z+|Ÿ‚6o+s‹.-0/210 ? /23 *3 3 bYbV3 * " ÿ ü ñ ÿ ú  ü    ñ ÆÿAþ ñ ü J ü ñ O ÿ þ ñ  ü   ý ù üOü      þT$ñ J÷ =H ý   +ïWñ  # ü  þ   ü ñ O ÿ þ ñ ü  ü ñ ñ ÿ ý  ü ý ù üÆü Ÿ J ú     ý ù  ô ù  ý   ü $ï   B ÿ   ü L  *Cÿ ü ñ    ð*ñ   L  ü  +ú ûð$ñ   ü ñ ñ ÿ ý E÷ ûð$ñ   ü ñ ñ ÿ   ï  ý ù üOü   ú # D0D = . . H7 1r+Žtxw(|J  z+|Ÿ‚6o+s‹.

7 «M     8o43 .

:Mh .

Wo43   M «  Wo43  3M   1o43 .

M  <  1  o43  «M W  o43 .

3M  .

Ÿo43 .

«M .

 .

 Jo43 .

? 7 3 E 6 .)29 ? 7 ? = 3 9I. = f - ? 3 E 3..4:4 V3 -.6 3 M O S - 3..9 ?  ? X1879:98. 6 bf 3 -.909I7 E 3.

? 3 E 7 6 1F79:9I. ü    þT*ñ  ú   ñ   ñ  Hð ü  ñÆÿ þ ñ  ü  ûð$ñ  ü  ü ñ ñ ÿ ý  ü ý ù üOü +÷   ñÆÿAþ ñ  ü   *ð ñ   ü  ü ñ ñÆÿ ý  ü ÷ B @T ü   ÿ   * CûúEù  ý  B  ý  F ÿ ü ñ Aÿ ï   ÷ . "ù üÆü  ý  ñÆÿ þ ñ " ûð$ñ  " ü ñ ñ ÿ ý E÷ GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6I&°ts8€Lz1L‰8w10i°q?z6ŽEwM*N GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6I 2R6‚1qLHwtWopHrH‡ @$ G 4353 PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c PRQTS3UWV+XEYZ\[3^L_W`8Q(SdRc PRQTS3UWV+XEYZ\ [ ZJUL_]H`Rc X8^Q(S6d£SEa@b3Zt^ l atUZ}^@_6Yg GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6I 8q(r‡W‡Eo G8K °¹p8q(r‡W‡Eo 0 «o‡6‡Jwr¤s8o*ƒ«s3o+‡to@Ž1Hr¸z@|1rÁƒ…o@‡W‡JwWrË$zL|¦r1q?zWŽtw}wLz¥zL|½ƒRsEwT—. C ú   ú üÆü   ÿAï   $. :.

o+‡‡JwHs x6o¸z+|1r½z6Ž3@‰3o+s‡tWx6rxJo3M 0Ho$|§zL|§ŽJwi|«o…· z+|1r¸|«rE@s8pLz…qTr\o{zL | @°6°¢M  |Ÿ~wx6wW‡£.

‚ W‡t6pWwH‡ˆƒŸr+sJroLŽ«LsErx6ryo¤‡rxWr£x6o½x6rWxWw‡¢M KG UVWaJ^W^½j6 EZE^^]6a k GHG:IJIJIIJIIJIJI6IJI6I6IIII6II6IJI6I6II6IJI6II6IJI6I6II6IJI6II6I6IJI6II6IJI6II6I6IJI6II6IJI6II6I6IJI6I?°.

Ls36‚Lz«wW‡ l X6mEVJQHUhe ^L_6`8Q(S6d£SJ]Lb8Z:g ^L_6`8Q(S6dŠb1aH_`3QWU@XtV6a…g ›VH]6a_¹Q@aWa¢g l `3Q EaH_EZe ^L_Ja_8QHUQ(S_¥SXb3ZW`J] EV+XSE]t^.

g îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñÆÿ ù KJ!    "#TUT .

  Hˆ      …*  l X6mEVJQHU:e GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6IIII6I6IIII6IIII6I6IIII6IIII6I6III .

~wx6wW‡ GHG «~6wWxWw£xHwŠwJ‚@¬Eo6+w…·¸r1q@HoLsJr§r+‡{ƒ«stw$ƒRs86oWx6rxJo+‡¥xHw£w‚+¬Eo6+w GH G «oLzsEryx6w‡rELs36‚@z1wW‡œ‹$ŽJwi|«oŸ·ž|RrE@s86p@z…qTr ]EQ@ Y 6S_`JaWYJaœ“(–Ÿg G G3±JrHxWr£xWw‡§rELs36‚@z1wW‡œ‹$ŽJwi|«o…· H ]EQ@Y£6aEQLY6aÓ(–ŠU]+S8^L_fg GHG  |}|.

~6+wWxWw”o+‡8.

E66pHw¤‡6¯Áƒ.

wWxJo¥rRq@6o@sErHs£rtLs8‚Lz«wH‡§o+‡8.

E66pHwW‡ ^L_aH_8QHUQ(S6_JZH_WSXb1ZH`J] EVX6SE]t^œ“– k ¨ g |1rETstWpTz…qr:·¤r6rW ¨ `Z_WX6`HSSXb1ZH`J] EVX6SE]t^Rg G8K GHGt°.

Ls8‚Lz«wŠo‡8tWpHwy~½r€Lz8o8qTo§€Tz3oƒo@s1WoLŽ1p6o{r£p3qr‡W‡Eo}o©ŽEv6w¥rHw}w‚@¬Eo6w GHG1oƒ«s3o6p+‡Jr¤‡toLsxJoi—ŸLŽ1Hx6w¥xo&ƒ.

w+‡§xHrp8q(r‡W‡Eo KG Q(S6_ j6 EZE^^]6a:eHe*SXb3ZW`J] EV+XSE]t^„¼ Ÿg GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6IIII6I6IIII6IIII6I6IIII6IIII6I6III&°ts8€Lz1L‰8w10i°q?z6ŽEwM+p&ƒWƒ GHGEn.

oi—.

@Ž3Wu6v6wyx6w‡\|.

~Hw6xwH‡ ]EQ@YŠj JZt^6^]a:eH e WS_`Ja6Ya”“– k U+]+X_§[E [ .

HS_W` Z 1U+]T' b ] SJ]Tb8 Z YW] 8aV@XWSJ]"e &1g dJZW_EVtQTSEZœ“@UHQ$S• SE]Tb8Z3–.

g U+]+X_§[E [ .

HS_W` Z 1U+]T' b a Wb3aW_6`3Q6ULX8VWa JYW]ta6V@XWSJ]æe '«g dJZW_EVtQTSEZœ“@UHQ$S•Ôb3aH_`3Q6ULXtV6aE–Rg ¨ U+]+X_§[E [ .

HS_W`Z1U+]Tb'] # JYW]ta6V@XWSE]"e 'Rg U6Q(ScJc½Q@aWa¢g U6Q(S ?dZ_Œ“–Ÿg ]EQ@YŠj JZt^6^]a:eHeWaEQLY6aŒ“–}U+]+S8^L_ k U+]+X_§[E [  ]Tb3 Z JYW ] ta6V@XWSE]"e '¤[E[ÁSJ]Lb8Z}[E[¤Z+SYJVg U+]+X_§[E [ EaH_6`1QWU@XtVW a %e $¸[E[ˆb3aW_6`1QWULX8VWa¥[E[¸Z+SYV¢g U+]+X_§[E [ Q@aWa ¢e '¸[J[½Q@aWa}[E[¸ZSYVg ¨ k GHG:IJIJIIJIIJIJI6I6IJI6II6IJI6II6I6IJI6II6IIII6I6IJI6II6IIII6I6IIII6IIII6I6IIII6IIII6I6III&°ts8€Lz1L‰8wÁ|1rTŽ¢Mp&ƒWƒ Q(S6_\b8aEQ(S “– ^L_W`3Q(S6d”VJQTS "Jay¼  iS «g U+]+X_§[E[.

HS_W`Z1U+]Tb'] S+b8Z`J] JYWZ ta6V+XWSJ]J^JYWatY8Q6^6UJQ l VtQTSta .

“Z+º'H¼E–…e#1g Q(S6_}S6XHb3ZW`J.

] tV+XSE]E^Ÿg U6Q(ScJc{SXb1ZH`J] EVX6SE]t^.

g îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñ ÿ ù KJ!    "#TUT .

 HÁ       .

 …*  U6Q(S ?dZ_Œ“–Ÿg G G LstHr¤zL|¦w‚@¬Eo6w§xHw§H?ƒ.

w H j JZE^^]a l `E]W›Zt^6^H]H`g 0 «o‡6‡Ew6r¥pw|ŽEw|.

oƒRsEwT—.

o+‡‡JwHs G G LstHr¤zL|‰8o6+w+sx6o¥wJ‚¬toHwH‡Šr«q?zWŽEw‡xHwH&ƒŸw H ZEUL_]`œ[¸j JZE^^]a¥c\a6V@XWSE]¦“(SXb3ZW`J] EV+XSE]t^–Rg 0 «o‡6‡Jwr U+]+X_§[E [ .

HS_W`Z 3  U+]Tb&6] SJ]Tb8ZYW] l `J]6›ZE^^]W`e &1g dEZH_EVtQTStZ“@UHQ$S• l `J]6›Zt^6^]W` &SJ]Tb3Z3–.

g U+]+X_§[E [ .

HS_W`Z 3  U+]Tb&6a Wb3aW_6`3Q6ULX8VWa JYW] l `E]W›Zt^6^H]H`he «g dEZH_EVtQTStZ“@UHQ$S• l J ` ]6›Zt^6^]W` Æb1aH_6`1QWU@XtVWat–Rg ›6]`¦“Q(S_UH]S_EaWYJ]H`¥¼W…g{U]HS_Ja6Y]W`Š[\a6V@XWSJ] (^Q6ZÓ–gˆU]SJ_Ja6Y]H`E¾W¾t– k U+]+X6_[E [ JV@X6SJ] ${[E[¥UH]S_EaWYJ]H`Š[E[¤Z+SYVg a6V@XWSE ] (U]HS_Ja6Y]W `  6S_`JaWYJaœ“(–.

g ¨ U+]+X_§[E[\VJQ(S "Ea¢g U+]+X_§[E [ + š   .

 E š.

  JHš J   Wäe &{[E[¤Z+SYVg U+]+X_§[E[\VJQ(S "Ea¢g U+]+X_§[E[.

]Lb8Z JYW] l E ` ]W›JZE^6^H]H`e &  ¸[J[ l `J]6›ZE^^]W` &SJ]Tb8Z}[E[S«g U+]+X_§[E [ EaH_`3QWU@XtV6a   e%'{[E[ l E ` ]W›JZE^6^H]H` Ob3aH_`3Q6ULXtV6a¥[E[S «g ›6]`¦“Q(S_UH]S_EaWYJ]H`¥¼W…g{U]HS_Ja6Y]W`Š[\a6V@XWSJ] (^Q6ZÓ–gˆU]SJ_Ja6Y]H`E¾W¾t– k U+]+X6_[E[\VJQ(S "Ja:g U+]+X6_[E [ JV@X6SJ] ${[E[¥UH]S_EaWYJ]H`Š[E[¤Z+SYVg a6V@XWSE ] (U]HS_Ja6Y]W ` iWatQLY6aŒ“(–Ÿg ¨ ¨ U6Q(S ?dZ_Œ“–Ÿg `ZH_HX6`HS"…g G8K oL‰3‡Jvw«µ R ª+‡rELs36‚@z1wW‡£€Tz8o}pHwT|ƒ…wJoi|§r§p8qr‡W‡to„ƒ.

wWxoi|”‡toLs}x6oŠxJ—.

o@s3oLŽ«Wo+‡H&ƒ.

wH‡M twoL­3o|ƒ"q(w{z‡r}x@zErH‡Š‡tLstTŽ´E‡¢·ˆzL|}—¢qwWrE½o©zL|”‡t+rJWWpTŽ31M ª+‡\|.

~Hw6xwH‡y‡vWw\zL| pHw+Ž«Ls6z1wHs¥o{zL|¦xEo+‡3LsWz«wHs”‹‰3@‡t+w‡\ƒŸwH‡3Wo+s8HwHs@|ŸoLŽ16o z@|1r{—EzWŽtuWvWw§x6o  Ž1@sErx6ryo½w@z1TsJr}x6o¤±JrxWrM KG G8K 1w+‰3Wx6rxJo3µ II6II6I6II6I  E66pHwW‡  ‡w¥x6o¥rtLs36‚Lz«wW‡¥o„|.

~Jwx6wH‡§o+‡8.

±JrxWr…µ II6I6II r+Ž8xs8o i|Ÿo@s8p@zs3Hw +r?ƒI 3ªª  ‡Jr+Ž8x6w 3 3 M&G1rRM@w+z3  Ž1Tsto£pw|w\ŽWÀ@|RoLsEw§x6o½r1q*zWŽEw‡xHr£xJ‡tp?ƒfq@LŽ8r‹@o(­ W:µp µ ŸM&°:(M 2Ro3q6q@LŽ1  Ž1Tsto£pw|w\ŽEw|Ro½xHwÁƒRsEwT—.

o+‡‡JwHs îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñÆÿ ù KJ!    "#TUT .

 ˆ     .

    Ž1Tsto£pw|r{|«rtLs8pLzq(ryxHwÁƒ«sEwT—.

 °q*zWŽEw  Ž1Tsto£pw|w\ŽEw|Ro½xHwŠr1q*zWŽEwµ JwWrWw¥xHr¥±t3q?‰Er  Ž1Tsto£pw|r{|«rtLs8pLzq(ryxHw}r1q?zWŽEw:µk  Ž1Tsto£pw|w + °W°xHw}r1q?zWŽtw:µv<  °q*zWŽEw   Ž1Tsto£pw|w\ŽEw|Ro½xHwŠr1q*zWŽEwµ «ox+sJw  Ž1Tsto£pw|r{|«rtLs8pLzq(ryxHw}r1q?zWŽEw:µk  Ž1Tsto£pw|w +°W°xHw}r1q?zWŽtw¢µ  IJIJIIJIIJIJIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6II  6 ° 1ªn   3ª   ±±Eª  ±  °   8ª±hµ IJIJIIJIIJIJIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6II 8w|.o‡6‡JwHs¢µ.

o½xHwÁƒ«stw(—.

o‡6‡Ewsµ …M&°:M 2«o1q6qL@Ž3 «rELs36p@z…q(rµy IJIJIIJIIJIJIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6II °q*zWŽEw 8w|.

o½xHw}r1q?zWŽtwµ wWr6w¥xHr½±t8q?‰Er «rELs36p@z…q(rµ rWr¦µ h  IJIJIIJIIJIJIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6IIII6I6IJI6II6II °q*zWŽEw  8w|.

o½xHw}r1q?zWŽtwµ 1oxsJw «rELs36p@z…q(rµ rWr¹µ  KG   '(" ('(" !#"%$&"  ï IH ý  $#Eï  ûð$ñ  J  ý ûúEÿ ù   ü QH   ü ú    # Oÿ ú     ü  E÷ x ü ñ   ü ú  ð  ý ú  ú iù ý  Eÿ   " ð*ñ  E÷ ï  H ý  ý !   ûð$ñ   ý ”ú .

 $ñ ü J  ý ûúEÿAù ! ï  H ý  ú  ï   ûð$ñ   ü ñ ù ý ùAÿ tT ïHñ  ý   ü ú   *ñ  ü ÷ iú ÿ ü  ?C ý ñ   ûð$ñ J*ñ Oï ú  ûù ý ù ï   ü ñ H ÷ G þ ü  H L  *Cÿ ü ñ # ÿ ü ú üÆü  ü ÿ ïHñ #Ýô   J ÿ O ÿ ü JJÿ ñ ð ï   ûð$ñ   ü ñ  $ú ÿ ü $ñÆï J L  ý ï ü   ñ ûú  øú ý  üÆü  $ïWñE÷ J   $ÿ  ü ñ úþEù#    ý Oÿ  ü  ü  ð*ñ   ü ÿ ïEùAÿ ï@÷ ï   ûð$ñ  ÿ ïEùAÿ ï ð  J ý û  úEÿ ù  #.H.

-0/210354 D0D `                               . 6 = = D0 = D 1 > 1 Q D0D @ A+.8A ? = S GIH+3B.M d = 7 . g 1879:9<. F ?= S 7 A > GIH+3M S:> A > 9I.  ú üOü   $ï # #   ð*ñ  J ý ù ý  ý úEÿ    ü   ï  ý !   $ù  ü ñ ü i ï  ý !  E  ÷ "  ü   L   ý Oÿ ý  ü ïHñ ÿ  ü  ý  ü  ?J ý  H ïWñ  #   &  HÆ ÿ-# ý   ñ ÿAú E  ÷ )+*+..

RC =  -0/21 .8*8/21 > > `= D0 = D = >= 1 >0? = 3 [ /  707l[ >0? 3 d D . F + ?= S >0? ` . > = [ 3 6 Q S0> >+? A .K . > = = .

= C = .

R E .8Q > l[ .

>0? A+7 6 g7 @ .

- .

O = ? 7:7 = /7187 @ 7 7 >0? =C 6 E 9F3 @ = 3 îï Oð . >0? A3 E 7 6 1F79:9I. 3 E ? bf 3 E 7 > 378A S .8Q E > 3 E . > = . O = C E f 3 1 > = 9 = .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ .  6 /:/ pf M > = 1 > .O îú  ü ñ ÿ ù KJ!    "#TUT .

> E 3 @ Q X GIH+3 5MPO#C S:> C D0D   e = E 3  . Á     Ÿ = = d = 1 >   .

  3 E ? 4:4 Q    bf 3 S:>   =  > X =   1 GIH+3 5MPO >   l[ `d       /23BA S . >0? A3 E 7 6 187909I.  .   ..f D0D @  .8Q = E = > 3 79:9 E - . C 46012(460 . Q3  6 /:/ = E .   = .

 ü  L     B _T ï *ÿ ý ù üÆü /-J ý ù üOü @÷ G ÿ    .+ F ý ù Æü ü  -J ïHñ E÷fî¥ùAÿ ü ñ    ÷ <  E ïHñ ðÿAù ü ñ  ü   ÿ$÷ G þ ü #QH  ü    ð*ñ   ü  :ñ ! ÿ üŸü # * CúEù ÿ ý   ú  ü ñ O ÿ $ ïHñ +÷…î ý ù üÆü  -J ü .W2 5ß0ß5=0Ÿ4 w    ð*ñ   ü ú L iï ü J D ûñ "”ù ÿ ï ! ÷ w    ð*ñ   ü L  ü  *C ý ñ  ü  ÿ ü  úEÿ  $ïHñ +÷   ü ú  ý ÿ-# ý    ÿ ïJù ÿ ï ð  ü   ü ñ  ú  L  ü _T  iÿ-ñ ü ü þ ü ñ ÿAñ ÿ   óï  ü ú ÿAù "ðSL   ü ù  H +÷ ý !  J  ý  E w    ûð$ñ      ï  J  ý  úEÿAù tH ÿ  üÆý ï ü ÿ #    ü ú  ý ÿA# ý ÿAïEù ÿAï+÷ w  ÿ   ÿü  E ú ÿ JJú Æð# ü   ûð$ñ   ü ÿAïEù ÿAïñÆï  ý  E w G w ÿ ïEùAÿ ïðøÿ  ù«ú  $ñ Æï UH ù ü ÷  ÿ$÷ ûð$ñ  *#tïEÿ  iïHñ   ý ù    ý ù üÆü ðøÿAïEù ÿAïú    ùAñi÷   w   ûð$ñ " ý  ü ÿPH r L  ý !  ü D   ü  W'fï  ú   ü # ÿAïEù ÿAï+÷ w w  *ð ñ   ü ÿ ïJù ÿ ï ÿ  J ú ùÿý ¥  ï ï ý  üOü ÿ    ü   ý ûúEÿ ù ¢ñ  ü ü þEÿ þEùAÿ+ñ ý ü  J ü _T J ü øAÿ ïEù ÿAï ý   ý ÿ  J÷ ü     ü   îùAñ i.

:î  L ÿ H  O(ô -J +ïWñE÷ ! ÷ GHG:IJIJIIJIIJIJI6I6IIII6II6I6IJI6II6II6IJI6I6II6IIII6I6IIII&°Es8€@z3@‰tw½o ŸI0 3w@Ž3+wM$N PRQL›SY6ZW›”‘j J]HS_J]J‘ PtY6ZH›tQ(SEZœ‘j J]HS_J]J‘ G8K n«oi—RTŽ8o¥r£p3qr‡W‡Eo 0 8w@Ž3w n«oi—RTŽ8o¥w£H?ƒ.  ý  Eÿ   ú  ÿ  úEù  i ïHñ  ÿ ïJù ÿ ïæú  ý  Oü ü   ü ñ Oÿ þ ñ  ü ïHñ  ü  ñÆÿ ùAÿ ú  ü ñ #Æÿ  iHï ñ @÷  #  TPonto +x: int +y: int +contador: static int = 0 +Desenha(): virtual void ÿ    ÷ < .:î * ý ù üÆü %-J ïHñ E÷ F ÿ ü ñÆÿ ï   ÷ .

w¥x6o\zJ‡Wz Hs8Hw KG 0 8w@Ž3wM îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñÆÿ ù KJ!    "#TUT .

 ˆ     .

  < UVWaJ^W^½jW ]S6_] k GHG¢IJIIJIJIIJIIJI6II6IJI6II6I6IIII6II6I6IJI6II6II6IJI6I6II6II?°RLs36‚@z1wW‡ GHGpHw+Ž«Lstw«qLo¤x6o¥rpWo+‡W‡w l `J]W_JZtU@_JZ6Y:e GHG.

rtLs8‚Lz«wH‡¥x6o¥w‚@¬to6+w QTS6_yº¢g QTS6_y»¢g GHGŸrELs36‚@z1wyx6o}p8qrH‡W‡Eo ^L_a_8QWUQ(S6_”U]HS_Ja6Y]W`g GHG¢IJIIJIJIIJIIJI6II6IJI6II6I6IIII6II6I6IJI6II6II6IJI6I6II6IIR~Hw6xwH‡ l XWmEVJQWUhe GHG W w+ŽJ‡3Ls6z1wHs£xEoi—«rz…q+ jW ]+S6_J]“i–eƺh“ E–…•Æ»h“ t– k U]HS_EaWY]W`t¾W¾g ¨ g GHG W w+ŽJ‡3Ls6z1wHsŠ‡EwJ‚@s3o6pWrs6s3o(´1r6x6w jW ]+S6_J]h“@Q(S6_Š‘Tºæ•LQ(S6_§‘@»1–…eOº:“i‘@ºR–Ÿ•Æ»“(‘@»«– k U]HS_EaWY]W`t¾W¾g ¨ g GHG W w+ŽJ‡3Ls6z1wHsŠx6oŠpH¯*ƒ…r jW ]+S6_J]h“@U+]+S8^@_§jW ]+S6_J]t k ºy¼ l ƺ:g »y¼ l Æ»:g U]HS_EaWY]W`t¾W¾g ¨ g l – GHGEn.

o+‡8@sWz«ws½‰3@s1Tz8r«q 1QL`6_6XEaJV WjW J]+S6_]f“i– k U]+S6_aHY]`  1g ¨ g GHG3±to6rÁƒŸw@Ž3+w Q(StVJQ(SJZ ]tQLY}6Z_¢“ij6 ]+S6_]3 l –Rg GHG3±to6rÁƒŸw@Ž3+w Q(StVJQ(SJZ ]tQLY}6Z_¢“@Q(S_y¤ºf•QTS6_yy»3–.

g GHG «~6wWxWwœTŽ…qTTŽ8oxJoi—ŸLŽ1Hx6w¥xoTŽ3TsEw}xHrp8q(r‡W‡Eo Q(S6_ 6Z_Wº“i–}U+]S8^L_ k `Z_HX`HS}ºfg ¨ g GHG «~6wWxWwTŽŸqLTŽ8o.

·¤xJop3qTrsErx6wyr6€(ztŸ·¤xEoi—ŸLŽ3Wx6w©ŽJw£rs3€Lz3@‰tw¥p&ƒ6ƒ Q(StVJQ(SJZ”Q(S_ 6Z_6»“i–8U+]+S3^L_g GHG «~6wWxWwŠ‰8@s8(zEr1q8·¸xEo+‡8oLŽNtr¸wÁƒ.

w@Ž1+w 1QL`6_6XEaJV ]EQLY EZE^ZHS"ta…“i–Ÿg GHG «~6wWxWw  8 ‡ .

EWpHwyo¥pw+Ž‡t ^L_Ja_8QHUQ(S_ J  ZH_J]SJ_JaWYJ]H`h“i–Ÿg ¨ g îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñ ÿ ù KJ!    "#TUT .

:î  L ÿPH  OTô -J  GHG:IJIJIIJIIJIJI6I6IIII6II6I6IJI6II6II6IJI6I6II6IIII6I6IIII&°Es8€@z3@‰tw10 3@ w Ž3+wM+p&ƒ6ƒ PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c PRQTS3UWV+XEYZ +Z HjW ]+S6_J]  "  GHGt°. Á     Ÿ + P8Z+SYtQL›  ïHñ J÷ ý úEúR÷ F ÿ ü ñ Aÿ ï   ÷ .

Ls8‚Lz«wH‡o+‡3E66pWwH‡¥xHr§p8qr‡W‡to£xoT‰8oi|”‡toLsxJoi—ŸLŽ1Hx6wW‡½xHr¥‡8o(´Ez3LŽ«Wo—«w+sL|1r GHG…H&ƒŸwyŽ8w(|Ÿo6p3qTrH‡‡toRµHµTŽtwT|.

oWrELs36‚@z1wc¤‰Er1qws Q(S6_}jW ]S6_]æeHe@U]HS_Ja6Y]W`\¼W…g GHGEn.

oi—.

@Ž3Wu6v6w¥xWw‡¤|.

~Hw6xwH‡½x6o ]EQ@YŠj6 ]+S6_]eHe$WZ_:“ijW ]S6_]t l – k º½¼ l  6ZH_Wºf“i–Ÿg »½¼ l  6ZH_W»f“i–Ÿg ¨ 0 8w@Ž3w ]EQ@YŠj6 ]+S6_]eHe$WZ_:“@Q(S6_yŠ‘Tºä•QTS6_y}‘@»«– k º½¼Š‘@ºhg »½¼Š‘@»hg ¨ Q(S6_}jW ]S6_]æeHe 6Z_W»“i–ŠU+]+S8^@_ k `Z_HX6`WS}»:g ¨ Q(S6_}jW ]S6_]æeHe ZW_]HS_EaWY]W`¢“i– k `Z_HX6`WSÃU]HS_Ja6Y]W`g ¨ ]EQ@YŠj6 ]+S6_]eHe EZE^ZHS"ta…“i– k ^@_6YfeHeTU+]+X6_[E[JSj6 E]SJ_J]¢e    ]]H`YJZStaWYaHºE¼'{[E[ˆºhg ^@_6YfeHeTU+]+X6_[E [ JSj6 E]SJ_J]¢e    ]]H`YJZStaWYaH»E¼'{[E[ˆ»Š[J[8^L_6YfeHeiZ+SYJVg ¨ F ÿ ü ñÆÿ ï   ÷ O6.  ü   ûð$ñ   ü  ñÆÿAþ ñ  ü   ý ù üOü @÷ GHG:IJIJIIJIIJIJI6I6IIII6II6I6IJI6II6II6IJI6I6II6IIII6I6IIII&°Es8€@z3@‰twžƒ1sEwT´:Mp?ƒWƒ PRQTS3UWV+XEYZ\[1Q@]J^L_W`JZWaTb:c PRQTS3UWV+XEYZ +Z HjW ]+S6_J]  "  X8^Q(S6d£SEa@b3Zt^ l atUZ}^@_6Yg k GHG  ­3oi|HƒfqTw¤x6o£p+s8Hru6vw\o¸z‡w½xHw£w‚@¬to6+w Q(S6_yb8aEQTSf“i– k 0 3w@Ž3+w Q(S6_yºŠ¼{¿…g Q(S6_y»Š ¼ g GH G LstHr}wJ‚@¬Eo6+w£xHwH&ƒ.

w jW J]+S6_] l ]S6_]hg 0 3w@Ž3+wpw(|ŽEw(|RožƒŸw@Ž3+w îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñÆÿ ù KJ!    "#TUT .

   (  õh  1        GHG LNJr(|1r¤|R~6+w6xWwŠ±to6¤xHw£w‚+¬Eo6+w{ƒŸw@Ž3+w l ]+S_] *WZ_:“ º:•?»3–.

g l ]+S_]  JZt^ZS "Ea“i–Ÿg ¨½GHG1‡r\x6o£o@‡tpw*ƒ.

w£o½xoTsJwo¥wŠwJ‚@¬Eo6+w¸ƒ.

w@Ž3+w ¨ GHGŸpLNJr(|1r¤|R~6+w6xWwœo@‡tJHWpw·¤wJ‚+‡8o@s6‰3oy€Tz8o¤ŽEvWwÁƒ«s3o6p+‡Jr\x6o¸zL|¦wJ‚@¬Eo6+w U@]@XW_…[E( [  J]SJ_JaWYJ]H` H ¼ '¸[E[{jW ]+S6_J]æeHe JZH_ ]SJ_Ja6Y]H`:“i–\[E[¤Z+SYJVg `Z_HX6`WS 3g G8K ±JrxWr…µ II6I6II6I r+Ž8xs8o i|Ÿo@s8p@zs3Hw +r?ƒI 3ªª  ‡Er+Ž8x6w 43 3 M&G1rRMLw@z1 8w+Ž3+wµ Ww6wHsExJo@Žtrx6r©­  8w+Ž3+wµ Ww6wHsExJo@Žtrx6r©® Ww+Ž1Hr6xws  KG   " " & &%$ & !#"%$ " w G ü ûð$ñ  ü ú EþEùAÿ ý  ü    ÿAïHñ   ý  ý ù üOü   BH¦ñ #äï  üý ù  ü  ïJÿ    ü ÷ w   ûð$ñ   L ùPL   ý iþ   +þT$ñ ý +ï ü ñJ ü ñ   *ð ñ    ü  ú  # ý  Æü ü   ü  *ð ñ   ü  ï ü ñ  ü ñ  þ T*ñ J ü _T J+ï ú   ý  üÆü   ü  ð*ñ   ü L    E-ÿ # ý    ü ñ    þ T$ñE÷ ý     ú   $ñ     à ¹ú .

-0/210354 )+*+ ? ` /23 .  $ ñ ý ï ü ñ ÷ w ûð$ñ   ï  ù-ñ #  ü ñÆÿ þ ñ  ü  +þT$ñJ  ý ù     ü   ý   ý ï ü ñ÷   w  ð*ñ   ï  ð   EÿA# ý  iïHñ  ûð$ñ Jtñ  ï ü       ü    w    ð*ñ     ïEÿ ú ù ú  iï ý ÿ ù  $ïWñ  ü ñ ÆÿAþ ñ  ü    ð$ñ     ü ñ   þT$ñ J÷  û w     þ  ü ñ ñ ÿ ý  ï   ý iþ  ú ïHñiÿ ñ ! ÿ ü J ü @T Jï  ü þ =L ù þT*ñ  7   *ð ñ   ü ñ ý  üOü ï E÷ w 7   J þT$ñ J iù  úH H $ù iïHñ õð  ú  Æü ü ÿAþEÿ ùAÿAñ  ý !   ûð$ñ   ü $ï ý   ü J  ûð$ñ  NH *ñ Oï   ¹ù H ù *' ÷ þT$ñ  = ..

?FS D0D A > = MPO  ? g 9 C d 9F3 MM 3. A+.

 .

 MPO O .

 MPOKO .

^ MPO#C îï Oð .

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ îú  ü ñ ÿ ù KJ!    "#TUT .

  .

 .

     .

!.

+ '   ð*ñ   ü J  ü    ð*ñ   üý  ü þ ý   &%$ &  $ !#"%$    ü  ."  þ ý     *ð ñ     ï  J üfý  £ñ ÿAú  ü   ú  Lô ü ý    ü      ð*ñ   ühü    #  ü    $ñ ü  ï  #  ú ." ú DAñ ùKH   ü ú ü $ïWñ  M  ü ñ ý J ï   üäý ”  ú   $ñ  ü E ÿ   $ïHñ  ü ÷ $#  % &('    *) &   $ " .

NM @ 3 = E Q S:> G8H+3B.Q ^ D:D  >0? [ [ Q1:387 ? Q1:387 ? 87  +î ý ÿ *#tïEÿ ÷ G¥ý  úJÿ ù "ÿ iïHñÆÿA# ý L   C      ñ ÿú  ü  M  ? CûúEù þ ÿ-CJ ü  ï  ÿAïHñ  ý !   ú Æÿ  $ÿ  ï     ý ù  ÷ G ü _T J  ý ûúEÿ ù   ý ï !  ý  L ù  ï   H  ý SL    H#Æÿ-# ý ï  õñÆÿ ú    ü ú .NM  Q = 1:387 ? @ 3 E Q S:> G8H+3B.  $ ñ ü Eÿ  iïHñ  ü ÷       #  ù ý    ü û  ð$ñ   h  ü ü ü þ ý     ñ     ü  õï  J $ù ü  ù ÿ þ ü ÿ ý  iHï ñ   ü  ñ   ÷ $# /#  021    " 3)  $  $ " ' & ?CûúEù ü   ÿ  ý ù  ûð$ñ   üäý  G = -0/210354 )+*+. = 3 = E Q S:> G8H+3B..NM @ 54 54 64 = $[ * >0? >0? $[Q1:3F7 * $[ * Q1:387 ? ? O#C !&    ü  õï  J ûð$ñ  üæü +þ ý    ü ÷ =   D:D O#C >0? .+ $ O#C = [ >0? >0? D:D  = 1:387 ?  .

 * ñ  ü  ûï    ú .

9:9I7Q S:> GIH+3B.. 6 .  $ñ ü ÷ ý  üOü R = *+.-0/210354 )+ 2Y * >0? Q S:> GIH+3I.NM 54 = ^ C *$[ 4 >+? O#C Y+ZC = D:D . D:D 5 = >0? [ >0? H  L    õï   ü ú .

8A:A3   E .NM >0? [ = >+? A2O C D:D Z  I.. 6 1F78A+7 E 7 .  $ñ ü ï õð  ü +þ ý   J ý  úJÿ ù  Eÿ  #$ï ý ÿ  ñ ÿ ú  G þ ü   øï   ï  + ÷ = *+.-0/2103 )+ >0? Q S:> :9 = GIH+3I.

        R  .

   =   # JHú + ÿ ü ñ #  ý  ø  ú .

8A:A3 A+. 54 ñ ÿAú "    $ï ý ÿ ú  õñ ÿAú E÷ G w = QM = >0? 7O#C QM K7O#C >0? [ D:D . 1878A+7G8H+3 6  iïHñ  Eÿ  #$ï ý ÿ   ï   ü ú .   üäý ÿ   ü þ ÿ- C E. E . ü   ñÆÿ ú n  L ï   G ü @T J$H ý   E Q S:> GIH+3B.  $ ñ ü  ÿ ü Aÿ ïWñiÿ  ü J$ú * ñ ÿ ï    ý ù    M  = * CûúEù ý ÿ =  ý  BH  ü ñ  ñ $ ïWñ üõý ïH ü .NM *$[ O#C ÷ @ 3 >0? >0?  ý ù  ûð$ñ   üäü  þ  ý   ü ÷.

 $ñ ü ï  ð ü þ ý   ÷ w  = = l[ QM = 0 > ? QM w   = >0? 7 6 >0? [ .

6 1878A+7G8H+3 ûð$ñ  ý ”ú . E . O#C E >0? [ D:D .8A:A3 O#C A+.

 $ñ ü   ù-ñð  ü +þ ý   . = @ 3 E D0D 6 A = i = +3 3 D0D @ >0? = M E = 7 309 3 = E +3 3 3 E +3 3 D0D @ = [ 7 = 3 9 f - = ? [ .

>0? i M = >+? 7 [ = >0? .

i M 7 [ >0? .

>+? >0? = 3 E = 3097.

 ü ú O. ü ÿ ïHñ    ÿ ü ÷ Oÿ ü  ý  ïH# ü .7 [ O 6 Y FO#C = *3 >0? 6 Y 8O#C C w G ü H ù  ü  $ñÆïûï  ü  H ù ÿ  ü # w   ûð$ñ  ü þ ý   " ý iþ  ÿ ïHñ J    ï ý ü ÷   ü þ ý   ÷ ùAÿ ü  ü ú  üÆü D H$ÿ üæý ïH ü . ü  þ Æ-ÿ ñ  ü  ý ô úEDAñ ù  <  '*÷ w w ï   ú $ù  ð*ñ    ôî üÆü ÿ ï ñ < ô ˆï ý  üOü  ô ˆï ý  üOü ô ˆï ý  üOü ûð$ñ    ï  ü þ ý    ð ý !  J  ý ûúEÿAù   ý *ñ  þ ü QH ï  ü L iï ý ÿ . ü ñ ñ ÿô  ð$ñ   ü * ï $. ü $ #EïEÿ ü ú iù  ü Æÿ E÷ îï Oð . üäü  þ ý     ü L  * C ý ñ   ü   ü   ü  ú  ý  E ÿ  $ ïô 7/  ý +ï<T ïHñ   û ñ  ü J  üü +þñ ÿ ú  ü Eÿ   iïHñ  ü J3ú   ü  ü þ ü ñ ÿ-ñ D  ü ú  ûð$ñ  ü  ï i. ü  TT ÷ O ÿ ü  ý   ïH# ü .   ûð$ñ  ðñ+ñ ù  $ïHñ  ý +ÿ ï ý ÿ $ïWñ+÷ Oÿ  ù ÿ  æ  ú  $.

Oñóò iïõôhöäöäöø÷áùûúJñ÷  üÆý ÷Ðþ   ú ý  îú  ü ñ ÿ ù !    "#TUT .

  .

  " .

  .

   .

"      .

  "  M  ü ñ ý ú Añ úJù ü  ü   ÿ ï ûÿ ý  ü J  J ú  ü  ý ú -ñ ù     ù ú ü $ïHñ ú +  ïWñiÿ  ü     Wñ ô ü   ü       " " .

'$    ï ü ñ  ý ïH# ü    ú  ïHñiÿ ü ÷ x # ô ü ý  ô ü   ü ú ïHñ iÿ  ü J ü ú ïHñ $ÿ f  ú +ïWñiÿ  ü ú  ý Oÿ   ü   þ T*ñ  ü ý ù üOü  ü J  ú ïHñ $ ÿ ñ Eÿ ü J  ü   ü   ú ïHñ $ÿ ü ú  ñ Oÿ þ ñ  ü   ð*ñ   ü   ý ù üÆü +÷ M  ù      ý ÿ ü ÷   "         ü þT ü ÷    ý ù   ú iÿ ü  #" Jtú  $ ÿAú  UJ %"& ¹ú  iÿ E÷     ü ÷ !Æÿ  $ÿ ý Æÿ (' ü   ú  $ÿE÷.

 ¥ ¦   iÿ  ü ü   þT  üøý T  ý    "   # ú ý   #  ü     þT û  ú $ ù ü Oÿ üOý  J ü _T ú  ý  Eÿ     ü   ü ú  i ÿ  ü    ú G               T     L    @T        ! - 4- *        .0 . . 5s)%** .7 4 ! #2 8:9<.0 *p  – ¤‘./  ‡ Œ2 *p*   / 2 . .5”“[*p  q‰  / p .5c6 T„    s20  ‰   *    . (' *  /2 0  / 1. 2   / A  ./ 5 %.    .*5… †  .  *‘‡  P* . . . 2 / . *:2   .  /      #3  .  *A –  4 0—  / A  .  4n„  5 6  *   20 .   † 0    P 4n„! 5    0 ..  ]¥  5 ¥ 5 * .*p    #     4„  !*  ’2 . . .k2 . š!5   †  / Ž ž  Ÿ *p . 0  J  .*  † 0 %˜  * T„ ‰ ™2 /  P2   . 2  5 .    / .2  * 3 .FE GGIHJ!KML#NPON(QRTS!KUJ?N RVKWONYXZON(QR[S!KUJ?N]\_^#`bacacd RVKWON#NeVfgS!R[N<d GGIHZN(hiN<jLkN]S!QmlnS!J?SpoqNrlnN]NeVfgS!R[NsQtNuON(QR[S!KUJvN ON(QRTS!KUJ?N\%wxNeVfgS!R[N<d GGZ`DyL NPON(QR[S!KUJ?N XVON(QRTS!KUJ?N]\zLh|{nN<dbGGtLJ~}sL<(S!QmLrLh|{nN QtN#NeVfgS!RTN € 2 ?( . . * 4n„ ! *  .  .* ?q2 ..' * &5 6 #2  2 .¢2  £*  .‹  .   † 0  Œ0  †  ? / *   5 ¡ _2   ../   Ž  / . # *p * ' * / .*:*?‚  * *ƒ2  * 4.2 q? . 2   s  k  q.  "  * *2  .  † •2 ..=?>=A@CBD. ‰c2 **  Š2   .*p . vš  "  ##3  "4n„  "    † 0   † ›*    œ˜  3#  .  / p  . . 0 0 H .  .*  g† *     s20  . /  *  2 ‡  ˆ  . ¢2   / p  .)+*.

¥   .

 •¥  5 ¥ 7    / 0   * 2   ...5    )+*+.-0/210354  D0 = D .7 79:9:3 *= >0?  D0D A D0D = C 3.  Passo 2: Passo 1a: x lixo x 3 1503 1503 ptr 1503 Passo 1b: x 3 2673 1503 Passo 1c: Passo 3: x x 7 3 1503 ptr NULL 1503 ptr 1503 2673 2673 7 ¤‘.

:AI- = 7 79:9:3 >0?  = / D0D .= D0D . E 9 ? E 3 A 6 7FA ? . A3 1F. >= E 3 D0D 7 E . @ 78A 3 ! = C 8. ? ? 9 D0D . . :. 6 D0D / D0D 9 * 3 BA 7 > E -27 3 > 6 $ . 7 .</ ?   7+1:3BA @ S 3 .

/ ? A / ? A A 9 A 26 1 .GF3  = 7+103BA @ /78A+7 3  && "#% ' D0D /. * M > $ 3 > O -. ? - 3  && (% ) /23 >0? . +7 D0D 8. > -27 6 . =  A3 E 3 ? 6 78A . 7 >  7 ? 3 3 -+/ 6 7 E S0? 3BA  7 E 6 79I7 . 3 = >0?  . :. > 7= . A A *.- .FA+.- 7  79:9:3 3 E -.B- .+:*C .FA3 = /23   >0? 6 3 > 3 -..3 D0D 79:9:3  / ? A".N 0 C ? 9 ?  6 ? 3 >0? 6  D0D 3 > E  D0 = D .

D0D D0D . = * .  S 6  79:9:3 *"#C /23 ? 33 7  6 3 .> 3 -.

+1F. > )  p .3  3 1 . :. ? 3 *K9 S 7 /309 GIH3 E .8A. *  /78A7 *  6 79I7 S -7 > 3. > 7 7 > 6 79I7 E . > 3 E . > @ 0  7+1:3BA 6 3 >0? @ 7 A7 3.8A+. > E .- 3 .GF3 -27 6 E 3 = ? .7FAI-7 . +7 E . E .  /- 1:3 3 / ? " A = .8A+..GF3 A3 /.G:3 E . * M 3 @ O 7+103BA = .

.*  . A  6 .GF3 7 E E 6 79I7 . p54  '768686 5|0s2.<A+. / ? .8A+.g5 Ž * / 5 4 E 7 ?  .

)%2 *A . 3g‚ !   "#9 TUT  ..0 .

!    .

      .

  .

.

 .

  ¥  . @  7FAK7 ?  * 4* † &   s20 / .  =  = D0D 9 ? A S GIH+3</78A+7 18. *  2 ***7 ¥ 5   / 0  3g‚ s2   .

  ".6 . 98.  ..  5>J7 Es7E f7 @7 ¡ 9 † 9 I. .' * * 4n„  * . 9 5)>@7 A< 5  H7 9 > 5 7 5t>@7!E7-E £¢ D¨ S¨{ª 9 < < < 9 A< ¡6¤ S¨ A< 9 œ< 9 7 85 r5 < ./ * 2 ** ..‰n2 2  r2 .=?>=A@CBD../ * 65  . @7 9 A. †/ 5 u -—† 2  * / /  * 5 ?‚ † / *p  *2 .‰ * 9 < < 9 ML 9 6. *   †n.@E 9 g< :5 9 @<t.  * 4n„ ! *‰ ** .. *.J7{< 9 <E< AKE wvx.‰  / .@<  †JÈIȜƒ€~   54  '768686 5|0 s2.A< 7E } @~€‚|ƒ…„A†g‡ 57 > ru <>A< *+" .:2  9 5!>@7 E7-E :5 H7 9 > < 9 9 < E7 r9 5 @7 @7 9 7 85 D5 =< <?5 9 @<.  > ..0i *2 . q0 40 / . A 18./ † /.‰ . 9 J.4 .0/ -1 #21 / 5 9 D7 85 > A<E <?E7 * 4n„  * . 7E FG< 7!5 r5s< 5 9 5  D75 < 9 <B7 @5{>J5 H5 M5 C< 5 65 D7 85 D7 =5 A< 9 5y< |< E 9 87!>@5 r5 <>@5 J.03 ‚ ‰ 0 •2 .$.0 / 2 / . 0  4n„  * .@E 65 =7-E)< 87 r9 5 @< 9 < ¦¥W¢€§ 4© 4© 0« ­¬ †—„I°|±Iƒ³² |µ?~·¶œ„nƒ¹¸@ºI†»AƒµŽI»J†Aµ¹@ƒ‚†¼~€€„A~€½f†?A~¾ƒ¼†?f¿J†€f†JÀœƒ‚†—„Á°I»IJÂ@µŽI»  A†ÅƵ…I» ‰ |µ?~·¶œ„¾ÇJ†»|ƒ?‚¿J†¾}~œf~J}¹»J†œf†JȂ†¼~œ„A~€½f†@~Ƀq†?J¿f†€f†JÀcƒ\†—„‚|ƒ¹„A† !1 @> ž< D¨ } @~€ÆÃi|ƒ¹„A† )  ru <>@5 :5 µ…I»ÄÃ_°I»IJÂ@µŽI» ´I´ 5 5E 87 9 H5 9 85€..- ./ ..5 .* . .qB 9 t. B 9 .0 . .5  * 4n„  *%*‚ q0 / *  r2  † ! ./  5 *P2 ‡ 7B>@7 :7 C< 9 T$UWVJXY[Z\Y[]I^WV_Ua`MbcZedfUg]ih jSk lgmnjSo6UW]qp >@<Es7E 3 . ..* 4n„ ! * .@7 @5 1|ƒ % !1 A†ÅÄ} @~€ʇR»J~—„|~? rE Ì.‰ † T„  s2 0 7 . r 2 / * k  &2  † .JE27 85€..* –  .0 H5  r<Œ>@7 .0 ./ *5 I.. =< % # -.Ž * / 5 4 9 87 Ë. ! / .  ‰ .%  6 * z 2  .  D5>J75 >J7 7>@7 >J7 >@5 D7 85 <t.JE 9 5 < ®f¯  ´I´ >@7 9 @5€Es7 < 67 A< A< 7 9 ‹  < 9 5>@7 9 <t< E)< 9 < 9 E< u 7 A< >@7ŒŠ‹ =7 9 7 [L A<075s>@7 <>J5 M.*A  p.yLnN ?d 67 9 < ‰ 9 <E<>@5 =7-E ’‘|“a”c•—–@˜™‘|•&š+”œ› 5 # €ˆW‰ @5E7 =< 5 @>@55 4  –*A .3 q  *5 / / *p Œ2 . 9 5 r9 =<E< 7 8<t5s7 !1 €  s20 * s‡ s2 .g5 .C #+0*C * >0? A ? C          = /  && "#% ' A ? 5 ¡ * s2  .&* r†  ! Œ 5-—† 2 .*u*‚ * *P2 . 2 / .0NC  / ? A /#  !  ' " P* 2  . r7!E< 5 f5 C<E< 7 9 5 @5 7 =7 9 <?E)<>J5 9 7 <Es7 9 =7 < 9 .0— / /  * 5 6 .@E e¡ 8< 0FG< / . . .@E H5>J7 9 7 87 r5 2  6    .0 . :u < Ž< 87 5 @>@5€‹ 5 D7 85 < 9 < > 87 9 7 @KE 5 0 .‰ 2  * 0 / ›40 /  s40 / 0 / 5£… Œ 6 Ž 0— ‰   4 0 / 5 8:9<.@E)< 9 < 5€E2Š‹ 9 =7 9 7 xL g< 5 5 < 9 < 9D9 7 9 87 9 7 .¢2 q0 / z4. > N+OPRQMPSN AKE =<?>@5 5 ) %&"' $# A< "*+ )( / .9 ƒE RVKWONFXuQtN(}•S OmRMJ rNeVfgS!RTNr\ QtS RVKWON&d RVKWONFXuQtN(}•S OmRMJ S!RTN(J:\ QtS RVKWON TlKU}•S!Q. /  *5 / . =< 5 9 87 :9 5 D7 =5 5$.JE r5 < 5 9 A<> Ÿ < 9 t>@7 < 9 5x>@7wE7-E r5 =< I. @ S 7 3 07 7+103BA @ * ?  =  >0? / 5  0 / 3‚   3 4n„  r r2   . 9 †J}†JÈcÈ 3 |µ€ƒ  †JÈIȜƒ€~ ˆg‰ )%2 *p .@E< 9 5 M7E B>@7 9 5  67 9 <>J5 5 :5 5 5t< A< r5 E< =7 7 9 < 7 =5 D705 < 7 9 5s7 9 <{.J7B>@7 5 9 5 z< D7.* / / *p ›2 . . ‰ ƒ*p . 9 5 3g‚ 9 <E< 9 MÍ!Í 5B7-E .0 . /  p. P* .

¥     ‹    .

.

 .

8.

8.

  .

.

 .

r *p  5 2  . .* * / 0 ! 2  .8*C6™H-73Fo6I ''4t)8B08•šAFAm“›)FœiL@6- šAFAmCKFŒo8—G@8G‘ž-03F98“Gwt.@70>@7 5€E !5 9 <$5 @5 D7 85 Es7 I.‰  2 .82-48r698“G9LCE''A”}6lL8-.–2 •* . .8*C6qo6C3ML@6?l=062B4CK6J 8}HK6‘m6*HKF’8B7o. 5 €5 87!>@7 9 7<E €7-E W7 8< 85B7!7E t>@7 c. :9 5 w5€E E25  J.Ž * / 5 4 9 87 Ë.0 . B 9 .  . A< 9 7!.4 . q2   2 ˆ4.qB 9 b.@E 9 <E AKE D7 =5 65  7 5{7 9 <7 D7 =5&> 8< :>@5 ?5 5s>@7B5 M. 5 3g‚ 9 <E< 9 MÍ!Í 5B7-E < 87 .0 .625.*5Œ)0 . ?5>A< 5 =5 5€E¾5 < < 65 87 :9 5s< > 9 @.3g‚ 4„  * .0 . ‡ / 0 *?‚  .s2 $%*5 ) * ˜ $%.*p .* / p4n„ ! .. . 9 <B5 ru < 87E<B5 D7 5y5 67 9 < 5 H7 9 <?>@5 9 @< =¢ °Hƒ?·°f»IfÂ@µŽf» ‰ .5 6 T„ ]  s20 ]* .g5 . „ s‡ ¥¥ 5 ¦ ‰(Ž0C * † s*  *c 4n„  .\xly@€ )  @> 9 .* 2 * *  ./ *5 &D."*p ! . ¥ .4* 0 . . c. ./ .  -¢-  n/ "q0 š . 9 < 5 9 9 E<s>J70.' * * 4„  * . @>@5 >@7 H5 A< H5 9 < =7 :9 5 =< 9 5 5 < 9 =5 c.*5 / Y* T„ ..@7{< D7 =5  5 > 85s>@7 9 .*‰ .*A . :>A<s>J70>A<?>@5 9 E< 5€E7  9 < 87 9 H5)E7 8Es5 D5y>@55 A< 5  7 @KE 9 <>@<7 AKE 5 87 r9 5 87)E< <t. 9 )%2 *A .+.@7< ru < 5 < 9 < 9 9 <t.=?. .=A@CBD./ * / 2  . .*A 2 / .4 .J7< @>@5 =7 r9 5 5€E 5 7 =< 9 E< =5 < z< :5 <t5 7E r5 M.J>A< < D7 8< 5E =7 :9 5 D7 85 c.8C6aB. ./ Œ2  .* 4n„  * . . . ru < =< D7 =5 D7 85 > AK?E 5 ' '()(*()()(*()(*()((*(()((*(((*(*(*((*((()((*((*(()(((*((*(.JE r9 7E A< AK?E < C< 87 .*D2 .@<  54  '768686 5|0 s2.*p .4n„ 4n!„  *  $%  . 55 :9 D7 85y7Œ>J7 E7 8Es5t>@7  e¡ ¡ £¢ D¨  °f»IfÂ@µŽf» ¤e¢ ¢ < 9 5 A< 75 r5 9 <5 =7E<5 5B>@7!Es7E < 9 67 9 < A< 5 A< ™.8E1pGP3H-. ru <>@5 {. D7 85)E{. .*A  #. ‚  . < =< [>J7 C< 5 9 E5 €7-E2< A< =7 9 <>@5)5y5 c.0 .A<&7 . 0 5 8:9<. =7 A< <y.&2 r* .j)kA8lGL<mn6po8qH-03F*rs*6 81*t*69o6q6*u2v78C6w?l=462B4C6 OnQZ ]0\. q0   .U*Va`2VKbKcJdef*XQZ)X<gih@` z ''.5 ¥ 7 ¡ * D7 9  < 65 H5 67 A< A< W7 8< J5&7 7E < :.6>@?=A6BAC6ED@3B7FEG@3*H6JIKHMLL  NPOEQ4RST.5 / p.4 .*p 2 / .6‡LJF-)F96a6*u2v.<(=7-. 5 € / 4n„  5 q p.% & & ‰  †Éƒ_Ç@†»Aƒ?~?°|ƒ—I»J~€¿@ƒ°|ƒ·|ƒ¹„A†  †JÈcȜƒ€~ |ƒ…„A†  †@ÈcȜƒ€~ #% && ‰ ¿J†f±€†»J†g‡ ˆ Hƒ…„A† <Es7E †Éƒ¼ƒ—¸@ºc†»Aƒ‚~?°Hƒ¹I»J~€¿Aƒ  ¿f†Jȹ»f 7 9 S¨{ª ¿J†f±€†»J†·°I»ffÂ@µŽI» ´I´ ¡H¤ D¨ ¿f†Jȹ»f 5 D7 857!>@7 S¨ «¬ ´I´ 7!5t5 9 †JÈIȜƒ€~ ‰ 4* A† s‡ q2  * #40 p.# ‡ .6Ÿ‡-48*C6K-B0F 1G uFoK¡7FPmn6)HAI Š*Z[9|pQ)VK¢aef)XQZ*X£€ ''J…2›)FGAFGP–*C6o6Œ¤78*C o6a6*u2v.  .2  –2  Œ0 .0 / / p .*p q.5Z*A 6 T.  ž”…” ’‘|“a”c•—–@˜™‘|•&˜+” *p .0 H5 r<{>@7 a9 .F˜H2-73KF-Œ1G’6)u2v. . ‡ .4n„  † 0 †  p.8CK6 LCE{}|¥€‚}|c€ ŠZK[d^)¦VKZx§{£¨§‚4yJ€ ŠZK[d^*©)V7YKVQh.‰ * ] * 5 s2 *p  s/ 20 /  .-0/2143257698:.. 9 5 8< C< 87 €.0 / 0 *p* 4n„  / + 6 5  2 . 2 ›*   . 65 87 r9 5 ?5>@7 x> H5 5 =5I>@5 @5 5 =< 9 . Œ‚ † ›*   .U*V WAO2X)YZ[)V\E]_^ NPOEQ4RST./ /$%  ].6I ''0B48•Œ-48*C6K-B0F—1G9L6B‘C83-. 7 65 =<>@5 D7 85 H5 5 Es5 5&>J7sEs7E 5$>@7sE7-E r5y< @7 9 7 87 8Es5 5€Es7  r5 r5 c./ * € 4n„  ' # q .‰ 2  .¢0*.Fo*6K-pB48•q– 1*t)Fo6—L@F-.9  =  E lnS!hiS!RTS›QtN(}•S OmRMJ rNeVfgS!RTN<d lnS!hiS!RTS PQtN(}•S OmRMJ S!RTN(J?d < 9 <>J7 >J7 r7 =7 9 .' * 2 0 ! q5 * *A  4n„  † 0 †  4 0 /  . 8<>@5 9 < < £7 0>@7s.A< >J7 r7 =7 9 9 5 5 A< =5 =7B7 5 @5 < 70< 9 7Œ7 D7 85 D7 =5 €7E :. ‰  .2 58 p.OnQ<xly OnQZp{}|~€ OnQZp‚}| ƒ„€ ''J…2-73KF†LJ6KBAC8*32-76‡L@F-)Fˆ?l=462B4C6 ef*XQZ)XP‰†ŠZ[9|Œ‹K)ŽŽ€ ''J…2-73KFq6*u2v.* 2 / .@7 @5 rE Ì. / 0 .

!     ¥n.¥   .

 VKZ{£xly@€  OEQZ}{{9| ŠZK[„d^ [*VKZT[Q €     .

.

 .

8.

8 .

.

 .

8*C6ˆo.   6543oF*o)8  (*((*(((*((*( ( t*6}o8 LJ6KBAC832-76 896*u2v.3B .

EG@3*H6 ( t*6}o6q6 L„82-7Fo6- B08• (”)uKt782-57F*rs6 ”.C2-03*u1AC6 8}HK6G 6*u2v78C6˜o*3EB .ut78-5A8p/E108aHK6G 6)uv08*C6tq8Kt0C7  C3*H6t1tF(t)8 B76EG@86)uv08*C6PI2F.

C2-03u21AC6  ' ' ¤)FK  oF (*((*(((  FB0oK-08l GJ82…-06*H26K1*-7-4o)38B06ŒFo*…F.Ž * / 5 4 9 87 Ë.>< Z\h[Z /  0 q4 5 °|ƒ¹I»@†@µ¹@ƒ‚†q½J†€f~ ¸@ºÉÅ°I»I ‰ ¯ ¸@~@µ ´I´ %K && E/  ƒ Ȇq°I»I 9 5 r7!< % &&  @ƒ? 65 ­Z AKE 5 65I>@7x.@E †—„I°|±Iƒ³² ´I´ )  E ­ZÁh[^oHV@j­^  – .8CKF™œ( Ÿ B.5 9 >A<>@5 @5s7 7-E GF ´I´ H/ ‰ †?°|ƒJµœÈ·¿f†q¿J†f±€†»J~œÄȀ†—„I°ff† . gUh ZÁUa`MbcZedfUg] =< o6Ugm   r20 4 .% & & ‰ |µ?~·¶œ„nƒ¹¸@ºI†»Aƒ|ƒ—ÇAƒ¼†¼~œ„A~€½f†@~Ƀq†?J¿f†€f†JÀcƒ\†—„‚°I»f °f»I  µ °f»I G/"J 1 @†Å ¸Aº KLKM N P :143 }œƒ¹¶f» † 9 :.JE 9 †—„I°|±Iƒ³² ¦UWkËdIV@U 6 / 2 ®f¯ =< . . .6nGP8K6*u2v78C6_(0  F.2 H5f>@7<>J5  .@7 @5 rE Ì.5D 55 C< 9 5 H5B>@7 WU 5 D7 85s> =9 =.g5 .< |µ?~ƒ ´I´ @> =5I>@5{>J7 .* + … † / * [„ / *p* s ' f7 5 >@7 87 8<s< N+OPRQMPRQ °f»I œ¶cHÀ fƒ ‰ ù°I»I œ¶cH} fƒ ‰ BC 5A.-/ 0 2143 657/ 0 2143 8 :9 ®f¯ W5 7 ¯ . 9 c†?J¿@± ‰ )%2 *p .0 H5 r<Œ>@7 a9 .JE)<{>A< >@./ ‰2 .… ˆ K ! IM'AFPI2614C ?l=462B4C6"— ?l=462B4C6"—…6*6K-7o)8B0Fo*F&%# ' …6BACFo*6K-(#*)  ' 4n„  .A< M5 7 :5s< A< ? A@ ŒUWkËdfZ£j V@UW] 5   ¿J†Jȹ»I f~@À~°f»I / fƒ»J†—„Ć f†Aµ…»Aƒ  †Éƒ¼ƒ¹¸@ºI†»Aƒ .F L„k# (=4$ ”*”K t)FB0o6.% & & °f»I  ´I´ ‰ BC I143  #% && 0 ¿f†J±€†»J†·°I»I¼ Ȇ·°I»I¾~?°|ƒ¹f»J~°A~€f~·¶œ„ă—¸@ºc†»Aƒ ¿J†f±€†»J†·°I»f 9 q* * 2F3  *7 .@< 3 ‰ 0 ¹|ƒ—¸@ºc†»Aƒq ‰ µ¹» GMKOK fƒ·~J±cƒI}~€¿Aƒ  54  '768686 5|0 s2.GP3HK6t£ Cn-*6HF„(t)86 L@6B4C6 œKI“Ÿ L80mF}t. 5 3g‚ 9 <E< 9 MÍ!Í 5B7-E ..

¥  ‡  .

 ..- 5A55 ´I´ 2143 &/ È~ƒ °f»I 88 .

 8   .

    88 .

5 4.Ž ‡ 4n„  ] *p  q‰b‚ .*  / *A / 2  . * .* A† –‡ ƒ  / • *p  * 0 ! ‰ *%* s2 € ¡ &J& 2  s2 Ž 2  ž €%¡ &&  – / .* ˆ2  ..Ž  * Ž q * p.  °Hƒ¹I»J†@µ—@ƒ ´I´ œ¶cH}~fƒ ¿f†f±€†€»J~Á~fƒ ´I´  HµŽ@~f± ¿J†f±€†»J†·°I»f ‰ °f»I ‰ .‰ ƒ4 *5   4 .y!R  * ]2 .q2  * 0 ! 5  )z2 0 † /  † jvN(Q.‰ k‡ 4n„  2  –‚ .. .2  s/ * s2 :2 * r0 / 0 ..*‰m* .% & & H/  ¿f†?°|ƒJµœÈq¿f†·¿J†f±€†»J~œɃ\ƒ¹¸@ºI†»Aƒ Ȇ—„f°ff† % && f~JÀ~q°I»I¾~?°|ƒ—I»J~€‚°@~€J~ € *A • .2 /  0 ‰‘  / / *p 2 0 3g‚ •2  .•* s2 4n„  † 0 . /  s‡ s2  .*5  .5 ) * 2 :* * / 2  .‰‘2 ..

5 7 =7 H5 5€. :7 9 <.@7Œ5 ?5sEŒ. @< H5I>@7 z< I9 < D7 9 Es7E < 9 >J7. H5 85€. …–Aš 9 5t5 5  …” =7 @>@5Œ>J55 D7 85Œ< H5 C<?>@5 5 C< =7 fE< a5 H5 =7 :9 5 D7 =5 †—„I°|±Iƒ³²  ¸ ‰ .$# Œ.@E A< =<?>A< 85s>@7 ‘Hš A< €‘Hš 9 <B5€.@7{5)5 9 E< c. H5I>@7 ®f¯ *+"   c. 70< 9 65 " 3 A< 9 < 5 =<>@5 @>@5 >@7 r7 5 c. 4n„  2  Œ / *A  q‰ * Œ2     4 7  A  / 2 Œ* 2  2   4„  .@>A< 65 f5€. 7 >@7 H5 < =7 r9 5 =7 =<&< 1 . .   D7 85 87 :9 5< <E H5 * # 5 65 =< =< 9 7 =7 @>A<s<  =7 D7E 5E{. 65 C<?>@5 < 9 7 c.+  + .  ‰ ù°I»I µ…I»¾~ °f»I °f»I ù°I»I ‰ ´I´ ‰ ´I´ ~ ¸ ´I´ ‰  5 4…”ž•¹‘ €‘Hš …–AšAŽ”   q2  2 Œ* 0— ‘6š < 65 =<>@5 ®f¯ 65I>@7 87 9 < vx. < 9 87 9  M>J7 r7 C< * 8<>A< 65 9 5 >@5   #23 9 c.A<  †€c@ƒ }cƒ¹I»J†  .@7 c. H5 5 H5 =7 r9 5 =7 [>@7Œ>@7 r7 C< 9 eE< D7E 9 7 D7E 9 7 9 *+" .@7 5t5 H5 5 D7 85 9 <B>@7 •¹‘&“–@•¹– < < 5 #21 5€E 5 …” 87 9 @5 A< I5€.@>A< A< A< 5B5 ÆEs7 DE)< 9 <s5sE7 8Es5 M> 7 9 7 :5 87 5 < £>@7 9 E)< 85 =7 r9 5 – A< 9D9 7s7 87 :9 5 D7 85s< 5€E 5 . ž< u < >@7 5 H5 C< 9 5 9 D .

:8  8 ³‰  0 1 2 34<!7"'#= )@.2  2 @>@5i5 H5 =7 :9 5 ù°I»I 1 ‰ ¸ .‰ 4„  < 9 M5i5 D7 =5 °I»fÁ~?°Hƒ¹I»J~ÉȆ—„f°ff†·°@~€f~„A†Jȅ„Hƒ‚ƒ—¸@ºc†»Aƒ  ƒ *5 5 †—„I°|±Iƒ³² °f»I @> A< 0  3 87 9 <?>@5 0  1)2 34 0 #576  98.. ¿Aƒ¹¶c¸|±€†‚¿ 9 * 9 < G/ fƒ_°Hƒ?¿f†ÉȆ€·„Hƒ?¿|µ 0 / 0 5iE7 8Es5 r5 < >A< E7-E |µœ}~€¿Aƒ  p.@< 5 .2  .Ž * / 5 4 rE  †€c@ƒ € *A / * & . €‘Hš “…–AšA…”) ‘6š ¿@ƒ}œƒ¹Hȗ»J~?I»J† 87 9 <?>@5 "!"$#%&  $ †—„I°|±Iƒ³² µ…I»¾~   ƒ ƒ . 5 fƒ 3 65 8†f¿f†€f†@Àœƒ °|ƒ?¿f†„I¶f¿J~€ 3g‚ 9 <E< 9 MÍ!Í 5B7-E .@7D-@5FE 68686 BC 5 9 + a‰ ¿€°6µ Ì.0 H5 r<{>@7 a9 .+ ¿  ?> 5 ‰ ´c´ ´c´ ‰ 7 4Ë.' =7 r9 5 5€E505Œ5 D7 =5Œ< H5 ‰ 0 1 °I»fÁ~?°Hƒ¹I»J~ÉȆ—„f°ff†·°@~€f~„A†Jȅ„Hƒ‚ƒ—¸@ºc†»Aƒ  †€c@ƒ 5|0 s2 C 5 . 9 7 =7 < D5 C< 85Œ5 H5 4„  2 .+  °f»I < H5 #+ ~ ‰ ´c´  ƒ ´c´ ‰ ‚ s2 /- =<>@5 5 ®f¯ ¸ ´c´ ‰ $* 0— H5f>@7-E D7 9 <  †€c@ƒ ù°I»I .BA& C<  4}—|µ?~·°|ƒ¹f»J†@µ¹@ƒ‚†µŽ6µœ}Iµ~f±fµ¹½f~ 4…”ž•¹‘' €‘Hš …–Aš4…”&“–J•—– ) ‘ (+*”…‘.- &2 - ./ ƒÁ}œƒ¹I»@† $ ¿@ƒ·¿@ƒ\ƒ¹¸@ºc†€»Aƒ·~°|ƒ¹I»J~œ¿@ƒq )%2 * C?.

! 88„ £ .

 $ .

  ! ³# C  %$" 3 C H5 *+" .JE)< ¥ ¥ !Ž  - < H7r< 9 7 " . † ?‚ Y˜ $ w š - Es5 89 <)<-5 r<@< 9 <&5 7 9 ¥n . .

† 8  .

  65 #   .C 7 9  ?5  >J765 € ‚ 7 9 5 D- !..

‰ R nKiy >.=< ‰ -@>@5 C † † [„ .H5.@E 5s5t7 HL † <s<7. K.@7D-@5FE 68686 BC 5 9 RrE# C .C D5€Es7 D.C A 5 9 E “ œŽ ‚ D- ‰ ? A -@77.8<B.A< QA<E<>A<B>@7!E 7 4Ë.C † C 65 . < C 5 D7 <>@5 5 C D7 @7 5 c. 9 r5&. >@798 < =9  @.87 8<  ƒ¹„A†   "143 ±€~@ÈcȆW²c²8ƒ¹°@†€f~€»Aƒ?OPO ‰ 16µœÈ f†»œ¶J€Æ×» & .Ž Ì. $ H51.D7 D7  .r>A<?>@5 $ ¥ ¥  <' 67z< $ ˜ $ 32 4 € BC n„ C ‰ ‡ A p† -‚ A A† <7@< 5 9 7D7 9 D. .C PŽ 7 5 9 E< . 5z< C :7 $ H51.C D7 70< ‰ )E   :>@5 65 .."-5€E# 9 7-7  5 - < 9 rEs7 9 <  A<t.C A < 67z< $ 5 † BC r>@5&7-E 7 9 - $:7z<<>A<% A< 7 -5€E&-. 5  5Œ>A< D7 rEs5 5 9 E<>J5{5 A C 9 <DŽ<>A< C D7 D7 7 9 5 5t<-7.@< C=9 <>@.@E 5I>@5G 5&5 E78Es5>@< 9 < C - C D7 C=9  @.@7 .C u‡ 87)5 9 r7 <)r<.@E >J7 C C < rE#65 9 - A ‰ 65 BC < .C $ H51.'S 9 A C 5f>@5B>@<#D7 / . n„ 5f>J5[5 5 D7 C †—„I°|±Iƒ³² J % P }œƒ¹I»@~€¿@ƒ? ƒ…„A†  ±œ~JÈcȆ .JE C 7[>0650 C  5 A :Er7Es7D. < 5z< † M 9 z<)A< $ H5 $ :7 65 .  ›Ž $ ˜ qš˜ . <>@5< C=9 < A KJ |5€.D7 <>@5$70A<?5%A< EH50>@5Œ5 z<087' w5€Es5)5[E $ H5 $ H51. u <!8.@E< J>@587> 9 r<0.C !L 9 <G>@7 u 7 A<>J5 9 E< 5x>@<Hr<.- 16µœÈ »  5I>@5 ŽM „ n„ C ‰ P‡ 5B7 5M>@5B5 9 z<s>@5A5€E#@.

ME 5 c.8<.@E’5 5 A c.>@5t5E A C 5f>J5w>A< —Ž ‰ 5Œ> A9C >@7>87.87'  C 5 ž< u 7 9 7D.@7$<7z<087 D7 5I>@5M5M< 5f>J5@.A< -A<Dz<'.@ .>H5 ( C r<Œ>@7 a9 5 g‚ 9 MÍ!Í /€9 <E<? 5B7-E 5  !L ¶œ„~€»I|µŽ¸c¶f»Aƒ¼¿@ƒ¼ƒ—¸@ºc†»Aƒ J}œƒ¹f»J~€¿@ƒ?1OPO 5€E#r<>@5 9 @-@> B9 A % M c.@7 -@<yE7-E 5 7:78Ž<E 5 C -:>A<:5E5 :‡ u‡ .-‚ C  C  5=<>rEs5g< @>@< 6.C 7 aE<Œ5{E A9C 5I>@5F87 9 5 5 f7:7x7 C <t<7.

@E n„ C ‰ † &‡ n„ C ?‚ C ‰ „ n„ C ‰ C ‚ C C 5 9 < :.>0.D7 5 @>@5B. ?5{>@7 9 <)5 E N ´I´ .:E E78E<:r<.

?š 5 .LJpLkN#NeVfgS!R[N S O.C 8Ž<? 5Œ>@7 c.@Es7 Œ‡ „ C C † }zON(QR[S!KUJvNPO.C 7 9 5 C  .L(yvyLlnN KU}%Omh K j!KUR L}•S!QRTSZO.LJpL N } !RTNlnN ®f¯  w D.C 90/ .-J>@5B5ŒE A C 5f>@5   >J5H5.A<H5 D7 5{7 C <{<'70=<.

C 7 9 5 C M5tE A9C 5I>@5t>A<!z<'. 5  5 5C 9 r<>@5A< D7 I.@< H5 -@7 < ‚ ?‚ n„ C ‰ ‡ .87)=<' 67 c. = C 9 < A  >@5#65..A<£5 >J7Ir>@7 5 65.n„ ?‚ A9C ‚ ‡ n„ C Es7DE5E.

- 7y>@7&< 9 5 @7 D7 *+" .C 7 9  5)>J7)H5  H5 $ † ‚ w5-  ( .@Es7 9 < H5 $ D. < 7 9 5M5 -# <>J57.@7[>@798 /-A<BE7-E C 9  @.:E $ <>A<G< c.C 90/ < $ w H5+*-. C 5 = A C 5f>@5 . 65 $ n„ .@7 *65   .5B ?š C D7 65 $ 5 .A<?-5 B9 787 9 5 A c.>0.

.D7)<-70=< 5Q@<E)<s.C 7 @>@5 "5 „ƒq†f¿f†€f†@Àœƒ¼¿@ƒ¼ƒ—¸@ºc†»Aƒ [j­] A 5 7 9 5 <s<7.A<£5 @>@5 7 16µœÈÁ}œƒ—I»  » >@5 C  5I>@5s>A<z<087 6<5y.8<>@5@rE# 5 C  @.@7.8< 9 E< 5G< c.@E c.@E’< 9 67 C F‰ @<.@E 5)<B7 D7 E  . C 5 +-A< C <Es7D.Ž  < -@>@5 5 9 E)<  ´I´ ‰ ‰ C c.¥  .@7 C=9 .@Es5 >J5y5 <W5 ( D7 5 $>@7 5>@5)5 7 A C @< 9 <y5yE A C E A C 16µœÈ +  + n¡ „ 5 .A< J>@5y. @<.8< 0UWkËdfZ£j V@Und z<'.87 < 65 E C=9 ‰ 5I>@5$>A<%r<.8< 7  @.C 65 E  C D7 ! q‰ .-/ 0 1 / 0 21 °f»IfÂfƒ¹¸Aºc†»Aƒ œ¶cHÀ fƒ €¶cHÀ fƒ °I»IfÂJƒ¹¸@ºc†»|ƒ „ † C  n„ C ¥ -‚ n„ 7D.@E 5 7 9 5 D7 A C c.@7  >J5A65 =9 < ‡ c.@E .

.C g<65 <:87-E 9 7A< 9 < Es7DE5 5 5 "’#™. ? (? x^aV@^ 0 OPO f~€¿œ¶HÀ <>@5 ´I´ e^W] B ´I´ ‰ ‰ 7 9 5 ‰ F.C C  †A C  C ]Ž .65€Es5 .-5- C H5  C 5 A ‰ .>0.n„ C A9C .:E  {>A< A s      fƒq°@~œf~ ‡ &‡ ..  .ƒ‡ n„ C C .‰ ‰  A .C u‡ A    .

87 » C D7 ./ .=< ƒ¹¸Aºc†»Aƒ MZ£kËdfZ£k N+OP MPSN 5 7 @>@7 9 7?5 C 5f>@5[7 5f>J5B>A<!z<'. 9 7Ž<r>A<?>@7w5 E <t. L  <x. 7 9 D- 5f>J5y587-.@E 7 3 A3 —„A†œ»I@ƒIÈ  °@~€— „A†»J@ƒIÈ °@~œ .C 87#67 9.

  .

C ‹ .r5t>@77 1-7?  7 D7 51 C 7-E2.D7 65. |7051-5 989 70. C 5@Ÿ  8 C 9 <.-565s.@E<t71 7? 5 5 >J7 7  9 5 7 9 Es7<. 87 8< <?5#8< 9 >J77.QA< C 5  <.  C=9 -@7 6  . C 5JŸG C=9 A .@E&H5.@E25 D7 C 5> -AK?E5%*  (  ..@E<y71 7? 5 <  <&<'r5Ž<? 5y>@7B.@E 5 D7 C 5$> -AKE#5 65&Es7DE5D7t<. C 5 9 >J55 D7 C 5 .C 7 9 5<?. C 5&>@7:7 C <1  .C 7 9 5 c.@E< 9 7z<? 5& .@7  C 7-E .C 7IQ@<E)<B5t>@7 C=9 .C :E)<)5€E < „$$ @>@7 5 9 E)< I.J7)H5I>@7@87 9 -5€E<>@5{7? ( 5€.-DE5 A< 9 <>J7r7 C < 9 5 5 D7 C 5 > -AK?E5 I.J7 +87 55 989 7 9 . C 5€E)< C <Es7D.C .  $# %&  *+ * 3  % -@5H<'& C .@E<r<.

 X /7VZ*X ¨86ARKXE]26ARKXQZ:6K|P`W.\7RKVŒYZ*U€ ''_()()(*()(*()()((()((*((*(*(*(((*(*(*((*(()(((*(*(*((*(()(((*(()((*((()((*((*(*(*(E…4mFKtt.D7<.‰ %‰ ž n„ - |> AKE#5>@7 ƒ‰ MÍÍ +-5€E :‡ ‰ [„ .Wp`54)XKQ4YZ[T*Z)X[6)UX6.Y2Z*[T)Z)X [ 6U' X 6.r>A<t7E ! Es7Es5 9*) #@ <W7 8<B57+ J7-Er5 C 9 A >@78  w5€Es5t>@70 ‡ &  ˜ š Ÿ ‰ 9  C ‰ †  g‚ ‰ †  † † –‡ ‚ n„  5 g‚ k¥ † C - / MÍ!ÍÄ7   7 w5€E#A< ( C 5 9 >A<  C 9 < † -@>@5s5.V.Xx y z RXQZ2131€ RXTZW.6A`W. C 5JŸG = .£(F10C26J(“L„CE-IHMLL   ' '_()()(*()(*()()((()((*((*(*(*(((*(*(*((*(()(((*(*(*((*(()(((*(()((*((()((*((*(*(*(8  NPOEQ4RST. r<. Q -qQ.*V)RZ*X[‘^ T0Y*On.W RKXQZW)WVQ*U)S R2X2QZd.U*V WK]0VE]0XK[‚‘^ NPOEQ4RST.8 RKS\)YYpe0OnŠ)X z ŠT.Wp`K©.U*V WAO2X)YZ[)V\E]_^ NPOEQ4RST.X/'7VKZ*X ¨86‘RXQ*Z26|./. C 5@Ÿ  C=9 >@7 ' .\2]4V7YŠ.S)OR0 OnQZpZ € YZ*\Z0OROnQZ™RXQ*Z € e0OnŠ.d4€  & @-@> B9 A .‰ <.D5>J7 7 C 9 7 7 5  C C n„ ‚ [„ 5 >J7 “v‰ uŽ „ .U*V  W .W9RXQZ˜W)WVQ)U*S’€ € 9e4OnŠ)X_xly z RXTZW.

Ž Ì. K.'S 9 .@7D-@5FE 68686 BC 5 9 RrE# C . .@< 7 4Ë.

>H5 C r<{>@7 a9 5 € g‚ 9 MÍ!Í /€9 <E<? 5B7-E .

! K  .

  .

 ¥n s    G €  H ''_()()(*()(*()()(()(((*(()((*((()((*((*(*(*(((*(*(*((*(*(*(((*(*(*((*(()(((*(()((*(MDP8lšJ3BA3rs*6 OnQZae0OnŠ.6AYVE] 6.X 050nRXQZq| w€ OnQZp]0\.*VZ*XK[ 67U0OQ 2]@ORX36)Vn] 6.4'131.HK6“LJ6 R2X2TZ@W*W4`.dd*dd*d ..OEQ<xly z R2X2TZ@W*W4`.dd*dd*d .40n`WW)VQ*U*S€ .¦KeŽ 0`WW)VQ)U*S€ z  e0OnŠ)XA‰ .YZ z   Z4ORX36*UV6.*VZ*XK[ 60V.\Z4OR € e0OnŠ)X  ''JH-73Fp548C6-’8Kt0C 7C3*H6 ''Po)8Kt0C2 .Y2Z. )8 508C6-ˆF6}t*F*3-˜o8q82t.

X € ''<IIIIIE1*t*Fp6p508C6-<III UVSVKZ) V :.F1G˜578C262.dd*dd*d .\TZ*XKŠZ[_d^ZqW.Vn]26.dd*dd* d  /'7VKZ*2 X 6567U0O Q ]JORX36.8C6.XKŠ*Z*[x Q)V¢ae0OnŠ)XAy@€ .4'131.4 131.s6ao*8E548}FlLJ6KBACKF.6ARXE] 6.WVQ*U*S€ ''<IIIIIE1*t*Fp6p508C6-<III 9''Jo)84m28*CFo6ŒF1‘CK6nGPF.\T*Z.\2]@ORKX|pQ)VK¢Œe0OnŠ.U0OEQ7\]JORKX€  ''L‘-48H*3t)Fpo6qo*84mE8C8  '' 2t)F2B.Fta1G’6*uv.  R2X2TZ@W*W4`.3 | 6‘`—W)3 W .C3HFEG@82BAC8  R2X2TZ@W*W4`.o6FK1AC6¡ELC-’œH-73KFK-™F“L8EB.6ARXE] 67\KT)Z)XŠ*Z*[0`WW*VKQ*U*S„€ z \TZ* X ŠZ[JWe7OŠ*X@^ .L@F-.*VZ*XK[ 67U0OQ 2]@ORX36)Vn] 6.Ÿ ' '@FK1ACK6K¡ELC- B.¦KeŽ 0`WW)VQ)U*S€ z .\TZ)XŠZ[_d^ZŒ|cc€ RXTZ˜W)W9` 6Z.U4OEQ.

*  YZ)S£x.S“O4d^Zp|qOP€ XK[xROnQXTZ˜ZOW.17y .V W.€ )YO Z)1.17y .*YZ.*V)R2Z*XK[JWe0OnŠ)X˜^ z .*VZ*XK[ 6)UV6)Š7XKQ)Z)V7O2[)X7Y 6567Vn] 634 131.H6“L@6 E e0OnŠ)X 050nRXKQZa| ™€ R2X2TZ@W*W4`.*YZ)S O„g§ZqW.*V)R2Z*XK[JWe0OnŠ)XA‰^ z .WOW.dd*dd*d .*  Y2Z)Sxiƒ ¨e0OnŠ)X_xly)y€ XK[xOnQZ˜O| ™€†O W .WVQ*U*S€   z ''Po)8Kt0C2- )896*u2v. H ' 'A–}o)32B EG@3H6  .8*C6qF69t*F)3-qo8q82t.~.)YZ)S£gnYO*V_xly™€ O 1.yP€ XK[xOnQZ˜O| ™€†O W .*YZ.)W.6ARKXE]:67¦Ke*Ž 0n`WWVKQ*U*S€ H .VQ**U)Y2Z)S„S€ “Oˆ€ [*VKZT[Q €  & @-@> B9 A .S“O—|}Q)V¢qe0OnŠ)X_xlyJ€ .*YZ.YWpZ)S£`6gnZ7Y|3O*6‘V_`†xlW*y™W.)YZ)S£gnYO*V_xly™€ O 1.S“O „gZ9|aOJ€ RXTZW.Wp`5 6 |6A`†W)W.S17y “O4UdV^ZaSVZ*W.|HWp™`OK|A€†`*O W*WW O.

@< 7 4Ë.Ž Ì. K.@7D-@5FE 68686 BC 5 9 RrE# C . .'S 9 .

>H5 C r<Œ>@7 a9 5 g‚ 9 MÍ!Í /€9 <E<? 5B7-E Š .

¥K   .

  .

L_(K¤032BACKFKk48 !™IM'4F@I6214C 8Kt0C7C3*H6po8p… …6B)t4C-1ACK6-Œo6Œ6)u2v.8C6 HK6B4C #*) …6B)t4C-1ACK6-Œo6Œ6)u2v.8C6 HK62B4C  # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #) (*(((*(n548C6-™o.3B E . s     ¤)FKoF (*(((*( (*F(B0(oK(*-0(n5488lGJC682-’ K -0H21*-436Œ…F.

8C6 HK6B4C #  D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C  # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #) (*(((*(”)u2v.8C6 HK6B4C  # …6B)t4C-1ACK6-Œo6Œ6)u2v. G@3*H6}8“Gw…  t78 G¤0?" …6B)t4C-1ACK6-Œo6Œ6)u2v.8C6 o.8C6 HK6B4C #*) …6B)t4C-1ACK6-Œo6Œ6)u2v.3B .

 …6B)t4C-1ACK6-˜HK62BAC #*) C#*'' D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #) (*(((*(n548C6-™o.EG@3*H6}8“Gw… pHK6nG FK1AC6¡ELC.3B E .

) D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4CE‘ ## ( (  (n+  . G@3*H6}8“Gw…p H6G¤0?" …6B)t4C-1ACK6-Œo6Œ6)u2v.8C6 HK6B4C #*) D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #) ) #  #   #  )E#  D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #  D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4CE#‘(.

8C6 HK6B4C ##.C# .8C6 HK6B4C  3#} …6B)t4CC-# 1A CK6-Œo6Œ6)u2v.8C6 HK6B4C #  3#qC# …6B)t4C-1ACK6-Œo6Œ6)u2v.8C6 HK6B4C #*) 3#  C#  …6B)t4C-1ACK6-Œo6Œ6)u2v.6t 8“G’… 9HK6G¤4?" …6B)t4C-1ACK6-Œo6Œ6)u2v. D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C ‘ (*(((*(n548C6-o8 LJ6B‘C8*32-.6ut76*u288v7k4-5088GKCFL6}rs*mn1266 GA Fo8B01)t*369HKF9o508 8508Hœ50CK63-wt7C6o)32B /E10E. D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C  # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #)  ' ' H2-43FKB7o6 6}”. D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C  # D@8t0C2-1‘CK6K-Œo6a6*u2v78C6HK6G HK62B4C #. 3n # .8C6 HK6B4C # 3#A ) C#*) …6B)t4C-1ACK6-Œo6Œ6)u2v.

LJF-)FˆH6--43n>‘3-q82t7C8 LP-.8tI …K6G‘6 LP-. G@836˜H6pHo6KF B)t0t)C2C)-1‘m4CK6K-982t7tCF ž}–a8kA8H21ACKF*o61GAF508 *ŸI '  FKt82t7CF˜o.q508.H8o.84m28*CKFKB7o*66a6*u2v.6.6.u4m8G‘F '  & @-@> B9 A .82.8*C6.

@75tE)< 7 . p† :‡ 87 9  c.'S 9 †  C 7 9   A 5 † 7 C 5 9 s… $%& >A< .@7D-@5FE 68686 BC 5 9 RrE# C Ì. .8< 9 7 4Ë.Ž 7!E)<' K.@< ŽM e>J70.

>H5 C  r<{>@7 a9 5 g‚ 9 MÍ!Í /€9 <E<? 5B7-E  .

8   .

r5B>J7 ‰ D }c±€~JÈcÈ P / 143 ¯ "1 D D  ´I´ .   #  E A 7 ®f¯ J C &C .‰ ‰ .@E / † .     !   *+" .D ´c´ ¯W‰ ȗ»J~»Hµœ}¾µŽf» *+s%&  ´I´  ´c´ ‰ # .

*  *+ c.@7) 7)87 9 >@7 51 65I>@7 5C c. H5 . C µ…I»  »Aƒ?¿Aƒ œ¶cHÀ €¶cH}€~fƒ K6K 1 ¯ ²c²8Å°I»ff - ¯ ‰ ¿f~}œ±€~@ÈcȆ .C ‰ 7 9 7 f7-E:5 " †  † 7 9 5I@< -5€E5 51 7' 9 <x.D.JE D.C  9 :5t7 167 9 :7 . ‰ ‚†f¿@± 1Ë#  E< 9 7! 7 9" z< 65I>@7  E< 9 7.@E A< =9 < % # .@7 9 7 9  1 -#™#   r>@5!H5 9  >@7!.@EÆ< >J7 7) C=9  @.

@E</. -r>A<s. 7 9$" r<s>@7!%€7D7 9 ®f¯ _¿J~¾}œ±œ~JÈcȆ ¯ ²c² ¯ ¯ fƒ ² ² ¯W‰ c Å°I»ff "—"  D */+ D 0 */ 143 3=143 / 143 D  + D 3 KK ²c²8Å°I»f 87 9 - Es7DE5 :51<e>A<tEs7E&) - 7 Ž< >@78 9 <>A<!-5€E5t.@E 5€.

@E ' <.C 9 7. -<&%€7 5 -@5€Es7 C=9 / u(' C 5 #D7 A< 9 <B..0rE - 5 .

´I´ 8 8 > †?„ÁÇ 8<*Á~f±/.@E< <#D7E# 9 7)A< 9 <5 9 r< †—„I°|±Iƒ³² +8+*-. µ…I»‚Ç > ‰ ‰ µ…I»‚Ç / / ´I´ ´I´. 7 9" z<<65 . J† ´I´.@ƒ ‰ fÂÇ / ƒ¹¸@ºc†€»Aƒ¼f† / °f»IA*B:¼J† N+OPC PSN f†œf†?H}Iµ~€¿@ƒ 8 fÂÇ D·jFECZ VJZ£k - 9 7.

JE 9 7. 7 9$" z<t>@7 ¶6È~?f¿@ƒ‚~¼f† J†€43?H}fµ?~>7\ƒ_„A†JȎ„6ƒ?9¶A†°@†@. 6^g]iZ£kËdIVJZ\V@ZGECZ VIH£k[oej­^ - -KJ5 7.f~€ăq†?J¿f†€f†JÀcƒ¼¿@ƒ 8 €„A~€½f†?A~\†f¿f†€f†@Àœƒ¼¿f†·Ç .@<?5 - f†œ43?H}Iµ~ †—„Á°I»I ‰ .

f~œɃ¼†?f¿J†€f†JÀœƒ·¿f~¼f† ‰ f† ‰ fÂ€Ç °I»I / 8qƒ¹¶nȆcºc~65 ‰ ~€f~Á~€€„A~€½f†?A~€É~f±/.C89 L9 .C 7HH5 9 :5 7 9 5 ' .@ƒ¼†—„¾Ç µ…I»|à E< ‰ J†€43?H}fµ?~¾~Ç ~€f~Á~€€„A~€½f†?A~€ÁÇ / ´I´.C 7 9 5 -KJ5 71  C 7 r5¦>@565 ' E)< 9 7! 7 9" z< &  C - /RQ   ( D5>@7 - 9 7. / 8+*¼Ç8 fÂ€Ç >0*‚f† Ç µ…I»¾~J±/.@7)7 1 .@ƒ0*21 ¿f†J}œ±œ~€f~¼¶œ„A~¼f† µ…I»:Áf† % < 9 787 9 ? -A< 70A<?5 '-@<GE7-EN) E? Z Es7E&) 0UWkËdfZ£j­VJU % 7 9 z<1POI D7 9  M 9 r< A< 9 < + . 7 9$" r< % <?E 9 7D7 9  887¾ƒi„A†Jȅ„Hƒ09¶@†·Ç8 fÂÇ / 8 D5 / †=.. C  )  9  .C 7 9 5 <?5B5 >@765 .

U*V WAO2X)YZ[)V\E]_^ @-@> B9 ATS . 7 9" z< NPOEQ4RST.

5 9 51-7>@7 9  »I|µŽ¸c¶f»Aƒ ƒ¹I»@†@µ¹@ƒq°@~œf~‚~€»I|µŽ¸c¶f»Aƒ }cƒ¹¶I»  " # ¥n ¦   .

'.

‰ C .*  ƒ‡  † c˜ š!‰ †  ‡ g‚ .† A |µ?~f¿@ƒq°|ƒ¹f»J†@µ¹@ƒ°@~œf~ Ç|ƒfµ¹¿ M !  .

.

 C  & .@E Ž<'85 œE{.JE)<!r<.0rEs5 7.   †—„I°|±Iƒ³² Ç|ƒfµ¹¿ . 4     %.H7r< 9 < 9 5 A C 5f>@5B>J7.@7 3 -& 7+  C 5 0 / - 8+Ž< En< / .D7 A7 C < 87? 5sEs5 C89 < C   5.

.

 .

 .IK.@< BC 9 D.@7 @5 Ì.FEWWW@RrE# C 7VUË.'S 9 .

>H5 C r<Œ>@7 a9 5 /€9 <E<?XJ5B7-EZYMÍ!Í .

       .

L_(K¤032BACKFKk48 ™ K ! IM'4F@I6214C % F‘m6-oF -78 š #   17o621˜-78 š % F‘m6-o8†k # ) $ % F‘m6-oF -78 š # )$  17o6219k % F‘m6-o8†k #*$ % 'F‘m6-oF -78 š #*$ & N+OPC PRQ <W5 @-@> B9 ATS . | 6‘` W.6*H8‡L@6o*8Œo)3n>P3*CFK'' H610C  j*BACE-78qHK6Gak  T0Y*On.6G@8‡L@FK-)F 1G 2 ' +)ta6-08k48lšJ8GK82L -$mnB46pH*F3FHt93“G4Ft*s 6p-71*8lšwt*Fo–—FKt 1G’LP-06143BACE-)H6}3“LJB.FAm6.W {˜W)WVQ*U)SŒW.#.OnQ<xly # B.F‘6nm§GPG@8‡82BALJC8ŒF6*-)u2v7FHK68GAk„C6„6˜I I F-K>. ''C3ML@6 # -48lš@8-2B4H3F L@FK-)Fq3B4C83-.6)H857F*31)t*F-a6Œ6*u2v.6‘` W.WVQ*U*S€ {}| ¥€ RKXTZW)W9`!T*UXT26{6A`WW)VQ*U*S€ RKXTZW)W9 ` *\SXK: [ 6*U V 6{ 6.8CK6qt7Co ''Po*82t0CFš462-EG4F8“G50 8 ao8}o)3n>P3*CFK'' t7Co KH610C  j)B4CE-78qHK6Gak  ''05.6G@8#Ek†5.WVQ*U*S€  6543oF*o)8  (*GAt*(6}F9(*(-0o(8#8(*š@("P8(*-08l( šJ8BA82-H32B4FpH*– 3FP1I G’621ACE-)6}B.W†[*VaW.WVQ*U*S€ [)V }| ~¥„€ RKXTZW)W9`!T*UXT26*[*V6A`WW)VQ*U*S„€ RKXTZW)W9 ` *\SXK: [ 6*U V 6{ 6.6†B. Q -wYZU 050nRXT*Z € T0Y*On.6GP8#-)8.rs6I ¤)FK  oF (*(((*(( % F‘FB0m6oK--08ol GJ8†82k-0H21*# -436Œ…F.Wp`*\*SXK[:6)U\6*[*V 6|. | 6‘` W.  Q  H610C‘ ''0”˜H6EG‘FKB7o6 1t)3nB> 3BKš‘6K-G‘FŒ/108 5.F‘m6-#k '')DAF*/E103 L@F-.6‘` W.W [*VKZT[Q €   {˜W)WVQ*U)SŒW.š 5.Wp`*\*SXK[:6)U\6*[*V 6|.6‘` W.1G@82BAC6t}o8 1GAF—š71B.Wp`*\*SXK[:6)U\6*[*V 6|.W†[*VaW. Q -wYZU 050 VQ*U)S„€   "  :  OnQZ ]0\.6‘` W.W {˜W)WVQ*U)SŒW.W†[*VaW.F—š7-08EB4C8J -78 šw–F GP82tEG‘FˆHK6*32t*F/E148†kI z ''C3ML@6 *3B7CJ OEQZp{}| € OEQZp[*V p| {€ RKXTZW)W9`*\SXK[:6*UV6{ 6|.

" ZGECZ VIH£k[oej­^W] 65I>@7W>@7z< 9 < 9 .@E< ? - ŒUWkËdfZ£j V@UW] 9 7.@< BC 9 .

.@E¾5€.JE Ì.C 65 7 9 5 ' 5€. 7 9$" z< D.'S 9 @ .@7 @5 ? x^aV@^ A< 9 < .IK. D7 8 # < ' .FEWWW@RrE# C 7VUË.

>H5 C C=9 5 r<{>@7 -@5€Es7 a9 5 A< 9 < .C H5 7 9 5 /€9 <E<?XJ5B7-EZYMÍ!Í .@E .

 „ £   .

C -  5€.@E< OÄE)<'r5 + @.JE C  / BF >3 >3 .87 8 # <s.H7 C .C 9 77 67{.      ®f¯  / :\f† »6µŽ°|ƒ¾Ã ‰ A< 9 <FH5 N+OPC PžO MZ£kËdfZ£k  .C B µ…»€„A~°  !(KS - 1 µ…»€„A~° 7 9 5M51-5 - C 9 5t5 #D7 C 8 5 5. B ´I´ BF -?XJ5)7. C 7 1  9 E< 989 7@5€Es5!A< .- C  5€.

@< 9 <W7 8 # < D7?XJ?5 Q=Q 1  C89 8.=< 7!5s5 #D7 '  D.@E)< C - <G< .A<! r< u <?  J 5 - 9 7. }œƒ¹6ȹ» 1 ‰ 1 5­¿|µ…¸ D¿A} H5 M ´c´ ‰ ´c´ ‰ %€5 " .@7 C >@7:7 <?>@5 C >@7:7 9  / <?>@5 - 7H5T%?<w.C D7 @>@5>@7:7  A<'a<H5 .

- 5 Ì.C Es5 BC .@E 9 9  / - C 7 5 #D7  A<' C D. 7 9$" z<'  u 7>J7 C A C 9 KE7 =9 5s>J7E 7 9 5)7r<)<-7 - ) 5< C 5f>J5 <tE)<GH5f>@7FŽ<.C=9 >@7 ..A<t< / C  .=< .@E"65 5 -5€E5 A< C 5 #D7 A9C 5I>@5 7 ' H5 9  C 9 KEs7 89 5!A< 65 9 5 ' <5 .C .'S 9 >J5 E .IK.

@E - E A C E  9 z< 9 5 9 A9C <r5Ž<?  J 5B> AKE#Ž< 7 9 5 5€E 9 z< 7s>@7H f5 C 5 ' >J7V 5 9 E)< M .@E ‰ ¶HȜƒÁ}œƒ?cf†€»Aƒ5G°@~JÈIÈ~?f¿@ƒÁƒ‚ƒ¹¸@ºc†»|ƒ %€5 " 5 >3 µŽ¸4:Á¿|µ…¸ Ȝƒ¼†€cf~€¿Aƒ5 >@7D7 8 # <#A<.@E 9 <>@5B5# r55B>@7 Es7E&) .)r< %<' ' - 7 7 989 < 9 <B.@7 @5 C 5 2#D7 A<.8< / 5 9 <A< 9 < >@7!7.FEWWW@RrE# C 7VUË.-5H55s5 #D7 =< 9 C 5t5 BF J†€43?H}fµ?~ :‚¿A}5¦}œƒ—Hȹ» 5C׿HµŽ¸ D¿A} <Es5 S 5 / „K7€»Aƒ?¿@ƒ³²  @5€Es7z<087&5 2#  +Yw5€Es5 5 #D7 @-@> B9 ATS  J5 65I>@7E 9 7.J7 A / 5 C -KJ5 A 7rE# -A<>J5 D.8< @>@5¦5 < 5 9 7! 7 9$" r<)>@5y5 #D7 9 °@~JÈcÈ~f¿@ƒq¶œ„\°|ƒ¹I»J†Aµ¹@ƒ .

@E< @ƒ—»|ƒ—»HµŽ°|ƒ¼¿Aƒ µ…»€„A~° B . 7 9" z<s7 7»Aƒ?¿@ƒ‚†Jȹ°@†€f~·¶œ„A~¼f† „ µŽ¸HÝ¿|µŽ¸ 5 ' 5 A< 9 < H5 9 <).

=<>A<'  / ´I´. ? 9 7.JE)<E . -KJ?5#$J5s5 #D7 C - 5I>@5 H£k[o6j­^g] /-KJ5 H5f>J7 87 9 < C 7 9 <>A<!A< 9 < 9 7! 7 9 7 -r< 9 .  x^aV@^nVJZGECZ V e^W] .@E&H5.85s>@7 9 ®f¯ + D7 9 .z< 87@5€E#H5 9BC <5€Es5t.C 7 9 9 7! 7 9"  9 7! 7 9$" r< A9C 5E5FA< 9 K?E7 =9 5w>@7 E †—„I°|±Iƒ³² U C .

@E<& .  C 5 - Yw5€E5s< + 7 9 5 9 7. 7 9" z< 7Œ.

7 9$" z< E< + ‰ f†œf†?H}Iµ~c€¿f†c°|ƒ¹I»J†Aµ¹@ƒ-*·°|ƒ¹f»J†@µ¹@ƒ - 7.

J7H @<.8<>@5&5)5 #D7 A .JE)< ' 5I>@5 ' 5I>@5 7 C 5 2#D7 5 . 7 9$" r< +  †—„I°|±Iƒ³² µ…I»ÄÃ_°|ƒ¹f»J†@µ¹@ƒ Qn   ) z< .C 7@H5 >@5 C 7 9 5 9 < M .

rE ' 5 H5.C 7 9 5t>@5t5 2#D7 C 5 C 5-KJ5G55 989 < %€5 " >@7.>0.

J?5).%7A<0=< 9 .@E<.

)z<s>@7 C 7 ' M .-@>@5 C 5y7 K 7:7!<7.8<>@5 < A 5 .A<.

>H5 C r<Œ>@7 a9 5 /€9 <E<?XJ5B7-EZYMÍ!Í .

Q @-@> B9 ATS .

       .

@< BC 9 D.IK.'S 9 .FEWWW@RrE# C 7VUË.@7 @5 Ì.  ‹ .

>H5 C r<{>@7 a9 5 /€9 <E<?XJ5B7-EZYMÍ!Í .

  .

  .

.

 D.C < E87 -@7 C .

> C89 . C 5 .

  .

9 7g7 <5 5 5 >@7!ž<. $ &%'$  * 4 ..-?E 705H5 C  9 z<?  J 5!7 >J7 >J7 89 . 9 C .C C 5  89 .C < E < 9 787 5I>@5 A9C 87 5WE .C C  :. - ' 9 7 5 C C 5I>@5a>@7 =9 . @>J5s55  =9 .?XJ5 9 >@7-En>@7 5 )( +* +. - .   9 7D7   ) z< >@7 9 C >J55 #D7 ' '& C 7< .

 9 < A9C .r5t5 E !"#.> ' 87 / .

(/3 3 D.  !* -. 9 -.C <E87<D7 / .

C M 5 9 C 9 7M7 >@7 =9 .C 5I>@5 C -5  89 .-. :>@5O  ( *+ 87 9 € % 7 O>@7 C=9 .$# # ( *+ " " %&" # A9C H5A< 9 <Œ>@7r< 9 <?  J 5B>@5wE -@>@75sE78Es5 A >. 5 C 5 9 7 .@Es7 9 5 C ) C H5s5 9 7D7 r<>@5t>@5# 5 ( * .7-E Es78Es5 %€5r> 9 5s>A< 87?XJ5s5 10 z<087@ C) C 9 5 /-@5E7x>@< z<087 7 -KJ5 9 77->r>J5>@5 C     Es7DE5 1 9 7 C 5 9 ( * # # " # . C -A<F-A<?>A< ' @ .

¢´¤ « C:¤ « •µ ¤¨¢«¡¤ « Cz¤.¤¤ 9« C:¤ 8¤¨§ « ª 8¥.¤ ª Cz¦ § C:¤ ¥.¤©¤®¤ 9« C:.¢ ¢ A9C:¤`¥.ª 9M M M M M ª M L ª M M  Š M             %  Q 9M ª Q   "  # M #   2# '  (  # I'  M  8  Y #  O  % !'    ( Q    ? J )   0   Q 4Q   M  M .¶ gª « ¸· «'¹ ª4¥.¤4¤ « Cz¤ A¡¥8ªv¥8ª ¤¨¦ ¤ CJª ¤‚¥.¤q¤ « Cz¤ ³ §8ª . C 5 9 C 7E25 5tEs78Es5F-@5€Es7x>A< .« .Cz¦z§ Cz¤¨¦ A §.¦²¤ ª ¤¨¦m« .C:¦m§ C:¤v¦z« A ª ±° ªv¦Z¤ ª C:¦ § Cz¤ ¥.¥\¤ ¤ ¦ ª.ª A §.J705 5 C 7-E 2436587:9.¤ ¢ A Cz¤g¥\¤ ¤ .¥.¤ ¤ .«f¦ ¥ «'¦z« .†JU6W XYXMKZNI[\HE]€^ `]1NI^4b`P‚CJƒJu K FIi/H6Pmlon`Np'rs„r XYXMKZNI[\HE]_^ g]aNI^4b`P‚CJNI[ PE^:H'n`N6i/H6Pmlon`N  ˆ KMu8L4NgSVNIU6OQW PTSVU6W XYX8‰ ]aN'b`N6H4b`PJHE<]_^K `]aNI^JPJHJikH6Pmlon`N <K ^E] \FvD ˆ KML4NIOQPTSVU6W XYX8Š‚PJHE]_^ g]aNI^ ^E] \FvD„i/H6Pmlon`N ‹ŒŽ_ ‘W $ &%:’ “ •”+–—&–™˜›šZ–™œ"˜ ”@( #”+–ž( Ÿ¡˜ £¢ ¢ A Cz¤g¥.«¬¤­¢q« ¢¤ A ªT§ C:¤¨¢qª C ªT¢q« .« ¤¨¹ C:¦z§ ¤4¥.ª .ª ¥.¤ A ¦ ªv¥.M5 .- C89 .Cz«« « § C:ªv¥.¤ §.«ž¢«'¢ ¦ ª ªv¦zªº¤ Cz«'¢qª»¤ «f¦:ª ¤¨¹.7=<?>@5BA CER DGFIHJHKML4NIOQP KML4NIOQPTSVU6W XYXMKZNI[\HE]_^ `]aNI^cb`PedfF gDh]jikH6Pmlon`Nqp'rs?t KML4NIOQPTSVu\Fv^mwvOQPE]_^JN6HaU6W XYXMKZNI[\HE]_^ g]aNI^xH6Nvy'^:PJCzFv^E^:P|{YFYb`K N6ijH6Pmlon`NQp'rs?t KML4NIOQPTSmCJNI[\HE]}KMLcNIOQP6~Nvy€U6W K XYXMKZNI[\HE]€^ `]1NI^4b`P‚CJƒJu FIi/H6Pmlon`Np'rs„r KM‡ L4K NIOQPTSmCJNI[\HE]}KMLcNIOQP6~Nvy€:i [8]1….¤ ¤¨¢q¤©¤¨§ Cz¦z¤ §.§.¤ ¤ « C ¤¯¥.ª §.

2#       % ?  !      M  ?XJ  # #   .

Q      .

.¢qªkV¢/.ªqªv€¤ m«'§#)¢ o&f¦z¤  3 % I' S  # ' # .0v§(±¦   Y ?XJ  # J - # 1323465798:%.8ªT¦:ªkV¹(o&!?ª + ° ªv¦x¤#¤  «!z¤ x} ¤¨¦™« $ «'¢).¤}ªz¦.A 4M6T4GL T4 Z `a3: Z :ihV: A 5VL T9: F .¦m.« «f¦ (& ªv¦ z«ž« $ *z«c§\¢Q ª ±)¢ .« m¤¨¦: ª &f¤¨¹.« &wJªv¥.+?ªz«  « ª¤º« $ «f/¢ .¦m«.(+±¤ª &!±¢qª 3V¹(o&!?ª + ° ª4¤ ª +±¤¨¦•ª)&f¤¨¢p ¤¢«.¤¬¤ «!:¤ ¤& /.¤`¥.kL%b C f 5kP bdVf 5YK blVf O << M 4 9 m 4 ZnKC L Q : K : Z M@T A B TV: A H>HH g ^ µ ¤q« $ «'¢).+±¤ª z«.>.¤)&'¤v¹(*z¦z§z¤¨¦¡¥8ª &..¦m«.(+±¤ ~z«zm§8ªx&!+?ª *z«Q¦m«. <<3=>=>=>==>=>=>=>==>=>=>=>==>=>=>=@?A 9 BDC6E :GF HJI K 8LM>MNF O 7 B>P 8 C>K .m¢q¤ §.¤¤ «!z¤  " #%$ !« &'§(' ¤Q¥.m«'¹RJª®§.B¤`¥. <<Q 4 K 8RL A LS:MNL T A CUPB TV:MWL 5XP 5YK C[Z T\L 5]P 5YK_^ <<Q 4 K 8RL A L` a: Q : K : Z M@T A B TV: A Fcb CUZ T C 5CUZ Ted(f ^ g ^ <<3=>=>=>==>=>=>=>==>=>=>=>==>=>=>=@?A 9 BDC6E :GF H K 7>7 <<Q 4h C[ZDC ` a3: Q : K : Z M@T A B TV: A\Q 4h CUZ 4e:M E L38>: A 4(M Q :MNLT A CUP>B TV:M << .«zV¹(o&!?ª + ° ªv¦ ¤™ª:¦*o.§:¤ •¥.]Fjb C[Z T C 5C[Z T\dVf.«Q¦m« ª + ° ªv¦ ¤v§:¦zª {:ªv¦z« ª |.¤x&f¤¨¹(y:¦z§3:¤¨¦ kª +ovf¢ ¥..§3:¤c¥.*z¤¨¦zª ¤ & {.         ¦?ª ¤º¥.«cª/qS (r&'¤¨¢ «s&s&'¤¨¢ut  «f¹>z¦z¤¬¥\¤¬¢/vw:¤`¥...

' # %  M I' % " ' I' % .

" ƒ‚„†….

„y ‡.

¢qzª &.« ¨e.¥.«.©  ª .)¤ &'¤¨¹ *:¦m§ :¤v¦ &f¤¨¢ ¹\« ªºª .¦ ¢ œ.¦ms« .¤º¥.«!+±«!z«  ™ ¤¨(¹ *z¦z§ z¤¨¦z!« £¹ €¤ .m¢q¤»¹.« ªv( ¢q!« z¢|¤ Jªv|¢ Dvf¢ ¥\!« 8¹.«f¢¢q«!z¢¤ ¤V¥  &f¤¨( ¹ *z¦z§z¤¨¦z«!.¤v¢q«.B¤)¨ ¤ ™¡  } ¤¨¦.¦z«!& ªv¦m¦z«.«'¢›z«'¦z¤ .« ª +±¤¨¦ \¹.§¤ Ÿ.« «»§.§ z¤ ²¥.8ª 0¨§.«»§.¤  ™ ¤ .8ªv¦z{ª ¤ } ªv¦zª‚« :ªv¦•|ª &f¤¨¹ «f¦  ¤Qªv3§ :¤¨¢ Ÿ& ªž§(z« « $ .¤»¥.ˆƒ‰‹Š3ˆƒ‰ŒŽc’‘Žj“(Ž•”D–c‰—RŠ3“˜Š3–j“(ˆƒ '¤¨¹ :¦m§ :¤v¦ :«'¢¤º¢«.« } ¦z¤ 0¨¦zªv¢qª ' ¤»«f¢ .¥.¤º¤  w« :¤¹.§\¢Q|ª &f¤¨¹ «f¦  ¤q¥.€¤ &'¤¨(¹ y:¦m§ :¤¨¦  ™ ¦±« ªv*¦  !« o¡(¥ VV¹ žv)¢ o& ª  ¹.(+o&.« «c¦z«!z¤¨¦z¹.¢uo.«fu ¢ z«f¦ V*¦ z§8ª o  ™ µ € ¤ z«f/¢ .(¹ o&f¤"ªv¦ 0v§.«ž¹.«f¢ ¤ +±ª Ÿ+±«  ™ § + ¢z«»§\£ ¢ &'¤v(¹ *z¦z§ z¤¨¦.¢q«fR¹ :¤&¥.¥8ª€&.(œ((+o&'¤   € ™ « w« Xm|« V(¹ o&!?ª + ° ªT¦ ¤ £6ª :¦ .+±ª m«  ™ µ ¤º¥.B¤`¥.+±ª m¥« ¤ ¦z!« &'.«'¹(š¸§..y:¦m§:¤¨¦&f¤¨¢›¥.¤ yŸo+±ª‚¥.«.«'p ¢ z«'¦ &f¤¨(¹ *}¹.¤`¥.ªv¦¡¹.¤g¥.0¨ªv¥.

  § &  \¦ & *   ™ O J % % % .ªv*¦ z« §.¥. ¤  s +±)¢ .«s« ¹.*¦ v §.«'¹.

' O J  % J % S Y % # L % Y W J % ' ' ª % TS U WWW J % % J J NL Y .

  ¥.

 .

e )ƒ   $&%  Q " –4œ˜ ”@(.

« CJNI[\HE]_^ `]aNI^‚b`PedfF `Dh]  « ¤ & s&f¦ ?ªT¦²§.«ž« $ oyŸV¦²)¤ &f¤¨(¹ y:¦z3§ :¤¨¦¡¥.¤&'¤¨¹(y:¦m§:¤¨¦ ¨¤&f¤¨¢/.¢«'R¹ :¤º« vs&Yš8ªv¢qªv¥.&'«!B« ¹\«'¹(š¸§.o+?ªT¥.¤¨¦ƒ&'¦*?ª}§. M (:@5V4 8L(M>M 4 K 8LM> O C[Z T\L ^ <<  K :[57 C 8RL Q : A L B TV:[5VL T CRK L65V4 Z T4 << 5 7 TV: Q : K : Z M6T A B TV: A L P L C 2(: 5 M465 << (:[594 8LMM 4~bwf Og ^ g ^ C[Z T 59L CUZ bwf O << RA C L Z Q : 1 l\: P d>4TV:M << Z Le8 CUZ IVLWL P L C 2(: B M L\: K : Z M@T A B << 7(L A L K A C L A B 5 E 4 TV: A 4M@T T CRK : (:[5V4 8LM>M 4 E 4 TV: A 1nM@TL T C>K :  1 l"! ^ A 4 T B A Z l ^ g ƒ‚„$#„y % .« ªv(§ +  %  %  J " " J ' M ' 1323465798:%.¢e&'¤¨¹(y:¦m§:¤¨¦ ª ° V¤ §.¢ªv*¦ 0¨§. ”+–c( —&Ÿ v- E” « ¤& •¹ ¤—&'¦*?ªv¦ §.¤º¥.!«  $ ª»¥.u ¢ &'¤v(¹ *z¦z§ z¤¨¦ 8¥.«•¹ ¤ ¦m«.¢¢/vw:¤`¥.

' ‡.

ª &!+?ª *z«"« $ oyŸV¦z«'¢ ª:¦*o.« ªv§ +  µ «.ˆƒ‰‹Š3ˆƒ‰ŒŽc’‘Žj“(Ž L : K A C G 7VL A 5V4T A :MW4 E L C : A Q 4Rh3L B 68 T Q L TV: \ b Z : 4M6T C 8>: Q 4 K 8 L(M>M 4 f ”D– ‰>Š“˜Š3–j“&%ˆGEYŽ ˜(']Š « ¹.¤¨¦4¹ ¤ &'¦*?ª®¤&f¤¨¹(y:¦z§3:¤¨¦ ¥.§z¤»¦z« «'¦ '¹(&!?ª º¤¨§ &'¤¨¹* Z¤&f¤¨¢).y:« &'ª z¤ ¤& ª .(o+±ªv¥.

§\u ¢ &'¤¨¹ *:¦m§ :¤v¦}¥\« ªv(§ +© 8ª V¢ ¤ & ž« ©J ª .¢ ¥(±¹8ªT¢/& ªv¢«'¹R:«  ¢ .«'¦‚¢¤¨¢«'R¹ :¤ .B¤`¥.±ª   ¤ &'*¦ ?ªv¦ §.¢ !« z¤¨¦Z«!* Ÿ&'¤™¥\«£¤ «!:¤  ¤& —v}¤.¢›¤¨§ z¦z€¤ &'¤v(¹ *z¦z§ z¤¨¦ ¤ & ª :«f¦}¥\« &f¦±ªv¦•¤¡¤ «w:¤¡§.¦zs« &f¦ ±«..¢´/¢ vw:¤`¥..¤c¥.8ªv¦:ª V( ¹ o&!?ª + ° ªv¦ž¤ »ª z¦ o\§ :¤ ™¥8ª &.« ¤& .§ z¤ &'¤v¢ ª +±¤¨¦m.« V(¹ o&!?ª + ° ª ' ¤ T§.ozª)V¹(o&!?ª + ° ªv¦ ¤¡¤ «!z¤&'¤¨¹*}«cª ¡¦z« «f¦ f¹(&.« .+±ª m«&« §\§« .¤ c& ª m¤  v&f¤¨¹ «'¹ ±«'R¹ z—« :«f¦z¢¤  §.¦z!« &..« m«'€¦ &Yš8ªv¢qªv¥..8ªv¦zªc§:ªv¦ ™ ª | §.¤cªc§(zªv¦ ¤|&'¤v¹(*z¦z§z¤¨¦Z¥\« ªv§(+© >.¦*o0YªT¥.¤ ™ # ¢´¥\!« :«f¦z) .« V(¹ o&!?ª + ° ªv¦Z¤ £6ª :¦ .¢›ª§.« ªT§(+ *) *:¤ ¤3&f¤¨¦z¦m«k.¤¨¦ §.¢´)¢ v!z¤g¥\¤c§:ªv¥.ªv¦:ª ¦z.:«f¦q¥\«x&'¦*?ªv¦º¤&'¤¨¹(y:¦m§:¤¨¦q¥.¦m¤ (+±«f¢Qª  ™ «') ¢ ±¹8ªT¥.¤¯ª §8ª + §.

B¤ .¤ ¡¥.8ªT¥.+±ª m«  ™.«f>¹ z¦z¤¥8 ª &.B¤`¥.«fp ¢ z«f¦£¥\!« 8(¹ V¥.w« 8(¹ ±¥\¤  ¤¨¦:ª»¥8 ª &.¦ +`..«'¥ ¹ yJªvR¹ :!« £«ž!« * 6Ÿo&f¤ .« «'¢ m«'¦¡¥...«   ¢ \¦z¤ ¡.« y o&f¤ ¡¥8)ª &!+?ª *z«ž¥.+±ª m«  ™0/(1 .

VR¹ :.« V¦z¤ .

ªv¦*z« §.« } z¦ ¤0¨¦zªv¢qª ' ¤»«f¢ ª .«'¹.¦*v §. *o+ J . ¤ ±ª™¥.¥.¤  TS U E L38>: A ±¢ § &  \¦ s + ).  WWW %^ g ^ *A.&f¤¨( ™ " % ' % " $" # ' % L % % M # % J X' " " X' % # % X'  " % % J I' M M M % % L L ª 1323465798:%. K 8LM>MiF O >H H>H M6TL T CRKGK : Z @M T CUZ T ¹.

«s« Y " .

     \ —  Q  .

 ]      –4œ˜ ”@(.

”+–c( —&Ÿ š * .

.  $&%  1323465798:%.i7%3 ^ <1< 0RA C Le: P d>4 TV:i7=>4 B M L K : Z M@T A B T9: A\Q <<? T A C[P>B TV:M Q 4i 7 =SM 4 A a3: C?:B L C M L3:3M 2V: Z TV:i 7 =jbX/ 7 3f ^ <A< @ M L K : Z M@T A B T9: AGQ 4h3L B 86T 2V: Z TV:iC 7 Bcbwf ^ <<? P L C 2(: B M L\:W:@7V4 A L Q : A .¤/.¤v%¦ $`§.(?ª  J o*±¹(0Q.(?ª»¥.ªv¦*z« †Z§.¤)&'¤¨1 ¹(y:¦m§:¤¨¦¡¥.« +±¤ &'¤¨)¢ . Yš –4œ"˜ ” –   &f¤¨¹(y:¦z3 § :¤¨¦¡¥.ªv¹.-./¤ .¢›¤ m«!z¤q« $ *z«'¹R:«   ¢«.€¤ &'¤¨¢ /¤ &f¤¨(¹ *z¦z§ z¤¨¦¡¥. .+±ª m«  ³ §8ªv¹.8ªvy¦ Ÿ±¦ ¥.)¤ &'¤v/¢ .m¢q¤º¦m«.ªv¦:ª€&'¦*?ªv¦•§\¢Qª & .¤vZª .¦:ª ¤ ¥ ±ª ¨¦zªv¢Qª# ¥8ª&.¥.§z¤ ¥\¤q¤ m!« :¤ªvR¹ o0¨€¤ . <1< 0RA C Le: P d>4 TV: Q :T C 79:* 2V: Z TV: K :[5 Z 2V: Z TV:i/ 7 3 ^ <1< 0RA C Le: P d>4 TV: Q :T C 79:* 2V: Z TV: K :[5 Z <<  M L T A CUPB TV:M Q 4N765\M 4 A a3: C":RB L C M 2V: Z TV:i6 7 5<.+?ªz« ª +±§\¹.  .¤  « &'¤v¹(*z¦z§z¤¨¦¡¥.¥.N6 7 5(f C hjbXC O H>H>H g :[5V4N7/3/4 B M L\: K : Z M@T A B TV: A\Q 4Rh3L B 86T 4 [: 5V4N76574 B M L\: K : Z M@T A B TV: A\Q 4 L3:M Q 4N7/3 K98 7 C L74 K 8 7 C L Q 4N7/3 « zª£¹8ª ¨§.¥\¤§\¢›¤ mw« :)¤ v &f¦ ±ªv¥.¦:ªO.«s&'¤ .«(M_ªv§+²«ž¥. 7BD.¦z«!z«f¹>:ªv¥8ª ¹.?ª .&¤ !v3¤ &('•(§ :ª£¤x¤ .«'¦:ªT¥.?ª v‹&'*¦ ?ªv¥.?¥ª vž(§ :ªT¥.s« .¢ ¤ m!« z¤q¥. .N 7 = ^ <<? P L C 2(: B M L\:@7(4 A L Q : A .«s& .ªvŸ¦ žv¢!« z¦z¤»§.(?|ª z¤g¥\¤¡¤}ª:¦*o.J ¤º§(z¤¥.¤¨¦ q) o0v§8ª ++*  µ ¤º« $ «f/¢ ..".»s« .\¦ . .« } z¦ ¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ ª .s F~0 ª S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTCTCTTTCTCTCTTCTTTTTCTVU6WYX?ZY[\-]_^IU`VZ a6]7bNc S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTCTCTTTCTCTCTTCTTTTTCTVde[CfY`?[ ]6ghi9j kml?Seln9n o/p"qYr s1t6uCvxwypz{?| }v ~">€ o/p"qYr s1t6uCvxwY{?| }pAqC‚e€ o/p"qYr s1t6uCvxwCƒCvr?|Cz9}e€ ¹.¥.8ªv¦zª»¤¹\"¤ !v¤  #£e ¢ &f¤¨(¹ *z¦z§ z¤¨¦ ¥\« &.*¦ ? ª &../.€ ª .  §M &  \¦ ¤ ±ª‚¥.¤ _ª &!+?ª *z« ª +±§.«ž§.I  .ª+o*:ª 0¨«f¢ ª z« ¨§ V¦ µ « :ª :ª ¨«f¢ `¢q¤ *:¦zª6X-Km«.«NM_ªv§(+©¡1«. yŸo+ «s« .s« &.¤ ªv§ z¤¨¢Q6ª Ÿo&'ªv¢«'R¹ :c« .  ..E GF~0 H.«s& .+?ªz« 1 ª +V§.(+?ªv¥.ªv¦: ª &'¤v(¹ *z¦z(§ V¦ .¹.(?ª vž§(:ªT¥.s« &.(?ª  .(+?ªv¥\¤¨ ¦ &f¤ .¤/&f¤¨¹(y:¦z§3:¤¨¦¡¥..¦*v…„ §.+±¤ª 8ª  $ ¤€¤ &f¤¨(¹ *z¦z§ z¤¨¦¡¥. ( 0 € !0 (  !* )+o* 0 L TAluno +nome: string +matricula: string +iaa: float +numeroAlunos: static int = 0 +Entrada(): void +Saida(): void ¨§.1PR#z¤¥.&'«!B« &f¤¨¢¤).¤ R‡‡‡  +±¢).«'¹.¹. 7 B. " €ª ..1P ª &.

    ¥.

 .

   G .e  t{CpAq‚   ƒ .

" S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTHGI0g ] S9S-Uyihk kC]<KJYfy`?[i ]L9g h"a  8t @6sp9rO= $ ]ZŠ]Cf?6hg ]M%] $ hmjiCh1kCkj Wm]1kN10Cg ] $ ]9k l9]1aeg?WZyg ]9Wh k $ ] k4yZyfY`?[Ci9] . t @6s9vp~A ~  i?W[ j ]  $< S9S6U/gW[Cf?Zyg9]_h kg2-g [Ci9]B0mi?W[ j {?|~ |p9r pAqC| qCt Yv }z." b 1  C 0 g ] ] k 3 f 2 k  [ i ]9k4 j1Wj h?aeg?W6j $ jhDkCj65 $ j $ h $ j $ ] k7b / $ + aYi`VZh i 1] a6kg?WZyg9] W_h $ h1kYg?W Zeg ]9W7 $ hiy`Aj W-j $ ]9kmh $ h'! [?aY[ $ ] k $ h"ayg"W] $ j i`Ij k k-h8" b IS r s ~{ { 98:6v6C { { z~ U .k " S9S l ]1akYg?WZyg ]9W $ h. S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTCTCTCTTTT U/gW[fZyg9]9k S9S-Uyihk kC< ] /W[\-j $ ] }Yp?ƒ6~9|6v = S9S6U/gW[Cf?Zyg9]Da6] Wyjy`>0 {?|}pAq‚ qz?v {?|}pAq‚my~9|C}Yp rt-s~) uz .+UU-9["a $ [ ih j&/W6] \Yh[g j%h?aeg ]. q6~Yv-{6~-r v_{|u S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTCTCTCTTTT?l`Ij kk6h S i`Aj k 6 k h ^eh kk]CjDWheWYh1k-hayg9j<Zyj hk k] j(Z jy`VZ a-]_]?Z Z /W6]!%h1kCk]9W#" h < % Z y  j Z aY[\Yh1WCk-[ $ j $ hYb  $ ^9h& Z a'] eh)( Z%yj*ej6gW[Ci?Z `"jxh Z.E6s1tCq6z-{F $ ] j1Wj aj $ i j j ]Cf?-hg1] i`Ij kk6h7jX"Z[ 0<j $ hiy`Aj9W6j8C#D].

U.U r1z1t| 6 w wBVCr?}p1z1tXWz%@6Y v9|CzZW[V<ww v1qCusA qCt yv9}z.«'¹.¥.\~ ts |[V w6w ]  S9S l ]1akYg?WZyg ]9W $ hmi3^ [ j S S l?9 W [9jxZej i^& [ j $ h Z 9#:v6{C{ zC~FQ1r1z1q{|L98:v-{{9z~3` .U r1z1t| w6B w VCr?}p1z1X t W% z @6Y v9|CzZW[V<ww v1qCuA s  X"Zhmi j $ j j-g?W[Cf?Zeg ] 0mi &]  qCt yv9}z.E6s tq6z-{xw6wBVW/r z qy{|C} tC|6z9}#Wu v6Wyr%c%Yp1~FV [9j $ ] w6w ] ª S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTHGK0g1] S9S lc-j /j $ jmj1Zeg ] /j6g[i9j %hayg h aj $ h1kYg?W Zy3 [ C#D] $ ]_]Cf ?6hCg1] S9Z S e#^ h _[k-g9hxZ  $ h kgW Zyg9]  W  j1Wj i j $ j i`Aj k k6h ¹.¦*v…„ §. ]Cf ?6hg ]h_y[1kYg h?aeg hx]6f1khW \yh z@6YR qz"v a z%@6YOb qz"v Y~ |}yp r?ts ~*amz%@TYb y~9|}yp rt-s ~A p~ ~Namz@6YbAp~~ qt9Yv }3 z E-s1tCq6z6.  §M &  \¦ ] d/h $B kgW Zyg9] W ¤ ±ª™¥.!ej Z `g S S lc-j/j $ ]mj1Zeg ]/j6g[i9j%hayg h  9 a j i ]1aeg?W ZC8DC] $ ]_]f?6hg1] S S/]f k-h1W \Yh j<!y]1Wyj $ h [?ay[i[ e 9 j `[%Pj#C8DC] $ ] j6g?WY[fZyg ] [9j j%b 9#:v6{C{ zC~)Q'R7=?p~ ~QSTR .E6s tq6z-{xw6wBVW/r z qy{|C} tC|6z9}#WuCv.« } z¦ ¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ ª .ªv¦*z« †Z§. qt9Yv  } z3E-s1tCq6z6{. { U. *o+ «s« .¤ R‡‡‡  +±¢).

.       \ —         .

q 1 t v9}CzEstqz{ r1z1t| w6wBV9uCv-{|C} typ?t6W-z%@6Yv |CzW[V<w6w ]  qt yv9}6z3E6s tq-z6{xw6wDv1qCuCs  S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTCTCTTTCTCTCTTCTTTTTCT GI0g ] $ ]9k S96 S GI0g ] $ ]9k $ ]m]Cf ?6hCg11 ] (xje`1g hW-j  ]1k j6gW[fZyg9]9k $ ]_]Cf ?6hg ] hxk6h"Zhk-g1j $ ] S9SehC[Cg?ZCW6j $ ] k j6g?WY[fZyg ] .(a]'eh)( y  j6g"W-[ i"Z `Ij(D[ jj. k (a'] e1 h ( yj6g"W-[ i"Z `Ij (x[ j3 j " ƒCz6puqC|C}~ u~)Q'R1 S9X S ejC[ $ j $ ] k j6g?WY[fZyg ] k." ƒCz6pu ~6p?u~ "Q z-{|}6v~N`yzC{TR r1z1qY{?|  S9S6GI0g ] $ ]9k. #98:v-{{9z~)Q'R .

C8D] $ ] kNF0Cg9] $ ]9k ƒCz6pu 9#:v-{{ zC~=3= qC|C}~uC~)Q'R . .@6s9vp~ ~[R . r1z1t| w6wBV9q|}CvTWyr1z"XWz8WCq6z"v6WCu z6W-~stqz ‚v |6s6p?q6v1Q"r9pqNqz?v[RI = WKVK r1z1t| w6wBV9q|}CvTWyr1z"XW~8WY~9|C}Ypr?t-s~. S9T S d%h'!%[aY[.¥. Cv9|q6z?yvFQ1{?| }YpAq‚q6z"v[R Cv9| Y~9|C}Ypr?t-s~)Q {?|}pAq‚I)R . yŸo+ «s« .WCu z6W-~Cst qz ‚v |6s6p?q6v1Q"r9pq y~9|C}Yp rt-s~TRI ] r1z1t| 6 w wBV9q|}CvTWyr1z"XWz8WE8ETWu z6W-~st qz rpAq €6€ p~ ~  rpAq b ‚v O | Q'R1 S9S6GK0g ] $ ] i 1 ] aCk-gDaTD ]_jy`?g9hWj ]1k j6g?WY[fZyg ] k ƒCz6pu 9#:v-{{ zC ~ =3= ~6p?u~ Q"z-{|C}v~N`yzC{TR r1z q{?| . v9|p~ ~OQIuCz1t. hg {?| }YpAq‚ v9|q6z?yv)Q'R r1z  q {?| {?| }YpAq‚ v9| Y~9|C}Ypr?t-s~AQ'R_r1z  q {?| uz18 t @6s9v v9|p~ ~ Q'R r1z  q {?| S96 S GI0g ] ƒCz6pu ƒCz6pu ƒCz6pu . z E6s1tCq6z-* { a<S) .«'¹. z E6s1tCq6z-1 { Q'R .¦*v…„ §. $ ]9kNehg . }Cv9|9t}9q qCt yv9}.  §M &  \¦ $ = WKV[ = W[VK ]_]f?6hg1] wCw qz"v w w Y~ |}yp r?ts ~ C w wxp~ ~ C wCw<v1qCuC s  w6wDv1qCuCs wCw<v1qCuC s  ¤ ±ª‚¥. z E6s tq6z-A {  ] ]  GI0g ] $ ]9k / kg326g [Ci9] k  S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTCTCTTTCTCTCTTCTTTTTCTVU6WYX?ZY[\-]_^IU`VZ a6]7bi S9S U `"["aCcj jCf jC[ _6] $ &h !%["a7 h 1jy`I]Ci > j  'h I^ W[  j " j1Wj ]_j6gW[fZyg9]Da Z %h1W6]?U7`NZCa-]9k b pAq| 98:6v6{C{ z ~ =3=NqCt Yv }.¤ R‡‡‡  +±¢).ªv¦*z« †Z§.« } z¦ ¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ ª . }Cv9|9t}9q q6z"v  ]  }Cv9|9t}9q Y~9|C}Ypr?t-s~ }Cv9|9t}9qŠp~~O ] p~ # ~ ap~O ~  ] q z?v8aqz"v  ]  y~9|C}Yp rt-s~3aI ]  ] S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTCTCTTTCTCTCTTCTTTTTCT S96 S GI0g ] $ ]9kmk-g1jg [ i %] $ &h  k6h?W ic6j ej $ ]9kk-&h  Z  ]Cf ?6hCg1] S9SyhD8 k ^ ] $ &h L/j1aY[ yZ`Aj W j6gW[fZyg9]9k k-g jg9[ i {?|C~ |Yp9r pAq| Cv | qCt Yv }. . ª ] zC{ z { C z { C w6wBVCz"Yv#Wu z6W-~st qz w6B w V6~9|}yp rt-s ~6W= WKV w6B w VCp~ Z ~ W=HW[V = W[V ¹.

  ¥.

 .

   G .     ƒ .e  .

S9S>TTTCTTCTTTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTCTTTTTCTTCTCTCTTTT U6WYX?ZY[\-]ejC["a7b i pAq|~6p"q Q.

R . {?| }pAqC‚spAq6~Ta[V                                                       qFV[ S9S%lW-[ jZ ]Cf%?6hg1] $ ] 98:v-{{9z~N}z8\Cv6{C{ z } g9[ %  ] ^eh1kCk]Cj i ].

 a6].

/h4eW-]! h1kk6] W S9S l9]3 j9Wh j hayg?W-j $ j jCf jC[_6] i ].

z \Cv-{{9z9} b Cv9| Y~9|C}Ypr?t-s~)Q y~9|}yp rt-s ~ZRF WKVK r1z1t| ww V9q| }v6Wyr z"XWz8WCq v }CzWu v6W-~st q6z{6Wu ~#Wup {CrCp-s6p?q6~#WFQAv[W3aTRA=V[ "p q|_qt yv9}6z3E6s tq-z6{F rCpAq €6€ qt9Yv }z3E-s1tCq6z6{1 rCpAq b ‚Cv9| Q'RF S9S%lW-[  j Z \hCg1]1W ƒvr?|Cz } N w 9#:v-{{ zC~ \Cz O} Q € $ h ]6f%?hCg ] k $ ] g9[ %] ^.\v6{{9z9} = W[VK {?| }pAqC‚ qz"v  ‚v9|-s6p?q61 v Q"r9p(q Nqz"YvXRF C}6. j $ h h_Yh'3 `"] r1z1t| ww V9q| }v6Wyr z"XWz8WCqz?v#Wu z6W6C}6z.z \Cv-{{9z9} b Cv9| q-z?y1v Q(qz"v[RF j1aeg hWY[9]9W r1z1t| ww V9q| }v6Wyr z"XW~8W y~9|C}Yp rt-s~.Wu z#W6}z8\Cv6{C{ z }O= {?| }pAqC‚_Y~ |}yp r?ts ~) ‚v9|-s6p?q61 v Q"r9p(q  y~9|}yp rt-s ~ZRF C}6.

/h1kk6]j ~Cst qz QqCt Y  v }z.E6s1tCq6z-{#RI i ] a6].

%h a*S) r9z qC|6~ uz9}_wx~s1t qz bI{p vQ'RA r1z1t| w6wBV%EstqzTW[Vwwr z q|~uCz9}mw6wDv1qCusA ~st q6z.

r1z1t| r1z1t| r1z1t| wwxsp"q~O ww V   . Ir z q|~uCz9} b qC|}6~ u~)Q'R1 pAq| r z9qC|~uCz } ] .\v6{C{ z9}Ob Cv | q6zYvAQ'Rxw6wDv1qCuCs  V~ |}Ypr?ts ~TW= W[V ww}z.U v1qCuCs R  \Cz } Q pAqC| VCz"vTWu #z WTC}z8\Cv-{{ z }O= WKV ww}z.E3W ZWT:    .\v6{C{ z9}Ob Cv |1Y~ |}yp r?ts ~Q'Rw6w<v1qCuCs  r9z q|~ uz9} a>S) r z9qC|~uCz }_wx~st q6zObA{Cp vQ'RA r9z qC|6~ uz9}TU.UZR . r1z1t| w6w<s6pAq~O r1z1t| w6wBV% E stqzTW[V w6w r z9qC|6~ uCz }mw6w<v qCuCs  ~st q6z.W TW6E  = wwxsp" q ~O r1z1t| r1z1t| ww w w  W[VwCw je`VZ a6] r z9qC|~uCz }6U.

Ir z q|~uCz9} b ~-p?u~ Qr1z1t|IRF ] S9S%jCi hk  k ]mj<Z I0g ] $ ]h kg326g [Ci9]Dk6h' Z ]Cf?6hg ] b r1z1tC| 6 w wBVCq  Y  v }z3Wu v6W~st q6z{TW3a#W[VDww<9#:v6{C{ zC~ =3=  v9|qt yv9}6z3E6s tq-z6{)Q'Rxw6wDv1qCuCs  ª r1z1t|  w wxsp"q~O r1z1t|  w wxsp"q~O r1z1t|  w w VWvv-r?tC|6~ 6 q uCz8WA='98:6v6{{9z~.W#}z8\Cv6{C{ z })Q.

*o+ «s« .¤ R‡‡‡  +±¢).« } z¦ ¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ ª .  §M &  \¦ ¤ ±ª™¥.C}z8\Cv-{{ z }R1HWKV<wwDv1quCsA S9S-ZkC] $ ] i9] akgW Zeg ] W $ h i ]& [ j ¹.¥.ªv¦*z« †Z§.«'¹.¦*v…„ §.

.  ]      \ —         .

C\ v-{{9z9} b ~6p?u~Q r z1t|KRI C S9SUeih kk6j1a $ ] 1C 0 g ] $ ] k.C\ v-{{9z9} b ~6p?u~Qr z1t|KRI S9S1kC] $ ] i9] akgW Zeg ] W $ h i^& [ j  h`Ij j-g?W[Cf?Zy[3C8DC] . 98:v-{{9z~N}z8\Cv6{C{ z }1Q'}z8\Cv6{C{ z }RI C}6z. r1z1t| wwxsp"q~O r1z1t| wwxsp"q~O r1z1t| ww VW vv6rtC|6~ quz#WA='986: v6{{9z~3W6}z8\Cv6{C{ z }TW3a8W6}z8\Cv6{C{ z })V w6wDv1qCuCs S9SCT9l?W[ j ]Cf?6hg ]*eW-]! h1kk6] W 98: v-{{9z~N }z8C\ v6{C{ z }*a  }z8C\ v6{C{ z })  }6z.

9W   |z uz6{%YW z%@6Y v |z b v |6W up?}6v9|6~?Yv9qC|6vXV w6wDv1qCuCs  r1z1t| ww  V  q. Ob v9|1y~9|C}Yp rt-s~AQ'Ra[D V wwM }z.\ v6{{9z9}b Cv | q-z?YvAQ'RF r1z1t| ww  V  q.\ v6{C{ z9} b v9| Y~9|C}Ypr?t-s~AQ' R w6w<v qCuCs ] S9SCT'% d h1kYg?W6]6h e W-]! h1kk6] W rCpAq b ‚Cv9|Q'R) }Cv |9t} qLS) S ] \Y[ $ j $ h1k 1 TCTTCTTTCTTCTT T. Ob Cv | q-z?YvQ'Ra[V w6w<C }6z. hg $ ] ]Cf-? hg1] $ [Whg j% h?aeg h r1z1t| wwxsp"q~O r1z1t| wwxsp"q~O r1z1t| ww  V qy{ ~9quz.

1kC] $ ] i9] akYg?W Zeg ]9W $ h.

!ej1Z`gDh $ h i ^& [ j T.

1kC] $ h $ h kg?WZyg9] W T.

1kC] $ ]9N k GF0Cg9] $ ] k.

hgxh>e-hg T.

_  j1a $ Wh' hWiZCWY[9]M-jW-g hT%+3+ b SYj/b]Zyg i?W[ ]Z]Cf? hg1]! i ]1akYg?WZyg ]9W $ h.1kC] $ h I0g1] $ ] k-g1j6g9[ i %j Wj*ej1ay[ e  Z A` j9W -j g?W[Cf?Zeg ]mh kg2-g [Ci9] ej[ $ j TCTTTCTT S9ST  j1W6j i ]3[Y`"j Wxa] 1S y["a Z._  j1a $ Wh' hWiZCWY[9]ml1j T 1k6j1a $ ]l-n nn nDh>Ti-`j1k9kRTCi ]ak-g"W9ZYg S9ST  j1W6j W6] $ j1W_]eW-]-W6j/j a] ?Se["a Z.

!ej Z `g / ayg"W-h i ].

 ]xa6].

/ h $ ]/ W6]%! h1kCk]9W l9j1W%`I] k / ayg"W-h i ].

 j<e j-g?W[Ci?Z`Aj $ ]e W6]%! h kk]9W" #$%.

& / ayg"W-h i ].

"" ) i?W[ ]Z]Cf? hg1]* i ]1akYg?WZyg ]9W $ h. ]xa.J/ h?W6] $ h jy`NZ a6] k $ j $ [ k-iC[  `[?aj h_('.

e! j Z `g i?W[ ]Z]Cf? hg1]+ i ]1akYg?WZyg ]9W $ hmi3^ [ j i?W[ ]Z]Cf? hg1]..i ]1akYg?WZyg ]9W $ hmi3^ [ j $ h1kgW Zy[?Z ]Cf%6? hg1]/& U`NZ a6].&Ši ]1akYg?WZyg ]9W $ hmi3^ [ j i?W[ ]Z]Cf? hg1].$ / ayg"W-h i ].

 ]xa6].

D ] $ j -e [Y`V\6j / ayg"W-h i ]./ h $ ]mjy`NZ a6]0 #1].

 j<e j-g?W[Ci?Z`Aj $ ]_jy`VZ a6]2 34 / ayg"W-h i ].

 ]N1+ U U $ ]_jy`VZ a-]" 5%b76 U`NZ a6]. / ayg"W-h i ].

 ]xa6].

/ h $ ]mjy`NZ a6]0 e h $ W] -e j1aeg j1aj / ayg"W-h i ].

 j<e j-g?W[Ci?Z`Aj $ ]_jy`VZ a6]2 3486& / ayg"W-h i ].

yŸo+ «s« . ¹.ªv¦*z« †Z§. ª U`NZ a6].« } z¦ ¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ ª .«'¹.¥.¦*v…„ §.¤ R‡‡‡  +±¢). ]N1+ U U $ ]_jy`VZ a-]" 5%b9& ]1W TCi ][ jb1i .  §M &  \¦ ¤ ±ª‚¥.

  ¥.

 .

e      ƒ  G .

.  ayg"W-h i ].

 ]xa6].

/h $ ]_je`VZ a6]0 Z[PehaCWY[X?Zyh<ejayg1] k / ayg"W-h i ].

 j<ej-g?W[Ci?Z`Aj $ ]_jy`VZ a6]2 & -$46.

8 / ayg"W-h i ].

 ] +U U $ ]_jy`VZ a-]" b TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT  d /     / e#e 8  e2 #/ U  / e / U   TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT .

] %h $ ] eW-] ! h1kk6] W l j1W%`A] k Gej6g?WY[iZ `Aj #$.

.

& TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT U`NZ a6].$ ] D] $ j e-[`V\6j .

. Gej6g?WY[iZ `Aj 4  [ j j /b6 TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT U`NZ a6].] %h $ ]_jy`VZ a-]0 #1C.

] %h $ ]_jy`VZ a-]0 yh $ W] e6j ayg j a-j Gej6g?WY[iZ `Aj 4867& [ j j /b & TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT U`NZ a6]. [ P /h?aW[XZY< h e6jaYg1] k .

] %h $ ]_jy`VZ a-]0 CZ% Gej6g?WY[iZ `Aj & -$68 [ j j  b  / J%/h?W] $ hmjy`VZ a-] k '3& TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT h _yhi?Zeg j a $ ] ^ eh1kCk]Cj eW-] ! h1kk6] W4  eW-] ! h1kk6] 8W ".

i ]1akYg?WZyg ]9W $ hm3 i ^ [ j . i?W[ ]Z]C f ?-hg1]!.

] %h $ ]_jy`VZ a-]0 l j1W `I] k Gej6g?WY[iZ `Aj #$.

.

& [ j j $ TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT h _yhi?Zeg j a $ ] ^ eh1kCk]Cj eW-] ! h1kk6] W ' eW-] !%h kk6] W  i?W[ ]Z]C f ?-hg1]mi ]1akYg?WZyg ]9W $ hm3 i ^ [ j .

] %h $ ]_jy`VZ a-]0 l j1W `I] k Gej6g?WY[iZ `Aj #$.

.

& [ j j $ TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT TTTCTTCTTTCTCTTTTTCTTTTCTTTTTCTTCTCTCTTTTTCTTCTCTCTTTCTCTCTTCTTTTTCTCTCTTCTTT ] 10Cg9] $ ] km]Cf?-hg1] b hg $ $N  b hCg?a-]% hIH" 'l j W%`I] k  b hCg'e j-g?W[Ci?Z`AjH" '4$%.

¤ R‡‡‡  +±¢).¥.«'¹.  §M &  \¦  ( ª [Whg j%h?aeg h .$ h1kgW Zy[?Z ]f6? hg1].¤ ¤ f& ¤¨¹(*z¦z§z¤¨¦¥.¥.&w:¤¨¦§&f¦±ª §.¢ ¤m«!z¤ §(:ªT¹.«NM_ªv§(+© &f¦V¤¨§!¤m«w:¤ .« } ¦z¤0¨¦zªv¢qª 'Iˆv¤»«f¢Š‰ «s« ¹.& $ h1kgW Zy[?Z ]f6? hg1]+ $ h1kgW Zy[?Z ]f6? hg1]* $ h1kgW Zy[?Z ]f6? hg1]! $ h1kgW Zy[?Z ]f6? hg1]!$ IS kja z«f¦ !v« $`§\« !¨«.ªv¦*z« †Z§.& $ h1kgW Zy[?Z ]f6? hg1].¦*v…„ §.&f¤¨¹(y:¦z§3:¤¨¦ ª .¤*o+±ª™¥.

 . t       \ —       .

¦z¤ (+±«f¢Qª ¤&'¤v¦z¦V¥.«.(±ª       ƒ‚„ ‚„y   –c‰—RŠ3“˜Š3–j“&%ˆG” j‘ yŽ  V¹ ˆW– .¢Qªœ.¤ &f¤¨¢ ¤ « $ «f/¢ .«.¹(o&'ª !¨« ° x«¯ª ¥.’ ¤ &'¤v¢ ¤’&'¤v¹(*z¦z§z¤¨¦&¥.« *z¦z§ z¤¨¦x¥( !¨«f¦:ª&!¨« ° «.¤¡&'¤¨¹(y:¦m§:¤¨¦"ª.±ª §.«!.(¢V& ªv¹\¥.¤¨¦ ¹.¤&¤ &'¤v¹>:ªv¥.¤¬¤x&f¤¨¹(y:¦z§3:¤¨¦4¥.¦ Ÿo&'ªno*z¤ 0¨¹(©V& ª $`§\«…!¨¤&' m«'¢)..B¤ oM¥.¤ ¥\.(?ªCM¥.  J £ª ¢q«f¹(:ª0¨«'¢ ¥.«!*:¦m§(±§ ¤ ¤ m«!:¤  ) *:¤ « $ .+oo&'ª ¤’..8ªv¦z«!&.¦z« ¥\(« !¨« &'*¦ ?ªv¦²§\¢u&'¤¨¹*:¦m§:¤v¦}¥\« &(. "  .+V«!:ª#¤#¤ m«!:¤ &f¦ ±ªv¥.«(M_ªT§(+ 1¥.«z&(.0Yª6Ÿ !v¤ xµ ª .. ¥\«(M_ªv§(+©  ª z«!0¨§(V¦{&f¦?ª¤™¤ m«!z¤ " 6§(:ªv¹\¥.+±¤ ¥8ª +o*:ª 0¨«f¢ .

€& ' &  (*(!    !)#  &(.    "!    $#( Vž  o&   ¢*  v   +  &  #     Y ! .>ˆŠ–c0% ‰ ”D–         !y.(    . .  R  !.  R  *!      #   .

 pxwxuYpYv9qY{9~zA p.  | }1ƒ a    | }1ƒ axq6v'> pAqC| Q?upIYv qy{ ~CzTRI  p\OQ | }  ƒ a.  ! . r1v } } w6wBV qC~s ~XW-~Cs z-r ~8?%@zXV<w6w v qCuCsvYp"| Q STR) ] \ z }-Q pAq| p<aNS.--  - +  &  +. $ 0 ( .# /&0 '!   .* |}ƒ  S9S6GK 0g]$] Q'RF ƒCz6puz{?| }C~ S9S l9] akYg?W Zeg ]9W 9:9Cv9|Cz } QpAq|xq a=<SZR = uYpYv9qY{9~z7Q qIR .a  R .  t8@6sp9r= pAq| upIYv9qY{ ~Cz) pAq|.  #     )#( Vž  o &   !ˆ %5 "  !*o  V¹ V¹  6  #( Vž  o&    o/p"qYr s1t6uCvxwypz{?| }v ~">€ t{CpAq‚ q6~Yv-{6~-r vm{?|Cu  S9S7TTCTTTCTTCTTTCTTCTTTTTCTTCTTTCTCTCTTCTTVU6WYX?Zy[?\-] ^87"hg1] W>b(c S9S7TTCTTTCTTCTTTCTTCTTTTTCTTCTTTCTCTCTTCTTl`Ij9k k6h ^87?hg1]1W r s ~{ { 9:9Cv9|Cz } .( 304       & ¹  ‡  ª  !     & !  ! & &  (  .  .  .PR# ±¹  1#  ! *#   #  ¹ ¹ &  (y"!    !2#   & % &     ! + & .UZR   | }  ƒ.U. + P ¹ ¹ ±¹ J o* (0Q..

 yŸo+  #  } !  % 0 ! '& 'Iˆ 0 ‰ «s«   . uvs v |Cv   | } 1ƒ  ]  ]  S9S7TTCTTTCTTCTTTCTTCTTTTTCTTCTTTCTCTCTTCTTVU6WYX?Zy[?\-] ƒCz6pu 99Cv |Cz } =3=Cz6{?| }C~ Q'R .p U.  ._  a pI ]  S9S6/ d h kgW Zyg9] W ƒYp}|t6~Cs #: 9 9v |Cz } Q'R . p .   M &  1! ª .UNR ª ACBEDGFH0IKJMLONQP6FRHISF0TUFVWISFYXRZGP6[Z0\WI]LOP6FRHIKZ['ZU^UF D_LO\K`QLG\ ^UF [MNQLOIKL_abZ0\SPL[MLO\]Lc[dNeL_IKLOabZG\KPLdf ¹ #!*v…„  !*  †  ¹  R‡‡‡  +  . \z O} Q p>a*S) pAq| pwDuYpYv9qY{9~z ^87"hg1] W>b i .

    ¥.

 .

e  wCwXVWXVwCw| }  ƒ Np xw-w r1z1t| ]   ƒ  G .

] 9:9Cv |Cz9} ƒ <FQTR1 r1z1t| ww V ~?uC~6Wu v6WCƒ <Fb Cz6{?| }C~ Q'RZV<wwDv1quCsA ƒ <1b Cz{| }C~ Q'R1 S9SyjXAZ-[1( \%T $ ['%hak6j]'-F(\/T g"W  \ '*. VW[VK S9S>TTTCTTCTTTTTCTTCTTTTTCTTCTTTTTCTTCTT y  jC["a pAq|~6p"q Q'R .

 . 9 9Cv |Cz9} ƒN : a ƒ <K r1z1t| ww V ~?uC~6 W u v6CW ƒb Cz6{?| }C~ Q'R3W6~%Tc{8W69:9Cv |Cz9}[WCƒZW3a8WCƒ <#VDw6w v1quCs  ƒOb Cz{| }C~ Q'R1 S9SyjXAZ-[1( \>T $ ['%  hak6j]'-F ( \7T g"W  \ '*.

 ] S9S hk-g9h /  ]?ag] ( \.

% S9S8e  j kxa] h?a $ hWYh3CC ]. $ ]6ln n $ h \.By! ]C[ $ h`"hg j $ ]( % ][k kCjC["Z $ hmhk-i ]%] S9Sej7-]WCj( \eT $ [' h?a6kj]%'-I( \/T  g"W \ '. aTD ] h_ [1k-g9h*y j[kZ ]Cf6? hCg1] b r1z1t| ww V ~?uC~6 W u v6CW ƒ <Fb Cz6{?| }C~ Q'R36W ~%Tc {8-W uCvs v? @z3W u v6W ƒKV<w6w<v1qCuCs  ƒ <1b Cz{| }C~ Q'R1 }Cv |9t} q4<X S e j65 $ j  TCTTCTTT  j1a $ Wh' h WiZCWY[9]ml1j    T  kj1a e6j 5 $ j $ h %\ /bGY] k-g"W6j H" $   & ej65 $ j ej65 $ j $. $.

7bGY] k-g"W6j & H" j F^ k \.

C8DC] $ hkh7.%h?aeg j#C8D]  je`Ncj IS  b Syj/b]1ZYg \% $ h<\. ' $ h \%/bGY] k-g"W6j & H" j F^ k $ hY`?h.

 S 6f1k-h1W \yhX"Zh_i ].

y]x\.

! . ª   +  'Iˆ  ‡\.7.  !P ±¹ ¹ ¹ ¹ ¹ 1323465798:%.  ¹ .¹ ¹ ¹ $ ( \%/b g"W  \ kh73 h?aeg j8C#D]%b h ¹ ¹  + & v#   (*!    + - R   &  (y"!    ! #  &(.&   3 &  (*(!    !2#  & .(    +  &  # - % !  (     2#( (ž  &   %ª &!  * &  R   &. bH g"W  \ h \%/b  g"W  \j' ]1aeg j \-j %j1W6j ]M%hky] f`A]Ci ] $ h/h'[^1W-[ jA( j1^ k $ h kg?WZY[1W \ j  ]aYg1jM%j WjxZ y]ayg9h $ h`"[_-]mhmi9jZCkCj Zyj<!yjy`(cj IS & % ª .   !  !    y  1 .+      . A : P d(f .(  #  #  .

   M &  1! ª .>.e: P d H Q C V 5 4 Z M L3: ^ #!*v…„  !*  †  ¹  R‡‡‡  +  .  4TV: A b K : Z M@T  4 T9: O <>< 4 A a3:WL 5V4(MU5VL Q C 5V4 Z M a3: TRI C M = Q C 594 Z M L3< : . 4 TV: A .  *o+  #  } !  % 0 ! '& 'Iˆ 0 ‰ «s« .

        A  E . Z 4 CUZ T¦b Z f ^ C hjb TRI C M = 73T A E .> —  ¥ . 9.  @ ^ TRI C M = 7T  <><10RA C L B 5 Z : E : E 4 TV: A 7(L A L E 5 TRI C M = 7T A E ..  @ f O K 4 AA.

   .  Z L386I(LGL38>: K L(` 3 a :   4 Z Q 8 ^ 42 C TcbŸl(f ^ g <>1< 0 :@7 C Le:M E L38>: A 4(M h(: A b CUZ T C .Gl ^C Q C 5V4 Z M L3: ^’C  f TRI C M = 73T A E  C ! . <1< 0RA C L Z Q A E 4 K TV:  hV: A b CUZ T A  P 7T    "! #   )- -  %& #        # . $ ¹ / 0 ±¹ ¹ ¹ - ( ! .(+  $ /      1323465798:%.G: P dcHJ7T A E  C ! ^ g  ( µ !  !   (  !  ! $ $  ¹ / .

   !  M  ! & #  #  y"!    !  ¹    +o  !  !  %& o& ¹> - & %!  c + & $  &   #   #   $  1 ¹  8 #  1323465798:%.  +    o+ 6) 5Y*   #  y"!    !jv &  .+  #  .& +    1 . '. << 7 4M@T A B TV: A\Q L K 8RLM>M 4  4TV: A 8 8  4 TV: A bwf EDC A T B L./+0%21 %('314./+ *"!    !    3    Ÿ  !  #  #  *(!  ! 3     &.+-) .   .+   2 R  &  #( #  .

O Q 438R4 T4  ! 73T  A  E ^ g ^ g ^ ƒ‚„:9.

„y ™ # ‡.

 # 0   !    ! &  !(!  ˆ  .  #  c  #  ¹ & ¹ $&%('*) v!  ¹ &       !  ¢  ! 1 !    !& '4&  & # - (ˆ /  &  -  !  +  !       $      &  (*(!    !|  !  &  !!  0  #   $ 1 !  &    1  +ooy  #  .   M &  1! ª .+    #  ™  2#  * (!   µ ™ ª ¹ ™ µ ¹ .  # 0   !&  (y  µ ™ m¹   %ˆƒ>Š“˜Š3–j“(ˆƒ ˆ µ ™  .(œ(+o&      4-  !  !0 1& ¹   P >d 4 T9:M Q CUZ  5 CRK :M 8LM>M 4  73T A P d%b>l(f ^ ^C l ^C f Z 4 V:[5V4 0 8RLM>M 4¦bX7VL A 6L 5V4T A :Mf ^ :>lG: (:[5V4 0 C .  yŸo+  #  } !  % 0 ! '& 'Iˆ 0 ‰ «s« .¹ œ (& / ˆ  !  #!*v…„  !*   ! † '    #  ¹ }¹  *"!   #  ¹>  !  . l d  C !.  !Ÿž      ˆ  & !  #   14 1#(  & '- R  1  #  R"!  #  M  !  !  & !  * #     0 !  #     +  o+   R‡‡‡  +  .ˆƒ‰‹Š3ˆƒ‰ŒŽc’‘Žj“(Ž &  &.  # 0 ˆ  .!  ¹   !  ˆ  .

Ri— .

!  %0 ! '& vc&Yš    0+    j    M  ! &Yš '& %ˆG”D“1 yŽcŒ – ¹R #    “%ˆ ƒ‚„:9.7 " 0 . k   ™ „  ! +o  &  !. ™   & ™¡  ‰ ™¡   ¹ # -1  * !   #  !  $  &     !   #  ¹R  %! 3 +  & y"!    !sv +  .1!  ¹  #  $  &    ¹ &  (*(!    #   #  #  *(!   'Iˆ #  &!+  ! ) $  &  'ˆ  #  . !#  *o&  (    .

„†… ³ ¹ #  0  ¥.

 .

    v  9!  !* *(!    !& #  #    8 +   o&        #  !    „ &  *"!  I' ˆ   ¹ &0 ¹ ¹ %—–c’– .  !  ! - !  % 0 ! %-    !   /  #  #     ¹ ˆ %—ˆƒRŠ3“˜ Œc–   V¹     2  #( Vž  V¹ #  !*!* %- ¹ M  ('ˆ M  ('ˆ   '& #    *(!   ! *(!    !  s  .

>ˆŠ3–c ±¹ z¹         vz&0!  #   ˆ  0& !  #           ¥ R  !    #  .  o|v  $  &    #    v! %  ª  &   $ ' (&!  #  #  *(!  'Iˆ   v  9!  !   #  &!*  'ˆ   *  v1.1! -  !  v  $  &    # /$ v! #  *(!    !  #  .+      M  !. +o    #             >  !  2#  &.  o ˆ .

  #  &0!  'Iˆ  v   t.0 & !  # 3&.& (! # /         $ ' (&.

 $  &   ' ˆ  #   .]2jbŸl(f O 73T A .+8F.    .(!    $  &.(!  #  ."!  „  . &. Z 4 g ^ 8Fjbwf OQ 484 T4  ! g ^ g ^ <<?>A  BC[E :N7 A :  CUZnK 8 B Q  4 F‹HJI Q E : C 5VL CUZ bwf O FS: P d4 TV: ^ <>< g ^ <>< µ $ V ¹(o&! + .    t  ¹ · '¹ $8 #  (y"!    ! V¹ · '¹ 1323465798:%.    . !  %0 ! ' 305 #    0  !  .+    $  +  & -- %!   ! ." ! *N #  . !    ! #  " t€ R   !     ! &   - #  !  '  #  (+  & .(+ . & #  R(!  #  M  ('ˆ .  #  #  y"!  o'ˆ  6.    3 .-WLcHdZ2XRLG[0/ IKJdNQZ21 3XRZGP6Z6JMVKLO\ Z^UF54MJ06GF\^dL78:9Yf R‡‡‡  +  .  o   "!*o    $D  (  ! !  $ +  !#  #  &0!  'Iˆ  vs 9!  ! & #  &  (*(!  'ˆ   ª & +oš  ! &  * !  #   R  #  !    $  ' (&!  #  &!*  'ˆ - #  *"!  o'ˆ  #         —v  & % .  *o+  #  } !  % 0 ! '& 'Iˆ 0 ‰ «s« .  ©    .  ©         $ ' (&!  #  #  y"!  o'Iˆ &       3 .  o—v  $  &    # + &  (*(!    ! #  &. µ  ±¹ ¹ V¹ m¹ · f¹ ¹ ¹   &  (y"!    !   _  +  &   -ˆ   ˆ  (š  #  y"!    !‹v  $  &    #   /¹ ¹ *  &.  R   !  ) #  +    . !(# 0 $ A) *  !y")   ! +   #   #  ¹ CUZ T£b =lVf ^ 7T A ^ : H K 7>7  T : K A C Le: P d4 V : P d>4 T9:GML C Q 4W4M K :@79:W4 Q 4M6T A B Q : ¹ ¹ ±¹ .! & *!  v  $  &    #  #  y"!    !(1$  #  +     &  >  œ#  #  .  o{v  +    #    "!*o    . <<?>A  BC[E : F‹HJI K 8LM>MNF O C[Z T 2 ^ T  7T A ^ C[Z  Fcbwf.  ¤ V} !* - *!  &0!  & "!    $    & % t    0   !—&!*  .  š  ! .   &0!         #  o.   M &  1! ª . +  &  #  .  ±¹ V¹ ¹ ¹ ¹ ±¹ ¹ ¹ Z ZG\KNQLGHM^!"$#Uf %dTUJMVKL'& VWF ª ¹ #!*v…„  !*  †  ¹  ¹ ¹ ¹ ¹ ¹ '¹ ¹ LcabJdH ()OZca* f.

R   O€O.

1   ¥.  —  .

 .

     *. ™ # 5 %(. .

O CUZ TG2 ^ g ™ #   #    ' ' .     &' % Ÿ&  1323465798:%.

+ 31 ¹ vs&  (*(!  .

/+-.  ' +0%21 ¹  #  %('   14. 8 8¹  o'Iˆ #  .

O E / 3 4 E 5743H>H>H ERZ g ^  !  & v!  #  Ÿ #   '  !    *(!   #    ¹ V¹ ª 1323465798:%.  !   (o &!  ! 5    - y   o &   ¹ #  $ .>. f¹  P>BC: f~H 06   &(' &0! %   0   0 ¹ ¹ M  ('ˆ ¹ )  >  3  #  #   0 +   +  !#  * ! #  &  (*(!    !&  !(!   v        !Y# / ¹ ¹ &  ./+0%21 - *(! #   M¹ ¹ #  !   !   +o  I' ˆ  (š ¹ ¹ ¹ $   ±¹  # 61   M     ! ¹ $  #  5 ™ ˆ µ     #  # /&0  &!*  y"!  * ! %!*   & #   ¹ %      ‡   #  + & !    ! #  + V¹ #(  #  '  o& ¹ 0 ™       # /& +oy ./+ << : P >d 4TV: 2  K : Z @M T A B Q : < < : P >d 4TV: 2SM L C Q 4W 4 M K :679:W4 Q 4M@T A B Q :     /'  %  Ÿo&  @ &!*   v!  #  * zª *   -ˆ    o&     i   !  &!  +! ±¹  * y   o&   >13234 K[B T(L Q L\L Z T(4M Q 4 V5 L UC Z bwfH  / M6T Q .  !  &.. 2 ^ T  7T  C[Z  A 4 T B A Z 7T  A  2 ^ g << ?   B  2  Q 4(@M T A B Q :W4i7T A 2\L79: Z T(LN7VL A L\8 C 2(:ub B 5 ™ #     %('314. T ihjbwf C[Z  O CUZ TG2D.  >   !   !  M  !' (. . K : B T A 4 T B A Z l ^ g M6TL T CRK\CUZ T C[Z T 59L CUZ bwf O < >L  Q Lc. j h b!f ^ M6T Q >. 4 Z Q 8 ^ g < ª .- %!*  . R  #  &  §.!  %0 !   vz&  ™0/   #  y"  !  #   $ 8 #    .>. T C 79: L .  1323465798:%. 4 Z Q 8 ^ 2D.  !  #  ! #  +    .&   * % ¹R ¹-ˆ '& !  X    / .   M &  1!   M@T Q .  #  &!*  ! 1  $  &    ]+ .! & *!  &Yš . !  0%! '& v  (&  !(!  #   .         ¥0+      *   Ÿ&  { ˆ  & !  #   $ 8 #   .  +o   ' ˆ #   ¹-ˆ &  #  ¹ ¹ #  +   '&// vs.  ! . K : B T &   "8  Z T4(M Q 45VL CUZ bwfH  8" R‡‡‡  +  .  CUZnK 8 B Q 4 C C[Z T hcbwf O M@T Q .  yŸo+  #  } !  % 0 ! '& 'Iˆ  % &   0 ‰ «s«   .  !Ÿž & " !     ±¹  o&. 13234 K[B T(L Q LGL ¹ #!*v…„  !*  †  ¹  :M@T A 4>L65 V¹    (+  &  ) %       #  .   +  ™ J    #  1323465798:%. * oy & . & '€.<= ^ A  2x. ) .!    ˆ  c v #  y "!  #     # & I ' ˆ  ) .

  .

 š .  ! .&  & '.%$ C  & '( ! &'s.  ! " # 'Iˆ . ' ‰ «s«  /& v1.  ! $ +  .       &  š  ' M  .

+ ! &  &  š  ' 0  ‰ «s« $ 1 32 34 . + !  .& 'ˆ $*) + & . .

.

  !  .7 68  $).+ 7  ! š :   . 7 š  ' . /8 0  v   &. . !   #  3% #  #  !  !    " %  (   !  (  .+ . . š  ' P <>=@?BA. : 0 - .C-A&DFEG?IH J!JGKLKLKLKLKLKLKLKLKLKLKLKLKLKLKLKLKMKLKMKLKLKMKNO+P %QSRTVU NXW@YZ[ \^` ] NXW_W U NXW@Y J!JBabYdcfe Qdgih%T6j%T W>NklO Qlm  k T W#Yonqp^k Tj%T W j N \^] NXW_W@Y U NXW@Y r-s J!JGKLKLKLKLKLKLKLKLKLKLKLKLKLKLKLKLKMKLKMKLKLKMKNO+P %QSRT abY^O QSR N j N!Z[ t Q e \^] -j Yvu U NXW@YZ[Iw \^` ] NXW_WxabY^O QSR N j N!y{z}|~}€lƒ‚ U NXW@Y„J!JGY_W†…BY \^Q c \ N j%T O j Yx[BY^O+Ne g NX‡ˆW@Y gih%T"‰!Š Z/‹ J!JBabYdcfe Qdgih%T6j%T W>NklO Qlm  k T W#Yonqp^k Tj%T W j N \^] NXW_W@YxabY^O QSR N j N r-s &        - ! #  (    '&  !#   _ #   1!    !  '  !   #   .   . 6. &  'ˆ &!+ + &!+ + 98  $ ª &. 5  &  & '.

&1  .14'   !   " !    x8-  " _ ! - " 1  !  8      #     (  ! !         8   #  (  #  ! *  !  0  !    " '& .

™B– ˜ -8-Œ/.-” QSR  j/ M X•† $ v–'Œ + „  ! v—9” '  7˜ –'. "/ ( #  /  !   #   !  ( /.   " #  ( #  ! #    #  (   ! 8  !#     &     ! ( 8  !    _   !    3  #  ( #  #Œ.+.%$ .73 + #–'Œ + †  $ ^™B M "– ›–Œ 7 „  ! +˜ '–.ž ¢– £ "–  /ž $ !  ! $  – -Œ $ ” $ #  _ # & !     !     %  #  ! #  ! " ! * ! -  %-  _ % "  * 1 !  %   !  #   #  ! "  # % .œ$   9 F .-š v— +– .  . !  */  !  ( - .–  — 7˜ –'./ š  NXW_WxabY^O N N!yzŽ|3~}€ƒl‚b‘B’“  \^]'+ vŒ/.%$ .-ž .ž .™-– o” . o ž -  9Œ/.. # . /8 0  6—'  v–'Œ + †  $  0  6 š ˆ .™B– #” -š ˜ – '7  . P ¤ $ - !  "/&'&  ! &  #  ! " !  2 8 1     + !  ( ) % !  !    #   !(#  !  ( " #   #  ! '& #   !  #   #  !)#   !     ( #   (  !(#  !    !  ( ( (   #   ( .ž #xŸ 9–Œ .+ .œ$ .7 ¡  ‰  – 0Œ ¤ –'Œ + 9  ‰  – -Œ 6—9” ' v–'Œ + 9 ¡J ¥ (  ˜  '! 3 •¦  ‰ J .

  .

P  !  .   TPonto +x: int +y: int +contador: static int +Desenha(): virtual void TCirculo +r1: int +Desenha(): virtual void F /ž ' !  %$ ¤ ” 0š ! o ¡¥ ! o  ‰  – -Œ $ .\9p}r?ts z  o-u3 v \-pAq6v  9p}r?ts z  ] g9[ %  ] $ hxZ ZZ29W[9] 9 Yp?}Yr?t-sz =   t8@6sp9r= pAq| } <K r s ~{ { .@6sp9r 9.:Cz1q|z S9S l ]1aYg?WZyg ]9W S S f-h1W \Yh X"Zh eW[. "& ! 0 * h8 6 T6^l[WYi?Z`A]eb(c Vv 8 9. .:Cz1q|z b FV o/p"qYr s1t6uCv S deh'!/["ah I S  ^ l[1WiZ `A]/b t. !  S S7TTCTTTCTTCTTTCTTTTCTTTCTCTCTTCTTTTTCTTCTTTTTCTTCTVU6WXZY[\-] 9 o/p\ qCuv.    .

:Cz1q|zOQ $"KR V} <[Q  }C~6pzKR . ]  S9S%6]fWYhi j Wyj pAq-spAqv_ƒCz-p?u.%hC[W6] %jCjM j1Wj ] i9] agW Zeg ] W $ j i`Ij6h f j6h 9 S Se] j6g?WY[fZyg ]M_ h)( hDj!6h Z[?W $ h'!/["ah W/b 9 9p}rt-s z)Q1pAq| pAq|#"  p"q| }C~6pzKR)= 9.

v |  Q pAqC|  ?pAq|&"  pAqC|m}C~-pzR1 S9S%6]fWYhi j Wyj pAq-spAqv_ƒCz-p?u.

v | Q'98:Cz1q|Cz `* S9S%6]fWYhi j Wyj pAq-spAqv_ƒCz-p?u.

v | Q9p}rt-s * z ` RA pAq|_}C~6pzXRI  S9S6GK0g ] $ ] a]?\]A( Whg 9 ] W a-jD]  W jC[ ] p"q|.

Cv | } <1Q'Rr1z1q{?| . C } v |9tC}9q } <1 $ ]  ] iC[WYi?Z `"] S96 S GK0g ] $ ] WYh $ 'h !%[aY[ $ ] ƒyp?}|t6~sDƒCz6p?u 6  v6{ v9q-~)Q'R1 ]  ov1qCu-p\ ¤ — #! „   ! ( †  #• ‡‡‡9$ Œ 6˜0 $ M 7– $ 8   *  ! ¤ ˜ &./Œ o¥ ž  * #  !  š ˆ ! '& 0 ‰(')' .

  .

73   #” -š 6– v–Œ 7 o ¡¥ ! $    !   0%4 *   "   0 .   &  x8 ! ( ! .

.   2   ¤ '– Œ + ¡  ‰  8 – 'ž ¤ ž ˜ & –'Œ + 9 ¡¥ (   ( !   !(!  % !   – -Œ –  . ) *^$ ¤ Œ/ž -. /8 œ (. '-š ˆ  – 0+ 0 –Œ 7   ‰  – -Œ 8.! –_” – -& 0 $ !   ! $  #  !  " (  & (-  " (   0 .-–Œ - 6—'  ' .6—'  '  ¡¥ ! o ˆ  ) ' b „˜  '   M ! ' * $   ‰  – -Œ ^™B 6'—  „  '-” $ .

7   ‰  – -Œ –_” 21 ˜ # ¡¥ ( $    1/ 8 ! - !  !  " !&#  *  &% 4  ( #  )  !  # ' ! "  ! 0 * ! 0 *    !  ( #  !  #    / 8'& #  #   " #  #  "  (   8 !  " !.  "! #  ( !   !     !  " !  $ 4    8'& (  %-$&  ¤ –Œ .#  &.

 #'() 2 # "!  $ 4 % ' 4 .

3 ! &.

7 V ¡¥ ! ˜ >˜ 7  .-   0˜0Œ//–'.-ž ./ 3 •¦  ‰  – -Œ $ –'˜-˜ $ J /&. /8 œ .CP ¤ $ - ! 0/ "'& "2  !  ( !c#  !   - . ^ lC[WYi?Z `"] pAq|_}C~6pz[R 9.œ$ .  '+*.:z1q|Cz=3= v | Q   "XR1 |p { € } <a C } ~-pz ] 9p}rt-s z=3= v |Q'9...:Cz1qC|Cz`   pAqC|m}C~-pzR S9Se-hgF  b _1(Hb 6" |p { € a< b v | Q'RF |p { €" a< b v | " Q'RF } < a }~6pz  ] ƒCz6pu  9 p}rt-s z=3= v |Q.  " 8 !  ! 0 * h8 6 T6^l[WYi?Z`A]eb1i S9S>TTTCTTCTTTTTCTCTCTTCTTTTTCTTCTTTTTCTTCTCTCTTTCTCTCT U6WXZY[\-] o/p"qYr s1t6uCv V1v 39p}rt-s z b FV o/p"qYr s1t6uCvxwypz{?| }v ~">€ S9SK+  ` h' h?ayg9j8C#D] $  ] *10Cg9] $ ] $ h ƒCz6pu 9  p}rt-s z=3= v |Q1pAq|  " p"q|&"  ( 8 ( !  c !  " . '! b– -+ 0 >–Œ .

 /8 0  / 41  ' '(  ˜ /  '  M ”  6–'Œ + 9 ¡¥ ( $ ¤  — „  †  #• ‡‡‡9$ Œ 6˜0 $ M 7– $ 8 ¤ ˜ +7/Œ o¥ ž š ˆ ‰(')'  + # ( ! #! !   !  _&  ! (  " #  (    !    c 2& (- * ! 0 *   !  !  !(#  #  1  #   * (  !     # 2 0 ( !    ( * #  !  ! '& 0 !  ( .9 Yp?}Yr?t-szM` r6R .: z1q|Cz=3= v-{ v q6~Q'RF S9S [agW ZC8 D ] % j1Wj $ h-haCc6j9W] i[1WiZ `A] {|u =3"= r1z1t| w6wBV q# 9 Yp?}Yr?t-sz= W Czz }Cuv q6~uC~#W } <%a[V<ww } < ] ƒCz6pu . |p { € a r)b   |p { €" a r)b "  |p { € } <_ a r)b } <K ] S9SK+ `h' h?ayg9j8C# D ] $ hM%d hh?aCc-j S9S$Cj]MI 0 g1] $ ] $ h-haCc6j $ j i`Aj6h f j6h h jiWYhih?aeg ƒCz6pu  9 p}rt-s z=3= v-{ v9q6~Q'R . x8- $ jx] ww-{|u $ hh?ac6] ] i[WYi?Z`A] =3=v1qCuCs  6—' 9  ‰  – -Œ P P ^ )   ‰  – -Œ 3 ‰*V9$ –Œ 7 –' – -Œ ˜ – 7  . S9S i?cjy  j>6! Z aTC8D ] $ j iY`Ij6h f j6h 9.

  !   4 . + .      .

  ) '31 ) 5 .&1      (    . .

+ '- 6  8   !  "!$#&%(') *'.&L%('L%(- )O6+'?%?!5!4PN<%9 )O6+'?%?!5!4PN<%9 #@G@:@9)H' #0M) N+<L% #30Q) N+L% #30K.76+8'9 +!4!4%. /8 œ #—9˜ -8-Œ.'7˜ –™B– – '7 +˜ '–. '7˜ ^• –'.œ$ PR#  * !   ! .™-– J /&.F(VW['FXR`JTXLG^UZ0\SF(V [dJ04dNQ`QXGTd[d\KZOIKFX IKF^F [d\K` D_L_IKF [MLO\]L^dFTMHd`Q\ZLGXRFVKVWZ6LOZV L_IK\S` 4dJUIKZ0V ^dL XCNeLGVKVWF0f>UFRP 4d\SF5& VSFWV0JMF JMVSLGP6Z0V [dJ04dNQ`eX [MLO\]L `QHUabZ0\SPLO\XVJdF ZL_IK\S` 4dJUIKZ6[ZU^UFYVSFR\L0XCFVKVKLG^UZcFY ISF\SHLOP6FRHISF0f [Z 4MVWF\SD0F1VJdF !" JMVKLLGV [LONeL"D\]LGV.HML6VWF(5)GZ 3Mf SZ6JMVSZ^UZ0V.'$L%. . $   8 Œ .&L%('L%(- #0F.C-A&DFEG?IH \^] NXNXW_W_WxWxababY^Y^OO QSR NN j N!N!yy EE}=i?-A /D A U NXW@Y6NX`7W@r-Yvs `7r-s \^] NXW_WxabY^O QSR N j N!y E}=D A U NXW@Y6`7r-s \^] QSR j U  – '7  8  v–'Œ + †  ! . /8 0 >—{˜  '–' '7˜ –™B– V” 0š >—{˜  ! . #@G@:@9)H' #@G@:@9)I' #@G@:@9J)H' #30K.– $ .- #30K.%$ . P ¤ – '7 q” $    #  ! #   #  !    !  !  "    ( ! &  ! & 0%- ( !   (   !    #  1 !   (  " !     !  (  " !        !  ( -    ! -  % #    0 ( #       !  #    (  #  !  #   !(#  #   ( ! 1 & 0 ' -   83  8  ! #  _     #  ! # .&L%.–  ˜  –' ˜  ! .-š $  !      (& #  !  #  1 !  6˜-Œ $ 15  /     r s ~{ {<E  8t @6sp9r= pAq| O }z9|6v6r1|v u= pAq|!"O A + `QPcZV./0ž .+-/.&L%('L%(- #0M) N+<L% #30Q) N+L% #0M) N+L% #0M) N+<L% )O6+'?%?!5!4PN<%9 .'$L%. & – + ” '7˜ –™B– – 7 0.–  – '7 ” >— ˜ 08-Œ/.&L%('L%(- #0F./– '7˜ –™B– 9” -š 6— ˜ -8-Œ/.@01-/%.! > #˜   Œ.&L%('L%(- #30K./-” b 8 Œ 6$ 9 .01-/%2+3'$%.EA<%30F-@+3-/.  – 7 "” 6—o˜  ! .&L%. M 6– q >˜ %– '7 "” 0š $ ¥ ^•¦ .FCIK` D0Z0Vf Z [d\S`QP6FR`Q\SZ^UF4TMHd`Q\ Z LGXCF(VSVSZ6LOZ0V LOIS\K` 4MJUISZV ^dZZ 4 .A<%0B+@6C.™B– ¡˜ -80Œ//–  ˜  '–' 9˜  ! X $ <>=@?BA.X]\ML"D0FV [dJ04MN `eXOT'[d\KZOISF(X IKF^FY[d\K` D_L_IKFYXCZ0P ^UZ0`QV Z 4 .   #  ! #  ( R o/p"qYr s1t6uCvxwypz{?|  } v ~">€ t{CpAq‚ q6~Yv-{6~-r m v {?|Cu  !(#  #   =!#/%.!4!4.Œ/  v 6–Œ 7 8   @${) "˜   #– Œ -  v ž 0 #– Œ - '7˜ –™B– ” -š   – ' v– Œ 0 – '7 M '7 ! ! ” $ x8.  # .- #0M) N+L% #@G@:@9)I' #@G@:@9)H' #30K. ( 8   * 8-  !      * !  ( !  (   #  ! # 3 0 " !  !  (/-  #  ! #     8  *     0 * 8 !  " !  "  " #     ( ! +    8 -  -  '- $)..™-– o” . *  +˜ '–™B– ' – + q 6–'Œ + 98  ) ˜ -8-Œ. ! '— . ( #  ! *- !  8  !#  #  1 !(#  #   0   #  !2#  ! *- !  (   # -    (-  #  ! #  ” -š .FRISZMf Z VWF 6GJdHM^dZMTd^U4F TMHd`Q\L abZ0\SPL6^dL^\dF\KLGH (RLMf ¤ — #! „   ! ( †  #• ‡‡‡9$ Œ 6˜0 $ M 7– $ 8   *  ! ¤ ˜ &./–  ˜  –^ 9˜  ! .:+<!4%   '7–Œ '– .– + o” .œ$ .   #  !2#    *   #  "  #  ! #   !   !  "  (    !(#  #  D'?%.'<) *>'?+3-/./Œ o¥ ž  * #  !  š ˆ ! '& 0 ‰(')' . ˜  +˜ '–.- #0M) N+L% #30K.-š ) ˜ 08-Œ/. * $ ¤   8 Œ .!4!5.  +˜ '–™B– >” -š Œ.&L%.&L%('L%(- #@G@:@9)I' #0F.'$L%.

      ( ( .

(       T    .

     .

}v |9t}9q "  ]  Q'R . }v |9t}9q "  ]  Q'R . }v |9t}9q O ]  S9Se]>_L0 [JyfY`[i9] S9Se ]  L0 eW-]6gh7e[ $ ] S9S / W W]T a D ] 9 g h& jCi h$]mj>P =  }Ypƒ~9|6vME OQ'R . }v |9t}9q   ]  OQ'R . }v |9t}9q O ]  S9Se]>_L0 eWY[?\j S9Se ]  L0 eY W [?\j S9S / W W]T a D ] 9 g h& r s ~{ { . pAq| pAq |  pAq |  ]   r s ~{ { . }v |9t}9q   ]  OQ'R . pAq| pAq |  pAq |  ]  S G%h?a6j/h?a $ ] i ] [Y`"j $ ]9W  j1a $ Wh' hWiZCWY[9]M-jW-g hT%+3+ h.           }Yp?ƒ6~9|6v= pAq|  ]  =  t.@6sp9rNE OQ'R .

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb j W-h /  W[\-j6gh h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb h.

6 TCh  hCi['! [ i j $ ]1W T1cYhW-j1aYi jeb IS $ ] $ ] jCi h$]mj>P  n nxh 6%TCh.

hCi[.

!%[ i j $ ]1W7T1chW-j1ayi9jeb i 8 +1a /h&/fh?W !-ZCaYig [9] a[?aYg d .

H" 74 I["aYg U .

.

`I]Cf9jy ` 6i &]  h   6j9W aY[a.P [ </W[?\j6gh 8 -[g"c["aŠg"c-[$i ]1aeg h_eg Uyg.

 i . i . i +1a /h&/fh?W !-ZCaYig [9] a[?aYgxl . i . i . i . i ." jy` ` /&h /fh?W !-ZCaYig [9]  a _[Aai`Ij ! l  . i .

H" 74 I["aYg U .

.

/Œ. 8> = 2 * #  ! #" # KJ L   8 ( ) # "% <( ' (  ' +0%21@?  !  " !  8'& !  "'& %(' % "$ ) 14.+ (  0 !(!  !    !  " #  !  " ! #"' ""% %$ '5  ( '&:$ * !  (  #  ( !  )( +-"% %$ !  )( (  #  0 .8 0 —x˜ . /8 œ  –Œ o ¡–Œ . .8 0 ˜ 08-Œ/.P [ </W[?\j6gh - -[g"c["aŠg"c-[$i ]1aeg h_eg .+' * !  # .˜.7 ' ”   $ ./+ 8 ! #   & :A !  E /F' !  " !  +(+2.* 8  ! !  * %(  ' # # '*  #   ( #  * !  #   #   * #  $1 1 !(#  !  #  !  " %+ *. '!  ¡– 0+ 0  ¤ $ <.Œ/  9 o–Œ 7   '–Œ $ ¤ 7+ B œ– 8 -ž6– X . #  :*    !  !  2 !(!    ¢5 ^4 4 –Œ 7 ¡8  ¤ o ¢– -& 0  – ¢˜  ^  l  9– -& 0 -Œ 9–'Œ +  o–_” 0/0˜0Œ//–'. "= . –'/Œ '-– (   98 0ž $   *. .  –'Œ + ›— œ.    * !  ! : &  *   !   !  !   ( !  " #   # /+   #   !  )(  /+1"% %$  #  )( !  (   8  ($ !  0 !  !  # 0*    #  *  !  # 3 8   #    ( !  "2*  1 !(#  !   /3 (    !  _ ' ( #  " " #   ( * # -  !  /+4"% ! ' " !  #  !   !  !  - &  " 6+  " #   *   # + ( #  %$ 5+   (  #  ( ! ' " 8&:9&:8 7  ! # -& 6 ( %( %. ž Œ x #˜ V 07/Œ/  > b–'Œ +   –'Œ V „–'Œ +  ”   +7 ˜ %– 8 -ž %– ˜ –'/ >˜ œ– o8 -ž  >–Œ 7  .ž .-Œ v :– ..CB +(. /8 œ  —{˜  X %– V 8 'Œ { >˜ { 0.8 0  %– o 6˜ '–/ "–   6– /ž 6–'Œ +    '™B- $ .:D  .  $ x8 / '-– . 8 -ž %–  ˜ %–   ”0 - ›–'Œ + ' › + ! ˜ ž ˆ/& —   bŒ %– .– & – .

 IHG+% %(..A  9> % !  " !Y# G*W' .  ( #  $5MON   PQP5R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1RQRQR1R1RQROSUTWV ¤ — #! YX    #• ! (8J  .

Z[Z[Z $ Œ 6˜0 $ d7– $ 8 * .* ! ¤ ˜ +7/Œ o¥ ž  * #  !  š ! '& \F'0^] ')' .

    S *   .

  PQP5M && .

       .

  .

S !   .

.   '  .- ! #    .

  .

5M    ' MON # PQP5R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R6SUT     #     &     .

#  .

  &  S      ! .

     '    .

!   .

.- PQP7.' (!   ' * ..M S       (    M S  PQP5R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R :TWV *       .

   !  ..- S  #  '  #  .

 M  #   & N      +&  .

 .

5M S .

&%   .

M %  (% $   '( S !)%  .

*%  '  $ !+% $ ' PQP5R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R1RQR1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R5R1R1R1R :T     #   &   .

PQP!   M&.

" M    $    V PQP        ..

$#ON-M     ! '% .

 '%  PQP7.žA-C B > BDFE%–7EG*G)D HA > BEIE"–7E = ˜-.™-– > G )EKB$E@B$D Do)D5G > 7– D+ > B$E $ 'D /KD = ˜-ŒLE > 8 >  /$E = E+)G > A =?>M>= 8-.žA-LB > BD $ . <. - 454 47698:69.=?>@>= 8-..M *..Œ > BEG Eq–5E-*DžAD>CBD'!.-0/21 3 > B 8? 9& " -F 7 $5MON JNO S  N U  L S   & N'P  MON'5M  MJQ   #   .

R  T M.

     T P  # T M.

    O WV M  .

-ž nm p$ o h^qrG)G)E > EXB$D'™B-L GaE"7– E-&+G*A0+EG.™B– š 8-/ž 0 —  !  – ! Œ > –5D7*E > +7 = (˜G+ = DCG*EbEb–7E = ˜-.DgA = –7E-+)G)A0)EGV*E8G)D'– > G*G)D'ž > BE›–5E = /-.BD > A-Œ.+.Œ > BEG +.D@A X Z CB > B$DY&JA > B$E = >I=?> D CG > D7G > @" > E 7EG*G)D7GFA =X>Y>= EA = )EKBE 5E = E = D = E E = D+EA )D2\ > + )D]A = E = D^BE = > "D7G Z CB > B$D 0*`D >:> +D BE 5E +G)E CDaB$D > \FE_BD >= "D7G )DbE = D = E dEHBD > *DcE0E H\*D +E -FE >= [ AE_DbBD dE A CB > BD dEHBD = )D5GeG)D )E #" LB > eD0/ >= >= D +D 7E = EihLh H E +D LE > > /KE > > G*D 5D?A =?>Y= D > G 5E = > GaEjD /KD = D > BD LBE?B$A > ["D5k7D YE S ‹ ” Œ #" #" -F 2" /+ + \F 7 * *   Œ > +G+/8A0)E?EA = ^— •  S  . '+ ^™B- $ l .™B– 8 ^ 6 v— 8 .ž - o˜ ' Œ œ œ˜-Œ/.. D7G = E > +G+/8A0)E —'  – ' 9 6 (  / E:EA0)G)E9 E > D /œ.+.LG >= 8-.–..žZ-LB > BD $ ¤ +.ž '˜ /¡ ' v˜ )D5G > –7D'7 > BE $ ¤ 8-.– > Œ/Lk > • B$EG)D' ¤ G HA0 E@D  • >= 8-/ ž A-C B > BD $ –˜-˜ $ . ! >– EYE˜fD7G > BEGeBDgG)D*EŒCA0š EYBDMD'7–5E˜dE $ ¤  ! >– ˜-/Œ ˜-Œ 8  ˜ – '. P  M  ' ž Œ  %– 8-/ž 0  E = D = E [ D'ŒŽ.> žD = BD@D7G*G)E $ –5E-+)G)A0)EG:BD > A0Œ.

(RT  X s JA > & <& " -H  . tt uvdwxKyHxHz|{z}~€dwH{HwJy‚wƒ$yKxHz„†…  ‡ˆJ‰$ŠJŠ  ŽH‘’r“ ¤ BG+— +  #• aA > G )D8J•AD E YX .

/Œ > BDo¥rG)EžG >=?> š EMD = \F ] ')' .* ¤ ˜fE&.Z[Z[Z $ Œ = ˜0 $ A d7– $ 8$G .

      $ s+* 5s s s s)‹ s  +s ” s  Œ s+ s+$ *  ‹ ” S  S  S  S $ S ‹r* ‹ s  ‹ S ‹5‹ ‹  7‹ ” ‹r ‹  ‹r  ( .

    .

    ^  (     . : 0CDE%GF ' “ t t u„wy|z0/…  z3IH v  y {z€  tt-J s S?S  K  ^ tt…  S S   9./…  > z =zK{?@!dyƒBA   „Jv  z„-. €$y  …€  y  w=yxH…|{„wy„'v} z.: Ž u < ‰ Ž %(' s+ S     .

_._.B& A {ydJ z(! zof = …„ zKyHx…x  Rt #lp w  y}X/Kw1vzv  …^^Y^ _ y}XK / w 1 vfwxKyHx…I j {k\-\uA(vwA {Jy€xwxKy  …  y„…XAxRA^AkRy # …^^Y^ _ y}XK / w 1 vfwxKyHx…I j {k\-\sAizbwA R{A^AGR|  wn€  W7Y # Zt tZ d /  …„-d = … y } …€  y‚ 1 …} …^^Y^ _ y}XK / w 1 vfwxKyHx…I j {k\-\sAG.^6Y..K$y : 0CM “ tZ  y0[xJy81d…„yJxJy]\…†z $ {z}^O \ wdyHxKz„EA _0_0_._0_._ `y€†x„†….__._./yKwLz  …5}  v }dy  y }E/Hw1vfwJxHyHx…   „Jv  z„QPSRT # zv8Rwn€ VU LXW-Y # tO t Nvy‚{z€  nwn€.B& A {ydJ z(! zof = …„ zKyHx…x  Rt #lp w  y}XK / w 1 vzv  z {Jz}o\ wfnyHxHz„€ J } z {z€  …$ 1 vd…'wJx$…€  w" ! wH{Jy„n~ vyd {z€  „Jv  z„|xK…i† = …  …„ Z t €.___.-._.__.-.___0__.__._0_0___.  tt{Jz€  „Hv  z„-.d0e  y€†xHzu0f-f(gOh@1Qf-f …^^Y^ _ y}E/Hwi1$vfwJxHyKx$…j{k\\ …^^Y^ _ y}XK / w 1 vfwxKyHx…I j {k\-\lA ~€m ! vK€f{  wz€  wn€  }dyKw€nojj-j #qp A …^^Y^ _ y}XK / w 1 vfwxKyHx…I j {k\-\sAG.  z0/„f…H{Jy„H„f…1dyHxHz # % ŽH‘32’5476 ' ’ 452’“ ) “ Œ 8 ) “ S S     t ˆ Ž ‡   „Hv  z„†…  tt…$y} z  {Jz€  tt{Jz€  „Hv  z„   x$…"!‚yv # “  Œ ) &%('    ) “ y.7a } …„†{vK„fwz(uyG\Ob _cd.l:A58.

^> …Lf…H{v  yHxHzwj 8.-0/+- ˆ…‰E†@6Š†‹†Y? 69..‚8ƒ…„‡† .

™˜•”¢™ŸBE/+ =?> ˜ > G b > > À7rD ˜+˜¢ÃiĦšCE2"EÀ%$]BDG"D]A ˜ > G E:EoÂdD5G > B$EGrBD]G)D(˜*EošCA0Å\FE BDbD(˜+5À Eof  E EihLh H¡  Æ ŸBG•ÇYXaA > G•”)D8J•AD(ŸE—Ä.…‚QŒG’F8:6j8 “a> ¥ > G•”)D—–^B >Y> ˜fEo˜•”+™›š > > š >= Eo˜ JADMA =X> –rš > ˜•˜)D_BD5G+™ > B > ”D7G*B > Eo˜ > ”)G+™œA0”+Ez˜aD_Eo˜ = —r”)EKB$Eo˜aB > –rš > ˜•˜)Džœ > ˜)D D JAD > `EG =?> –7E = E > ˜V–7Ez™›˜ > ˜ > –5EoŸ^”+D–5D = Ÿ > –(š > ˜+˜*DgBD5G+™ > B > ˜ EXA = ˜fEA-–5EIB ™ `D7G)DrŸ^”+D(˜ B > r– š > ˜•˜)DŠœ > ˜*Dz  Ÿ > ˜v˜ > G > JAD9Eo˜MEoœH\*D¡”+Eo˜0BD5G+™ > B$Eo˜—˜)D2\ >= D `D¡”¢™ >= DrŸ-”)DYB ™ `D5G)DrŸ-”)D(˜ E%– ˜G*D–r™›˜ > G*D7BD'(– š > G > G^DFG*D7BD^™£Ÿ ™CG > š.®X¯s±O²³µ´¶²&· ²3·0®X¸q®X¹Oº»²&· ²±I¼¬®X³ ½¿¾ D9"E.”+E B > Àrš > ˜•)˜ Duœ > ˜*DsÀ5EoŸ^”¢™›ŸJA > D /.?Š‰E†Žj8:A58‘E .žA Ÿ ˜ = —r”)EKB$Eo˜ B > –(š > ˜+˜)D‡œ > ˜)Dz  ¤ (– š > ˜+˜*D BD5G+™ > B > f˜ EHBD > –7G*D(˜7–5D(Ÿ^” > G¤ŸE Ez˜ = —r”+EHBEo˜ eEA > š”)D7G > G9Eo˜ = —¡”+EHBEo˜9B > –rš > ˜•˜)DSœ > ˜*Dz  ¥ EKB$D = Eo˜¥”+D5G_BEo™˜b– > ˜)Eo˜5h “ E ˜G+™ = Dr™CG)E > –rš > ˜•˜)DYBD5G+™ > B > G)D > š›™Lk > > = Dr˜ =?> E˜fD7G > š E JAD > –rš > ˜•˜)D  œ > ˜)D =X> ˜•BDaA =X> EA0”)G > `EG =X>   “ E¥˜)D ž A ŸBE > (– š > ˜+˜*DeBD5G+™ > B > G)D > š›™Lk >:>g= D(˜ =?> E˜dD5G > š E_B > –rš > ˜•˜)D œ > ˜)D^D =X> ™›˜ > š/ ž A =?> 5– Eo™›˜ >  –¦˜§”+E˜+™/zž Ÿ ™.+ 6+ * F #" * \F /+ & +U" %$ + " * #* " #" & %F G" /+ ¨Q©…ª«©¬ª§¨ ­¬®X¯T°.À$‘À5G+™ > G^A = > ”)G+™›œ$A0”+EÁŸ > À(š > ˜+˜)D:BD5G+™ " > B > 5À E = E = Dr˜ = EÁŸ$E = DbB > À(š > ˜+˜*D‘œ > ˜)D6+dE > ”+G•™›œA.‰X‚ŒGB.™B– > JAD > r– š > ˜•˜)D BD5G+™ > B > d˜ EHBD G)D5D(˜+–7G)D D5GT”+E” > š = DrŸ-”)D E = —r”+EHBE ”$D7G)B > BE EA:f˜ EKBD –_” >=X> G E = r— ”)EKBEMB > r– š > ˜•˜)D‡œ > ˜*D:DbBD'd˜ Ez™›˜ > 5– G)D(˜+7– DrŸ-” > G > š/ž A =X> 5– Eo™›˜ >   + 6+ & * '& #" * " & " #" " . 69.

*ɘ+À Êœ$G Æ ÂfEo˜•”+™›š > BDËrG)EoÌG >=?> Å\FEMD = ] ')' .Z[Z[Z‡ Èš = Â0”" pA.

 @   { ¥.

.

    ¶ ž.

  MON  N-M S !""M#!"M%$ L &'(*)+&6SN)-.0+1./.

2 N-M S Ÿ E = DFB > ½¿¾ D "EÀ%$:G)D7B$D(À(š > G > G A == rÇ ”+EHBE—Ÿ > (À š > ˜+˜*DbBD7G•™ " > B > +$D(˜•”)DbE.À5A š” > E = rÇ ”)EKBEMB$D = D(˜ = E  À(š > ˜+˜)D¬œ > ˜)D .

À$t™Ÿ ™›œfD A = = Ç¡”+EHBEaB > À(š > ˜+˜*Dtœ > ˜*D+G*D7BDrÀ(š > G > Ÿ$BEeE = (D ˜ = E.7 = ¡Ç ”+EHBEeB > rÀ š > ˜•˜)D¬œ > *˜ D…ÂfEKBDt˜)D7G > À7D(˜•˜ > B$E:A.+E0* > kT > G > ™ = Â0šCD = (D Ÿ^” > G ½.+769872 U43 &4#S  Ÿ BE0"E.*`A ŸB ™LGFG)D5BD(Àrš > G > Å\FE E = Ç¡”+EHBE 7À E = = D(˜ = EŠŸ$E = M D D  > G?> = rD ”)G)Eo˜.”¢™›š™Ck >  Ÿ BEÄ ˜)D EFEoÂfD7G >  B EG B$D G)rD ˜)EošLA Å\FE BDbD(˜+5À Eof  E    MON  N-M S !""M#!"M%$ L N-M N )..-0/CB E 7À EzŸ.: A >  E = D(˜ = E B$D?A =?> *`EG ? A D > = > B ™#*`D7G*D(Ÿ^”+D  “ EG =?> š = DrŸ-”)DME = rÇ ”)EKBEjB > rÀ š > ˜•˜)D@BD7G•™ " > B > * > k@E &J À(š > ˜+)˜ D¥œ > )˜ D* > k(™ > BDMA ? A D > Àrš > ˜•˜)ž D œ > ˜)DY* > kr™ > D =X> ™ ˜ > š›ÌA =?> = >X=?> ŸD(™LG > B ™ *`D5G)D(Ÿ^”)D+EA * > k_E &J 7À Eo™˜ >   ½=< “ À7E À >  > .5.

Ÿ > À(š > ˜+˜*D0BD7G•™ " > B > HI+ A ˜)E BD = Ç¡”+EHBEo˜"™CG§”+A > ™›˜ E = Ç¡”+EHBE 7À E = = Dr˜ = E ŸE = Y D DŠÂ > G?> = ¡D ”+G)Ez˜ X = 0 = > ˜¥À7E = Dr˜+ÂfD(Àr™A@0Ä BE9 G "™C§G ”+A > š HeD À5E = A ˜*E BDÁ˜)EoœG*D(À > G+Ì >  B D = rÇ ”)EKB$Eo˜ E = Ç¡”+H E BEo˜‡À7E = = Dr˜ = ¤ E ŸE = D =X> ˜‘À5E = ?G > = ¡D ”+G)zE ˜ B ™ *`D5G)(D Ÿ^”)(D ˜ HG  F D@.…‚8 ƒ 8 Àrš > •˜ ˜)D¥œ > ˜)DcBDgA =?>IH ™CD5G > CG JHA0™ > ‘ Ç À H>=X> B > BD‘À(š > +˜ ˜)Dœ > ˜*D+dBD‘Àrš > ˜•˜)D‘ > ™ EA B$D¥˜)A0ÂdD5G+À(š > ˜+˜*Dz  Æ ˜^BD ? = > ™˜¬À(š > ˜+˜)Dr˜l˜ FE@BD(Ÿ$E = ™ Ÿ > B > ˜¬À(š > ˜+˜)Dr˜^BD7G•™AK > B > ˜+ ˜)A0œIÀrš > ˜•˜)D(˜]EA À(š > ˜+˜*D(˜L@£š H> ˜(  ½ Æ ½ Æ ½ &A ˜)EcBDuÂG)Ez”)D(À¡”+D7BXDuÂ$G+™AK > ”)D^BD(™O > E¥À(KB0™›ÌE =?> ™›˜rDrŸ À > Â0˜)A š > BE   <]= Ç =?> ™˜:* > À(™š = D(Ÿ^”+DaBD(ÂA$G > B0 E   =?> ™LEGaB ™M@£À7A0šCB > B$DMD = = DrŸ-”)Eo˜(  A =?>NH ™CD5G > GCJJA ™ > Ç = EKBDrš > GsÀ7E = 7 À(š > G)D7k >9> ˜‡À(š > ˜+˜)Dr˜cD—˜*D7A ˜:G)Drš > Àr™CEoŸ > Ä À%(HB ™›ÌE =?> ™˜rD(Ÿ À >  ˜)A0š > BE 7.l ƒ 8‘FEj8‡‚ 8 GY.l—‰ .

=?> Àrš > •˜ ˜)DLK > k(™ > ÂfEKB$Du˜*D7G A0”¢™š›™Lk > B > ”)D = ÂdEG > G•™ >= D(Ÿ^”+DRJHA > ŸBEcE‘ÂG*EoÌG  > =X> BEGJJAD5GtÀ7G•™ > GrA X = > À(š > ˜+˜)D¬œ > )˜ D =?> ˜ > ™ŸB > Ÿ-FE.œ0˜)D7GPKDQJJAD > rÀ š > •˜ ˜)D?BD7G•™AK > B > Ÿ-FE > š”)D7G > D = Ÿ > B > > Àrš > •˜ ˜)D œ > ˜)D6+ BDK*`EG =?> JHA$D ˜*D > Àrš > ˜•˜)D BD7G•™AK > B > *`EG > š ”+5D G > B > +0˜)E = DrŸ-”)DbD(š > Â*G D(Àr™›˜ > ˜)5D G^G)D(À5E =  ›™ š > B >   ½ ½ <.

™LBD(Ÿ^”+™A@£À5EA > ˜rG)Drš > Å9SKDr˜rD(Ÿ^”+G*D > ˜&À(š > ˜+˜*D(˜ BD5G+™AK > B > ˜(  <.=?> À(š > ˜+˜)DTK > rk ™ > ÂdEHBD‡7À G•™ > G EzœH\*Dr”)Eo˜(  ½ Æ B D(À(š > G > Å\FE9BD0A = > ”+G+™œA0”)ENO ŸHA X $ = > À(š > +˜ ˜*D0BD7G•™AK > B > +UJJADe\+à ”+DrŸ  H > +˜ ™CB$EjB$D9@£Ÿ ™LBE Ÿ > Àrš > •˜ ˜)D œ > ˜)DFEÀ7A0š” > E > ”+G•™›œA0”)E_B > Àrš > ˜•˜)D.

œ > ˜*z D  Ë > G 0 E G > > À5D(˜+˜ > G E > ”)G+™›œ$A0”+E_B > À(š > ˜+)˜ D.

œ > ˜)DeA0˜)DbEMEoÂfD7G > B BDbG)(D ˜*o E šC0 A Å\FE0BDbD(˜•À7EoÂfE E h h HG   MON #!"M  2 L ½ “ A =?>VH D7G > Ÿ Å > Ç > À5EoŸ ˜*D(š H ÃWKD(šJJAD9A = = Çr”)EKB$E À7EoŸ ˜§”+G*A0”+EG À H>= DYEo˜ = rÇ ”)EKB$Eo˜—À7EoŸ0˜•”+G*A0”+EG)D(˜ > Ÿ À7Dr˜•”)G > ™˜¥Â > G > > BD(Àrš > G > Å\FE BEz˜ > ”)G+™›œ$A0”+Eo˜ > Ÿ0À7D(˜§”+G > ™›˜+ D = K7D kIBD@BDrÀ(š > G > G:D(šLD = D(˜ = E D(˜§”+D(˜ œ A0)” Eo˜(  > +” G•™› Æ ŸBG•ÇYXaA > G•”)D8J•AD(ŸE—Ä.

*ɘ+À Êœ$G Æ ÂfEo˜§”¢™›š > BDËrG)EoÌG >=?> Å\FEMD = LXYX ] .Z[Z[Z‡ Èš = Â0”" pA.

M0@  I  ¥.

.

1   q ž.

 ½ EoÂfD7G > BEGFBD > ”+G•™›œA0™›Å\FEYD?Eo˜‡À5EoŸ ˜•”)G)A0”)EG)Dr˜cB > Àrš > ˜•˜)DÁœ > ˜)DÁŸ-FE ˜ FE H D5G)B > BEo˜ÂdDrš > ˜.

Àrš > ˜•˜)D(˜ BD7G•™AK > B > ˜  EAx˜)D2\ > Q”)EKB > ˜ > ˜‘Àrš > ˜•˜)D(˜:BD KD = ”+D5G‘À5EoŸ ˜§”+G)A.™LG•”)A > ™›˜ DboE ÂfD7G > BEG*D(˜l˜)EzœG)DrÀ > G*G)D(Ì > BEo˜r  ½ < < 7 A ˜)E?BDÀ(š > +˜ ˜)Dr˜ H D7G > Ÿ Å > D = Ç¡”+EHBEo˜K.™LG•”)A > ™›˜¬Ç > œ > ˜)D‘ > G > EÁÂdEzš›™ = EGP@£˜ = E JJAD‘ÂdEz˜+˜+™œ ™›š™” > E?BDr˜)rD ŸKo E šAK™ = rD Ÿ-”)E?B$D˜•™›˜§”+D =?> ˜¬À5E = Â0šCD OKEo˜r  ½=<.”+EG*D(˜gB$D > A š ”:D?BDÁÀz ™ > BDr˜•”+G*A0”+EG)D(˜ K.

¾ D KEÀ .

‡+” D = A =?>IH D7G > Ÿ Å > †Eo˜^BDr˜•”)G)A0”)EG)Dr˜.BD KD = ˜*D7GK™CG•”)A > ™˜(  ¾ D KEÀ.

Ÿ > B$D(˜•”)G)A ™Å\FE0BDbA = EoœH\*D¡”+E@B ™›Ÿ4> = ™À7E HE0BD(˜§”+G)A.”+EGJJAD‡˜)D5G¢Ã0D OKD(À5A0” > B$E Ç E0BDr˜•)” G)A0)” EG.”+EG*D(˜lŸ-FE K™CG§”+A > ™˜.B$D9@£Ÿ ™LBE ÂdDršCE—”¢™ÂdEMB$EÁÂfEoŸ^”+Dr™CG*E@A.‡”¢™MKD7G H D5G > Ÿ0Å > DbBDr˜§Ä ”+G)A.”¢™›š™Ck > BE   : Æ ŸBG•ÇYXaA > G•”)D8J•AD(ŸE—Ä.

Z[Z[Z‡ Èš = Â0”" pA ɘ+À Êœ$G Æ ÂfEo˜•”+™›š > BDËrG)EoÌG >=?> Å\FEMD = LXYX ] .

 o Æ ŸBG•ÇYXaA > G•”)D8J•AD(ŸE—Ä.

Z[Z[Z‡ Èš = Â0”" pA ɘ+À Êœ$G @   { ¥.

.

    ¶ ž.

Æ ÂfEo˜§”¢™›š > BDËrG)EoÌG >=?> Å\FEMD = LXYX ] .

  .

            Æ Â$G)D(˜*D(Ÿ^” > Ħ˜)DŠŸ$D(˜•”)D À > Â[”)A šCEjE   G*Ez” z”+™›ÂfE ? D E À7EzŸ À7Dr™”+E  B D H D5G > Ÿ0Å > = š”¢™Â š >   ‘ ˜ ÂG)Ezœ šCD =X> : ˜ BD œ ™ÌA ™LB > BD]D =FH D7G > Ÿ Å >_= š”+™›Â š >   Æ ˜)DrÌA ™LG > ÂG*D(˜)DrŸ^” > Ä ˜)D > H D5G > Ÿ0Å >_= š ”¢™Â š > K™CG•”)A > f š D > EG*BD =  B D >= 5À G+™ > Å E0DbBDr˜•”+G*A ™›Å E0BEo˜^EoœH\*D¡”+Eo˜^D = A =X> H D7G > Ÿ Å >    . ! " ‚Q†‰$‡# ‰EŒ E †  Ej8.B?/7.

‚8 GY.…‚ 8‘ ƒ 8 % &('¡‰EŒ E)'78 * Di\ >0> ˜)DrÌA ™LG]E ÂG*Ez” ”¢™›ÂfE— > G > Eo˜^B ™ `D5G)D(Ÿ^”)D(˜¬”¢™ÂdEo˜ B$D H D7G > Ÿ Å >0= š ”¢™›Â0š >   +-.:9<.…‚ 8‘ ƒ 8 % &(G' ‰EŒ9E)5' 8 Æ H D7G > Ÿ Å >_= š”¢™Â š > EÀ7EG*G)D JHA > ŸBEMA =?> Àrš > ˜•˜)DaB$D7G+™MK > B > Ç H D7G)B$D(™CG > BD =?> ™˜ B$DeA =?> À(š > ˜+˜*Dqœ > ˜*Dz  * Di\ > ŸE@D OKD =  šLE0B >„ƒ ™›ÌA$G > /…    #JJAD > À(š > ˜+˜*D-m† Ç H D7G*BD(™LG > B > ˜lÀrš > ˜•˜)D(˜s‡  Dˆ‡   * Di\ > Ÿ$EYD OKD =  šCE > ˜)D(ÌA ™CG¶À5E = E ™ =  šCD = DrŸ^” > G >QH D7G > Ÿ Å >I= š”+™›Â š >?> ÂG)Dr˜)D(Ÿ^” > B > Ÿ >(ƒ ™ÌAG > /…      Æ H D5G > Ÿ0Å > ˜)DbB£ÃMB > D(˜ JJAD5G)B >  > G >@> B ™LG)Dr™” > 0ÂG•™ = D(™CG*E H D5G)B > Eo˜ > ”)G+™›œ$A0”+Eo˜ D = Çr”)EKBEz˜ BDl‡  BDrÂdEz™›˜ B$Dr‡   ‰ ‹ŠWŒ    0!#""(W$&Ž !0&' ) UŽ 2 (W$& !0&' ) 2u‘ 2 % %  0!#""(W$&:’ !0&' )4’ 2 (W$& !0&' ) 2u‘ 2 % % 0   !  "  " “ R N     +  )   (  Ž ”    +  ) (  :’  # (W$& !0&' 2u‘ 2 %–• (W$& Œ !#(*$ 6 8  / —m ./. =>=1?-@BADCFEHGICKJML<NPORQTSNUCWVYX/@DGIZ<[]\<^F_a` bwux4NUCWy XcXed@BAfQhgWC>i>Ckjl@cXmS1@ b Q n b C>i<[WA6o-p1@BADCFEHGICrqsCWX/@!\WVt@cXmS1@ b Q n b C>i<[WA6o-p1@BAuCFEHGIC-qvCWX/@B` =>=1?-@BADCFEHGICKJML<NPORQTSNUCzg/QhAfO|{4CFNTVYX/@DGIZ<[]\<^F_T} bwux4NUCWy XcXed@BAfQhgWC>i>Ckj~g/QhAfOR{:CFN@cXmS1@ b Q n b C>i<[WA6o-p1@BADCFEHGICrqsCWX/@!\WV€g/QhAfOR{:CFN@cXmS1@ b Q n b C>i<[WA6o-p1@BAuCFEHGIC-qvCWX/@B` .1032406587.B?/3 ‚ .

 —–…   .

L  ƒ ™ÌAG >  …    h  q ž.

D > )” Glœ D]EcEoœJ\*Dr”+E BjEo˜ > ”)G+™›œ$A0”+Eo˜ > ”+Guœ   G•™ > Àrš > ˜•˜)D   H D7*G B > BE@BD    > ”+Glœ ! H D5G)B > BE?B$D " D > ”+G ]B  B > Â$G o    ƒ ™›ÌA$G > /…   .…‚ 8 ƒ8 ‡ ‡ > ”+Guœ   h h > ”+G uœ > ”+G uœ h h > ”+G uœ > ”+G ^B % &('G‰EŒ9E)'58 s‡ l‡ ”+D = A = > ”)G+™›œ$A0”+E—À5E = : A > ŸB$EIKE. U    š”¢™Â š >   .  -‡ Eo˜^EoœH\*D¡”+Eo˜lœ  £œ œ  > ”)Glœ  > ”+Guœ > ”+Glœ > ”+Glœ % œ D:BjD = l†  š”+™›Â š >   A =X> H D5G > Ÿ0Å >0= B G9.À. .B?/%$ 3 % '& l‡ h#E = E @£À >= Œ54)(ŠŒ7698:69.D7G > Ÿ Å >@=  Ž ) ŽU2 4’ )4’ 2 “ •2 ' Š &+'0$   2  ƒ ‘ /… ›™ ÌA$G >    5À E = E @ À >= Ez˜MEoœH\*Dr”)Eo˜ œ  œ DYB Ÿ > = D =   G+™ > BD )˜ D5A 5À E = ÂA0” > BEG(  œ ˜*D7GPKD Ÿ > EzœH\*Dr”)E¥œ  ”+D = E > ”)G+™œA0”+E > ”)Glœ  D > +” Guœ HE:EoœH\*D¡”+Eœ ”+D = E > )” G+™›œ$A0”+E > ”)Glœ D.

À.bA ˜ >IH D7G > Ÿ Å >@= š”¢™Â š > ÂdEHBDFEÀ7EG*G)D7GLJJAD > ˜lÀ(š > ˜+˜*D(˜  D ( D ˜ ¤ E  Ÿ E D K  i D \ Ÿ  ™  Ì  A G   E ) ” + G › ™ $ œ 0 A + ” E + ”  G l  œ r  ( D § ˜ + ” D ) ” + G › ™ $ œ 0 A + ” E K T ™ = = = > > >   > > > > ˜)D5G—À7G+™ > BE B$A > ˜ KD5k7Dr˜   A =X> ÂfD(šCE À >= ™Ÿ H E uÄ  D0EA0”+G > ÂdDršCEŠÀ >= ™Ÿ H E uÄ   : A > ŸBENKE.

™›œ0™CG¢ÃMA =?>M= DrŸ ˜ > ÌD = B$DcD5G)G)E ÂfEG >= œ ™ÌZ ™LB > BD $EA ˜)D2\ > 4JJA > ŸBEIKEÀ. ”)D(Ÿ^” > G > À7D(˜•˜ > G:D(˜§”+D > ”)G+™›œ$A0”+E Ÿ > Àrš > ˜•˜)D  E À7E =  ™›š > BEG•D O.

À. † K E.

J J AD5G > À7D(˜•˜ > G > ”)Glœ9B > À(š > ˜+˜)D > À7D(˜•˜ >?> ”+GuœN  EA > ”)Glœ9B > Àrš > ˜•˜)D +* Ë > G > À7EoŸ^”+EG+Ÿ > GbDr˜•”+D ÂG*Eoœ šLD =?>   K EÀ@ .

‡ Èš = Â0”" pA ɘ+À Êœ$G )† m‡ l‡ l‡   Æ ÂfEo˜§”¢™›š > BDËrG)EoÌG >=?> Å EMD = LXYX # .-.-. BD9KDXA ˜ > GbE9EoÂdD5G > B$EGbBD0G)D(˜*EošCA0Å EjBD0D(˜•À7EoÂfE  hLh  UKD2\ > E Â$G)Ez” z  ”¢™ÂdE > œ > ™MK O E   E )† m‡ l† r† -‡ ƒ /… Æ ŸBG•Ç aA > G•”)D •AD(ŸE—Ä.

.   L    /—   q ž.

1032406587. CWX/@!\>jhjaE[WJz@ ~ORAfQ <{ O [ ~J Q F{1[/y CWX/@B`<jhjaE[WJz@ ~ORAfQ <{ O [ ~J Q F{1[/y ‰ ‹ŠWŒ   Ž  ! &' ) 2 ’  ! &' ) 2                 ËEKB$¡D Ħ˜*DDrš›™ = ™›Ÿ > GEqÂ$G)Eoœ šLD =?> B a œ ™›ÌA0™CB > B$D&À7E = A ˜*EaB >  > š > KHG > À  > >= H > KDA ˜+™Ÿ Ì G  #E = > ˜BD(Àrš > G > Å SHD(˜ A0˜+™›Ÿ0Ì KE./.À. . U    +-.

”¢™›š™Ck > BEo˜r  = > À(š > ˜+˜)DbBD5G+™MK > B > o ‰‹ŠWŒ  0!""R “ N+)( Ž ” +)(   (*$& ! &' • 2   +"(*$. Ž  Ž 2 P +4! $  +"(*$.ÂfEHBD‡˜)D(šLD(Àr™CEoŸ > G0ŸJA ? E ˜ = Çr”)EKB$Eo˜ D > +” G•™›œA0”)Eo˜ > ˜)D5G)D = A. Ž  ! &' ) 2 P +4! $ •   ‘2  ’  . ’  ‹’ 2 P +4! $ ••    +"(*$.

® ¹$"&%' )ƒ /… ~‡ l‡  B ™>  Ì G >=?>X<)( l ›™ šLA ˜•”)G > $ B E Ÿ > ›™ ÌAG >      = Eo˜§”+G > A =X>QH D7G > Ÿ Å >Y= š ”¢™Â š > 7À E = œ > )˜ D À5E = A =   0 Àrš > ˜•˜)D >Ç H D5G)BDr™CG > B > ˜uÀrš > •˜ ˜)Dr˜ D D b ( D • ˜ ” ˜ u ˜  E 7 D * G B  ( D L ™ G ^ ˜  B D +* EA˜*Di\ >  > Àrš > ˜•)˜ D +* Ç:A =X> > H >  Àrš > ˜•˜)D‡œ > ˜*‘ D À5E = A =   -† Æ ƒ ™ÌAG > /…    h r š”+™›Â š > .-0/21354/687:98..D5G > Ÿ Å >@=  * 3 l‡ À7E = l‡ œ > ˜*DÀ5E = A =   Kƒ ™ÌAG > / …      Di\ >0> ˜)DrÌA ™LGuÀ5E = E—™ =  šCD = DrŸ-” > G > H ™LD7G > G JJA ™ > B > .=<:>@?A4/:BC3EDGFH3I4J3+4?I6LK+MNBC?4?I6O4/P9C/Q68?@DGRH<Q>E?A4J/P/Q6C7N?@ST?57N?IKURH68.‡ Èš = Â0”" pA ɘ+À Êœ$G  Æ ÂfEo˜•”+™›š > BDËrG)EoÌG >=?> Å EMD = LXYX # .-.-.        ¨lªuª§¨  !    ®w·0²{¯s±O²qº ° ¦´¶º»² Œ !0' Ž Œ !0' ‹’   ! ! ¹!" Œ !0'  Ž ! !"" Š Ž ‹’ •• !  !"" Š ’ ! &' ) • !  0!"" Š Ž +" 0! ' + " 0! '  ! &' ) 1 + "0!0'    #q²³.WVJX+VH3+68/Q<Q>E? J  Y r† -‡ Æ ŸBG•Ç aA > G•”)D •AD(ŸE—Ä.

— 0  ¶ ¥.

  ‰‹ŠWŒ   0!#""(W$& !0&' ) 2D‘2  0!#""(W$& Ž !0&Q' ) +)ŽU2D‘(  2  0!#""(W$& ’ !0&Q' )4+)’ 2D‘(  2  0!#""(W$&R“ Q!0&+' )( 2u‘ 2 Ž ” • (W$& Œ !#(*$ 6 8  ) 2 Ž ) UŽ 2 ’ )4’ 2 “ •2 ' Š &+'0$ 2 ‘    U      7           +)(    ’      : A > ŸBE KE.À.

B?/21 ‡ À7E =  > rÀ š > ˜•˜)D K > ™uÂfD7G•À7EG*G)D5GXEo˜ H D7G*B > ŸBE BD  D D + * lÀ5G+™ >  Ÿ BE BA > ˜ KD5k7Dr˜jE > )˜ DrÌA ™LGIEo˜ À5EoŸ^”+G)A.…‚ 8‘ ƒ 8  /… % &('G‰EŒ9E)'58 † > ”)Glœ0* > ”)Glœ ‡ ‡  š”+™›Â š > A =X> H D5G > Ÿ0Å >0= œ > ”+Glœ  .  À5E = œ > ˜*D‘À5E = A =   ‡ ‡ B  h h > ”)Glœ0* h h > ”)Glœ0* > ”+Glœ  > ”+G lœ > ”+G ]B ˆ' ’ ŒG‚Q‰ (98 ™ = Ez˜.”+EG*D(˜YBD K D7k5D(˜rA =X> ÂdDršCE >    o JJADXE > ”)G+™›œ$A0”+E > ”+Glœ0* ÇÁÀ7G•™ > B$E BA > ˜  ™Ÿ H E gh h h h +*.”+EG*D(˜YB > ˜ À(š > ˜+˜)Dr˜ * D  D K D Ÿ > ™ ÌAG > ”+G+™œA0”)E > ”)Glœ0*0  œ ˜)D5GC À >= ™›Ÿ H E chLh  h h *@DbEA0”)G > ÂfD(šCE À >= „† ‡ T‡ ƒ ™ÌAG >  …   o h E = # )‡ EI@ À >= ƒ ‡ † ‡ … „† ‡ T‡ Ez˜]EzœH\*Dr”)Eo˜lœ0* £œ  0œ œ * > ”+Glœ0* œ  > ”+Glœ0* DFBjD = ‚ * .”+D =  H D7G > Ÿ Å > = š ”+™›Â š > À5EoŸ ˜§”+G)A.

À .”+Eo˜_B > Àrš > ˜•˜)D œ > ˜*D  DYBD(ÂfEo™›˜—”)EKBEz˜MEo˜ > ”+G•™›œA0”)Eo˜_B > Àrš > ˜•˜)D‡œ > ˜*D   ™ = Ez˜&Ÿ > ˜*D(Å E        JJADq˜*D > ˜Àrš > ˜•˜)D(˜ ˜ E H D5G)BDr™CG*Eo˜ B > Àrš > ˜•˜)D +* JD(Ÿ^” EgEÀ7E =  ™š > BEG  D K > ™E5À G+™ > G Eo˜ > ”+G+™œA0”)Eo˜^BD D +* †BD `EG =X> JJADgE > ”)G+™›œ$A0”+E0BD +*  > ”+Glœ0*   D +*@D > ˜)D(ÌA ™CG]BD ˜*D7G+ÃÁ5À G+™ > BE KD7k5D(˜(  ¾ DKE.Ÿ > ˜)DrÅ E     JJAD > E¤À5G+™ > G:A =X> À(š > ˜+˜*DXBD5G+™AK > B > BD =X> ™›˜bBDXA =X> À(š > ˜+˜*D œ > ˜*D  H D7G > Ÿ Å > = š”+™›Â š >  ESÀ5E = Â0™›š > BEG¥À5G+™ > ”)EKB$Eo˜MEo˜ > ”+G•™›œA.

FBD(˜*Di\ > ”)D7G E > ”)G+™œA0”+EgG)D(ÂfDr”+™CBE ”)ABE—œfD =  &ËOEG•Ç =  ˜)D KEÀ.

À .FBDr˜)Di\ > ”)D7G > ÂfD(Ÿ > ˜ A =?> Àz ™ > B$E = Dr˜ = E 1KE.

—  G)DrÀ(™˜ > BD @£Ÿ ™LG > H D5G > Ÿ Å > À7E = E K™CG§”+A > š«  ÂG*Ez” ”¢™›ÂfE > œ > ™MOKE = Eo˜§”+G >I> ˜+™Ÿ^” > OKD_B > H D7G > Ÿ Å > KC™ G•)” A > š   r ! /… * r† -‡ r‡ -‡ Æ ŸBG•Ç aA > G•”)D •AD(ŸE—Ä.‡ Èš = Â0”" pA ɘ+À Êœ$G ‡ v‡ u -‡ -‡ v‡ 3 -‡  Æ ÂfEo˜§”¢™›š > BDËrG)EoÌG >=?> Å EMD = LXYX # .-.-.

@  I  ¥.

.

1  /—–—  q ž.

bwux4NUCWy XcXˆE[WJz@ NUCWXcX/@cd@BAfQhgWC>i>C>j S{ NPQ b 5m./.= š ”¢™Â š > K™CG§”+A > š«  “ Dr˜•”+DTÀ > ˜*E zÀ5E = E > H D7G > Ÿ Å > ÇbBDrÀ(š > G > B > À7E = E K™CG•”)A > š 0˜  ˜*D7G¢Ã—À5G+™ > B > A =?> Ào ™ > BE > ”+G•™›œA.”+EMB > À(š > ˜+˜*D.F0  CWX/@!\WV S{ NPQ b  5m.–0   CWX/@B` * D2\ > Ÿ >vƒ ™›ÌAG > /…   m EaB ™ > ÌG >=X> < l BD•A =X>H D7G > Ÿ Å >.1032406587. . U    +-.

œ > ˜*D EA ˜)D2\ >  > ”)G lœ ž˜  LJÀ5G+™ > BE0A =X> KD7k ÂfD(šLE—À >= ™›Ÿ H E„†uÄ ‡  Ä ‡ 0  * Di\ > Ÿ$E D OKD =  šCE > ˜*D(ÌA0™CGžÀ5E = E ™ = Â0šCD = D(Ÿ^” > G > H ™CD7G > G JJA ™ > B > ƒ ™ÌAG > /…   m rEoœ ˜*D7GPKD9E A ˜)E B >  > š > KHG > À H> KDIK™CG•”)A > š   œ0˜)D7GPKD Ÿ >)ƒ ™›ÌA$G > /…   … JHA$D@E > ”)G+™›œ$A0”+E > ”)G lœ Ç À7G+™ > BE > ÂfD(Ÿ > ˜:A =X> KD5k  ÂfD(šLE À >= ™›Ÿ H E„g † hLh ‡  h h ‡ 0  ƒ ™›ÌA$G > /…   m h ]D7G > Ÿ Å >0= š ”¢™Â š > K™LG•”+A > š«      '(  0* +* 0*  +*  ‰‹ŠWŒ   #0!(*$"&" ! &' ) 2D‘ 2  #0!(*$"&" ! &Ž '  ) .

1(/Ž '2D&‘ +#2 ! +)1(   #0!(*$"&" ! &’ '  )4.

1’(/'2D&‘ +#2 ! +)1(   #0!(*$"&"R“! & ' .

1(/'‘ &2 +#! +)(  Ž ”.

(/'&+#! +)(  ’ • ) 2 Ž ) Ž 2 ’ )1’2 “ 2 ' Š &+'0$ 2D‘ (W$& Œ !#(*$ 6 8F •   .

      .

 .

  .

B?/+- ½    D@.-.À5D7B ™ = DrŸ^”+E¤Ÿ E¤Ç  Æ ÂfEo˜•”+™›š > BDËrG)EoÌG >=?> Å EMD = LXYX # .…‚8 ƒ 8 k† 4   š ”¢™›Â0š > Ÿ E¤ÂfEKB$D ”+D5GgBD5G+™MK > Å E = <.‡ Èš = Â0”" pA ɘ+À Êœ$G % &)'G‰EŒ E '58 z‡ BDXA =X> À(š > ˜+˜)D 4  D(˜§”+D ÂG*E.l ƒ 8‘FEj8‡‚ 8   GY.=?> À(š > ˜+*˜ D ÂdD5G = ™”¢™LBEžÂfEG¬˜)D5G >= œ[›ÌAE   r† -‡ Æ ŸBG•Ç aA > G•”)D •AD(ŸE—Ä.  .l—‰ .-.

@  I  ¥.

.

1  * * ƒ ™›ÌAG >  …   … h E = E @£À >= Eo˜•EoœH\*Dr”)Eo˜tœ * .œ  .œ # œ0* > ”)Glœ0* r š”+™›Â š > A =?> H D7G > Ÿ Å >g= D]BID = œ  > ”+Guœ * > ”+Guœ   q ž.

U   œ À7E = e‡ œ > ˜*D +*YK™CG•”)A > š   B > ”)Glœ0* > ”)G lœ > ”+Glœ0* > ”+G lœ  > ”+G lœ > ”+G ]B ‰‹ŠWŒ   00!!""""R“   ‘ +2 )( ”+)1(  ‘2 ‰ ''# ! Œ ).À.0+    * E.5.

”+Eo˜  JJADuÂdEHBDu˜)D5G•A ˜ > BEžÂ > G > ™›Ÿ ™À(™ > š›™Ck > Å   EXBEo˜ > ”)G+™œA0”+Ez˜FBE9EoœH\*Dr”)E   * E.À.sÂfEKB$DsÀ5G+™ > GrA = = Ç¡”+EHBE:BDs™Ÿ ™›Àr™ > š™Ck > Å  E –¦Ÿ ™À(™ > š›™Ck > Æ ”+G•™›œA.

”+EGMBD  > A š ”" x–¦˜•”+ESÇ EoœJ\*Dr”+Ez˜…ÂfEo™›˜IJJA > Ÿ$BE ˜)D À7G•™ > A =?> ? = > ”+G•™Ck9BD 1 ‰‹ŠWŒ  S 0!"" U (*$ ! ! $ Š 0! +)(  T '! Œ1Š (*$ •   U (*$/$1!"5& '0! +$ &4Š '!.ÁÂfEHBD—À H>=?> G‡–¦Ÿ ™›Àr™ > š™Ck > Æ ”+G•™›œA0”)Eo˜uŸEÀ5EoŸ ˜§”+G)A.”+EG   ½       B > rÀ š > ˜•˜)DbBD5G+™AK > B >   ½ J AD > À H>=?> B > BE¥À7EoŸ ˜§”+G*A0”+EGB > À(š > +˜ ˜*D¶œ > *˜ D¶˜  K > ™I˜*D7G…™ = ÂfEG•” > Ÿ^”+Du˜)DeDršCD `EG•D `Dr”+™AK > Ä œ0˜)D7PG KD J  šCD = rD Ÿ-” > BE_D‡À5EoŸ^”¢™AKD7GlÂfEG D OKD =  šLE > À7G•™ > Å EMBDbEoœH\*D¡”+Eo˜^B ™Ÿ4> = ™›À5Eo˜(  = DrŸ-”)D‡™ = ½ A ˜*EFBD H D5G > Ÿ Å > K™CG•”)A > . š Dž™›Ÿ^”+D5G)Dr˜+˜ > Ÿ-”)D -ÂfD7G = ™”+™›ŸB$EqÀ7EzŸ ˜•”)G)A ™LGÀ(š > ˜+˜*D(˜ =?> ™›˜QÀ7E =  šLD O > ˜ >  > G•”+™CG B >@= EoŸ^” >  Ì D =  B D‡À(š > ˜+˜)Dr˜ X E   = > ™˜…˜+™ = Â0šCD(˜ À7E = D(À5EoŸE = ™ > BD = D = G+™ > DbBD‡™ =  šCD = rD Ÿ^” > Å  ½ Æ ½ < ¾ D > À(š > ˜+˜*DŠœ > ˜)D ÇYBDrÀ(š > G > B > À7E = E K™CG§”+A > š rD(š > ”+D = ½ A š”  ÂfEo™›˜ `Eo™ BD9@ Ÿ ™CBE < ¾ D ŸJA =?> H D5G > Ÿ Å > K™CG•”)A > š > Àrš > •˜ ˜)D œ > ˜)D Ÿ E”¢™MKD5G_A = À7EoŸ0˜•”+G*A0”+EG_BD > A = À7EzŸ ˜•”)G)A0”)EGÀ7E =  > G?> = rD ”)G)Eo˜    À7EoŸ0˜•”+G*A0”+EG B > Àrš > ˜•˜)Dlœ > ˜*D K™LG•”+A > šBD  K Du˜)D7G D O0Â0š›™›Àr™” >= DrŸ^”+D À  H >=?> BE   ! ! H D7G > Ÿ Å > K™CG•”)A > šB$D9KD˜)D5G^A ˜ > B > À5E = À7G•™”+Ç7G+™LEMD‡À7E = ! ŸD(À5D(˜+˜+ÃG+™LE  > G > > À7G•™ > Å E B$D A ? = > =X> ”)G+™LkYBD EoH œ \*Dr)” Eo˜ EÁÀ7EzŸ ˜•”)G)A0”)EG^D OKD(À5A0” > B$E b Ç E@BD > A0š”"  À5A ™CB > BE   BD ”+D5GMA = À5EoŸ ˜§”+G)A.

6 "/&'1(*$. &(W&+8 2 ‘2 W“ Š (W$( .

 •   5$1"/&'0+&4 ' U (*$ ! ! $ Š ! U (*$ !0! $ Š 0!6 "/&'1(W$. &1(W&+18  '! Œ1Š  (W$ • 6P&1(W&+8 S ! Œ !  0!"" Š )4!" Š ”  (W$ 6P&1(W&+8 S ! Œ !  0!"" Š )4!" Š   ‘ •           ½   .

À.1(/'&+4! Š0 (  (W&! ŒHŠ $& Š < ¾ D KE.

B$D(˜)D2\ > ”+D5G•A = ”+D ='> ÂfD(Ÿ > ˜ A = r† -‡ E  > G > C™ BDrŸ^”¢™A@ À > G BD JJADqÀrš > ˜•˜)DuÇ..A = EzœH\*Dr”)E  B > BE JJADKEÀ.

= DrÀ > Ÿ ™˜ = ‡ ÂfEoŸ^”+Dr™CG)Es > G a > > Àrš > •˜ ˜)DTœ > ˜)D   KE.À.

‡ Èš = Â0”" pA ɘ+À Êœ$G  Æ ÂfEo˜§”¢™›š > BDËrG)EoÌG >=?> Å EMD = LXYX # .-.BD KD…™Ÿ À(šLA ™CG A = = Çr)” EKBE JJADG*Dr”)EG+ŸD•E¶ŸE = D Æ ŸBG•Ç aA > G•”)D •AD(ŸE—Ä.-.

L M0          {    l  5 l ¡    -  ¶ ž.

¶ *  ! >= œ ™CDrŸ-”)D(˜ BD\ > ŸD(š > À7E = E ]™›ŸB$E l˜ > À ¾ .

" ǑÀ H -.)0"(˜§”$." <"oœ=9r”"0  " Ç A  Ÿ*r Ÿ^”BzšJ.)"/ 0r” tšz˜•˜ “ -*    ™›˜1$rÀ(Ÿ^”2(Ÿ^”3" LXYX ™›Ÿ0À(š40™4 ”65Â7r™4J8$9r”"$+Ÿ'  ™›Ÿ'- ™À2(Ÿ^”:" ”+™›Â.  ˆ†       !!ÁÇr”"#" J%$¡”"&$•Ÿ'(" Ÿ)"&* Àršz˜•˜ +r˜•”  Ç¡”".”"&$CžÀ(š˜+˜.

 .) ”( Ÿ H  ˜"*r Ÿ-”  Ç¡”".o" ˜TK™4§$ ”'z ™˜(  ½ < ËG$9"."oš›™@*"&P$ @£˜2‡ ˜D= K™4$§”'zš  ˜ "2(˜§”$90”"&$1' À(š4z  ˜+˜9‡ œ'z ˜‡ Ÿ1-" A"&T$ K™@•$ ”z šE"%( ˜§”$90 ”"&$F'— À(š4z ˜+˜93)+$ ™MK-'— Ÿ1" K™X˜$1 O)rÀ0”"    œ'z ˜9Y J. H  $z ƒ ™›Ì&$ /…   ™š4  ˜§”$ TŸ'S •$ ™42( ™4$ Ào" š@  Ÿ'  W ˜9 JVr Ÿ À(™4 À•$ ™z Å!"Xo" ˜2o" œ.À $‡À $+™-$C* Àršz˜•˜‡ HB*ICB J ‚LKNM % KN> M T‚QŒO ƒ…„‡†PMQKNlM w‰X‚ ŠŒrƒ…„†PŠK †‘¿† .RE…M ‰E†‘SM % GN…M ‚TO  ƒCO   Ÿ ÅU  š”¢™Â š E ˜ JVr Ÿ À(™4UÁ À•$ ™z Å!"(o" ˜o" œ.=9r ”o" ˜( @ËG•$ ™42( ™@$"Y O#r À0 ” "¤Ào" Ÿ ˜§”$90 ”"&$8(‡ Z( Â.=9¡ ”o" ˜‡˜2'(( ˜CJ.o" ™˜8" À o" Ÿ ˜•”$0 ”"&$?z‡   @ Ÿ'z š42( Ÿ^”.¤" À o" Ÿ ˜§”$. ”"&$?)(¥†   Æ ˜9 J.)$¤ Â'$U(  ™4$9( ™ ”B  + “ ).œz˜ ½ < : zŸ"—˜9> ˜"?2(ÀzŸ ™˜2"?"—Â.

(Ÿ Àr™[ )( ˜•”$  ™Å  " 0™›š@  ˜•”$‡ Ÿ¥ ˜r Ì&  Ÿ'‘ Ào" š@  Ÿ'  -Çq™ŸK&•$ ˜?3'‘ À +$ ™ Å  " -•$ ™42( ™@$"  O#( À 0 ”B?"3( ˜§”$90 ”"&$We† )( Â.  ƒ ™›Ì&$ /…   #\ ¾ 9 J. V .o" ™›˜1"%( ˜§”$90 ”"&$1l‡   @£Ÿ' š42( Ÿ^”0"2( ˜§”$90 ”"&$1l‡ .

 H  $z Ÿ Å0   •$ ™z Å!" †( ˜•”$  ™Å " Àz " Ÿ ˜•”$0 ”"&$1l‡ B]&^`_ r ˜•”$90 ”"$F)2aH† b]^ Àz " Ÿ ˜•”$0 ”"&$1l‡  B]&^`_ r ˜•”$90 ”"$F)2aH‡  B]&^`_ Ào " Ÿ ˜§”$90 ”"&$1l† b]&^&_ r ˜•”$90 ”"$F)2aH‡ B]&^`_ B > Àrš > •˜ ˜)Dz –¦˜•”+E‘Ç.A.”¢™›š™Ck > BE¶Ÿ > ÂG)EzÌG >=?> Å EFD =  .=9r ”o" ˜1<).(Ÿ Àr™%‡ Ào" Ÿ ˜§”$9  Å "*0( ˜§”$9  ™›Å!"*)o" ˜1o" œ.

ŸE = D eq   J À Àrš z˜•˜ —” # (   ( .  # ( &  +* +*  # +*         *     cµ· ¸s® ¸q®]¹I· §²±7d ®V¸s®X³-°· »±d ¸ ³ fe-®O° {³ ® gq®w· ²¯s±O²³ih ¦·.° s² »³  ˜(Ì ™4$1*žÀ(š4z˜+˜9 .

” H  $zŸ0Å Ÿ"&$*zšE)0jk K™4$§”'šE3l  “ "% O)  Â0š4"2— ‰‹ŠWŒ   0"!" "m" ŠnNm +)  Œ ( Š '” ! $.

1 (5!'&+#.

1!(5' &+#+!) •( Šnoo 0   ! Sp  < ‘2 q '( ! /)'r Š &4 •  &1(* m   Œ $1 Œ1Š  m 2 Æ ˜9 J  .

(Ÿ0À(™2‡ À•$ ™z Å!""2o" œ.j  .=9r ”I" O Ç '' Â7"$Fl .

€ 9{ƒ‚…„†zb„‡ { 9€ ~„{ D| ˆzb„†zz ˆ„ „#z ~„ { D„Š‰‹z ¨lªuª§¨  .) ‡  K™@•$ ”z š7) ‡    Æ À(š ˜+˜:sZo"  ”u$•™AK-zÅ!"¥Ÿ"$*zš )r†   K™4§$ ”'z šl†   Æ H ™@$-$ J  ™' ƒ ™Ì&$ /…   LJ™@  š@2( Ÿ^”B-'¥ Ÿ'— š›™˜•”z Ì&v— ˜( Ì  ™4r$   Œ|„ …‰ { …‰ 9„Šz~„Š‡ …‰‹z w9z~x „ B…yBzb{ { ‚ | ~} y € . š.   * D= Ÿ' ƒ ™Ì&$ /…   * H ™@$$ J  ™4*ž Àršz ˜•˜r ˜¶À"& H  $zŸ Åz˜¶Ÿ"$*z™›˜F K™4$§”'™›˜ ‡  ‡ †   † %so"    Æ ˜‡À(š4z ˜+˜9( ˜‡œ'z ˜9Á ˜u" ‡  „‡   Æ À(š4z ˜+˜9]†  ”t$•™AK-zÅ -"ŠŸ"&$*zšT)„‡  K™@$•”zšT ‡    Æ À(š4z ˜+˜9e† ”u•$ ™AK-z Å!ž" Ÿ"&$9.

   " .

%' P#  5 % "            ? MPRH6 OR +/:V C/  4 / I? WFJ/ W/ 4J/ JJ R X Y $•Çr†:$•”-‡W(Ÿ"—Ä Æ Ÿ RJ/ ? / WFH? 4 Ž )$ ‡ Èš ÁÂ0”"  ɘ+À Êœ ." 48ˏ$"oÌ&$*zÅ "  Æ Â o˜•”+™›š R @6 LXYX # .-. +M C?4?OS ES 8/QVH4/ L? 4/ 4/ 7 @<:>@?L/ 4/Q6 CR =<:>@?O/ F W/ .-.

* nL 0M               5   -    .

 ƒ ™Ì&$ / …   \ s™@$$ J ™4 À &"  H  $Ÿ Å%  š ”¢™›Â0š¥Ÿ"$*zš K™4$§”'zš    .

 . ™›˜§”¢™Ÿ Ì /…    \ ¾ 9J.

"! u.  $zŸ Å2  š”+™›Â š4 K™4$§”'zš   H .::/N4LPORQ#+!D$ > ."3]aVcbdZ4?ˏ$"oÌ&$*zÅ "  Æ Â LXYX # . L0 > +.: /'4LM?A@ 7 !BDCE3!#!:/#:F/4LC/ C u0HGB0 I34L'?A@ 7 !B (C3K::!# ! /#:F/F4LC++ u10HGB0 GJ0 3$ K6B.<6=0 > +.: /'K+LM?A@ 7 !BDCE3!#!:/#:FK+LC/ C u0HGB0 I/K+L'?A@ 7 !B (C3K::!# ! /#:F/F K+LC++ u10HGB0 ÆUT $•Çr†:$WV -‡W T "—Ä YX[4Z Á V\ŽX  ^+] ÀX`)_ $ .::/N4LPORQ#+!D$ > .-/-)!10 ()+*.: /'46?A@ 7 !BDCE3!#!:/#:F/46:C/ C u0HGB0 I346J?A@ 7 !B (C3K::!# ! /#:F/F46C++ u10HGB0 GJ0 3$ 54L 7 )+!8$3!#:9.> .: /'7 K6?A@ !BDCE3!#!:/#:FK6:C/ C u0HGB0 I/K6J?A@ 7 !B (C3K::!# ! /#:F/F K6C++ u10HGB0 GJ0 3$ K+L1.> .-/-2Cu 0 3$ 546 7 )+!8$3!#:9.(Ÿ Àr™%‡À"oŸ ˜§”$9 Å "2 (˜§”$9 ™›Å!"*  6u "!# $%'& ()+*."! u.-.: /S46 7 > +.-.: /S46 7 > +.

L M0                5   -    .

?A@ 7  >S> 0 #3!/+# 60 G    .: /1 > ?A@ 7 ! (C/E 3!+#+! #F > C  Cu0HGB0 I  > ?A@ 7 !BDC/K :!+#+! #:F/F  > /C  u10HGB0  GJ0 )+!S%($:.> +.D /SK+L 7 > +.: /K:6MO Q"#!:$  > .  *  GJ0 3$  > .

=7 # 9>9> + +33&&3 3    94.    "!$#&% ('))* +  .&/10  203 !! + 3(3(443 3  665587 !! ++ 3(3(443 3  :69588 !! ++ 3(3(443 3  :<94.=7 # 9>9> ++ 33&&3 3    9588 9>9> ++ 33&&3 3    5587 ? + @ ]9 J  .!--.

A b2 A $ b4B -"2)"2"_."&$ \ HJI W$ b42Ab@$"% ]9J.=92V"DCFE0''GC. T. .

"3 " bd]% A  $ b4]9„ J‡O K?.A b*)-†LK JME K+b4$WV'Z \ A $WbM‡  JNEYK+b@$WVZ  A $ b4„‡OK? T Vc" A $WbM†PKX H A†:$ b4C. T.

3" )bd] † A $  b„J† Q X E T "&$9. TA )bXC.AZ@" A - b T H "Ys" C \ \ †PK \@\ ‡  3=TS A"3b H ƒ b T  Z42 T V A $ b4%s" C X ]6= -"] A " T ]aV$9 V"&$9A]Œ-:Z V] A Z] ]2]UKb@$WV'bd]J]u" A H *"3]+ T VA]"3]'] A Z]W]2] T "LKb@$WV'bd]2X UWV A Z@A b A$ ] A b4*  KD=I J32 ] A $9 K+b [/X b [WE:XBO|Af{‹Om[WA3@cXri<@YX CF{‹NPO i>CWX b NUCWXcX/@cX]g/QhAfO|{4CFQaX!_[Z  A Z]W] _]Y K+b4W$ V' Z T " V<) A " T ]WV$9 V"$  Œ: Z V v3" ] A " T ]WV$9 V"$A] A "\C'$?>-*V$"]f9K ]9$F OC:Zdb^] A b V* T V A H .-:" X .Z \ ‡  EQK+b4$WV'ZRC.

" Vcb A 2 T VaC72 Z4" A "&b:C b Z"A$ X * b423" ]TJ K&" A .   _$9=] ]  V".' A Z ]W] V  A " T ]WV$ V"&$3) Œ: Z V  ]_C'$ >22 V$93" ]7J`E A $ b4"2 V"&.

NC.) ] K" A ."#)$92 ] A $99 K$:" A " T ]WV$ V"&$1' A"&$* J J:  b ] $ ) J.

 Z J $ A " T ]WV$9 V"$ A "&<C'-?$ >22 V$3" ])" A " T ]WV$ V"&$C  Œ: Z VC2 bMO)8 ]9$ A W$ b)"cC72 Z4" A "&DC bdZ-"&A$ X "&2"" A " T ]aV$9 V"&$f) Œ: Z Vf2 bMO) ] $ A $ b4 " #" A " T ]aV$9 V"&$f Obd]WV T V C)$ A bd] ]9$1 O:C Z b A b VB2 T V A H *:" X @UT $dEr†:W$ V-‡W T "c] YX[Z4bC V\XŽ  ^] A X`_)$ @ C. A W$ b$ J. # .3" ]WV bdZ48 I $" e&$*B "  LXYX # .-.-.

K H B*I  W              . b? A Z4 ] ]9A ]Fs I " T V:" X *   .M % E ' KNM GNMTO "!CO #$!% E)'~M#vM GNMLO%"!CO % &(''&$9E)' O _:] $CK T  ƒ b e&$ /… X —  H b@$-$ J:b1 A Z]W]2]Ls " T V":X @ A Z] ]Ws b4$ A :Z@" E H $)Ab4$Ws " T V" 2 A Z4] ]92s('Z b C:]9bE H  $2b4$()*s b@$ A  Z4":X @<A Z4] ]9I %s b4$ A :Z4")(1Z b C:]9cE H $9Ab@$N2s b4$ A :Z4"(I % s('Z b :C ]9 X ƒ b e$ /… X — \ b4 $C$ J.

         # # # #  @ ] A Z]W]A]ƒs I " T V"31s b@$ A  Z4" A"&$-  T V $ b@"&$2 T VFC)$A]9 T VB-']AX @ C$2] T V(] ]9> J:b  Z bd]WVe&   A Z ]W] s('Zdb C ]0  C$9" e&$. J :]*] A Z]W]2] @ T b@']AX .

(4/ ."3]aVcbdZ4? I $" e&$*B "  ./ 021  .O )+! # $:(6.:: > /9 6u C)=)>?E(#(D6@BABC  D C .:: > / ?)+!IHO")+!IJ.CX  -.:  E"#(D+ #  7 >  .:D > 3@OAC +* @UT $dEr†:$WV-‡W T "c] YX[Z4bC V\XŽ  ^] A X`_)$ @ C.:: > /9 + * -u+9D): 9 <./021  .4365($# + 0W## 6u C)=)>?2. bd]aVcb T e /… X K \ @ $ J:bAK"* ]†s(1Z b C:]9X H X   .(4/.O)+! #$:L@J0    4 N>  Q"#+!+:$ 5Q:?u K::3/2AD$ ?\@B0 JG 0 (CuD/9 e /… X  \ @ $CJ.> .D: > 3 .4365($# + 087 /93Cu+:9 9 <. bAK&"% ]6s('Z b C:]9X A C. F E + ? G# 5 + 3$  2.O )+! #$:(6 O")+! #$:L<@0   + 3 Q:uLK/! ?/)+!MH1O")!MJ.:  1+! #+ML 0    + 3(43   <.

bd]aVcb T .-.  LXYX # .-.

 4 6   ƒ .

                       K   T*  6u "!# $%'&   ! + 3(43  "  .43 5 W# +  -5?( ++    .

.

4.!+3(5 4 3   " <  3    + 3(43   .!. ( # ++   +  3(. &  +"+ #G J5#F3 .  <. (65 6 7. ++ : . N&  53  .

<.:: > /M-/. 7 <.O)+! #$:L<@ 7   7 (.O )! #$D(6 O")! #$DL<@ .O )+! #$:(6. ' 3 !)A(3 ?&)HIH'0 !)A(3 ?)& JIJ'0   7 (.!( 5    (    .E(#(D=?HOOJ1O2# $:(6 @'O #+L ?)#$:L@ 7 G Q :u 2.    .3.7  .<.:D > 3M-/-8K+3! ?3)+!MHO+!IJ.:D > / ?3)!MHO")+!IJ.(&3  +   6.

43   8"<-5? ++ 1.-/-ACu0 .   5   E("#"(M-/-AK D33<A:$ ?A@J0   *  + (43 "  +  + /. + "!u.-/-)3+!8:SC"!+<.:D /'-WF(E+#Cu 3:$u$F#+LCN  > G #+L  D!u.:D > 3M-/-2K :/3<A:$=?A@    + 3FE #>  + <7.4365($# +  #+L # $:L10 #6 # $:(6B0 G Q :u 7 2.

:.2E2.

)) .

++ :. 3 + (&923   <7.-.4365($# +   7?49> + (<7   .5? + 0 %. + +  .4 . 6  3 92 + ( 7..  .!( 5  $#>$ +  .

 .  : 8N2( &  + 3 # N2 ? '  : .!+ 5 .

.

  +  & +  5)(2 +   +  0 . 9> + <7 ++N4"'.

X A C.CX C)$" e&$* A $ b4YN:]X"3_. bd]aVBe&  " C$9" e&$.[ ] I $9" e&$.=9V"3]2" Vcb 7C "Ys I " T V"  s b@$ A : Z4"% s ('Zdb C ] X .

 X A CCX   +* -. .  /0:1 (' . &&0W##  #  6u "!# $%'& ()+* :$%D > $D3 !u0 6 u C) =)> ? +*+!  @BAJC 6 u C) =)> ? E(#(D6@OAJC 6 u C) =)> ? 2.( . bd]aVcb T e /… X \ @ C$ J: bAK"* ] I $9" e&$-.:D > 3@OAJC 7   3  #G5 6   <E :  +    +  .

@ C.-.-. .! 5   ."3]WV bdZ48 I $ " e&$*B "  LXYX # .-.3  + .4365($# +  )+!S%($:. ' 43.?A@ @UT $dEr†:$WV-‡W T "c] YX[Z4bC V\XŽ ^] A X`_)$ .

K …   .

' 43 )+! H#=0 )+! J# 0 7 !8: C!? ?<? ?<? ? ?<? ?2? ?2?<?<?<?2?  W                       D!:$3u F+*3+! -)C Cu0   !(   . *   ' 3   3  + 3    .

?> #3 +*3+! > 3+!10   /! 7 46 3 " 36  . ' 31   .-..3 <3 W#>1.

.3 #3 > !G@K3!'?H'O'J@J0   /! 7 46  3 92 + < 7.-.  .

. 3 +*+!  > !#  . 3 #>3 >  ! G@HK D33<A:$ ?A@B0 G +    +  =#>  3  #3 !8: C!? ?<? ?<? ? ?<? ?2? ?2?<?<?<?2? D!:$3u F+*3+!(F6u%J+3-CCuM0   !   # 43 J#>1.

M.

0 '   !    .

' 3     5?  (  E =# 3  > !#S   +* +!0   ! 7?46  3 " 3   ...3 <3W#><.

3   + .. ' 3  - 5?#&  +  (4 : (6 .  # 3  J#  ++   + ..  5   +   H#=  0 J 2>=0 !> 3# ?& K3!M?HOJ@B0 > !3# ?&K D3/2A:$ ?A@J0 +! HH > !3# ?& + 3!2H?A@J0 u++/3!  > !#10    7?46  3   + 3  3  <- 5? ++ 1.

-..# 3   "   5 F E    =# 0   +.

:D > 35 ? O O O LLLD@B0 6@2K :/3<A:$=?A@B0 #3!/+#= 0 G  . + 26.  2. : < + !=: C/E 3 ! $ u /#DF +F+C++*+ +!  -/- /! E3 ! $u/#'?A@  u + 0   ' 3    3  + 3   .! 5  +! : C"! ?<? ? ?<? ?<? ? ?<?<?<?<?2?2? ?? D! $/u F.:D > 3-)C Cu0 2.   #  5       .35(=# +  +!8  C-! ? ? ?<? ?<? ? ?<? ?2? ?2?<?<?<?::! $36uF 2..E"#"D+-\C+3Cu0 E(#(D  ? O O:@0  2@ K :/3<A:$=?A@B0   ' 3  ++ 3  + 3 "  .

 021  '   (. ' 43 0 W##   .! 5 20 W## / 021  . 35$# + 0W## /021  .  2&0 W## * / 021  . (' -.

@ C.-."3]aVcbdZ4? I $ " e&$*B "    # .-.     "!$#&% ('))*+  ! --.&/10  20(43 @UT $dEr†:$WV-‡W T "c] YX[Z4bC V\XŽ ^] A X`_)$ .

' 33 ..:   a  ? " >  "      ƒ f      K     T*   .

.

 +  3  WW   . !!    ((  . ' 3  .

' 33 . ' ..

.

' 3 1  >&. !!    ((  . +  3  WW 1  .

.' 33 . !' 43    W 7 .

.

! 5 4. !!    ((  . +  3  WW   .

' !( 5 . .

.7 W %% ..' 33 . !  .( :.

.

!!    ((  . +  3  WW   .435$# + .

. '3!5(=# ( 45 ..

.

(  :: 8. !! .7W 8W 8%8%% ? +   . .  .

)]9$u"* bd] A  Vcb@"3]1 ] e&:b@$AX .     l' +M K"%# M   #<M % $'&$K %# YM ' r% "$B'OK   " #bC:Z4"%  ]9e&:b@$f T =] ] A Z4] ]90s b4$ A :Z4")(1Z b C:]9 0$9C$9A] T VB*)v"3Z ":X @A Z]W]0s @b $ ] A :Z4")(1Z b C:]9 C$9A ] T VB* $$93" ] .

. 2 3 4 1.  %( # )$ > .:: > / ?3+! H+'O)+! J1O )!S#+1O+!    + 3(43  "   <.: / ED#DD/O > . . * /0 * *72 * 3 *74 *75 +?6 +@* +!+ +?. bd]aVcb T e … X  \ @ $ : b "* ]6s b@$ A :Z4"('Z b C:]9X X   ' * - . / 021  . + /0 + .:D > 3@OAJC 1.:: /9 H *I     $8#    ! #    #" %$ # " '& * + -.:D > / 7 :9 <.:: > /9 +9D): 9 E(#("(:.9 E(#("(:.!5 + 5  + 2  + ./ . -= 1> > +. 1. 5 *76 *!* *8+ *7. /0 "  ()+*    "!# $%'& :$%D > $D3 ! 0  C)=)> ? E(#(D6@OAJC  C) =)> ? 2. ( 5(3 $ # + 5?&  #7( 31 (43.4436 5(+ =# 0 +  3$  E"#"D+.  FE . +  E(#("(:.D /"<.!( 5 /365($# + &07 /93 +:9.D: > 3.     (  5  :4 -5 W# +  (\ 57  FC + . .> +.:: /=?? E("#"( "#"(:@J0 > #(6\ O")+! #L(@J0 @UT $dEr†:$WV-‡W T "c] .: /1-    + 3(43   E(#("(:.

CB @ C.-."3]WV bdZ48 I $ " e&$*B "    # .A YX[Z4bC V\XŽ ^] A X`_)$ .-.

 b &"2 ]6s b@$ A  Z4"('Zdb C:]X A C.(4/. * .+ *    0        ƒ f           ?3)+! H MO)+! J O )+!S#'O")+! #(6\PO)+! # LD@B0 K::3/2AD$ ?\@B0 ./021  .!6 . ++  :  3  <  + 3.K )D )  QD +?2 + 3 +?5 Q "#+!+:$ 5Q: GJ0 ( D/9 .CX   +* -.! 5 /35$# + 20$##   C)=)>?E"#(D+.:D > /=?)! H+MO+! J+O )+!S#'O")! #(6AO +! #L+(@ 7    + "  # . e … X … \ @ $ . 5 E("#"(M-/-4K3!?HMO+JMO#::@0 .    +  5 F E   +   #> #> .:D > 36@OAC   ! + 3(43   E("#"(.D: > 3-/-E(#(D:.

K3!'+? H'+O J+1O #(6\PO2#LD@B0 G . * /0 * *72 * 3 <. +  #2.K3!'+? H'+O J+1O #(6\PO2#LD@B0 G Q : E(#(D:.:: > /M-/8.   ! + 3(43  "   <.:D > /-/-8K3! ?3)+! H 'O")+! J O )+!S#MO)+! #D6\ O )+! #L(@ 7 E("#"(M-/-4K3!?HMO+JMO#::@0 <. . /0 2 3 4 5 *76 *!* *8+ *7. bd]aVcb T '& "  %( # 1.:: > /M-/8.

E("#"(M-/-4K3!?3"#"(:@J0 + /0   ) .. (   1.D: > 3 ? E(#(D 8#(DD@ *74 *75 +?6 +@* 7 +!+ A +?..3 7" 3 .3!: .5 /!35$(#  5 :3 5(=##+ 3 (   L  ! ? &. !(  (+ 5?35  4   ( \ + 6  (        ( 3   4  3  "       <. +   + E("#"(.33 $#>5T (&.

 . + :.

+ .!.   * .!4  2   * G     #G5(43 2E  92 + ( 7.!6 .7" ?4 . .    4N>  +?4 .:: + 3 +?4 +?5 . /0 .  #> ++ 1( 5 &0. + / 6 LK+3! .!5 a  -.!2 . . . 3 . * .4365(=# +  > /M-/-8K3!'? "#(D+ @BHO#("( @BJO "#"D+ @ #D6=O "#"D+@c#6@B0 + +?2 <. .7  8 1.

(& .3 4 N>6 +    3# .   "- 5?++% + .

G @ A Z4] ]9s b4$ A :Z@"('Zdb C ] T -" A "&bC:bdZ4* b@"U`C$2] T BU)*Z e& T ]>$9$"3]2X @ Zdbd]aVBe  ]e:b4$ C$2] T V]* T ]e T ]T)f$$9"0 b V b4'] C.3" ]aVcbdZ4? I $" e&$*B "    # ?( #  B $ $ $ & 7"  # $ ? # . CB # # # # .K::3/2AD$ ?\@ 7   92 + < 7.  5=F+ E   +   #> #>. Q: E(#(D:.  - 5 W# +  <.  ( 5  E("#"(M-/-AK D33<A:$.AZ@" A  b T "s('Zdb C ] \ \ s b4$ A :Z4" X0V$"% $$"2C)$A]9 T VB-" E  Œ Z VB0' A '*'  :C Zdb A b VB>3" ] A " T ]WV$ V"&$2]WFs b4$ A :Z@" A "&2" s b4$ A :Z@" T "V  A " T ]aV$V"&$ @UT $dEr†:W$ V-‡W T "c] YX[Z4bC V\XŽ ^] A X`_)$ @ C.AZ4" A "&bC:bdZ4"&$2X C)$ b42Ab@$"$$9"0A]aVB T 0 _:b e& b4') T "  A A]W]": A Z]W]ƒs b4$ A :Z@" Zdb T '] =] …  Z bd]WVe& n ] e&:b@$AX ]WV"F" A "&$9$ C7"$ ƒ A Z] ]Gs b@$ A  Z4" C7".-.:: > /M-/-2K::/32AD$ ?)@J0   92 + < 7.*:3!:-. ]9$F A A ] ]'bC72 Z4" A - b T "s b4$ A : Z@"%MC.?\@B0 .-.

" A " T ]WV$9 V"$s b@$ A :Z4"('Z b C:]9 Z b T ']NK" ] … A]WV ŒZ V T "N" T "&2  A Z]W]  \@\ Dbd]aV"cE 's b@$ A : Z4" ('Z b :C ]9 \ \ s b@$ A  Z4"('Zdb C:] X X X X .2V C$0s('Zdb :C ] Zdb T '] K ]  X ]1Zdb T ']  ] &$9$"" V T VB$ A " T $aV$ƒs b4$ A :Z@"('Zdb C:]RC$ s b@$ A :Z4"C."3bd]V P)3" bd]Fs b4$ A :Z@"*8 _']9 E?- _ e' X  ($$9" ]3$ C7V T ]UZ b T ']LK =] K :X( bd]aV )!$9$" T N T b B!"("(DE V".K — ? " > "     ƒ f     ) Œ:Z V 0" A " T ]WV$9 V"$U s b4$ A :Z@" C)$ A bd] ] $U C:Zdb A b V2 T V A '*" Z b T ] ] "S $$" ] $9C.

b ]WVcb T e … X #\ ( #b:C Z@" ) 2 T ]e&  ( $$"X  b Vcb4 C72 Z4" A "&DC bdZ-"&$Me  T "i  .

2.FB3$3 ( $/!::F:$3# .D: > 3. %(3!A  ? E(#("(:. 93# )=> ? E("#"(.D: > 3FJ?2/! OcFA3!UOcFA/! OcF)+!@ )=> ? 2.D: > 3 @) >> .LM)=> ? E("#"(.3#(D cF  $ F+ 3!DF D/$#  +F\DF !A/+F >  )=> ? E("#"(.L6<.3" ]WV bdZ48 I $" e&$*B "    :   a    !B    # $  & $   *  .D: > 3 @) >> -A6 ' .=M.<"*+"!<J )=> ? E("#"(.D: > 3'-/.3$/  $! D5$3#.D: > 3 @) >> - .L 1 .D: > 3 @) >> .:D > / )=> ? E("#"(.:D > 3 !+ $ > D"! # )9 !:J >  ? E("#"( )=> ? E("#"(.FB/J/+!$HF(3##/#DF:.D: > 3 @BA.F :$# $/!/:F:)9 F )+!:F.> $3#D 3#+#3# .  & ( #   $  -&  B     - #  C. $  3$  )=> ? E("#"(.D: > 3 @\ >> .D#:"! .:D > 3 !+ $ > D"! # )9 !:J >  ? E("#"( )=> ? E("#"(.D: > 3 @) >> .: $/#+"*.L ' .$"%D.D: > 3 @) >> -2 >.:D > /-/-8K3! ?A3! O A/! O A3! O A/!UO )+!<@ )=> ? E("#"(.L 1 .:: > /1-/.?\@ )=> ? 2.D: > 36@BA-A6 '.D: > 3 3:!+ $"%:.D: > 3'-/./3  9/#% )=> ? E("#"(.:D > / ?"A/!O A3! O A/!UO A/! O )+!<@ )=> ? E("#"(.D: > 31-/-8K3! F3F:3!:F$F!$3!(/:F/%(% .  ../! !  > 3Q+1)=> ? E("#"(.D: > 36@BA .::/$33F E"#(D+ 3$ $"%D.F(.-WF.F$3 3!F</3 Q /#!F+$F > ( ! /#+F:)9:F !:J >  E"#(D+.D: > 3 @) >> -M .L '.E"#(D+M-/-2K::/32AD$F=?\@ /!(  S)9 3$  3N /! :9("!/ )=> ? E("#"(.FB$ /!F<3/Q #+!F$+F > D"! #F )9:F!:J >  E"#(D+. /#F)9 "3/$ F<.> $3#D 3#+#3# .!3$: #  /! .D: > 3 @) >> . $  ?E"#(D+ F":$D+3D+ .3#(D cF  $ F+ 3!DF D/$#  +F\DF !A/+F >  )=> ? E("#"(. 9+3# F -/)=> ? E("#"(.D: > 3 @) >> . b T  ] @ $ : b &"2 ]†s b4$ A : Z@" ('Zdb C ] XŽ ]T:e X $3 #  "%/#(#SE$ >  ?+* < 3$3 +E * L?N)=)> ?E"#(D+.*:$! D5+ D/$# $!/ AQ: E"#"D+'-/-2K :/3<A:$ ?A@ )=> ? E("#"(.D: > 3 F (@ )=> ? E("#"(. 1. 93# G @UT $dEr†:W$ V-‡W T "c] YX[Z4bC V\XŽ ^] A X`_)$ @ C.<"*+:3 .D: > 3 @) >> -.F "#(D  $ N 3! D/$#  \ !A/  >  )=> ? E("#"(.D: > 3 @) >> .F:: DF :$# $/!/ F )!:F E("#"(1-/-K D33<A:$ FB?\@ )=> ? E"#"D+@ A - ' .F "#(D  $ N 3! D/$#  \ !A/  >  )=> ? E("#"(.K 5E 9 /#.< ( D/+$/# $!33 )9 AK::3/2AD$  !:A(F+ F !:J >  )=> ? E("#"(.D: > 3 @) >> -A6 '.E(#(D:.D: > 3 @) >> .L6J-cF+FF+FF+F+FF+FF+F+FF+FF+F+F2. 93# G )=> ? E("#"(.::)+*8!# +$!  $ /"% > 3 :H > #::/ )=> ? E("#"(.D:3$///F  E("#"( 3S$ $"%:.F:.D: > 3 @) >> -.D+ \DF ? E("#"(.2.E("#"(1-/-=E"#(D+ ?A/!O A/!UO )+!<@ )=> ? E"#"D+@ A -E("#"(1-/-=E"#(D+ ?33("! E("#"( D@ )=> ? E("#"(.D: > 3 @) >> .D: > 3 @) >> .:D > 31-/-=2.D: > 3 @) >> .D: > 3 @) >> .L.=M.D: > 3FJ?"!(F.L 1 .F K +F+E +FF9 /#.%$/!/A<* 9/+!3L9+3# 3$+ !+ 2.2. $ 3 //$  )=> ? E("#"(.L 1 .L 1.:D > 3 @A >>  9(/. .D: > 3 @) >> .> $3#D 3#+#3# .FF+%$/!/A<* FD9/+!3:FD9+3# F3$+ F!+ E"#(D+M-/-= E("#"(:FB?\@ )=> ? E"#"D+@ A -A6 =.D: > 3 @) >> .< (F D/+$/# $!33:F )9:F 4K3!  !A  !:J >  )=> ? E("#"(.3)+! 2.D: > 3 @) >> - .*:/N.2.D: > 3 @) >> . %(3!A  AQD E(#(D:.D: > 3 @) >> -M .

 /0 &&  $ #  1.     . .+ . . A   1. .  . + /0     . .  2 3  4 5 *76 *!* *8+ *7.    . * .!. /0 A! ! " ! "       .         + +?2 + 3 +?4 +?5 . .!6 .  . . . A *72 * 3 *74 *75 +?6 +@* +!+ +?.  $     + & # # & T*   ! (  $ # 7"   & #    . * /0 *  C.

C.  .!5 / 6 / * / + / . 1. . . "  . /!/ 0 / .!4 . 3 .   %    . . 1. !  $# .!2 .

 .  . / 2 !  . . CB #  .-.  .-. . .   .   .   .

" e$Z ˆC7  T ":$$9") :b e3b VB " ] b T V # C.K   0      ƒ f     "&2" " A C. ] $8?:b V"Fe&$ T X †:.".A Z4:b bE T  A A]W] S$Wb4" A "&bC$  T )$ _7   ] b T V #*   %: b 3e b V$:"FC$"e&$* A "& A :b4'-":X * " A C$ A b ] ] A " TA  T V$$1NC7 T ]-$ T "  A ]aVB Œ  T :" X  b ] A "&DC Z4 #3" ]   X " ]9 C$ " A .  ] T "/ T V T   V"  .C.AZ@" A "DC:b Z)"&$PC7". e&$$ SW$ b]2 T ]e& T ]L)W $$" X  #bC:Z4" A Z S]W] b A " $$9"8F:b eb VBB "0 ae$*Y]  A " T A: ] E Œ Z VB0"&* A 2] ]"8 A "3Z A V2] ]  ˆ^ X †> " AGA " T. *"."# & $  ] ' e$-' C.

-."3]aVcbdZ4? I $ " e&$*B "    # .cC$Wb42Ab4$ Z42 b V$ X6(1]aV2 ] A " T.-.A 2 b V3" ]]$u"* ] ]Wb4 bdZ-3" ]CC 3]1 Z e& : ]"2  X  2   &* # (  a           (   " (     ( !"   B B ? "  "  ? #  $ # B  )# @UT $dEr†:$WV-‡W T "c] YX[Z4bC V\XŽ ^] A X`_)$ .   2]WVcE3P"3] A C V:Z@"3]* T ). CB @ C.

  .

  .

  .

 .

: A Z<:] ]=7MC14357>/ ]=7>? T 1@?=/A:bd] B7A]aVWSV b A 1]C1D8 +bE?WV285:bd]2X  ]."3] T "&$9. ]0/DEV2143513]6357985/.: Zdb eP:BQ1MA7 ]aVWS V b A :X SV27K?F/R1 Z b eP:BD1M72]WV SVcb A : ] b e T b A : S857 485: T 351R1 A 1@/bC:bdZ<:D351@?I7 T.) C.b ]f8"3]DEV"."3Zdb@*"&$ D]2":X @ C)$A]9 T VB ] ]3 T V -" A "&2" b4bC:Z4 * T V$C"DC7"3Z b42"&$ :]2" "V$ EA]F < # DC:Z@":X " T ZE" A C V:Z@"%C$9A] T VB(] ]"3]fDEV".:D3T:cCA7 ZE1L7 T 357K?F7 B>1A3O1.A Ab V".+ M# & &$ G #.p qBrDs i rStutwv m tOx4x izyJ{ v o\j|o x jT}D~noQ5o x€Z‚ { €Bƒ { 4€ „ { …v i@m †ntOxS‡ €x ‡QˆDy ‰5iuˆD‰5i €4„v]Š5t j tz€Z‚ i €OƒG‹FrPq Œ lS‰SmB‡ v p K  ]WV B 1( ? -& & .:D3T:L351R/b2E V214351 ]F:8 _ ]WVcb V2:8 bU: A T:D/.85/."3] +b4$aV'b ]  C7"] ] b _:bdZ b Vv b4c] C Z42 T VB"*" A " T. @ C)$A]9 T VB ] ] T A]aV A C V:Z4"%"3]DEV"./b2E VF1B351 ] T 1D?F/.72]WV2:R85/ CZ1@8 A 1 A 1 T d8:]F1 Q:D/R13]PVF7 T V :D?072] A Z<:D?F7 A 7K? A 1@/e85/f7 B7>/bC:Z<1 X gBhBikj4lnm4o.V27K/ ]F7>87 T 357K?F7BK1L357 T b<351M: C5? bE1@? b  T : A 1@/DC bdZN:BD1 VF7 T 3O1.A 1 T V2?2: 8O/A: A T:D/."3] +b4$aV'bd]OC$9"3]AX  ( "  ( ?   ( ! "&2K  # #  $ $' &&% O $8#('" *) O $8#.: bd]G7H13]I/DEV2143513]J7A]aVWSV b A 1]./bE2VF1B351 X V 7XWF: T :%sY: _Z27 ZN: \+[ X 97 B7K/D:C ZE31 ]03579/DE V2143531 ] A 1@/ Zdb eP:B>D1M7A]aVWSV b A : X sY: _A7 ZN: ][ X \J^ 2E VF1B351 ] A 1@/ Z b eP:B>D1M27 ]WVW"S Vcb A : X I ?=7 B1 V 27 V21D? T 1 1@/R7 I :D?2_D/R27 VF?F1 Z 8 B1 s b C1 1@/R7 aAs b C1cCcb `9` `b T 9Zdb ` T 7 s b C1 1@/R7 aAs b C1cCcb `9` ]aV : V b A s b C1 1@/R7 aAs b C1cCcb `9` b T Zdb T 7 ]WV2: Vcb A s b C1 1@/R7 aAs b C1cCcb `9` s b C1 1@/R7 aAs b C1cCcb A 1 T ]aV b T `9Zdb ` T 7 s b C1 1@/R7 aAs b C1cCcb A 1 T ]aV ]aV : V b A s b C1 1@/R7 aAs b C1cCcb A 1 T ]aV b T Zdb T 7 ]WV2: Vcb A s b C1 1@/R7 aAs b C1cCcb A 1 T ]aV H % IH   ( ! % $ " " & $ %& ? & %& !C CC          F1.

K K      .

   a   a        & sY:_7AZN: I ?=7 B1 bEW? VF8T: Z bEW? VF8T: Z C \[+X K ^ E2V2143513] A 1@/. wt v m tOx4x i5* ! 6.Z b eP:B>D1L3:b T _D/ b A :X V 7V21@? T 1 1@/.pSp €4$„   %# qSq4v\Š5t j t€4„  t v m tOxSx iy q4q o v o]j t .BToy.7 I :Q?2_D/R72VF?F1 Z 8 B1 s b C1 1@/.‡ .p l4‰SnmB‡ v y Œ lS‰SmB‡ v p … oBoB‡\‡\ €Z€Bƒ‚ QŒQŒJJ‹S‹S‹S‹S"‹"‹ !$!$## …!'# q4q g@j j t . ‡\ t .5i €Z‚ i B€ ƒG‹ v m tOxSx *.7 aŒs b CZ1GC b `9` s b C1 1@/.: ]F7 e@8:bE? A 1D/.A bE1 T :D/ 1] /bE2V2143513] +b<?WVF8T:b ] 7 A 1@/R1A8:]F:D? 1] /bE2V2143513] +b<?WVF8T:b ]aCT:Q?2: S857 1R/b2E V214351 L351R13_4W=7V21:7 A 5:D/.pSp €Bƒ   %# ! =7>? @7 T 1 7 B7>/bC:ZE1 : A b</.]F7>? 3O7 A Z<:D?2:Q3T:] A 1@/R1L/bE2V2143513] +bE?WV285:bd]2X V 7XWF:.1 d8 T.pSp €4$„   %# … t ‡ x i@†~4† t @‰9n‡\To loQ† q4q yIpSp € ‚   %# y.04Oo € oO‡ †BiPBi € ‡. / * #  ‹ €Z‚ # q4q4v]Š5t j t € ‚  twv m t5xSx 3i *  ‹ €Bƒ # q4q4v]Š5t j t €Oƒ  twv m t5xSx 3i *  ‹ €4$„ # q4q4v]Š5t j t €B„  twv m t5xSx iy  €B„ .p …Œ oB‡\zj t . / * # * pSp €Z‚   %# qSq4v\Š5t j t€Z‚  t v m tOxSx i3* * pSp €Bƒ   %# qSq4v\Š5t j t€Bƒ  t v m tOxSx i3* y.7 97 KL351 13_4W=72VF1.1D/. / { v †n‡ t ‰Pj|o\0 (SiD~noTo ~‡]lno1* v o]j2.:  S857 d13b A ? b<:D351985/ 13_4W=7V21 351 V b C1 7 7 48O7 1 /DEV214351 97A]aV : 7 B7 A 8V : T 3O1 7 K 35: A ZN:]W]F7 @ X I :D?F: S85791L/DEV214351 A T:D/R7 13] /bE2VF1B351] 97 KM3T: A Z<:] ]=787  7 K 357 @7>/.no]jni  q4q i v\Š5t j t o x jT}D~ToQTo x€Z‚ { €Bƒ { i €4„ …Œ oB‡\zj t .:D?H13] /bE2VF1B351] L7 KA3T: A ZN:]W]F7 @ 7 T D1 3T: A Z<:] ]=78 7 X H8 ]F7XWF:  A 1@/R1 : Zdb eP:B>D1 E 72]WVWS"Vcb A : 51 A 1@/DC bdZN:Q351@?1V2?2:Q358  /.7UX @UT 35?dE < 85:DW? VF=7 7I857 T 1c?] >>>YX[Z</bC V\X 8 ^] A X`_O? @ C13]aVcbdZ<:M357 I ?F1 e@?F:D/.:BD1L7K/@6   _:] B & ( ? B .‡ ..:b T 35: ]F7eD8:b T V27 d1@?=/A:X #B & B B  ( $ B & B B gBhBikj4lnm4o.‡ .7 aŒs b CZ1GC b A 1 T ]WV '& !C -C  (  (  … oBoB‡\‡\ €Z€Bƒ‚ QŒQŒJJ‹S‹S‹S‹S‹"‹"!$!$## … oB‡\ €4„$QŒP€Z‚%# €Oƒ%#&!'# …!'# q4q@s i)( tut v m tOxSx i+*I{ BiP†n‡ … t  t OizyG{ izˆ@‰5iz†Oi@Bi € ‡-.113] /DEV2143513] L7 K ]FD1 T 1@?=/A:bd] Z1/DEV214351 Q:b A T:D/.

" B " " B  $ B & #B B  CB & B  ?( ( B B  $ ( B & B CB ( " .

B>D1M351 CO?F1 e@?F:D/.K      <   -&  ! "&  # $ $' &&% $ #  ]I/bE2VF1B3O13] bE?WVF8T:bd]'VF7>/8]F7K8 7 T 357>?=7B>1 357 T b<351 3:b T :Q/ b A :D/R7 T V27 P1@8 ]=7XWF: 43585?F: T V27 : 7 O7 A 8.: X 27 ]WV2: ]=7BQ1 D:Q/.A b<1 T : X V 7XWF:A: ]F7 e@:8 b<? 1`C5?=1V V b C1A357 357 A ZN:D?F:BD1.13]63 bd] A 8 VcbE? A 1D/.A Z<:8 ]FD1L3T:GCT: Z<: 4?F: A 5: D7 +bE?WV285:Z X    .357M85/ /bE2V214351 bE?WVF8T:Z X @ b A :.3:b d7K?F7 B:A7K/ ?=7AZN:BD1 :Q13]0/DE V2143531 ] 1@?=/A: bd]RE : b .1 bd]aV21 d8 T.

: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .1@/R1 d8 E1 : N: F7 T: F7 F7>/ 17 357K?F7 >1357 =7>8 / F1B351 <? 28T: : F8T: 2: Z7 N: V ^  7M: >7 2:1 /.: D7 S857.1 E351 T:Q?2:M: N: F7 7  S8T: 351 D1 >? N: 85/ 1 4W=7 21L351 1 7 1/.7 F/R1 D1 d1 ?F7K357 <351 : <: =7 7 ^ : S8T: 351 M: >7 2: 7 B: >7 F:M1 .g B & cb eIjla  tg:] 3bIb r^ [ =gf] 3b4b OŽS‘h o }g:] 3bIb B " B   ^  ng :b4b  [ 4j%( }g:] 3bIb fb ‚e g $ jlg  :g Xe f] €a …d 3]lj  j  & ? " [{^ cjMb '" dfe ( 3j„b 3g fbIb b ta  cb }g $ jlg B^O[ cb g:] 3bIb o 3b B & BC_ a r^ )\b g:] nbIb Œa "e ( B cj 7" f] 3g fbIb c\  fb 3b4b =a ‰b g 4j …gf] 3b4b 7" a 3b ( Xg  dfe BC_ta o gf] 3b4b -" }gf] 3b4b 3g :bIb dfe B & [ " ! )a  3bIb ta j f] ’h“”–•X“”˜—H™›šœ)™xž™ Ÿ¢¡H•X£h¤r£›š¦¥p§8ž.j 4e cb (."7C2 *% <>?2"7A@B#3!7C>D* GH*&+-.jlb4e 4j tgf] 3b4b Be :^u« " 7" ¬g [  be }g:] nbIb Xe 4j%( N:D?F:D351 >1D/.1@? Y: E7 a V ^  1D8 2: Z7 N: 357/ 214351 E? 285: 2b 2: 2: Z7 N: K1 >/(1 7 357>?=7 >1 351 / 214351 E? 285: </  S8T: 351A1 5?=1 @?F:D/A:M7 2: =7 351R?F143T:D3O1T:L357 >D1.7 /R1 @7>? >: 351 F7>8 H7 3O7>?F7 >1 : V ^ N: F7 3O7>? Q:D3T: 2:D/ >/ 27K/ 85/A: V ^ Z1 357 27K/ 1 7 357K?F7 K1.7 21L3T: P: >D1 3 _D/ >: &1B35: T:D/.j e 3] :b4e b Š a ‹b a ®e 3b 3b  3bf^ = O? ‰^¯] aBe°^ CB±bIgn^²\ o 1 <: 357 ?F1 @?F:D/. /0/1 .:D3T:L: 7 T: 2: Z7 N: V ^ 85: 351 @1 >? N: 85/e1 4W=7 21./ F1B351 7 3T: N: F7 7 1@? S857 5: F: Z7 N: V ^ u3T: N: F 7 7  [ o :] & X^`_ 3\ " gf] 3b4b ue 3\ " pe f]   5d"e dfe a 5aB] cb (.j e gf] 3b4b e j g nm  gfj 3b B  c\ dfe 3b  © o˜ B Bb 3g :bIb  a  o  :g :\ †e [{^ a ~j }\d j dfe :be 4j%g 3m g 4j #BC_ fb " ƒe jMb & X^ &  5d"e  ‡„jlk [{^Hˆ  -e 1( 3jb g Be  ( jMb 3jlbf^ 3\Be j :g b  (./R7 =/.j 4e dfe 3b  3jlb }a ca e  ªg b4e (.*=<>?2"7A@B#3! <>?2"7A@B#3!7C>D*EF@.:D?L/ 214351 N: F7 =7>/ 5?F7 D: T:Q/A:D?.'"!$#324#5+-6"78*:9.1 / F1B351 L3T: <: =7 1@? S857 1 /.8O/ / 214351 357 N: F7 3O7>? Q:D3T: 35? < 85:D? F=7 7I857 1 ?>>> </ 8 © e "e [ " cb :g Bm e -e 3\ b }]Mjlk  ~b  fg m :m  3jMb Ij ( -"   (.1 .1 8 F:A: V ^ 3T: N: F7 7 =7>/ 5?F7 : >7 F: 1 6/ 214351 7 3T: <: =7 w/R7 =/.GUTWV. ( !  (  B  (  (  $ ( %B   (   "!$#&%'%)(*&+-.3O7 F7K8 0/ 214351 E? 285: '< 7 : d1@?=/A:  S8T: 351 85/ 1 4W=7 F1L3T: <: =7H357>? Q:D3T: T:D/.•X¨r™›§8š g:] nbIb {b 3j  cb g $ '( B cj­g 4j 4e  dfe ( njg $ a  g:] nbIb fb 4d BC_ e 3\ Bj  a B dfe B & cb r^ ?(  b 3g :b4b  cb :b td#(nŠ3]lj :b fe ( 3j„b 5d"e j  3m o ‹gf] 3b4b 3g fbIb [{^ dfe 3m [ }\€d e 3\ n] f] ^ =]ljMk eIjla D1 53 7 @7>/R1 T:D/.351 0/ 214351 : 2: Z7 N: V ^ F7L/.1 =7>? T:D?F: F7>/ 5?=7.j 4e cb (cdfb ne vxb4e 3b fb4e e }b fm cb 5d"e fm 5d (cd:b e fm  Bb b  jlg  -b )b dfe | nb te  :m  g:j gf] 3b4b }\ " cb B^ Ij ( 5d"e E? 285: M3O7 O3 7 2?=1 351 >1 F?F8 F1@? Y1D? S8571 K1 2?F8 21@?L3T: F1B351 .7 F/R1 8 2: : V ^ 3T: N: F7 7w7 =7>/ 5?F7R: K7 F: 1 9/ F1B351 3T: N: F:7 7  =7>? D7 S857 S8T: 351 7 : K7 F:.3O7 S8T: / 214351L357 D7 =7>?C: K7 F:D351 35:D3T: Z7 N: V^ 6. .GHI#.*3JKMLN /0/1 .*XKMDB#324Q3+-.4RSEF@./ 214351 Q: F7>? 7 B7 >8 :D351 L?F7>: :D35:A3 : / >:D/R7 279: F?2: 35: D7>? >: D1R351 7 357>?=7 >1.7L7K/ 2143T: 9: :gf] g '(.3T: 5? 5? N: N: F7  F1 S857 : V ^ 35: N: F7 357>? Q:D3T: cb ‹d (.*=<>?2"7A@B#3!O'*&+PDB#324Q3+-.'"!$#324#5+-6"78*:9.j 4e cb ck dfe 3bhg  3jlb 3g 3jlb "^wvxb4e ye 3\ Bj  nm eId  f] zg  jlg B^ :] rg $ qe 3\ !  fb4e b i]Mjlk j e  e d " jlm :m n] cb 3] st[ dfe (.:M85/ / F1B3O1 51 7 3O7>?F7 >1 1 E351 7>/ F7>/ Z1L35797 O7 >8 >D1A35: =8T: V ^ 2?F: 9357 F7R/R7 >: F/R1  : E357 : D1357 S8T: .1 / 214351 n: K7 2:.:D3T: V <? 28T: ^ 7K/.j 4e cb !( b 5d"e 3\] 3g :bIb [ o 3jlbf^ bIb4j 5d =a f] [{^ B o  cb( 4j%g  o   fg  ! ( .7 : F/R1 :Q/ K/ ?=7 K7 7L1 1@/R7M357 P: >D1A3 _D/ >:  Z1 1/ F1B351 S857 Q: F7K? 7 B7 K8 :Q351  Q: F7K?0357 <351 7>/ 27>/ 1R3O7 7 B7 >8 D1 V 7XWF: : @85?F: \[ 1 d8 <1 :D/."7C2 *%YLN Z V 7 WF: : Y: 7 <: ][ M7 O7K/ <1 63579/ F1B351 >1@/ P: D1M3 _D/ >: N: F7 S857 F7>// 214351 E? 285:  >1 >/85/A: : 7 <: T:D/.1 <? 28T: *7 F7./ : 35: D1 d1 >? N:D35: /.351 1 n1.

     .

  .

1 : 27K? E1@?F/R7 2P7 148O7 1 </R1@8? 7 =/.d7K\? ` N: 1@8 .1 7 :M/M8 : Q.: D1L7K@ / 6 "! b © dfe a 3b "e  "e © dfe 3b:^ 3b .7 2?F1 ^ F1B351 3# E? 285: Q1 14357>/ =7>?07 K1 / 557K?2: >: Z7K?F/ F7G: E/ <7>/R7 2: D1.d7K?F7 F7 .d7>?=7 27 T:D?2_Q/.351 1 E/.d1 K? N:Q351 ] F K 7 ? 8 D # 7  S 1 857C357 1 148O7 191 4W=7 2I1 .d1@?F/.j 4e [« cb :be'ŠneIjlg cb:^ :be :b dfe .: <: K? N: 351 85/ Z1 F7 <?=1 T:D?F: : N: F7 5: F703T: 5 E7>?F:D\? 1S8 <: * : <: =7 Y1 F1 < 7 2?=1c351 351 >35 <7@a Db *&1c8 =8 D? <1 F7 E7 <1 B: 1S8T: J1 4W=7 F1 35D7 #@7 =7>? >? <:D35+1 * 21 ]* &1 2+1 * 6 E? >8 <1 1@8 F7 =7 @8 E.7 7 =7>8 0/ 7 21@? 1A3 .1 F1 5?=7 >:D? P: 3579/ 214351 D1R3 -.d1@?=/A: %*O1@8 =7XWF: * 5:D?2: >:D3T: <: =7 357>? #Q:D35: 1M/ 21435I 1 # <? F8T: R#Q: =7>?I?F7>3O%7 7 E35+1 *B/A: J357H8O/AI: .1 I: 3TS: 1S857 1 / 214351 # E? 285: 41S85I 7 #D: F7K?CD7 .351 >1 K7 21C357 Z1 </R1@?87 F/R1 "! 8 =1 357G/ F1B351 4# E? F8T: 7K6 7 7 E/ : 1P: T:D? 2793T: 07 2?=8 285?F: &> 95 : 8. b.       _&  @85?F:\[    <8 2?F: D1 3T: P: >D1M3 _D/ >: ‡OjMk X^ Y] be 3m =]Mjlk j  3m jlg B^ VMT_CLASSE_A Classe A f1 +f1(): virtual +f2(): virtual +f3() f2 f3() { f1(). } / F1B351 $# E? F8T: L3O7%#@7K/ 27K?R7'&O: :D/R7 F7 1 /R7 =/.: 3 -.d1 >? N:D3O+1 * 1B357 =7C8 2:D?G1 G/ 214351 >1 35: N: F7 Y1 F1 ! 7 7 27 E?2D1 '7 &O7 >8 2:D?A1 / F1B351 351 1 4W=7 2b1 1S85B7 . O? 1 <:M357 ?F1 @?F:D/.f1().f2().11 4W=7 F1 K? <:D351 ^ : >1@/ 18 =1 3O1 /R7 >: F/R1357 Z1 </R1@8? 7 F/R+1 *Z1/ F1B3513O7 F7 5TB: 148O7 =7>? '7 &B7 >8 :D351 : 1S857 E7 3O1R1 4W=7 F21 1S85a7 .? *T357 2?F1R351 &> 954* K? <: 1 1 SW=7 21 F7 <7 <1 :D351 F K 7 ? 8 D # 7 : 9 T 5 D : .d7K?F7 N:R/ 214351 %*121S857 3 .d1@? @85: .: 7 UVU Y1 </R1@8? 7 F/R1 H8 F: : N: F7 &1 2+1 * 6 <? K8 <107 F7 35D7 7 E3T: &: 27K? <1D? /R7 ! F7 Wa #@7 WF: @8O?2X: Y [ZPb ! 5?F1 D?2:D/.d1@?F/.f3(). f2().: >D1 =1 5?=7 1S8T: ! .1 5?=1 )( 1+* F71 1@/R7.* F7>?F7K/.1@T? 7 F/R1 O?F1 @?F:D/. } Herança VMT_CLASSE_B Classe B f1 +f1(): virtual +f2(): virtual f2 void main() { B b. b. b.j 4e 3jlb a :b  e Ij e & g Ij   j jlbe d ^ 3m dfe  j b c\  :b 3] 5b Š ^ cjg 4j ±bIgn^²\   e n^ }g ^ Pa BjMb4e   b  e  :g  a [{^ j a c]lj gf] 3b4b fb„[« jlg:j ˜g Ij j b f] j b Š c\ 5a Bb cjg Ij c\ :m a jM] dfe  jlg :b 3b Bj :g :bIbIŠ b cjMb fg Be  rj  ^$^ BjMe nb  d :g ck e j g 3b ^²gfaa a aBe 8 g Ij 5d b F^ [vx]ljlaBb 3^ tg \b 4d Bj  c]Mj j pd fbIgf] X^ Sj Ig B] \b 3j b  ‚bIjMk fg Be 3]lj fe cbxb &Y« ‰‡Ojlk  e 5aB] ck b   qa 3\ c]Mj 3jb e j e ‚a feIj  {g 4j 3m e 3] nj­b j a] =b :k o˜  Ij dfe .d7>?=7 N: 1 / F1B3O1 1 =7>8 1@/.d7 -#Q:D/R7 279D7 &B7 >8 2:D351 7 357K?F7 >:D351 Z7 N: V ^ *:Q?2: </ <7K/.7 2:D? 1 Z1 </R1@T? 7 F/R1 7 K7 D? E1 85/.7 2?F1 63 -. / D : T 3 : 2 ? 9 ^ < 7 =7 55:Ta 'b _-* D1M'7 & F7 7 5S85/A:M?=%7 .d7>?=7 27 V E/.71 T:D?2_Q/.j 4e \ e e :b e  e 3b Xj 4e =a  a g:j 3b  3b e .: 5 <7K?2:D8? 1S8 N:6357 <: =7 >1@/ / F1B351 # E? 285: 7 1S857C: >? N: >D1H351 J1 4W=7 F1 F7 WF:93 _D/ >:La K1@/|1 8 F19357085/ 1 27 <?=1 T:D?2: : N: F7 T: =7]b 5?=7 =7 : =7 : =7 @8 E?685/e'7 &O7K/ <1 1S857 7 N:D?=7 >791 8 =1.j 4e 3] « 3bb j$e g ­^  m 3b ya a jMe 3e 3eIjla  ›b jlk 3] cb cbf^  j Be 3b a  …g:] 3bIb -[« e U[ c\ :g Xe  e ^ fe gfj cb  j 5aB] dfe e 3m ^ 3b‰g :] 3\ :a :be fb5j cb˜d  g 4e = Ag b o b :k  fe "e b ‰^¯] aBe°^ Ij nb  -b g :j$e tb ›a c]Mj b b  e b j$e g {a g 4j$ dfe dfe {gf] 3b4b h\ Sj Ig ] e :j 3b 3b  )g:] nbIb h\ 3] g Ij c\ c\ fe F^ o j 3b -j  g:j b 3b ~b fe b f] fg:j  c]Mj  ›[vx]ljMab {a  a 3j  cb g:] 3bIb :b e fj n[  4j …b :] :gfj jMb j =g:] 3bIb .d1 >? <:D351 0c47 K? N:Q?L85/ 1 4W=7 21 Y1 F+1 * D7 &B7 >8 2: 35? < 85:D? F=7 7I857 1 ?>>> </ 8 . <>= ) = ?K) @BADC0) C3EGF IHJ= @K=LAD?>) =IHNM OU) = V E/.d1 .

j  e Ik ib  b :g 5d"e 3jlb e  ne 3bhb c\ j  3jlb dfe f]lj 5j    "e b © 3jlb  j j a © Xj 4e 3b "e ca FYb 3jhg Ij Bb cb ^ dfe o g Ij a cbxa  \]ljMg cb c\ cbe jl] ‚« ‚gf] 3b4b [«  "e ª[« ck 3m e  e fg Be h³‰³ .

         .

d7>?F7 27 Z1 J357 1 4W=7 F1 \[   &B7>/ <1 35798 =1.1 / F1B351:< 7 F7 5T:D?C357 F7  _  5d"e :b  [«  e ^ …g 4j c\ fe ª[ Sj 4g ] :g Xe 5d"e :b  V X7 WF: 1S7 : 3T: 2: @7K/ >1@/R1S7 : : 2:E3T: 3O1 5?=1 @?2:Q/A:* =7 E7 E1 : 351 =7 1 J3 .7'&B7 >8 : 1 / 214351 < 7 =7 T5 :Q?A357 6 E? K8 <1+*O7 =7 K? <:D? 85/e1 4W=7 F1 F7 7'&B7 >8 :.351 1 E/.1D?87 =/.       1 / 214351 < 7 =7 55:D?A357 Y1 F1 cB7 >? N:D? 85( / 1 SW=7 21 6 <? >8 E1+*.1  [ Sj Ig ] ‚b g Ij  3\  3] 3\ ]Mjlb4e 3k fe 5[vx]ljMab ¢g :g Xe g ‚b dfe ta  fb ck ‰[vx]ljlaBb 3^ 0b :] :g:j   nYb cb  j e :b e jMa cb fe cb:^ jlbe j  k X^ ›v a] b a c]lj b ^                                     .

234 5CE5'F'GIHJ.51< 8ID 1 . 5.. 5.0/1..f *I0eCa#TQg+%& .K 8/ : 8qplB : .l"m+Ic`  n+%Z' ZZC*#Z'&.:%6 6E€ / J P.!…'‚!E!D 183.0/1.|'}Z] ^_ `~X 0e&*'Z.0:1NMh9'5 2.+ -(. 5.51< 8i j 1< 9'5o‡!ŒB :. 5.<'’WD ƒ .  4.0B9'5LRN%E j TUV"+W0YX A*Z [ \ 7] & XA ^_ `baVc`Idea.?/ :b9'5 2.234 5CE5'F'GIHJ S2.:%6 6E€ / K <'.re/5ŽCJ K 8/ : 8Wh?‡I‘ˆ ivD 1< 9'5mˆŒB :.0B9'5WL L L L L L L L L L L L L L L'h‰ŠiED 183.234 5CE5'F'GIHJ P.. 5.re/5ŽCJ P.8h?‡I‘ˆ†‘Š iID 1< 9'5mŠŒB :.cZ X  90Ž.e} ^_ `A& * .X. <‚9<.rs't u uQD .132.<'’WD  •–.8QLRN%E -(..?/ @A/<=59B<1'5C9: 4D -(.:%6 6E€ / J S2.132.re/5ŽCJ P.0/WhVi (k]f..<0=> 39 .51'< 8vD  wxy!z  c`....re/5ŽCJ S2.?/~>>9'5 2.132.<'’WD ƒ .“ <32:QŒ B :.0/1.0B95Ih?‡I‘ˆW‘Š†R‹i%D 4 5...234 576.0/1.<'.8h?‡I‘ˆ†‘Š iID ” ƒ .?/WL @ 5:†hVi%D (lf.:%6 6E€ / J K8'/ :8†L L L L L L L L L L L L L L L L'h‡.8 j 183..132 8WL L L L L L L L L L L L L L'h‰ˆiED 183.&o^'Z'& J.iED 183.!#"!$%'&"(()* +.‚'‹ …vŒE!D 1 .?/ :e=<.{+%Z Zee &.<'’WD ƒ .K 8/ : 8MLON%E -(.8 9:.:%6 6E€ /3 < 2‚8ƒ „ 5': 8‚1.

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.N.)./~¤ID o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8...)  !–Z ZAX&`.25¢h£95 2. 5':3 .mm ^_ `o*'Z.).X ˜$Z™š`?X eC0C0&›*'#"oC ^_ ` B:'..vH.vd¡ & 4 5 25': 5}B :.—y+%.zZm *.uD ” Ž.X.51'< 8q6y‹eivD .: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .rs'tu.D B :.) +x`#Qž`0'&"%Ÿ `' X & ) ).X ) ) ).> œ 59'5/ N<h#iID *'Z..

Y _      .

  .

 U                           z .       ”  ZZ~*.?"+v0Z'7c  0c.

.

~ "šX 0 & Z'&Qd &`'mŸd˜&    `.*"‰+%[.` ZeX C*.70'(#"!'$%'&"!()'* +.\.+¢%a f *v?!)* + +¢xa?T +(&)'* +.#) .+¢  % a#c`Q)*g+.+ .c!`(]& `**Z'& £^'Z  ‰"Z~&` `0 Z&  `*!oŸ] & Z.\.X Z X          & mX y+I!V"!$x&"( & mX C'&`.Z˜+xZ Z}&[ \ 7X Y"ZC +%[.X.

o +%[ \.v) &`A0U‰"'+†#vd & 7YZ!#o& * .|' $!Ak}U *`Z]Z›00cZ *'Z'&mk +v`0&$˜c!a#c`'‰kdVw ^'Z(  YZ#qX &[ \ lc\.Z. w *'Z'&7(  X #$!Z'I` +v`0&$˜c!a#c`'‰kdVw +v`0&  $˜c! a f *v?-‰kdVwvd0.~XV$(ZI`) ) 7 * ^Z~ŸY` '™ Z X n+%Z' Zqc*  Z'mZ~U *[ \ YXq^? *'C&  `*) &  `*!+#& *.˜$}c‰"okd¡c‰"mwvd¡cV"}!dU *`'Z7Z} +%[. +v`0&  $˜c! a?Tg+(&(  ‰kdVwd0%d # •  +v`0&  $˜c! a f *v?-‰kdVwvd0  . ^'Z( ^' Z ( ^' Z ( ^' Z ( ) Z#/'X.Z    *'Z'&mk *'Z'&l.mZ&bU *!`'Z X ZŸeZ 0#Z 0C`‰"oA*'Z'&7Z?% $  +%[.\.\.cZ X n+v# &.       0'ZcX'2 1V"x* }fZg+!v *2* &ZcX  f.

2.

: aVc`8 ˜f 'X cZ X Z U($k aVc`8  ˜f 'X cZ X Z=<($?w a f *v?( lf 'XcZ X Z]k>$ 6 Z!l ^_ `*'Z87 aVc`†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )#?k9 a f *v?v) ) ) ) ) ) ) ) ) ) ) ) ) ) ‘# w  a?T +(&x) ) ) ) ) ) ) ) ) ) ) ) ) ) )     ZZm& Z 7 • 7 ?k aVc`8 ˜f 'X cZ X Z U($k aVc`8  ˜f 'X cZ X Z=<($?w 6 Z!l ^_ `*'Z87 aVc`†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )#?k9 a f *v?v) ) ) ) ) ) ) ) ) ) ) ) ) ) ‘# w  o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.435C)g!Z()`  7 6 Z!l ^_ `*'Z8 aVc`†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )#?k9 a f *v?v) ) ) ) ) ) ) ) ) ) ) ) ) ) ‘# w  a?T +(&x) ) ) ) ) ) ) ) ) ) ) ) ) ) )     ZZm& Z 7 • 7 . O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .

d1@?F/.P      B N       ) ) B  hN3P+) q \[  _  a?T +(&x) ) ) ) ) ) ) ) ) ) ) ) ) ) )   ZZm& Z 7• 7 w aVc`8 ˜f 'X cZ X Z U($k aVc`8  ˜f 'X cZ X Z=<($?w a f *v? £f 'XcZ X Z]k>$ 6 Z!l ^_ `*'Z87 aVc`W) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) #k9 a f *v?v) ) ) ) ) ) ) ) ) ) ) ) ) ) ‘# w  a?T +(&x) ) ) ) ) ) ) ) ) ) ) ) ) ) )     ZZm& Z 7 • 7 ‰ aVc`8 ˜f 'X cZ X Z U($k aVc`8  ˜f 'X cZ X Z=<($?w a f *v? £f 'XcZ X Z]k>$ a?T +(&  ˜f.d1 1 1 4W=7 F121S85791 8 =8 D? E1 >? E1@8 85/ /.: Q1 =7 F: E1 : *3#D1 %`c7 >?=7%#@7 1P: 5:D? F7c351 %(B3 @1 3O7.1 4W=7 F1 >? N:D3O1R3O7 2?=1.: P#D1 %` D1 2: Z7 1S8T: .: D7 K? >: a 2? 9^ < 7 F7 5T:D?]a bD_ bD* =7>/ F7 5?=7>1 >8 5:D? F7a.g a 3] b Xg :b4g cj­g Ij y\ ¬a  ia e 4e g jMk ig:j Ig B] f]ljMab n^ ’h“”–•X“”˜—H™›šœ)™xž™¢œ£ §Ÿ¢£xž.7 : F/R1 357 5?F1 D?2:D/.d1 K? N:Q351 85/ 1 21+*58O/ E? >8 <1 1@885/. X cZ X Z]' w $V• 6 Z!l ^_ `*'Z87 aVc`W) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) #k9 a f *v?v) ) ) ) ) ) ) ) ) ) ) ) ) ) ‘# w  a?T +(&x) ) ) ) ) ) ) ) ) ) ) ) ) ) )     ZZm& Z 7 • 7 • aVc`8 ˜f 'X cZ X Z U($k aVc`8  ˜f 'X cZ X Z=<($?w a f *v? £f 'XcZ X Z]k>$ # 7 <7 N:M1R7D&B7>/ E1 K1@/ K8 <3T:Q351 7 1 F7K?8#@7S1S857 3O7 1 1S857 1.: 7 F7 :] fj :b a] g ‹a n] 3j }b c\  b Š  fg d Ijlg jMb ±aBe 8 OŽSq dfe fe  k ig j b a Ij g Ij ck  fb 3\b :a 3b)aBe 8 b  fb cjlb 3\ aBe  Be  fe 5d‰g 4j cb dfe cb e b j$e g 3b Xg  ‹b n\ ­^ 3m  ¬b b ‰a  b 3g:j .1 14357 F7K? 8 2:Q351 a / F1B351 2? 9^0357 F7 5T:D?]a bD* F? )^C1D8 2?=1 ` / 214351 a b'_ b'*Z/.351 &> 954*n1 /R7 =/ /.

^ 214351 # E? F8T: 58O?F1 2D1 / 214351 . ršBŸ¢£ Y14351R1 4W=7 F1 >? <:D351+* 2: 7 :1S8T: N: F7 7>? 27 >7 7 8 2:R: V ^ u3T: =8T: N: F7 <?N1S8570: 1 7>?F: 47 =1 5?F7085/1 4W=7 21 F7 WF:D/?F7>: :D35: "! /R7 : =/.1 4W=7 F121S857a#Q: =7>? >? <:D351 </ <7 67 D7 K? K1 "! Z1 </R1@T? 7 F/R1 357 &O:L1 5?F1 D?2:D/.351 1L351.:M/A: : ! " F= =XO 2$ ?'HNF&% I?.O @ % H =SO +' <>A LOO C3O BO4F H IF LO.1P# E? 285: 57D& 27 5:D?2: 7>?=/ F7>/ 1 K1 557 </R7 F1.

7 2:D351 a D1 F7>/ :L35D7 7 >D1Sb V 7XWF: 1 5?F1 \( ZG1 1S85791R/ 214351 @85: N:D3O1L:D1G#Q: <1@? [ c\ © b a  3]lj Bb 3\ .1S857 2D1 357 N:D?F:D351 >1D/.1I# <? F8T: : N: F7 5: F7C71S857 D1 FD1 </ <7K/.j 4e 3]  fg:j b  cb Xj 4e  j a] e n]g:] nbIb ‰a XjMb4e ha e )a =eIjla fj a d"e b jlb g ©   :g © fe g Ij 3\  e g 5j$e j 3b fe ck  cb cb b 3m qg Ij njlbpb4j a] fb ‚k   cb jlm qb F^  :gf] a =b gf] 3b4b n^ :bxb c\ c\ 3]lj "e ‰b 3b ^ d Ijlg ^ i.

 :.

dfe =e [ ca 3j­b .

3jlb›a Bb cb›g O.

j 4e 3e 3e jMa 3jMb 5d"e . .

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/. . o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .   ‚gf] 3b4b r\ =d‰jlk  3b 3] B^ 3]   "!$#&%'%)(*&+-.

U _      .

ª6"78*:9."7A2 *%YL N Z N OŽS ˜ ’h“”–•X“”˜—H™›šœ)™xž™ Ÿ¢¡H•X£h¤˜£ ¥p§8ž.•X¨r™›§8šuœr¨˜ž£›š .*XKMDB#324Q3+-.  P        a    <>?2"7A@B#3!7C>D* GH*&+-.

: .1 # <351 5:D?2: &7 =1P: : 7 : T: 357 ?F1kW=7 21 <H: /.\/6=03+-8] o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.: Z7 F1@: 27K/ 85/ 1@/R79/A: D1 F7>/ 85/.8O/A: /R14357 <: @7>/ Z7K8? .: /A: F? >8 <: ! : 2? 58 F1 /A: F? >8 <B: .1 : F? O8 F1 2? -#@7K? <3T:D3O7 D17 2: 7>/ K1 <1 :Q351 : T:D?F:1 7 28O3T: 27.j 4e 3jMb˜a cb .j  {j 5a] a g pg a z[« fbIb  jlk 3b e g:] nbIb fb . :357R/./8:>-6G<)9TXE<&%Y<>ONE% %Z*.+-#/./# 8A@CB#).7 F/.g  g j ‹d jl] Bb4e e 3b :b4e …\  e  ‚g  Ib4j 5aB] fe j   fjMe ne IjMg ] k  "e cb fe 3b:^ j j 3k †a Be be 4j  c\  ^ :] 3k &e IjM\ cb 3bf^  a c\    Ij ‚g Ij =j 5a] {g 4j © g:] nbIb fb e  ne =g:] nbIb © o 5d"e &e B^ ©  njlb f] X fb4e e :bf^ TPessoa +nome: string +matricula: string +Entrada(): void +Saida(): void TAluno TFuncionario +iaa: float +numeroAlunos: static int +universidade: static string +Entrada(): virtual +Saida(): virtual +indiceProdutividade: float +Entrada(): virtual +Saida(): virtual TAlunoFuncionario +Entrada(): virtual +Saida(): virtual @8O?2:\[  <7>?F:D?\1S8 <: Y7 F1@:* E8 1+* n8 E1 :D? <1+* <8 1 n8 E1 :D? <1 <: =7 Y7 F1P: ‡Ojlk o g:] 3bIb ‰[« X^_ :b4b qj j }[« fbIb [ o ]  B[‡  g:j  4j X[ o ]  c‡  g:j  4j ^ X^ "!$#&%'#(#)%'*.d1@?F/./8./#1032 45#67.*n85/.d7 : *n: 7 : U357 >1 2: .: </R7 27 8O/A: <: =7 T: F791@8 F8 Z7K? <: =7 /.^`_X^  fe na ng a  \b e  d ne Ijl\ ~e 4eIj  c]lj  ne IjMg ] B^ fb  a b e "e ^ fb4e fb  nb « ^=‡OjMg ‹a j g 3m  …‡OjMk e  :bIb g c] . : K7 T:Q?2:A: >7 2:D?%* : F?2:# 357 85/ Z1 F7 E?F1+*: N: F7 3O7>? #Q:D3T: : C0) @BAD= = ) @ A%C F= = ) @K=LA%?K) =IHNM OU) = O?F7 =7 : F7c: F7 @8 <?R85/ D7 &B7K/ E1 K1@/ <7 F+1 * K1@/ 85/ >1 W=8 F1 357 N: F7 7 1 8 F1 3O7 1 /R1@?T7 F/R1 ! 3 <: @?2:Q/A: ^  3T: 5 <7K?2:D8? 1S8 N: <8 2?F:D3T: : @85?2K: \[ ! =7>8? #D7 1S857 D1 .: :D?=%7 .(43 D1 : 0/.: N: F7 : 2?F: : 1D?F/.W8AJC#/.: N: F7M: 2?2: : /./#[SUNF8@EB&#Z8./#EHI@EB#(JK#0?0-#L9M>?6G<>ONE%P#Q/R 8M+?#)JK#&>TSUNF8V8:.=<&>?<.+-#/.: N: F7M: F?2: 2: 8 2:D3T: >1@/R1A8O/A: 27K?8.DE@F6G.“šw™)š0•XžB™ •B™›š B7 D1 %` 27K/ 8O/A: N: F7 >1@/ 85/ 1@8 /A: 0/ 214351 3# <? F8T: 58O?F1 #@1 . š 8™›šXš./8:9.143 -7 : B7 1S857 : 95T:D? Z7K? 7 F7 c S# © e Xg te g:] nbIb g gf] 3b4b 3\be a  :j  a 5a }g:] nbIb 3\Bb4e ne ©   gf] 3b4b n\b4e ne 5d   :b b Bj e WYb ¦b fk .: N: F7 : 2?F: : D1 1B3O7 K? <:D? 1 4W=7 21 D*T/A: Z14357 F7K? 8 2:D3T: T:Q?2: >? <:D? 1 27 <?F1 cB79: N: F7a5O7>?F3O7 <?F: D1 E/ E7>/R7 : 1 / 214351 585?=1+*T: N: F7a557K?F357 <?2: 2:D/ >/ 85/A: N: F7 585?2: * 148O7 D1 14357 >? N:D?61 SW=7 21 /.` F7>/ 85/..7 551@?F:D?H7 : 5 <7>?F:D\? 1S8 < : *57 E/ E7>/R7 :Q? 1 . O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.d1 I/.g e 5gf] 3b4b n\b j   e j nbha 5d"e  3] Bb e rd {b }a Bb =a }gf] 3b4b =g:] 3bIb ‰\ j  g g Ij fj }e  pa }\€d e fj d 3b:^ }gf] 3b4b e 3b …b Ba 3g ta Ig:] 3bIb 3^ ng :b4b ne cdfb  a e :j 3b  5a] ¦g cj 3] .: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .: *.

“'/ 4 5.“qJ K59 9'8 <N -4 5“. 5  a       P         0  \[  ?\1S8 -#D1 &7 F1P:  Z _  jMb4e j  k X^_ o j 5[« :b4b 5 B^ ­^ -(.?/5~J K59 9'8  < N                                                       g.

 *Z&}f f .Ca#(& &  Z()                                                        ( ^`.

.

?/ @(>                                                       f#Z'&.0/1.&   .&l$&`Z?" 0& Z X.0/1.234 576 “9:.ZAX & *Id `'VZd) )  -(..&&`0c' z & -(.234 5769:... } & Zo^_ `'. 5 <0=> } & Zo^_ `'.

Z ‰"›Z c Qd¡"e+! #$(& & †d¡"A$ c* c|'  ) a‰"~"~c V"!Id "Z]"!Z` *I0Z() T"xŸ ` X .9J K59 9'8 < j                                                       g.& *& +%Z Zqc!`Z X Zee& Z2/'X.X.c&` `''&}˜" X &` `' # 1'2.c &š*.& .&oa?!'& &  ZY +!&c`Z]"Z +I&.ZCX mX.Z.< 9.&A^|.'&Q) a‰"šZ‘z .›*?Z'&.

%` ^!`'.& .

?/ @C=<: .?/ @q/ 80=5QD 9: 4WŒŒ09:.& l+(Z X   0&?"xc` ˜c&`Zo*#Z'& &2   B . 132 <vD  ... <:5Œ 9: 4WŒŒ09:.* &.....

3 ƒ2 .1Œ  ^_ `'˜+%.`.e"  B.X }Z * & & Z'}Z&7$ c[ '&¡+^.*2                                                        .& l+ ^ *.0cX.* &.

[ \ eXA ^_ `#   J K 59 9'8 <IhVixD  If.?/ @/ 8?=5 n9: 4MŒŒ09:...c &` `'}X }* +I'Z f'Ze"Z~* +IZ}X ]"› ^_ `›U'&` c` !  J K 59 9'8 <%h18/9:~J K 59 98 <m8'ƒ „i%D  If.˜c Zq*..c`.'&Y"%Ÿ `' X & xf'c &`  e ^_ ` !* Z?"!Z X Z}Z`?"(Z`.132 <i(D                                                        .&Af'c`..`'&   % *0Z'Z [ \ X.Z' ZzZ X  *'?"+IZ'?"% `&  J K 59 9'8 <%h9: 4WŒŒ09:.c &` `'}& ^ *.0/ @0=<: .%Ÿ ` X ... *Z0"%c!`.

(Ÿ `.(&` `'   ('&`  e ^_ `' '9 f Z0"!Z X ZmZ'`'0"!Z`. *. : 3<  2  J K 59 9'8 <vhVixD                                                        .[ \ eXA ^_ `#   .Z?"xc` ˜c ZAX '&` ..X.

%Ÿ ` X .&   .

ZAX./ : .. : 3< 2 8.. : 3<  2  8.'&~Z` ^`'.!Ÿ `'.4 <h9: 4WŒŒ#89: .4 <hVixD  ) Z X.~Xm ^_ `Id]Z` Z~Z&l+!‰+( .4.5 <=8 9i18/9:WD                                                        .<.X Z X &mXA ^_ `   !  ` ZmX.<.'&~Z` ^`'.& ‰c V"!xdn"(Z` *I0Z .4CS.& V c V"!xd{"(Z` *I0Z  .X.

3 ..3 ./~/ 80=5†D ” D 9: .. 5':.. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o .?/ @  5:'=<: . 132 <vhViC18'/9: o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.. ` j .<D ” D 9: ./C=<: .&     c [  & .?/ @  5: /8=5IhVi 18'/9: j .%Ÿ ` X .. `  )  ` 1 <: 357 ?F1 @?F:D/.132.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ . 5':.

.?/ @ #=Ii  ._3_      c[ & )  `   8. 132 <Ih9: 4WŒŒ9:.?/ @/ 80=5!i  8..4  5:'=<: .4  5: /8=5%h9: 4WŒŒ09: ...

&. 8:51: 5.).*.).4Œ W).“  a      .&ClcZ'&o*0Z& &&  B .& }c&`Zo*#Z&.) ” D -5/ 4.).

132.& && \[  ? S8 D1 &7 =1P:  jlbe j  k  X^  o 81 j-# 5[« :bIb B^¯g:aaH^                                                   ‘.^ *?Z.<r #= D ” X  Z& g$( Z&vd˜&.  P         j / 80=5 r /80=5†D ” j =<..: ..

8 9:.6 5/ 4 2QD ” D o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.?/ @ 0=<..234 5CE'J K59 98 <LRN(E If..3.'&mZ(?&qc * ..6 5/ 4 2QD ” If.<%E.:x6 6E 1.5: 8‚ J K59 9'8 < ‚!1'8/9: .3 : 8.6.i j '&.. 51'<. 132.5: 8‚ J K59 9'8 < ‚!1'8/9: .@ < 4 8E.6 6 5'/ 4 2D ”   ('&`   ^_ ` J K 59 9'8 <Œ.<0=> 39 . ‚4 5 “ <'32':E.: .6.Œ  J K59 98 <vhVi j 183.: .<ID 183.5 ‚1B.+ %*'#"o &0czbcZ0"%&?+xZ* ˜& `0Xvd +x'&.3 ‚8ƒ„...6 5/ 4 2vD ” D If.c &` `'}X }* +I'Z xfZ7"!ZA * ‰+I'ZCX} ^_ `Id7*' +v'Z}&qZ` ^!`'&ec#"(£"!Z` *v?Z J K 59 9'8 <QŒŒ‰J K 59 9'8 <%h18/9:~J K59 98 < m8ƒ „i j / 80=57r 8ƒ „L‘/ 80=5D =<.3 : 8.<i j c#"( $ .<i Œ / 8=5vh / 80=5iI =<.Aa?!& &  Z)'* +.0/1.&  % X V$xc[ \ X.3 : 8.. ‚!9'8ƒ ..5: 8‚ J K59 9'8 < ‚!1'8/9: .: . 5.& c * ..c &` `'}& ^ *.83‚8ƒ „.c &` `'AXV$!Z'I` ?&‰"m+IZ'0"% `. 132..<xh=<.?/ @/ 8?=5 y9:. 132 <xhE E.a#(& & Z  –c#"(   %d?"(Z` *I?Z- !bX c`0 AX~^# *' ) ) ) ~Xq*'c &``Md7*'#"!~ &`Z X mZ ^'Z 0U c#"(  $  "!Z` *v?Z$  183..Z' ?zZ X  *'?"+IZ'?"% `& J K 59 9'8 <QŒŒ‰J K 59 9'8 <%h9:.?/ @A/<=59B<1'5}9: 4QD x0c*gm}Zm0A`‰"oZCX  *?ZZ [ \ eXZ~*#Z'& &oa#(& &  Z -(. 132..132.6..5': 8‚J K 59 9'8 <E. ‚ 4.132..83‚8ƒ „. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.& m & Zo*`mX  ` -(.<Yr 8ƒ „LR=<..Z!'™ Z}&~Z` ^!`'.&7c#"(m "(Z` *I?ZC*'#"AZ *.0/1...:x6 6E 1.:x6 6E 1.: . .: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .234 576.: .Z '&eX Yc#"% "(Z` *I0Z J K 59 9'8 <QŒŒ‰J K 59 9'8 <IhViŒ / 8=5QhE E ix‘=<: .:x6 6E'4 59: .....V"Z a#(& &  Z .83‚8ƒ „.c?"(   "!Z` *v?Z $ '"!Z` *v?Z  183. 5.

“qJ23 /8 'N -4 5“. < 4 <IhVi j 183 :q66eES/ : . 5      P        0  a    _c_   8./5xh01. 5‚180=‚ < ‚ =<: ..?/5~J23 / 8 'N \[ 0 ?81S8 -#D1  X^ o j 5[ o E8 1 ]  5 ^ ­^                                                         ..< ‚Œ ‚!E 6 6y=<.V/  / 8=5i(D 183 :q66eES/ : .4 <Qh089: . 5‚180=‚ 8 ‚ /80=5WŒR‚!ED @ 5.'&   8.ZAX X.4AJ K 59 98 <QŒŒ‰S.: .“'/ 4 5.:2.132 <i%D ”   ) Z2/X.V/  =<: .4AJ K 59 98 <QŒŒ .<. 5 <= 8 9i18'/9: j 8 9e66eEs 80=5‚Œ ‚E 6 6¡/ 8=5}66Y5/ 4 2QD 8 9e66eE<: ....132. 132 <QŒR‚(ED @ 5./5xh01./ : .Z X..132.<66Y5/ 4 2D ” <: =7 <8 1 o g:] 3bIb ‰[ o ]  B^  jlbe j  k -(..:2.

Ca#.

cQ)                                                         ! ^.&}f f .`  *Z.vg.

.

234 576 “9:.234 5CE'J K59 98 <LRN(E                                                        f#Z'& &   . 5 <0=> -(.?/ @(>  Ic*‰ &\ n+%Z' Z Zc[ Z  -(.0/1.. -(.0/1.234 5769:..0/1..

›*?Z'&.&oa#.

c~Ÿ X  ZeXZq*#Z&.&oa?!& &  Z7 +!&c`Zl"›Z .X Z X %) Tq.ZI) .c XZ c &.X #$%c]&Y"xŸ ` X .& T c`Z X Z ) Z 'X.vg.

.3./ 8 Œ j                                                         .X  * 'cZY}Z` ^!`'}'Z Zm7&7"%Ÿ ` X &&.< 9.1mJ K59 98 < 1'2. `'Z.Z v) #  %   #"%XZ~*#Z'& &   x a +% Z'c[ Z    I{c#"(mXZA*?Z'&.Z'Id )  `Z.ƒ2 .&q^Z'&         0 `   ! Z # B.9J 23.

(` ^`& .

<:5Π.* &.& l+(Z X  B ..

X.(` ^`Yc'"ZYŸm*'Z.ƒ25.< <vD .ZA ^_ ` 4 8'3.X.l+xZ Z~*'Z.

823 /89%D .X.(` ^`C'&`'|`..1q.?/ :m/ 3'=5.c Zq*#Z'& & 9: <':. *eŸ}*'Z.

1~18'/9:›9:.&}C*'c &`Zc!`..9 .(` ^`eXZq*#Z'&.4 5vD .4 <.?/ @q3 /..  5. 9: <':.

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.3 ƒ2 .`.* &.X }Z * & & Z'}&7"xŸ `' X .&¡+^ *.& l+ ^ *.e" B.& 35? < 85:D? F7=7I857 1 ?>>> </ 8.1Œ o˜  ^_ `'˜+%.0cX.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .

 _3_c_  a      .

 P         Q                                                .

<..!`'AX #$!Z'I` J 23./ 8 h9:.?/ @?=<':../ 8 C8'ƒ „ixD xf'c &`.132<  4 83./ 8 h18/9:~J 23.(Ÿ `' X &qf'c` `''& xf'c &`.<}rl¤ivD                                                    .Z' ZzZ X  *'?"e+IZ'0"% `.!`'}X C* +I'Z J 23../ 8 h#i%D xf'c &`.& J 23..ƒ25 ..?/  @ / 8?=5 y9:..!`'C& ^ *.

X.(Ÿ `.   ('&`  e ^_ `' .. : 3< 2 7J 23./8 h#ixD ('&` `'                                                    .

<. : 3< 2 8.ZAX..'&~Z` ^`'.& ‰ c V"!Id–"Z`0. : 3<  2  8.4CS./ : .4.5 <=}8 9im18/9:WD                                                    .& ‰c V"!xdn"(Z` *I0Z .%Ÿ ` X ..4 <šh89: .4 <h#iID  ) Z X.<.*0I#ZdY'Z Z .&   !  ` ZeX '&qZ` ^`'.

 `   .%Ÿ ` X .&&.

4  5':.<.<.3 .(Ÿ `' X &   ` 4 83 ƒ2 5  5:.<7r ”  )  ` ./ .<i .<.<. 5':.<.<QD ” j    c[ & )  `  8.< h#iC18/9: j .<D                                                    .<.<¢h04 83 ƒ25 .

?/  @  5: 3 /. 82'3 /89bh#i j .  5.1q18'/9:›9:.%Ÿ ` X .* 9: <:.3 .“ \[  ? 48 @1 <8 1  jlbe j  k  X^  o 81 Bj-# [ o ]  ^¯g:aa­^                                                       g.&YT&`'|`.X ‰"›&b!* Z0"!Z X &e&‰"~"š ^_ ` Y&  +x./ 3'=5.3 . 5':.X ‰"~"(Zc +v?Z'~Z` ^`&&`'Z `. *&     c [ &}&`Z `.9 ..?/  :  5:.9 .. 5':.4 <..4 5ID ” D ” D -5/ 4../o3 /. 82'3 /89(D ” D 9: <:.  5.4 < 4 5šh#i j .1q./o/ 3'=5.*£+%.

CaV.

+ -(.v .234 576..8 9:.<0=> 39 .0/1.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .?/ @A/<=59B<1'5}9: 4QD o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8. 5. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.cv)'* +.

0/1.234 5CE'J 23 / 8MLON%E . 5  a       P        0  _c_  -(.

</ : <‚P <:<. 82'3 /89vD 183 :~66eE 1.<i .<hg¤QL ¤i j / 3'=5.%` ^!`'}'&`'|`.<(E]66 5'/ 4 2D ” If.4 <..&I) .<vh . 8 23 /89 6 6YE.ƒ25 Œ J K59 9'8 <Ih / 8?=5  0=<..<iI0.1032<  4 8'3./ 8‚%hE]6 6l/ 3'=5.c &` `'}X }* +I'Z xfZ7"!ZA * ‰+I'ZCX l"  ^_ `bU&`.3 : 8.5 ‚ ../ 8‚%hE 6 6£/ 3=5. *ŸeZ 0~0y+`.5 ‚!1 B.4 < 4 5.4 5YrqEt /!.i'‚!18'/9: ./ 8 ŒŒ J 23 / 8h9:....4 8E]66]5/ 4 2QD ”                                                        .c!`. 5@<.ZA`V"~" c * ..: . ‚!98'ƒ .c* lZA*#Z'&. 82'3 /89vD 183 :~66eE 1.../ 8 ŒŒ J 23 / 8†hVišŒ¡..  5.?/ @ ?=<':. ‚4 5 “ <32':!El66 5'/ 4 2D ” D If.132. 82'3 /89vD 183 :~66eE 1.. J23..<..&C˜c\ mZC ^_ `' y+! * & Ze&qX V$xcX mX  +% &oXZA*?Z'&.... . ‚  5.9 . 3 :8..?/ : J 23 / 8 ŒŒ‰/ 3'=5.3 : 8..<. 82'3 /89766eEi'‚!1'8/9: .83‚8ƒ „ 5': 8‚ J23. 51<.Z?"%c` ˜c Zq*c!` [ \ eX} ^_ ` J23.<QD / 3'=5./8 ŒŒ 3 /.8 2'3 /89]rl¤vD 18'/9:›9:.c &` `'}& ^ *. 82'3 /89766eEi'‚!1'8/9: ./<E!D If.?/  @ / 8?=5 y9:.<.4 5.9 .Z' ZzZ X  *'?"+IZ'?"% `&  * ^&..c &` 7 ^_ ` I9f Z?"(Z X ZmZ!`'0"!Z`  *..<.e0mZ.<i j / 3'=5. ‚ 4./ 8‚%hE]6 6l/ 3'=5.Z!™ Z X  J23.83‚8ƒ „ 5': 8‚ J23.83‚8ƒ „ 5': 8‚ J23.  5.<./ 8 ŒŒ J 23 / 8h18/9:~J 23 / 8m8ƒ„i›Œ J K59 98 <%h?8ƒ„i j .< 2‚ 4.?/ @ J 23.<7rC8ƒ „L0.<.

3'=5'./ 8 Œ./ 8WhVi j 183./ 8 9HHD ” D ! .X.Œ  J 23./ 89x6 6 5/ 4 2QD /.:%6 6E'4 59: .. 823.5': 8‚J 23 / 8WŒ?E6.3!.(Ÿ `.(&` `'   %&`  7 ^_ ` J23.03 ‚8ƒ „. 8  23.6 / 3=5'.

CXV$%c./ 8 ŒŒ S / : .&  8.X Yc&`Zo*?Z'&.<.4}J 23. Ÿ `.X.4 <IhVi j xf  Z?" Z .

!Ÿ ` X.4 <IhVixD ” R+%Z' Zoc!`Z X Z7Xec#"(£"!Z` *v?Z .~XZA*#Z'&. <.&o^'Z'& J K 59 9'8 <QŒŒ‰S / : .

X  * 'cZZ 7}0eŸXV$%c`. 5‚180=!‚ 8  ‚  ‚ 4. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.?/q>>e.& 183 :~66eES/ :..8 ‚< 23 / 8MŒR‚!ED 1 .?/ML @ 5':hVixD o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.< <D 1 .: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³  .]c&`'Zo*#Z'&.

 _3_  a      .

 P          .

X.!Ÿ `'./ 8 ŒŒ .<.8N k \[ Y  ?\1S8 -#D1 T8 <1 :D? E1  X^ o j 5[‡  g:j  5 Ij ^ ­^ Q                                                  ...X    8.“'/ 4 5.<C66]5'/ 4 2D ” <: =7 n8 E1 D? <1 o g:] 3bIb ‰[‡  g:j  Š 4j ^  jlbe j  -(.< <‚Œ ‚E 6 67.<.8/<..?/5~J  3 /1 .8N -4 5“.“qJ  3 /1 .4}J 23.<.4 <h?89: .4 <hV8 9i%D 8 9e66eE .AXV$%c.8/<.. 5 <=8 9 i}18/9: j J K 59 9'8 <QŒŒ .

Z&}ff>.~a  c* 'cZ'%) Q                                                  ! ^`  *.

.

.&  ..234 5CE'J K59 98 <LRN(E Ic*‰ &\ {+%ZZ Zc[ Z Q                                                 f#Z&.. -(.0/1.0/1. 5 <0=> -(.234 576 “9:.?/ @!> -(.0/1.234 5769:.

cZ'.cZ.&oa#(& & Z g+!&c`Zl"A$ c* .Ÿ X ZeXZ~*#Z'&.*#Z&.X Z X) T~X #$%c]&7"%Ÿ ` X &]Tc`Z X Z ) Z 'X Zv) .X l"!Ze c &.&ba   c* .

8¢Œ  j Q                                                  .3 ƒ2 ..9J  3 /1 .  X Z  X    v  ) ) #  `0Z!9# B..X  * 'cZY cX  * ? X'` .< 9. `     .X Z X £"%Ÿ `' X % &   ` cX  * ? X'` .8/<.X Z X  (d  `    c  X  * ?       ' X   .1CJ K 59 98 < 1'2.

(` ^`& .

<:5Π .& ]+(Z X  B ..*.&.

..X./ 4.ZA ^_ `  4 83 ƒ25š.8.1'5.(` ^`Yc'"Z]Ÿ}*'Z.l+xZ Z~*'Z.4 5QD  .4 <.X.K .43 :.

X }Z * & & Z'}Z&Y$ c[ &£+^.0cX.e"  B.* Q                                                  .& ]+ ^ *.1Œ  ^_ `'˜+%.*.&.3 ƒ2 .`.

.ƒ25. 1'5K .'8vhVixD xf'c &`......4 < 4 5r ¤i(D Q                                                  .'8'/<.!`'}X C* +I'Z J .!`'AX #$!Z'I` J .'8Ih18/9:~J  3 /1 .1032<  4 8'3. 8 43 :.?/ @ ?=<':.Z' ZzZ X  *'?"e+IZ'0"% `..0/4..  3 /1 .  3 /1 ..'8'/<.& J .8/<.8 m8ƒ „i(D xf'c &`.'8Ih9:...!`'C& ^ *.3 /1 .(Ÿ `' X &qf'c` `''& xf'c &`..'8'/<...?/ @/ 8?=5 y9:.

'8vhVixD %&`..'8'/<. : 3<  2  J .X.!Ÿ `'.!`'' Q                                                  .   ('&`  e ^_ `' .3 /1 ..

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.(Ÿ `' X & o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .

4 <h?89: .ZAX..X Z X  .&  .'&~Z` ^`'..4 <hVixD  ‰c V"!xdn"(Z` *I0Z   ) Z X.& Vc V"!xd{"!Z `0.4. 5  a       P        0  _c_    !  ` ZmX.<.4CS.'&~Z` ^`'. 5 <=8 9 i}18/9:D                                                   ./ : .<. : 3< 2 8. : 3< 2 8.*x#ZQdcX * ? X'`..

4 < 4 5Qh?4 83 ƒ25.3 :.4 <.K ..4 5 r ..4..0/4.15K .4 <.3 :.4.0/4.3 :.3 :.4.0/4.0/ 4.0/ 4.15K ..3 :..4 5D ” ” D -5/ 4.4. 8 43 :. 8..8. 1'5..8.. ` 4 8'3.4 < 4 5i j . . . 5':3 . 8.4 <.4  5:.4 < 4 5D ”  )  `  8.(Ÿ `' X &.15K . .15K . 8./ .4./ 4.15K .4 5hVi 1'8/9: j .“ \[ [ ? 48 @1 T8 <1 :Q? <1  jlbe j  k  X^ o 81 Bj-# [‡  gfj  Ij B^²gfaa­^                                                 g.ƒ2 5  5:.

“ <'32:El66Y5/ 4 2QD ” D If.3 /1 .132<  4 83....15K ... 8 43 :.8/<.Aa   c* .5 ‚!1B..0/ 4.132..8xh'18/9:~J .4.Z' ZzZ X  *'?"+IZ'?"% `&  * ^&.5: 8‚J  3 /1 . 5...8/<..X Z X A`‰"A" c * Z(™Z X ' J .3 :.4 8El66Y5/ 4 2D ”                                                   .0/1.8...()* +.. ..Z?"%c` ˜c Zq*c!` [ \ eX} ^_ ` J ...15K . 5.e0AcX  * ? X'` .8/<. 1'5K .3 :..'8'/<. 3 :8.@ <.4. .c &` `'}X m* g+xZQde*'Ze"Z~* +IZ}X ]"š ^_ `U'&` c`  J .234 576.3 /1 .?/  @ / 8?=5 y9:.8 9:. 1'5.4 < 4 5er 8'ƒ „QL.5: 8‚J  3 /1 .4 5hg¤L‘¤i j 183 :q66eE 1.c &` 7 ^_ ` I9f Z?"(Z X ZmZ!`'0"!Z`  *.5: 8‚J  3 /1 .8‚‚!18'/9: .cZ'.ƒ2. ..4 5D 183 :q66eE 1. 3 :8.8‚‚!18'/9: .8/<.'8'/<.4 5i j 183 :q66eE 1.0/ 4.<iI..3 :.4 <.4 <.4 <.0/1.c &` `'}& ^ *./ 4. ...+ -(..4 <.. 8 43 :.?/ @A/<=59B<1'5C9: 4D -(.. 51'<.'8 C8ƒ „i›Œ J K59 9'8 <IhV8'ƒ „i j .'8ŒŒVJ  3 /1 ..8.8/<.3 /1 .0/ 4.8. .8hVi›Œ£.1'5. 3 :8.234 5CE'J  3 /1 .4.4 5šh .4 <.'8ŒŒVJ  3 /1 .83‚8ƒ „.'8'/<.83‚8ƒ „.8xh'9:.15K .8‚‚!18'/9: .K ..0/4.'8'/<. .4 5i Œ J K59 9'8 <Ih / 8?=5  0=<. ‚(9'8'ƒ .43 :. ‚4 5..K .: .8LRN%E If.<!EY66l5/ 4 2QD ” If. ‚ 4.<0=> 39 . .?/ @?=<':..8./ 4. 5 .'8ŒŒVJ  3 /1 ..8/<.83‚8ƒ „.3 /1 .8/<..

3 /1 .5': 8‚J .X.'8QŒ?E]66l5'/ 4 2QD ” D ! .Œ J ..'8†Œ.'8'/<.  3 /1 ..'8'/<.!`' J ..%&`..3 ‚8ƒ„..3 /1 .'8vhVi j 183 :q66eE'4 59: .'8'/<.!Ÿ `'.3.

4AJ .&~^'Z& 35? < 85:D? F7=7I857 1 ?>>> </ 8.X Yc&`Zo*?Z'&.3 /1 .8ŒŒ‰S.X. Ÿ `.X CXZq*?Z'&.8'/<.&  8./ : .CXV$%c.. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\  +%ZZ~c`Z X Z7X7c?"(£"!Z` *I0Z  o 1 <: 357 ?F1 @?F:D/.4 <vhVi j o˜ xf Z#"!ZY"(Ÿ `.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .<.

]Y   _3_ a      .

<.  P         J K59 98 <ŒŒ‰S./ : .4 <vhVi%D .

8'/<.?/~>>}.8.K . 8 43 :. 1'5. . .8ŒR‚!E!D 1 .4 <.cZZ 0e}0eŸmX #$%c!`.lc&`Zo*?Z'&..?/ML‘@ 5':hVixD ”  .X * ./ 4.3 :.0/ 4.4 5D 1 .& 183 :~66eE'S/ : .8‚“3 /1 . 5‚180=‚ 8 ‚%.15K .4 <.4.4 5‚ 4..

8N -4 5“.3 /1 .!Ÿ `'.8/<.X    8..4AJ .. 8 43 :.X.“'/ 4 5..4 <. .?/5~J23 /8  3 /1 . 8 N X^ o j 5[ o E8 1 T8 <1 :D? E1 ]  0‡   gfj 5 Ij ^ H^ Q                                                  .0/4..AXV$%c. 8 43 :.8ŒŒ .<.4 5‚Œ ‚E 6 6m.4 <h?89: .8'/<.K .“qJ23 /8  3 /1 ./ 4. 1'5K ... 1'5. 5 <= 8 9i}18/9: j J K59 98 <ŒŒ .<.4 <QhV8 9i(D 8 9m66eE.8/<.4 < 4 5C6 6Y5/ 4 2QD ” <: =7 <8 1 n8 E1 D? <1 o g:] 3bIb ‰[ o ]   c‡ g:j  Š 4j ^ \[ U  ?81S8 -#D1  jlbe j  k  -(.

~a#.

 *Z&}ff>.Q  c c* 'cZ'x)                                                      ( ^`.

.

  &  & 0 `     ' c z O& -(.234 576 “9:. C & Zo^_ `'...8/<.?/ @!> -(.234 5769:.0/1.8LONxE                                                     f#Z'&..&˜$&`.0/1.234 5CE'J 23 / 8WLRN%E -(.Z}X & *d `'VZd) )  -(.&  . 5 <0=>         C   &  Z o     ^  _  ' ` .234 5CE'J  3 /1 .0/1..0/1.Z?" " 0& Z X.

&ba?.*#Z&.

3.8/<. #"( Z~*#Z'&.c&` `''&}˜" X &` `' #  x.ƒ2 ..& '&*0Z' * .ZCX mX.& *& +%Z Zqc!`Z X Zee& Z2/'X.'&Q) a‰"šZ‘z ./8MB 3.8 j                                                     g.8/<..1CJ  3 /1 .c &š*.cI) a‰"~"~c V"!xd "Z˜"(Z` *I0Z%) T"xŸ ` X ..‰ c   c* ..mg+('&c!`'Zl"A$ c* c|'}0eŸZ .1J 23.9J23 /8  3 /1 .X.8WŒ B.ƒ2 .cZ'.< 9.Z.X '#     x0V"% Z Z'c[ Z    x ) ?z cX Z Z'c[ Z 1'2.&A^|.

ƒ25b.3 ƒ2 .CX y+x ^'™ Z 4 8'3.1Œ                                                      .*.& x0cX .%` ^!`'.#B†D B.

3 /1 .%Ÿ ` X ...'8hVi%D                                                      .!`''& J 23 / 8 .'8'/<.&~f.c`.

(Ÿ `.X.'8QhVi%D                                                      . : 3<  2  J 2'3 / 8 .3 /1 .'8'/<..(&` `' ..

%Ÿ ` X .&   .

<.Z'&b*0Z& &&C^'Z&}Y& \ X *0Z'Z X .4 <Qh9: 4WŒŒV89: .4 <hVixD . : 3<  2  8.X V$xcX .: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .& (X 0‰"›&A.5 < = 8 9 i}18/9:†D o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.. 4 ./ : .(Ÿ `' X &`0Z '&mX..&%) .<. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/. : 3<  2  8.4CS.

X Z X (  # Zc[ Z " I`.ƒ25  5':.4  5':.?B†h?4 8'3.. 5  a   @[     P        0  _c_   8.“   ./ .0BMD ” 4 8'3.0B!i j #.0BMhVim1'8/9: j .g+M?Z \[  ? 48 @1 <8 1 T8 <1 :Q? <1  jlbe j  k  X^ Z o 81 Bj-# [ o ]  0‡  gfj  Ij B^²gfaa­^                                            .#B†D ” ” D -5/ 4. Br .ƒ25 . 5': 3 .

~a#.

'8†ŒŒ‰J23 /8  3 /1 .83‚8ƒ „....5: 8‚J23 /8  3 /1 ..3 /1 .3 ‚8ƒ„..8LON%E J 2'3 /8.4AJ2'3 /8 .8 9:.?/~>>.5': 8‚J 2'3 /8.'8'/<.?/MLg@ 5':hVi%D ”   Xba#.+ -(.0/1.8'/<.8/<..3 /1 .3 /1 ..5 <ŒR‚!ED 1 ./ : .4 <IhVi j J 23 / 8 ŒŒVS.234 5CEJ23 /8  3 /1 ..#BD 1 .0/ 4.'8WŒ.8hVi j 183 :q66eE 1..'8'/<.3 /1 .8/<.8/<.4 <IhVixD 183 :q66eES/ : . 3 : 8. ‚4 5.8WŒŒ S / : ..Œ J2'3 /8 .?/ @A/<=59B<1'5C9: 4D -(. 5.'8EY66l5/ 4 2QD ” D  8.15‚ 4...'8'/<.5 ‚ B8ƒ ...<0=> 39 .0/1.234 576.8‚18'/9: .8'/<.3.<. 5‚180=‚ 8 ‚!.3 /1 .“ <32:E]66]5/ 4 2QD ” D %&` 7 ^_ ` J 2'3 / 8 .. < 4 <IhVixD J  3 /1 ..8ŒŒ‰S / : . <.8QhVi j 183 :q66eE'4 59: .‰ c  c* cZ'x)'* +.8/<..

*x#ZdYZ.Z aV.~* Z#"!Z~c#"% "(Z`/ *I0Z T c!`Z X ZeX ˜c V"!Id–"!Z `0.‰ c  c* cZ'- VTc`Z X Z    ) ! [ \ {+%Z Zec\.

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\    o 1 <: 357 ?F1 @?F:D/.0cQ)‰z `  35? < 85:D? F7=7I857 1 ?>>> </ 8.vg c  ?T c`Z X Z .X Z X > *. *'#cxž ž‘8 +  *.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .*.X Z XX]$ c* 'cZ'. *'#cIžžCcX  * ? X'` . wC™& T c!`Z X ZeXqcX  * ? X` X Z X  *' `  VT c`A*'#"o~cX * ? X'`.CX y+x^™ Z..0cQ)‰z `   o˜ T c!`Z X eXqcX  * g+I ^™Z ‘+  *' `  VT c`A*'#"oCcX .

]U  _3_  a      .

4AJ2'3 /8 .  P         #   ) Z2/X.:..4 <h#8 9i(D J  3 /1 .8/<.5 <= j J 23 / 8 ŒŒ  <.4 <Qh089: .7Z  N: C7>?F: : ^ N: 4* 1S857L8 :R: N: F7 9: </.7 2: Q1A351 O?F1 @?F:D/.<...4 <hV8 9 ixD 8 9m66eE . 5  < r ‚Œ ‚!E ” 6 67.Z}X }X.8WŒŒ .8ŒŒ .<.7.: 357 <3T: ][ -  ?81S8 -#D1.Z  N: 7>?F: >: ^ 8 N:   a] 7 8 9im18/9:  j e 3m ~a Ygf] 3b4bM ck  g W  Be jM]lj ]$e jMa] B^¯g:aBa 3brgf] 3b4b :b ng:j " nb:^ jlb4eIj  k X^  o j Ygf] 3b4b   g & B]Me jMa] X^²gfaa­^                                                            g.'&   8.15‚ B8'ƒ .?/ 4.#B~66Y5/ 4 2D / <7K/.Z X.3 /1 .8'/<.

'&~&~Z& !X A*.6.?/.?/ :7=<..[ Z(  ) I0l} & Z) 39 .234 5CE'J 23 / 8WLRN%E -(.6 5'/ 4 2QD 9: ..<=< ‚5.&o^'Z'&() J K59 98 <p˜B 8ƒ „rs't u uD T&`.0/1.0/1. 5.'8ML L L L L L L L L L L L L L L‘ˆ €/(E 6 6YE'J 2'3 / 8 .234 576. 5 9B!i j 1'< 95m¤QŒ xfZC ^_ `›a#!'& & Z B 8ƒ„ere/ 5'ŽCJ K 59 9'8 <IhVixD ƒ .?/ @A/<=59B<1'5}9: 4QD j .<'’†D 1'< 95o‡(Œ xfZC ^_ `›aV.0:10NMhV.?/ @!> -(.8LONxE -(.?/~>>l..234 5CE'J K59 98 <LRN(E -(.. 5.0/ :}. 8.3 /1 .+ vc* & \ eX C` X. 5 90Br ¤ID 4.0/1.8/<.N<D 1 .<0=> -(....'8'/<. 5 <0=> -(.?/ML‘@ 5':hVixD If'Z7"+Ic!`.?/ @2.?/ h#i 183.'8 L L L L L L L L L L‘ŠŒ €/xE 6 6]2 .0/1.:x6 6E€ < € / K .0/1.0B 8‚ 4.@ .. 7&‰"+!AZ +%c`Z˜+%ZZZA*#Z'&. n+xZ ZY"š ^_ `Id +%.3 /1 ./ 8 L L L L L L L L L L L L L L L L L L L L L?‡€ /(E 6 6YE'J .'8'/<.234 5CE'J23 /8  3 /1 .Š!E.?/.X e&"  +x'c`.234 5769:. -(.?/.8†LON%E "Z 0c)'*g+.!`0 ZeX A*'c`! 90Ž.‚ 4.234 576 “9:.Z ^ .8 9:.0/1.234 5CE'J  3 /1 ..N< 6 6YE  5 2  5  8.N < rEH H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H#€#/(E D .8 ‚ :.5 ‚8ƒ „ 5': 8€'/€ <E 6 6YE'J K 59 9'8 <†L L L L L L L L L L L L L L L L L L L L ¤ € /(E 6 6YE'J 23.8 j 183 : 6 6]2 . 5 9BD 1 .0/1.8/<.

O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o a?!'& &  Z7m" aV.vg.c o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.

: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .vg c 1 <:M357 ?F1 @?F:D/.

5.'8'/<./ 8WhVi%D ƒ . 5  a       P        0  ]Z _c_  B 8ƒ„ere/ 5'ŽCJ23.<'’†D 1'< 95mŠQŒ xfZC ^_ `ša#.<'’†D 1'< 95mˆQŒ xfZC ^_ `ša  c* 'cZ' B 8ƒ„ere/ 5'ŽAJ .'8vhVixD ƒ .. 5.3 /1 .

Q  c  c* 'cZ' +% ^& _ $lc! a?.

0“h‰B 8'ƒ „ Z 0¡+%ZZ~^Z 0U & Z xaV./ : .u!i .<.4 <hVixD B <“†L .cZ'..'87B <.‰ c   c* .4 <Qh183 :(i(D ” ƒ . 5.  j J 2'3 / 8 .<'’†D ƒ . 5.WL0El66Y5/ 4 2D ƒ . 5.“ <'32':Œ ” 183 :~66eE€ /.3 /1 .'8'/<.<'’†D j Rr}s't u..<'’†D 1'< 95H ‡Œ 4 5.“QD B <“†LgS.<.<.

<. 5 90B 1 .N.& .4 <IhVixD B 8ƒ „IH > .uD ” aV&.[ \ eX~`g+%mX m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV. +W0ZYc"Z            0'ZcX'w1#"%* ~ k  Zc*'Z w 0+I!#"!$%&0"(x  .?/WL @ 5:†hVi%D .cIda   c* . +W0Z!3 b) %   zZ0"!Z} ..Z ‘+%Z Z Z'c[ Z "v`.A& }*' Ž. 5':3 .cZ.                                                               ) .5hV.Zxd  rqH ‡'ixD ” ” +% ^_}&V"b& Z ^.2.g. 2Z'c*Z0"v`. B 8ƒ „IH> S / : .X Z X &            & mXq*'c*   `7X y+I!V"!$x&"(  & mX m ^'_ `&A*#" Zc[ Z  " v` g+W0Z ) Z#/'X./~¤ID   .4 <h183 :i%D 4 5 25': 5}B 8ƒ „D B8ƒ „erms't u.<.

g.cZ'.v) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.cW) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )k a   c* .

cZ'. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.) ) ) ) ) ) ) ) ) )V                                                                o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .‰ c   c* .

 _    a      .

Z .  P         : *' ^_ `a?!& &  Z}*'c &`.!`''~X #$!Zv` T c`0A*'#"o7c#"( –c#"(eXZ +I& & .Z T c`0A*'#"oZl"!Z` *v?Z( k k k k k k k k k k k #"% {c?"(XZ +I& & .

A ^_ `ša#!'& & Z                                                               ) .[ \ YXq` +x}X m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV.!Z` *I?Z k k k k k k k k k k k X&`.

) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.g.c†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )0k a   c* .cZ.

!`''~X #$!Zv` *' ^_ `aV.‰ c   c* .) ) ) ) ) ) ) ) ) )V                                                                k *' ^_ `a?!& &  Z}*'c &`.cZ'.

c V!k *.c &` `'AXV$!Z'I` T c`0A*'#"o7c#"(  .g.

cY$I#ZcAX A`Z T c`0A*'#"oZl"!Z` *v?Z. w w w wkw T c`0A*'#"o .g.

c   #"% –.oXCZg.

g.cY$I#ZcAX A`Z .

Z  X&`.!Z` *I?Z w w w wkw 'Z.A ^_ `a#.

A ^_ `ša#!'& & Z                                                               ) .[ \ YXq` +x}X m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV.vg.c #k X&`.

c†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )0k a   c* .g.) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.cZ.

!`''~X #$!Zv` *' ^_ `a   c* .cZ.X Z X eX]$ c* 'cZ'- :). .) ) ) ) ) ) ) ) ) )V                                                                 w *' ^_ `a?!& &  Z}*'c &`. T c`0A*'#"oZl"!Z` *v?Z wQ0  X&v &` T c`0A*'#"o~cX  * ? X'` .cZ.XZ.X' Z.cZ'. #"%  c* 'cZ¡+%Z.y+%Z.`'~X V$(Zv` T c`0A*'#"o7c#"(    c* . *c&`.‰ c   c* .

[ \ YXq` +x}X m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV.A ^_ `ša#!'& & Z                                                               ) .A ^_ `ša   c* cZ'(  X&`.!Z` *I?Z w  X&v &` cX * 0 X!`.X Z X :)  X&`.

c†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )0k a   c* .) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.cZ.g.

!`''~X #$!Zv` *' ^_ `aV.) ) ) ) ) ) ) ) ) )V                                                                 *' ^_ `a?!& &  Z}*'c &`.‰ c   c* .cZ'.

 *c&`.`'~X V$(Zv` o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.c V!k *. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.c &` `'AXV$!Z'I` *' ^_ `a?!& &  Z}*'c &`.g.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .!`''~X #$!Zv` *' ^_ `a   c* .cZ.

 5  a       P        0  _    *' ^_ `›a?.

‰ c   c* .A*.c&` `'AXV$(ZI` T c`0A*'#"o7c#"( '&eXZ )  Z  c* cZ'£.cZ'.

c T c`0A*'#"oZl"!Z` *v?Z- • • • • • • • • • • • • • T c`0A*'#"o .v .

c  • T c`0A*'#"o7c#"(  '&eXZ )   Z   c* cZ'£.qXCZg.

 ].c7 T c`0A*'#"oZl"!Z` *v?Z- • • • • •  T c`0A*'#"o~cX  * ? X'` .X Z X mXl$ c* 'cZ.* CX y+I ^™ Z ]) #"% &XZ )   Z   c* cZ'e˜.v .) '  T c`0A*'#"oA0cX .

c .v .

!Z` *I?Z • • • • • • • • • • • • • 'Z.Z • #"% &XZ )   Z   c* cZ'e˜.

v .c7 .

!Z` *I?Z • • • • •  cX * 0 X!`.£+I ^™ Z $ ¡2 k :'      X&`.~ ^_ `›a#.X Z X :) .  0cX .*.

~ ^_ `›a   c* cZ'(  X&`.~ ^_ `›aV.‰ c   c* cZ' X&`.~ ^_ `›a#!'& & Z X&`.

[ & d£Z~c* & \ 7XZ£+xZ(?Z' ZC* Ze`0Z( ' cZ'& Z'c[ Z.&mX ~aV.c  #k X&`.*Z.~ ^_ `›a#!'& & Z #        ) Z#/'X.Zew.vg. +W0Z]`0Z!          f #"šZ +IcZ'&mw7" X ‰$(. ‘+%Z Z Z'c[ Z˜"v`.

vg.cAAa  c* 'c|'7 +!zZ?"!ZY& ~*Ze~a?!& &  Z]"Z7™x) .

&7"! XV$x *Z [ & Z'c[ Z]c"!Z ]*#Z&.&›aV.

&›aV.vg c +^0 *oa#(& & Z Z'c[ Z]`0Z! £*#Z&.

*a#!'& & Z Z'c[ Z]`0Z! £*#Z&.[ \ eX~`g+%mX m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV.&›a  c* 'cZ' +^0. 2Z'c*Z0"v`.*a#!'& & Z TCZecZ& Z#/'X.                                                               ) .&›a  c* 'cZ' y`0Z! +^0. +W0Z!3 b) %   zZ0"!Z} .ZAX¡+(zZ0"!Z      0'ZcX'w1#"%* ~ k  Zc*'Z w 0+I!#"!$%&0"(x  .vg c n`0Z! +^0 *oa#(& & Z Z'c[ Z]c"!Z ]*#Z&.

cW) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )k a   c* .v) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.g.cZ'.

!`'CX #$!Zv` *' ^_ `aV.cZ'.) ) ) ) ) ) ) ) ) )V                                                                 *' ^_ `a?!& &  ZC*'c &`.‰ c   c* .

c &` `'AXV$!Z'I` *' ^_ `a   c* .c"  V!k b*.`'~X V$(Zv` *' ^_ `›a?. *c&`.cZ.g.

cZ'.‰ c   c* .A*.c&` `'AXV$(ZI` T c`0A*'#"o7c#"(  .

X x  .

•   • T c`0A*'#"o . cX' Z V"x T c`0A*'#"oZl"!Z` *v?Z.

qXCZg.c8  –%)#   T c`0A*'#"o7c#"(  .

X x  .

cX' Z V"x  o˜    35? < 85:D? F7=7I857 1 ?>>> </ 8. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .

 _   _    .

* CX n+I ^™ Z l) #"% –.           T c`0A*'#"o~cX  * ? X'` .   T c`0A*'#"oA0cX .X Z X eX]$ c* 'cZ'.  P        a    T c`0A*'#"oZl"!Z` *v?Z.

X x  .

cX' Z V"x .

!Z` *I?Z –          'Z.Z x)V>   #"% –.

X x  .

cX' Z V"x .

X Z X   0cX .A ^_ `ša#.£+I ^™ Z $ :) X&`.!Z` *I?Z –          cX * 0 X!`.*.

‰ c   c* cZ' X&`.A ^_ `a#.A ^_ `ša   c* cZ'(  X&`.

c #k X&`.[ \ YXq` +x}X m ^_ ` a?!& &  Zv) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ): aV.A ^_ `ša#!'& & Z                                                               ) .vg.

) ) ) ) ) ) ) ) ) ) ) ) ) ) ) w a?.c†) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )0k a   c* .cZ.g.

:.:C: 5?F7 F7 2:D3T: 8 >: 351C1 :D?8148 -#@1 /A:Q7%7 E7 : =7 @8 <?  1 :Q?\1S8 -#D1/A:Q7%7 E7]* 7 D1 <8E3T: F?F8 B7 T:D?F: >1@/ <: Q1A351 O?F1 @?F:D/. 8.g Sa j na  3b  j Sg ajl] ] fb4e 3b]ljMb4e 3k  cb ] a  3bO]Mjlb4e 3k j  3brj  gf] b cb4e ng:j b4e m  4j 3a fb{a fb  e ~g e C« 3b 4e Xe jl]Mj  « ck  ajl] 3m 3m {a Bj cb{a ck j   ] rb :k 3b 0_ Aj  "^ Bj :^ g:] cb b "^ jlbe j  k X^ o j ] ‚a Ig Mg:j cb 0_ ^ -Yt=b<.7 F7 a Y:D? F7 V * ?F1 @?F:D/.) ) ) ) ) ) ) ) ) )V                                                                0k ) Z ) #  !.8l=<’ 5 “.573=qB .  <Y<@5.: D1 5:D?2:   8&5b ^ : #@1 . : Q7%7 E7 5:D?2:L7D&B7K? V E1 07ZV*O7Z *O7Z   cb 3b b .3.‰ c   c* .. < .<=< -mP <4 <C<.3. 8Y/ 80=5LRN h4 512.Z [ \ 7mX '&`..` Z14357 K1@/ <:D?&: 2: @7 *: </. <  874.5m<3 :8=<. . .2.<..@ .cZ'.Z X &mk˜™  * ^& e0£"(&"q*'#" Zc[ Z¡ " I` +†?Zd7&`Z£+X cX  Yc#"%]Z˜"(Z` *I?Z˜w}™&Q) #      V >7 ?=7>/R1 1 8 F1 357C:D?\1S8 #@1 G/.[ \ !) f#"oZ Zc[ Z  " v` g+W0ZYc'"Z &qZ` ^!`'&ec#"(  "(Z` *I?ZC Z#" *Z X &lwm™& f#"oZ Zc[ Z  " v` g+W0ZY`Z(n&qZ` ^!`'&ec#"(  "(Z` *I?ZY& \.q*.* Z  * ^& lZ}X ‰"šX C*.: H7ZL7L7Z a E8<3O1 : Z7 : : 2: @7 b \[ V  8? 1S8 -#D1R/..:D7D7 <7 1 F7>? <1@?=/.

.8Y/ 80=5L#10B B -mP <4 <C<.'2 < 8 H H H.@ . 59 i75 9: <~2 .?/ L 8ƒ „  o 1 <:M357 ?F1 @?F:D/.. <m@ 5'.5o1'8=B. 89˜/ 8=5†Lg8'ƒ „A9  8C<.'2 < 8 h‘=<.3. 87/ 80=5L‰8ƒ „ -mœ. 8Y/ 80=5L?10B BA4 5'B 8.B~i o˜ €H H H H H H H H H H H H'>P 8=B!. <=<:. <'. -eB <'.. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ H H H. <73=›<.?/ L#10B.2.<@ .1<=5/ :5Œ - h <LON <LV1B.>–=<.B~i - h‘ƒWLON YƒWLV1B.8@ .< 4 87@ 5. .0@ <4 8C<Y3=b<.'2 < 8 H H H.0/ ’ 5'. .. 3 B< 4 89˜B 5 28~2 .. 3!.B~i €H H H H H H H H H H H H'>P 8=B!.  5.94.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ .989Y<. <=<m5 513 :   5 2 -mœ. 3!.}8B .>–ƒWL 8ƒ „ 35? < 85:D? F7=7I857 1 ?>>> </ 8.>y<L 8ƒ „ €H H H H H H H H H H H H'>P 8=B!.3.

0/ ’ <@5= €  L =<. 5      P        0  a   _  -    u.?/ L 5.

.8/<.  5../1.874./ : 5.B   'S J  lr J 23.. 3..'8'/<.“.5A<.  . 3.8†L#10B.8  }  5 9: . 5 - -S  5=B2..  .8}5?=  39.8/<./ 8ML#10B B J23 /8  3 /1 ..5b.'8Lg8 J  3 /1 .'8'/<.B J K 59 98 <L#10B.  89£4./8ML‘8 J 2'3 / 8 .9m..3 /1 ..3 /1 .23 4 5  @  œ  S J ./12'3 4 5]4..B J .'8QL#10B.8L‘8 J K 59 9'8 <L‘8 ./<9  t  ]rmJ23.5 - <.  8˜=<’5.2..

 .

98'3 .0/1.1'5 œ  P.234 5mH 0N5 <.ur œ  S  J .  .CH.  .0/1234 5  @  }H   39. s P u't œ Ser  -H   39.4 5.

 .

 u  rH 2#= P  Ku œ .

'  3 ƒ ..0/<9 < 2.8:.ƒ ¤WŒ< 2 2m5 513 :<7: 84 <9< 9 93 ƒ .9m2 .2Œ8ƒ„} 5 ‡l 5 .?/ N < 9C<ƒ<.3.2. 8.:.  8b59B51 ./<9 ./<e8ƒ „†Œ P 8=B.<78 9  t     8ƒ „†Œ Ih t   i Ih?P  K u œ  i7H 1xh  t    ixh#œ S J .Š . r]@   .:. 8.ˆ} 5 . 1'<=~< 99#3ƒQH.“.

   s P ut œ Si -(93 ƒ ./<e5‡IŒ @ 5'.:. 8. <~5 513 :   5 275‡ 5 ‡xŒ Ih  'S J  i Ih?P  K u œ  il5 ‡H 12'< 99xH.

Bxh  S J   i Ih?œ  S J    s P ut œ S! i Ih?œ  S  J   . 5.. <'/1'<L?1B.

ˆŒ Ih  'S J  i Ih?P  K u œ  il5ˆIH 12'< 99xH.:./<e5. <~5 513 :   5 275. 8.ˆ†Œ @ 5'.ˆ 5 . .u  !i7H'85 ‡ -(93 ƒ .

V=8. <'/1<%H5H K 8 2. 5'..9?=8QL#10B Bxh  'S J  i Ih?œ  S J    s P ut œ S! i Ih?œ  S  J   . “.

u  !i7H'85 . <~5 513 :   5 275.Š†Œ @ 5'.ŠŒ Ih  'S J  i Ih?P  K u œ  il5ŠIH 12'< 99xH. .:.Š 5 . 8./<e5.ˆ -(93 ƒ .

32:.<QLV1B. 5'.BIh   S J  i Ih?œ  S J    s P ut œ S! i Ih?œ  S  J   .B2. <'/1<%H.

5.: 2: @7K/ K1@/e: F:<35: @7>?F:D3T: 7 N: D7 &B7 K8 D1R351 5?=1 @?F:D/A: /A:Q7]*B1 F7K?8#D7L1S857 .=bpxL 8 .u  !i7H'85 .=o 5 ‡]5.ˆC5.7 D? <1 \[ - .</ Œ .Š V 7XWF:L: =7 @8 <? 85/.Š 1'2.d1D?2:D/ E8<3O1 K1@/. .

: D1L7K/@6 a cb4eIjl] ‚« ck 3m h³‰³ .<4 <}4.cO:<35: @7>?F:D3T: Z7 <1 /.8q18=<'/ 4 8£=<'’ 5 r r r r r r r r r r r r r r r r r r r r r r r ‡i 3</ 4 8q5 513 :8 =<'’ 5}5‡ o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <: 357 ?F1 @?F:D/.:D7D7 <7 351 C7'&B7>? ‰ <1 07ZV*57Z *T7Z   ij  }b :k Bj t]Mjlb4e 3k g:] cbSg jMb4eIj   k e'Š g }b }k }a :] :g m =a ck c\b 4j cbf^ .^ W_ }k =a f] ] 3b Ig lgfj cb c_ ^ .

_    a      .

8m/51'59 9. <'.<9]B <'.. 3!.“.8@ . 1'<e< 94 5B5/ 4 5/1 .  P         ˜=<'’ 5 5..<=<Y5‡y18=B!.89 '3 5~9 . <m@ 5'.C8B .'2 <e8 9e<.

J 23./ 8† J.'2./1 .  8 '3 5e8]=<'’ 5  <.8 ‰J K59 98 < 54 5B8..8@ .8  J2'3 /8 .8m39<e8A2 . <'.3.<..}1'8=B!.'89˜5}5/ : .?/ ’ 5'. <}@ 5.8'/ <.C8B ...9x. 5˜/ <o9<4 <~<ƒ <.AB <'.3 /1 . <=<e5‡xL 'ƒ9'5..9C 5 ‡ 1'2<9..8'/ <'..

. 89]pILg8 5 513 :8'3}4.'8QL‘8mJ  3 /1 . <'/1'<L?1B.B @   H1H'8J .  ..8L?10B.0/1..2.4 5..  8=</ 4 5.L h?9 }.'8L?1B.. <m/51'59 9.8/<.V=8..<C@ 5'...<'/ 4 8]8B ./ 8ML 8 J23 /8  3 /1 .13 .'8Lg8J 2'3 /8..3 /1 .0/12'3 4 5   @  CH   39. </1<xH5H K 8 2.3 /1 . 51'8=B.8/<..<'/1'<L#10B. <4 8A8 9m<.8L‘8 J  3 /1 .}H   9'83 ..  ../ 8WL 8J23.L.BC@5.8<ƒ<..8/<.83A< '3.234 5 H N5 <. H  5. 3!.8QL 8 J K 59 9'8 <L‘8CH   39.8@ .L.3 l=<'’ 5C5‡ @   H1H'8J23. 5 ˆ=5.q1'8=B.<..'8'/<. 5': 8C8Y@}5 ˆ 1'2<9.2.2#=›H8}5 ‡ ˆ i s 8A5  5=B2.9?=8L?10B B L.28 '3 5}5'.15oH.3 /1 .B @   H1H'8J K 59 9'8 <vL 8mJ K59 98 <vL?10B B @  } 5 ‡ 1'2< 9 9( H  5...BAJ 23.9xH  5'. <=<e5‡xL <'/4. “.'8'/<.8@/./ 8ML#10B B @   H1H'8J 23 / 8 .'8'/<.8e5'ˆ y180=8C„ N <.

ˆ 1'2< 9 9(H.ˆ @  }  5..8@/. 5 ˆ=5....'8i <'/4.13 .3 l=<'’ 5C5..

8'/<./ 8WLg8 J2'3 /8 .BAJ 23..8L 8 J  3 /1 .  .8QL 8 J K 59 9'8 <L‘8CH   39.0/12'3 4 5  @  H   39.  .}H   98'3 ..ˆ o˜ 35? < 85:D? F7=7I857 1 ?>>> </ 8.#=8.K8 2.: D1L7K/@6 a cbe jl] ‚« ck 3m h³‰³ . 9#=8QL?10B.. 5'. O? 4d 4e  = ‰^¯] aBe°^ ±bIgn^²\ o 1 <:M357 ?F1 @?F:D/.8/<. </1'<xH5H..0/12'3 4 5mH N5 < 4 5. “..15oH 2#=H8m5 .3 /1 .

  .

+<+= %$6/ > " :8+) #$)(.@7A!? B EGF H =)CEDEFHGL= II= =SE C?DF= C CKJ HN?DC3ELC 3/$6+)$ #6$ .$ & *  '8+ t ! !T #6 1Q". .           !  #" %$&$'" $)( *  .g rb }a :b 3e ne jla j  Ij 0e cbf^ ‰b Bg:j 3g :b4b b fe 3b=b 3]lk jlk :b4g  c\ 3b 3b fb 0e ^ c\ o ~a za cb e fbIb fb g ygf] 3b4b 5a] 3] ~j 0e Be o  g nab ] m  3b  0e '^ ‚e jMa \]ljMg cb 0e j © ck g nab ] ne e g a }g dfe 3jlbf^ 4j cbf^ jlgfj {a cb4bIjM\jl]Mj  e .8( (& 2 $7y+)!+ .". !$6+O 5 %(.GUTWV :b Be jM]lj 3g fbIb Bb 3be b 24Q 5d"e .8dx".g Ba a Ij a c\ ªa 3jMb a 3e fgfe "e v . )$ Q[ #G$ .g ªb )a B\]ljMg '^ cbb 3bxg cjlb 3b:^ /0/ Z jMk a Be cb e yg nb n]lk qa \]ljMg cb XKMD g Bb a 3g :b4b EF@.2O #85O.+7 2$  m $ 68+7 8$n$6 :2O #8(.8w(. .8#  . :(.O %(.$P!+ +78O #2E01Q".+S$ V[ #$T(.0"O V %*p+ #$V(. !$6+S$T2O > " :8+)!O #$T($T+7 +)$ c-2" 9  .$ # #2(-Y ! " #$ T$ Q[ #$ \( $-(. *  5b  ) 6"O T$ V[ #$ $-(!+c  !O N72O   *d".+e * :$6O. 2 G€9 EF2"> "G€9 /0/1 =@ > /0/ 2 )N G€9 =@ 6"7 :9 > _  < 4TWV b \ f] xb cb cbhb ba ck 5J fbIb 3m b jlk ~d m =gf] 3b4b 3^ 3@.g =b 5jMk {b c\ fe b fk j ^ cb4b :g:j e {g t\ /0/ b 5a c\ dfe yb cbSb 3a :b 3b ne Ijl\ 0e G ­@.~€*‚ƒ|„‚†…‡{!…ˆ8{N€‰6ŠŒ‹ƒ `Ž)‘ V’j“8”:’8• ‘ ” u`rŽ’ )†‘L’ ˜†’ ‘  u – V’ ‘  u #’}— ˜ ” ‘ — —m™ ” — —}u u r’ †’'šj’  u r’ V’ ‘  u #’}— `Ž)‘ ‘E˜ ” ‘ — —}u ˜ ” ‘ — —w› —}uv“ u ˜ ” ‘˜ ‘ ‘ V’ )‘L˜ ” ‘ — —}u ‘8 œ“ ‘ ‘ —}u V’ 6žQŸ:  vu ˜ ‘ ” ‘ — —U™ 4 8 0 u  u ” V’ ¡’ V’ ‘8 œ“V’ o  g a  :b  e WYb g :jMe  4j fb4e ‚g 3a a $e ] b {g:] nbIb fb c\Xe  3j  .$ W$ !$8+]O$6+7^$ V[2_^ *#6$ .g ‰j ª6"7 :9 XKMD 2IQ cb -g:] nbIb fb jlk )g:] nbIb Xe nb:^ 5d"e "7C2 "7A2 YLN YLN .$ /.k !2`" $l(.~#.*.$ !"hO 8$ #2+c ! $i "." >8(.2+ 8$)$ !" m8+ 6$ q r[s  6" %&$ .` :O . 2" %(-( 6$+*3#6$ .` \( $-(U 2 #8H$ H  " #$ 5U+ $-($ `(%7.+7 *  *Q+ #$V(.0$6+78 1Q".$ )( $ .R(." #$ /U+ $-($ ! N$+* !+ .` M".1V" W$ #6 * X .$ 9O 8$ a !$ 9(l"+=T$6" ## *  zj{}|.O 8$l W$ :(.+ .O :$8O.0$ 2+48+ 6$ &-2+ %$. * #V# 95.g j cb f] 3gfj \b N /0/ Yb4e yd dfe b ‚a b .U 6".2 8$M ! #8'$K1Q".`  !$ !" ... 9( #62 # *  ?.$w$6G" .0$8+7 poH G #6$ .$ 2$6+)$ a !$ 'O.N(. ".+ $-(.f +g(.)+) +=X . #N #ZY=$8" X .0 % (12+43 53/$6+7$'" #89$ 2$ 2 $7(I.8+72O #$ +7 :O %+7+$ * !$8+7$ L . > # *`8$ 2" W2O W $6 + 8+ 6$ 2" $-(.'(.0".0" - .$ 6#N+=8($6 :O ! 8(." \Y  #$ * #6$ .` !+]". 2 "7 &2FG .0 : ( .G€9 /0/1 3bIb . #6 vu *Qw+) +7 .g yd a .GUTWV 2 "7 &2FG Bb Ib nb˜gf] 3b4b :bf^ 3]Mj Be 3b "e cba  B^ )d h³‰³}^ ng :b4b e ‚g 3b m :b cb a ¦b a EF2F> "G€9 ne IjM\ .0". > j3 .N(. 1N( :$6O.8#'$ #!.0$8 X .

_  Y       .

.1 2 8'$ y  ." #$ &(.($ *  . :  * $V(.2+  ! #N #$V(.$ !$6+)$ .UTWV XK  Q Z Q 8u0 ‘ —}u V’$#6žQŸ&% !"8u0 ‘ —}u V’$#6žQŸ0/ !" YLN YLN 4TWV 4TWV N ?.0/1. 2$6+7$)8+ 6&(." $ n+ $-(.0$68+ t9(. -).*p$s+ $-(. * /oP* $ + $-($ (. * lo %O U 6f #8O. *N#8(.85 48+7 #7 $ 6D* W$68 1Q".@7A21 <>A2ISOO C3O<J H ?DC3EEC c-5". *  x(.8 9:.234 576.$ 9(.n". #$V(.  u ˜ ‘ u r‘ ’ †’&™ ) œ‘ šl’  u ¡’ V’ ‘ ‘ ˜    u‘8  ’}—  ‘ Tu ” V’  V’&“8”:’8‘ • ”  ’  ’ “ u u r’ †’ †’ u – V’ u ’}—          XK    )+UTWV !('   *)       . : jo m$s' &-!+ :$s  6" %.$s$ Q[ #$M$ Q[2_ 3  ! :(.$ $  # .+ $ V[ #$)(. 5. (.+7 :  .$ .<0=> Q                                       O. :  W$V(.0 :!O(  ˜g:] 3bIb dfe 3b jlk c\ a] fg :\Bj o g "e b :k =g:] 3bIb j a qg:] nbIb "e cb dfe cb o ˜g:] 3bIb a 3g fbIb „e cb cb ne 4jl\ Be cb ˜^ o dfe Xa {e jMb4e j k o g:] 3bIb o =g:] nbIb B^  b a d 3g :bIb fg:] 5gf] 3b4b :b cb =g ne IjM\ 4j jlk Be 3b c\ g:] nbIb fe c\ q\ r^ ­^ -(.

Q)   ) 0"%c`.X  *?ZZYZA*#Z'&.9 †D % *0Z'Z [ \ eXZA*#Z'&.&  1'2.< 9.&l.

< 9. 1'2.<:5Œ ( ^_ `~Xq` +%~0c`m*'#"oc#"(YZ .9  j B ..1Œ   .3 ƒ2 .?/ :m<D B.

~XZ~*#Z'&.&˜.X.!Ÿ `'.

^ q*'#"£+IZ'0"% `l"š ^_ `~Xq` +%  8.›07..4}“h }8ƒ„ ƒ%i%D ” D  Q                                        Q)  >  5(c* X  g.*.

<:5Œ ..?/ :7ƒD .&  1'2.< 9.Q4)     % *0Z'Z [ \ eXZA*#Z'&.9  j B .

š*#Z&.&l.

X.~ŸZV"!VzZQdlZ&&  " d£˜"%Ÿ `.]$ .

7+%.9 D ” D  Q                                       O.5/ 4›12< 9.X }Z* & & Z}&~Z` ^!`'.&mX  “..

Q)'* + + >  5(c* X  g.

$ 4d 4e :+ ".8 jo`".  .4 MŒŒ “h C8ƒ „ ƒ%i j <7r}8'ƒ „ ƒ LRƒD ” o Q                                        Q)'* + + >  5(c* X   Q4)   O.!O. p$ 68+7 8$'2+ 3 a cbe jl] ‚« ck 3m h³‰³ .:<:<:‰^¯] = aBe°^ ±bIgn^²\ o $ :T(.Q4)   >  5(c* X   Q4)    8.(. 98U".

    <      _   j                                         .

+ .‚8ƒ„ 5.'<'/4 8.?/ :e=<.Z 0cQ)'* +.: 89‚ ‚8ƒ „ .0/WhVi ” 9: 4WŒŒ?18'3 :~66eE.P...<†D‘‚.

Z.‚8ƒ „ ƒ D‘‚EY6679: 4†ŒŒ#5/ 4 2QD  8ƒ „ <D ~ q8ƒ „ ƒWD 8ƒ „ <WLg“Qh?8ƒ„ ƒxi(D .        0'ZcX'21V"x* ˜Z`'v 3 b) Z%)` fZ'cX  ^'_ `&˜./~¤ID  ) Z#/'X. 5:3 .

o ^_ Z(  ^ _ ^ # .

28#8&O.  jD&-!+.

9<'=7?>A@BC45DFEHGI/JLK 3/$6+)$U$w+  $-($.*  jo.$ !$8+7$U8+&$6$^(.(     %.+ + $-($'(.*.!+ !^2   8(.1032545*6087:9.3P*+W$V(.-f ')(+*-.$ .0 :2O.$ **    ! o 0$8+7y$   " $ j + $-(.*  lo#n(.$!$6+)$)8+%$6$T(. ?.@7A8.$ (.koMH(:8#N(.*88(.&:O+5.N:  .%$21Q".92  8Œ$   " $ (.   ($V(.(.*  j3 O.$)+  $V(./.&o .-#N8(./"+ $ [ $ ($ %$)3  O $ U PO f Q 8O. ! F=)C =XO<J HN?%C3EEC m $y'&2+":$)  &-$+*. $V(.".(.

<:5Œ ..& 1'2.3 ƒ2 ..234 576.  -(.8 9:.<0=>                                         Q)4  ) ?"%c` 7X  *?ZZYZA*#Z'&.< 9.< 9.&Cf 1'2. 5.0/1.1Œ   .?/ :7ƒD B.9YPQD % *0Z'Z [ \ eXZq*#Z'&.9  j B .

?/ :A1xD R  * "(Ÿ `'..^ e"› ^_ `~Xq` +%mf()  8.$S.    R  $  %:&(..5/ 4  8.& ›07.<:5Œ .4m“ h  P }8ƒ„ 1i(D ” D                                        Vf)4 1'2.!O.X }Z * & & Z'm&qZ` ^`&mX f “.4   Œ Œg“h‰P C8ƒ „ 1i%D O.AXZ~*#Z'&.< 9.]$ b  Ÿ7ZV"!VzQd +%.X. p$H$68+7T 8$'2+ 3 ‚« h³‰³ .98U".8 jo`".X..9YP j B .(.:<:<:  :+  ".!Ÿ `.*.

OU         N .

4  ŒŒ “ †h P C8ƒ „ 1i j ƒrA8ƒ „ 1LV1%D ” Q                                       Vf)'* + + >  5(c* X  f4)   j Q                                        .  ” D Q                                        Q)'* + + >  5(c* X   Q4)   >  5(c* X  f4)    8.

+ .Z 0cQ)'* +.?/WhVi 9: 4MŒŒ?18'3 :~66eE./q¤ID  ) Z#/'X..3 .?/ :7=<..Z.P.: 89'‚‚ ‚8ƒ„ ƒ D‘‚ P ‚8ƒ„ 1D0EY6679: 4†ŒŒ#5/ 4 2D q8ƒ „ ƒWD PA8ƒ „ 1vD 8ƒ „ ƒ L‘“†  h?8ƒ„ 1i%D ” .'<'/4 8‚8ƒ„ 5.        0'ZcX'2 1V"x* ˜Z`'v 3 b) Z()` fZ'cX  ^'_ `   b ^_ ^˜fm ^_ * # ?.@7A =DBEEF C3O<J HN?%C3EEC q ¡[y 6$ ". 5':.

%^"+ D&-!+.

0"O.%$)(I.

T 8$)8+%$6   .

lo 1Q". 6 "!$#&% 7)G 2 9  3 2 :07.@7A EFHISO @LIIH I J HN?DC3ELC J 3/$H:$ 1Q". H .    "!$#&% ('*).(EO. '" 1:":>= ?   "!$#&% ('A@ /'  2 @ B'4> 2C D! @!"E' /:":&  2C D! @ 2  3 2 !F!.+".-/ 10 2 &3 2 !45!4 6 !4#&% 7)8/ 2 9 &3 2 : 0<. jN+&$t&(.:    + &$t&(.$7.0:2O.O 8$:+. $V(.+ (.  (.j3P*.:8#T - . ?.

0H$  (.:<:<:  :+   " .M LpH$ $68+7 T 8$'2+ 3 NON  I C3EGFC3E . *N#8(.O N$$#8 : .0 :2O.*8 T 8$ *   (! #N8(.98U".    R $  %:T(.*$6" ¡[*.&%>L1Q".( (#DK%%(.8#' :  x!+ 1V" . R l8+%$6&(.  R O.j3  J c-l*   R l8 $ .N#' J R (.(.!O. .8 jo`".$ S.

5  N     3 OZ  .

0%!O. :O.( !O.(.  (:8# T 8$ .

0".  *    + $V(.O.&> 1Q".$  .

O.T N$P(:8#N(.0". ! !$6O.(. !$6+)$P8+&$tM 8+&$t   8$ W$V(.

!$6+)$)y(:8# T 8$y!+ ƒ(.$  .%(.:    + $-(.O.0".

$y !H$ $7(.y  $6"O."O %>'+78O.$ +  $V(.$72O l(.  " $8 n+  $V(. *    +  $V(.(  R ( :8# T 8$y(.$ # : ".0%!O.+='  " "#  (H$H&>T(.+7 *  ] *p( & *8$1Q".*88 $V(. :#'(. *   n(.$ 2+4 2  $ 8$ +72+ $ :O 2O. *   !$8+7$G.k .8  (.(L+Ta ".. :8#8($ !$6+) $ .$(.0%!O.0 :2O.(i!+K".n 7 >Nm$)*:$6O.$y  yO.T 8$  R a.:+)%#*Va#/&! S #62   +K+  $V(.+ $ [ $7(.0".n".$  O/ ! +  $V(.(E(.$  K &!$ 6    !  +7G .  '(.n". $+7 +)$ .  O N$ $-(!+ !3 .+ +  $-($'!O #6H$ #6 8 `    $ f   !  +  $V(. *    3/$6O  " $6 *‡(. ".$ .0 %!O.N+72O $$.(. :  3 'D &/! T 8$7(.".

O T 8$y$6"L +  $V(.$$ .0 :! O( !+4 W2 O.$ !  . %+7 :$T   $   3/$6+7$ #   $LO.  $ .

 : $6!B+ *ƒ".8L .+7 *  )(.: . %&$t T N$ )" %& !8(. !O 8 !$6." %$L()+)$V(.

8 :H(. $6"E+7  *   3  T 8$ O >  .$y * :$8O.  8+<'D &/  :H .".O 2  $ 1Q". (.8+)!O $T(x(.

+= *  x(. %&$t T 8$ $-(.      6  L 8y8". ! $V(.H$ $8#8+7 *V".+)!O 89$y2.$ ." :8+72O $)(.

 * !O.$ *.(E(. #8N(.a . :8# T - . . *   1Q".!+ !" %O ! :$6% *(.0 %!O.(.k8 N$7 !  $  Us+72.

( :(.0".R(.$ W$  #6  * *    +  $-($  .

( O 8$M(.O T V .0 %!O.% #8!+c+)$-.

$M(.$ $ [ $  O T V .( N$ 2$6+T.0 %!O.( 7 >N&$M  8(.

 .8 %+ ":!+)!O 8Œ $  !8 $6l(.H$ !8(." &% >8(..$6 3 #6¡[  "." %+72O .

    R  $  %:&(.8 jo`".:<:<:  :+  ".!O.(. $ Z   6   T 8 J R J J   J J  J  J R J    O.98U".MLp$H$68+7T 8$'2+ 3 NON .$S.

$S.R O  O.98U".8 jo`".(.     5  N     3  .!O.:<:<:  :+  ".

 R  $  %:T(.MLp$H$68+7T 8$'2+ 3 NON .

  .

  .

       .

 h   .

     ! ".

 !62= $ >8$ts(.$6  ".?$-(. $ $H!8(.O.$6  ".1$H!8(.2+ ! $  >8$68(.%$ N8+7$ (.$  y $ >8$t 2$6+)$0".

 !O +S T&$6".O.p(.$?> "":$  .(M)+ $-($1+72+ $   $.O !-!+.TN$0:2O.

8O.($ 8$/9=(.:.O.-)+.'*/#0/I1'32&I C/4)657/8' IjC)1'  ".:$  ?#"7A!? %B $&('*))CEDEFHG+) I .

:"„".:.O.+7 *    8$/9=(.

$H$6#N+=8($6  q $ .+ %$ (.:"„".$ .978(.

O $s(.+7A 0".%:$6O$6"M".    " $ =(=+  $V(.+ 2$6O [". ! *89".8#:   7? <6$ .$ 6 ".+7 *   $H&:O@6+:$  $V(.$.<k>=2!+ 2O :(.9!%$6"i".O.

8# $6+=N9(.8$.T.$H $H&:O@6+:$  q ¡['$7!-!+.

:$.f .

-DC"&3:>@/F3 C 4E C ! C  E" C !.HON "G F1'0<. C >"G F"I H "JF&-KH 4"JF1'7.  > B 2C E. J L E: " C ! C :F"JF>"JF&-E  2 GM D!/(("JF/' :" 2 )GJ F"I H "G FDK. P + $6 ¡[0".O.

$  T8$ &.+7'O.   'O.$ T.:$6O.8$)%+= n".

".(.$H$68+=T2+ 3  ? 2*:%O !  8O  A8$/9.+ .n".  )!%Q=>8m$H!# T.RV !$6+)$ $8+= 3 N 6  " " TN$ 3 S 6my+T".%!T(.

 %.

 WV $W2#8(.(.$H $H%%O@6+:$  $ $W2#8(.& S !TN $ 3TS 6U" %&U=!8O.$7$ $H!#N(.$6 " ".'(.$8MNS>&U=>N*7 $6+7 (.$8 S >&U>= N*j)+&".

 %.

$ $H%%O@6+:$ l  :+ $69(.&%> T8$l(.

:8O   q r['$7!2+":$  .

 4"JF1'YXF4"JF"F4"JFD.. \ O]0%Q=!+)!O    &:O.

$62O (.  !$8+7$n3  OD8$ $-(!++7$V(.$H$8#8+7TN$U" ".$8"..

Q.

+7 %%O.>8 ^0$6+= !$6+)$w$ $W2#8(.$8 $W2#8+  b 3NMN OD8 $ 9".

$6".+  9+T". $6!+ !$8+T".

b0 $6+7  ".$6 3 N  S  S `_]`aA  & 6  (.U$&:-2+. $ >N$t8H$ $H!8(. $w+7   2$6+ 3NONY8$/9 W$V(.

%$':+7 $   2/" %&U=>N(.$ T.8$7+&".$ *V " ¡[  2$6+ 3NON $-(!+)$ " N^"+=TO.

(.)+7 2+ K %!fe  R $ . O"%TN $x(.$8 3 N  S  S f_f &  66>N $  !$8+$6 8  hg..O.8+78+)$ (.dc"%+=T(.  ˜‘  ‘  ‘  3V "j:O. !$6+)$x$ $W2#8(.$/2  $j(9(.  ˜‘  ‘  ‘ 5. $'+= :8#T ..(.

’8:• .+= *  n6 —}(.$ $—}’8W• 2#u 8(.d(.8$m(. !+%O. O. 8k - ".8(. u $ V’ l".%T.&U’ != .$8“^>Vu.

$6  ˆŠ{l-id”“j3{:km†mlo”“ndn“prƒ…q‡r{.}!l€’–—}:loldƒ—š”Œ{.}!‡„xz{Ÿp„{nwŽŠƒ…{€€ˆŠ}!n ‘lond’†{:q:pr{:‡rž`n“q8ƒ…8nd†nd‡„†n-‡„{K{l%ˆŠ”Œnw{:xm†•pr”Œ{n“|:ƒ…‡rp~{.n“†.lDn-€}h‡„n“€˜h‡„ƒ`”“{l O ¡ .u :(.’.“ V%$u.u$H$8#V8’+78(..n(l™s”“tm{:n*8u(xzvwtŠ‡~v}:”“nyƒ…{xz†mpr}!{ƒ—|:l“p~š›}!jœ€}:sdtm‚!n3{3{:}p„”Œƒ…ƒ`ndž…†ƒ…‡„‡~}Ÿ}:ˆz{€}wnd}I†‡„{n“kŠ†m‰‹ˆznŒƒ…‡„8{m.

O O        .

$ + $-($  $ >8$t !$8+7$ + $-($1+72+ $ !+ "'".2+7$ " %%Q=>8 (.          N #xU>&U=> T8$m(. $ !8$6w(.H$H!8(.$6 $-(.$1(.:*  ".+ + $-(.y>&U=>7 $ !8$t $8"  $ >N$t !$8+7$ 0"O.

T8$W0%!O.(  !+   ".+7 0".l ".O.

8$ $:$  † 0 % !O.T.(E !%Q=>' $  >8 $t  q ¡[)  $8.

" :.$ .

&)(:8# T8$ mn(."O %TN $  %$8". .$ c %$ .( Q022O  .. ‡n(.8 $ >8$t7(j$H!8(.+ +  $V (.$ _ 0"O.".$6 8V !“6 ".

T8$  " .

  ".

$l$jO.%O.(.$j+ $V .$8+79(.

$ _ 0"O.(.

-/ . -/ ’  u  & šj’  9u 8 ’ .  -/ .u  ‘ V’  •  10  ’ ˜ ’  ’  ).{ : 2& šj’  9u 8 ’8•  #<6.+ B !('TDu C.u  ‘ V’  ). ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ . ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ . ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ .10  ’ ˜ ’  ’  ¡’ V’  u  •  ’ & šj’  9u 8I& šl’  u  |8‚ƒ‰8{>…‡~ |{>: 2A6 * ŸŸŸ  u  )  G2& šl’  Hu 6. T8$ : .u  ‘ r’ FE 2& šl’  . ‘  /   !('Tu ” ’|N‚ƒ‰6{!V…uw~#—}|’8>{ • : u ˜‘  “ ‘  VuT’ .  -/ .u  ‘ r’   L R zj{}|.u  ‘ V’  •  10  ’ ˜ ’  ’  r’ V’  u  •  ?’ 2 —}u -/ $’ #54t0Ÿ /@6 .10  ’ ˜ ’  ’  ¡’ V’  u  •  ?’ 2 —}u -/ .10  ’ ˜ ’  ’  )+ -/ ’  u32 —}u -/ ’.:<:<:  TS  M   L R 1 R  %TNUJ O LVLPRH$.LPN@SWNT@R O SYXNON .-/ .+ B !('TDu C.+ !('Tu ˜ ” ‘  ‘. ’ ‰6{!V…uw~#—}|’8>{ • :  u ˜‘  “ ‘ VuT’ .u  ‘ V’  ).u 84’8•  #<6 * ŸŸŸ  u  )  G2& šl’  Hu 6.  & šj’ 9u 8 2& šl’ .u 84’8•  #>=& šj’  9u 8 ’8• Z  6 * ŸŸŸ  u  )  G2& šl’  Hu 6. -/ ’  u 32 —}u -/ ’.-/ . ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ .~#.u 8 ’8• Z  6. ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ .’ ‘   • )+r.10  ’ ˜ ’  ’  )+ -/ ’  u  & šj’  9u 8 ’ .  -/ .  -/ .+ !('Tu ˜ ” ‘  ‘.~€*‚ƒ|„‚†…‡{!…Q|t{ ‰>…‡{.+ ˜ ‘ .Š 8 ’ .u  ‘ V’  •  10  ’ ˜ ’  ’  r’ V’  u  •  ’ & šj’  9u 8I& šl’  u  |8‚ƒ‰8{>…‡~ |{>: 2& šl’  9u 8’8• Z  6 * ŸŸŸ  u  )  G2& šl’  Hu 6.#54tŸ&%76 ˆ8{8€‰8Šp‹ & šl’  9u 8 |8‚ƒ‰8{>…‡~#|.*V# hg.’ + !('Tu ˜ ” ‘  ‘.u  ‘ V’  ).{ : 2& šj’  9u 8 ’8•  #>=& šl’  9u 8 ’8• Z  6.u  ‘ V’  •  10  ’ ˜ ’  ’  ).+ B !('TDu C.+ B + !!"""""""""""""""#""#"#"%$& šl’  u!Ÿ ˜   !('TDu C.u  ‘ r’ FE 2& šl’  ..#54tŸ&%76 ˆ8{8€‰8Šp‹ & šl’  9u 8 |8‚ƒ‰8{>…‡~#|.’ #54tŸ0/@6  N | ƒ ‚ & šj’ 9u 8 2A6.{V !!"""""""""""""""#""#"#"%$& šl’  u!Ÿ(' ˜ ” ‘ — )— & šj’  u *   .+ B OKJKL98MKN@L PO oQM O OKRS. ’ Vuw—}’8•  u ˜‘  “ ‘ VuT’ ..u  ‘ V’  ).…‹ ‰„|N‚ ‰8{!…W‹†|.

 > 0                  .

  F  O   57/8' I )1'*/#. .

UT.(0 N S S _ : .-)+.-/8' .UT"( *-4(R4/S D *.'*/#01'y'*/€2 )6. R PO J O NKL O O  N@L SWR N D R. (QP 014 (L./457) / . 8 < S N S = > a ? @ a a a _Ja :Wa ./).]a 86a < a ?A? @A@ @A@^a > ?A?^a aS a a ? a  @^a J 8  8  <B< J S @  S  S@ N CED FHS G OJICKD O O POLCKD OJI O O PO MON .L S NFM &%U= N@JN N@L N R L O 9N@L L O $5N@LVR RH O LPN@JKR. R2S1..L O  O N  NN 1O TN ¡ "¡  M O R RH O LPN@JKR.L O  R J O S O LM  K@LAR R@M   K@LAR I? @RUM  K@LAR  MN  JKR N MN@S R L O MKS  %RR  O R  O   K@LTR Ÿ MKN  JKRWN MKN@S R L O JKR R  O R  N 1O TN !¡ "Q#¡ " V  O L N@JKR@L O # M O  R J O S PO L R L O 9NLPL O $5N@JKR  $&%('*).+*-(.'021(35476*)839.L O  KL O  R TN  Q N@L R RH O L NJKR.

_%(.(+*-4(R #"  21  . "( *-4 R2S UT (R M N QP O \ ] .c0d0J.e1*)H' fL+c)8).'gc+*)ih ^  8 VWV j 9 XYX j S Z "k" R m1R J O S RLn Npokq O L N@L N L OJr L N J O mKL Ots7O J  ts u N O NpnvnPR stu Npq u n8nPR&n u5r  u s N M O  NOn O x  stu N " . ( 014 (L. 1.`-/'*ab.

Km L u S OJu L R @N u O n8q N n O x  stu N  @ROm1R J O n O LN#okq O LPN@JN j  N@S RLnN#w1R.SWN O J O m R u nN ukr MN#oAJN@J OO  J j )+.SWR DM  @R DL uAO \ #"    . 9 . 9 M[X [Z A  T W [ Ll "  u JN@J O JKN o u  r MN r. zy .O S F  O NN#w O o N X jQ¡ G j L O Npo u = N@LNOnPR.'*/#0{ '32 / )+57/8' )1' 0K) ) }p.LPJKN@L{mKL u S Otu L R NOnPRLwKL Ots N@L r N s R.

L S N jŽ Ou  N  R O O Sm‡O oAR Nn s Otr M u L  NO J Ots oTN@L N „ @  R s R@SWRD M ‡„ @ RD L uAO  J?JKRLn RLm O LPN@JKR.S RŒn F = OO  n8n O s mN@Lq O J O oTN G j X R.$~{€+) }m'‚/#$ ƒ SWN DM 7„ @ R D L uTO  J†… MKSWN DM ‡„ @R  M O … J Ots oTN@L NJN s R@SWRˆn O  J R NS ukr N?J O J O q O L S u  N@JN s o N#n8n O  N N#mkqPM‡oTR !¡ ‰ j X R@SWR o NŠ… N@S N3JKN o N#n8n m1R J N n8n N@LRLnN‹q L wKM7qPRLn JN S nPSWN R.SIRLn O R#m O L N@JKR@u5L r O n6DM  sts u R  N3O• JKN3S OO nPSWsN O DR.L O n a1a O > a j  8| I .

 ’‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘’‘‘‘‘’‘‘‘‘’‘‘‘‘’‘“ E!3•”H– ‹ — 1' 2 1#&%1@ (:".C !‡˜ 2C :('$F !4#&%   2C D! @ '" 1:": “ E!3 ? "- C '  C ! 3 .2 1'  2 +  @  ./ 2  @/ 2 1:F..

!4:.!4:. H .3 “ E.C ‡! ˜ 24C :('4> "!$#&%   2C & ! @ -4""(.  2C D! @-"/ 2 &3 2 X X ) '".3 “ E!3• Nš ™ H '.!4:.2 1'& 2 +  @  .3 “ E!3• Nš ™ H './ 2 &3 2 XfX) '.!3•N‡›0<. Hy ./ 2  @/ 2 /:F.3 “ E.3 “ E!3•Nš™ H '.!4:.!3• N‡ ›0 ? 2 &3 2 ! )8š ™e” .  2C D! @-"/ 2 &3 2 œ X ) '".!$:.!4:. ’ ‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘’‘‘‘‘’‘‘‘‘’‘‘‘‘’‘“ E!3• ” '" ‹ —   C ! C #&%  @1 :.3 “ E.!3•N‡›0<.

X X ‡ ›ž” .

/ 2 &3 2 œ X) '. H -4""(.3 “ E!3• Nš ™ H '.3 “ E.y0<.40 N N )Gš ™U”.!3• N‡ ›0 ?   ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLn8q u To N J O LVLPR r LPN@SWN „ @R O SYXNON .!$:.y[XfX>‡ ›Ÿ”.!4:.

 .

F       XX œ$#&% ™ "! + V     ¡ F  7G a a   1 w n O L O M O R RLm O LPN@JKR.L ‡ O L u s N n O R#n NpqPL u wKM7q R#n J O m s R.S m‡o O q R  R  N#o!J R s N#m Bq M‡oAR j #"     .

  !    ›('*) % “  W  .

L s L u N MKS q O L sOJu LPR RLw  O qPR 7  s R.'3) W 0 J6.-.S N J O m ¡ O m j  &.L S N J O n RLwKL OJs N@L r N J O RLm O L NJKR.R L L OJn sJ O w O L N#m O  N#n O O O O OJr u  O O u s O O O O F G O J O ŒF G jwV RLm O LPN@JKR. L M N  L Ru R   RS Lm‡OtoTs7RO wN¥O n L OM  O L  g M MKS R mRLN@m L @L S N@JO q R.S MKS S… q R JKR S O SwKLPR JKN s o N#n8n O j ? O  J R M S S …Jq R JKR JN s o N#n8n O• m R J O N s7O n8n N@L J u L O qN@S O  q O RLnNpq L u wKM’q RLnJ R RLw  O qPR j V w‡n O Ld O M MS O mMKN@S L @RLS m O q L L N@R J j R.  O m -. 21 797 <7 E @?A%CBADE ’‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘’‘‘‘‘’‘‘‘‘’‘‘‘‘’‘“ DG!A4D ”.. )+.– FAF‹— HBI" IJKDML INODQP  H"I"OR ISL DQ% I"LDGNTO! ˜ VU"DANHDW?VDX?4YCDGLD?4@?APD “ D@!A4DMZT%OAPCB UH[E\U]!  > y^) HOB"INON FAF E “ ‹— E N DQ!A4D FAF “ E D@%" N HBI" ZZ ICDG IJKDML H '*) #_U]!A Z INODQP  H"I"OR E ISL N DQ% “ D@!A4D % ›'c) FAF’‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘‘ ‘‘‘‘’‘‘‘‘’‘‘‘‘’‘‘‘‘’‘“ “ DQ!A4D “ DQ!A4DdEOEeDQ% I4DG #fU]!  ' DQ!A4D E D@%" Z –  E + “ DQ!A4D E Z “ ‘Gg UN %j %j N E fZ Z > d) N “E X X > ‘Gg y   –  – "!ihW%j –  UN #bHODQ!VNQ ZZ ]Z Z ‘Gg y d) DQ!A4DdEOEeDQ% X DQ!A4DhW%j ‘Gg ICDG UN UN “ Z !k ‘Gg > ‘Gg y Z  O Z E I4DG DQ!ACD % % "!ihQ – #bHDQ!`NQ “ UON E ˜ I"LDGNTP`U]! E CU"DANHDW?`Da?4Y"4DGLD?4@? ” DG!A4D P D HW%O% ) DQ!A4D N % ›' ) ›Ÿ”l>^) ›Ÿ”.NUL{wRLn8u  N#L oAu R.L  … u Sm‡o O S O  qNLQN nPRLwKL Ots N@L r N s R.S  R.(/ V M7q LPN+DR. F  7G  n @R ukr MN u n jU O N O O S m‡oTR -.'*/#0{ '32  / )+57/8' )+' 0Ÿ)  )  8&-))  / . = > 3 787 787 . / 0 43 3 43 65 65 :.S O m   R  J O NLPSWN>= O  NUNn R.^ y ) ) +   N#o!JKR s NpmkqPM‡oTR j  O N O O S m‡oTR s R@Sm‡o O qPR  R #"  nm   :2.L L R O M S  RLL m O S L NJK qR.

M7q L RLn RLm O LPN@JKR. / .L O n j OusQ]~Cs4~T‚}uGz*s€~`‚us$ƒbG„"…†z[‡ˆuKf‰4Š rtsWu4vnwvyx{z|u}z~Cs€~ EŒ‹Ž4fe‘’&‹@@“”“ A2 6. ’ 6.'3/#0{ '*2  m L O n O  qNQ¤n O N¥n OJr M u LMKS s R   M  qPRJ O mKLPR#q #c q u m R#n¦mN@L N¥n RLwKL OJs N@L r NJ O op1 *q R. ’ 6.$.+ ••—– ••—– ••—– ••—–  4fe‘˜A‹@9‘e‘“”“:‹™›š 4fe‘˜A‹@9‘e‘ $$ ‹™›š 4fe‘˜A‹@9‘e‘†‹™›šQ“”“ 4fe‘˜A‹@9‘e‘†‹™›š  ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L +cœbž +d§  ž +cœfž $ $ +[§  ž ŽfŸ  nfŸ    ’&‹¢¡£n¤ ’&‹—¡£n¤  nfŸ  nfŸ   ’©‹t¡ªW« ’©‹¢¡ªW« $ Cc¥ ‘˜A‹¦ $ Cc¥ ‘˜A‹¦ $ Cc¥ ‘˜A‹¦ $c C ¥ ‘˜A‹¦    m1RLnq u To NUJ O9¬ PL R r LPN@SWN „ @R O SYX­787 .+ EŒ‹Ž4fe‘’&‹@ $ $ l2 ¨.()6.+ EŒ‹Ž4fe‘’&‹@ $ $ 2A6. 5'*)1& 1&e57)6.+ EŒ‹Ž4fe‘’&‹@@“”“ l2 ¨.

 T      E t‹Ž4fe‘’&‹@ 8 2A6.+ E 8 ‹Ž4fe‘’&‹@ e2 ž ‹  «f’ E E ‹Ž4fe‘’&‹@ 2A6 2 E 86.+ Ep‹Ž4fe‘’©‹@ $ 2A6.+ Ep‹Ž4fe‘’©‹@ 8 2 E 6.+ Ep‹Ž4fe‘’©‹@ $ 2 E 6.+ E t‹Ž4fe‘’&‹@ $  2A6.+ #"      : .

+d•• •• – ' 4fe‘˜A‹@ – ž ™f« ‘Ÿ .F     •• •• 4fe‘˜A‹@ – 86.

S  O  q O nPR#wKL OJs N@L L Otr M O  OJI O J O o O q O s R.L O n ? ? 7 r N@JKRLn s R.L O nWJ Os Lm u N O N‹q L u wKM u „ @R R n j O u nq u L O S ‹N q L u wKM7qPRLn J u  5@S uks L ? R.SWR DM ‡ O S mKL O Pn RLwKL tO s @ S mKL R r PL N@S U N R@L uTO  qN@JKR N RLw  O q R j r oT#R wN#o M O … J O Pn N s R  n O o 3 O o O S MK NOnq L O N  n  n O SmKL O n O L @ROnPRLw L Ots N@LPL O ¤ nPRLwKL Ots N@LPL Otr R.M 7 6a O j nq O N pN q O  q ROmN@LPN O Otu q RLn s R.L O nVJKR X zn @R nPRLwKL Ots N@LPL Otr N@J RLnžmN@L NRLn q u m1RLn u  q O L  RLn j V RLm O LPN@JKR. R S R S… q R JKRUS O SdwKL R j   n L R wKL Ots NL r N s R.SWR DM ‡„ @R DL Au O  J j  A  W P C >   uAO Nbn N AJN J u L O qN@S O  q O mKN@L N s R.SWR " = Cc™ X > C› X ]F X ]F X C [X ]F Z LF y Z @?A%CBADE D@P N@ACU]! R ™ > HODW?A%CB" HODW?A%CB"  X DQP NQAVU]! H > L DQP R › HODW?A%CB" _ > I L4DQOPCB"  FAF ) j > & 4D F ]F ) FAF ">^) L4DQOPCB" HODW?A%CB" FAF > I G!VHIL VU]%CD NDQP OI@?4!A4DAN (' NTLVU " HI"ORI !AN *)CB@VUW%CB"I ? )  9 c    M O a¬ N@LPN O u q N@L nPMKL8mKL O n N#n ^s L Au O @R s 3S O nPS R R#nWRLm O LPN@JKR. 5W1' . $  =  10 $ = ™ ¨.'3/#0{1'32  /4)657/8')1'  R s 9  J O  O q O L•m O L s7O w u JKR  M O S M u qPRLn RLm O LPN@JKR.10 4fe‘˜A‹@ – •• 10 ™ 4fe‘˜A‹@8˜A—‘ – - ˜Afn  8 4fe‘˜A‹@ – •• •• 4fe‘˜A‹@— –   ‹¦ ¨  ‹¦ ¨  ž ¨ ’&‹¦  A -/ ‘˜‘ ˜A ‹¦ /#$&-/#$~{6.L S …FM’q u o u =N@JKR mNL N SUM‡okq u m‡o u5s N „ @R  J OJs oTN@L N „ @R J O m R  q Otu L RLnR.()6.   ˜A€¦ ‹¦ ¨ Ž«Ž«W‹¦ ž  4fe‘˜A‹@:« ‹  ¨.S R "  !fN@"#$SDQP HODQA V “ + w n O L O M O RLn RLm O L NJKR.M mN@L N RLw7q O L / 3 ­787 R s R  q O  JKRWJ O m1R  q JO u L RLn j   O  q O M‡n N@Ln MKS N DM 7„ @R A   f Qg  1   uTO MKN  JKRnPR#wKL JO s @ N L L Otr N@L ? ?  R O  m R u n¦m R J O ¤n O q O L#N o r R s R.M7q !O  %!%  MN  JKRWN#m‡o u5s N@JKRLn OO@ @  mN@LPN)Nnq L O N@S ) 4D a  @ ROn u5r  u  s N  M O @R s 9  X L u NL MKS N¥n RLwKL OJs N@L r N¥mN@LPN 7  6  W  „ R DL Tu O  J s L u N N L r N s .S RS… q R JKRLn O n8q 3 q 5u s RLn j =    s R  n8q L M7q R@LJ Os Lc m u Nm R@L M n O S… q R JKRLn J O s R  O L8n @R j a¬ N@LPN L O JKM u L R  KS O LPRJ O nPR#wKL OJs @N L r N#n ‡ V M7nPR JKRUR#m O L N@JKR@LQJ O Npq L u wKM u „ @R F N a n @R JKMN#nRLm O LPN „ R O nJ u  O L O  q O n j  ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M§n s j w L  nO  S m L O w G O J R =  u  u5sJu N#o u 9N „ @R §F u  q N  a w 9G   m1RLn8q u To N J O9¬ PL R r LPN@SWN „ @R O SYX­787  .

   = > T        .

       .

   @?A%CBADE  HOB"INON Z FAF HDQ!VN@A"A4D ^#©VU]%CD FAF 'c) N HDQ!VN@A"A4DL ^#bHDQ!VN@   N FAF + I"LD U]!`UH UGI B U M IJK D '*) X DQ%"I"LDGL DQ%4" Q%`UGI$%CDG H  N IACUWPO`UJKD  #bHD@!VNQ '*) ) V  Aa  1  „ €d9 !  c .

? Otr M  JKR ? q L R. M O  stu NS O  qPR FHG: q O S n ukr  u  s N@J RLnmKL8… ¤ J O   u JKRLn  MKN  JKR N#m7o u5s N@JKRLnN RLw  O q RLn J O s o N#n8n O n jŸ R s 9m1R J O u S m O J u LR N s7O n8nPR)N O nq O n F O1 MN#o  M O LR.M‡nq LPM7m  J O  u JKR%N MKS N stu J O  q O g u n8qc@L u5s R  RLn)RLm O L NJKR.L O n a F Npq L u wKM u „ @R G:8 F O  J O L O „ R G:!O n O.M7qPLPR RLm O L N@J R.S ROmKL u  Npq O j .L G! J Ots o N@LPN  JKR RLn S O nPS RLn s R.

L O n  @ Rdm1R J O S n O LJ O   u JKR#nmN@LPN L OJsO w O L O s oAM‡n u N@S O  q O m1R  q OJu L RLn  O sO q R F„aA 8G j  V mKL u S Otu L R N@L r MKS O  q RJ O MKS R#m O L N@JKR@L¦nPRLwKL Ots N@LPL Otr N@J RWJ O  O n O LM SoQN#oAM O j c …N@S u5r N  O o N  @ RUL OJsO w O MKS m1R  q Otu LPR . V m O LPN@JKR.

SWRUN6D M ‡„ @ RAD L uAO  J  @ R  N>= mKN@L8q O JN s o N#n8n O> m R u nndd u S m‡oU stu qPR&qg u n jOV M n O N  mKL OJstu n N@S RLnmKN#nvnPN@L O 7m7o u5sJu q N@S O  q O R.RLw  O q R Nn O LUSWN  u mKM‡oTN@JKRm O o N D M ‡„  Rj . X R.

L  M O n8q n  @RL w S S m‡o q N@S  q ROm R  q L R¥qg n j nRLm O PL N@JKR.S R S… q R JKRS O SdwKLPR   R… m1RLnvndQ O o s R.L¦mN@LPNS O SwKLPRd¤ @ n M‡w‡n s L u q R KC D O  m N@L  q O n O n FHG n m R J O S n O Ln RLwKL OJs N@L L JO r N@JKLR n s R@SWR S …JqPR JKR#n S O SdwKLPRJN s o N#n8n OF  R m1R J O  S n O L DL uAO  J G j  3 O O OJsO O u ukstu g O O Otu u    N#n8n u S  RLnmNL @S N nPR#wKL OJs N@L r N … MKSWN s N@SWN@JN J O DM ‡„ @R .L O nJ O pN qPL u w M u „ @R N#m1R  qN@J R.   n RLwKL Ots NL r N s R.S S …JqPR JKR#n O n8q q uks RLn F nqNpq u5s!G: m1R.

S R u  o u  O j V n O O Sm‡oARLn  M O n O L@R N#mKL O n O  qN@J RLn NŠn Otr M u L  S RLn8qPL N@S  NŠmKL q u5s N žs R.L O nŸnPRLwKL Ots N@LPL Otr N@J RLn j  u nq u  r ¡ 7j¡L"•  L  M u .S N#o r M  nVRLm O LPN@JKR.R O ‰# ¤ R  q R j g . ƒ S ¥ mN sO NOn O LM’q u o u N@JKR j = n5 O qPLPRLn¦m1R J O S J O   u LR  NS O n¤  M O MKS N¥n RLwKL OJs N@L r N  M O S N u n L m u JN  J Ots o N@L O NS O n S N s R.S R M‡nPN@LNŠnPRLwKL Ots N@L r N J O R#m O L N@JKR@L j O N#m L O n O  qNQ¤n O Nn Otr M u L N s o N#n8n O  R  qPR  N r R.L N s R.

@AB.$32 Pa F..: :B> 687E:"FG0H<= IJ7 BK:L=MENO b P Q .-$0/"10$3254 687)9.@AB.:<=9?>.-$ /"1..:¬ N@L N 3 3 ¬ ¬   "! #%$'&)(*+.R8!E/& $]1!^_$ [& W%`!$].$W   ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLnq u To NUJ O9¬ PL R r LPN@SWN „ @R O SYX­787 .: :B %_1)!c)d1.WW&X.: :B> 6%<=9%7C:=D>.-"$ /"10$ZY\[&.GMKK'@AB.& R8!E/& SUTVCS..

 T       T$0/d1)%$dV)&  L"7M.:=  .

F      :     [& ST&0WW$ _S%1)!c)d1.$W [& $c%&10$ 7E: :  7E: : .

_S1)"!c J1.$ K:M':7FX7C: : [ &UTVaSWW&  F.B: :M<BL .

RdS.$][&.$[$W  HG7F $0/W"1)J1. V01 @AB0: :B. 1.

 b F.B: :M<BL !" $0/W"1)J1."&$#JS[$ @AB0: :B 7C: : >%&)7C: : >.$ W$c "&TS.

'(C>).

C>.

.) b F.$ [& T+* ^ !.B: :M<BL !" $0/W"1)J1.0/  .   b .S @AB0: :B F0B0:K: @AB0: :B.

.0/ ..

<0 7E: : .$.  . F.L343' 5! 76%&1.S^+$ /"10$ 7C:%G7C:=8B%7)<:9=':C@AB0: :B. #"!0"1ESdV J7)L :HMG 2@AB0: :B0 b F.B: :M<BL1 !  Q &0W1 d1. .S^+$ /"10$ 7C:%G7C:=8B%7)<:9=':07E: : .B0: :M<B. 76%&1.

7 .

) 10$[$D!E/ VE!E/&_Y\$c1 >=:? 7C: :A@=':B F0B.:K: b L=':HL:80 C!" .

) 10$[$D!E/ VE!E/&_Y\$c1 >=:D 7C:%G7C:= 7C: :8@=:.

%F0B0:"K: .

=:BG%M" .) 10$[$ #! 1CSJVY\[&0W&)/4%S\$^_$ /J10$ J7)L :HMGEB7)<8F=K.

$M=J$<=.UB 7C:%G7C:=]@AB0: :B4.   ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L /`.LO334."!$W T.) 10$[$.W  =LM:BL07C: :'  =LM':B.%SBKBL$ [S 7C:%G7C:=]@AB0: :B4.$[$N=8&=8c)$    m1RLn8q u To N J O9¬ PL R r LPN@SWN „ @R O SYX­787 .+#"S [& $5^3& %S[$&.7C: :'  =LM:BLM  =LM':B.HW1`1!T$ K:M':7FX7C: :A@=:JIB. B W$c0&TS.: :M<BL "  Q &T"VES. 1.L 3737. B 7C:%G7C:=]@AB0: :B4.UB 7C:%G7C:=]@AB0: :B4.

+#"S B  =LM.B0:K:        T.W % @AB0: :B4.  Q &T"VES. 7C:%G7C:=]@AB0: :B4.+#"S  =LM:BLJ  =LM':B.:BL-B  =LM. 7C:%G7C:=]@AB0: :B4. @AB0: :B4.R_! /"!KBL$ [& T [ & $5^3&   F.L3 B B B B W$c0&TS.%SBKBL$ [S 7C:%G7C:=]@AB0: :B4.$M=d$    F0B0:K:    F0B0:K:           S[$&.F. @AB0: :B4.B0:K:  F. .B0:K:  F. 7C:%G7C:=]@AB0: :B4.$M=d$  c! % / `!$W]T. @AB0: :B4.B0:K: .%SBKBL$ 9L7 =0:<ABBG 9L7 =0:<ABBG 9L7 0= :< 9L7 0= :< ! B W$c0&TS. 6=0:<%7)9 P  $0#"![S[&0W  Q &.L 3  =LM:BLJ =LM:BL =LM':B.B0:K: .:B L - [S K:<0+aB%K:L=M  N . K:<0+ 7K:L=M  N . ‰   Q &T"VES. 7C:%G7C:=]@AB0: :B4.F. @AB0: :B4.

      .

W  c ! /%`!$W]T.$ 6%$c "&TS.U75:  @AB0: :B. B  =.^Z& %S[$.$M=d$ R%/KL$ R%%!&E/%[ F0B0:"K: @ AB0: :B.'B)H:  F0B0:"K:  @ AB0: :B.      F0B0:K: @AB0: :B.^Z& %S[$.      F0B0:K: @AB0: :B.LM':BL+OO) K :< +  7K:L=M)N.   " F0B0:"K: @ AB0: :B.  ..= LM':BL+II) K :< + aBK:L=M)N. W$$=JS .-"$ /"10$ U$5^3& S%1.   = 10$[$ =8&>=8c)$ [& $5^3& %  S[$&.W W$c "&TS.&. $.&$#S[$W3Y T. #JS Pa    $.$M=J$ $ .   " B  .

L j  u nq u  r 7j "   L M u @R O ‰L ¤ ¬ R  q R j s m7m q O nqN  JKR ¥  "! #%$U.R_! /"!KBL$ [& S1 !c)J1$U&.: :B./  C.&.: :B&+ F.W1.WW%& 7C: :U@AB.$WX&0W"1.a-$ /"10$ ^  ¡ = 10$[$ =8&>=8c)$]&UT.W'[& ?+Y%D Y WS /[$ ^+$ /"10$ ^ B7 < @AB0: :B +9=':Oa@AB.$M=J$\R/KL$ R%!&E/[Z2    N n RLwKL OJs N@L r NJ O RLm O L N@J R.`%1!T$ [S TVaS.S #SdVE$.   b ...`1!T$W  Q &.-"$ " / 10$320T ^^ 687E:"FG0H<= IJ7 BK:L=MENO 687E:"FG0H< =  = "3@AB0: :B /  G   Q &aR_!)/J!+K L$'[$W]S%1)!c)d1.B: :M<BLN-E  Q &aR_!)/J!+K L$'[$W 76%&1...

/ . .

! .

S $0W #%S8VC$.S][!.  $=_&1)%$ ".SM=8c >= 1&>=] =8? &  =8D %WS $^+$.$[$W [S]TVCS. . 1.WW& 76%&1.R+& "&)/"T!S<? [$U$c&10$][$ ?\^+S$=+&1   $ B7 < @AB0: :B +9=':O07C: : .W [& ?U& \ D ^+SWWS[$W]T.E0 7C: : .$M=d$ ^ S.WW&D1./J1&! %$U1E4%! W ^_S.$M=d$'&T&c&E?]& D3Y &'[&E/"1E$ [S]TVCS."&0W'[& ?]& D][$U$c&10$+YWS /[$U$0W #SdVC$&.

K.' b : G7.K.3O+ -N %W$ [&]1E4%! W : G7.3O+.

-N.

O ! .

$[$ #J&1\/L$ =[S $ $c%&10$ Y 7C: :U@AB.) 1.: :B&+@=':.

$M=d$ T$ /W%1    m1RLnq u To NUJ O9¬ PL R r LPN@SWN „ @R O SYX­787  . F0B0:K:  W&E/[$  ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L [&TJVCSS[$ T.

T       b !  .

F      :     L=':HL:8.

.

W1`1!T$ [S]TVaS.: IB: :M<BLO b L=':HL: F.B: :M<BL ! W&)?T 4S%=dS[$  .: :B&+M@=.WW%&8Y ^+$[& 7C: :U@AB.) 10$[$?&.

:%M< M +.: :BO 7IBBL<=.: :BO7IBBL<=.:%M<M+-  K:<0+EF0B0H :XII   :@AB.=:BG%M b K:<0+EF0B0H :XII   :@AB.) 10$[$ #J! J1E%S8V B7 < @AB0: :B + F=K.

 ! W&>=X = $c&10$ II   I I . .

 #JS [$]$5^Z&0S[$.^ V)&.W =_& /J1& ! /"T "&=+&)/J1$ ? & D @AB0: :B4.R_! /"!KBL$ [S W$c "&TS. IIK:<0+.'@AB0: :B&+CB  =LM.:BL07E: :' .  '6"!=.=0:<G   Q &aR_!)/J!+K L$'[$W W$c0&TS.&%#"S[$W  Q &.

 1.$[$W b :  G 7.K)3O  : G7.) K 3O .

'@AB0: :B&+CB  =LM.:BL$ b :  G 7. L=:HL: :+G"7K ! @AB0: :B4.K)3O  : G7.) K 3O .

^ V)&.'@AB0: :B&+.L 3307E: :'  b :  G 7.  '6"!=. #JS [$]$5^Z&0S[$. L=:HL: :+G"7K !  Q &.W =_& /J1&'[&T "& =+&)/J1$ ? & D @AB0: :B4.B  =.) K 3O .R_! /"!KBL$ [S W$c "  &TS.K)3O337 : G7.L'M :B.

B  =.) K 3O .L 3437 b :  G 7.'@AB0: :B&+.K)3O337 : G7.337 L=:HL :  +: G"7K ! @AB0: :B4.LM':B.

:BLJ"0F0B0:"K: @AB0: :B. #JS [$]$5^Z&0S[$.337 L=:HL :  +: G"7K !  Q &.    F.'@AB0: :B&+CB  = L M.R_! /"!KBL$ [S W$c "  &TS.B0:K: b @AB0: :B   - := ]@AB0: :B . @AB0: :B4.

K.3O     / O . 3O  -e: G7.

 3O .

3O .K. -e: G7.

   / .

O   ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLn8q u To N J O9¬ PL R r LPN@SWN „ @R O SYX­787 .

.

  L=':HL: !     T         .

      .

K.^Z&0S[$.     Q &.: :B  3O  -e: G7. L M':B.R_! /"!KBL$ [S W$c "  &TS.:K: b @AB0: :B    .   'F0B. #JS [$ $.X @AB0: :B4.3O  3   / O   3O .'@AB0: :B&+.L 370F0B0:"K: @AB0: :B.B  =.:= ]@AB.

K.3O . -e: G7.

3   / .

:BLJ-"0F0B0:"K: @AB0: :B.  /   : G7. @AB0: :B4.O L=:HL :    !   Q &.'@AB0: :B&+CB  = L M.) K 3O .R_! /"!KBL$ [S W$c "  &TS.    b :  G 7. #JS [$ $.^Z&0S[$.K)3O ..

  /  ...

^Z&0S[$.    b :  G 7.K)3O  B  /  : G7.  @AB0: :B4.) K 3O . #JS [$ $.R_! /"!KBL$ [S W$c "  &TS. L=:HL: :+G"7K !  Q &.B0:K: @AB0: :B4.:BL- F.'@AB0: :B&+CB  = L M.

B.

 #JS [$ $.B  =.K)3O (3%  /  : G7.    b :  G 7. L M':B.B0:K: @AB0: :B4.? @AB0: :B4.^Z&0S[$.) K 3O .   / L=:HL: :+G"7K !  Q &.'@AB0: :B&+.R_! /"!KBL$ [S W$c "  &TS.L3 - F.

(3%.

  / ' .R_! /"!KBL$ [S W$c "&TS.^Z&0S[$.   / L=:HL: :+G"7K !  Q &.B0:K: @AB0: :B4.R+!)/J!+KBL$'[S.  BBG B  =LM:BL-- F. #JS [$ $.    b L=:HL:   "/  -.W R%/K&0W W$c &TS&%#"S[SW  Q &.1  "/ .: :B.B.:K: @AB.  )F0B.

-B.  / .

 #JS [$ .7 !  Q &. .$ ^Z&0S[$.R_! " / !KBL$ [S W$c "&TS.

 BBG B  = LM:BL  - F.   )  II / .R_! /"!KBL$ [S  W $c "&TS.= LM':B. B  .    )F0B.H :]II ' \II 0/  L=':HL:?B0H : II    @AB0: :B.^Z&0S[$.LZII' K:<0+aBK:L=M)N4.B%K:L=M N4. b L=:HL:     -.'BEH: )F0B0:K: ! B.: :B.B0:K: @AB0: :B4.  K:<0+.  " ! b  Q &. #JS [$ $.:K: @AB.

]II +)   ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLnq u To NUJ O9¬ PL R r LPN@SWN „ @R O SYX­787  .

T          : .

F       b  Q &. #JS [$]$5^Z&0S[$. LPR r L N@SWNUJ O q O 8n q O JNpn^n RLwKL Ots N L r N#n j ¬   0/ O  / .UB  .= LM:B.L OO' K:<0+ 7K:L=M)N4. K:<0+07K:L=M)N.R_! /"!KBL$ [S  W $c "&TS.

.O 0 7a: 7a: OO a7 : OO L =:HL:  ! 75: 5@AB0: :B4.

-$0/"10$ Y 7C: : NM7E: M 7C: :  7C: : ..  ¡    u nq u  r 7j 7"•  L M u @R O ‰L ¤ ¬ L R r L NS N j s m7m j   "! #%$'&)( Z) -%$ #%S%=dSd20T ^^ 687E:"FG0H<= IJ7 BK:L=MENO HK7C: ]:M N"=%K  M%F.=UK:<   687E:"FG0H<=0=3@AB0: :B / G b H?"&=^ VE$ [&]T0!S KBL$ &\W$'[$]$c%&10$?.

$M=  W$c &TS #"S  ")%!SU$c&10$][$X1! ^_$D.$$=X/$$=8& ^ JY ^ 3Y ^ @AB0: :B        ..-"$ /"10$DT.O T.

 F0B0H : II  : :L= "F0BEN BKJMGBL=%K <=    F7C: OO   F7C: / =':"     %=0: :=.   WS0/[$X$.L .^Z& %S[$.

L )   . %=0: :=.

II  43J3J3   3 3O .

   II =0:<G F0B0H : II J33B3  3J3O II   II  43J3J3   3 3O .^Z& %S[$.    . WS0/[$X$.  F0B0H : II   K   +.

^Z& %S[$.^Z& %  S[$.  F0B0H : II J33B3  3J3O II       II   II  7  3J3 3 .    WS0/[$X$. WS0/[$X$.

 3J3O II   II\=0:<G  II   II  7  3J3 3 .

 3J3O II   II\=0:<G II   II  7  3J3 3 .

:<B. 3J3O II   II\=0:<G   F0B0H : II 0@=K:M.

    I I\=0:<G =GK.   +-B-  \II 7E9   -.   F0B0H :]II    -+.    =0:<GO .= F0B0H :]II  I I\=0:<G   .

WS0/[$X$.^Z& %S[$. F0B0H : II   K   +  II =0:<G F0B0H : II J33B3  3J3O II   II  43J3J3   3 3O .

WS0/[$X$.  +\II =0:<GO           F0B0H :  .^Z& %S[$.  F0B0H : II   M =:<B  +.

    II J33B3  3J3O II   II  4  3J3J3   3 3O II   II  7  3J3 3 .

 3J3O II   II\=0:<G .

WS0/[$X$.^Z& %S[$.     ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLn8q u To N J O9¬ PL R r LPN@SWN „ @R O SYX­787 ¡ .

.

"   T         .

      .

    F0B0H : II  M =:<B.

   +-+B   \II =0:<G       .B F0B0H :  I I J  33B3  3 3O II   I I  43J3J3   3J3 O\II   .

 .^Z& %S[$.  WS0/[$X$.

 F0B0H : II 0@=K:M.:<B.

I I\=0:<G     II  7  3J3 3 .   F0B0H :XII     . I I\=0:<G     =GK.   +-B-   \II 7E9    .= F0B0H :XII    -+.

 3J3O II   II\=0:<G II  7  3J3 3 .

 3J3O II   II\=0:<G =0:<G .

WS0/[$X$.     F0B0H : II    K  +. &  .^Z & %S[$.  +   \II =0:<G F0B0H : II J33B3  3 3O II   II  43J3J3   3J3O\II   .

&Z  .[S   .S0/[.-$0/"10$320T ^^   6S.T ^^ &)( Z..&=+& T "!$ -%S %1. /$  E! /?  # &E( ZE-%$ #%S$=8Sd2.    ! L=':HL:       P -S0S T$$=^Z!"VES.

$M=?$0W #SdVC$&.D &E/"1&)   ^ _ .W [& ^ ??&E/"1& .?2 "S82 $ J1 H/J1E%&]T.

ZY   ^  .

JY   ^ 3 .

dY  )^*W ^  ^  ^ _ .

ZY    ^  .

ZY   ^ 3 .

dY  .&0W1S0/[$.

^  .

 ^ ^ . ^ )^*W^   ^ _ .

ZY    ^  .

_Y   ^ 3 .

dY   ^   S %& /%[$ ^  ^ _ .

ZY    ^  .

Y   ^ 3 .

Y  ^  S %& /%[$ ^  C  ^ _ .

ZY    ^  .

8Y   ^ 3 .

&0W1S0/[$._Y  .

 ^  .

^ )^*W^  ^  ^  ^ _ .^ ^ .

ZY    ^  .

8Y   ^ 3 .

5*dY  Pa   .

   .

 .

       .

    .

               ¡ JKL8…¢MKN@L8q O £ M O  R¥¤ I¦I¦I j oTS m7q j M §n s j w L    m1RLnq u To NUJ O9¬ PL R r LPN@SWN „ @R O SYX­787  .

 .

   .

u nq0) 21 143 q056879*o:)Ln.+G@+ mm).)49 1/< 5dm 3 ) r 301 + 1#„>= )/) 3 u 5  q 14<211 )Lw  5Jq?)@7A5CB u n8q?5>+ 3 5to 1 stu ) 21 +-5  q?)Ln 5  q 3 5DL) w  J5 q0#) n < u n8q u  q0)#n>7 1 5tnq05Jn 3 5to 1 stu ) 21 +-5  q0)Ln <21 +-)LnE)  ).j stq?5u u 3 )dj 1 s o 1 nvn?u 5u z{G@5u 14u ‡ ) 1 s J5 nvn?) j‰ˆ )Ru 5CB†5> + m‡o:) u51r n?5 r G u 3D1 s o 1 n8n?5  1 s J5 nvn 1Ru 1 s o 1 nvn?5 £ j ¬ ­787 3 o = > 1 @?A%CBADE  HOB"INON Z ””” HOB"INON †Š {Š Vha%A + ) )  G%I"I GP )  HOB"INON ””” Z + ) l… 5 1]1 n8n?) stu #1 „K= )uv) 3 w u < u 3 5 stu ).j 1 o@5 n.j 1 ok‹7 w u < u +-5>‡j n u ).5 £ 1 s 5tn8n 1/1 s o 1 n8n?5  j .j 1 os7/n.) sJu 1#„HF 5JnLG‡n 1#M< )( NPORQ>S TUWV#XZY-[]\ ~{€^Y ^_ ^_`_#YRat~*bdcD_ecDf gh h ) m) < {5 n?5 3 G@j u < u +-5>‡j n u ).5 3 u + m‡o:5H+R5Hj q 14<21q< 5^tduv) 3 + 1 n j + m‡oJ5>+-5>j q 1x3D1-1 nvn?) stu #1 „K= ) 1 q 301 #.5  t5 n8q?5 s 1 m@IBq0G‡oJ) 1 u +m7o:5>+-5  q 1#„K= ) < 5 1 nvn.)@‡7 n?5 30= )WjM5 s J5 nvn 43 u L) nmm).5 £ 5 1 s o 1 nvn.5iz{G@5 3 J5 m 3 J5 n?5H m 14301-1 s o 1 nvn.       !#"$&%   ' ' (*).j 1 ol5 mm) < 5n).Gdj = ) q05 3o1 q 3 u w@G7q?)Ln < 5¦o u5r 1p„K= ) j ƒ + 1i1 n8n?) stu #1 „K= Y ¢p5qG@+r+R) < ) r 5 301 os7 7 m) < 5 n.5>+ 1 q 3 w@’G q0) < 5 o #1 „>= )@7 1 +RJ5 n?+ 1 m) < 5 n?5 3 + m‡oJ5>+-5>j q 1x<21 )s .5 r G u 3|1 s o 1 nvn?5  1 s 5tnvn 1R1 s o 1 nvn.5 1 nvn?) stu #1 „K= ) m 143 q u j < ) < L) nDL) wly.jq05 u 3 )Lni5>+ 1 +dw 1 n 1 n s o 1 nvn?5Jn jWˆ )]5B†5>+ m‡o:) 1 n.5 30= )j@5 s 5Jnvn x3 u )#nm).j q?5 u 3 L) n    s 3 u #1 „K= ) < 5iG@+ 1 s o 1 nvn.+-5 < 5 1 n8n?) stu 1#„>F 5tnE).J5 q?L) no ukr 14< L) n j <j  ƒ n?) < 5PuvG@j „HF J5 n|u 3 u 5Hj š NPORQ0N }_`_#YRa >~ ~{€Y _#cDf ~PV#X €‚\V`Y [c Jƒ„~ ~{€Y …†5 1„1 n8n?) p1 „K= )uv) 3 G@j < +-5>‡j n ).J5 q?L) n j  6w j q 1R1W1 nvn?) stu #1 „K= )@7Mj@J5 n8q?5 s 1 n.GOo u5r 1#„HF 5Jn j ¢ u n s G7q?5 ¤ j n. …tn < 5 mm)4j q?5 u 3 L) nm 143?1 L) nDL) wly.+-)/.

t 3 .

 *”      .

= >  .

)   . 7 5Hj = )-j 1.j x31 ) 3 ƒ + <>"/ ).45 3 GM+ 1<"K143.   2        @?A%CBADE  HOB"INON Z ””” ) HOB"INON †Š {Š Vha%A +  G%I"I ) ) GP  HOB"INON ””” Z †Š {Š Cha%A +  ) G%I"I ) OI l… 5 1  #1 „>= )‚5>j 3 5 1!„< G 1!#"$ 1!% 5 uv) 3^< )& ' )G@+ '2143?1 +G  0) )(*">143?<+ j 1!:<214< 5WG@+ @' 14301 +G  ?) -.45 5 32 + '+ 5H+R5Hj 14< )„G@+r.50) 3D< 5 ' ).+ < G 1!A  1! < 5 ' ).5 31  13  ?@>G ?) P< 5  !1 HK= )5d5 ?5 =1I 5B   J3 5>+ 5>+ 3?14‡K= ) <@11!% ) "/:1!HK= )M7#5>j = ) < 5H.<+ j 10:<@14< 5d+G  0) ='2143?1 +G  0) 7 &1 )  G „>= )… ">31:143 G@+ <+"$ ).5 3 J 5 K3 "H13  1x<21 G@+ L1 "$ !1 % 5 < 5 !1 1 ) "$ !1 H>= ) 3M 5wy 1 )d5CBM5H+ '> ) 3 G 0) < 5  !1 H>= ) 3     j JN 3PO@QSR.j05 J3 ) 5iz{G@5 u 14‡i11!1 ) "$ 1#„>= ) " ) 3?3 5$ 1 5>j 3 5 1!B"$ 1!% 5   5 £ 3 NPOR%Q C }_`_#YREa D>=~ FAGY a‰Y„f ~PV#XD€‚\V`Y [c $Dƒ„~=FAGY …†5 1]!1 1 ) "$ !1 H>= .j 43% )…iG@+ )@?ly.50) " ).j05 :3 ) /3 = > @?A%CBADE 54 F h DHIND H"I"OLCU]!4I B   HOB"INON L UQL I IL    B"IJ"K D G!AA 64 ? S M" INSHB"INONN 87bN ” h O?4I F ) HOB"INON MŠ Z 9  Vh HQ4DG + g 9 4DG ) GP :4 # 'c)  HOB"INON †Š {Š Z Cha%A + )  G%I"I OI ) …l5 &1  #1 „>= .)   .."/ 101 5z{G@5 1!" 5 1?1 +G  0) n< 5H...

% ) "/ 01 HK= ) " )4+ 1  %3  ?@ 687):"FG0H<= IJ70BK:L=MENO HK7C: :M N"=K  M%F.GMKKUT7 M%F.MB 9L70=0:< F.MB   :L%>G%7 M%F.= K:< F.MB" R   j <@3%V#W G 143 ?5YX‰G@5>j@)LZ\[][][ 3^ + '  3 MG u 1"03 ? 3 R.GMKK  b 3 3 o 1 n3 7C: : M  H  %G7F  T"7 MF.GMKKUT7   MFMB" F.

' )  :1< 5 3 ) .3?1 + 1!HK= )W5H+ ( ¬ ­787 .

         .

  .

    N .

.

MB !   G%7 M%F..GMKK  7C: : NM7C:  b   T"7 MF.MB  II =0:<G L=':HL:   II  /5 :L>G7 MF0MB3O 1 5 < 5  1!HK= ) ' ) < 5 5 3D< 5 "$ 143?14<21L j05 :3?1" )..MB 9L70=0:< F.GMKK T7 M%F.:M:L"7 H :B T"7 M%F.MB"     /  :L%>G7 M%F.j05  Z 3 ) 7M5 5 10n< G 1!B"/ 101 5   .<+ j 1!J<214< 5 +G  0) 7 ' ) < 5 5 3  + '+ 5>+-5>j 14< )pG@+ .MB  b L=':HL: M:LJ7%H :B T7 MFMB ! 9L70=0:< 9L70=0:< !   F.j " 5  0) < 5 +< "/ ).:M:L"7 H :B T"7 M%F..MB   :L%>G%7 M%F.50) 3Z< 5 ' ). 1 +R5Hj ?547 < 5H.MB !    T7 MFMB F.+-) 1 +  1„< 5 R 5=X 3 …†5nGM+ 1|<21! "$ 1!% 5   .MB  -  @=.j 4%3  ) 3 R "$ !% R 3 j <@3%V#W G 143 ?5YX‰G@5>j@)LZ\[][][ 3^ + '  3 MG u 1"03 ? 3 R.5 Z 5PG> :‡>143 ) " ).GMKK b 7C: :N  H%G7F  T"7 MF.GMKK F.B0H :]II % /5 :L>G7 MF0MB3O@=:M:L"7%H :B T7 M%F. ! F.5 3 5>+ G@+ 1#"K1x3?<+ j 1!J<214< 5D+G  0) 7lj@) .GMKK b  7C: :  ::M.?G7 MFMB" F..MB aM:LJ7%H :B T7 MFMB  b !" 7C: ::@=.MB..45 3 G@+ 12"K143.LL: 0LJ7% H :B T7 MFMBO        H%G7F  T7 M%F.

3?1 + 1!HK= )W5H+ ( ¬ ­787 .' )  :1„< 5 3 ) .

R N .

0 j <@3%V#W G 143 ?5YX‰G@5>j@)LZ\[][][ 3^ + '  3 MG u 1"03 ? 3  *       .

  .

    R.

' )  :1< 5 3 ) .3?1 + 1!HK= )W5H+ ( ¬ ­787  .

" .

j . 1 +R) p1!'@3 5 5>j 143i1 j@5 " 5 %1:<@14< 5W5„) '@3 )0 I  ' ) <21! " ).45 31.50) $3.  %  ˆ 5 ?5 "K1!' I0G  )d.F 5 5>j 3 5)@?ly.

j  3 G>?) 3 < 5 " ).45 31?= )@7†) " ).45 3%0= )@7l) + V 0) < ) < 5 " ).j  3 G>0) 3‰< 5 " )4j{..j .R 5  G :3‰1!'@3 5 5Hj  1 Z 5 ) " ).j .j  3 G>0) 3 5 $3 W.5 310= ) 5H+M5 301 j HK1! 5) G ) < 55CB '>"$ q5>+ " ).

j  K  "K!1  5 < ) 3 5  j?5 31'M3 5$ K"K1!  3 NdS^Q>S X Y^V V D Y„_.1" G05Z 5 1! j <21 ) G ) < ) < j 1 + "2">1! >7 < ) " ).

‚~XZ~ a*YqU „cnXo_#bdcD_ R.

*q           5B '+"/ KX 1! 5 ( '2143 x+R5 3 ) -." ).:bacAed E..5 310= ) 5 < ) ) ' 5 3014< ) 3 5 D< 5 " ).j .  /.'M3 5 5>j  1 Z 5 1 5  G :3 ) '@3 !)  I  ' ) '2143?1 < 5H92j HK= ) 5]G ) < ) .5 %3 0= ) 3 ..E&FHGJI LK4MK N8O G6PRQ S N'ONTO GHI NVU ! G M@W NX K4MK I LKVWJW G  KVW G  W G N.j  3 G>?) 3 5 R< 5 " ).j .     ! #"    %$  ' ( !   *)  + %$ -.E&FHGJI LK4MK N8O G6PRQ S N'ONTO GHI NVU ! G M@W N( I NVU ! G M SfG O GhgiP.Y[Z 04\]:4^_793J0=^`5T792.:=< 09>@?/ACBD  E.0 1%243658&79! 2.

Y€ Nƒ‚ƒ„ rtsWu4vnwvyx{z|u`Š ‘@«Ž« ž ‘@«W «W‹ ˜A •• ž ‹  «f’ˆ ’&‹@ ‹@Ÿ ž   ¥ ¨ žf¨ ’ «W A‹ ¦ 5 ž •• •• ‘@«Ž« f §  ‘ ‹ ¨  ‘˜‘ ¨  ‹™›š]f’©‹ ˜‘ ™ «f’› ’©‹@t˜A "sGx ~V‚`~[ƒ ‘@«W ‘@«Ž«W9˜Af ž ž ¨ ž ‹  ¨ ‘˜‘ ‘8‘b’ fn« A‹ «W A‹ ¦ ¨ t˜A ‹™›š]f’&‹ ˜‘ ž ‘@«Ž«W9™Ž‘@«W .E&FHG W I MM j !VKN8K O G{I N MP K N MW G X M N IJG WJW'K#K I NVU ! G MJW N G Skg U|x w j X&NJy  M  M YYY E.Y[Z 04\]:4^_793J0=^qpsr*\]0tacAed  E.Es} W NRO G O4~VU K P{jcITI KVW S  W G N.E&FHGvu U j N8ON PRQ S N'ONTO GHI NVU ! G M@W N w j X&N FHG j O ""kNJX G S N w j X&Nixzy E.Skj X&NmlnX K4MoK N giS M N kS j X&N( W G N.

4‚ N   .

      ]            KVW G X S M  W'KVW .

7C78\ 3 ^+`:ƒ^r-. 7b7&1 7 ro.=7C7 af5T792. .G U G FHG M j !VK O K  +`:ƒ^r-._7&243h+`:4^4r-.Y  w j X&NTO G M  w j X& N KVW .:'Ad E.Es} W NRO G W S K SkjcITI KVW S  W G N{.

G W S K S jcITI KVW "S ! KVW $G # xfO G M y  E.E M G&%_G (M ' U I j KVW G O4~U K P{jcITI KVW S  W G N.Y4 w j X&N ) M &G %.

O4~U K P ~ ITI KVW "S ! w j X&N ) # x M y  NdS^Q0N * cDa*cD_`_ DH[‚~^[c [c a*Y„U{ cnXZ_ G^Y M ) ".j .5 13 ?= )]5>j  3 5W) i<+ uv5 3 5Hj 05  ' ) jlGM+ VH13 " ) /3.+ "y .?1 ?5zlGM55B  05G@+ 1   5 301x3 z{G  1‚< 5 "/:!1 1 5 L'21x301 )  ' ) j{G@+ V>3%" ) 5z{G@55CB  ?5G@+ % 05>+ 1/< 5 " )..

R.

<21 .3 .+ ' 5 3?<@1..1% +‚7AG@+  j?5 :3 ) ' ) < 5 5 3 " ).45 3  :< ) /3 .45) 5  G   j 05q5B†5>+ '+ ) QAW.3?1 + 1x< ) 3  1  + ? V + ' ) < 5>+ 5 23 " )4j{.j . 5G@+ < )4+G ?  5 ' ) < 5 5 23 " ).5 3  J< )/5H+  j ?5 :3 ) (*" ).? 5 3 .  ' ) L< 5H92j J< ) K' 5  ) '@3 ) .45 3  :< ) 5H+ < ).j .>G ?  5 (* 5>+ ' 5 3.

1x<21 WY30/ G@5 uv) ">%3  14< ))@) ?ly.X 7AG@+ 3 " )4j{.5 "H13  1x3 GM+e@) ?ly.45 3  :< ) '2143?1 X 33 j  3 $5  1 j ?)@7j = ) VY' ) 1 I .+-) 1 "$ !1 % 5 W VW< 5 %" 5Hj < 5>j ?5 <21 "$ !1 % 5.) ? OW< )  ' ) X5„)@) ?ly."/:1!1 5 < 5 31 .$5 ?) < J)  ' ) !) ?ly. 1 +-) z{G@5„5CB  ?5„G@+ J1 "$ !1 % #5 X 5^G@+ 1.5 0) ? N 7Au 14‡ 5>j < ) X ? N21 < Oƒ 5WGM+ @) ?{y.$5 0) ?2t†7Au 14‡ 5Hj < < ) X ?2t 1 ? OƒP 3 (*)..$5 ?) < )  ' ) W ' ) < 5 5 .$5 ?) < OW< ))  ' ) W#30/ GM5 ">%3  1 +-) ) @) ?ly.5 0.

GTYVU W U CED. W 1 '2143  :3|< 5G@+}@) ?ly.@9A 7BCEDF7GCH:= A K <LNMOM A >X:. 7 ' ) 3 z{G@5 X V +-5>j@) 3 z{G@5 W#3 .ROS<C K Q :OROS<NC K > CHD.=?> @. 5CB†5>+ '+ ) 5 1"$ 143 5 " 5 3 56798.@]_^ CL =9SF`O7Ga= IdS0c0U A bec0U @O@ IdSNfdgJS0chU @O@ IdSFjgbechU A bjgJS0chU @O@ ^ 7G_R ^ Dut?U W I ba=GCE:=I K =E8TD=E87PS0c =9i 9= i 7 ^O^ =lkmSFjPDan=o: ^ 7O7D Kqp 7rbjVs ˆp1J j  1 R IdSFjgbechU j <@3%V#W G 143 ?5YX‰G@5>j@)LZ\[][][ 3^ + '  3 MG u 1"03 ? 3 R.GT6VU W U @.5 0) < ) )  ' )) X 7 ( u 14‡ 5Hj < ) W < N41 ? Oƒ .@9A 7BCEDF7GCH:=JI K <LNMOMPI Q :OROS<NC K > CHD.:<.GZ8LFCHD[\ Q @.

' )  :1< 5wv 3 ) .3?1 + 1!HK= )W5H+ (yxzx .

+ '+ 14< ) 3L1!" G 01 ) 5 3?3 ) ) G >= ) '2143?1 5 ?5  ' ) < 5 'M3 )@?  5>+ 1#V )dG ) < 5 " ).j  3 G0) 3 5 D< 5 " )4j{.      ]         ƒ‚   N ) "/Il<+ )uvG@j "$ ).45 3%0= )@7 < 5 1"H31 ?) D1 5  G J3/3 NdS^Q%C gYqU‚_.+-) ? O j = )J05>+47m) " ).) + '+:14< ) 3 u 14‡ ˆ 1L j  1 A SFjs 6rgdbec s 6VU 3 bjdgPS0chU 05>+e) 1  3% ?@G0)Bm7m5 < NJ'M3 5 "$?1R< 5qG@+rB5qG@+ 3 (*).j 1L' ) 3 z{G@5 < O ? 5>+) |1  31 ?@G>0) B]55P) " .

.j .Ga= ^ b7 K =qD 9 7 ^ Mn=lk ^ 7 K 7SF7ZR_8 A [ K =qDM9 G .50) < )Y ' ) < 5 13  . 14< ) 3 M 5wy 1 )d5B†5H+ '+ ) 3 ? O#1I  3 R  H 56798.j  31I@ G@+)@?ly.50) < )  ' ) W 1 '@143  :3 < 5iG@+@) ?ly.5 0) < Y )  ' Y) X 3 6 0) V 7 3 5 " $5 ?m5iGM+ !) ?ly.$5 ?) < #)  ' )=? 1! 5i5 " ).@] =qDM9G ^ R.j  3 G>0) 3 G> J‡K14< ) '2143?1)" )4j  3 G J3 G@+})@?ly.=?> K <LNMOM A > :OROS<NC K I Q CED.GrYU @.:<.5 31?= ) V G@+ " ).V#XZ\V`Y^X [c a‰Y„U{ cnXZ_G^Y + " )4j  3 >G ?) 3 < 5 " ).

.45 z{G@5 )&+ V 0) < ) 3 ]' ) ( .45 3 ?5 3 G@+r)!?ly.j .5 3%0= ) V G> J‡K14< ) '2143?1" ).5$?)]y".5 31?= )@7 < 5 %">3% 0) 1L 5  G :3$3 NdS^Q   nV`Y-[Y„_[c a*YqU „cnXo_GY  an~^_#V + + V 0) < ) < 5 " ).+-5 '2143?1"]' ) 3  ) ' 5 301 0)  R j <@%3 V#W G 143 ?Y R. j= 1 A bjdgPS0chU j 3 5 1 j 0)@7 5   . )  G "/ ).45 3 05 3p< 5 Dˆ ).50) ? 5) )@?ly.45 3%0= ) < )d5B†5>+ '+ ) 1!"$ + 1 7 3 5 )  .j .5$?)5H+ ? 3 v 1x301.) j  3 G0) 3D< 5 " 4) j{.5 " )4j{.? 5 3 . 5 3 +-) 3  $  IdS U  iU r S gJi U @) ?ly.45>+-) ) M' 3 )@?  5>+ 1<21..TI =qSa`F\ Q G p C_ M 6 gT=qSa`Vs 6VU G p C_ M Y gdt?U W W U IT7 K =qDM9G ^ CoR_8 A (*)4+) " .j .. '@3 )! I  ' ) V <214< ) 1 ? 1! B†) 3 . !i< 5H.3% ) G@+ + V 0) < ) z{G@5 " ).5$?) < 5PG@+  ' )5>+)4G> 3 ) 3 .uv) 301 + "H13  1x< ) /3 ˆ 5 05 ">!1 ) V j@5 " 5 % .j .45 z{G@5 j = ) 'M3 5 "$?1 5 3<21 +-5 + 1 @5 301 j HK1>3 ..j 143 5 ?5 'M3 )@?  5>+ 1 G 01 Z 5G@+r+ V 0) < ) < 5 " ).5 3  1 ) )!?ly..? 5 3 .

3?1 + 1!HK= )W5H+ (yxzx 5 X‰G@5>j@L) Z\[][][ 3^ + '  3 GMu 1"03 ? 3 . .' )  :1„< 5wv 3 ) .

N _            >          ]     .

j .@ 5..5)G ) <2 )-+ V 0) < ) < 5 " ).6:<NC K EC GNL K E= 8rReM_=Pba= K LFMqG 7FMqG7˜GC K =b7 ]*))  Š NdS^Q+ gYqU „cnXo_GY c-.? 5 3 .@ 5.+-5 <@1"/ 101 5 1# 5 3]" )...6:<NC K EC GNL K E= 8 =RM_=Jb7 K LNMqGTb7 ] K U @.5  "!#l7 5  G :<@1„< )Wj@).:<.4) "$+Y' ) < 5 05 3 GM+ L1 " )4j{.@"$ 8.# /.E&FHGJI LK4MK N8O GhPRQ S N'ONRO GHI NVU ! G M@W N 04\]:4^_793J0=^qpsr*\]0tacAed  1 '2!1 :1 .5 3  :<21>3 v 14301 G 0143 .:<&% K CEGNL k K =qD 9 7 ^ GN7db7 K :FL ^ LPS @.. 3?#1 "  1 .=?> IdS U ] K U S g K U S g [ I\ K U S g M9GNLGC K K LNMqG('dI @.5 %3 0= )M7 .45 3%0= )  + '+ I "/  1 )4G‚5CB '+"/  1>3  56798.j .D>aBDCV ~ UY„_ a*Y„U]_.     ^(0&3 3 r*\]0 I LKVWJW w N PRG YYY E.

45 %3 ?F 5 7†G 5 1='@1! 1 .G? H(BG5.j  3 )  5 <2!1 8" )4j{.j  3 G>0) 3/3 M 5wy 1 )d5CBM5H+ '> )  0    j JNO@3PO@Q ) < 5 " ).j  3 G>?) 3K" ).=<2>&? @A&.+ 1  "K1 +R5Hj ?5 3 …†5o.4) "$+ j = )|z{G@5 31 )D) " ) 3?3?1 7 )4G 5 y 1 7lz{G@5 3 05 83 " ).3":"7fJ h N 2#3*@=CB(2#3r\Žd 2#3*@_2i`iUJ KM"B@"Bb:*BP@"B\#2*dUJ SPSTZGsx‘twv6x&Y9x R 59>98*@_<&<u’9‰A2#3*@ \l:"B@"B6dJ“g’FJ SPS”kpZsŽkm=•x&Yx ‰A2#3*@\l:*BP@"BdJ j <@3%V#W G 143 ?5YX‰G@5>j@)LZ\[][][ 3^ + '  3 MG u 1"03 ? 3 R.R /.5 3%?F 5 ) " ) 3?3 5>+ 1 G>0).I? @":J 57B&??LKM"B@&B N H 8*O(7&2P5Q  2#3*@LRJ SPSUTV9W&X6Y Z*[YVPZ KM"BP@"B]\92#3*@_^RI`ba4c(d QeRf\#^Rgd Nih SPSUTV9W&X6Y Z*[YVPZ_jVlknm o prqs*j*s&Y SPSUmo4prqs*j"s"Yutwvx&Y9xzy9s4WY|{Po~}i€ h J J ‚ƒoy„{PoGF…‡† > 2:I‰*A2#3*@ \59>3? @_KM"BP@"B(Šu:*B@gd ˆ ( N 59>98"@_<(<‹:*B@ŒR<"<(..V#XZ\V`YX cD_ea*Y„f c-..+r5B '+"/  3 124365798(:".$DHaBDCV  3 + 1! G@+ 1!   5 3?143 z{G :1! 7 1! " ).j . 301 "  1 .B4CD 8?"2#3*EF3(BC6.5p5B '+"/  j 1< 5 "$ 143?1!HK= ) < ) " ).

3?1 + 1!HK= )W5H+ (yxzx .' )  :1< 5wv 3 ) .

  V V    K.

.

          N9>O S x"s4o(V‘•(.

m mZsxuV&jVZ"ZmZ=[ k]m4ZPZ"V ‡p V"sX&Zs4W6Y=ZGmjm mL[ k 4s WY  x  ~ X jVlkgV_m osXGYPm=[ k jPVW&X6Y Z[gYVPZ p x9Z&x~twvx&Y9x4[m  ZGm*jm m=[ k slWGY  (x"sbj ZGsxZI[ k V  m*Y9V twvx&Y9xbmIj.

@P8*A3 a6J  h S  V 6s•*x"•&m6‚  X"V•*mbmo4p-q s*j"s"Y=mƒk jPVW&X6Y Z[gYVPZ x#"•xIX(mwk‘["X"Vu•*mFm o prqs*j*s&Y‚ ! ###### )((  x9W•Zm%ŽkmZj["Z6sPVIT9x„p'& &Zs4W6Yy4•x&Y9x"0132 &Zs4W6Yfyl€4  1 *€ $ +5 V9Z&x~jPVq#V6 [6m‹x X&x9W•*V(T#*+*-.&xlkgx9Z&ZGs W6 Y  lS 5>8@ <"<6’9‰A2#3"@-\4a4cGd J“’J ‰A2#3*@ \4a4c(dUJ A".'./ Sx0V9[6Y pxgq4x &Z(xIj.

=<  m o prqs*j*s& Y j pp ‚4I  2g‚|s#W pUxPX*Xs W 5 xZ 5 [k m WgY‹LV-7J?K&ZGs4W6Y y9jVW"XY_twv6x&Y9x>F*LA $ ( [bX&m  x =jV#k]mo4prqs*j"s"Y|VFjV#kpfs6q4x*•*VPZLW6:Vbx"jm*s*Y9xbxFj(x#kx*•"x &Zs4W6Yfyl€'1 lS  -c `c Fn~ ‚~ Z~ f J‡ A" .  H ' MONQPSR T VUXW g vhi6j-k_h g /tq VU Vl j-m mu6i6h %  \[ m l h =nIj l po j #j l mu rjvkwh hIu=nIj l po j gzy ZY m ?6ƒ Iq m $3 .(x m_m o prqs*j*s&Y W&x87ZGm4W6YPmb•PxF•(m*j6q4xZGx9:"VL•PV‘jPV9W(XYZ[YPVZ4 x#"•x‘jVlk‘["X"Vu•*mFm o prqs*j*s&Y‚ ! ###### x9W•Zm%ŽkmZj["Z6sPVIT9x„p'&  )(( X&x9W•*V(T#*+*-. 5 *+* m.+<  mo4p-q s*j"s"Y9j p*p m.Ž† .=<  m o prqs*j*s& Y j pp -‚ &#<6‚ jV[q#•LWGV&YjV9 W 6mZYC? P€DA YVE?ŽjV9W"XGYFtwv6x&YxGFHA m.j 1 " .'.=<  m o prqs*j*s& Y j pp ‚ ”9W>7G["W6j"Y*sPVW@?ws4WY kx&s4W y BAw‚ m.j " hIk  h pj hi6jvkwh  i6m )' j  h '6l h I l i6j|{}u  LW4]_^`]ZYa^cbedH]ZU l rh lSq l j " j G\] bL[fY V rhi6h hIkak " j %1 i6mi6jQi6j " mXu6j  mk~mi#h l hIk_j-u rj rs h hIu > q i6j "  lSq+xlK" hu 4j % h +nj l rs h  lpq ph 3 l j " i#j  k '+"/ mk_j-urj mi}m 1 3 hIu=nIj l rs h j€‚h l j-k s h u mk … " j…„pm g hIk gzy "  hIu R q " k  hIu   u6i  YX m l pj " i#j  % hu+nj l po j rj hi6j 1 mi lrs h h q‘ 1 $ ' s h u hIu=nIj l rs h ' m q ' s h u ?  ?  h!pj " ?)hh A(  %V#W˜q l " hIk lpq rh l j -† "/ u'“–“Lc€—m  }m R " h lSq rh l V phi6h gzŠ g  h m q rj + q .

 k '> ƒ "$ rm /3 $ lVl j rh l u6h ' Y" hi6jvkwh hi6jvk mŒk 3 j l   n ‹l q m @?  k‡h „Sj rhˆi}m "$ m % j‰jvk q keh q  l h ' $3 h ' † h   V rhi6h i#j " hIu=nIj l1ps h † u6hXjŽ#jvk '> hOm!?}m  h † hXh ' j l mi#h l [   jj 1' j l V " hIu=nIj l   i6h•j-k  lpq j † mu p  hm " 6mk~mi}m`m $"  u0“”“L † €‚h l h  † "/ u L  j 3  j-u6’ q †l j ph l u6mX€—m LZ\[][][ 3^ k '  3™q € 1"03 ? j-u6h  hIu=nj l pj lOq l R.

' h   mi6jwv  H l h Il mkwm šs hXjvk y xzx h m j .

"vl1 m lwq k ' hIurj xl h ' m l m m /"  m 1 j&?}m jj ' hIurj ' m l m q kCh@?+„Sj$rh•i6j q kwm /"  m 1 j_i#j l1 nmi}m ( nj…„pm " m ' ƒ q> h h@? l j j q jvk pj-k ' u ' k   hIu rj xl hQi#j " +Hšs hi6jtj|j vq "$ hIu}m = ' h W q+x lfq k j „pmtm j j "$ m % hwj’ q ^ C0/ QOW U @.7Ga= g jvi gzy hIk g mOh_u#kwj l hOi6jt€ q ' m m m q € q " m l m u  rj j\jvn k k~m yv 6m njjŽ V p hi6hOi6j " "$ m % j ?a.:<.3 1' pq#l 6l j q † j\h /q   ]ZU wq kwm  ' y >  lpq rh l m  hIu q % mu6i#h~m l Iq hIkC’ q („ j_j  y  2%I lSq rh l nm  K" j l   1 nmi6hti i#j l ' u "$ m % jQi6j l% nmi}mXu s hwh "-q+ m V phi#h ]" hIu=nj l rmk ' m i6h  k kwm q l H V phi6hOi6j " hu+nj %l rs mXhwk_j kwh ' h 3 k k "$ m %  (* jvu6i6h.Ž† i6j|nIj Z j X /"  m 1 j y † j\i6j "/ m l m l]" hIkwhX€ l% j-u#i•i#j-u l hwi6j=X 3 Hvo 1 j-u6i € l j u s h ' hi6jvk "vl1 mi}m j l " u6i %V#W˜q l DvU ^ Dvd dH] ^!‰U" D-d q k~m "$ m % k '+ j ( ) u # > m i6j "$ m % j v†]' hi6jvkwh .=?> J6\  p C<7 [ K =qD K =qR.Xu s h 6j l i6j xl mQi6j y .NN   NE 56798.GF7FC ^ =J:FL ^ L K <LNMOM7ZSFLFM7 @.@ L:=qDGNL:FL ^ L =qSF`.%" m k Hšs gQy " % .Gu'r' q=qSF`.@ :_7 8 6RMLbF= C K28NK LNMqGI9 ' + $ 8L21798:5  [ :_8 \ U l R.7Ga=Zb7 ^ C 9 LbF= @.@ :=qD.

-FLG LZ\[][][ 3^ k '  3™q € 1"03 ? j-u6h lDq j l m l ’ q 3 )}q   '  l ?}m j ' m l m q k ' hu pj ‹ l hOi6h.' h   mŒi6jwv  H j j % nmi6h V '+ h 3 j|j-k j l +. ' hL  ' h W j l1 nmi6h *  l j$rmh q. u6i xl jmk_j-upjHi6h  ' h@XLm j †@" m h " hIu l .l% h l jrh l u}m > ‹  3M  YX "vl1 m dZY0W hu pj ‹l h m l pj + l j|€‚j l hIk j h‰jvk ^ D 6 .

U @O@ 7 ^.sOs K =qDeMqG .^ = ^ K ^ CLbF=Mo:aL ^ L D s.

W U K <LNMO.=?> M +. M + $ 8L21798y> :OROS<C K K <LNMO.sOsOsOsOs.sOsOsOsOs. U ^ DysOsOs VU 56798.8 gbOY_DFL98 R   '+"/ rm 3 }mk~mi#h_i#jQ€‚h l k~mŒjŽ ^(0&3 3 r*\]0 S j X&N( KVW G X S M  W'KVW GJ X S M  KVW G. +3-FLG ^ 4 C /(5:_8 U :O8 gJDF7  + $ 8a2 L 1N798 [\ U s.:<.sOsOsOs + $ 8a2 L 17 8 5TC.sOsOsOsOs.-FLG ^ C0/ Q.

U G S j X&N FHG M j !VK ON  S j X&N FHG M j !VK ON X S M O4~VU K P{jcITI KVW S ! S j X&N FHG M j !VK ON # zx X S M  KVW G y  hu+nj l rjŒh   .

 i6jv€—m q    .

l% h " hIu=nIj l pj l h ' hIurj xl hQi6m "$ m % jK?}m i#j l1 nmi}m 3& rh V €‚j  r  h " hIk/h q+ hXi6j " m V  i  u('k  " h †+q k " m  l jšm  $-mi6hZj-k q> m_m ' m  mšn l m " }mšnIjZi u}mk " 2" m  3 M j…„pmXh '6l h! I   ' h 3 €—m%$-j l " G\] bL[fY rjvkwh mu6i#h ’ q mXkwjvu6h     .3 3 k m Iq kwm h " m %xo j SV u6j " j % . >  3  k_j-u rh m l mm h_i}m j€ q   rj ' hu pj ‹ l h`m ' h  k_h l { kwh † y m ' 3O @.

=?> B ^ C7Db sOs.@ 8aLNMo:=b78 M7 B ^ C7Db sOsOs ^ 7G_R ^ B ^ C7Db sOsOsOs ^ 7G_R MONQP " † h   ' '.   /3 m % 56798.:<.s ^ 7G_R @.

o<C9bF=?s eU  hIu hu+nj l rs h‰jvk  k '+ ƒ "/ m hIu=nIj l po j '>"$  i6m hIu=nIj 'r'6 Hvo j 2" "/ m 1 j %l rs hwi6j-u l  hu+nj l rj l hwi6j u  " n l m '+"$  jQj| g g @‡ q >   l h Il mkwm šs hXjvk y xzx .

   H  .

  .

      .

 .

     .

# q3xl h q Shi6jOi u}mk - 4 m 5(  jrj_j|j-k23‹h  u   q3 ZpjXh q Shi6j jŽ  j Hvo j. N9  jrj‰jŽ#jvkxh †-l m5Zpj q k hIupj xl h#k ’ q j~m )hIum6m l m q k@h!„Sj"rh  & kwm #Ijvk $—i6j l% nmi#h'&"(v h:Z pj l h l kwjvurj -l m  & kwm #Ijvk*)‰m+}m l  ‹l i6j. <2>(? @A".9G N‹h J SPS ######## vmZ6s. † ’ q j6S  j lps hwi#j v l%  m V  u6h y m 6ƒ7 q ‹h N@N ( 0    u# NO ( NQ S hwi#hwi u}mk 8 Z  m  † 9 j  i`j\j|  j H-o j.6a ˆ 2 A*@*8(B&7 h J ˆ >(2 :DC\Žd N‹h J SPS ######## 6 A xX(mFE 57B&?? &B&?9.G? H(BG5. <"@'BH&.(2#3C">gD ~ 8?"2#3*EF3(BC6.( SPSTV ZGm=["X"V•*mbjxXYL•"s W3l: ksjPV 6mZ6s-7s*jPx"•*VPZI•*mIYspV |mbm oj*mX*X.(m9X SPS=( < oY ZGx&s•*VL•PV?>'<'+@  •PV?A VZUq#x9W•=T** 24€Lmx*•*xŽpfYPx*•*V  1~2 365P78&:&.rh  l% mi6hOjQm  hu'r mi6h/)h l 6k V\q k h !„Sj.B CfD 1 2 365P78&:&.phwi6h0  )h  & k~m #j-k ( v R  l jS j-u m Z1p jwu6h•j|j-k23xh•m*pj.6k † q rmu6i#h h i u}mk - Z  m ( )}q u  hu}m)h l ’ q jwhh!+„Sj.b?@*:fJ N SPS ######## 6 A xX(m 57B&?? &B&?9.

PA62 ˆ B*:"Bi:J M(.&“`*“6’&<"<|@'BPH&.G“P“ &B&?9. GSIPO GJ v px9Z&xVA9E Y 5>8@ <&<G ’ K(.*B&7(2ML&B“8C“59B(? @“G:2 33N C25P>*“ \#:&>O*35BG?@dP“*:.'G N‹h J SPS ######## 2#3*@LCB(243r\Žd N @ A'B  N M(.G“P“3W&B&?9.aP“*H&BPA"B(“W&B&?9.93":"7J h .(2 : \ƒH*:dŒ 3&B C.G? 87@&BP3"@(. @ R*A&> O‘O(B*:&^(5B(?9@f\Žd J SPSpZm 6sPx4k mWYmu•&šm 7 s WsP•"V SPSS<(XGY9x9Z x(YPm4W6Y9Vbxs*m9Z(xPZ [sPxL•Px_jqlxX*Xf SPSsXGYU V T' jxXGYu•*m‹[kgxFjq#xXX(m?A6 p x9Z&x|v‘m•"m pV"sX‘•*m W&B(?9'.A62 ˆ B:&B Q‡H8OG7&2P5 "B"?.A62 ˆ B:&BfŒl’<<".G2 :\ƒOGdUŒ 3&B4C. x*•*x 57B&??uM&.*B&7(2ML&B“8C“59B(? @“G:2 33N C25P>*“ \#:&>O*35BG?@dP“*:.a?IPOa|`|ŠI:J  x"s4W SPSj ZGsxFV  * m Y9VI• SPSPpVWYm"sZGV p x9Z&x v mZs Gx"•*x SPSPpVWYm"sZGV p x9Z&x?AGx9X&mP ixwp VW6Y9xip x9Z&xFV  m*Y9Vb• 5>8@ <&<G ’ K(.*7"?9.2 A(>“(A&.GaH H*8O(7&2P5 &B&?9.G2A&>“GA&.aP“*H&BPA"B(“(M&.\Žd=<(< .93&:"7J h . u6i Z\[˜q l  6] m l pj q 0^`_a_a_b(cxk25( q d€   (e! j-u6h l Y )h  xmi6jwv l h# l mkwm f s hXjvk y xzx .(?8G7P@&B3&@&.*7"?.A62 ˆ B:&BJI(D\ƒOa*d*dQPe`=c(d N 59>98*@_<&<u’9K2#H&>(“&:>"“"HG>3&@&.93":&7fJ 2FCn\\wH*:L`b:BP3&B C2P5^"5B&? @<&M&.'GrŒ#’<<&.PA62 ˆ B*:"BJIPH*:J &B&?.93":"7fJ 2FCn\\wOG=`b:BP3&B C2P5^"5B&? @<9W&B&?9.'GXI(D\ƒOad"dQPe`=c(d N 59>98"@F<(<L’9K2#H(>&“&:>&“"H(>P3"@&.\Ždu<(<‹.(“P`*“*“g’i<&<‹@'BH&.

 NEy `      .

   .

 .

      @'R*A"> ‘ O OGB:(^&5BG?@\Žd J h 59BP@G5FR N h 59BP@G5FR N \lOGB:(^&5BG?@d 59>98*@‘<(<L’.

93":&7 J \&ŒŒŒƒd 59>98*@‘<(<L’ "R5.P@P8*AP3‘cUJ h S x"P•x ‚ !  $ % x9W•Zm ŽkmZj["Z6sPVIT9x„p'&  )(( X(x9W•*V&T}*+*-.G?*?*>(“fŒŒŒ“6:62? HGBPA(B:"BŒl’i<(<i.@8*AP3]a6J .#  i}m l h rj  &   Shzi#j  hIu=nIj l " l h\^   l 'kwj kwm &  o j  6m hIk  h3i  hIk2   mi6h l mXh hIk † hOi  u}mk  h l jHjQkwm   xjvu'ph( -./ Sx0 V[Y m xgqs(x [ knjxXYI•&s W :#ks*jPV‘y9•"VWjPxXY I•*m A6xX(m  P tPs pVI•PV pVWYm"sZGV=ZmXP[ qYxWY*m }  v mZs Gx"•*x A6xX(m  mPxgqs(x [ knjxXYI•&s W :#ks*jPV‘y9•"VWjPxXY I•*m tPs pVI•PV pVWYm"sZGV=ZmXP[ qYxWY*m } )2MA6xXGm E lS  m l m .4 m   €—m  mk A@}m( /   hŒnh  i )'( h  u}mk -.4 Mm   k23 8  jQnh $+ u s hOi6jvnj q rm  l  . "“G:9B3(BC 2*5P^&5PB(?9@&“3C*B*7 & R >98f’‹<(< A".93":"7J A". g 2 ?> > g .'.@8*AP3]a6J h A". u6i l nIjQ’ q l jv{ l m_i k   lpq ^  k_j  u#€‚h u M  hIu l kwm †  j l k  pjˆh &  jQi#h_i u6mk 8.

Li6jbpj q hIk   mi6h l & ( v g vmZ6s.rh l u}m  $—h q }! mi .  u6hX€‚h l  l  nmi}mXh jQm v i   #Iu  {  & pjrm l h/ hIupj xl h_m  <  l j j-k g q A6xX(mFE q phOi6h q g g p xZ&x ShOi6h  m   i  u('k -  h Z u6j  j(.  m  &"(  6] m l pj q 0^`_a_a_b(cxk25( q d€   (e! j-u6h l Y )h  xmŒi6jwv l h# l mkwm f s hXjvk ^ u}m 8.l m_m/6m %pm #Ij-kai6h/}m $ xj  m  u#€‚h l kwm f o j..4 Mm 5( h_i u6mk q =< i  #Ih mQj-k q jcu q k~m u}mk Z\[˜q l   !pj > g Y m   m pj\i6j.4 m  l j.+ i6j|nIj nIj l {  m l pj h  m •i6jSj…„pmi6hzu s h Z mk !6ƒ8# q h3( > jˆ€‚h l mk #! ƒ-# q h † h -.4 m   0 m )j  i ( B@  j l m l ’ q3 mnIh . +   nIj l0 xm %SjXi q    - mi}m  † !}m SjXn xl  q m   † m  jpƒ‹nj  2)h l kwm  i6j  u/@6h † nIh .

'. x*•*x0 !#"$!&%(')+*.-/'102')3"54&6&7981602: Y   #xm   8 .4 m 5( k g p xZ&x y xzx l .

Oy &  MONQP    >  .

‚ tW . jQm dH]     Y0W   .

-d dZY0W # l m h  hIu=nIj l  o j i6j    h jvk rjvk)hOi6j  hIk2   m f  hk   mi#h l m v q r mOhOj lSl h3( ^ &3 3 r*\  S j X&N  N LO N S j X&N N W S K SkjcITI KVW S(! Skj X&N # xN y s h /rj † i}mƒ0h 0m  - ( l k_h         bVYW tW .

vd ]ZUbL[fY \] mM -.

=?> CED.:<.G LdgfVU CED.# 3q xla hwjŽj-k  M46m hIu=nIj l rjZi6j}h=m l mXi6h q !3xjM( 56798..( s h hIk q 56798.GZ8LFCHD[\ Q CED.#=m  † .  m   † p jZj-k  l h!xj-kwm .:<.  m  Ztq pmi6h2}m  hIu=nj l  s hw€‚h la xj.G 5:FLZg .   ?  9   23xh_m0pj.=?> Ba<O=LG B:eCPgf s cecc?U ba=qROS<7db: Cg MqN G LGeC K 8NK LFMqG&'bF=9ROS<7 ?  [ B:eCO\ U  MONQP vj l k  pj ]ZUbL[fY \] Z   u}m 'i6j\’ dH]  [b  upj l  l j.rm l˜q k  m (   j6 q m_k_hi6jxm #Ij-k/jm q l j # Sj l j  urj l  l j.

G'r$ ' 5 ^ 7FCED.G'r W MONQP-N&% 'EY ZU`^c] (9)!ˆb dQY0W .GN7 ^ : ^ 7G 8NK LNMqG&' Kqp L ^ K =qR.L?U ' #_:FL_g$#(' ':FL r ' 'r7Dba<lU K =qR.

-UXW4bL["!`[bLW  5 m -# q k '  kwhkwjvu ph l j . pm . l i6j xj [ :FLF\u'-'d7DbF<lU .

b?@*:fJ Y 57B&??32 N H 8*O(7&2P5Q  u6i Z\[˜q l  6] m l pj q 0^`_a_a_b(cxk25( q d€   (e! j-u6h l Y )h  xmi6jwv l h# l mkwm f s hXjvk y xzx .ph † €‚h  i6jSj-u=nIh ‹n  i}m`m !  !3  h rj  m 4^ )j  u#€‚h6“b( Y !  !  hMrj  m a9 j  u#€‚h#“SSh! l j  m lSl j.* - 0    u3# /.(24 3 C*> D 8?"2#3*EF3(BC6. ( ph_i6j 9 j  i ( 10 124365798(:".=<6? @A2#3"ED 124365798(:".   m l m~nj l% {  mMf s h`i6h   )h‰i6jXi6j"rj l k  u}mi6h~h!„Sj.G? H(BG5.l h3( .B4CD 124365798(:".v^ .rh( j…„pmQu6hŒjŽ#jvkx  hŒmM}! m  h †' hIkwh  hIk2} m l m l i6h   h! „Sj"r h Y j ] † 6m l m rm !)j l pj  s hi6hkwj.=<"' @ BPH&.=<2>&? @A&. h  j l mi6h l  ) j  i) hi6j p j l q p mi6h/} m l mOnj l {  m l h2  ) hXi6j q k h!+„Sj.=<2>4CB932#HD 124365798(:".#=mchh)j l mi6h l j 1z1 j 1Œ }m l m  hIk2}m l m l   )h˜i6h q  q .pk_h6   h( v m l m~€—m +* .

(2 59>98*@_<&<u’\Ž' @ BH&.(2 : \wBGdP`P`G@'BH&.(2 : \wBGdP`P`G' @ BH&. N _     `  2#3*@BJ h J 57B&?? W Q‡H8O(7(2P5 N H 8*O(7&2P5Q  2#3*@=O J h J 2 57B&?? N H 8*O(7&2P5Q  2#3*@J h J 2#3*@=CB(2#3r\Žd N BJ 2 WLO J J SPSj G Z sxFV SPSj G Z sxFV SPSj G Z sxFV m*Y9VF•PV‘YPs p V  jVlk‘W(Vlkm=x m*Y9VF•PV‘YPs p V AzjVlk‘W(Vlkm m*Y9VF•PV‘YPs p V  jVlk‘W(Vlkm    59>98*@_<&<u’\Ž@'BH&.(2 : \ OdP`P`G' @ BH&.(2 59>98*@_<&<u’\Ž' @ BH&.(2 59>98*@_<&<u’\Ž' @ BH&.(2 : \wBGd&d“P“P“P“ .(2 : \wBGdP`P`G' @ BH&.

&DG’‹<(<g\Ž@'BPH&.G2 : \ Od&d“P“P“P“ .

&DG’‹<(<g\Ž' @ BPH&.G2 : \6d&d“P“P“P“ .

G2 : \6d&d“P“P“P“ .&DG’‹<(<g\Ž' @ BPH&.

3":"7fJ :\gd*d"<*<".\Žd"“*“““““*“““.(2 : \wBGdUŒ & 3 B4C.G2 : \ƒB6d`P`@'BPH(.(2 : \ƒB6d`P`' @ BPH(.3":"7fJ :\gd*d"<*<".&DG’‹<(<g\Ž' @ BPH&.(2 : \ƒB6d`P`' @ BPH(.(2 : \Od`P`' @ BPH(.3":"7fJ 59>98*@_<&<u’“&@'BH&.(2 :\ƒB6d*d"<*<".3":"7fJ :\Od*d"<*<".

\Žd"<<&.GD&’‹<(<‹@'BPH&.(2 : \ OdUŒ & 3 B4C.\Žd"“*“““““*“““.93":&7fJ 59>98*@_<&<u’“&' @ BH&.G2 : \ƒB6dŒ ( 3 B4C.

G2 : \OdŒ ( 3 B4C.93":&7fJ 59>98*@_<&<u’“&' @ BH&.(2 : \6dUŒ & 3 B4C.\Žd"“*“““““*“““.\Žd"<<&.GD&’‹<(<‹@'BPH&.

G2 3"@ 9O".(2: \243&@/ O*.(59@z\#@'BPH&.G5@dUŒ 3&B4C.(59@L` UJ ? @A2#3"E‘3(>C6.G2 : \gdŒ ( 3 B4C.93":&7fJ SPSW(Vlk m"}Gs4WY 243*@z243"@ 9O*.(59@6“““““*“““““*“““.\Žd&dJ 59>98*@_<&<u’93(>C6.GD&’‹<(<‹@'BPH&.243"@ 9O*.\Žd"<<&.

(2 : \#:&>8"OG7.(59@“““*“““““*““.G5@ \#@'BPH(.*:">8"OG7*.(59@6dUŒ 3&B4C.243"@ 9O*.6D’‹<(<‹3(>C6.(59@<"<&. 9O*.$ 9O*.\Žd&dJ 59>98*@_<&<u’93(>C6.93":&7fJ SPSW(Vlk mG}L•*V[ q m=(  m*j"Y :*>98O(7.‘:">P8*O7.(5@u`UJ ? @A2#3"E‘3(>C6. 9O*.:&>8"OG7.$ O".

/ Sx0 V[Y   €  0^`_a_a_b(cxk25( q d€   (e! j-u6h l Y )h  xmŒi6jwv l h# l mkwm f s hXjvk y xzx .$ 9O*.3":"7J A".*:">8"OG7*.G5@I<&<".'.@P8*A3 a6J h S  V 6s•*x"•&m6‚  X"V•*mFY#pUms•|px9Z&x 6m9Zsš7 s*jxZuX&m•V"sX‘V  m&YVXLX:Vu•PVikmX kV~YPs p V x9Z(xbV YPm ZbVLW(Vlk mL•*mFsP•(m WY*s-7s*jPx9:"Vu•PxFj6qlxXX(mb•PVbV  m*Y9V  <ip lS  S ! x#"•xU‚  $ % Y x9W•Zm ŽkmZj["Z6sPVIT9x„p'&  )(( y9Y#pUmsP•ywx6}P}Y#pUmsP•ywx" y9Y#pUmsP•ywx6}P}Y#pUmsP•y " u6i Z\[˜q l  6] m l pj q X(x9W•*V&T}*+*-.D’‹<(<‹3(>C6.

   u   3 .

   y9Y#pUmsP•ywx6}P}Y#pUmsP•y &* y9Y#pUmsP•y 6}P}Y#pUmsP•y &* Y#pUmsP•ywx lW(x#km y Y#pUmsP•y  lW(x#km y Y#pUmsP•y " lW(x#km y WV#km*s WgI Y (  m"j"Y WV#kmP•*V[ q = m (  m*j"Y lS >bL[".

d .

q ph_i6jb  $-jvh€$—h!+„Sj. MONQP-NQN \] h j l mi6h l . q ph_i6jb  $-jvh€$  l &   .ph g . q ph_i6jb  $-jvh€$d  )h'& l j"rh g .rh& l j.

„  • s  W QUc] " " l m ^cb 0mk~mu l j rh l u}m l h ]'bLW4] @6hXi6j q k ! . -.    . M i bbL[VU`d  -. ( h +„Sj rh dH] - j „pmOm Y .   .

Lb ]  4 h  !    i}mi#j 0mkwmu/@6hOi6h0  )h3( l u}mXh /mk~mu @6hXi6hOh!„Sj"rh3( l u6mOh 2rmk~mu/@6hXi}m  xm %Sj\i6h)hIurj xl h3( " k "!# b )hi6jbSj lVq ^ C NLbNL?U ^ DFL =oGFL98aLD p J = bNL ^ DFL =oGFL98aLD p J = bNL ^ DFL =oGFL98aLD p J = bNL $&%'     $šmi6h  K <_LNMOM7ZSFLNM7 K <_LNMOM7 A 7 ^ CNLbL K <_LNMOM7ZSFLNM7 %(!)+* "+ l jv€‚j l hIk m^  *r \  w j X&N) M &G %.

4O ~U K P{jcITI KVW S"! w j X&N) # x M y  1 .

†6l j rh l u}mXh .

ZY  u}mk -.

.M7INLNM7F\ U M0C /7=BV[ K <LNM.@^ 7Ga= @ @^ 7Ga= .  m  5( 0   h0!6mi 4 s h~i6h Y )h  xmi6jwv l h# l mkwm f s hXjvk y xzx 0 .=?> K <LNMOM7INLNM7 5E:G ^ gZDF7  K <LFMOM7 A 7 @. M0C /7=BV[ :.:<.G ^ \ U MONQP-N  € ^c] g €                 $vj-h€ Ztq     $šmi6h\}m  .4 m   mk\! Z  5A   56798.@^ 7Ga= M0C /7=BV[ K <LNM.   u  mM(   Y > jZhOi u6i  u}mk -  m   }m Z\[˜q l  6] m l pj q l m q kwm "+ l jv€‚j l u  mX€—m A@}m 0^`_a_a_b(cxk25( q d€   (e! j-u6h l † h  h lpl j q k~mXj|  j f .M7 A 7 ^ C NLbLa\ U @.

s hXjvk Y y y > xzx  .Y  u6i N  N Z\[˜q l  6] m l pj q 0^`_a_a_b(cxk25( q d€   (e! j-u6h l  `  1   [  Y Y )h  xmŒi6jwv l h# l mkwm f Š & y .

  .

    j.j (  m_m2S j-’ 6j-u  mOi6j  hu' l h‹jtj-k q k  l h# l mkwm  hk  { MQMOP-N )UXW[  ]_^ .pj  m 6ƒ7 q ‹hnmkwh  m  l jpjvum l m  jŽ  jf o .

( b .f o j. q S h~i6jQj|  j. 0 3   .=<2>&? @A&.j % s h [ n   s h/ h 0 l 3( $vj l h 124365798(:".G? H(BG5.(.b?@*:fJ 2#3*@LCB(243r\Žd N SPS kxb•&s 6s# X :*V pV9Z Gm Z&VX(mwknjPV9WgY ZGVgq m •*mbm ZZ(V C"7P>*B@bB` Œ c J C"7P>*B@uOF`icŒ c J C"7P>*B@‘5~J C"7P>*B@I:L`I5UJ 59>98"@_<(<L’B`’‹<(< BI<(<L’“O&`’‹<(< O‘<&<u’5*“P`*“&BG“ P“PO“`’ <"< B 9O_<(<L’“:G“`’i<(< :I<(< .( hIu q phOi6j\j|  j f o j. jŽ#jvkxh_m !}m  h_k_h l m q k  l h 3! xjvk~m q  q m j-k  l h# l mkwm  † m_i  n   s h0 h l $-j l h3(    u3#  ( .93":"7fJ A". j|  j  pha!a. - h L  j\h  j.f o j )  j l k  rjQm  hIu3 lpq f s h‰i#j6 l h# l mk~mMBkwm   l h! q  rh  †  hIk kwm  h l r h‹j M @}m .B4CD 8?"2#3*EF3(BC6.P@P8*AP3 a6J h S V 6s•*x"•&m6‚   GZ(V 5 Z(x4kgxIjV#k s s9# X :"V p V9Z (m Z&V  [ 5 i•(.

V @s4W[o(S ' S 5 **=xwpUxZ6m*j*m jL}us4 W 7 y4•*mFs W 7 sW6s&YV  J $# %# '& x#"•xU‚ !  $x9W•Zm%ŽkmZj["Z6sPVIT9x„p'& )((  xG}I& }€=j"}xS }&s W7~•&}Gs4W7 lS X&x9W•*V(T#*+*-.‰dHb+.'./ Sx0V9[6Y Y Sh q f }m s h q  q    m xk_j-u rjQmi#h mi6m 0    u3#  ( V3 0  hkwh ObVY €—m 0 y "! -.

  l j ph nIj l s h 0 .pj  l h!3‹j-kwm Z m - #Ih  j [ n   s h/ h 124365798(:". l m  .B4CD 8?"2#3*EF3(BC6.j % .G? H(BG5.( l 'u  mwm .=<2>&? @A&.b?@*:fJ  l $vj l h  hIk hIk_h 0  hu' l h‹j   k3‹j. QY Q]   .

(“59>4C“POrQl’J 5*2#3 D"D OJ 5*2#3-Œ„E".93":"7J h A".( ./ Sx0 V[Y )(( X(x9W•*V&T}*+*-.„9   N y              Ba9  2#3*@=CB(2#3r\Žd N k xF•&s 6sX#:*V pV9Z Gm Z&V_jVlknjPV9WgY ZGVgq m •*mbm ZZ(V  C"7P>*B@bB` Œ c J C"7P>*B@uOF`icŒ c J C"7P>*B@‘5 J 59>98"@_<(<L’ P3"@A".'.*7"?.@\ŽdJ F2 C\ OF``ic(d SPS jPV9WgY ZGVgq m 59>98*@‘<(<L’ AA&>&“PO“P`*“cg’<<&. N 5‹`uB ‹OJ 5>8@ <(<u’5*“P`*“&B(“ P“O&`’‹<(<i5L<(<i./ Sx0 V[Y !3pj l nj’ q jQj-k !)h l mOh2 l h# l mkwmŒu s h/rjvu/@}mwkwm   q kQ! q # † jŽ  pjmOu6j  j  i}mi6jZi6j6Sj vl% m lVq up  hwi6j mM#Vj\nj l {  m f o jBmi 8 hIu}m  ( [ j q kwmXk~mu#j x l m #Ij l m  † h  hIu l hxjti#jQj lpl hVj-k q k  l h# l mkwm\ hi6jbpj l €‚j  phXi6j\i q m V€‚h l k~m .'.  hIu.93":&7 J .@8*AP3]a6J SPS # h $# S V 6s•*x"•&m6‚  GZ(V 5 Z(x4kgxjVlk  jV9WYZ(Vq miXsŽkp-q mX  x •xU‚ ! #"  x9W•Zm%ŽkmZj["Z6sPVIT9x„p'& ‚ < š j } x|S } € -2 $x9W•Z m %ŽkmZj["Z6sPVIT9x„' p & <"WY4ZGmFjVlk ‚l€ <&ZZ(V }|€ lS $ <"WY4ZGmFjVlk   )(( X(x9W•*V&T}*+*-.

f o j † ’ q j )j l k  rj-k / l mMmk_j-uphXj\nj l {  m f s h_i6j\j lSl hVjvk q k  l h# l mk~m(  ]ZU•dDb .„ q   hXi6h  < i  #h $‚€‚h l k~m q  q m  & †= hu' l hxmu6i6hOmOj-u l mi}mOi6j\i}mi#hVjQh  q h i#h l h# l mk~m( 3 m_kwj"r hi6hxh #  mi#j  hIu l h xj\i6j  #mwh  < i  #IhOkwm    hIu#€ q Sh †  h  Vh2 l mMrmk_j-urh_i6hBj lSl hV{  m  < i  #h3( u6hwk_j  hXi6h  g h_kwj  g &   Z u - mMLi6j  l mMrmkwjvurhŒi6j˜j|  j.

|W4]ZY xm f q   l h! q  m s hQkwm "! -.‰dHb+.

+ ZY.

 mQ’ !xh  h  mM  @ ( h q Y )h  xmŒi6jwv l h# q l mkwm j˜h f  h lSl j q~q s hXjvk y k xzx . . hIu6m 4’ q jh  h lSl jQj-k k_j-uphwj.%)j  m  †Z  hIk2 h m0!}mM - mk_j-urj\i6j  l + Vj‹j-k_j-urh  u6i q rmu6i6hOm }m MQMOPrM Y k k   0pj  .j f /)h q#l mi6h  #j jZj| q k  l mMrm ^ 0 l mkwmXm k~mQj| l mk~mXh~’ q l q s h k ( jŽj -q mi6h † l pj…„pm † mu q u .vdH]Ya^`b b ObVY /~ !3‹h   h  g k g kwmZh q 3( D .f s h Q Z q kwm  hIu6i  f s hwj|  j.  Z\[˜q  6] m l pj @ j  hu' Z k phi6hXh  < i  #IhXi6jb    @}mkwmi}m Dm  †  @ l h _  mu3fšm q k  m  h _Jxmu3f-m h!„Sj"rhO’ q j6Sj l - k~m j lpl h ‰’ q l q 0^`_a_a_b(cxk25( q d€   (e! j-u6h l l h q # Q l h# q kwmOj| l kwmZ€‚h l k l mXh  j.

        a!3xh  h      k~m F_b(  j|j-k 0 2 l mŒh l h    u3#   .A">’dJ SPS V[Y4{V 7 {"Z(xW 5‹` B ‹OnJ 5>8@<(<u’5“`*“"B(“ “PO6“P`*“g’i<(<i5L<&< 9 .G? H(BG5.(m9X Gm Z&V_jVlk C"7P>*B@‘5~J N 5>98*@‘<&<u’ P3*@A".(“59> C“PO Ql’J 5*243 D&D OJ 5*243rŒ„E".P@\ŽdJ F2 C\ Ob`` c(du@R*A&> O ? @A243*E \’9M2 ˆ 2 ?">“*H&>AG“3L*.  N y  g  h q k @   †   \ ’ q j „ Ba9   hIu(-šnIj   )j‹h2 l mMrmk_j-urhOi}m Bj|  j f o j  mu3f-mi}m   s h l j .=<2>&? @A&.B4CD 124365798(:".@P8*A3 a6J h S V 6s•*x"•&m6‚  X"V•*mFYZ(xGYx#km WgYVu•*mbm oj*m9X"X.=<6? @A2#3"ED 124365798(:".j f o j.( j| 124365798(:".(m9X4 m }P € bqlx6 W 9*xL[9kxFm ojmXX#:V FqlxW}9x=[ k]V  !  m*Y9VFXY4ZGs4W 5  [mUTIjxwpY4["ZGx*•"V pUmqlV‘jx(YPj. 3&:"7 J # h $# 5 m#1 59BP@G5FR \9? @A62#3*ECg? Egd N 59>98*@‘<(<L’ "R5.H*@2>93 D 8?"2#3*EF3(BC6.93&:"7 J h A".G?*?*>Qe“g’|<&<4C6?#E<(<=. hIk l h 23xh_m !6m  h   q  .RG59.j %Sh ( V3 0  0  j  s h 0 [  n   s h0)h l  $vj l h hk  .=<G.b?@*:fJ 2#3*@LCB(243r\Žd N SPS kxb•&s 6sX#:*V C"7P>*B@bB` Œ C"7P>*B@uOnJ @A'B pV9Z c J Y Z(xGYx4k m WgYVL•*mFm oj*mX*X.

'./ Sx0V9[6Y )(( X&x9W•*V(T#*+*-.j %)j  {  Y )h  xmi6jwv l h# l mkwm f s hXjvk y mi6h xzx † .# q3xl h 4 l"+   hIk2 hIu#j-urj.f x •xU‚ ! #"  x9W•Zm%ŽkmZj["Z6sPVIT9x„p'&  ‚l j } x‹S } & $x9W•Z m %ŽkmZj["Z6sPVIT9x„' p &  <"WY4ZGmFjVlk ‚l€ <(o6j*mX*6X :*V‚ vs 6s96X :*V p VZ lS $ <"WY4ZGmFjVlk )(( X&x9W•*V(T#*+*-./ Sx0V9[6Y (mZ&V  jf s h  j l k  pj m q k k Z rhi6h pj l‰q k mM8rj l mu#i6h_m/  u/@6mŒi6j\j|j vq f s hwi6h2 l h# l mkwm( [ j. -l jvnj"^1SjXm0pj.'. u6i l nj”’ q Z\[˜q l  6] m l pj q k~m j q jŽ 0^`_a_a_b(cxk25( q d€   (e! j-u6h l " l j rh l u6h i  €‚j l jvurjˆi6h .Bi#j q k~mXj|  jf s h3( !3pj Y .

=?> G ^ Y Q Bec [\ U W U B c [\ Q BNj [\ U W U BNj [\ Q Bf?[\ U W U Bf?[\ Q G p ^ =  H7 ^O^ = e U W U    " -   $‚’   N y  GF7D.GNLT767 K R.:<.( [ jvu' l hQi6hb!3xh  h  l Œnh $+  hi6ja mu3fšm l i xl j"mk_j-upj q k~mjŽ  jf s h  hIk  @ l h _ h q2 @6mk~m l k Z rhi6h j6)hi6j-k pj l j-u  mi6j-mi6h & † jt’ q jQj-k m 8 # q k kwhIk_j-uph0 mu  j-k q k~mXjŽ  jf s h  hIk  @ l h _b( q 56798.f Bf <L D LZR_8aLr76 K 7n= @O@ @ @ O @ @ O @ @ O  mu3fšmk_j-uph‰i6j q kwm~jŽ  jf s h* h   k_h0!3‹h  h  mM  @’ q j l @6mk~mXh2 l < q l j KEp L98aLdBec Z r hi6h.rh2 mu3fšmi#h3( Z phi#h s h•i6h‰k † j " &-/:    Z q rmi6h }m l m  mu3fšm l m˜jŽ  jf s h †Z  hIk_h q kwm  @}mkwmi}mBi6j q kk Z phi6h(.„            Ba9  . a!3x h  h   l   hi6j-k  mu3f-m lLq kwmXh q k~m  Lj|  jf o j †  mu3f-mu6i6hOi  €‚j l j-urj.GNL ^  = S<O= K =Ra7 B c KEp L98aLdBj BNj KEp L98aLdB.rj l k  u}m  k_j-i  mMmkwjvu'pjmwj|j vq f k k  j !6mwh0   hXi6j\h!+„Sj.   )hLi6j\h!„Sj"rh.

 {  mi6h3( > j q kCk Z r hi6h mu3f-m q kwm~j|  j.  @ l h _‘€ q u  hIu}m _ L  hIk_h q k l j"r h l u6hOk q 8  ^ u6ƒ‹nj † n  rhO’ q j\h l j.rh l u6hOi6hOk Z rhi6h Z i  €‚j l jvu'pj\i6hOj%)j .f s h  hIk  @ l h _ † nh   hi6jŒk q i}m l  q mci6j   m l m f s h †  u   q3 u6i#h‰m  jŽ  jf o j.˜’ q jb)  hi6jvk p j l  mu3f-mi}m .(  @ l h   .

j f o j ’ q j q k Z r hi6h x mu  j q kwmj|  j.$'""!/ 01(# 32" 3 (+  #   )4#.    "!$# % 6"&'(#*).  7<4=>5 &'(?@4=IHJ24&).f jthXk h Z phi6h2)hi6jbxmu3fšm l-†=Z ’ q s hi6j   m l mi}mjvk pj q  k jZh s h_u l h  hIk0^  <    h( 0(' "$0  Mm   @ Z 0 h  l m   mi6h  m l l i6j\j|  .  7<4=>5 &'(?@4=A9CB    "!$# % 6"&'(#$"0'1"# D(+" $'')2%#10E&).05+"687:91&.j f o j(NMh#Ih_m  <  / h !3xh  0 h  Pl O nh  brj l h/!3‹h  h  Mm   @ ( i6j|nIj   .05+" FG7:91&.+-("'"+ #..+ 1@29 B Y nmumM#Ij-k jvkQpjQi6j   m l   xmi6h l hIu€‚j l j † j  k)j-i6j g  LK ’ q a  )hVi6jQj|  . ' "!   )4#.1# ..

R7:24&).  + "&*2&).+ 1S291TRU5U5U5U5UUWV.+ 1  "&Q.

R7).B  + "&3)Q+&  "&Q.+&X)591TYU5U5U5UU5UWV.

 "&Q./# .R7U5U5U^9$TYUU5U5U5U5UPV.&).. '""! [H\#    E2"*%]&).  "&Q.B  + "&Z 0 ""0' .

ph/ mu3f-mi6h3( } k !3xh  h  m   @ /!3‹h  h  Mm    @  <Z l nIjZ’ q  6] m l pj q jQh   )h i6jcjŽ  j f s h  rmi6h2pjb  nj l   i6h/ mu3fšmi6m j|j -q 0^`_a_a_b(cxk25( q d€   (e! j-u6h k l † q nIh _ )hi#j.rj k~mXj|  j f Y )h  xmŒi6ja` l h# s h l  l mkwm  i#j k~m hk  f s hXjvk @ l h q k _b( cbdb y .B gzy hIkwh q  !pj Y g u6i Z\[˜q l !3‹h  h+ lPO ) hi6j  mu3fšm l k~m  i#j q †}q k  m l m  mi}mOh!„Sj.

phwi#h2  )  h ( ?> g j_€‚h  # k g  u6i6mO’ m  † !3‹h  h h )h_i#jb l mMrmk_j-urh  m   @ pjZm %Sj-k_j @6m_m lSq hIkwh gzy    .phi6h*   h h!„Sj.    1     mu3f-mi6h q kEh !„Sj.

 q k q j  Mm   q @ k *pj m l  rmi6h Z j|j -q  € j 8pj\j-u  .

 . j xj_’ q 2 l mMrm j q k 3( mi6j-mi6h  mM  @ $ (7(8( &6 l mMmB’ q m x’ q j l    h i6jLj|  jf s h † hk_jpk_h˜i#jvnIjaSj  hIkwh  mM  @.

.. 7~w9 TRU5U5UWV  "&Q. O AX/.D68 /IJ/ E  /f2K : ( LK  L*MON&!026' 4& 0(:#" .$ (8(7( &Ou s h l j  j. 7}|9 TRU5U5UWV  "&Q. 4 .0/V ? /21 3/543’2• 6?™I8X6>8X6 §Y/ ›—: 4@Z = /5.E  /../ EW/2’5V˜ 6>836 ¥ GŽ3/2. =?6 BA   :Z A / =C:92: .. 7'9 TRU5U5UWV k bh€ j‚vƒ„j b†…@gˆ‡‰n…WŠŒ‹Yg sss pp3 6 › •74/@ 6œlŸžh W¡ ¢‘£ 4XK :š™ . : #.EW/ = § ›—: _% À : ’ 6  : / = 1@V/ : ’ : . 4 D68 /-/.D6 /JEW/  V 6>8X6/ZI8X6>8X6 Y/ :  4@Z = /5. : 7/ 38 : 3.}/‘1V3/?’ :=: 43K :“: ’ : . 6>=?6  :@8 / 0/5.0/ 6 /JEW’2/2”2K : A–•—˜ :š™ A š _ ¤¦/2§ : •— 83: Ž ›7: ’ : ˜<./4/24/@V =?6 /JE  /f2K : A 6 0/51 /24 . 6 4 : . vuxwRB 5 +!/ Q0&# ppy s@ss z pp{  "&Q.f2F@/G/ 6/2:>=H:5: .:QP  )  8 $ SR 02!%ST: UGV 6 4 8: 43K ::5: .0. A A\[A  A^]W_ `acbJd>e%fhgSi jlknm o pprq ppt s@sss &5. :  .! j\u6jvu/@ q k h! „Sj"rh_u s h/)hi6jt€—m $vj ! m’ q l 38  k_h  m (  !3pj q m  h  pm(  h l k l nj "#%$&('*)+$-. ­A ¬WA­[WA\®3A­]W_  ¯ ¯O°LK°B¯ L ±*MON²±*³¦´cµ}¶¸·²±†´S¹ ³»º@¼¹QP~±½´c¹»¾  ±SR´S±*¿cTQ¹ = 6 /JEW’2/2”2K :6 0/21 3/543’2• 698 /’ : 4n˜0. : ÄÃA­¬WA\[AÅ®3A^]@A­Æ_    .  Y 0/21 3/54 7698 / 2 : 4<. :› / ™=:W8 •©ÁX’ 6‚8X6 A>/~« 69: /.EW/5’2V˜ 696(› •—43¨ 6(6 Ž 6 •©E :(83: Z › ˜0• =: Ž ›—: ’ : ’ 6 ˜<’ª¨SA : Vš/~« 6 AX/JEW/2’2VW˜ 696  /21 3/24’2• 6 .0.

:Î . ¦§ : ˜0• ›76&8 /a`Í. ™ ¤¦V 6 . vuxwRB 5>Ç z 7  Q0&# 9 s@ss ²4 8 . jlknm o pprq ppt s@sss &5. 6>=?6 ”ŒK : / =CÏ bdb .˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.

¬ ®  @   .

 .

~.

EW•7}˜</ 4 : /2’ : § : 83: ˜0.:6 <=. 6 ˜ 6 6 /JE’5/2”2K : ›D6 43” 6>836 ™ /JEW/2’2VW˜ 6>83: _GW/“/5˜0/ ’ 6 ˜0’ª¨ 4XK : /..0/ : ˜<3 ¨ . :Î .EW/2’5V˜ 6‚8X6 _I Ž ›7: ’ : <˜ . ™ /JEW/2’2VW˜ 6>83:“: Ž ›—: ’ : ’ 6 ˜0’ª¨)( È*G/ 8 /2§ : •— 6 : ™ AX/.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž. G 8 /24n˜<.. O 1V3/ ›76 43” : V 6 /JE’5/2”2K : A ˜ :@8X6  6  8 / =96 •7 ’ª¨ 6>=96‚8X6  8 / =™ ˜ :W8: Ä1V3/9/5˜ªK : §Y/24 8 V3.zDtDxƒYqYž– y=ŸUzDwM~ ”xjyUzfl…nU†¡”g˜M¢=rqnfo{qw%›=“m˜=–T–m‰ oMwMrTy—uHu`˜g¢fl£|›T’q“Qœ…˜ququTtMnTsTp‰ ¤ €TwHlgsˆ’q¥ ”gl…nUy•zTtDxƒm–  oMwMrTy—uHu`˜D™…nYš=oUlgwf›T’q¥Qœ…˜ququTtMnTsDp ‰ ²4 8 .EW’5/2”ŒK :?83: 0˜ •7§ : ¦ È A•—˜ :(™ A 6› •743¨ 6œhŸžh @¡ ¢'&Y™ /. 6 Ë :96 4n˜</5.. O ™ /24’2/2. 7}|9 UU5U V  j ‡!#" pp{ ‡ 3 o z pp3 sss  "&Q. ¦§ : }˜<• ›768 /a`Í./ 6 /.0./ = 0/5. 6>= •—43’ › VHE 8X6 Ä43/2}˜</Ž ›7: ’ : ˜<.EW’2/5”ŒK :²™»›76 43” 6‚8X6 A :  : Ž@«/5˜ :  ›7: ’ 6 •—*/ :  : Ž«/5˜ :  8 •—4#B = •7’ :  6>›7: ’ 6‚83: *’ :>= 6 V˜ :DC §W˜<. :lÊ A 6 0/ Î V3•7.V=WYX%Z[H\D]T^`_Uacb=dfeg[%hjif^=\ = kmln%oqpMrHsTtvuYlgwDxjyqzDtq{|} kmln%oqpMrHsTtvunUtj~} kmln%oqpMrHsTtvuT€TtDojyTw=z} kmln%oqpMrHsTtvu%xjyUsUt‚foMtMƒUy„} kmln%oqpMrHsTtvu%xjyqzfl…nT†} rfxTl…nU†‡nH{g|%t#xjƒH{#otˆxjyTs‰ R=RSDSTSDSDSTSDSTSDSUSTSTSTSUSTSUSDSUSUSTSUSDSUSTSUSUSTSTSTSUSTSUSDSUSUSTSUSDSUSTSUSUSDSjXfZŠb\U\Œ‹qag\#=a opq{Dxqx`ŽTtDxjyDt  ƒqrUHpDl=o‘ €TwHlgsˆ’q“ ”gl…nUy•zTtDxƒm–  oMwMrTy—uHu`˜D™…nYš=oUlgwf›T’q“Qœ…˜ququTtMnTsDp ‰ l’ ”.. O AS0V 6  V3Ž É ./2}˜ 6 4n˜</ 83: ’.˜ 6‚8X6 2 _ N / « 6&: /JE/ = § ›7: _ À /2}˜</G/JE/ = § ›7: A 6 ’ ›D6 0/²˜0/2}˜</¦˜0/ = [ =™ ˜ :@83: 5A Ë~Ã>AË ¬WA3Ë [_RGŽ3/2.0VDE 83: 5_  / Î V•7. 6>836 I*J_ J / › /5• 6: § 6 K. : ˜0•74 6  8 /.>/-1V3/IË~ÃI’ª¨ 6>=?6 Ë ¬(/I1V3/ÄË ¬’ª¨ 6>=?6 Ë [_ M •—˜0•74 Î ¬¬@_\®HOQP EW’2/5”ŒK : / 8 /2/ = §3• › ¨ 6>= /24n˜ : _ R RSDSTSDSDSTSDSTSDSUSTSTSTSUSTSUSDSUSUSTSUSDSUSTSUSUSTSTSTSUSTSUSDSUSUSTSUSDSUSTSUSUSDS. : 83: Ž ›7: ’ : ˜<.2A : §3.¦/&>/~« 6 1V3/Ë 6ML /24n˜<• 83: A*§ : •7²0/¨ : V/(§.F-ŒE• =?: ’ 6 ˜<’ª¨ 1V3/!˜<. O <K : 8 /2}˜<.  T  "&Q. 8 /50’ 6 . 6>=?6 ”ŒK : / =CÏ bdb .0• : . ™ ¤¦V 6 . 7'9 TRU5U5UWV k bh€ j‚vƒ„j bˆ…@g†‡‰n…WŠŒ‹Yg sss pp%$ GŽ3/2. + Î . 6>836 &4 6 §3• › ¨ 6 /1V3/?Ë : .. : Ž › / =?6 4 : Ž ›—: ’ : ˜0.EW/5’2V˜ 696 0/51 /243’5•+šÃ>A^¬WA\[AÅ®3A­]WA­ÆW_ /21 3/543’2.>6?8A@ U V 6 4 8: V =?6 /.0.• +?’ : 4˜0•74V 6 / = .}/1@V/Ē :=:(: ’ : . 6>8: 4 6¥› •74¨ 6 / = 1V3/ : ’ : . O <K : 8 /20/ = §• › ¨ 6>8X6 ?( 8 /2’ : 43• 8 /5.8 • Î: _/ }˜   10 2 $ $43 $ 5š76 6 8:9.

M v>  .

 .

~.

  ¬ ]  Q  ’q“„”.– l…nUyˆzTtDxƒ¡‰ ogwgrqy uDu#˜ Tn .zDtDxƒm– ‰ oMwMrTy—uHu`˜g¢fl£|›D’fž œ…˜ququDtMnTsTp ‰ ¤ ¤ ‰  R=RSDSDSTSDSTSDSDSUSUSDSUSTSUSTSTSTSUSUSTSTSTSUSTSUSUSDSUSTSUSTSTSTSUSUSTSTSTSUSTSUSDSUS  [qWU]q^YbThjW  l…nUy`|f{Hln¡”.zDtDxƒm– ‰ oMwMrTy—uHu`˜g¢fl£|›D’q¥œ…˜ququDtMnTsTp ‰ ¤ € wHlgsˆ’fž”gl…nUy•zTtDxƒ – T  oMwMrTy—uHu`˜D™…nYš=oUlgwf›D’fžœŠ˜ququTtMnTsDp ‰ ’q¥„”.

HtHxt U{q›#tq‚Dt#ojrTyH{=zT›Yxt|Y›#tq‚fo=tHxUxUwH›”#–›Hwgrf›YoMw|%›%t=‚fo=tHxTxUwH›”jž–‘˜Y‰ oUl…n }D} zTtHxƒ ‰ oUl…n œI†TtyQ”.– ‰ ŽTtDxgyTt‡wM‰ yqz ¤  ¤ wMQœ ’fžY”.%/T^T_U^q\•a0‡[132fZŠ^TX^ 8 b 9_qb: . ™ ¤¦V 6 .P'O7$  h.'A:$ D X=^dTdfag[RQY H ! XUa\U\DbT^ WDbSH' [qWU ]q^T  [qWfXbq^PA ²4 8 .'BNI$ VWq 9 Xqh^.. ¦§ : ˜0• ›76&8 /a`Í.a"!%XTaM\U\H]U^L>M"—^j[ VW9qXqh^.'O7$ VWq 9 Xqh^.P'A:$  h.+#b-ajWY=^c_qb=\  d 4Œe[fa`\T(^ '#dfa[ b—"X +#-b mbU_Ubb 5 +qdD ^ 67$ X +Hb-mbU_Tb=\ˆ_q^=\.'A:$  h.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.zTtHxƒ–‰ oM{=y#oŸ ”Mxjyqz%l…nU†ŒxT–  oMwMrUy•uDu#˜ TnHow=zTzDt=rD›U‚%ot#xUx{TwU›=›TnT{D›H’rqnqw%›„‘j˜=uquUxTuTuDtMnDsTp„‰ ¤ R  ^Mi%hq_UbT_Da STSUSTSUSUSTSUS \T^c_Ua•a"!%XTaM\U\#Da\%$ & agdf(h ' hTX=)b T]U^_=^‡_HaM\#a(* h%Z.'BNI$ VWq 9 Xqh^..'O7$ VWq 9 Xqh^.a"!%XTaM\U\H]U^L>M"—^j[ X^( a1!%XTaM\T\D]U^L>N 7(N VW9qXqh^. 6>=?6 ”ŒK : / =CÏ bdb .. < bMWf_dfa =>agdfXg[Td%h=^@?Mb*BA S1CD D \DbMWf_U^?EE>FBGH$IRYbI$g^M[%  J Ma \Ha"KTbŒa"!%aTXj[Y=bdc\#a.).P'BNI$ X^( a1!%XTaM\T\D]U^L>N 7(M < bMWf_dfa =>agdfXg[Td%h=^@?Mb*BA S1CD D \DbMWf_U^?EE>FBGH$IRYbI$g^M[%  J Ma \Ha"KTbŒa"!%aTXj[Y=bdc\#a. :Î ..

¬ Æ   4 “ ? .

>.

0• 6 . :?8 /IË [WAX4XK : . 6 Ë [A3Ë ¬/ÄË~à ( 4XK : 5/ 0’2./ EW’2/5”ŒK : A 6 0/213/543’2• 6 /.EW•—˜ 836|{ 2’ }˜ 8 ˜ › •—Žm}I_ A . :Î .0• : 0/ › /2’5• : 4 : V ‘ G 4 : ./5>/-Á = Ë [WAÁ = Ë ¬WAWÁ = ~Ë Ã*J_  ‘%  "!I$ '*)6Ä'6" 6# ¦/JE’5/2”5FW/5²4XK : ˜0. ™ ¤¦V 6 . N : D’ C§ :@8 /&’5. = •74 6>= 6 /JE/5’2V3”2K :98: §3./2:(̦43• Ï bab *1V 6 4 8: 43/ Ê Ë 6>› ¨ 6 A / =  / Lš8 /š.EW’2/5”ŒK :¥™›76 43” 6‚8X6 /(4XK : ’ 6 §˜0V3.˜ C ˜</5.˜</ 8 _ E'F'G7HJILKJMN  OJO @PLQSRUT-VJW=X>Y'M[Z>G7H\P'G>]LMSP-WLMUG^Z-G7H_I`R-P'a7H`G-]JPbM c (T5VYB M'QedfH)QgWhbR@i-VW=j>RkM7lkG-P>HmQgWbR>]kGn2o OJO7p G-TLQqWbGrj@MqH=Ms]kG-P-H)QgWbR>]bG B Z-G>]kt>]kG@P>H)QgWbR-]kGunvH)QqWhbR-i-VJW=j>R'M>lkG-P>HwQgWbR>]`Gbo +x ‘%y!I$  8 6I) 6 yz ¤¦/?V =96¥=?6 43/2•—.EW§Y/2’.˜</ 8 /˜</2. = •74 6 ˜0/G/I0/.–‰ ²4 8 .0/. 6>=?6 ”ŒK : / =CÏ bdb .0• 6 ËÌV43”2F@/2²V343/. 6‚8X6 A 6 Ä/ Î V•74n˜</5GËÌV343”2F@/2¦<K : J/ E/5’2V˜ 6>8X6 £O%$'&)(+*-.&=<>13(06S1@V/’ª¨ 6>=96 <@?2A78B1.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.˜ : . :lÊ (̎ 6>m N /~« 66 0/ Î V3•—.• 6 A /?Ë 6>› ¨ 6 . :Î . = •—4 6 ˜0/ £ /&V3Ž3˜0•—˜0V3•7.4 6 4 83: § 6 . =?6>› _ÍUÄV 6 4 83::  V 0V#+>.EW/2’5V˜ 6>836!™(6  Ž30/5.>/1V3/(1V 6 4 83:¥: V3V#+>.EW/ = § ›—: _ M •—˜0•74 Î ¬¬@_^]TOQP EW’2/5”ŒK : § 6 . 6Î /5.  % 8 C6>›—›7: ’…*. 6>=96 _ UGV 6 4 8: V =96 /. 6  8 /5Ë 6 V › ˜²’ := 6  ËÌV43”2F@/20/.H> ŠR 6 : §Y”ŒK : A„0/ = .–  ~rƒ ƒTyqk z „Tx nDtM… ~ ~”. D› 6 43” 6 V =96 /.4 6 V = À : 4 :  : ’ := §3• ›76>83: . 6>=?6 _ ./5˜ : .• : 0/ › /5’2• : 4 66: §c”2K : Ã>A 6 /JEW’2/2”2K :9™I›76 43” 6‚8X6(8 /24n˜<.04 6 .– €DtDojyTwz u@~f})€‰ R=R \T^_Ua‡d4 yU z   pqwMnU† l…nUy—l=)‰ R=RH1[ @'Y^d hg W ' hgW%hD^ ’Uwz”U‰q‰. 6>› 43/ Ê ˜</24n˜ 6 6>›7: ’ 6 .6*1V3/ÄÁX4 6>› • L26: §.O˜<. 6 ˜ 6>8X6 O˜0/2. = / = -.˜ C V343/JE§Y/2’. ->§3.0V 6 ²§3. :Î . 6 ˜ 6‚= /54˜ : ’ª¨ 6>=?66 Ž : .V = /. (0/213(5476S1@V/-’ª¨ 6‚=96 13(2829%:._ ˜0¨3. 6 4/ Ê _ kmln%oqpMrHsTtvuYlgwDxjyqzDtq{|} kmln%oqpMrHsTtvunUtj~} kmln%oqpMrHsTtvuT€TtDojyTw=z} rfxTl…nU†‡nH{g|%t#xjƒH{#otˆxjyTs‰ xjyUz=rfojy ~  l…nUy lnHsflUo{qsDw=zy5€ )  ‰ sUwMrUHp=t‡€T{Tp=w‚ z 5€ ))J ‰ ¤ ‰  l…nUyv|f{Hl…n¡”. ¦§ : }˜<• ›768 /a`Í.˜ : .0/.}˜ : V¥/.EW’5/2”ŒK : A–0/ 6š= 2/  =96 43K : 0˜ •—>/2.

–TuquDtMnTsTp‰ ¤ R  ^Mi%hq_UbT_Da \T^c_Ua•a"% ! XTaM\U\#Da\ * bMdDb`Wfa16 $ D m * dH^#dHb5  bˆXjdfhbv[ Yb‡a\fgdq[Yj[Td#b $ —\Ha T[fhjd .M Œ ¬  4 >  %>  €QœƒUr%xgŸ`„H{Ho ” ƒqƒTyqzk„Txf– ‰ ogwgrqy uDu#˜ =nq€…˜ququUlquDu#˜>q›%{Dpqw#o{qsD{#˜ququDtMnTsTp ‰ l„‰ ¤ ¤ ¤ Mo {=y#oŸ ”.H{Usk„U{TpUpUwHot=zqzTwY–  oMwMrUy•uDu#˜ Tn T‚fot#xUx={Uwq›˜ququTtzqzTw œI~qŸD{=y ”.

_TaWYdD^‡_Ua %bUh…W.

vXjdfhb[1ŒifaU^Md7$ 2 ZŠ^TX^•_=^SY ' ^Md hjW"m ' hWfhTM^.

bYZŠ^DXb["Yb aM\%jdq[[DdHbc_HhjWfb- hTX=b5 ajWqavacbDXgd%aM\fXUajWbb=^  ^ f i%aUM^Md7$  a>   dfhqbv_Uav\Haj[m  hUXjdD^ =ajd1 hWHbMd.

v^TX^Mdqdfa`["Y  b—a1!%XTaM\T\D]U^`_=^ =h *^ 2bU_HbYZqZ…^TX.

6 V =  : • 8 /ħ :W8 /G0/5. Q N : ’ » C § :W8 /Q’5.˜ C 3 4 /Ê C ¨ 6 4 3 & 43/ Ê A 6 /. 6 ˜<. 6 ˜ 6 .2_ Ï%:=:  : ’ C./2’2/5Žc/5. ›76 43” 6>8X6 /I0V 6 ËÌV343”2K :™ /JEW/2’2VW˜ 6>8X6 _ (' { ‘% 8 6"‘)u ¦§. 6 ˜<•© 6‚8X6 ’ :>= 0/. ™ ¤¦V 6 .12 Ž 6>8mC6>›—›7: ’ 8 C ’ 6 ˜ Ž 6>m & 334 3#34 6>› ¨ ( 6 6‚›7: ’ 6 ”2K : 6>› ¨ 6 ’ : 4n>/2./ 8 /.EW’2/5”ŒK : § 6 .  [#bgWH_q^•b a ^ f 2 ZŠ^DX^ XbD=X"+ =2 bT_fbZUZ^DX" • / a1Y ! aUXg[YbT_U^B$ ŠR R 8 b9 _qb: STSUSTSUSUS i < NM-F bZ^DX=bT_Ub i < NN-F  b Z^DX=bT_Ub ^g[%v^>'  . 6 ˜ 6>= 2/ 4n˜ : § 6 . ¦§ : ˜0• ›76&8 /:9Í.0/2/24n˜ 6hÉ 0/ 6 / Î V•7.a Y^Md4 ŠR GW/I1V3•7/2.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.=. 6 4/ ʽ8 /5•©E 6(8 /I0/5. V =96 ËÌV343”2K : § 6 . . :lÊ O E'F'G7HJILKJMN >u I']JPQfWbG vu n3WLM7]h'PbM =odbM7VLK-G!"""#%$ 6 6>›7: ’ 6 Œ” K : ’ :>= 43/ Ê A  6 = /2 =968 /5>/%. 8 › /2. 6 ’ª¨ 6>=?6>8X6(8X6 /. :Î .EW’2/5”ŒK : 3#34 6>› ¨ 6 /5.˜ : .EW’2/5”ŒK : § 6 .0/.#. 6 4/ Ê V0/4 : ˜<¨.00K : & Ž 6>8mC ˜65@§c/5• 8 & Ž 6>8mC /.0• 6 .4 6 .EW’2/5”2F@/2–§ 6‚8 .EW’5/2§˜0• : 47384 6>› ¨ 68 /I/./#0.0•©ÁX’ 6 ”2K :8 /Ę<•7§ : ²4 8 .01V3•© :  /JE’5/2§˜0• : 4)}x/ { }˜ 8 /JEW’2/2§W˜g}I_ )+*-.0F@/2 83:¦Ï bab A 6  = /5 =?6  /2˜<K :¦› •7}˜ 6>8X6 *4 :  6 .ÁX43•—V : ˜<. 6>›7Î V =96 S/. ² / . 8 /5 6 ˜0•— 6 . 6>=?6 ”ŒK : / =CÏ<.

¬  M žvžh   1  .

  ) & •74n 6>› • 8mC6 .0. :lÊ C /5.. 6 4 Î / hË : . : . V =96 /. ‚4Z = /2. & : V˜ C: Ë C . 6>836 3#3 &   12 žvžh   1 ./2. 6>›—: 3#3 . :lÊ C /2.. : >/2.0.EW’2/5”ŒK : 8 /54n˜<. Î V = /24n˜ : •—4nM+ › • 8: & › /24 Î ¨n˜ C /2.’2.. : 8 / V = ’ : 4˜<. žcœ  ) D %. := V3•—˜ : §c/51@V/24 : 3#3 (' "76 8 6I) 6 » § @: 8 / D› 6 43” 6  . : . :  8 / =96 •7 : Ž@«/5˜ :  8 /2• E >6 =H8 I / 0/5. 8 2/ }˜<. 6 4 8 / 3#3 ‚4Z = /2. : .0• 6>83: 5A 8 /5©• E 6 4 83:8 /I0/5. Î V = /54˜<3#3 6 . := V3•—˜ :(Î . 683: •74n˜0/2.V˜ : .2A0/ 6 = /5 =?6 : ’ : . & V34 8 /5.  .0VDE 83: 5_ & N : ’ %>c 4     8 • = /2430K : /2.

:Î . ¦§ : }˜<• ›768 /:9Í. 6>= /24n˜ :š83:“=™ ˜ :W83: _ 6 &0/ 8 /54˜0. 6 . 6O8 /ÍV = Ž ›7: ’ : ˜0. :š83:“=™ :9=™ ˜ :@83: 4XK : ˜</2. 6 ˜ 6>= /24n˜ :-8 /²/2. ™ ¤¦V 6 .FE—˜0•7’ : 2A/5@•—˜0/¦/2VV3 : ’ :=:&=?6 •—»V =¸= /2’ 6 43•7 =?:8 /G§. : 8 /?V = =?™ ˜ :@83:  : ’DC9§ :@8 / 8 /2’ ›76 .„Q    C  =?6 /JEW’2/2”2K : 43K : . = •74 6 ˜</‚_ /. Î V ›76 *. 6>=?6>83: .9/543’2/5. : Ž«/5˜ /243’5/2. 6>=?6 ”ŒK : / =CÏ<. V =?6 /. :Î .=.Ë 66 •74 836™ V 6 _ & GT-V3/G/.V˜ : ..0VDE 83: 5_  @Ž «/. G 5 §.EW’2/5”2F@/2+/ 6 1V3/ › /5 8 / ˜ :>=96>8368 / 8 /5’2•—<K :²8 /5>/ = 0/5. 6I: §c”2K :  §˜<• : 43 É }§3./ Î •7K :(8 /Ę<. 5 : V¥’ 6 ˜<’ª¨!4XK : ’ :›—: 1V3/ :¥£ (̧ : 4n˜ : /Đ@•7. :  : ’ 6 : /243’5/2.0V3”2K :6 0/2.5_ >J# & $ & ¤¦/2§ : •7 8 /V = Ž ›7: ’ : ˜0.0. 6>=?6 AW/2˜ 6 ˜ 6 .0/2 :› >/ :  8 /2}˜<•74 :  83: 0/2Vš§3.0/2 :› >/2. . : 5 A 6 »•743}˜<.8 • Î:(8X6 ..EW’2/5”ŒK : § 6 ._ &%J !' ²4 8 .0/.˜ :  : 8 /5 É š/2 =?:š6 <˜ •© 6 4 83:¥6: §Y”ŒK : " J ! ª/ AŸ := 2/ 4n˜</ :  : Ž«/5˜ :  —› : ’ 6 7• ²1V3/?43K : < K :¥8 —• 4#B = •7’ : ¦<K š 8 : ›D6 43” 6>= 2/ 4n˜ : X 8 6 /JE’5/2”2K :  ˜<. :Î .V3”2F@/2 8 /²˜0.EW’2/5”ŒK : ’ := ˜0¨3. 6‚83:  6 n4 ˜0/2 3 A §c/ ›7: & §3.0. 6>83:    83: £’ .}/G1V3/¦/ = V = 0•—˜0/ =?6 ˜<. :lÊ  / ’ 6 ˜<’ª¨  : ’DC&0/2§ 6 . :>Î . 6>= /24n˜ :83: §3. : Ž › / =96 A 83: ’ := §3• ›76>83: .}˜Œ_ & ¤ •7§ 6 . = •—4 6 / :  : Ž@«/. 66 . 6 1V3/ :  : Ž@«/. 6 ˜ 6>= /24n˜ :8 //5..EW’2/5”ŒK : ’ := ˜<¨3. 6>836 ²4 : ’.0K : / › • = •74 6>83: Ä1V 6 4 83:“83: ˜ :W83: Ë : .+/2§ 6 . 5>Ac˜0¨3.•7’ : _ & Ž 0/2. : Á3’ 6>= = •— ˜0V3. 6 . 6 ˜ 6>= 2/ 4n˜ : 8 //2.8 • Î: 4V =™ . :hÊ 4ÄË : . : 2_ & & N /~« 6 4 : ’ 6 §3•©˜<V ›—: È  : V :8X6 •—43˜0.EW/2’5V˜ 6 4 3 ¤¦/24n˜<. / = 05/ . : «/5’5˜ É } J ! / ›7: ’ 6 •—%˜</543¨ 6>= /2V3 8 /5˜<. 6 ’ 6  : O’2.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.0/ Î •DK : 83: £’ .˜ :  8 •74HB = •—’ :  8 /. 6 ˜ 6>= /24n˜ :8 /Q/.8 • Î>: _ Ï%:>= : V :8 /˜<. 6 ˜<. 6 „ ¦ .0.˜ :  ›7: ’ 6 •— 4XK : 0K 8 /5>/ É / 6 ˜<•— 6 . ›76 43” 6‚8X6 V =96 /..0/2’ª¨ 6>=?6>83: 2_ & :  ›—: ’ 6 •7 £ 1V3/9/2. 6>=?6 ”ŒK : _ & = ™ ˜ :@83:  § 6 . 6>8 •—’2• : 4 6>›38  / ˜<.5A‚1V3/ 6 0/ Î V3. :lÊ A : / › • = •—4 6>83: 5_ 9 6 . 6>=96 A 8 : ˜0/2. :Î .²/2˜0/§3.

M D „ .

6 ˜ 6>8X6 ( /543’2/5. 6‚8X6 *.0. 6  .A 6 0• = 1V3/9/54n˜<. 6>8X6 ˜0.      ¬ %> 4     $ =?6 /JE’5/2”2K : ›D6 4” 6>8X6 ’ :>= 4 : ’ 6 ˜0’ª¨„_ ˜<¨3. :hʸ™ ’ : 430• 8 /2.

™ ¤¦V 6 . : Z › ˜<• =?:-8 /2}˜</I˜<•—§ : _ GW/Ę<¨3. : %/ 8 /5>/-/2./20/54n˜ 6>83: ¦’ :>=H6 ˜0/243”2K : AX/Đ/ « 6 1V3/ : V3 :8 /I/. :¥: V .’ 6 §W˜<V3. 6 4n˜</5 83:?836 ’ ›D6 0/IŽ 6 />_ /.1@V• 6 8X6 ¥’ ›D6 0/25_ 9 ./ 0.=.5C543’2• 6!8 /V = : Ž@«/. & /213/543’2• 683: !  ’ 6 ˜<’ª¨ 8 /.V = ’ : 43˜2_ j-R>]Ljqh n2j@K-RkZZ $      J / › /2• 6: /.EW’2/5”2F@/2 ™ 0• = § › /22_ ²4 8 . ¦§ : ˜0• ›76&8 /:9Í./2}˜</ 6 ˜</543”ŒK : 4 : 8 6 ’ ›D6 0/ 8 /2. 6>=?6 ”ŒK : / =CÏ<.•— >6 8X6(8 /. :hʆ›D6 4” 6 V = ’ : 43˜2AX’ 6 ˜0’ª¨ 8 /5/’ 6 §˜<V3.+C243’5• 683: ˜<•7§ : Â&_3¤ 6 Ec : ’ CG’ : 4’ › V•S1V3/ÄV = ’ 6 ˜0’ª¨ (̐ : • 8 *Q’ 6 §˜<V3./I@•7.˜ :!83: ˜<•7§ : Â&A 6 = /5 =?68 /5>/-/2. :(: ¥ V .EW/ = § ›7: A : ’ 6 }˜ 3  $ E'F'G7HJILKJMN OJO EJPP'R@dbM j-R>]Ljqh n2j@K-RkZZ wbRkZ>Gbo j-R>]Ljqh n2j@K-RkZZ p G-PLQ c R@d'R j-R>]Ljqh n2j@K-RkZZ p G-PLQ c R@d'R bo j-R>]Ljqh n2j@K-RkZZ p G-PLQ c j-R>]Ljqh n2j@K-RkZZ p G-PLQ c  OJO kMSPPkG>]`M $ & -o       R@d'R bo R@d'R -o wbRkZ>Gbo GW/( : ’DC 8 •7§ 6 . V = ’ 6 ˜<’ª¨!1@V/. 6 .ËÌ/2. 6>8X6 § : . 6 ˜ :@83:  :  ›D6 43” 6>= /2n4 ˜ :  8 /G§ : 4n˜</5•7.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž. 6 .0/. /50§Y/2•—˜ 6 . . 6 ¨3•7/5. 6 ’ := V = ˜0¨3. :lÊ V = § : 4n˜</2•—. :Î ./2’5/2ŽY/V = § : 4˜0/2•—.0/.ËÌ/2.EW/ = § ›—:  6 §3.

™ ¤¦V 6 . M D%.˜0/-È»V3/24 :(É Ê Ê Ê _ ›7= §˜Œ_ÅVË̏0’‚_\Ž.¬  ²4 8 .

:Î .=.„     %>c 4     ¦§ : }˜<• ›768 /:9Í. . 6>=?6 ”ŒK : / =CÏ<.

  .

      .

  .

*3g$..)+: /G0 &(y%?'$ )%&(j+:=*-"O0Q<S0 $.../Fg(*3C30'<($.L0 É =)0‘>) Î V *3:F$g(:>$'.$Q<()B.L0 =)M&()%N.=)@j V /10 ËÌV &(yO?'$M<() Á &(*3<S0HgS0':=0 V / ( $ V /G0'*.=)%/Fg(CD02.).0<($ V R(C-)'Et)Š0'>=*-/ g$.:r*3: + Î )+:.*3g$..?'$=)%/F)%C-{S0'&K.g(*D0A<S0 ËÌV &(y%?'$ Ë gS02:. J TBUGV%W XY@Z[]\F^`_ I\ 6H\ aZc>b 3 8`.0': V /10@" . V C-$Ihi>$..=( $AV <()BÎ "+CD0'>=)%+E(*<() § $..=)%+J :>)%>)%&K. g)%&S02/G) $ "+CD0'> ES$'#.* .:=§D<(E *-& V + :>*3$.=)%/Fg(CD0~.)+&({S0F0F>)%:t"L{S0'/G0'<S06J TBUGV.0@/102&(*3g V CD0':r<(* Ë )+:=)%&K.*3g$’gS0':=0 ËÌV &6y%z9)%Q.0 >)%&(<($`.4e 6If 6B[ 98Zc\ @ À $@"%0'g E ...L02<($(V J À $ËÌV )s7k)%/Fg(Î C-$ 02"%*3/G0x"%:>Ë*D0`0 ËÌV &(yO?2$ Ë gS0':..:=$'Ë̄)V B<()H:=Ë+)+Ë.=:=$ Ë $.) $ 0'RS02:=*-..=$.=)0'>=*-/  J  V =)ƒ‚=06E V /10 ËÌV &(y%?'$ .:=&($o V )F)%>.#<6)I<(0'<($.02$./F$GgS02: /F)+.=:=$ /ˆ*3&K.=.d 6BZcb <.02..:=&6$ * .:=/G0 u }v >w XV &6y%z9)%M. *3g$ EPJ-J ) J • à E'F'G7HJILKJMN ] T`KM-R>] T n+TbKM-R>][FLo QqWJ] T n QgWJ][FLo d`MeVLK-GUT n+dbMeVLK@G QgILMfT n ]=QqILMF=o F=o u @P'G>]@V'P@W n F 7F=o-$ @P'G>]@V'P@W n F 7F=o-$ @P'G>]@V'P@W n F 7F=o-$ -PkG>]@V'P-W n F 7FLo-$ <..t)%/†.=*3g$ <($ gS0': B /G)s.=..)%/Fg(C302..)+%J !R(>)%:Nm.02yO?'$ ( V V V 0'Cr<S0 * ËÌV &(y%?'$(E“"+Î $.)'E]=) Î V *3<S0 <() E”0ŒgS0'C30Omk:=0 "L{S0Om') .=)%/Fg(CD0~.*-Àgp$@<6$.&("+)%*P.)„j V /G0 ËÌV &(yO?'$I)%/…o V ) $Q.#"+$.$'¦#/§ 102*3546.T Ž[\IZcHZ 98Š\ 8 6B[ 6 Zc>b 3 8`£d 6HZcb  g6:=)%>)%&K. "y!  Sv >w u Sv >w u Sv >w !R(>)%:Nm.=$.H) <6$ R(C-)'J *-<()O0'C|=)%:>*D0@)%>"%:>)+m.?'$@$A"+§ $.:1<6*D0'&K.n"%:>*D0 /G0 &(yO?'$ Ë gS02:.L02/G)+&€.0  $.*-HgS0':.)+%E]0 4(&(*-"O0<(* Ë )+:=)%&6yO0 jG$ ../ /F)%>/G$Q&($'/G)BgS02:.&S0'/)s7602.=)%/FgpB $Q<()H"%$'/GV g(*-CD0'y%?'$(J V ËÌV $F)s7k)+/Gg(C-$102"%*3/G06E(>)‡0 &(y%?'$ $. ..)o V )&S0‘C3*3&6{S0’0'"%*-/10Œ<S0 <6)%"%C30':.)%/Fg(C302..OEc<()+gp$.. )+&(j%:>*3"+$. 4  5 { } .=*3g$@gS0':=0G0@o V 0'C)+CD0Am.0@"O0'<(0@.C3$9"O0 É =)10(  gS0'C30OmkC :=0à "L{S* 0Om..:>$ )G$ .. C3$@$F"%$.0`*3&K.:t"L{S0'/G0'<S0@. O  <.?'$Q<() Á &(*3<6$.=)%t.)+É *3#)!)879.5<() Ï ..)+/ C302.)@<() Ï ËÌV &("%*-$.:=02.=*3g$ ( * Î )%&(j+:=*3"+$ ( * J  /10 ËÌV &6yO?'$I.%Et=)Š$‹gS02: B /F)+.*-gp$`<($ :>)+.: Á >/G$H) <6)I. ( gS0': B /G)s.)2J  "+$.)q"%:>*D0':r/Gjs.=)%/ CD02...&("+)%*-.)H"O0 .C-*3/F$.=V $.0‰*-&€.:G<($ V R6C3)Œ"+:=*D0 V /10 ËÌV &(yO?2$ Ë gS0':...t<S0'<($.$9<($.:..#o V )I0A=$'R(:=)+"O0': Î 0@gp)+:=/F*-.R(:=)+"O0': Î 0A<()B/Fj+...)+&(<($1"+$.)x"%$'/G$ 0' ËÌV &(y%z9)%M.=$k<($'Nlnm.  !#"%§ $'&("%)+*-.)+:=* Á "O0'/F$.

•K•      .

+ -.-.     !"# "%$&(')* ".

/ A78B9 <>13A10 1 (29 <>13(4 3 / 2 <6575 .

=.=. 63/ 2 <6575 . A98:076<. : .

: .*2 . A98  & > .

: . A98 :  $?"A@:BCEDF HG .

-.-.*2 <>1 ( RS -. A98 :u&)A79 (JI KL-.4J()M &`:)NPJ O A98 4@<A8BQ $'&NPJ O A98 13(29 . : ..

(2&=<>9 ( ./ A78B9 <>13AUT 1 (29 <>13( 3 1WV .

A98:70 6<.=.=. 6 1XV . : .*2 . (2&=<>9 ( .

: . A98 :  $?"A@:BCEDF HG .

A98 :u&)A79 (JI KL-.4J()M &`:)NPJ O A98 4@<A8BQ $'&NPJ O A98 13(29 .*2 <>1 ( RS E'F'G7HJILKJMN ZYkj@K-RkZJZ n l=QgILM%[  . : ..

   . : .

 .

.

 v%>  „   .

„  .

0F„G%$ V }HJ €k)I0@/G)+=/G0@)%>.t*-&K.:=0'/G0'yO?'$@)+Œ j ‡ V 0':>.$../F$U^ V lK0'R(0':=*P.m'$k" 0'*-&(<S0BV &S?'V $I)%&K.)2J x "+$.:>*D0.%E~<6)%g$.=:=$‡hi"+$..=$@/10' &("%*-$.. ) <()%g$.N. 98  & > A %[6\ u 6v >w ]_^ V &(y%?'$G.*P.”Csr6E. ƒsJ x”>.:t<(†$ z :=)+)%>"%:=)sm.=*-./F$ /vl.: *-&€..:.R€‚>)+./G$ V /a"%$..:N. 9 .&(>. gS0':.0„"L{S0':+J !  R(=)+:>m') &6)%>..=$.)+/GV g6CD02.)%{lK0'R(0':=*P./F$:lK0'RS0':>*-./Fg(*3C30'<( $.)'Ep$x"%$..&S0@"%$.=)M)87k)%/Fg(C3$(E6o V )M$Q=)9l V &(<6$GgS02: B /F)+.=)%/Fg(CD0~.$1wyx“7602.*3C30A<() :=%$ l. *-&(<($1$ *3g$1g$.=$k<S0GV 0 &(y%?'V $(Ep VR(N.: 0':=/G0 u )%&S0Q0@<()%"+CD0':=0'yO?2$F& V /ˆR V ^ )%: &(0Q/F)%/1V ‚.OJ V ^ ="2J R6: / z  V C kC .=)%&(<() V "+$.02yO?'$ )+>..ƒ8J 0'&(<6$Qm'$k" "L{(0'/10Q0 &(y%?'$G<6)%"%C30'^ :...t=* L )slH&(?'$Q/ V <S06J ed }v Pfg Pf ed v Pfg Pf ed Sv Pfg Pf m 9 .=.R€‚>)+.=)#gp$9<() >)%:tt.)A.)+/Gg6CD02.$(J V . 5 3 C . l t"%$./G$ ^ V &6"%*3$'&S0I$B. *3yO?2$FjH:>)%g)+.*3cgS02:.0FR ="%0F)H R(>.0'< *-<($Q"%$.=*3g(C-*3"%0'yO?'$6E9o V )Ij V / $...$G<($G.=*3g$  3* g$ Ca` ) :>)+..&K.q*3&K...*-<S0@gS0':=0Q"%0'<S0@.)2J ] $x)%&6"%$.0'/F)%&K../Gg6*3CD02<($..=)'Jqp )%/EKm'02/G$..|w t >*3/Fg(C3)+%E(jH"+$.0Q$Fg$.=)%/Fg(CD02. 1 c M'Qed JPLQgWJ] nBj@MeW=Z7] c M'Qed JPLQgWJ] nBj@MeW=Z7]\TbKM-R>] QgWJ] c M'Qed JPLQgWJ] nBj@MeW=Z7] jqhbR-P H`R-]JPLQ j@M7W=Ze] QgWJ] ZJQ 'G`o-$ gH`R>]JP=Q j@M7W=Ze] QgWJ] ZJQ 'G`o-$ H`R-]JPLQ j@M7W=Ze] QgWJ] ZJQ 'G`o-$  on-2 (< $IV L Rp)+/ E.)H<($F)s7k)%/Fg(C3$10'"%*-/10@j V /G0 ^ V &6yO?'$Go V )Im20'*c:=)+"%)+Rp)+: V /ˆ$.V 02<S0@"%$..OV E($ "+$./F$QgS0': …2/G)s.*3cgS0':=0  $K02.$Q<($Q.: 0 / >)O0':>"L?{  *3g$ ƒ :=)+g(CD0'"+1)  *-&€7.0t*3&K.%J "+$.*-gp$  *-gp$ Cb` J ]bG7HJILK-R-]kG %[ l QgILM T l QgILM R`o ZY>]Ec-IbG>WbR7H`GUl 6 \ ]bG7HJILK-R-]kG u >Rbo$ n5R $ E'F'G7HJILKJM c -PkG>]@V'P-W edJPLQgWJ] nBj@MeW=Z7][l M'Qed 'v  6fg H`R>]JPLQ j@MeW=Z7] 6f QgW']…ZJQ 'Gbo hY^Z'QPf'G $ Q6iiLo j@MeVJ]jYY H`R-]JPLQPf0Q_YHY_GSW'dbK$ T`MSP n QgWJ]  Q " $ Q w k $q)87k)%/Fg(C3$q0'"%*-/10kEOm'02*K"%:=*30':c0' ^ V &(y+zk)+ :>*3&K.=) p V )%&(U$ ‰Š‹Š‹ŠHJ C3/Fg6.)+C3*sl')%&K./F4 $ z *-/Gg6C3)%/F)%&K.02&(<($F"%$.=)%/Fg(CD0~.=.:=0': V /G01<()%"+CD0':=0'yO?2$x<() V /G0 ^ V &(yO?2$`./Fg(*-CD0'<($':nm')%:=*~}S"O0x>)G0<6)%"%C30':.=)'E(gS 02=...0'RS0':>*-..g gS02>.0‡)%N.=*-m')%^ :tV %$ }ES$Q"%$.L02<($Q<S0@/ V C-. .:=0'< V*3<(u $@gS02:.....=:./ V $Q./Fg(*3C30'<($.:=&S02:n$Q:>)% V C-.:=$ /†^ *3u-&K.*-gp$(J ] &(<(:>ˆ ] g$.

    .

)+*3:>$.)%&(j+:=*-"O06J — /G0A"%C30'=>)Mo V )Hg$k<6)I>)%: "+$..=)%: ^ )%:=)+/ g$.:=0'V <S0I<()%N.$@o )q$‡&€4(/F)%:>$‡<()qgS0': …2/G)s.=)'J R(>)%:Nm.L0M$G"+$.=)„gp)+C3$ "+$.)2E /G^0'V “o V )„:>)%"+)%RS0 V /&9u 46/G)+:=$B<()#g(0': …'/F)+./Fg(*-CD0'<($':rm20'*c0'" ./Fg(*3C30'<($.=)'J  .=<>@?>BA=CBDE9=F5G<7H..L?2$G)+/ ^ V &(y+zk)+n<6*3>.t&S?'$Q=)H*-&€.+J€k) m'$k"VU!<(^ V )%>)i‚=0Ao V ) V /10 ^ V &(yO?'$M..V ]<(* ^ )+:=)%&K. V :./F$@.r2.%E}"%:=*30 V /†„($K02.=*3"+$(J ] $"%:=*30': V /10 ^ V &(yO?2$1gS0':=0F*-&K.02:„)s7kg(C3*-"%*P.)+/Gg(C302./F$m9*3>.    !#"%$# "  '&   )* •)( E'F'G7HJILKJMN OJO ]bG7HJILK-R-]kG Y Ec@IbGSWbR7HLG^]=QgI=M%\ + 2u }v >w -.=*3g$@gS0':=0Q"+:=*30': /G0@"%CD02==)B.=)%&(<($F"%$'/G$QRS0'>)I0F<() }S&(*-yO?'$Q<S0 ^ V &(y%?'$Q.*3"+$(J ] $1"+:=*30': V /10 ^ V &(y%?'$1g(0':.=)%/Fg(CD02.=)%/ 0H/F)%>/10 ^ $':=/GU0  )+>.L0 V &6yO?'$A<6)+m..)%&6{S0G$F/G)+=/F$G&6$.=:=^ )sV .‰ "+V $...)!0 &6yO?'$QgS0':=0@*3&K.)%/g(:=$'R(C3)+/106E~m.0@*3&K..:+E9.!o V 02&(<($$"+$...=$Œ)%N.&(N..$. ‚'.&("%)+*-.L0B>$..:=$'r<()q)%&K.0…„S$K02.*-gp$(E2/102”o V )t..=:=$.)2E9.0Q<6)%"%C30':.=)H<($Q<(9) }S&6*3<($FgS0':=0F0 &6yO?'$Q.R(:=)+^ V"O0':>:=9) lK0'&(<($ 0 &(yO^ ?2$M.0':n0'/‡R(s* l *3<S0'<6)'J Y Z []\_^/`_a2b f []\_^/`)o f [ Y f cj^[ d o]\/[ flc ^l%a \ f!c ^/a g p flc ^/a:Co g flc ^/a{z st f []\_^/`)o f [ Y f cj^[ d o]\/[ flc ^l%a \ f!c ^/a g p flc ^/a:Co g flc ^/a{Hz g flc ^/a}| st 02134053~1 OQA!CD€Jx9SRG<>@J 9.=*3"O02/G)+&€.L0'/F)%&K.)+:==?'$1gS02:.L02%J TBUGV>U ‡dVˆŠ‰‰b‰†Zcb‹ Œ`dXˆBZcb‰Ž. + 2u }v >w 0213405376 8:9.*-gp$ ` "%$'/G$ $..\M_ ZŒŠ\‘‰’Œ ˆB[2ˆ“‹ ”#Z[ X• \Š‰2– — /G0@"%C30'=>)H.=$F<6) V /10@"%C30'=>)al.=)Fm'$k"VU1g$k<6)1<() }S&(*3: V / .=$.=)%/Fg(CD02.)+*3:=$Q)+>.=)%*-:=$..&K.:=0': V /G0M"L{S02/10'<(0‡<S0 ^ V &6yO?'$@o V ) V =)!*-&€.=)%n$.+E}"%:=*30 V /ˆ*3&K.0x*-&€..=)%*-:=$.:q)%&.)2J 0213405340 v5D@w?x9.L0‡0'gp)+&S0'r<()%"+CD0':=0'&(<($‡0 ^ V &(y%?'$(E9 V 0M<(9) }S&6*3yO?2$‡=)+: r‡<(0'<S0‡0 V .)+/Gg6CD02..=)'EK&S?'$q..)2E6>)%&S?'$F$Q"%$. )+>.L0'<S0GgS0':.*3„)+>.!IKJ >ML9NPOQA!CDRJ 9SRG<7>2J 9T z $.7r~.=$(E 0 ^ V &(yO?2$./G)H<() V /G0 ^ V &(yO?'$G<(9) }(&(*3<S0F"%$.)%*-:=$..: V .$ ƒ8J™ )ƒ‚=0H0H>)l V *3: $Fg(:>$'.: Vx˜ <S0BgS0':=0B/10'*-]<(V) V / ..$9"XUM<()%>)i‚=0Go V ) V /G0 ^ V &6yO?'$F../Fg(*3C30'<($.)%/Fg(C302...06E lK0'R(0':=*P.)!*-/Gg(C-)%/F)%&K.!DS D@w5'9=J DE9‚'J ƒ2J I7.7r2..*-"%$(J x”>.a [ f []\_^l`)o f [qp crd_f g crd_flst u R(>)%:Nm./G02.R9‚>)+.=)%&({S0 /10Am.=)%/Fg(CD02..)%/Fg(C302.L0'&K.=)A ‚=)+: r`*3/Fg(C3)+/G)+&K.=)%/Fg(CD0~..) >)%:n<(* )+:=)+&€.=>@?yB>EL9hNPOQA=CBDRJ 9SRG#<>2J 9 T €k)Hm.%E(R(0'>...)+*3:=$'XW Y Z []\_^/`_a2b ced_fhgji'dlknm .)+/Gg(C302...$9"XU„)+>.)Bo V )qm'$k"VU )+>. /.=:=$Š<() V /G0 ^ V &(y%?'$..!DBT ‡ )+&€.=*3&K.R9‚>)+.)!)+&€.

=.OJ V ^ ="2J R6: / z5·¸· ]bG7HJILK-R-]kG >] ] n ]=QqILMUM QgILMfT OJO QqWJ] I bo -PkG>]@V'P-WrF 7F$ JZ_M^Z>GR-PLjqh n ]=QqILM'osP'GSI=K-Rkj>Gun QgWJ]=osTLQj>RUd'RsTbM>P>H`R T n2QgW'] M bo -PkG>]@V'P-WrF 7F$ .=.=*3C30‡<()“¶”:=%$ l.:=0'/G0'yO?'$@)+Œ j ‡ V 0':>.=) p V )%&(U$ ‰Š‹Š‹ŠHJ C3/Fg6.-›œ›œ›œ›œ›œ›œ›-ž ŸP¡ 2£¢n¤¥¢ NPO_¦‘§ ¢ ¡ 2£¢ 575 Ÿ¨KŸ©ª 2£¢ ¨Ÿ ¨Ÿ©ª 2£¢ ¨KŸ 3 ¨ V ª«Ÿ¬ ¢ ©­Ÿ¯®°±ª ¦ 0]² ¨ V ª«Ÿ¬ ¢ ©­Ÿ¯®°±ª 6¦ Tn<² .>.> ¡ 2£¢ 575 ®´³ ¦ ©­Ÿ-µ 2£¢ 575 Ÿ ] &(<(:>ˆ ] g$.=.    %š '=#6#" "%$&q'=* " + -.

• K      K   = .

0 )(/†.0':„)%>gp)+"%* }("O0'/F)%&K.=..I"%$.*-gp$.=.)M"O0'>$(ESm.“ ª 2 °4¡ -.)%/Fg(C302.¸„S$K¡ 02¦ .R(3'C3)Q.=:.N.=.=.02.0 &€4(/F)%:>$.OHJ ) ^ ="2J R6: / z5·¸· .-›œ›œ›œ›œ›œ›œ›  ! 5e¦…§ ¢ ¡ 2£¢ 575 Ÿ¸¨KŸ©ª 2£¢ ¨Ÿ ®´³ ¦ ©­Ÿ-µ 2£¢ 575 Ÿ 3 ¨~°±ª ¦0]² ¨~°±ª ¦6Tn²<.=.-«ž ŸP¡ 2£¢n¤¥¢­¢ ¨ ¤ °_¨ ¦ 5 ®°±ª ¦ 0 ¢ ¨ ¤ ° _¨ ¦0 S ®°±ª ¦6T ¢ ¨ ¤ °_¨ ¦6T S -./Fg(C3)876$Q"+$. )F¦ C3¨ $.> ®°±ª ¦ 0 ®´³ ¦ ©­Ÿ-µ 2£¢ 575 Ÿ  ¬ ¦ ©­Ÿ  ¨ ¦X§_¦ G ®°±ª ¦0M¦  ²<.. I K .> ®°±ª ¦6T ®´³ ¦ ©­Ÿ-µ 2£¢ 575 Ÿ ¬ ¦ ©­Ÿ ¨ ¦X§_¦ G ®°±ª ¦6TM¦  ²<./ g(:>)%"%*-.35<(§_) ¦ „S$K 0~Ÿ .=.=.. I S ®°±ª 6¦ T ¬ ¦ ©­Ÿ ¨ ¦X§_¦ G ®°±ª 6¦ T ¦  ²<.=.=.)%/Fg(C302..=.=.=.> & l<6$+)(R(C-)'E $+)>)i‚=06E =) m'$k"VUQo )6)%.:>/10 Y Z []\_^/`_a2b f []\_^/`)o f Z[ Y f c)^[ d o]\«[ flc ^/%a \ zla'a'`\«[ d a <Bp flc ^/a}a]z>+ =Fg flc ^la a z«/+ ? s u <x[ fji < d a z«> + = Y}a z+ ? st wt @ )(&6"%*3$'&S0': rQgS0':=0F*-&K.„.=.˜ &S02:„gS0':.%©Eª <($Ÿ*)(.=*3g$@)%=g)%" ˜ }S"+$(J /G0 )(&(y%?'$F/ &(*3/F$‡<S0 $.=)%/F— g(CD0~.=.:=0'/G0'yO?'$@)+Œ j ‡F)(0':>.?'$Q<()H<($ )(R(C3.)+&(j%:>*3"%06J x / 0'sC l+)6/10' =*-9./ g(¡ ¦:=)+©"%ª*3=?'Ÿ*$`..H)Gg$k<6)F>)%:M"%$.=.=.- µ ¦ ¬ 5 ¨ ¤ _¨ ¦ ¤ ®´³ ¦ ©­Ÿ-µ 2£¢ 575 Ÿ G I K .=.: )(/&€4(/F)%:>$`"%$.0Q^ 0@/G0'*3$.=) pG)()%&(U$ ‰Š‹Š‹ŠHJ C3/Fg6. > )(=) 2 ¢ E=)@o/)()+: )6/&€4(/F)%:=$ "+$.*: ) <S0`gS0':=0&€4(/F)%:>$.)B&($Q"%0'g ˜ ˜ .-›œ›œ›œ›œ›œ›œ›-ž Ÿ M ¬«° NPO_¦‘§ ¢ ¡ 2£¢ 575 Ÿ¸¨KŸ©ª 2£¢ ¨Ÿ ¨Ÿ©ª 2£¢ ¨KŸ 3 ¨ V ª«Ÿ¬ ¢ ©­Ÿ ®°±ª ¦ 0]² ¨ V ª«Ÿ¬ ¢ ©­Ÿ ®°±ª ¦6Tn²<.*3C30A<()“¶”:=%$ l../Fg(C3)87& :=)+g(:=)+=)+&€./Fg(C3)87k$x"%$..OE„S$K0~.. R -./Fg(C3)87k$.$9"XUIgp$9<()I"%:>*D0'A : )(/G0Q)%=g)%"+~* ‰ ^ ] u u 02C3* 0'yO?2$@gS0':. I K ....=.=.-«ž ŸP¡ 2£¢n¤¥¢  © ¨ ¦X§_ ¦ 5 ®°±ª ¦0 ¬ ¦ ©­Ÿ¨ ¦X§_¦ G ®°±ª ¦0 ¦  ²<..OES)I<(+ $ )(R(C-)M) ^ 0'C-{S0': rQg(0':.:>*D0I<($.=.=.)B^ *3: r ^ )(&("+*3$.)H<($F"O02=$F<()H"L{S0':%J Y Z []\_^/`_a2b f []\_^/`)o f [ Y\ zla'a'`\«[ d a < Yx|ja d B]f D| C+o <S%v \qp |ja 'd B f D| CEo <Sva]z>+ =FgP|'a d B f D| C«+o <Svha z/+ ? s u ] &(<(:>ˆ ] g$..)2J )%=g)%"+*D0'C-* 0'yO?'$@*-: r‡.j )(/G0@<(9) }S&6*3yO?2$ l. R ¨Ÿ©ª 2£¢ ¨KŸ 3 ¨ V ª«Ÿ¬ ¢ ©­Ÿ ®°±ª ¦ 0]² ¨ V ª«Ÿ¬ ¢ ©­Ÿ ®°±ª 6¦ Tn<² .)%/Fg(C302.&(N.=...) )(>) 2 2 J TBUG1V 0 2‰ŒŠb• VˆId4 3 6ˆ 587H\ — /a. RS -.+E() ^ 0'C3{(0': rAgS02:.> ¬ ¦ ©­Ÿ"#rŸ¨ ¦ S ™ )ƒ‚=0F)87k)%/Fg(C3$Q<()H"%C30'=>)B.0Q"L{S0':+J k )+>.)!<6) ^ )(&6yO?'y$  $ ) "+CD0'>=) ƒ#.0Q0 )(&(y%?'$Q. I S RS -. )S0'y+zk)+:)6/ <S0'<($ .. V C3$Mhƒ"%C30'=%$t"%$'/Gg(C-)s7'&#lLJ ] "%C30'=>)($n"+$.

#"+$.)%+J ] &(<(:>ˆ ] g$. l..0'C9"%$.& =)+/ˆgS0':…2/G)s.0’<()%"+CD0':=0': )(/10’"%C30'=>)'E„g(:>9) }S:=0‘.&(N...=)%>..=)%0'&K.%Ek"%$.OHJ ) ^ ="2J R6: / z5·¸· E      .+J ] R(*3R6C3*3$2.=)%&(>*-m20'/F)%&K..)  "+$..0 )(/10@"+CD0'>=)H"%$.$@<() .*-gp$6E(0Q/G)+=/G0A*3: rQ0'"+)%*P.0A)87k.&6"%)%*P.=*3g$Q)%=g)%" ˜ }S"+$(J TBUGV FbtY@ZcbtY 5 ˆŠ‰MŒ ˆH[qˆ Zcb‹ Œ`dXˆBZcb‰ ‡ )%=0'"%$. 9g)%&S0'/F)g(0':..=)%/Fg(CD02..=) l.)+%J u R6=)%:Nm..q$./.)%"%0Ig(0'<(:..=)%/Fg(CD0~.)%/Fg(C302.=*3g$.:=$'„)H0'g ‚'n$Q&($'/G)B<S0 ^ )(&(y%?'$Q$@.)Œ"+CD0'>B‚ r‘j )(=0'<S0‰g(0':.=:=$.g(:>*3/F)%*3:>$t"%:=*-)r"+CD0'>=)+“&($.)!/o )() "%$.*..C3$'RS0'*3+J k ?'$!"+:=*-)5.)+“<()r.0'&(y%0M<() )(/G0M"%C30'=>) l.:>$..x    ql#"  %   • t <x[ fji < d B f <«|r\_^p o gz s Y w u R(>)%:Nm.$Q<() ^ :=*-)%&(<x.0 <()%"+CD0':=0':„$.OJ z $.)%&(j+:=*-"%$.*-gp$G<(9) }S&6*3<($G)%/ )(/ˆ.=$Mg(0':.:>/10'*) ^ 0'yO0Q.)$.?2$@<(a) z5·¸· )(.=)%:c..„.C-m')%:#g(:>%$ l./G$‰0gS02CD0Om9:..0 )(/ .=)%/Fg(CD02.)+/Gg6CD02.*3g$Q)%>gp)+"%*D02C3* u 0'<($(J ‡!0'<(0 )(/G0A"%C30'=>)H<S0 ^ $':=/G0xW f []\_^/`)o f [ Y f cj^[ d o]\/[ f =P\ |'`)o B/B a \«[€u iw t 0Q/F)%=/G0Ag$k<()H>)%:t)%>gp)+"%*D02C3* u 0'<S0A<S0 ^ $.$ j2E.?'$ =)%/Fg(:>)I"+$.C-$.>.:=0'/102 l')%&(j+:=*3"+$.=)%/Fg(CD02./ )(/ J u "%$.$6EK{()%:=0'&(yO0M<(F) )(/G0M"+CD0'>=){lK0'RS02:=*-..=) pG)()%&(U$ ‰Š‹Š‹ŠHJ C3/Fg6.0'<S0x0 "%CD02==)B.=)%/Fg(CD02.&("+)%*P.:=0'/G0'yO?'$@)+Œ j ‡F)(0':>./F$1$*-&€.)‡($ )(>$G<6)H..=)%/Fg(CD0~.)+/Gg(C302.=)%+E9m'$k"VU g$k<()n<()+=)%&Km'$.:>/10 W f []\_^/`)o f [Y\ |'`)o B/B a \«[ Y flc ^/%a ['[ B ^[x| c ox` c f o «%a \€u iw t u R(>)%:Nm.q&Œ<($G)s7k)%/Fg(C-$x0'"%*-/1%0 ƒsES=)+:.=*3g$@<()9}S&6*3<($(J Y Z []\_^/`_a2b f []\_^/`)o f [ Y f cj^[ d o]\/[ =Fg crd_f d \ |'`)o B/B ae\/[€u Nw t dx+o < o€| < c +o <