Quarto Módulo

Apostila
Em 1988 o governo americano lançou o primeiro banco de dados público contendo sequências de DNA dos mais diversos organismos. Este repositório de seqüências recebeu o nome de Centro Nacional para Informação em Biotecnologia (NCBI-National Center for Biotechnology Information). Hoje este centro tem várias ramificações no mundo inteiro e além do banco de dados propriamente dito, o NCBI proporciona um grande número de ferramantas de informática e recursos para auxiliar o cientista na pesquisa genética. A utilização cada vez maior da informática no estudo da pesquisa biólogica e ainda mais específicamente no estudo dos genes deu origem à disciplina conhecida como bioinformática. A bioinformática é ainda considerada uma recente subdivisão da biotecnologia e representa o “casamento” da biotecnologia com a informática. De modo simples, bioinformática consiste no depósito e análise de sequências genéticas em bancos de dados e consequente manipulação e análise destas sequências com a utilização de software específicos. O estabelecimento de bancos de dados públicos possibilita que os cientistas possam ter acesso à informação proveniente de outros laboratórios e possam também trocar e compartilhar seqüências genéticas. Todos os dias novas seqüências são depositadas no banco de dados púbicos do NCBI, o chamado GenBank. A bioinformática tem revolucionado o desenvolvimento da pesquisa médicobiólogica e tem possibilitado que novas descobertas relevantes sejam realizadas quase todos os dias. Hoje a maioria dos biólogos envolvidos com a pesquisa genética não estão restritos apenas ao trabalho de laboratório devendo os mesmos dedicar grande parte do seu tempo à bioinformática.
2) 3) 4) 4)

da oficina prática de Genética, Genoma e Biotecnologia

www.odnavaiaescola.org
deste Módulo Introduação à Bioinformática Conteúdo 1) Síntese de c-DNA Gene-bank e banco de sequências Pesquisa BLAST, Comparação de sequências Mapa de restrição

Anotação de genomas Este texto foi escrito por Francisco Prosdocimi (transcrito com permissão do autor). Este artigo foi baseado, principalmente, no artigo da Revista Nature Reviews, volume 2, julho de 2001, páginas 493-505, Genome annotation: from sequence to biology, que foi escrito por Lincoln Stein. Por milhares de anos, rabinos têm trabalhado sobre os textos do Torah, tentando fazer com que esse livro sagrado, tão difícil de ser entendido, seja traduzido num conjunto de regras e condutas mais claras, de forma a montar uma versão compreensível desse texto, conhecida como Talmud. Com o passar do tempo, a grande quantidade de anotação contida no Talmud chegou a ultrapassar, de longe, o tamanho do texto original, o Torah. A mesma analogia pode ser feita para os genomas. A seqüência de DNA é uma fonte rica de informações sobre a biologia dos organismos, mas deve ser traduzida e anotada de forma correta para que possamos obter corretamente essas informações. A anotação genômica consiste num processo de vários passos, havendo, mais ou menos, três

Todos os direitos reservados à DNA Goes to School, Inc 2004

Isso porque quando o DNA é transcrito para a forma de RNA apenas uma das fitas é transcrita. As sequências estão sempre depositadas em forma de fita única. Na anotação em nível de nucleotídeos procura-se encontrar a localização física das seqüências de DNA e descobrir onde estão os genes. ® Chico On Line. Quando não se conhece o gene. apenas a fita senso de DNA é depositada no banco de dados. F. Ao invés disso. Já a anotação em nível de processo procura identificar as vias e processos nos quais diferentes genes interagem. Então. Na anotação em nível protéico procura-se descobrir a provável função dos genes. As letras em maiúscula correspondem aos exons de um determinado gene e as letras em minúscula correspondem aos introns. montando uma anotação funcional eficiente. Prosdocimi. Deste modo. não está depositada no Genbank desta forma. que é transcrita para a forma de RNA. etc. A outra fita complementar à molécula de DNA. Veja. mesmo que seja um fragmento de DNA. anotação em nível de proteínas e anotação em nível de processo. Vamos supor que um fragmento de DNA de uma determinada fita senso seja da seguinte forma: ATGCGTTACCTTAGtcagtctcatcTCAGGTGTCatcttttcttaCTGATC O RNA mensageiro correspondente à esta fita senso estará depositado no GenBank da seguinte forma: ATGCGTTACCTTAGTCAGGTGTCCTGATC . o RNA mensageiro depositado no GenBank é semelhante à fita senso de DNA. a que chamamos de fita senso. RNAs. 2001-2. qualquer uma das fitas pode ser a fita depositada. corresponder à fita complementar do DNA . Então qual é a diferença entre a fita senso de DNA e fita de RNA mensageiro depositadas no GenBank? A diferença está no fato de que o RNA mensageiro constitui apenas os exons da molécula de DNA pois os introns são removidos durante o processo de edição do RNA. Como as seqüências estão depositadas no GenBank? Para que você possa realizar as atividades interativas você tem que entender como as seqüências de DNA e RNA estão depositadas no GenBank. Mas não se preocupe porque só trabalharemos com genes conhecidos. o primeiro ponto que você tem que ter em mente é que a fita de DNA depositada é a fita senso. na realidade. o exemplo abaixo. apesar de. O segundo ponto que você deve saber é que a molécula de RNA mensageiro. identificando quais são aqueles que determinado organismo possui e quais ele não possui. chamada de fita anti-senso não é transcrita para a forma de RNA. É claro que isso é válido para os casos onde o gene é conhecido.categorias básicas: a anotação em nível de nucleotídeos. elementos repetitivos. Deste modo o RNA mensageiro é sempre menor que a fita senso de DNA.

a transcriptase reversa faz o caminho contrário daquele percorrido pela RNA polimerase. Veja a figura abaixo. ou cDNA. Ou seja. que a partir de uma molécula dupla fita de DNA produz RNA. O cDNA é uma molécula similar ao DNA porém esta é sintetizada no laboratório. Deste modo. O cDNA é uma molécula estavél. uma enzima de origem viral que tem a capacidade de produzir uma molécula de DNA dupla fita a partir da cópia de uma molécula de RNA. mas sim com as bases de timina A explicação deste fato está na síntese de DNA complementar. timina. adenina. . como o nome diz. A síntese de cDNA é realizada com a transcriptase reversa. A maioria das seqüências de RNA que estão no GenBank foram obtidas através da síntese de DNA complementar. de fácil manuseio e sua multiplicação é bastante simples. ponte de hifdrogênio e as 4 bases nitrogenadas.É importante que você faça as seguintes observações: · O RNA mensageiro constutui apenas os exons da fita original de DNA · O RNA mensageiro NÃO está na forma de fita complementar · O RNA mensageiro não está depositado com suas bases de uracil (que é o que na realidade ocorre). A molécula de RNA é extremamente instável e dependendo do RNA em questão o número de cópias pode estar muito reduzido. a possibilidade em se trabalhar com moléculas de cDNA ao invés de RNA tem facilitado muito o trabalho do cientista no laboratório. guanina e citosina). A descoberta desta enzima viral e de seu mecanismo de ação abriu um importante caminho na biologia molecular. grupos fosfato. A molécula de DNA produzida pela transcriptase reversa é chamada de DNA complementar (ou cDNA) e é formada pelos mesmos compostos encontrados na molécula de DNA (açucar desoxirribose.

Atividade 1: Procurando um gene no GenBank.Seqüência de Imagens Passo 1 .

Passo 2 Passo 3 .

Passo 4 Passo 5 .

Passo 6 .

Atividade: Cachorro. o melhor amigo do homem Passo 1 Passo 2 .

Passo 3 Atividade: Em buusca da mutação da anemia falciforme Passo 1 .

Passo 2 Passo 3 .

Mapas de Restrição Veja abaixo os mapas de restrição que você irá obter no exercício Cortando com o Webcuter Exercício 1: Polimorfismo do gene ALDR .

você concluiria que o homem e os cachorros apresentam 91% de similaridade em seu DNA? 4) O que é mapa de restrição e como o mesmo pode ser usado? 5) O que é o GenBank? .”. o melhor amigo do homem..Exercício 2: Seqúência do gene VLCS (Very Long Chain Synthetase) Após realizar a atividade no computador. tente responder às seguintes perguntas: 1) O que é bioinformática? 2) Se o DNA é uma fita dupla. por que as sequências aqui apresentadas só têm uma fita? 3) A partir da realização da atividade “ Cachorro.

.

Tabela de Aminoácidos .

estamos ainda no começo.org. ela é essencial para a construção de bases de dados contendo informações sobre os genes e proteínas dos organismos vivos. e de novos medicamentos. computação. O verdadeiro oceano de dados que está sendo gerado por projetos como o Genoma Humano. ou seja. o bioinformata é muito valorizado pela crescente demanda e pelo ainda pequeno número de pessoas capazes de preenchê-las. tem como objetivo descobrir o código genético dos cerca de 80. instrumentação e bioengenharia. Os salários iniciais são altos. A universidade precisa urgentemente se movimentar para formar esse profissional crucial para a medicina do próximo século! No exterior (como na Baylor University. que tem como objetivo desenvolver e aplicar técnicas computacionais no estudo da genética. ter múltiplos talentos.Bioinformática. particularmente nos grandes laboratórios multinacionais. Os maiores empregadores são as universidades. de grande importância econômica para o estado de São Paulo) e o Projeto Genoma e Câncer. como o da UNICAMP (Grupo de Biologia Computacional do Instituto de Computação. e a maioria dos profissionais da área é autodidata.br/correio/cp990430. Usando alta tecnologia. institutos de pesquisas privados e do governo. a profissão do futuro Renato Sabbatini (disponível em http://www. Onde encontrar um bioinformático. que montou uma organização para o sequenciamento genético (ONSA). biologia.epub. Esta é uma ciência novissima (existe há menos de 10 anos). por exemplo. Antes de tudo. são os principais responsáveis por esta explosão na demanda por bioinformatas. O Brasil também se ressente da falta desses profissionais. e um especialista com muitos anos de experiência pode ganhar muito dinheiro. ambos da FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo). estatística. tais como matemática. causando a doença chamada “amarelinho”. embora já estejamos embarcados em projetos genômicos grandes e multi-institucionais. para a descoberta de novos genes. etc. genética e bioquímica. Núcleo de Informática Biomédica). sem dúvida. Existem hoje grandes repositórios de dados genéticos e bioquímicos. da biologia molecular e da bioquímica. como o GenBank (que contém todas as seqüências de DNA conhecidas até hoje e que ocupa o equivalente a mais de 100 CD-ROMs). E aqui? Tirando uns poucos centros. Quase não existem cursos sobre esse tema. Mas. genética. é preciso ter uma cabeça interdisciplinar. Geralmente é um biólogo ou médico que tem grandes conhecimentos de informática. já existem até cursos em nível de graduação sobre bioinformática. . Centro de Biologia Molecular e Engenharia Genética. no Texas). Entre outras coisas.000 genes humanos e utilizar esse conhecimento para tratar doenças genéticas.htm) Nos últimos anos. como o Genoma da Xylella fastidiosa (um microorganismo que ataca os laranjais. e a expansão no setor de biotecnologia médica. empresas farmacêuticas e de informática. as seções de oferta de empregos na área biomédica têm estado lotadas de anúncios à procura de um profissional ainda desconhecido da maioria das pessoas: o especialista em bioinformática. é a profissão do futuro. O Projeto Genoma Humano. ou como formá-lo? É uma tarefa ainda bastante difícil.

do aprendizado à gerência. então coordenado por João Carlos Setubal e João Meidanis. Ao me envolver com biologia molecular aplicada a plantas. compartilhei a coordenação da bioinformática com João Setubal. João Setubal alçava vôos mais altos também. Tenho trabalhado como bioinformata desde 1999. Em 2003. ir para a iniciativa privada era para mim algo totalmente fora de cogitação. Condições aceitas e inexeperiência tolerada. afinal de contas meu último contato com DNA havia sido no segundo grau. estava eu lá. Na verdade. diferentes experiências na área de bioinformática. Confesso que o projeto Alellyx era tentador. como sócio e diretor. Vivi. trabalhando e realizando contatos acadêmicos no exterior. esta heterogeneidade de situações me permitiu chegar a algumas conclusões que podem servir de orientação para quem pretende trabalhar na área. Mas eu estava vendo as pessoas a meu redor tomarem novos rumos e eu precisava encontrar o meu. O triângulo ensino-pesquisa-extensão era pesado demais para mim. Eu sentia mesmo ojeriza a esta possibilidade. Eu precisava de algo com mais foco. como outras áreas emergentes de trabalho. agrônomo e microscopista de longa data. Atualmente. Começamos a operar em março de 2002. como profissional e mesmo como pai. nas portas da Votorantim Ventures (VV). fazendo informática para biólogos. nestes últimos 4 anos. para a iniciativa privada na área de software e serviços de bioinformática. quando deixei para trás uma carreira promissora como professor adjunto no Departamento de Ciências da Computação da Universidade Federal de Minas Gerais. Naquela mesma época. Vejo nela a confluência de meus vários ideais de profissão: a multidisciplinaridade e o equilíbrio entre teoria e prática. Apesar do pouco tempo. consigo entendê-lo melhor. na área de biotecnologia. outros vieram. decidi mudar para uma área de trabalho mais aplicada. alguns meses antes desta proposta. um dos big boss da ciência no país. levamos. farmacêuticos e químicos me tem sido muito enriquecedor. a bioinformática se enquadra em um contexto onde o problema “não é hardware. O contato com biólogos. Não considero .Bioinformática: manual de utilização João Paulo Kitajima “Experiência é o nome que damos a nossos erros. as propostas de investimento estavam sendo analisadas por um grupo chefiado por Fernando Reinach. envolto por uma atmosfera efervescente de desafio. Fernando já havia uma contraproposta: juntar-se. 3 meses para finalizar o projeto. proteínas. a Votorantim havia decidido investir em empreendimentos de risco e.” Oscar Wilde A bioinformática é uma área fascinante. Chamo isto tudo de “ironia do destino” porque. Cheguei mesmo a prestar vestibular para agronomia e economia. Voltar para a universidade também estava fora de cogitação. entre bioinformatas. alguns meses antes. mas a necessidade de um salário falou mais alto e consegui uma bolsa de pósdoutorado da Fapesp no Laboratório de Bioinformática (LBI) do Instituto de Computação da Unicamp. conto com uma equipe de primeira linha. o destino me chamava para novos desafios. assumi sozinho esta área na empresa. João Meidanis já havia mudado de rumo ao partir. eu o havia procurado para me orientar sobre como submeter um projeto para a VV. a um novo grande empreendimento que estava surgindo na área de genômica aplicada a plantas . Afinal de contas. Mal me lembrava do que era o dogma central da biologia molecular. como dizem por aí. analistas de sistemas e de suporte e me considero privilegiado em estar onde estou. pessoalmente.a Alellyx. Impus algumas condições e declarei minha completa inexeperiência em assuntos empresariais. nem tive tempo de expor os meus planos. nem software. a bioinformática do primeiro projeto genoma do Brasil estava acontecendo ali. Mas. Cansado de empregar o dinheiro público em projetos sem retorno mais imediato para a sociedade. No início tudo era muito estranho. E. enzimas e ribossomos. com a volta de Setubal para a academia. tornar-me bioinformata me possibilitou alinhar com a área de trabalho de meu velho pai. Além destas razões. de repente. Em meados de 2001. agrônomos. A ironia do destino me fez bater. ao meu lado. mas peopleware”. então. Estudar a vida é uma experiência única e participar deste estudo me é muito gratificante. do público para o privado. em dezembro de 2001. Assim. E depois do genoma da Xylella fastidiosa. eu e mais 4 sócios. Durante aquele ano.

em bioinformática. eu prezo muito mais do que a capacidade técnica e que muitas vezes não vem explicitada nos currículos dos profissionais: a capacidade de compreender o que os usuários ou clientes necessitam para resolver os problemas. Em geral. em várias situações. -Conhecer os príncipios da biologia molecular e as diferentes técnicas de bancada nos diferentes domínios onde a bioinformática se faz necessária (as “ômicas” principalmente: genoma. eu valorizo muito mais um profissional mediano entrosado e com foco do que um aluno nota 10 na faculdade. Parece óbvio que um bioinformata qualificado precise preencher as duas condições acima.htm . Visto de outro ângulo. nem mesmo os usuários sabem exatamente o que querem e onde querem chegar. saber traduzir a solução de um problema em um conjunto de programas eficazes e eficientes). deve possuir boa capacidade de abstração pois os problemas não são claros e as soluções menos ainda. Isto implica obrigatoriamente na facilidade em se relacionar com diferentes tipos de profissionais (aqui. informatas se relacionando com outros informatas e com biólogos). ela é mais dramática.br/reportagens/bioinformatica/12. mas. Ou seja. um bioinformata deve. Além do mais. Esta condição é vital para qualquer contexto de análise de sistemas. Gostar de biologia é essencial. Biólogos são cientistas e muitas vezes a solução bioinformática que necessitam faz parte do processo da descoberta. Um profissional de bioinformática bem colocado precisa: -Ter um bom conhecimento em ciência da computação: isto significa basicamente possuir uma boa capacidade de abstração algorítmica (isto é. mas anti-social e disperso. transcriptoma. antes mesmo da implementação dela. Os bioinformatas atendem um público que está envolvido com um negócio bastante complexo: ciência. proteoma e metaboloma). Enfim.comciencia. Texto tirado de http://www. Na formação da minha equipe na Alellyx. O bom bioinformata deve estar ciente deste fato e sintonizado com o usuário. Familiaridade e gosto por computação são condições obrigatórias para o sucesso na área. O bioinformata deve ser parte da definição da solução. antes de tudo. a bioinformática é uma área de trabalho que exige um profissional multidisciplinar. João Paulo Kitajima é diretor de Bioinformática/Alellyx Applied Genomics. Mas existe uma condição adicional que.a bioinformática a profissão do futuro. profissionais de computação que trabalham em ambientes de P&D devem possuir esta característica. mas penso que ela exige profissionais do futuro. saber se relacionar com pessoas e saber se colocar no lugar dos cientistas.

Sign up to vote on this title
UsefulNot useful