You are on page 1of 52

PRIRUNIK ZA VJEBE IZ MOLEKULARNE BIOLOGIJE I GENOMIKE U VETERINI

- MENDELIZAM -

9. KLASINA GENETIKA NASLJEIVANJE PO MENDELU I


TEORETSKI DIO 9.1. Znanost o nasljeivanju Genetika je znanost koja prouava biologiju nasljeivanja i promjenjljivost ivih organizama. Ona prvenstveno prouava nain nasljeivanja biolokih osobitosti s roditelja na potomstvo. Jaja i spermije zovemo gametama. Gamete nastaju redukcijskom diobom, mejozom i imaju polovian broj kromosoma (N). Ovaj polovian broj kromosoma nije matematiki polovian broj, ve je genetiki, a to znai da gameta ima uvijek polovian broj svih kromosoma, a time i polovian broj svih svojih alelnih parova gena zigote. Oploeno jaje nazivamo zigotom. Dakle, spajanjem gameta mujaka i enke (spermija i jaja) nastaje novi organizam ili zigota. Svaka zigota (osim iznimaka, haplonta) ima diploidan (paran) broj kromosoma koju oznaavamo s 2N. Shema je sljedea: enska gameta (jaje) ima N broj kro mosoma spojen s mukom gametom (spermij) koji ima N broj kromosoma, daju zigotu 2N kromosoma ili N + N = 2N. Haploidno je oznaka u genetici za stanice koje imaju polovian ili N broj kromosoma u svojoj jezgri. To su najee spolne stanice mujaka i enke, odnosno spermij i jaje, koje nastaju redukcijskom, mejotikom diobom ili zajednikim imenom gameto-genezom i imaju polovian ili N broj kromosoma. Shema je sljedea: 2N : 2 = N (N = gameta; 2N = zigota). Diploidno je oznaka za stanice koje imaju diploidan (dvostruk, paran) broj kromoso ma 2N. One nastaju spajanjem spolnih stanica jedinki iste vrste razliitog spola. Taj proces nazivamo oplodnja. Shema je sljedea: N + N = 2N = zigota (diploidan broj kromosoma). Svi geni jedne zigote (jedinke) ili svi kromosomi sa svim genima jedne zigote ine genotip, genom. Svaka jedinka ima odreeni broj kromosoma zakon o konstantnosti broja kromosoma svake vrste, a na tim kromosomima nalaze se alelni parovi gena koji ine genotip. Kemijska osnova genotipa su nukleinske kiseline, odnosno redoslijed duikovih baza. Fenotip je produkt genotipa i utjecaja okolia. Geni se izraavaju u svojstvima, odnosno odreuju fenotip koji moe biti vidljiv i u vanjskom izgledu. Kemijska osnova fenotipa su bjelanevine, odnosno redoslijed aminokiselina. Homologni kromosomi su parovi kromosoma koji su jednaki po obliku, veliini i imaju jednaki pravocrtni raspored gena za ista svojstva. Npr. ako se na "lijevom" homolognom kromosomu na odreenom mjestu nalazi gen A (itaj veliki A) dominantan gen za boju sjemenke (zrna) graka, onda se na toj istoj visini "desnog" kromosoma, (homolognog) dakle pravocrtno mora nalaziti

isti gen (A) ili drugi gen a (itaj mali a), recesivan gen za boju sjemenke (zrna) graka (Slika 58).

Slika 58. Homologni par kromosoma (geni za boju zrna graka - jedan alelni par gena na jednom paru homolognih kromosoma za jedno svojstvo) Alelomorfni par gena ili aleli su parovi gena na homolognim kromosomima za isto svojstvo. Te parove gena uvijek moemo pisati na tri razliita naina kao: AA (itaj dominantan homozigot) Aa (itaj heterozigot) aa (itaj recesivni homozigot). Pojam dominantno odnosi se na dominantan gen. Gen je osnovna jedinica nasljeivanja, najee ga oznaavamo slovima abecede. Tako velika slova abecede oznaavaju dominantan gen (A, B, C, D ...). Pojam recesivno takoer se odnosi na gen, a oznaava se malim slovima abecede (a, b, c, d ...). Dominantni homozigot je jedan ili vie alelnih parova gena koji zajedno ili vie svojstava imaju oba dominantna gena npr. AA; AABB; AABBCC ...(Primjer 1.)

Primjer 1.: AA; Aa; aa: genotipovi triju monohi-bridnih zigota (pratimo jedno svojstvo). AABB; AaBb; aabb: genotipovi triju dihibridnih zigota (pratimo dva svojstva). AABBCC; AaBbCc; aabbcc: genotipovi triju trihibridnih zigota (pratimo tri svojstva). Ovisno o tome, koliko je alelnih parova gena unutar genotipova jedne zigote, govorimo o monohibridnoj, dihibridnoj, tri-hibridnoj ili polihibridnoj zigoti. Heterozigot je takoer jedan ili vie alelnih parova gena koji zajedno ili vie svojstava imaju u svakom alelnom paru jedan dominantan i jedan recesivan gen npr. Aa; AaBb; AaBbCc ...

Recesivan homozigot je jedan ili vie alelnih parova gena koji za jedno ili vie svojstava imaju u svakom alelnom paru oba recesivna gena npr. aa; aabb; aabbcc ... Svi alelni parovi gena unutar jedne zigote ine genotip te zigote. Fenotip je izraajnost svakog alelnog para u svojstvima proteina, a svaki od njih moe imati alternativnu mogunost jedno ga izraaja. Tako smo vidjeli da boja sjemenke zrna graka, jedna izraajnost - boja zrna graka ima alternativnu mogunost: utu boju zrna graka i zelenu boju zrna graka. Dominantan gen je onaj gen koji se uvijek izraava u fenotipu ako se nalazi u genotipu, a ti su genotipovi dominantan homozigot (AA) i heterozigot (Aa). Recesivan gen je onaj gen koji se izra ava u fenotipu jedino ako je u genotipu recesivan homozigot (aa). Da bismo odreeni genotip odredili i proitali njegov fenotip, moramo odrediti zaduenost gena svakog alelnog para (Primjer 2.) .

Primje 2. : A - dominantan gen za utu boju zrna graka a - recesivan gen za zelenu boju zrna graka Genotip AA = uta boja zrna graka Genotip Aa = uta boja zrna graka Genotip aa = zelena boja zrna graka
genotip AA Aa aa fenotip uto zrno graka uto zrno graka zeleno zrno graka

P = parentalna generacija (roditeljska) G = gamete, gamete se piu ispod svoje zigote, (svakog roditelja) i to samo one koje su razlii te i zaokruuju se F = filijalna (sinova) generacija, ili idua generacija moe biti F1, F2 ili F generacija.

9.2. Mendelovo pravilo uniformnosti F1 generacije Mendelovo pravilo uniformnosti F1 generacije kae da su potomci F1 generacije svi po fenotipu jednaki (uniformni), a po genotipu heterozigoti. Uvijek ako kriamo roditelje genotipa AA (dominantan homozigot) s aa (recesivan homozigot) imamo pravilo uniformnosti Fi generacije (Primjer 3.).

Primjer 3.:

Kad bismo kriali AA (dominantan ho mozigot) s Aa (heterozigot), u F generaciji dobili bismo sve potomke po fenotipu jednake, ali to krianje ne bi bilo pravilo uniformnosti F1 generacije, jer svi genotipovi potomaka nisu heterozigoti nego je 50% potomaka dominantni homozigoti (Primjer 4.).

Primjer 4.:

Takoer ako kriamo roditelje genotipova AA x AA ili aa x aa potomci e uvijek po fenotipu biti jednaki, a krianje ne potvruje Mendelovo pravilo unifor mnosti F1 generacije (Primjer 5-6.).

Primjer 5.:

Primjer 6.:

Pravilo uniformnosti Fi generacije moemo pratiti i kod ostalih krianja koji se razlikuju od monohibridnog, a to su: dihibridno (Primjer 7.), trihibridno (Primjer 8.) i polihibridno krianje.

Primjer 7.:

Primjer 8.:

9.3. Intermedijalno krianje

Ako geni, u alelnom paru, nisu u odno su dominantan-recesivan, govorimo o in termedijarnom (jednakovrijednom) odno su gena i njihovom jednakovrijednom do prinosu u fenotipu. Krianjem takvih jednakovrijednih gena u genotipovima nazivamo intermedijarnim krianjem (Primjer 9a-d.). Takve gene najpri kladnije je oznaavati s velikim ili malim slovima. Ta slova neka budu i prva slova fenotipa.

Primjer 9.: C - gen za crvenu boju cvijeta zjevalice B - gen za bijelu boju cvijeta zjevalice genotip CC = fenotip crvena boja cvijeta genotip CB = fenotip ruiasta boja cvijeta genotip BB = fenotip bijela boja cvijeta

a)

b)

c)

F2

CC ; CB ; CB ; BB

omjer genotipova: 1 : 2 : 1 omjer fenotipova: 1 : 2 : 1

Svaki gen unutar genotipa jednako pridonosi izraajnosti u fenotipu. Ako su oba gena jedan alelni par za crvenu boju, onda je boja cvijeta crvena (genotip CC). Ako su u genotipu (CB) unutar jednoga alelnog para, jedan gen za crvenu boju, a jedan gen za bijelu boju, onda e cvijet biti ruiast. Ako su oba gena, jedan alelni par, za bijelu boju (BB), onda je boja cvijeta bijela. 9.4. Analizirajue krianje Ako je gen A zaduen za utu boju zrna graka, a gen a za zelenu boju, onda geno tip AA (dominantan homozigot) i genotip Aa (heterozigot) daju jednaki fenotip: utu boju zrna graka. Razliiti genotipovi daju iste fenotipove jer je ovdje odnos gena dominantan-recesivan. Genotip aa (recesivan homozigot) dat e u fenotipu zelenu boju zrna graka. Kod fenotipa uta boja zrna graka ne znamo na temelju fenotipa, genotip. Genotip je mogao biti ili AA (do minantan homozigot) ili Aa (heterozigot). Upravo taj genotip AA ili Aa (nepoznanica), analiziramo pomou genotipa aa (poznanica). U Primjeru 10. P. AA x aa je pravilo uniformnosti Fi generacije), a u Primjeru 11. P. Aa x aa je monohibridno analizirajue krianje jer je omjer fenotipova potomaka F1:1. Da je omjer potomaka bio 1 : 1 : 1 : 1 onda bi to krianje bilo dihibridno analizirajue (Primjer 12). Broj svojstava (alelnih parova gena) ovisit e o tome hoe li krianje biti monohibridno analizirajue, dihibridno analizirajue, trihibridno analizirajue (Primjer 13.) ili polihibridno analizirajue.

Primjer 10: Uniformnost F1 generacije

Primjer 11. Monohibridno analizirajue krianje

Primjer 12: Dihibridno analizirajue krianje

P.

AaBb

aabb

F.

AaBb ; Aabb ; aaBb ; aabb

Omjer fenotipova:

1:1:1:1

Primjer 13: Trihibridno analizirajue

F. AaBbCc ; AaBbcc ; AabbCc ; Aabbcc ; aaBbCc ; aaBbcc ; aabbCc ; aabbcc

PRAKTINI RAD Rijeite slijedee zadatke: 1. Napii genotip monohibridne zigote u tri razliite varijante. 2. Napii genotipove trihibridne zigote u tri razliite varijante. 3. Napii fenotipove odreenih genotipova: AA; Aa; aa; AABB; AaBb; aabb. 4. U genotipu trihibridne zigote je gen za prvo svojstvo dominantan homozigot, za drugo recesivan homozigot i tree heterozigot. Koji je fenotip tog geno tipa?

5. Svim genotipovima AA, Aa; aa; AABB, AaBb; aabb ispii gamete. 6. Kakvo e potomstvo imati grahorasta andaluzijska koko (GB) ako se spari s pijetlovima sljedeih boja perja: crna (CG), grahorasta (GB), bijela (BB)? 7. U goveda je krianac svijetle boje krave (SS) i crvenog bika (CG) pjegav (CS). Kakvi bi bili potomci para pjegavih goveda? 8. U goveda je gen (P) dominantan za fenotip bez rogova, a gen (p) recesivan za fenotip s rogovima. Bik bez rogova sparen je s tri krave. S kravom A koja ima rogove, imao je tele bez rogova; s kravom B koja takoer ima rogove, imao je tele s rogovima; s kravom C koja nema rogove, imao je tele s rogovima. Koji su genotipovi svih roditelja i potomaka? 9. Dvije crne enke mia (A i B) kriane su s dva smea mujaka (C i D). U sluaju krianja A sa C i A s D, potomci su smei i crni, a u sluaju krianja B sa C i B s D, potomci su crni. Izvedi sva etiri krianja. 10. Izvedi Fi generaciju monohibridnog, dihibridnog i trihibridnog krianja. 11. Gen A je za utu boju, a gen a za zele nu boju zrna graka. Kriaj uti sa ze lenim grakom, a da krianje pokae pravilo uniformnosti. 12. Kriaj uto puta zeleno (zrno graka) kao u prethodnom zadatku, a da krianje ne bude Mendelovo pravilo uniformnosti. 13. Roditeljski par svinja dao je 12 potomaka crne boje dlake. Drugi par roditelja dao je 6 potomaka crne boje dlake. Drugi par roditelja dao je 6 potomaka crne boje dlake i 6 potomaka bijele boje dlake. Za prvi i za drugi par roditelja izvedi krianje (gen B crna boja dlake; b bijela boja dlake). 14. Napii roditeljsku (parentalnu) generaciju koja je dala potomke razliite po fenotipu i genotipu, a u omjeru su 1:1:1:1. 15. Kriaj genotipove roditelja P. AaBbCc x aabbcc. Ispisi sve fenotipove poto maka i roditelja. 16. Mukarac smeih oiju i ena plavih oiju imaju 8 djece koja sva imaju smee oi. Koji su genotipovi roditelja i djece? Kolika je teoretska vjerojatnost za eventualne druge mogunosti? 17. Mukarac plavih oiju iji su roditelji imali smee oi, ima suprugu smeih oiju iji je otac imao smee, a majka plave oi. Oni imaju jedno dijete plavih oiju. Ispii sve genotipove. 18. Gen za utu boju i okrugli oblik graka su dominantni nad genom za z elenu boju i naborani oblik. Kriaj uti okrugli graak sa zelenim naboranim. ispii F1 i F2 generaciju. 19. Ako se boja cvijeta naslijeuje intermedijarno, kako e izgledati potomci (F1 i F2 generacije) roditelja crvenih i bijelih cvijetova, te potomci krianja F1 generacije sa svakim od roditelja?

10

10. NASLJEIVANJE PO MENDELU II i III


TEORETSKI DIO Drugo Mendelovo pravilo nasljeivanja je pravilo nezavisne segregacije kromosoma koje govori o tome, da se kromosomi nezavisno segregiraju (odvajaju) u gamete. Tim Mendelovim pravilom nastaju gamete iz zigote procesom gametogeneze. To pravilo iskazujemo tako, da umjesto kromosoma piemo gene, te jedan gen predstavlja jedan kromosom, a jedan homologni par kromosoma predstavlja nam ujedno jedan alelni par gena. Nezavisna segregacija kromosoma znai da kromosomi koji imaju na sebi dominantne gene za neka svojstva (odnosno dominantni geni), nemaju nikakvu prednost nad kromosomima koji na sebi nose recesivne gene za neka svojstva (odnosno recesivni geni) da dou u gametu. Dakle, svi kromosomi sa svim genima (u polovinom broju - N) imaju jednaku prigodu, jednaku mogunost da dou u gametu. Kod izvoenja pravila nezavisne segregacije kromosoma nije potrebno izvoditi krianje (Primjer 1420).
Primjer 14: Primjer 15:

Primjer 16:

Primjer 17:

11

Primjer 18:

Primjer 19:

Primjer 20:

Tree Mendelovo pravilo nasljeivanja je pravilo slobodne kombinacije gameta da se svaka gameta jednoga roditelja moe slobodno spojiti s gametom drugog roditelja is te vrste. Drugim rijeima, ovo pravilo upuuje na jednakovrijednost svih gameta, bez obzira na to koje one gene nose. Gamete koje imaju dominantne gene za neka svojstva koja pratimo, odnosno kromosomi koji na sebi imaju dominantne gene, nemaju nikakvu prednost ili jakost ili prodornost pred gametama koje imaju recesivne gene, ve su svejednako vrijedne. To u praksi znai da kod vanjske ili unutarnje oplodnje uvijek vrijedi Mendelovo pravilo slobodne kombinacije gameta (Primjer 21).

12

Primjer 21:
x

P.

Aa

Aa

F2

AA ; Aa ; Aa ; aa

Slobodnom kombinacijom gameta dobijemo sljedee genotipove F2 genera cije potomaka: AA (dominantan homozigot), Aa (heterozigot) i aa (recesivan homozigot). Omjer genotipova potomaka spomenutog krianja je 1 : 2 : 1.

Ako kriamo P. F1 x F1 uvijek dobijemo potomke F2 generacije. Prije smo ispisali to je to F1 generacija. Rekli smo da su to potomci dvaju roditelja koji su svi po fenotipu jednaki (uniformni), a po genotipu heterozigoti. Izvest emo primjer krianja roditelja koji e dati F2 generaciju kod monohibridnog, dihiridnog i trihibridnog krianja (Primjer 22-25). LEGENDA (za primjer 22-23): A = uta boja zrna graka a = zelena boja zrna graka B = okruglo zrno graka b = smeurano zrno graka

Primjer 22. Monohibridno krianje:


P. Aa Aa

F2

AA ; Aa ; Aa ; aa

Omjer genotipova: 1: 2 : 1 Omjer fenotipova: 3 : 1

13

Primjer 23. Dihibridno krianje: Kod krianja s vie od dvije razliite gamete jednog roditelja, slobodnu kombinaciju gameta izvodimo s pomou Punnet tove krialjke: P. AaBb x AaBb AB AABB AABb AaBB AaBb Ab AABb AAbb AaBb Aabb aB AaBB AaBb aaBB aaBb ab AaBb Aabb aaBb aabb

AB Ab aB ab

Omjer fenotipa: 9 : 3 : 3 : 1 9 = uti okrugli graak 3 = uti smeurani graak 3 = zeleni okrugli graak 1 = zeleni smeurani graak Primjer 24: Trihibridno krianje P. AaBbCc x AaBbCc
ABC ABC AABBCC ABc AABBcC AbC AAbBCC Abc AAbBcC aBC aABBCC aBc aABBcC abC aAbBCC abc aAbBcC ABc AABBCc AABBcc AAbBCc AAbBcc aABBCc aABBcc aAbBCc aAbBcc AbC AABbCC AABbcC AAbbCC AAbbcC aABbCC aABbcC aAbbCC aAbbcC Abc AABbCc AABbcc AAbbCc AAbbcc aABbCc aABbcc aAbbCc aAbbcc aBC AaBBCC AaBBcC AabBCC AabBcC aaBBCC aaBBcC aabBCC aabBcC aBc AaBBCc AaBBcc AabBCc AabBcc aaBBCc aaBBcc aabBCc aabBcc abC AaBbCC AaBbcC AabbCC AabbcC aaBbCC aaBbcC aabbCC aabbcC abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc

Omjer fenotipova je: 2 7 : 9 : 9 : 9 : 3 : 3 : 3 : 1 27 = okruglo, uto, visoka stabljika 9 = okruglo, uto, niska stabljika 9 = okruglo, zeleno, visoka stabljika 9 = smeurano, uto, visoka stabljika 3 = okruglo, zeleno, niska stabljika 3 = smeurano, uto, niska stabljika 3 = smeurano, zeleno, visoka stabljika 1 = smeurano, zeleno, niska stabljika.

14

PRAKTINI RAD 1. Za Mendelovo pravilo nezavisne segregacije kromosoma na vjebama (praktiki rad) radimo oponaanje nezavisne segregacije kromosoma s pomou jednostavnih modela. Studenti rade u parovima. Jedan dobije vreicu plastinih vrpci u dvije boje (npr. 24 vrpce crvene boje i 24 vrpce bijele boje). Drugi student istoga para dobije drugu vreicu plastinih vrpci s druge dvije boje, (npr. 24 vrpce ute boje i 24 vrpce zelene boje). To znai, da dva stud enta (jedan par) imaju skupa jednu dihibridnu zigotu genotipa heterozigot AaBb, s tim da jedan od njih ima Aa dok drugi ima Bb ili, jedan ima gene za svojstvo oblika, a drugi za svojstvo boje. Plastine vrpce nam predstavljaju kromosome, odnosno gene, pa ih moemo oznaiti tako da je gen A (npr. crvena boja vrpce) gen za okrugli (glatki) oblik zrna graka, a gen a (npr. bijela boja vrpce), gen za smeurani (naborani) oblik zrna graka. Gen B (npr. uta boja vrpce), gen za utu boju zrna graka, a gen b (npr. zelena boja vrpce), gen za zelenu boju zrna graka. Svaki student u paru, ne gledajui u vreice, ve nasumce izvlaei po jedan gen (odnosno jedan kromosom) svakoga alelnog para stavlja ih skupa u gametu. Na taj nain studenti rade nezavisnu segregaciju kromosoma. Tako dobijemo etiri razliite gamete od dihibridne zigote genotipa heterozigot.
Zigota AaBb

Gamete su u omjeru 1:1:1:1 prema vrsti gena, odnosno zbroju plastinih vrpci. Tom omjeru bi u naem zadatku odgovarale teoretske frekvencije (ft) (uestalosti) 12:12:12: 12. Naime, kad su oekivane pojave ili dogaaji izraeni u brojanim omjerima, te omjere ili brojeve zovemo frekvencijama ili uestalostima (ft). Pokusne ili empirijske frekvencije (fe) dobit emo izvlaenjem gena nasumce. To su frekvencije ili uestalosti pojava ili dogaaja, koje dobivamo mjerenjem pokusnih rezultata. One mogu biti jednake ili razliite od teorijskih frekvencija. Signifikatnost nam kae jesu li odstupanja izmeu teorijskih i empirijskih frekvencija velika (znaajna, signifikantna) ili su malena (sluajna). Pomou 2 (hi-kvadrat) testa treba izraunati i oitati jesu li odstupanja sluajna ili znaajna (signifikantna). 2 (hi-kvadrat test) pokazuje nam jesu li empirijska (pokusna) odstupanja od teorijskih samo mala (onda su sluajna) ili ako su

15

velika, onda su znaajna (signifikantna). Je li 2 znaajan (signifikantan) ili je malen (sluajan), oditava se iz Tablice vjerojatnosti za hi-kvadrat test (Tablica 2). Brojevi izneseni u Tablici 2. rasporeeni su prema "stupnjevima slobode" (DF). Broj stupnjeva slobode ovisi o tome koliko svaka istraivana varijabla (razliitost) ima mogunosti da zauzme mjesto u okviru odreenog zakona. Stupanj slobode izraunavamo na taj nain da od ukupnog broja mogunosti oduzmemo jedan npr., ako stol ima etiri noge i svaka noga se moe privrstiti na svako mjesto predvi eno za nogu na stolu, onda tri noge moe mo mijenjati kako elimo, a etvrtu moramo privrstiti na mjesto koje je ostalo prazno. U ovom primjeru imamo ukupan broj mogunosti etiri, a stupnjeva slobode tri (4-1 = 3). Ako su odstupanja malena, onda je velika vjerojatnost da su ona samo sluajna, a ako su odstupanja velika, onda nisu sluajna nego znaajna (signifikantna) i ne potvruju Mendelovo pravilo nezavisne segregacije kromosoma. Rezultate svog pokusa unesite u Tablicu za izraunavanje 2 testa (Tablica 3), te izraunajte 2 test prema formuli za 2 test (Formula 1). Treba izraunati vrijednosti za 2 i oditati iz Tablice 2. u stupcu "stupnjevi slobode" pod tri stupnja slobode (jer su bile etiri mogunosti (etiri gamete): AB, Ab, aB i ab. Stupnjevi slobode su broj mogunosti minus jedan. Primjer: ako stonoga ima 100 nogu onda postoji 99 stupnjeva slobode
Tablica 2. Tablica vjerojatnosti 2 testa. Stupanj slobode 1 2 3 4 P 0,99 0,00015 0,02 0,115 0,297 0,95 0,80 0,004 0,103 0,352 0,71 1 0,064 0,446 1,005 1,649 0,50 0,455 1,386 2,366 3,357 0,20 1,642 3,219 4,642 5,989 0,05 3,841 5,991 7,815 9,488 0,01 6,635 9,210 11,345 13,277

Tablica 3. Tablica za izraunavanje 2 testa.

Formula 1. Formula za izraunavanje 2 testa.

16

2. Za pravilo slobodne kombinacije gameta na vjebama izvodimo "oplodnju" oponaajui proces oplodnje u prirodi. Studenti rade u parovima. Jedan student ima "gamete" jednoga roditelja, a drugi ima "gamete" drugog roditelja. Gamete (npr. spermije) jednoga roditelja predstavljaju nam plastine vrpce dviju razliitih boja i to 24 vrpce jedne boje (npr. crne), to nam predstavlja gamete koje na svojim kromosomima imaju dominantan gen A i 24 vrpce druge boje (npr. bijele), to nam predstavlja gamete koje na svojim kromosomima imaju recesivan gen a. Drugi student istog para ima vrpce u iste dvije boje kao i prvi, a one predstavljaju (jaja) gamete drugog roditelja. Oni ne gledajui (nasumce) izvlae svaki po jednu gametu i spajaju ih u zigote (F2 generacije), tj. oponaaju oplodnju. Prema broju vrpci, uestalost teoretskih frekvencija je 12 : 24 : 12. Rezultate svog pokusa unesite u Tablicu izraunajte 2 test (Tablica 2.) prema formuli za izraunavanje 2 testa (Formula 1). Pronaite u priloenoj Tablici 2. vjerojatnosti vau vrijednost P za 2 test prema stupnjevima slobode dva, jer imamo tri mogunosti: AA, Aa, aa. 3. Rezultat krianja graka je: 315 o kruglih utili zrna, 108 okruglih zelenih zrna, 101 naborano uto zrno i 32 nabora na zelena zrna. Koji su genotipovi pret hodnih dviju generacija roditelja? S pomo u 2 testa objasni razlike od oekivanih frekvencija. 4. U zamoria su geni za crnu (B) i otru (R) dlaku dominantni nad genima za bijelu (b) i meku (r) dlaku. Par zamoria otre crne dlake dao je dva potomka: jed nog sa crnom mekom, a drugog s bijelom otrom dlakom. Ispisi sve genotipove. 5. U zamoria su geni za crnu (B) i otru (R) dlaku dominantni nad genima za bijelu (b) i meku (r) dlaku. Zamori crne otre dlake i zamori bijele otre dlake, dali su 28 potomaka sa crnom otrom dlakom, 11 sa crnom mekom, 31 s bijelom o trom i 10 s bijelom mekom dlakom. Ispisi sve genotipove i testiraj vjerojatnost s po mou 2 testa. 6. U jazavaraje niski rast dominantan nad visokim, a crna boja dlake nad crve nom. Par jazavara ima 9 mladih: 3 crna niska, 2 crvena visoka, 2 crvena niska i 2 crna visoka. Koji su fenotipovi i genoti povi roditelja?

17

11. KROMOSOMSKA OSNOVA MENDELOVIH PRAVILA


TEORETSKI DIO Thomas Hunt Morgan (1866-1945.) prouavao odnos gena i kromosoma, te je prvi povezao odreene gene s odreenim kromosomima. Njegovi su pokusi pokazali da kromosomi nose Mendelove nasljedne elemente. 1933. godine dobitnik Nobelove nagrade. Morganovo nazivlje za alele na engleskom i to tako da se gen naziva prema mutantnom tipu. Simbol alela za bijele oi (eng. white) w+ (mutirani tip). Normalan alel dominantan je nad mutiranim alelom. 1910. godine Morgan uvodi vinska muicu kao ekspermentalni genetiki organizam u laboratorij.

PRAKTINI RAD Homozigotnog recesivnog mujaka crne boje i zakrljalih krila (e+e+vg+vg+) kriamo s heterozigotnom enkom normalnog fenotipa (e-e+vg-vg+). Nakon dva tjedna prebrojima i proanaliziramo potomke. Pretpostavimo da smo nali 100 muica u potomstu. Koliko e muica biti pojedinog fenotipa?

Slika 59. Drosophila melanogaster

18

12. UTVRIVANJE GENA NA ODREENOM KROMOSOMU


TEORETSKI DIO Svi geni koji se nalaze najednom kromosomu zovu se vezani geni. Pritom oni koji su smjeteni neposredno jedan uz drugoga, imaju neusporedivo manju vjerojatnost da se razdvoje u sluaju crossing-over a od onih koji se nalaze na veoj udaljenosti na kromosomu (Slika 60).

Slika 60. Shematski prikaz vezanih gena na homolognom paru kromosoma.


U profazi mejoze I odvija se crossing-over. To je prekriavanje unutarnjih kromatida homolognog para kromosoma. Ta mjesta prekriavanja oznaavamo kao kijazme, a to su ujedno i mjesta sratavanja. Nakon razdvajanja kromosoma (dijakineza) dolazi do pucanja unutarnjih kroma tida i to ba na mjestima sratavanja (kijazme). Nakon pucanja unutarnjih kroma tida najee dijelovi kromatida recipro no (suprotno) sratavaju. To reciprono sratavanje dijelova unutarnjih kromatida je rezultat crossing-over procesa koji pred stavlja izmjenu genskog materijala unutar zigote pri nastajanju njezinih gameta, a oituje se brojem rekombinacija (Primjer 25.).

Primjer 25:
CROSSING-OVER I NASTANAK REKOMBINACIJA

19

Postotak rekombinacija izravno ovisi o udaljenosti dvaju gena. Vea udaljenost gena je i vei postotak rekombinacija, a i obrnuto. Jedininom udaljenou dvaju gena smatra se ona udaljenost koja ima 1% rekombinacija. Npr.: gen A i gen B imaju pet jedininih udaljenosti (jer ima 5%rekombinacija), a gen A i gen C ima deset jedininih udaljenosti (jer ima 10% re kombinacija). To znai, da e ti geni zamijeniti mjesta na kromatidama u 5%, odnosno 10% mejotikih dioba koje te stanice prolaze. Genska karta nam predstavlja sve kromosome i na njima mjesta svih alelnih parova gena jedne zigote (organizma). Imajui gensku kartu imamo poznata mjesta svih gena, a time i njihovu zaduenost u fenotipovima. Spolni kromosomi su razliite veliine (heterokromosomi) pa zato nemaju na sebi jednaki broj gena. Tako je spolni Y kromosom manji i relativno prazan (nema na sebi puno gena). Spolni X kromosom ima na sebi puno gena od kojih su mnogi ivotno vani. Od tuda je pojava da se neki geni nalaze na X kromosomu, a Y kromosom ih nema (odnosno nema alelnog para). Gene za odreena svojstva koji se nalaze na spolnim kromosomima nazivamo spolno vezanim svojstvima. Jedno od spolno vezanih svojstava je sljepoa za boje - daltonizam. Postoje mukarci koji npr. ne mogu razlikovati crvenu od zelene boje. U ena se sljepoa za boje izraava samo onda, ako se promijenjeni geni nalaze na oba X kromosoma. Ako se pak gen sljepoe za boje, nalazi samo na jednom X kromosomu, ene su normalnog vida, ali konduktori, tj. prijenosnici tog nepoeljnog gena na potomstvo. Ako se u mukarca koji je heterogametian (s obzirom na heterokromosome) nalazi gen za sljepou boja na X kromosomu, onda se kod njega pojavljuje spomenuta bolest. Genotipovi za daltonizam su: X XD - zdrava ena ( bez promijenjenog gena za boje) XDXd - ena konduktor- razlikuje boje (u genotipu ima gen Xd za nerazlikovanje boja) XdXd - ena koja ne razlikuje boje xDy - mukarac koji razlikuje boje XdY - mukarac koji ne razlikuje boje. Hemofilija je takoer spolno vezana nasljedna bolest (vezana na X kromosom) koja se oituje usporenim zgruavanjem krvi. Posljedica hemofilije je dugotrajno krvarenje nakon i najmanje ozljede. Od hemofilije, uglavnom boluju samo mukarci, a ene konduktori prenose je rece sivnim genom. Genotipovi za hemofiliju jesu: XHXH - zdrava ena (bez gena za hemo filiju) XHXh - ena konduktor (ima jedan gen za hemofiliju) XhXh - ena koja ima dva gena za hemo filiju (jedan alelni par) - hemofiliarka
D

20

XHY - zdrav mukarac


XhY - mukarac koji ima gen za hemo filiju hemofiliar

12.1. Partenogeneza Partenogeneza je razvitak zametka iz jaja bez oplodnje. Lijep su primjer pele. Kod pela postoje dvije vrste enki, radi lice i matice. Jedino su matice reproduk tivno sposobne, te se samo kod njih dogaa oogeneza (kod radilica ne). Mujaci kod pela su trutovi. Ako jaje matice ne bude spojeno sa spermijem truta izlei e se trut, a ako jaje bude spojeno sa spermijem (oploeno), izlei e se enka (Primjer 26.)..

Primjer 26:

Aa ; aa - enke A ; a - mjaci

Kod pela enke (matice i radilice) su diplonti i imaju u svojim tjelesnim stanica ma diploidan (2N) broj kromosoma, jer nastaju oplodnjom ili spajanjem spermija i jaja. Za razliku od enki, mujaci (trutovi) u svojim tjelesnim stanicama imaju polo vian broj kromosoma (N). Takvi se orga nizmi zovu haplonti, jer nastaju iz neo ploenih jaja matice. Ovo je primjer fakul tativne partenogeneze. Primjer ciklike ili sezonske partenogeneze nalazimo kod vodenbuhe. Ljeti se iz partenogenetikih odnosno neoploenih jaja razviju enke, a ujesen ili zimi kad se pojave mujaci koji oplode jaja, razviju se mujaci. 12.2. Odreivanje spola Kod genotipskog odreivanja spola, potomak je odreen kombinacijom spolnih kromosoma (heterokromosoma). Kod ve ine ivotinja spol se odreuje prema Dro sophyla tipu i to tako da, kod sisavaca postoje X i Y kromosomi: mujak je XY, a enka XX. Kod veine ostalih

21

kraljenjaka i nekih insekata suprotno je gore navedenom, a to je: mujak XX, a enka XY. Spol se nasljeuje u jednakom omjeru 1 : 1 ( P r i m j e r 2 7 ) .

Primjer 27:

Spol u sisavaca odreuje mujak (XY), koji ima dvije razliite gamete, X i Y, te za njega kaemo da je heterogametian. Za razliku od mujaka, enka ne odreuje spol, jer uvijek ima jednu vrstu gameta za spol, a to je X. Za enku kaemo da je homogametina. Sve ovo je vidljivo iz gore navedenog primjera. Drugi tip za genotipsko odreivanje spola je protenor tip, otkriven na stjenici. Kod prot enor tipa, genotipska oznaka za mujaka je XO, a za enku XX. Kod nekih vrsta ivotinja, spol moe biti deteminiran temeljem vanjskih imbenika te tada govorimo o fenotipskom odreivanju spola. Tako liinka Borelius viridis veliine 1-2 mm, ako se privrsti na rilo enke postaje mujak, a kad liinka potone na dno, tj. izvan enke, postaje enka. Mali mujaci ostaju doivotno na rilu enke i oplouju njezina jaja. Kod Ophryotrochea puerillis (kolutiavac) broj lanaka odreuje spol, do 20 je mujak a kad je broj lanaka vei od 20 postaje enka. PRAKTINI RAD Rijeite slijedee zadatke: 1. Trutovi se razvijaju iz neoploenih jaja pelinje matice. to moete zakljuiti ako se 50% trutova u praenoj osobini razlikuje od matice? 2. Izvedi krianje matice (dugih krila) i truta (kratkih krila) kod kojih e potomci (mujaci i enke) imati duga krila. 3. Matica dominantan homozigot dugih krila (A) i dugih dlaica (P), kria se s trutom dugih krila i kratkih dlaica. Ispii sve genotipove i fenotipove mujaka i enki tog potomstva.

22

4. Matica heterozigot dugih krila (A) i dugih dlaica (P) kria se s trutom dugih krila i kratkih dlaica. Ispii sve genotipove i fenotipove mujaka i enki tog potomstva. 5. U Drosophyla je crvena boja oiju dominantna nad bijelom, a gen za sintezu boje je vezan X kromosom. Kakve su boje oi sinova i keri nakon krianja enke bijelih i mujaka crvenih oiju? 6. U Drosophyla su crvena boja oiju i duga krila dominantni nad bijelim oima i zakrljalim krilima. Geni za ta svojstva vezani su na X kromosom. Kakvi su potomci krianja homozigotne enke bijelih oiju i dugakih krila s mujakom crvenih oiju i zakrljalih krila? 7. U Drosophyla su crvena boja oiju i smea boja tijela dominantni nad bijelim oima i utom bojom tijela. Geni za ta svojstva su na istom X kromosomu sa crossing-over vrijednou od 1,5%. U kojem omjeru se mogu oekivati gamete (etiri tipa) heterozigotne enke? 8. U Drosophyla su geni za crvenu boju oiju i duga krila dominantni, a recesivni za bijelu boju oiju i zakrljala krila. Geni za ta svojstva su na istom X kromosomu sa crossing-over vrijednou od 15%. Prikai potomstvo krianja hete rozigotne enke (crvene oi i duga krila) s mujakom (bijele oi i zakrljala krila). Kromosome prikai crtanjem. 9. Sljepoa za boje vezana je za X kromosom. Mukarac slijep za boje i ena koja ima normalan vid imaju sinove i keri normalnog vida. Gdje se meu unucima moe oekivati pojava sljepoe za boje? 10. Kolika je vjerojatnost da bude normalnog vida mukarac iji je djed po majcibio slijep za boje? Kakav vid imaju njegove sestre i kakav se vid moe oekivati kod njihova potomstva, ako imaju djecu s osobama normalnog vida? 11. Roditelji imaju muku djecu sposobnu za razlikovanje boja i ensku djecu konduktore. Ispii genotipove roditelja i izvedi krianje. 12. Potomci roditelja po genotipu su: 25% XDXd; 25% XDY; 25% XdXd; 25% XdY. Ispii genotipove roditelja i izvedi krianje. 13.Kriaj enu konduktor (hemofilija) sa zdravim mukarcem i ispii sve genotipove potomaka. 14.Kriaj enu genotipa XH XH s mukarcem hemofiliarom. 15.Izvedi krianje (hemofilija) kod kojeg e muki potomci biti u 50% zdravi (genotipa XHY). 16.Na X heterokromosomu domae make smjeten je gen koji odreuje boju dlake: uta boja dlake = XZXZ ; uto-crna boja dlake = XZXC; crna boja dlake = XCXC. Kriaj roditelje kod kojih e sve enke biti dvobojne (uto-crne), dok e mujaci biti jednobojni (uti). 17. Kriaj crnog maka (genotipa XCY) sa crno-utom makom (genotipa XZXC). Ispii sve genotipove i fenotipove potomaka.

23

18. U Plymouth kokoi, gen za arenu boju perja lokaliziran je u spolnom X kromosomu. Ovaj gen XA je dominantan nad genom Xa za crnu boju perja Longshaw kokoi. Kriaj roditelje da dobije potomke u postotku: 50% arenih i 50% crnih enki i 50% arenih i 50% crnih mujaka. 19.Kriaj genotipove roditelja domi nantni homozigot (bijeli mujak) s crnom enkom, ispii genotipove i fenotipove po tomaka.

24

13. MUTACIJE GENOMA, POLIGENIJA, POLIFENIJA

TEORETSKI DIO

13.1. Mutacije genoma

Genom su svi kromosomi sa svim genima jednog organizma. Genom se sastoji od autosoma i heterosoma. Autosome nazivamo jo i tjelesnim kromosomima. Heterokromosomi su spolni kromosomi ili kromosomi koji odreuju spol. U genomu ovjeka nalaze se 44 autosoma i 2 hetero kromosoma (XX i XY). Mutacije su bilo koje promjene u genskom materijalu i one se nasljeuju, a moemo ih promatrati na razini genoma, kromosoma i gena. Mutacije genoma izazivaju promjenu broja kromosoma (aneuploidiju) i moemo ih podijeliti na autosomske i hetero kromosomske. Svaka vrsta, ivotinjska ili biljna, ima odreeni broj kromosoma te govorimo o pravilu konstantnosti broja kromosoma svake vrste. I upravo taj konstantni broj kromosoma je euploidija kromosoma. Promijenjeni broj kromosoma, bilo autosoma bilo heterokromosoma, je aneuploidija. Ta aneuploidija moe biti izraena poveanjem ili smanjenjem broja autosoma ili heterokromosoma. Primjer autosomske aneuploidije je poliploidija kod endomitoze. Kod te vrste endomitoze dijele se centromere kromosoma, a ne dijeli se jezgra niti stanica, ve se u jezgri poveava broj kromosoma od diploidnog na tetraploidan, odnosno poliploidan. Heterokromosomske aneuploidije su promjene broja heterokromosoma, a nastaju nepravilnom redukcijskom diobom he terokromosoma, odnosno neodvajanjem heterokromosoma pri mejoz (Primjer 28-29) . Primjer 28: Redukcijska dioba heterokromosoma u mukih jedinki

a) pravilna
P. XY
x

XX

F.

XX; XY

25

b) nepravilna
P. XY
x

XX

F.

XXY; XO

Primjer 29: Redukcijska dioba heterokromosoma u enskih jedinki

a) pravilna

b) nepravilna

Dakle, aneuploidija heterokromosoma nastaje u nepravilnoj redukcijskoj diobi, a izraava se ako doe do oplodnje tih gameta. U ljudi, ovakve kombinacije heterok romosoma rezultiraju nenormalnim fenotipovima koji su nazvani: - Turnerov sindrom (enska osoba ima samo jedan X kromosom) - Klinefelterov sindrom (muka osoba ima vie X kromosoma).

Promjene promatrane na razini kromosoma nazivamo mutacijama kromosoma. One mogu biti: delecija ili deficijencija, translokacija, inverzija i duplikacija.

26

Delecija ili deficijencija jest mutacija kromosoma kad nestane dio kromosoma. Moe doi do prekida kromosoma na dva mjesta. Prekinuti segmenti se nakon toga spajaju, a segment iz meu mjesta prekida ispadne. Kromosom ili njegova kromatida koja je ostala u citoplazmi bit e razgraena i imat e za posljedicu deleciju kromosoma (Slika 61).

Slika 61. Shematski prikaz delecije kromosoma. Translokacija je mutacija kromosoma u sluaju koje dolazi do premjetaja jednog dijela kromosoma na drugo mjesto u genomu. Duplikacija se moe dogoditi u mejozi (kao i druge mutacije) u sluaju crossing-over. Dolazi do odvajanja jednog alela za neko svojstvo s jedne kromatide kromo soma. Taj se alel vee za drugu kromatidu istog kromosoma i na njoj se to svojstvo udvostruuje (Slika 62).

Slika 62. Shematski prikaz duplikacije kromosoma Inverzija se dogaa unutar jednog kromosoma gdje se jedan skup gena rotira za 180 stupnjeva. Npr. kromosom s genima rasporeda ABCD moe se promijeniti u raspored ABDC (Slika 63)

Slika 63. Shematski prikaz inverzije kromosoma.

27

Mutacije gena su promjene kemijske strukture DNA i bit e obraene u molekularnoj genetici. Mutacija moe biti razliitog smjera a i intenziteta. Tako gen moe mutirati i do letalnog gena. Letalna mutacija ivotno vanog gena izazvat e smrt zigote (orga nizma) ako bude zastupljen u genotipu kao recesivan homozigot (Primjer 30). Primjer 30: Krianje Dexter govedo x Dexter govedo:
P. AA
1 n

xAA

F. 1

AA ;A A;A A;A A : 2 : 1

Iz ovoga krianja vidljivo je da je postotak letaliteta 25% (AA1), 50% (AAn) Dexter goveda i 25% AnAn Kery goveda Rezultat su viestruke mutacije alelnog para gena na homolognom paru kromosoma zajedno svojstvo (Primjer 31). Primjer 31: Boja dlake kod kunia: A = divlji inila a = inila a1 = albino. Multipli aleli ine osnovu za veliko arenilo jednoga svojstva u populaciji, a odnos gena moe biti dominantan, recesivan i intermedijaran, jednakovrijedan. kolski primjer multiplih alelomorfa su i krvne grupe kod ovjeka. Krvne grupe su fenotipovi izraeni bjelanevinama (glikoproteini) koje nastaju utjecajem gena, a razlika u biokemijskoj strukturi je u jednom eeru. Nalaze se u svim tkivima. Nasljeuju se prema Mendelovim pravilima nasljeivanja. Prenose se s pomou jednog para alelomorfnih gena koji se nalaze najednom paru kromosoma.

Krvne grupe A,B,0 sustava u ljudi Eritrociti na svojoj povrini imaju spe cifine antigene tzv. aglutinogene oznaene kao A i B. Eritrociti mogu imati ili aglutinogen A ili B, istodobno aglutinogen A i B, ili biti bez ijednog od

28

njih. Serum pak, moe imati jedan ili dva aglutinina tj. antitijela anti -A i anti-B. Znaajno je da je aglutinin anti-A uvijek prisutan u serumu kad su eritrociti bez faktora A, a aglutinin anti-B je uvijek prisutan u serumu kad se faktor B ne nalazi u eritrocitima. Na temelju tih spoznaja ustanovljena su etiri osnovna tipa krvnih grupa: A, B, AB i 0. Pripadnici krvne grupe A nose na membranama svojih eritrocita aglutinogen A, pripadnici krvne grupe B aglutinogen B, pripadnici krvne grupe AB oba aglutinogena, dakle aglutinogen A i aglutinogen B, a pripadnici krvne grupe 0 nemaju na svojim eritrocitima te aglutinogene (Tablica 4).

Tablica 4. Oznake krvnih grupa ljudi

Kod transfuzije neodgovarajue krvne grupe doi e do hemolize eritrocita. Osnova hemolize je u prisutnosti specifinih supstancija koje se nalaze na eritrocitima (aglutinogeni) i u plazmi (aglutinini) koje se veu u imunoloku reakciju. Osim ABO sustava krvnih grupa postoje i mnogi drugi faktori kao to su MM; MN; NN; Rh+ Rh+; Rh+Rh ; Rh Rh . Dokazano je da je nasljeivanje svojstava grupa ABO sustava tako da dominantan karakter imaju geni IA i IB, a recesivan i. Djelovanjem gena IA ili IB molekula grupne supstancije stjee specifinu konfiguraciju A ili B. Gen i smatra se amorfnim, to znai da on ne sudjeluje u promjeni strukture supstrata na koji utjeu A i B. Ova tri alela stvaraju est razliitih genotipova: IAIA, IAi, IBIB, IBi, IAIB i ii koji se izraavaju u etiri razliita fenotipa: A, B, AB i 0 (Primjer 32). Primjeri 32:
a)
P. I^I^ x ii

29

F.

IRh Rh

13.2. Poligenija To je pojava u genetici kad je vie alelnih parova gena odgovorno za jedno svojstvo. Te gene zovemo polimernim genima. Oni nemaju odnos dominantan-recesivan. Njihov fenotipski izraaj moe biti vrlo razliit, a ovisi o interakciji njihova djelovanja.

13.2.1. Kvantitativna poligenija

Polimerni geni pri kvantitativnoj (aditivnoj) poligeniji djeluju tako da svaki od njih jednako pridonosi izraajnosti jedno ga svojstva (Primjer 33).

Primjer 33: AABB = crvena boja ljuske zrna penice aabb = bijela boja ljuske zrna penice Ovo fenotipsko obiljeje uzimamo iz pokusa koje su obavili Nilsson i Ehle kriajui penicu. Kod penice su pratili boju ljuske zrna penice (posija), pa su tamniju boju zrna nazvali crvenom, a svjetliju bijelom bojom.

30

Geni AABB nisu dominantni ve su to geni za crvenu boju, a geni aabb nisu recesivni ve su to geni za bijelu boju. Fenotip e uvijek biti takav koliki je u genotipu brojani (kvantitativni) odnos gena za crvenu, odnosno bijelu boju. Ako kriamo crvenu s bijelom penicom, onda emo u F] generaciji dobiti sve fenotipove ruiaste (roza) boje, odnosno tono na polovini izmeu crvene i bijele. Taj fenotip je ruiaste boje jer genotip ima dva gena (AB) za crvenu boju i dva gena (ab) za bijelu boju (AaBb) (Primjer 34, Slika 64)

Primjer 34: Ako kriamo Fi x Fi onda emo u F2 generaciji dobiti omjer fenotipova: 1/16 : 4/16 : 6/16 : 4/16 : 1/16

1/16 = AABB - crvena, jer genotip ima sve gene za crvenu boju
AB AB Ab aB ab |AABB| AABb AaBB AaBb Ab AABb AAbb AaBb Aabb aB AaBB AaBb aaBB aaBb ab AaBb Aabb aaBb aabb

4/16 = AABb - manje crvena boja od crvene, jer genotip ima tri gena za crvenu boju, a jedan gen za bijelu boju
AB Ab aB ab AABB |AABb| |AaBB| AaBb |AABb| AAbb AaBb Aabb |AaBB| AaBb aaBB aaBb AaBb Aabb aaBb aabb

AB Ab aB ab

6/16 = AaBb ili AAbb ili aaBB - rui asta, jer ima pola gena (2 gena) za crvenu boju i pola gena (2 gena) za bijelu boju, a mjesto gdje se nalaze geni za crvenu ili bijelu boju ne utjee na fenotip.

31

4/16 = Aabb - bijelija od ruiaste, jer ima jedan gen za crvenu boju, a tri gena za bijelu boju

1/16 = aabb - bijela, jer ima sva etiri gena za bijelu boju, a ni jedan gen za crvenu

Slika 64. Gaussova (simetrina) krivulja distribucije frekvencija

13.3 Kvalitativna poligenija Za razliku od kvantitativne poligenije kvalitativna (komplementarna) poligenija ima epistatike i hipostatike gene. Epistatike gene oznaujemo velikim slovom, a hipostatike gene oznaujemo malim slovom. Na primjer, ako je neko svojstvo uvjetovano s dva alelna para gena i da bi se to svojstvo izrazilo u fenotipu, potreban je u genotipu najmanje jedan epistatiki gen. Omjer fenotipova u F2, generaciji je 15 :1. Primjer ovoga omjera fenotipa je kod biljke Capsella bursa

32

pastoris (pastirska torbica, rusomaa), a odnosi se na oblik sjemenke koja moe biti trouglasta ili unjasta. unjasta je jedino onda kad u genotipu nema epistatikog gena (aabb) (Primjer 34):

Primjer 34:
15 : 1

Ako su za izraavanje neke fenotipske osobine u genotipu potrebna najmanje dva epistatika gena i to najmanje jedan u svakom alelnom paru gena, tada e omjer fenotipova biti 9 : 7. Primjer za ovaj omjer fenotipova je kod boje cvijeta biljke Latirus odorata (grahorica), devet cvjetova je crvenih, a sedam cvjetova je bijelih (Primjer 35).

Primjer 35: 9:7

Dakle, kod kvalitativne poligenije, osim broja epistatikih i hipostatikih gena i njihov razmjetaj e dati drugaiji fenotip. (Tablica 5).

33

Tablica 5. Primjer kvantitativne poligenije kod oblika krijeste kod peradi

fenotip

genotipovi

rua krijesta graak krijesta orah krijesta jednostavna krijesta

RRpp; Rrpp rrPP; rrPp RRPP; RrPp; RRPp; RrPP rrpp

13.4. Polifenija Polifenija je pojava u genetici kad je jedan alelni par gena zaduen za vie fenotipova (ili izraava vie fenotipova) (Primjer 35).

Primjer 35: A A - par gena za boju, duljinu i gusto u dlaica kod Drosophyla.

PRAKTINI RAD Rijeite slijedee zadatke: 1. Oba roditelja imaju krvnu grupu A, ali jedno od etvoro njihove djece ima krvnu grupu 0. Izvedi krianje. 2. Jedan roditelj ima krvnu grupu A, drugi B, a meu djecom su zastupljene sve etiri krvne grupe. Izvedi krianje. 3. Kod spornog oinstva jedan pretpo stavljeni otac pripada krvnoj grupi A, a drugi AB. Majka i dijete pripadaju grupi 0. Koji je od njih mogui otac? 4. Dijete zamijenjeno u rodilitu ima krvnu grupu B i Rh+. Moe li biti potomak majke 0 i Rh i oca krvne grupe B i Rh+? 5. Dexter govedo ima u genotipu letalni gen (A1). Kriajte ga s drugim Dexter, a zatim s Kerry govedom. Opii potomstvo. 6. Boja penice uvjetovana je s dva para gena: AABB (crvena) i aabb (bijela). Koja je distribucija genotipova i fenotipova krianja ruiaste (AaBb) penice s a) ruiastom i b) bijelom?

34

7. Genotipovi za oblik krijeste u peradi su: rua RRpp, orah RRPP, graak rrPP i jednostavan rrpp (istaknut je minimalni uvjet za fenotipski izraz). Pijetao orah krijeste krian s kokokom jednostavne krijeste dao je etiri potomka od kojih svaki ima drugi oblik krijeste. Izvedi krianje. 8. Genotipovi za oblik krijeste u peradi su: rua RRpp, graak rrPP, orah RRPP i jednostavna rrpp (istaknut je minimalni uvjet za fenotipski izraz). Pijetao rua krijeste s kokokom graak krijeste dao je est potomaka s orah i pet s rua klijesom. Izvedi krianje 9. Teini ploda bundeve (tikve) prido nose tri para gena. Ako genotip AABBCC daje plodove od 3,0 kg, a genotip aabbcc od 1,5 kg i ako svaki gen uvjetuje po 0,25 kg teine ploda, koji e biti genotipovi i fenotipovi F1 i F2 generacije krianja bundeve od 3,0 kg s onom od 1,5 kg? 10. U kukuruza je branjavost domi nantna nad slatkoom i uvjetovana je jed nim parom gena. Duljinu klipa od 26 cm uvjetuju dva para gena bez kojih je klip dug samo 10 cm. Ako imate 26 cm dugi branati i 10 cm dugi slatki kukukruz, a elite uzgojiti 26 cm dugi slatki kukuruz, u kojoj ga generaciji i s kojom vjerojatnou moete oekivati?

35

14. CITOPLAZMATSKO, NE-MENDELOVO NASLJEIVANJE

TEORETSKI DIO Mitohondriji i kloroplasti u eukariotskoj stanici sadravaju vlastiti kromosom odnosno krunu molekulu DNA koja ima odreene gene. Ti citoplazmatski geni ne pokazuju nasljeivanje po Mendelu. Kod biljaka i kod ivotinja zigota dobiva gotovo cjelokupnu citoplazmu iz jajeta. Takvo nasljeivanje uzrokuje odreen fenotip u potomcima, a to je tzv. materinski uinak, odnosno svi potomci slie majci u osobinama koje su kontrolirane citoplazmatskim genima. Citoplazmatsko nasljeivanje najee se moe identificirati na osnovi rezultata reciproni h krianja. Molekula DNA kloroplasta (cpDNA) sadri gene koji kodiraju 120 proteina od interesa cijele biljne stanice: ribosomske proteine, RNA polimerazu, enzime za potrebe fotosinteze. Odreen broj gena cpDNA ukljueno je u transkripciju i translaciju unutar biljne stanice: to su geni za rRNA, tRNA (Slika 65). Molekula DNA mitohondrija (mtDNA) ovjeka nosi 37 gena (13 za proteine, 22 za tRNA i 2 za rRNA koji grade ribosome, te 13 za enzime (od ukupnih 69 enzima) koji su ukljueni u proces oksidativne fosforilacije (Slika 66).

Slika 65. Kloroplast biljne stanice i cpDNA

Slika 66. Mitohondrij stanice eukariota i mtDNA

36

14.1. Mitohondrijska DNA

Mitohondrijska DNA (mtDNA) nalazi se u citoplazmi stanice. Mitohondriji imaju ulogu u proizvodnji energije za potrebe staninog metabolizma. Broj mitohondrija varira ovisno da li se radi o somatskim ili spolnim stanicama. Mitohondrijska DNA je kruna dvolanana molekula, koja ne podlijee rekombinaciji, prisutna je u mukaraca i ena, a nasljeuje se iskljuivo po enskoj liniji. Braa i sestre imaju istu mitohondrijsku DNA. Zbog prijenosa mitohondrijske DNA s majke na potomstvo, svaka osoba koja je naslijedila mitohondrijsku DNA imati e haploidni genotip. Mitohondriji somatskih stanica sadre od nekoliko stotina do nekoliko tisua istovjetnih kopija mitohondrijske DNA (Bogenhagen i Clayton, 1974.; Robin i Wong, 1988.) .Animalna mitohondrijska DNA duljine je 14 do 20 kpb te sadri vrlo malo nekodirajue DNA (Lynch, M. The Origins of Genome Architecture; Sinauer Associates Inc: 2007.). Majinsko nasljeivanje mtDNA znai da se cijeli genom nasljeuje jao jedan nerekombinirajui lokus, imaju isti haplotip, odnosno istu genealogiju. Navedeno omoguuje relativno jednostavnu analizu i razlikovanje varijacija koje se javljaju izmeu razliitih vrsta. Kruni oblik molekule mtDNA titi od razgradnje egzonukleazama, to uvelike poveava vjerojatnost dobivanja rezultata. Poliploidnost mtDNA genoma ima vaan znaaj u forenzici, jer postoji mogunost da postoje dvije ili vie razliitih slijedova mtDNA u istoj stanici ili organizmu to se naziva heteroplazma. Za razliku od jezgrene DNA, replikacija mtDNA odvija se neovisno od staninog ciklusa u somatskim stanicama (Chinnery, P.F.; Samuels, D.C. Relaxed replication of mtDNA: A model with implications for the expression of disease. Am. J. Hum.Genet., 1999, 64(4), 11581165.). Somatske mutacije nastale u mtDNA nakupljaju se tijekom ivotnog vijeka jedinke klonalnom ekspanzijom individualnih mtDNA genoma pri emu nastaju tokaste mutacije ili insercije/delecije (Birky, C.W. The inheritance of genes in mitochondria and chloroplasts: Laws, mechanisms, and models. Ann. Rev. Genet.,2001, 35, 125-148.; Wonnapinij, P.; Chinnery, P.F.; Samuels, D.C. The distribution of mitochondrial DNA heteroplasmy due to random genetic drift. Am.J. Hum. Genet., 2008, 83(5), 582-593.). Uslijed mutacija razliita tkiva iste jedinke imati e razliite haplotipove i njihova uestalost se mijenja tijekom godina. Uestalost heteroplazme je vrlo niska.

14.2. Analiza mitohondrijske DNA Analiza mitohondrijske DNA sloenija je u odnosu na prethodno opisane metode, jer se nakon umnaanja specifinih regija mitohondrijske DNA, odreuje slijed baza DNA sekvenciranjem. Jedna od prednosti analize mitohondrijske DNA iz kotanih ostataka je veliki broj istovjetnih

37

kopija u stanici to poveava mogunost izdvajanja DNA kod izrazito degradiranih uzoraka kao to je i ranije navedeno. Nesporni uzorci krvi bliih srodnika, a ukoliko nema ivuih, i uzorci krvi daljnjih srodnika po enskoj liniji mogu se koristiti za poredbu prilikom identifikacije kotanih ostataka metodom analize mitohondrijske DNA. Najzastupljenija metoda analize je sekvenciranje mtDNA.Sekvenciraju se hipervarijabilne regije I i II koje su dio nekodirajue kontrolne regije D petlje, citokrom b oksidaza (CYTB), citokrom C oksidaza (COX 1,2 i 3) i rRNA geni. Hipervarijabilne regije I i II su vrlo znaajne za identifikaciju zbog visokog stupnja varijacije izmeu jedinki. CYTB gen je takoer u irokoj uporabi, jer pokazuje visoki stupanj divergencije izmeu vrsta, te niski stupanj unutar vrsta. Analiza rezultata se zasniva na poredbi slijeda baza mitohondrijske DNA osobe iji se identitet eli utvrditi i pretpostavljenog srodnika po enskoj liniji. Ukoliko su analizirani sljedovi mitohondrijske DNA istovjetni, statistika vjerojatnost srodnosti izmeu osoba je visoka, u suprotnom se srodnost iskljuuje (Marjanovi i Primorac, 2009.c). Uvijek je potrebno imati u vidu da mtDNA nema snagu diskriminacije kao STR genotipizacija za potrebe identifikacije jedinke. Svi srodnici po majinoj liniji, kod mtDNA imaju isti haplotip. Individualna identifikacija na osnovu mtDNA je mogua jedino u rijetkim sluajevima u zatvorenim i potpuno karakterizirana populacijama, kada se haplotip se ne prenosi izmeu jedinki. Zadnjih godina sekvencira se cijela mtDNA, te je za veinu ivotinja poznat slijed nukleotida.

14. 3. Usporedba kontrolnih regija mitohondrijske dna Usporeujui DNA razliitih ivotinjskih vrsta i skupina ivotinja u njima moemo pronai razlike, te razlike i odreuju razliitost u fenotipu tih vrsta. to je razlika u DNA izmeu pojedinih skupina vea to je i njihova srodnost i filogenetska udaljenost vea. Stoga stupanj razliitosti u genomu moe posluiti kao evolucijski sat tj. pokazati nam kada su se pojedine skupine ivotinja izdvojile od drugih. Dananja biotehnologija omoguava sekvencionirati (tj. saznati redoslijed baza DNA) cjelokupni genom pojedinog organizma, ali takvi projekti su jo uvijek vrlo skupi i zahtijevaju puno vremena, novaca i rada, te je teko usporeivati cjelokupne genome organizama zbog prevelike koliine podataka (cijeli genom sisavaca se sastoji od oko 3.000.000.000 parova baza ekvivalent 3 Gb tj. oko 4 CD podataka). Zbog toga se koriste genetski biljezi tj., odreeni dijelovi DNA (kratke sekvence) koje se zatim obrauju, usporeuju. Koje genetske biljege koristimo ovisi o istraivanju koje provodimo i na koja pitanja traimo odgovore. Za istraivanja kod kojih traimo rjeavanje filogenetskih pitanja na razliitim taksonomskim razinama vrlo korisan biljeg je mitohondijske DNA. Mitohondijska DNA (mtDNA) ima mali genom (15000 - 20000 parova baza) jednostavne strukture i organizacije,

38

haploidna je, ne rekombinira, nasljeuje se od majke (uz neke iznimke), nema introna, ima razliitu stopu evolucije u pojedinim svojim dijelovima to omoguuje upotrebu ouvanih DNA klica. Mitohondrijski je genom do danas najbolje poznat dio ivotinjskog genoma. mtDNA je kruna, dvolanana DNA koja sadri 37 gena, od ega 22 tRNA gena, dva rRNA gena, 13 gena koji kodiraju za proteine ukljuene u transport elektrona i oksidativnu fosforilaciju, te nekodirajui dio veliine oko 1000 parova baza koji zovemo kontrolnom regijom (esto se koristi naziv D-petlja) i u kojem zapoinje replikacija i transkripcija mitohondrijskog genoma. U veine ivotinja ova regija pokazuje mnogo veu varijabilnost od ostatka mitohondrijskog genoma pa je stoga vrlo koristan genetski biljeg u istraivanjima nedavno razdvojeni h populacija ili vrsta. Poto kontrolna regija mtDNA ne kodira ni za jedan protein (fenotip) stoga ne podlijee prirodnoj selekciji te se mutacije nastale u njoj ne ispoljavaju ve se akumuliraju i predstavljaju vrlo toan evolucijski sat (Primjer 36).

Primjer 36: Kod stoara je uinjena teta, neka ivotinja je zaklala stoku. Treba saznati koja je ivotinja zaklala stoku jer se o tome odluuje tko e nadoknaditi tetu. Na ogradi koja okruuje stoku pronaen je uzorak dlake od nepoznate ivotinje. Sumnja se na psa, vuka, medvjeda, lisicu, aglja, risa. Iz korjena dlake se izolara DNA, te se upotrebom PCR metode (lanana reakcija polimerazom) umnoi kontrolna regija mtDNA, sekvencioniranjem te regije i dobije se raspored baza kontrolne regije te se usporedi s poznatim kontrolnim regijama sumnjivih vrsta koje smo uzeli genske baze podataka (http://www.ncbi.nlm.nih.gov/entrez/). Upotrebon raunalnih programa (ClustaW) usporedili smo kontrolne regije (poravnali) i iz toga napravili filogenetsko stablo iz kojeg je vidljivo da je nepoznata ivotinja pas.

39

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

10 20 30 40 50 60 70 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| CACCCCTACATTCATATATTGAATCACCCCTACTGTGCTATGTCAGTATCTCCAGGTAAACCCTTCTCCC .....................G......T..........................AG.-----....T.. .....................G......T..........................AG.-----....T.. .....................G.C....T.........................AAA..T..T.CT.T.. .....................G.C....T.........................AAA..T..T.CT.T.. ...................................................................... ...................................................................... 80 90 100 110 120 130 140 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| CTCCCCTATGTACGTCGTGCATTAATGGTTTGCCCCATGCATATAAGCATGTACATAATATTATATCCTT .....-......................C..................................C..T... .....-......................C..................................C..T... ............................C......................................T.. ............................C......................................T.. ..................................................................T... ......................................................................

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

150 160 170 180 190 200 210 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| ACATAGGACATATT-AACTCAATCTCATAATTCACTGATCTATCAACAGTAATCGAATGCATATCACTTA .............C-.......CTC..C...C.......-..C........................... .............C-.......CTC..C...C.......-..C........................... ...........G.CT.GTC....TC..C..CC.....G.-CC..........CTA............... ...........G.CT.GTC....TC..C..CC.....G.-CC..........CTA............... ..............-....................................................... ..............-..........................T............................ 220 230 240 250 260 270 280 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| GTCCAATAAGGGCTTAATCACCATGCCTCGAGAAACCATCAACCCTTGCTCGTAATGTCCCTCTTCTCGC ...................................................................... ...................................................................... .................................................CT........A.......... .................................................CT........A.......... ...................................................................... ...................................................................... 290 300 310 320 330 340 350 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| TCCGGGCCCATACTAACGTGGGGGTTACTATCATGAAACTATACCTGGCATCTGGTTCTTACTTCAGGGC ...................................G.......T..................C....... ...................................G.......T..................C....... ................T.............................................C....... ................T.............................................C....... ...................................................................... ......................................................................

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

40

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

360 370 380 390 400 410 420 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| CATAACTTTATTTACTCCAATCCTACTAATTCTCGCAAATGGGACATCTCGATGGACTAATGACTAATCA .........G............................................................ .........G............................................................ ...G...C......T............................................G.......... ...G...C......T............................................G.......... ...................................................................... ...................................................................... 430 440 450 460 470 480 490 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCCCATGATCACACATAACTGTGGTGTCATGCATCTGGTATCTTTTAATTTTTAGGGGGGGAATCTGCTA ..................................T............-...................... ..................................T............-...................... ..................................T............-...................... ..................................T............-...................... ...................................................................... ...................................................................... 500 510 520 530 540 550 560 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| TCACTCACCTACGACCGCAACGGCACTAACTCTAACTTATCTTCTGCTCTCAGGGAATATGCCCGTCGCG ...................................................................... ...................................................................... .......T...T...........................................G.............. .......T...T...........................................G.............. ...................................................................... ...................................................................... 570 580 590 600 610 620 630 ....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCCCTAACGCAGTCAAATAACTTGTAGCTGGACTTATTCATTATCATTTATCAACTCACGCATAAAATCA .......T.........................................................G.... .......T.........................................................G.... .......T.............................................................. .......T.............................................................. ...................................................................... .......T.......................................................T...... 640 650 660 670 ....|....|....|....|....|....|....|....|.. AGGTGCTATTCAGTCAATGGTTTCAGGACATATAGTTTTAGG .....................................C.... .....................................C.... ..................................A..C.... ..................................A..C.... .......................................... ..........................................

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

nepoznat Canis lupus Canis lupus Canis aureu Canis aureu Canis famil Canis famil

41

PRAKTINI RAD:

1. Pokus s feniltiourejom (phenil-thio-carbamid, PTC). 2. Svaki student dobiti e na listu papira A4 formata sekvencu kontrolne regije mitohondrijske DNA ivotinje nepoznate vrste, te nekoliko specifinih poetnica za vrsta na koje se sumnja da tkivo potjee. Student mora pronai specifino mjesto u mitohondrijskoj DNA ispitivanog uzorka i poetnicu koja e se vezati na to mjesto, te znati kako dugaak PCR produkt e se dobiti. Na temelju toga treba odrediti kojoj vrsti ivotinja pripada ispitivani (pronaeni) uzorak.

15. BIOMETRIKA

TEORETSKI DIO Pojam statistika dolazi od latinske rijei status - stanje. Postoji stotinjak definicija statistike kao discipline, ali sve ju definiraju kao obradbu brojanih podataka radi njihova jasnijeg prikazivanja i tumaenja. Statistiku moemo definirati i kao znanstvenu disciplinu koja obuhvaa skup metoda koje sc koriste u svrhu planiranja eksperimenata, prikupljanja podataka, za analizu tih podataka i njihovu interpretaciju, te na kraju za izvoenje zakljuaka ili pravila koja smo dobili na temelju mjerenih podataka. Dio statistike, odnosno statistike metode koje se primjenjuju u biologiji, naziva se BIOMETRIKA (gr - ivot, - mjera). Biometriku moemo definirati kao znanstvenu disciplinu koja se koristi statistikim metodama u istraivanju ivih bia. posebice s obzirom na odnose mjere i broja.

Poznavanje statistike potrebno je: radi praenja strune i znanstvene literature. pri obradbi rezultata prikupljenih podataka radi deskripcije (opisa) i analize podataka radi izvoenja zakljuaka iz konkretnih (pojedinanih) podataka na ope. od nosno iz pojedinanog zakljuiti na openito (1/ uzorka na populaciju). Da bi se statistiko istraivanje moglo obaviti potrebno je sljedee: 1. Postaviti problem 2. Odredili statistiku masu 3. Prikupiti podatke

42

4. Srediti prikupljene podatke 5. Izraunati potrebne statistike podatke koristei se odreenim statistikim metodama 6.. Pravovaljano interpretirati dobivene rezultate

Populacija i uzorak POPULACIJA u biologiji oznaava skup jedinki iste vrste ogranien u vremenu i prostoru. U statistici pod populacijom podrazumijevamo sve lanove neke skupine s odreenom karakteristikom koju mjerimo. Ukupne pojave i predmeti u prostoru i vremenu koji ulaze u statistiku obradbu ine STATISTIKU MASU. Dio statistike mase predstavlja OSNOVNI SKUP. Pod pojmom statistiki skup razumijevamo sve elemente koji imaju neke zajednike karakteristike. Unutar skupa, svaka pojava, svaki predmet ili jedinka sama za sebe ini ELEMENT SKUPA. UZORAK je ogranieni broj elemenata skupa koje mjerimo odnosno dio statistike mase koji se uzima u neposrednu statistiku obradbu. Pri definiranju uzoraka najvanije to treba uzeti u obzir su nain uzimanja uzoraka i veliina uzoraka. Nain uzimanja uzoraka Najei i najjednostavniji nain odabira elemenata u uzorku je sluajni ili nasumini uzorak. Sluajni uzorak je uzorak u kojem svaki individuum populacije ima jednaku vjerojatnost da bude izabran u uzorak, to znai da mora biti uzet nasumce. Ako neki lanovi populacije imaju veu ansu od drugih da budu izabrani, uzorak vie nije sluajan, nego se naziva pristranim uzorkom. Drugim rijeima, uzorak ne smije biti selekcioniran, nego mora biti reprezentativan, a jedan od naina koji daje veliku vjerojatnost reprezentativnog uzorka je upravo uzimanje sluajnog uzorka. Veliina uzorka Ako elimo dobiti to precizniji i toniji rezultat, uzorak treba biti to vei. Uzorak treba biti to vei to pojava koju istraujemo vie varira, tj. ako je varijabilnost pojave u nekoj populaciji vea. Isto lako uzorak mora biti vei ako je pojava koju ispitujemo rjea u toj statistikoj masi. U pravilu, to je broj podataka u uzorku vei to moemo biti sigurniji da su ti podatci toniji u odnosu na populaciju za koju elimo donijeti neki zakljuak iz konkretnog uzorka.

Parametri Parametri su brojane vrijednosti ili mjere koje opisuju neke karakteristike u populaciji (npr. visina ljudi).

43

Varijabilnost (v)(lat. varius - razliit) ili raznolikost elemenata skupa jest raznolikost mjerljivih osobina unutar skupa ili uzorka. Frekvencija (f) (lat. frequetlare - posjeivati; esto initi) ili uestalost jc broj pojavljivanja nekih karakteristika u skupu ili uzorku. Numerus (n) oznaava ukupan broj jedinki u skupu ili uzorku.

Distribucija frekvencija Prvi korak u sreivanju podataka je grupiranje podataka u razrede, odnosno izradba tzv. distribucije frekvencija. Grupiranje podataka u razrede daje nam sliku o rasprostiranju i uestalosti vrijednosti promatranog obiljeja (varijanti). Jedan nain grupiranja je da se sve jednake vrijednosti varijante stave ujedan razred, a to znai prebrojavanje koliko se puta pojedina vrijednost pojavljuje u empirijskim podatcima (podatcima dobivenim mjerenjem u uzorku). Ako imamo veliki broj obiljeja koristimo se drugim, kraim postupcima koji se sastoje u tome da u jedan razred stavljamo vise uzastopnih vrijednosti obiljeja. U tom sluaju razred ne predstavlja jedna vrijednost ve itav jedan interval dobivenih vrijednosti. Kod takvih razreda imamo granice razreda, gornju i donju, sredinu razreda i irinu razreda. Pri daljnjem raunanju koriste se podatci sredine razreda, jer su svi podatci unutar jednog razreda reprezentirani jednim rezultatom tj. sredinom razreda. Nakon unoenja dobivenih rezultata u razrede moe te pristupiti izraunavanju drugih statistikih podataka, a to su mjere centralne tendencije ili srednje vrijednosti, varijanca, standardna devijacija i standardne pogrjeke.

Mjere centralne tendencije Aritmetika sredina (MEAN = M) Jedna od najeih i najpoznatijih mjera prosjeka, odnosno mjera centralne tendencije, je aritmetika sredina. Aritmetika sredina je zbroj svih podataka podijeljen ukupnim brojem podataka (Formula 2).

44

Odnosno

M - aritmetika sredina - oznaka za zbroj n - broj rezultata ili ukupan broj elemenata u uzorku, suma frekvencija X - broj pojedinanih mjerenja. Formula 2. Osnovna formula za izraunavanje aritmetike sredine. Aritmetika sredina iz sreenih podataka rauna se tako da svaku varijablu (v) pomnoimo frekvencijom pojedinog razreda (f) te da sumu tih umnoaka podijelimo brojem rezultata odnosno brojem jedinki (Formula 3).

Formula 3. Aritmetika sredina iz sreenih podataka.

Druge mjere centralne tendencije Osim aritmetike sredine upotrebljavaju se i druge mjere centralne tendencije i to ponajprije onda kad zbog razliitih razloga nije preporuljivo izraunavati antmetiku sredinu, npr kad u raun moramo uzeti i neke vrlo ekstremne vrijednosti koje bitno mijenjaju antmetiku sredinu ili kada distribucija frekvencija veih i manjih od srednje vrijednosti nije simetrina. Najpoznatije druge mjere centralne tendencije su dominantna vrijednost ili modalna vrijednost i centralna vrijednost ili medijan. Dominantna vrijednost moiha (at) je ona vrijednost koja je u nizu mjerenja najee postignuta odnosno koja je najuestalija (koja dominira) Prednost dominantne vrijednosti pred aritmetikom sredinom je u tome sto na nju ne utjee ni broj ni vrijednost rezultata, ve samo frekvencija jednog rezultata Ako imamo rezultate grupirane u razrede, aprosksimativna vrijednost je srediona onog razreda koji ima najveu frekvenciju. Centralna vrijednost medijan je vrijednost koja se u nizu rezultata poredanih po veliini nalazi tono u sredini. Na ovu vrijednost ne utjeu vrijednosti pojedinih rezultata, pa stoga ekstremni rezultat

45

nee promijeniti ovu vrijednost. jedna od preaktilnih uporaba centranlne vrijednosti sastoji se u lociranju optimalnog poloaja.

Mjere varijabilnosti Ako su vrijednosti gusto grupirane oko srednje vrijednosti onda nam one dobro reprezentiraju rezultate. Ako
SU

vrijednosti znatno rasprene oko srednje vrijednosti, onda nam one slabo

reprezentiraju rezultate. Stoga je uvijek potrebno znati koliko i kako se rezultati grupiraju, tj. je li aritmetika sredina dobar ili los reprezentant dobivenih rezultata. Zato je potrebno izraunati i odrediti tzv. mjere varijabilnosti: raspon i standardnu devijaciju.

Raspon Raspon ili reakciona norma je razlika najveeg i najmanjeg rezultata Sto je raspon manji to je vrijednija izraunana aritmetika sredina tog uzorka. Nedostatak raspona je u tome to je on obino vei ukoliko je vei broj mjerenja. Osim toga. raspon je dosta varljiva mjera varijabilnosti, jer bilo koji ekstremni rezultat, makar bio pojedinaan znatno poveava raspon, a da se grupiranje rezultata oko aritmetike srednje vrijednosti ipak nije bitno promijenilo.

Standardna devijacija (STANDARD DEVIATION = SD) Standardna devijacija izraunava se prema Formuli 4. gdje i izraava interval odnosno razmak izmeu varijanti u uzorku, a d oznaava odstupanja (engl. distance) od najuestalije vrijednosti u uzorku, odnosno od modalne srednje vrijednosti.

Formula 4. Formula za standardnu devijaciju.

Formula za standardnu devijaciju izvedena je iz formule za variance (Formula 5). Varijanca je veliina koja govori o rasipanju dobivenih vrijednosti oko aritmetike sredine.

46

Formula 5. Formula za standardnu devijaciju izvedena je iz formule za variance. Standardna devijacija oznaava grupiranje ili rasprenost rezultata oko aritmetike sredine. Drugim rijeima znai da ako aritmetikoj sredini pribrojimo i oduzmemo vrijednost standardne devijacije dobiveni raspon obuhvatit e 68.2% rezultata Npr. ako aritmetika sredina iznosi 18, a standardna devijacija 2. zbrajanjem i oduzimanjem 2 od 18 dobit emo da se 68.2% dobivenih rezultala u uzorku krece od 16 do 20. Ako aritmetikoj sredini dodamo ili oduzmemo dvije standardne devijacije raspon e obuhsatiti 95.5% rezultata, a ako joj dodamo ili oduzmemo tn standardne devijacije obuhvaeno e biti 99.7% svih rezultata uzorka. M +/-1 x SD = 68.2% M +/-2 x SD = 95.5% M +/-3 x SD = 99.7%. Standardna devijacija ima istu dimenziju kao i samo obiljeje to znai ako smo mjerili u milimetrima standardna devijacija bit e izraena u milimetrima. Standardna devijacija smije se raunati samo uz aritmetiku sredinu, a ne i uz druge mjere centralne tendencije. Kad su nam poznate vrijednosti aritmetike sredine i standardne devijacije tada su ti rezultati potpuno definirani i mogu se usporeivati s nekim drugim rezultatima. Standardne pogrjeke (STANDARD ERROR = SE) Standardna pogrjeka srednje vrijednost (STANDARD ERROR OF MEAN = SEM) Aritmetika sredina konkretnog uzorka u stvari nije prava aritmetika sredina populacije (statistike mane) ve samo njezina procjena. Procjena e bili tonija ukoliko je uzorak vei i to je pojava koju mjerimo manje vanjabilna. Prema tome, to pojava vie varira izlaemo se veoj pogrjeci kad iz aritmetike sredine uzorka zakljuujemo za populaciju. Isto to vrijedi ako zakljuujemo iz malog uzorka. Stoga je potrebno iz dobivene ariimetike sredine uzorka izraunali standardnu pogrjeku srednje vrijednosti ili aritmetike sredine koju se izraunava kao kvocijent standardne devijacije (SD) i korijena ukupnog broja elemenata uzorka (n) (Formula 6).

Formula 6. Formula standardna pogrjeka srednje vrijednosti.

47

Standardna pogrjeka srednje vrijednosti je odstupanje od prave aritmetike sredine, odnosno aritmetike sredine populacije. Populacija s manjom standardnom devijacijom ujednaenija je od populacije ija je standardna devijacija vea. a sto je posebno poeljno npr u uzgojima ivotinja. Za razliku od standardne devijacije (SD) koja prikazuje rasprenost oko aritmetike sredine uzorka, standardna pogrjeka srednje vnjcdnotli (SbM) prikazuje odstupanja i vanranja aritmetikih sredina uzoraka oko prave antmetike sredine populacije stoga za standardnu pogrjeku vrijede isti zakoni kao i za standardnu devijaciju, tj. prikazuje se kao raspon vrijednosti dobiven dodavanjem i oduzimanjem SEM od M. Standardna pogreka standardne devijacije (STANDARD ERROR OF STANDARD DEVIA TION = SESD) Standardna pogreka standardne devijacije je kvocijent standardne devijacije uzorka i korijena dvostrukog broja elemenata uzorka (Formula 7.).

Formula 7. Formula standardne pogreke standardne devijacije. Standardna pogrjeka standardne devijacije govori o odstupanju standardne devijacije uzorka u odnosu na "pravu" standardnu devijaciju koja se odnosi na populaciju te se izraava kao SD SESD. Grafiko prikazivanje rezultata Distribucija frekvencije moe se prikazali i grafiki u koordinatnom sustavu tako da na os x ili apscisu (horizontalna koordinata) nanosimo varijante, odnosno vrijednosti mjerenja, a na os y ili ordinatu (vertikalna koordinata) nanosimo dobivene frekvencije (f). Spajanjem svih toaka dobit e se linija koja se zove poligon frekvencija. Poligon frekvencija esto oznauje zapravo vise ili manje pravilnu krivulju (GAUSSOVA KRIVULJA). PRAKTINI RAD:

1. Mjerenje duljine graha Populaciju graha u naem zadatku predstavlja ukupan broj zrna graha jedne sorte koji je dozrio odreene godine na odreenom podruju. Uzorak predstavlja grah u alici, otprilike oko stotinjak

48

zrna. koji je svaki student pojedinano nasumce uzeo i treba ga izmjeriti i statistiki obraditi. Element skupa predstavlja zasebno svako zrno graha iju duljinu treba izmjeriti. Varijabilnost (v) je u naem zadatku razliitost duljina zrna graha. Iz dobivenog uzorka treba svakom zrnu graha izmjeriti njegovu duljinu (jedinica mjerenja je milimetar) na milimetarskom papiru i upisati u biljenicu. Prije mjerenja potrebno je u biljenicu upisati veliine od oko 8 mm do 20 mm jednu ispod druge. To su zapravo veliine duljine graha koje se mogu oekivati u naem uzorku, a ujedno predstavljaju RASPON varijabilnosti. Svaki put kad se uzme zrno graha iz uzorka i izmjeri, pokraj veliine koja oznauje vrijednost izmjerenog zrna graha, stavi se jedna okomila crtica, a crta ide vodoravno preko etiri okomite. Postupak se ponavlja dok se sva zrna graha u uzorku ne izmjere (Primjer 37).

Primjer 37:

Prebrojene izmjerene vrijednosti predstavljaju uestalost ili frekvenciju (f) u uzorku, a zbroj ukupan broj zrna graha u uzorku (n). Nacrtajte tablicu u kojoj e te oznaiti varijante (v), frekvencije (f), distancije (d) te umnoak vf i fd2. Dobivene vrijednosti upisuju se u tablicu kako je prikazano u tablici 1.1. Odredite modalnu srednju vrijednost i izraunajte aritmetiku srednju vrijednost. Izraunajte u kojim se granicama kree 68,2% vaih rezultata. Odredite granice pouzdanosti odstupanja aritmetike sredine uzoraka (SEM) od "prave" i naite granice pouzdanosti, te odredite odstupanja standardne devijacije uzorka od onekoja se odnosi na populaciju (SESD).

49

U navedenom primjeru:

Slijedi raunanje standardne devijacije aritmetike sredine (SD) po kojoj se dobivaju odstupanja od aritmetike sredine u naem uzorku, a to je

i je u naem sluaju 1 pa se rauna prema formuli

to znai da se 68,2% dobivenih vrijednosti u naem primjeru kree u okviru 14,43 2,798 mm od srednje vrijednosti, a to je od 11,450 do 17,228 mm duljine graha. Da bi se odredilo odstupanje aritmetike sredine uzorka oko aritmetike sredine populacije treba izraunati standardnu pogrjeku srednje vrijednosti:

Tablica 1.1.
V 8 9 10 11 12 13 14 15 16 17 18 19 20

Rezultati graha
f 2 4 4 5 8 11 17 14 13 9 7 4 3 n = 101

mjerenja
vf 16 36 40 55 96 143 238 210 208 153 126 76 60 S(vf)= 1457

uzorka d
-6 -5 -4 -3 -2 -1 0 1 2 3 4 5 6 d2 36 25 16 9 4 1 0 1 4 9 16 25 36 fd2 72 100 64 45 32 11 0 14 52 81 112 100 108 Z(fd2) = 791

50

to znai da je M

SEM = 14,43

+ 0,278 mm odnosno daje aritmetika sredina populacije za

0,278 mm manja ili vea od aritmetike sredine uzorka, odnosno kree se izmeu 14,152 i 14,708 mm. Na kraju, treba izraunati odstupanje standardne devijacije populacije od standardne devijacije uzorka:

to znai da su odstupanja u populaciji za 0,196 mm manje i vie od dobivene standardne devijacije uzorka. Dobivene rezultate upiite na milime tarski papir i prikaite grafiki kao poligon frekvencija. S gornje desne strane milimetarskog papira, dobiveni rezultati trebaju biti brojano upisani prema navedenom primjeru. Sve dobivene vrijednosti treba zaokruiti na jednu decimalu. List milimetarskog papira s nacrtanim grafikonom i napisanim svim podatcima (kao na primjeru) treba zalijepiti u biljenicu (Slika 67).

Slika 67. Grafiki prikaz rezultata

51

Replikacija Transkripci ja DNA DNA Lliteratura

Alters, S 81996): Biology, Understanding Life. Mosby. A Tomes Mirror Company. Bernstein, R., S. Bernstein (1996): Biology. WCB. Wm. C. Brown Publishers. Chang, R. (1998): Chemistry. Sixth edition. WCB McGraw- Hill Carley, F. A. (2000): Organic Chemistry. Fourth edition. WCB McGraw- Hill. Cox, T. M., J. Sinclair (2000). Molekularna biologija. Urednici hrvatskog izdanja: Jonji, S., P. Luin, V. Crnelk-Kunstelj, L. Traven. Medicinska naklada, Zagreb. Deli, V. (1997): Genetiko ininjerstvo u biotehnologiji. Manualis univesitatis studiorum Zagrebiensis, MCMXCVII. Elliott, W. H., D. C. Elliott (2001): Biochemistry and Molecular Biology. Second edition.Oxford University Press. Guttman, B. S (1999): Biology. WCB McGraw- Hill Jones, M. (1997): Organic Chemistry. WW Northon and Company, New York, London. Keeton, T. W., J. L. Gould (1986): Bilogical Science. Fourth edition. WW Northon and Company, New York, London. Kormelink, E., R. Smith (1994): Concepts in Biology. Seventh edition. WCB. Wm. C. Brown Publishers. Mader, S. S. (1996): Biology. Fifth edition. WCB McGraw- Hill Mannino, J. A. (1995): Human Biology. Mosby. A Tomes Mirror Company Miller, S. A., Harley, J. P. (1996): Zoology. Third edition. WCB McGraw- Hill Petroveko, V. (2000): Patogeneza infekcije virusom ljudske imunodeficijencije (HIV). Praxis veterinaria, 48 (3), 109-121. Postlethwait, J. H. , J. L. Hopson (1989): The Nature of Life. McGraw-Hill Publishing Company. Silberberg, M. S. (2000): Chemistry. The Molecular Nature of Matter and Change. WCB McGraw- Hill Tamarin, R. H. (1999): Priciples of Genetics. Sixth Edition. WCB McGraw-Hill.

52