Investeşte în oameni!

FONDUL SOCIAL EUROPEAN Programul Operaţional Sectorial Dezvoltarea Resurselor Umane 2007 – 2013 Axa prioritară 1 „Educaţie şi formare profesională în sprijinul creşterii economice şi dezvoltării societăţii bazate pe cunoaştere” Domeniul major de intervenţie 1.5. „Programe doctorale şi post-doctorale în sprijinul cercetării” Titlul proiectului: „Burse doctorale pentru dezvoltare durabila” BD-DD Numărul de identificare al contractului: POSDRU/107/1.5/S/76945 Beneficiar: Universitatea Transilvania din Braşov

Universitatea Transilvania din Brasov
Scoala Doctorala Interdisciplinara Departament: Silvicultură

Ing. Iacob I. CRĂCIUNESC

Evaluarea nivelului de hibridare naturală la specii autohtone de cvercinee: analiză de caz în rezervația naturală Bejan-Deva Evaluation of natural hybridization in native species of oaks: a case study in Bejan-Deva Natural Reserve

Conducător ştiinţific Prof.dr.ing. Neculae ȘOFLETEA
BRASOV, 2013

MINISTERUL EDUCAŢIEI NAŢIONALE

UNIVERSITATEA “TRANSILVANIA” DIN BRAŞOV
BRAŞOV, B-DUL EROILOR NR. 29, 500036, TEL. 0040-268-413000, FAX 0040-268-410525 RECTORAT

D-lui (D-nei) .............................................................................................................. COMPONENŢA Comisiei de doctorat
Numită prin ordinul Rectorului Universităţii „Transilvania” din Braşov Nr. 5998 din 10.09.2013 PREŞEDINTE: Prof.univ.dr.ing. Gheorghe SPÂRCHEZ PRODECAN al Facultății de Silvicultură și Exploatări Forestiere Universitatea Transilvania din Brașov CONDUCĂTOR ŞTIINŢIFIC: Prof.univ.dr.ing. Neculae ȘOFLETEA Universitatea Transilvania din Brasov REFERENŢI: Conf.univ.dr. Liviu FĂRTĂIȘ Universitatea Ștefan cel Mare Suceava C.S.gr.II.dr.ing. Flaviu POPESCU I.C.A.S. București, Stațiunea Simeria Conf.univ.dr.ing. Alexandru-Lucian CURTU Universitatea Transilvania din Brasov

Data, ora şi locul susţinerii publice a tezei de doctorat: 11.10.2013, ora 1100, sala SI2, Facultatea de Silvicultură și Exploatări Forestiere. Eventualele aprecieri sau observaţii asupra conţinutului lucrării vă rugăm să le transmiteţi în timp util, pe adresa Facultatea de Silvicultură și Exploatări Forestiere, Brașov, Șirul Beethoven, nr. 1, 500123, la numărul de fax: 0268.475705 sau la adresa de e-mail iacob.craciunesc@unitbv.ro.

Totodată vă invităm să luaţi parte la şedinţa publică de susţinere a tezei de doctorat. Vă mulţumim.

CUPRINS
Pg. teza Pg. rezumat

INTRODUCERE 1. STADIUL ACTUAL AL CUNOȘTINȚELOR PRIVIND RELEVAREA ȘI EVALUAREA FENOMENULUI DE HIBRIDARE NATURALĂ LA CVERCINEE 1.1. Taxonomia și filogenia genului Quercus 1.2. Conspectul de specii din genul Quercus în flora României şi semnalarea hibridării naturale 1.3. Aspecte ale fenologiei cvercineelor 1.4. Hibridarea naturală în cadrul genului Quercus 1.4.1. Amploarea fenomenului şi relevarea acestuia în literatura de specialitate 1.4.2. Relevarea hibridării la cvercinee prin analize de markeri genetici 1.4.2.1. Studii de izoenzime 1.4.2.2. Studii cu markeri PCR-RFLP, RAPD, AFLP 1.4.2.3. Analize de microsateliţi 1.4.2.4. Cartografierea genomului 2. SCOPUL ȘI OBIECTIVELE CERCETĂRILOR 2.1. Scopul cercetărilor 2.2. Obiectivele cercetărilor 3. MATERIAL ȘI METODE DE CERCETARE 3.1. Material și metode de cercetare pentru observațiile fenologice 3.2. Material și metodă de cercetare pentru evaluarea hibridării naturale la arborii maturi 3.2.1. Zona studiată și materialul de analiză 3.2.2. Efectuarea analizelor de laborator 3.2.3. Analiza setului de date genetice 3.2.3.1. Evaluarea erorilor de citire și a alelelor nule din setul de date 3.2.3.2. Parametrii genetici 3.2.3.3. Stabilirea celei mai bune metode de grupare pe specii 3.2.3.4. Stabilirea numărului de clustere genetice 3.2.3.5. Diferențierea interspecifică 3.3. Material și metodă de cercetare pentru evaluarea fluxului genic actual 3.3.1. Recoltarea ghindelor 3.3.2. Genotiparea ghindelor 3.3.3. Analizele de paternitate 4. REZULTATE ȘI DISCUȚII 4.1. Structura fenologică în complexul de cvercinee Bejan-Deva 4.1.1. Datele climatice pentru cei trei ani de observații fenologice 4.1.1.1. Date climatice în anul 2011 4.1.1.2. Date climatice în anul 2012 4.1.1.3. Date climatice în anul 2013 4.1.2. Fenofaza de deschidere a mugurilor foliari 4.1.2.1. Deschiderea mugurilor foliari în anul 2011 4.1.2.2. Deschiderea mugurilor foliari în anul 2012 4.1.2.3. Deschiderea mugurilor foliari în anul 2013 1

7

7

9 9 14 15 17 17 19 19 20 22 29 30 30 30 31 31 34 34 35 40 41 42 43 44 45 47 47 48 49 51 51 51 51 52 53 54 54 56 59

8 8 9 9 10 10 11 11 11 13 16 16 16 17 17 17 19 19 19 22 23 24 24 25 25 25 25 26 26 27 27 27 27 27 27 28 28 29 29

4.1.2.4. Concluzii privind fenofaza deschiderea mugurilor 4.1.3. Fenofaza de înflorire 4.1.3.1. Înflorirea în anul 2011 4.1.3.2. Înflorirea în anul 2012 4.1.3.3. Concluzii privind fenofaza înfloririi 4.1.3.4. Androsterilitatea fenotipică în pădurea Bejan 4.1.3.5. Intensitatea înfloririi în doi ani de observații 4.1.4. Evaluarea corelațiilor fenologice 4.1.4.1. Analiza categoriilor fenologice individuale de deschidere a mugurilor foliari în ani consecutivi de observații 4.1.4.2. Analiza stadiilor fenologice individuale de înflorire în ani consecutivi de observații 4.1.4.3. Analiza comparativă dintre fenofazele de deschidere a frunzelor și înflorire în ani consecutivi 4.2. Structura genetică evaluată prin analize de markeri moleculari 4.2.1. Echilibrul Hardy-Weinberg și dezechilibrul linkage 4.2.2. Structura alelică a celor patru specii de stejari în complexul BejanDeva 4.2.2.1. Markerul ZAG112 4.2.2.2. Markerul ZAG39 4.2.2.3. Markerul ZAG96 4.2.2.4. Markerul ZAG110 4.2.2.5. Markerul ZAG11 4.2.2.6. Markerulul ZAG87 4.2.2.7. Markerul ZAG7 4.2.2.8. Markerul ZAG20 4.2.2.9. Markerul ZAG9 4.2.2.10. Markerul GOT021 4.2.2.11. Markerul PIE040 4.2.2.12. Markerul PIE215 4.2.2.13. Markerul PIE223 4.2.2.14. Markerul PIE239 4.2.2.15. Markerul PIE227 4.2.2.16. Markerul DHN3 4.2.3. Estimarea parametrilor genetici 4.2.3.1. Numărul mediu de alele (Na) 4.2.3.2. Numărul efectiv de alele (Ne) 4.2.3.3. Bogăția alelică (AR) 4.2.3.4. Heterozigoția observată (Ho) 4.2.3.5. Heterozigoția așteptată (He) 4.2.3.6. Indicele de fixare (F) 4.2.3.7. Recomandări pentru diferențierea interspecifică și analizele de alocare genetică a indivizilor la specii 4.2.4. Diferențierea interspecifică 4.2.4.1. Indicele de diferențiere Dest 4.2.4.2. Indicele de fixare Fst 4.2.4.3. Valori globale ale indicelor de fixare și diferențiere 4.2.5. Testarea analizei genetice a grupării exemplarelor studiate pe specii 4.2.6. Analiza alocării arborilor din Pădurea Bejan la specii și hibrizi 4.2.6.1. Analiza alocării genetice a arborilor încadrați morfologic la Quercus frainetto 4.2.6.2. Analiza alocării genetice a arborilor încadrați morfologic la Quercus petraea

61 62 62 64 66 67 68 69 69 70 70 72 72 73 73 74 75 76 77 78 79 80 81 82 83 84 85 85 86 87 88 88 89 90 92 93 94 95 96 96 97 100 101 104 106 108

30 31 31 32 33 33 33 34 34 34 35 36 36 36 36 37 37 37 38 38 39 39 40 40 41 41 42 42 43 43 44 44 44 45 46 46 47 47 47 48 48 49 49 50 51 52

2

3.2.2. Estimarea fluxului genic actual prin analize de paternitate 4. Concluzii rezultate din efectuarea observațiilor fenologice 5. DISEMINAREA REZULTATELOR.2. Dispersia polenului 4.3. Analiza alocării genetice a arborilor încadrați morfologic la Quercus pubescens 4. Diseminarea rezultatelor 5.3.1. Concluzii finale 5.1. Compararea analizei de grupare a indivizilor la specii în două studii diferite 4.5.4. DIRECȚII VIITOARE DE CERCETARE 5.2. Analiza alocării genetice a arborilor încadrați morfologic la Quercus robur 4.1.2.3.6.4. CONCLUZII FINALE.6. Sinteză comparativă a analizelor de paternitate și a datelor fenologice 5.4. Direcții viitoare de cercetare BIBLIOGRAFIE REZUMAT CURRICULUM VITAE 110 111 113 117 118 118 123 125 130 134 134 134 135 136 137 138 139 140 174 175 53 54 55 57 57 57 59 60 63 64 64 64 65 66 67 67 68 69 80 81 3 . CONTRIBUȚII ORIGINALE.3.3.2.3.3.6. Identificarea arborilor donatori de polen 4.2.6.1. Concluzii rezultate din analizele de paternitate 5. Concluzii rezultate din evaluarea hibridării arborilor maturi 5.4. Analiza încrucișărilor din suprafața de cercetare 4. Contribuții originale 5.1.1.3.6. Concluzii privind analiza alocării genetice a arborilor din Pădurea Bejan 4.

2. CURRENT STATE OF KNOWLEDGE REGARDING THE DISCLOSURE AND ASSESSMENT OF THE NATURAL HYBRIDIZATION PHENOMENON IN OAKS 1.1.TABLE OF CONTENTS Pg. thesis Pg.1. Climatic data in 2013 4.1.3.2. The objectives of the researches 3.3. The species compendium of the genus Quercus in the Romanian flora and the highlight of the natural hybridization 1.3.2. Material and methods for phenological observations 3. The phenophase of the foliar bud burst 4.2.3.1. The taxonomy and phylogeny of genus Quercus 1.3. Foliar bud burst in 2013 4.1.1. RAPD. The study area and material 3.4.2.2.4. MATERIAL AND METHODS 3. Studies with PCR-RFLP. THE AIM AND OBJECTIVES OF THE RESEARCHES 2.4.1.3.2. The spread of the phenomenon and its disclosure in the speciality literature 1.1. Aspects of oaks phenology 1.1.2.1.4. Genome mapping 2.2.4.2. Establishment of genetic clusters 3.2.2.1. Natural hybridization within genus Quercus 1. Establishment of the best method of grouping by species 3.4.2. Acorns genotyping 3. RESULTS AND DISCUSSIONS 4. Interspecific differentiation 3. Accomplishment of laboratory analysis 3.1. Conclusions regarding the bud burst phenophase 4.1.4.2. Climatic data in 2012 4. Highlight of hybridization in oaks with genetic markers analysis 1. Acorns harvest 3.2.3. Climatic data in 2011 4.4.2.1.2.3.3. Paternity analysis 4.1. Foliar bud burst in 2012 4. Phenological structure in Bejan-Deva oaks complex 4.3.1.2.2. Flowering phenophase 7 7 9 9 14 15 17 17 19 19 20 22 29 30 30 30 30 31 34 34 35 40 41 42 43 44 45 47 47 48 49 51 51 51 51 52 53 54 54 56 59 61 62 8 8 9 9 10 10 11 11 11 13 16 16 16 17 17 17 19 19 19 22 23 24 24 25 25 25 25 26 26 27 27 27 27 27 27 28 28 29 29 30 31 4 .1. Isozymes studies 1.5. Climatic data for the three years of phonological observations 4. Material and method for the assessment of the present gene flow 3.2. Foliar bud burst in 2011 4.2.1.2.4.3. Material and method for the natural hybridization assessment in adult trees 3.2.4.1.3.2.1.1.2.1. Assessment of reading errors and null alleles from the data set 3. Microsatellites analysis 1.3.3. Genetic parameters 3.2.1.1. abstract INTRODUCTION 1. AFLP markers 1.2. The aim of the researches 2.3.1.3.3. The analyse of the genetic data set 3.

2.1.2.2. ZAG110 marker 4. Fst fixation index 4.2.1. Fixation index (F) 4.2.4.2.3.3. GOT021 marker 4.5.4. Flowering in 2012 4.2.2. Recommendations for the interspecific differentiation and the analysis of genetic assignment of the individuals to the species 4.2. PIE239 marker 4. The analyse of the trees assignment from Bejan Forest to species and hybrids 4.6.2.3.12.2.3.4.4.2.2. The analyse of the individual phenological categories of foliar bud burst in consecutive years of observations 4.2.2.2.3. Assessment of phenological correlations 4. Dest differentiation index 4. PIE223 marker 4.2.1.1.2.2.2. The effective number of alleles (Ne) 4.1.1.16. ZAG96 marker 4.4. ZAG9 marker 4.5.11.3.2.4.2.2.2.4.2.2.3. Global values of the fixation and differentiation indices 4.2. Observed heterozygosity (Ho) 4.5.2.1.2. The analyse of the genetic assignment of the trees morphologically grouped to Quercus pubescens 62 64 66 67 68 69 69 70 70 72 72 73 73 74 75 76 77 78 79 80 81 82 83 84 85 85 86 87 88 88 89 90 92 93 94 95 96 96 97 100 101 31 32 33 33 33 34 34 34 35 36 36 36 36 37 37 37 38 38 39 39 40 40 41 41 42 42 43 43 44 44 44 45 46 46 47 47 47 48 48 49 49 104 50 106 51 108 52 110 53 5 . The genetic structure assessed with molecular markers analysis 4. Phenotypical androsterility in Bejan Forest 4. The analyse of the individual phenological stages of flowering in consecutive years of observations 4.2.1.1.2.1.2.6.2.3. Assessment of the genetic parameters 4.2. The analyse of the genetic assignment of the trees morphologically grouped to Quercus petraea 4.2.3.2.3.8.2.1. Conclusions regarding the flowering phenophase 4. PIE215 marker 4.3.2.2.4.2.9. Flowering in 2011 4. ZAG7 marker 4.3.2.2.2.2.2. ZAG87 marker 4.2.2. The flowering intensity in two years of observations 4. PIE227 marker 4. Allelic richness (AR) 4.4.4.6. Interspecific differentiation 4.15.2.2.2.6.7.2.13.2. Testing of the genetic assignment 4. ZAG112 marker 4.1. ZAG11 marker 4.1.2.2.6. PIE040 marker 4. Hardy-Weinberg equilibrium and linkage disequilibrium 4.3.4.2.3. The average number of alleles (Na) 4. Expected heterozygosity (He) 4.5.3. Comparative analyse between the phenophases of leaves opening and flowering in consecutive years 4.6.3.10.1. ZAG20 marker 4.7.3. DHN3 marker 4.2. The analyse of the genetic assignment of the trees morphologically grouped to Quercus frainetto 4. ZAG39 marker 4.4.2.2.1.3.1. Allelic structure of the four species of oaks in Bejan-Deva complex 4.14.3.2.

Final conclusions 5.3.4.3. Pollen dispersal 4.4. The analyse of the crosses from the study area 4.2.2. RESULTS DISSEMINATION. Comparative synthesis of the paternity analysis and phenological data 5. Conclusions drawn from the assessment of the adult trees hybridization 5. Future research directions BIBLIOGRAPHY ABSTRACT CURRICULUM VITAE 111 54 113 55 117 118 118 123 125 57 57 57 59 60 130 63 134 64 134 64 134 64 135 136 137 138 139 140 174 175 65 66 67 67 68 69 80 81 6 . Identification of the pollen donor trees 4.4. Conclusions regarding the analyse of the genetic assignment of the trees from Bejan Forest 4.4. Conclusions drawn from the phenological observations 5.6.3. Conclusions drwn from paternity analysis 5. Comparison of the analyse of the individuals assignment to the species in two different studies 4.1.2.5. FINAL CONCLUSIONS.3. FUTURE RESEARCH DIRECTIONS.6.2. 5. Original contributions 5.3. Estimation of the present gene flow with paternity analysis 4.1.1. The analyse of the genetic assignment of the trees morphologically grouped to Quercus robur 4.1.2. Results dissemination 5.3.6.3.3.2.1. ORIGINAL CONTRIBUTIONS.6.1.

Astfel. 1952. Genul Quercus pare să fie unul din cele care dețin un „arsenal” pentru contracararea amenințărilor extincției. Nu în ultimul rând. 2008): i) migrația în latitudine sau altitudine. hibridarea a fost subiectul unor cercetări la un alt nivel. barierele reproductive nu sunt izolate în totalitate. Datorită faptului că acest fenomen a fost invocat și la nivelul țării noastre (Georgescu şi Moraru. speciile și populațiile lor actuale ar putea fi afectate nu numai de încălzirea globală. prin plasticitatea fenotipică care poate permite un răspuns rapid la schimbările bruște de mediu. Pe de altă parte. caracterizată prin existența mai multor specii simpatrice de cvercinee. fluctuante.. cu ajutorul markerilor moleculari. această teză își propune să analizeze. datorită unei divergențe relativ recente între specii. datorită avansului tehnologic din domeniul geneticii moleculare. pe urmele condițiilor de mediu favorabile. Răspunsurile posibile ale acestor specii în raport cu modificările condițiilor de mediu pot fi de trei tipuri (Aitken et al. Dumitriu–Tătăranu.. Relativ recent. Nyarady et al. o suprafață de cercetare amplasată în rezervația naturală Bejan-Deva. s-au întreprins observații fenologice în trei ani consecutivi cu scopul de a investi ga rolul fenologiei arborilor ca barieră împotriva hibridării sau dimpotivă. deoarece speciile din genul Quercus au dat de bănuit de mult timp prin caracterele morfologice intermediare la anumiți arbori. fenomen cunoscut sub numele de hibridare naturală. în prezent se conturează o dinamică diferită a acestora. Datorită activităților antropice abuzive asupra mediului înconjurător. Pe de o parte. Cu toate că speciile de plante au trecut în decursul timpului prin mai multe succesiuni termice. În ultimul timp. 1960. s-au realizat analize de paternitate pentru a surprinde dinamica fluxului genic în condițiile actuale de mediu. prin numărul remarcabil de specii repartizate la nivel planetar și adaptate la condiții de mediu extrem de diverse.. De asemenea.INTRODUCERE Populațiile naturale de plante se găsesc la începutul secolului XXI în fața unei noi provocări: schimbările climatice la scară planetară. ca factor favorizant. 7 . 1991). schimbările climatice care se preconizează se disting în raport cu cele din trecut prin rapiditatea lor. acest gen de arbori a constituit un adevărat model pentru studiul genetic al hibridării. Stănescu et al. 2001).. manifestate dincolo de amplitudinea de manifestare a acestora asimilată în comportamentul actual al speciilor. ii) adaptarea populațiilor existente la noile condiții de mediu sau iii) extincția locală a populațiilor. s-a emis ipoteza conform căreia hibridarea la speciile de plante are un rol important în migrație (Petit et al. Totodată. ceea ce poate cauza producerea încrucișărilor interspecifice. Complementar scanării genomului în vederea alocării genetice a arborilor la specii sau hibrizi. ci și de fenomene climatice extreme. 1948. 2004). care poate surprinde capacitatea de migrație a speciilor de plante (Davis și Shaw.

8 . Howard et al. 2002). Taxonomia și filogenia genului Quercus Genul Quercus este încadrat taxonomic în familia Fagaceae. 2002a). 1995).. Asiei. 1993.1. Italică și Balcanică (Petit et al. Totuși. separate în șapte genuri. Genul Quercus are o distribuție extinsă în emisfera nordică. STADIUL ACTUAL AL CUNOȘTINȚELOR PRIVIND RELEVAREA ȘI EVALUAREA FENOMENULUI DE HIBRIDARE NATURALĂ LA CVERCINEE 1.. Bacilieri et al. Din punct de vedere ecologic.. La ora actuală variantele cloroplastice (haplotipuri) nu permit distingerea speciilor. 1983). Prin alăturarea acestor date genetice cu cele palenologice (Brewer et al. 1999. grupul Lobatae. pe direcția sud – nord de migrație globală. de la nivelul mării până la 4000 de metri în Munții Himalaya (Menitsky. 2010): grupul Cerris. 2007). Denk și Grimm.. cu aproximativ 1000 de specii la nivel global. răspândite în emisfera nordică. 1997). Americii de Nord. 2010) indică o grupare infragenerică a genului Quercus în următoarele „grupuri” independente unele de celelalte (Denk și Grimm.. ocupă ecosisteme variate. de la pădurile temperate până la comunitățile de plante montane tropicale și cele sclerofile mediteraneene (Axelrod. Manos și Stanford. Distribuția altitudinală a speciilor de cvercinee este la fel de variată. de la regiunile boreale la cele tropicale sau chiar ecuatoriale (Kremer et al. 2002b). Cu ajutorul markerilor cloroplastici. O parte a acestei variabilități a caracterelor morfologice a fost explicată prin fenomenul de hibridare naturală care s-a observat mai ales în zonele de contact dintre specii (Rushton. 2005). moșteniți pe cale maternă la stejari (Dumolin et al. 1993. căci majoritatea haplotipurilor sunt împărțite local între specii. răspândindu-se în sud-vest spre Columbia (America de Sud) și în sud-est spre Indonezia.. una din cele mai bogate familii din punct de vedere dendrologic. nordul Africii.. grupul Cyclobalanopsis. numărul speciilor alocate genului Quercus a variat considerabil de-a lungul timpului datorită variabilității caracterelor morfologice care a cauzat atașarea expresiei crux botanicorum genului Quercus (Schwarz.. grupul Protobalanus și grupul Quercus. au fost comunicate trei refugii glaciare principale în zonele muntoase ale peninsulelor Iberică.1. Ultima trecere în revistă a speciilor de stejari a fost facută în 1998 de Govaerts şi Frodin şi include 531 specii de arbori şi arbuşti. grupul Ilex. 1937). 2001. s-au identificat liniile filogenetice ale cvercineelor și s-a reușit retrasarea căilor de migrație post-glaciare prin care taxonii din genul Quercus au recolonizat teritoriile europene (Petit et al. Repartiția actuală a haplotipurilor cloroplastice pe continentul european arată că fiecare refugiu a recolonizat o parte din teritoriu. Cele mai noi studii filogenetice bazate pe genetica moleculară (Manos et al. acoperind zone întinse ale Europei.

Q. în principal în Moldova. 1997. de regulă. Stănescu et al. Distribuția mugurilor este influențată de poziția de pe ramuri: aproximativ 72% din totalul mugurilor apar pe lujerul terminal din acel an. ca în cazul pădurii Bejan-Deva. Dumitriu– Tătăranu.. 1952. 2009). 2007b. Şofletea şi Curtu. Q. S-a observat faptul că la stejarii albi.3. petraea ssp. – cer (Şofletea şi Curtu. respectiv 2% pe lujerii vechi de 2 ani (Johnson et al. Stănescu et al. apoi deschiderea lor apare și pe ramurile inferioare (Johnson et al. 2009). unde s-a realizat și o evaluare a fluxului genic actual prin intermediul microsateliților și a analizelor de paternitate (Curtu et al. Nyarady et al. 1948. cerris L. 2009). amenții apar după 10 zile în care temperaturile minime zilnice au fost mai mari sau egale cu 10°C (Sharp și Chisman.. În câteva zile devin semi -pendenți. polycarpa (Schur) – gorun transilvănean. Sanda et al. Totuși. Cvercineele din ţara noastră sunt reprezentate de: Quercus robur L. 9 . ssp. Q. 1991). la limitele de areal ale unora dintre ele. amenții sunt erecți. frainetto Ten.1. – stejar pufos.2. Q. cu ajutorul markerilor moleculari și a analizelor statistice multivariate a caracterelor foliare. Stanciu (1997) a semnalat existența a 14 tipuri de entități hibride în 44 de puncte geografice ale României.virgiliana Ten. devenind complet pendenți în 5-12 zile de la apariție. Q pedunculiflora K..) – gorun de Dalmaţia. 1948. 26% pe lujerii vechi de 1 an... petraea (Matt.. în literatura de specialitate din România lipsește o cercetare a fenofazelor înfloririi și a implicațiilor acesteia asupra hibridării. Șofletea et al. petrea (Liebl. Relativ recent. În privința contextului mediogen care favorizează sau limitează producerea hibridărilor. Q. În arboretele mixte de cvercinee din România a fost semnalată existența unor centre de hibridare sau a unor hibrizi (Georgescu şi Moraru. când are loc înflorirea totală sau anteza (Sharp și Chisman. 1961). 2007). În ultimul timp.. 1961). 1952.) Liebl. genul Quercus este reprezentat de 5-9 specii. în funcţie de încadrarea lor taxonomică (Georgescu şi Morariu. – gârniţă. – stejar (stejar pedunculat). – stejar italian şi Q. Q. Amenții apar mai întâi pe ramurile superioare. pubescens Willd. Nyarady et al. Imediat după apariție. Aspecte ale fenologiei cvercineelor Stejarii sunt specii unisexuat-monoice.) – gorun comun. 1. 2007).. 2011). (2004) au mai identificat alți 5 taxoni hibrizi prezenţi în pădurile României. Conspectul de specii din genul Quercus în flora României şi semnalarea hibridării naturale În România. 1960.. dalechampii (Ten. se afirmă pe de-o parte că întâlnirea în acelaşi arboret sau trup de pădure a unor specii cu exigenţe ecologice diferite se face.Koch – stejar brumăriu. adică produc flori mascule și femele pe același arbore. fenomenul de hibridare naturală a fost investigat. petraea ssp. în rezervația naturală Bejan-Deva (Curtu et al.

În România. De asemenea.. 2005). 1..1. Bălănică și Tomescu. respectiv spre speciaţie (Arnold. 1994). 1967. 1952. 1950. 1975. Hibridarea naturală în cadrul genului Quercus 1. Schimbul de gene şi hibridarea din cadrul genului Quercus au stimulat în trecut multe dezbateri asupra conceptului de specie biologică şi s-a sugerat că această accepţiune este inadecvată pentru stejari. 2009). ceea ce poate conduce la o identificare a arborilor la care s-a terminat eliberarea polenului pe baza dezvoltării frunzelor.. dată fiind amploarea hibridărilor (Burger. Mallet. Uneori hibridarea poate conduce spre introgresie. Hibridarea este un fenomen larg răspândit printre taxonii de plante (Rieseberg şi Carney. 1938. însă literatura de specialitate care abordează studiile fenologice asupra cvercineelor este săracă (Rădulescu. Se crede că acest fenomen favorizează dispersia polenului deoarece minimizează interferențele din coronament. 1953. 1952) şi au servit ca model în dezvoltarea conceptului de specii care se bazează pe criterii ecologice (Stebbins. cercetări fenologice la cvercinee au fost efectuate în suprafața intensivă Fundeanu (Ocolul Silvic Grivița). stejarii au avut un rol central în problema privind importanţa introgresiei în evoluţia plantelor (Anderson.După ce s-a realizat dispersia polenului. 10 . 1998. 1949. Muller. Datele fenologice din suprafața respectivă indică interferența fenofazelor de primăvară la t oate cele patru specii și posibilitatea departajării de grupuri diferențiate după precocitate/tardivitate.. dar fenomenul în sine este demn de consemnat şi avut în vedere atunci când se analizează în dinamica sa de manifestare. 1993). Până acum. VanValen. Chesnoiu et al. primele observații fenologice datează de peste un secol (Teodosiu și Mateescu.4. În cazul cvercineelor. 2009). în pofida hibridării extensive. 1993). Muller. 2005. 1952. În ultimul timp (Chesnoiu et al. s-a observat că suprafața frunzelor crește cu 50% (Johnson et al. Tomescu et al. 1997). Teodosiu et al. 1976). Rieseberg şi Wendel. 2005). 2005). înţeleasă ca procesul de producere a unor urmaşi viabili. Coyne. mecanismele menţinerii integrităţii speciilor sunt încă puţin înţelese. 2009).4. Amploarea fenomenului şi relevarea acestuia în literatura de specialitate Hibridarea interspecifică. adică procesul de integrare stabilă a materialului genetic de la o specie la alta prin retroîncrucişare repetată (Rieseberg şi Wendel. speciile rămân bine diferenţiate la nivel morfologic şi ecologic. parţial viabili sau neviabili în urma încrucişărilor între exemplare care aparţin la specii diferite. apare la aproximativ 10% din speciile de animale şi respectiv la 25% din speciile de plante (Mallet. au stimulat discuţii asupra rolului factorilor ecologici care limitează hibridarea (Muller.

2.1. Cele mai importante avantaje ale izoenzimelor sunt legate de faptul de a fi markeri codominanţi şi markeri universali. 1993) şi de migraţia postglaciară printr-o dispersie pe distanţe lungi (Petit et al. Q. Astfel. ceea ce trădează o speciație ecologică incompletă. 1. când au constituit un mare progres pentru studiile de genetica populaţiilor arborilor forestieri.2.2. după ce s-a demonstrat acest lucru prin încrucişări artificiale (Steinhoff. Relevarea hibridării la cvercinee prin analize de markeri genetici 1. analizele cu izoenzime nu au descoperit niciun marker specific (Zanetto şi Kremer. Gömöry şi Schmidtová (2007) au studiat hibridarea dintre Q. 1996a. robur și Q. suber şi Q. 1993.. 1993. (2009) au analizat hibridarea dintre Q. 1987) au început să se utilizeze tipuri noi de markeri moleculari bazaţi pe această tehnică. Mir et al. Studiile ulterioare bazate pe ADN-ul cloroplastic din eşantioane mai mari de populaţii alcătuite din două specii de stejari albi (Q. dar au confirmat hibridarea asimetrică între gorun şi stejar pedunculat în arborete naturale (Bacilieri et al. robur și Q.. S-au identificat hibrizi într-un procent de 40% din indivizii care au prezentat o morfologie tipică speciilor. 11 . stellata și Q.1. 2011) la taxonii Q.PCR) (Mullis și Faloona. RAPD. Studii cu markeri PCR-RFLP. Markerii PCR-RFLPs (engl.b). 1995). Q. AFLP După descoperirea și punerea la punct a reacţiei de polimerizare în lanţ (engl.. 2005).4. Studii de izoenzime Izoenzimele au fost folosite pentru prima oară în anii 1950. ilex cu ajutorul a 3 loci izoenzimatici şi prin compararea regiunilor de ADN cloroplastic. pedunculiflora a subliniat că diferențele interspecifice sunt limitate. La stejari.4. michauxii. Restriction Fragment Length Polymorphisms sau polimorfismul lungimii fragmentelor de restricţie) au fost utilizați la cvercinee mai ales pentru analiza ADN-ului cloroplastic. pubescens cu ajutorul a 9 sisteme izoenzimatice controlate de 13 loci. Autorii au concluzionat că hibrizii recunoscuţi morfologic sunt mai rari în natură decât prin estimarea fluxului genic extranuclear. deoarece caracteristicile morfologice ofereau rezultate limitate. 1995. fusiformis). 1997). Q. petraea) din Europa de Vest au sugerat că modelarea geografică şi discontinuităţile dintre haplotipuri pot fi explicate de barierele geografice (Ferris et al.. 1993). virginiana var. petraea şi Q. robur. macrocarpa. Bacilieri et al. Un studiu recent care a combinat izoenzimele și analizele foliare multivariate (Curtu et al. Polymerase Chain Reaction . fiind folosite la toate speciile (Vendramin şi Hansen. Q.4. Whittemore şi Schaal (1991) au descoperit schimburi considerabile ale genomului cloroplastic la cinci specii de stejari albi americani (Quercus alba.2..

Markerii AFLPs (engl. crenata din încrucișarea speciilor Q. crispula şi Q. între Q. Samuel (1999) a identificat fragmente RAPD care pot detecta hibridarea dintre Q. 2002. Rezultate bune ale utilizării fragmentelor RAPD au fost comunicate de Howard et al. De asemenea.. toate rezultatele indicând o slabă diferenţiere între speciile analizate. 2006). Studii cu markeri AFLP s-au realizat la complexul Q. grisea şi Q. care au reuşit să diferenţieze speciile Q. 2006) şi între 4 specii de stejari roşii americani (Dodd şi Kashani. Kelleher et al. Bodénès et al. gambelli) şi s-a propus ipoteza emasculării mediului care susţine că stresul cauzat de factorii de mediu poate creşte probabilitatea formării hibrizilor prin reducerea abilităţii competitive a gameţilor paterni ai unei specii (Williams et al. robur-Q. Amplified Fragment Length Polymorphisms .ADN-ul polimorfic amplificat randomizat). Marea majoritate a polimorfismului ADN-ului cloroplastic pare să fie anterioară începutului ultimei recolonizări care a avut loc după ultima glaciaţiune (acum 13000 de ani). petraea. deoarece din 2800 de fragmente RAPD doar 2% au afişat diferenţe semnificative ale frecvenţelor alelelor. ilex. robur şi Q. grisea şi Q.. suber şi Q. cerris şi Q... 2005). dentata din Japonia. Matsumoto et al. (1997) au comunicat o omogenitate mare între gorun şi stejarul pedunculat. suber a fost dovedită de Conte et al. 2004) sau la evaluarea diferenţierii populaţiilor de Quercus pubescens din Croaţia (Franjic et al. Mariette et al. Totodată.. (2003) au analizat gradul de diferenţiere şi hibridare dintr-un arboret mixt de Q. originea hibridă a speciei Q. 2003). 2001). (1997). Random Amplified Polymorphic DNA . 2004.Dumolin-Lapègue et al.polimorfismele de lungime ale unor fragmente amplificate). pentru estimarea hibridării naturale la speciile de stejari roșii din Mexic (Tovar-Sanchez şi Oyama. pe baza analizelor multivariate ale descriptorilor foliari şi analiza componentelor principale (PCA) folosind markeri AFLP. markerii AFLP nu au fost informativi. 2002. Gonzalez-Rodriguez et al. De asemenea. Lumaret şi Jabbour-Zahab (2009) au analizat fluxul vechi şi actual între două specii sempervirescente de stejari din zona mediteraneană: Quercus suber şi Q. Markerii RAPD s-au utilizat în unele studii împreună cu analizele foliare. De asemenea. Ishida et al. (2009) au identificat hibrizi între 3 12 . Din cauza diferenţierii moleculare scăzute dintre cele două speci i. aceşti markeri au fost folosiţi pentru analiza izolării reproductive dintre stejari (Q. (2007). (1997) au studiat variaţia ADN-ului cloroplastic şi au descoperit că este evidentă hibridarea sistematică şi introgresia între cele 8 specii de stejari albi analizate.. Markerii RAPDs (engl. petraea (Coart et al. gambelli. Rezultatele nu au oferit probe pentru variaţia geografică a fluxului genic dintre specii. ilex (Coelho et al.

pentru specia Q. Analize de microsateliţi Microsateliţii sau secvenţele simple repetitive (SSRs – engl. Astfel. petraea și Q. robur. Între aceleași două specii europene. petraea (Steinkellner et al. (1997b) au arătat că aceşti loci se conservă la alte 6 specii de stejari. Neophytou et al. rezultatele sugerând că tiparul observat este modelat de fluxul genic şi selecţia naturală. În Europa. 2005. Simple Sequence Repeats) sunt motive repetate în tandem cu 1-6 perechi de nucleotide.. O contribuţie importantă pentru dezvoltarea microsateliţilor pentru stejarii albi europeni au adus Kampfer et al. 2005). 2010). 2011a). (2010) au folosit un set de microsateliţi pentru a detecta diferenţierea interspecifică şi geografică. 2000.. prima utilizare a microsateliţilor s -a realizat la Q. 2002). alnifolia și Q. 1. O diferențiere semnificativă s-a observat între Q. respectiv Q.specii de stejari albi din Japonia (Quercus crispula. petraea și Q. mongolica var. Astfel de microsateliți au fost obținuți pentru speciile Q. Cea mai recentă noutate în privința microsateliților este dezvoltarea lor din regiuni care conțin informație genetică. rubra s-au dezvoltat un număr total de 30 de microsateliți (Aldrich et al. Muir et al. Muir și Schotterer. Ulterior au fost dezvoltaţi 9 microsateliți pentru specia asiatică Q. Un domeniu de utilizare a mcrosateliților este cel al studierii diversității genetice și a diferențierii interspecifice a cvercineelor. la care s-au elaborat 3 microsateliți.2. 1997). Prima utilizare a microsateliţilor în cadrul genului Quercus a fost comunicată de Dow et al.4. găsite în toate genomurile procariote şi eucariote (Zane et al.3.. 2006). 2002. Bruschi et al. Ulterior. (1998) care au dezvoltat 32 de microsateliţi pentru Q. myrsinifolia (Isagi şi Suhandono. s-au putut diferenția statistic speciile Q.. coccifera în Cipru (Neophytou et al. când au fost identificaţi 17 loci polimorfici. Totuși. combinând caracterele micromorfologice și 5 microsateliți nucleari. 1998. indicând un nivel redus al fluxului genic interspecific în populațiile pure și simpatrice. pubescens decât un set de 5 caractere micromorfologice ale frunzei. Steinkellner et al. (1995) la specia nord americană a stejarilor albi Quercus macrocarpa. pe baza diferențelor observate la frecvențe alelice (Streiff et al. Pentru a explica acest model al structurii genetice dintre specii au fost invocate originea comună sau fluxul genic interspecific (Muir și Schotterer. respectiv din așa numitele EST (engl. Expressed Sequence Tags). 2003) cu scopul de a fi utilizați pentru stejarii roșii... 1997a). Lexer et al. Fortini et al.. dar nu s-au identificat loci sau alele specifice unui taxon. Quercus dentata și Quercus serrata) cu ajutorul a 66 markeri AFLP polimorfici (din care 4 au fost aproape specifici celor 3 specii) şi a două programe de identificare a hibrizilor (HINDEX şi STRUCTURE). 2008). (2009) 13 . robur (Durand et al. (2000) au relatat că trei microsateliți nucleari au diferențiat mai slab speciile Q. petraea. robur și Q. crispula (Ueno și Tsamura.

(2002) la speciile americane Q. petraea și Q. Astfel. 2011). Este primul studiu în care hibridarea a fost descrisă ca un factor potenţial important care modelează structura spaţială în cadrul unei populaţii aparţinând unei singure specii. pubescens și Q. petraea.. Quercus acutissima (Zhang et al. ilex) cu ajutorul a 8 microsateliţi şi două abordări bayesiene de alocare a indivizilor la specii și hibrizi. 2007).. petraea. alnifolia și Q. liaotungensis și Q. La speciile Q. O dinamică mai complexă a hibridării a fost evidențiată în studiile care au utilizat mai multe specii de cvercinee... petraea (Pospiskova și Dostalek. petraea (Alberto et al. pubescens. Observațiile asupra variației genetice de-a lungul transectelor ecologice au arătat că adaptarea influențează o mică parte din genomul speciei Q. Q. robur. 2010). 2013) s-au comunicat valori ridicate ale diversității genetice. lobata şi Q. O strategie asemănătoare a fost urmată de Yucedag și Gailing (2013) la speciile Q.. coccifera în Cipru (Neophytou et al. Burgarella et al. 2008). 2009. coccifera şi Q. semiserrata (Pakkad et al. (2007) au analizat structura genetică spaţială în trei populaţii din Spania alcătuite din Q. Q. La aceleași două specii asiatice există bariere reproductive puternice în nord-estul Chinei. robur (Crăciunesc et al.. (2007a) au calculat variaţia genetică şi diferenţierea din cadrul unei comunităţi naturale cu cinci specii de cvercinee în România ( Q. cerris). Q. La genul Quercus. prima utilizare a metodelor bayesiene de alocare pe specii a fost realizată de Craft et al.. suber and Q. Q. pyrenaica. ilex în Spania (Ortego şi Bonal. mongolica prezintă un tipar al hibridării diferit în funcție de localizarea și compoziția arboretelor studiate. Q.. fiind utilizate împreună seturi de microsateliți și analize foliare. douglasii. frainetto şi Q. probabil datorită unor bariere reproductive puternice. în Turcia. dar majoritatea variației a fost situată în interiorul populațiilor. virgiliana). 2011b). suber (Lopez-Aljorna et al. Valbuena-Carabaña et al. În schimb. fiind comunicat un nivel scăzut al hibridării (4. 2009). petraea şi Q. la stejarii europeni s-a observat o hibridare limitată între speciile Q.6%). odată cu dezvoltarea unor aplicații statistice puternice pentru alocarea indivizilor pe specii. Q. cât și în Mexic (Penaloza-Ramirez et al.. frainetto. fiind comunicate proporții ale hibridării în intervalul 8 . Curtu et al. Rata medie de hibridare a fost foarte scăzută (<2% indivizi introgresivi). s-a putut efectua evaluarea hibridării naturală la un nivel avansat. Microsateliții s-au utilizat pe scară largă în studii de hibridare naturală la cvercinee.au reușit să discrimineze cinci specii de stejari care sunt destul de greu de separat ( Q. Q. Lepais et al.. 2010) sau între Q. (2009) au identificat hibrizii dintre două specii mediteraneene de stejari (Q. însă acestea sunt mai permeabile în nordul Chinei. 2011). acolo unde cele două specii sunt de mai puțin timp în contact (Zeng et al. Speciile asiatice Q. Q. Pentru identificarea hibrizilor s-au folosit 9 microsateliţi şi 15 descriptori ai frunzelor. Viscosi et al. 2012). 2007b. 2010).. Q.. 14 . robur. atât în Europa (Curtu et al.57% la populațiile mixte (Zeng et al. robur. 2010).

de 298 și 463 m în două arborete. (2000). De asemenea. prin reconstruirea relaţiilor dintre generaţia părinţilor şi cea a urmaşilor cu ajutorul analizelor de paternitate sau de părinţi. ValbuenaCarabaña et al. fiind observată o polenizare importantă din exteriorul zonei de studiu și o pondere a hibridării de 8. Salvini et al. prin aceste analize s-a identificat o proporție ridicată a polenizărilor din exteriorul acesteia (Buiteveld et al.5%. Lepais şi Gerber (2011) au studiat sistemul de încrucişare la patru specii de stejari albi dintr-un arboret mixt din sud-vestul Franţei... Analizele de paternitate (engl. Chybicki și Burczyk (2010) au comunicat distanțe medii ridicate ale fluxului genic. paternity analysis) se realizează atunci când este cunoscut arborele de unde provin seminţele.6 m). Fluxul genic este o caracteristică importantă a geneticii populaţiilor. La aceeași pereche de specii. În pofita nivelului ridicat raportat pentru fluxului genic îndepărtat. într-o livadă seminceră de Q. Analizele de paternitate au arătat că stejarii. specii anemofile. 2009). Moran et al. 2009). 2001). (2012) au comunicat că peste 20% din puieții eșantionați sunt hibrizi potențiali. parentage analysis) se realizează atunci când nu este cunoscut niciunul dintre genitorii puieţilor sau seminţelor. În Spania. Acest tip de analize s-au efectuat într-un arboret mixt de Q.. 1998.. Într-un studiu asupra a trei specii de stejari roșii americani. robur din Franța de către Gerber et al. 2010). În acest scop au fost combinate analizele de părinţi și cele de paternitate. dar şi a succesului reproducerii parentale (Ashley. pot să îşi răspândească polenul pe distanţe lungi (Dow şi Ashley. Analizele parentale (sau de părinţi – engl. 1999) sau în ani de reproducere diferiți (Nakanishi et al.8 și 15. Analizele de paternitate bazate pe microsateliţi au fost folosite pentru estimarea nivelului de hibridare la scară fină în arborete de cvercinee amestecate (Dow şi Ashley. (2005) au analizat nivelul fluxului genic şi al hibridării într-un arboret mixt cu Q. Streiff et al.Un alt domeniu extrem de important în genetica forestieră este cel al studierii fluxului genic prin analize de paternitate și parentale. petraea și speciile parentale au reliefat că arborele hibrid a prezentat o viabilitate ridicată a polenului. 2005). petraea şi Q. petraea și Q. robur. modelând diversitatea speciilor. 15 . Prin genotiparea câtorva sute de seminţe se poate obţine o imagine detaliată a distribuţiei distanţelor şi direcţiilor de polenizare.. 1998. Fluxul genic actual poate fi studiat cu ajutorul markerilor genetici. Rezultatele oferă noi descoperiri în dinamica fluxului genic interspecific. determinând diferenţe semnificative în compoziţia genetică a fondului de gene efectiv recepţionat de fiecare arbore-mamă într-un singur an (Streiff et al. pyrenaica. Pluess et al. Analizele de paternitate realizate asupra ghindelor provenite din încrucișări artificiale (Olrik şi Kjaer. 2007) ale unui hibrid Q. robur x Q. 1999. în timp ce dispersia efectivă a ghindelor a fost mult mai redusă (8. care vor fi genotipate la un număr de loci genici.. încrucişările apar de obicei între arborii apropiaţi.

îmbunătățiri ale acestora fiind semnalate de Barreneche et al. Primele hărți genetice la stejari au fost raportate la Q. Q. Hărțile genetice au fost folosite pentru identificarea regiunilor genomice implicate în diferențierea speciilor. Bakker. 2008). 2007). (2004a) au identificat puține regiuni cu diversitate interspecifică ridicată la speciile Q.4. La stejari construcția hărților genetice de linkage s-au construit cu ajutorul analizelor familiilor de frați-buni (engl. 2001) și la Q. Scotti-Saintagne et al.2. recunoscută ca centru de hibridare a speciilor Quercus robur L.. robur (Barreneche et al. 1998. Astfel. Q. half-sibs) (Kremer et al. (2004). Lesur et al. rubra (Romero-Severson et al. (gorun). (gârniţă) şi Q. 2003). SCOPUL ȘI OBIECTIVELE CERCETĂRILOR 2.4. full-sibs) și semi-frați (engl. 2004). (stejar pufos). (2011). (stejar pedunculat). frainetto Ten... fluxul genic este considerat mecanismul principal care menţine integritatea speciilor. Scopul cercetărilor Cercetările întreprinse și-au propus să aducă elemente noi privind hibridarea naturală între speciile de cvercinee existente în fitocenoza forestieră Bejan-Deva.. Acest model de diferențiere interspecifică este explicat de conceptul modern al speciei conform căruia gena este unitatea majoră de speciație iar genomul este unul poros (Wu. 2007). 1995). În concluzie. Faivre Rampant et al. (2012). robur și Q. Cartografierea genomului Analiza cariotipului stejarilor a reliefat faptul că numărul cromozomilor este de 2n=24 (D’Emerico et al. Față de cercetările genetice anterioare efectuate cu ajutorul markerilor genetici de către Curtu (2006). Bodenes et al. 1. Ulterior. cele din teza de față prezintă un nivel avansat de analiză și interpretare ca urmare a: i) investigării fenologiei 16 . petraea (Matt. 2001. în timp ce existenţa barierele reproductive se presupune a fi premisa necesară pentru menţinerea identității speciilor (Rieseberg et al. pubescens Willd..) Liebl. hibrizii sunt în totalitate fertili şi pot îndeplinii ambele roluri la reproducere. (2011). deși uneori a fost semnalată apariția naturală a triploizilor (Dzialuk et al. Lexer și Widmer.. 2. petraea. densitatea hărților genomice ale stejarilor a fost crescută.1. demontând incompatibilitatea hibrizilor ca o barieră reproductivă post-zigotică.În primul rând. Din aceste considerente evoluțiile viitoare din domeniul genomicii sunt de un interes major pentru studiul diferențierii genetice și a identificării hibrizilor dintre numeroșii taxoni ai genului Quercus.

este declarată sit Natura 2000 (cod ROSCI0136.sit de importanța comunitară. tip SCI . altitudine medie 326 m). aparținând celor patru specii de cvercinee analizate și anume: 64 de exemplare de stejar pedunculat ( Quercus robur). 2. Totodată. pubescens). 2. Fiecare arbore a fost marcat în teren și cartat cu ajutorul aparatului Field-Map Antilope.3. iar cu ajutorul software-ului ArcGIS (ESRI). se are în vedere continuarea evaluării fluxului genic actual pe baza analizelor de paternitate. 3. versiunea 9. Estimarea diversității și diferențierii genetice în interiorul și între speciile de cvercinee și identificarea hibrizilor interspecifici pentru arborii maturi din complexul interspecific BejanDeva. 17 . MATERIAL ȘI METODE DE CERCETARE 3.înfloririi pentru a determina eventuale bariere prezigotice. 135 de gorun (Q. Estimarea fluxului genic actual cu ajutorul analizelor de paternitate. aflată în administrația Agenției pentru Protecția Mediului Hunedoara. în special a genului Quercus. localizată în sud-vestul Transilvaniei. în vederea stabilirii implicațiilor acesteia în producerea hibridărilor interspecifice. respectiv a determina corespondența dintre fenologia taxonilor și nivelul de hibridare din fitocenoza luată în studiu. pe un eșantion mai mare de arbori seminceri. sa realizat harta cu repartiția arborilor pe specii.2. Evaluarea fenologiei deschiderii mugurilor foliari și înfloririi într-un arboret mixt de stejari albi.1 Materialul și metoda de cercetare pentru observațiile fenologice Observațiile fenologice s-au realizat în arboretul mixt din rezervația naturală BejanDeva (45⁰ 51' N 22⁰ 53' E. această pădure. ii) utilizării unui set mai mare de markeri moleculari capabili să exploreze regiuni mai mari din genom și să asigure o rezoluție mai bună de diferențiere a speciilor și a hibrizilor dintre acestea. pe o suprafață de 99 ha) datorită bogăției dendrologice de excepție. 47 de gârniță (Q. petraea). Datele au fost prelucrate. frainetto) și 79 de stejar pufos (Q. Suprafața de cercetare a inclus 325 arbori ajunși la vârsta fructificației. Obiectivele cercetărilor Pentru atingerea scopului propus s-au stabilit următoarele obiective de cercetare: 1. În prezent. 3.

pe un eșantion de 108 exemplare din cele 4 specii de cvercinee: câte 28 de exemplare de stejar pedunculat (Quercus robur). 18 .  3 . de culoare cenușie-negricioasă Eliberare polen nu se eliberează polen se eliberează polen maxim eliberare polen se eliberează polen nu se mai eliberează polen Pentru a evalua nivelul androsterilității fenotipice. la înălțimi mari. instalat în interiorul arboretului în data de 14 martie 2011. utilizând un telescop (40x) . amenți alungiți până la 50% din amenți de culoare cenușie -negricioasă (uscați) 100% amenți uscați.Datele climatice au fost furnizate prin intermediul unui senzor de temperatură și umiditate relativă a aerului (HOBO Pro v2). pubescens). s-au efectuat și observații privind numărul de amenți (flori mascule) raportat la mărimea coroanei. Anterior deplasării pe teren a fost stabilită metodologia de evaluare a fenofazei deschiderea mugurilor foliari prin care s-a stabilit că fiecărui arbore analizat să îi fie atribuită la data măsurătorilor o anumită valoare din intervalul 1-4 care semnifică un anumit nivel din stadiul de înfrunzire. frainetto) și 21 de stejar pufos (Q.1).procentul mugurilor deschiși este cuprins între 67 și 100%. 1999). deoarece florile femele sunt de dimensiuni foarte mici (câțiva mm) și nu au putut fi observate cu suficientă acuratețe în coronament. The classification used for the appreciation of the male catkins development stage Stadiul 1 2 3 4 5 Descriere 100 % amenți de culoare verde sau verde -gălbuie. Amenții masculi s-au clasificat după culoarea și proporția lor (tabelul 3.1. sau între cele două fenofaze în aceiași ani s-a folosit testul neparametric Spearman din cadrul pachetului software SPSS Statistics 20 (IBM).  2 – procentul mugurilor deschiși este cuprins între 1 și 33%. Pentru testarea corelațiilor care apar între ani diferiți la aceeași fenofază.procentul mugurilor deschiși este cuprins între 34 și 66%. P – număr redus de amenți și M – număr mare de amenți. Astfel. cu ajutorul căruia s-au înregistrat condițiile microclimatice la un interval de 30 de minute. petraea). Tabelul 3. arborii analizați la nivelul coronamentului au primit următoarele valori corespunzătoare procentelor mugurilor foliari deschiși:  1 – procentul mugurilor deschiși este 0. Această metodologie a fost preluată după manualul de fenologie elaborat pentru studii de evaluare a efectelor poluanților asupra pădurilor (Preuhsler.cenușie. 22 de gorun (Q. Cercetările fenologice privind înflorirea s-au axat doar pe studiul florilor mascule (grupate în amenți). amenți compacți până la 50% din amenți de culoare gălbui.1.  4 . amenți alungiți 50-100% din amenți de culoare gălbui-cenușie. Clasificarea utilizată pentru aprecierea stadiului de dezvoltare a amenților mascul i Table 3. 37 de gârniță (Q. S-au folosit următoarele notații: O – lipsă amenți.

la fiecare individ. în două etape succesive a câte un minut. (stejar pedunculat). Speciile avute în vedere pentru evaluarea fenomenului de hibridare naturală în suprafața de cercetare sunt: Quercus robur L. unde au fost stocate la temperatura de -60°C.2) dezvoltați anterior pentru amprentarea genetică a speciilor de stejari (Steinkellner et al. 2010. Materialul necesar analizelor genetice a constat din muguri sau frunze prelevate din coroana arborilor cu ajutorul foarfecelor telescopice și a unei catapulte. cu o frecvență de 30 Hz. Rezultatul izolării constă în obținerea unor. Probele biologice au fost transportate în laboratorul de genetică moleculară din Brașov. Testarea calității și a concentrației ADN-ului izolat s-a realizat cu ajutorul spectrofotometrului NanoDrop 8000. Materialul și metoda de cercetare pentru evaluarea hibridării naturale la arborii maturi 3.5 ha. pubescens Willd. versiunea 9. Coordonatele geografice au fost obținute cu ajutorul aparatului Field-Map Antilope.8 – 2. împreună cu două bile de wolfram. Kampfer et al. Zona studiată și materialul de analiză Un set de 492 de arbori a fost eșantionat. în rezervația naturală Bejan-Deva. În funcție de aceste două proprietăți ale soluțiilor stoc de ADN s-au efectuat diluțiile acestora. etichetat cu numărul arborelui de proveniență. datele au fost prelucrate.2. Q. este de 100 μl soluție stoc care conține ADN-ul arborilor eșantionați.2. Materialul vegetal provenit din interiorul mugurilor (aproximativ 50 mg) s-a introdus într-un tub de 2 ml. iar cu ajutorul software-ului ArcGIS.2.3.) Liebl. Efectuarea analizelor de laborator Izolarea ADN-ului este prima etapă în realizarea analizelor genetice cu ajutorul markerilor moleculari. 15 sunt microsateliți iar un marker este o porțiune 19 .0. cu ajutorul unui bisturiu și al unei pensete. petraea (Matt.. În acest studiu s-a folosit un set de 16 markeri moleculari nucleari (tabelul 3. Această operațiune a necesitat în prealabil decorticarea. conform cu Șofletea și Curtu (2007). 1998. Q. Cu ajutorul unei mori de tipul Tissue Lyser Rotch MM400 s-a efectuat macerarea probelor. Durand et al. (gorun). Volumul obținut prin acest procedeu. 3. Din cei 16 markeri utilizați.. Vornam et al. Încadrarea taxonomică a exemplarelor eșantionate s-a realizat cu ajutorul unui set de descriptori morfologici. Izolarea propriu-zisă s-a realizat conform protocoalelor de lucru Qiagen (Mini kit) și Bioline (ISOLATE Plant DNA Mini kit). (stejar pufos). frainetto Ten. 2011). a 4-6 muguri aflați în repaus vegetativ.3.. Efectuarea reacțiilor de polimerizare în lanț. s-a realizat harta cu repartiția arborilor pe specii. Ulterior. pe o suprafață de 8. (gârniţă) şi Q. 1997a.1. Calitatea ADN-ului izolat se apreciază în funcție de raportul 260/280 la care valorile optime sunt situate în intervalul 1.2..

thermocycler): Palm-Cycler CG1-96 (Corbett) și Mastercycler Gradient (Eppendorf). 0. la care nu se știe cu exactitate dacă sunt localizați în regiunile în care se codifică sau nu proteinele.5 unități (U) polimerază Taq (Promega) și fiecare pereche de primeri la diferite concentrații (tabelul 3.25 mM MgCl2. 2./ GA di.15µl apă pură și 1µl ADN (20ng)./ AT tri.3). După optimizări.2)./ TC di../ GAG tri. 1998 Kampfer et al./ AG di./ GGT di. din care jumătate este ocupat de HotStarTaq MasterMix (Qiagen). 1998 Referință Kampfer et al./ AT tri.15µl primerul înainte. 0.. Caracteristicile markerilor moleculari utilizați Table 3. Characteristics of the molecular markers used Tipul markerilor Microsate-liți genomici (gSSRs) Locus Secvența primerilor (înainte/ înapoi) CAACTTGGTGTTCGGATCAA GTGCATTTCTTTTATAGCATTCAC GCAATTACAGGCTAGGCTGG GTCTGGACCTAGCCCTCATG CCTTGAACTCGAAGGTGTCCTT GTAGGTCAAAACCATTGGTTGACT CCATTAAAAGAAGCAGTATTTTGT GCAACACTCAGCCTATATCTAGAA CACCGCTGGAATTTTAAGGGA GACCTAAGCCAAAGTGTGGGC TCCCACCACTTTGGTCTCTCA GTTGTCAGCAGTGGGATGGGTA CCCAGTCACATCCACTACTGTCC GGTTGGGAAAAGGAGATCAGA GGAGGCTTCCTTCAACCTACT GATCTCTTGTGTGCTGTATTT TTCTTGCTTTGGTGCGCG GTGGTCAGAGACTCGGTAAGTATT C AGAAAGTTCCAGGGAAAGCA CTTCGTCCCCAGTTGAATGT GAGAGAGAGAGAGACAAAGAAGA AAAA AAATTCTCCGCCACATTGAG ACGAAATGGAGCTGTTGACC TCTCCTTCTCTTCTGCCATGA AGAAGCCCAACACGGCTAC AGCAAAACACAAACGCACAA CAACAAATGGCTCAACAGTG CCCATTTGGTAGCAAAGAGTC TGTAAAACGACGGCCAGTTACCATGATCTGGGAAGCAAC AAGGGCTTGGTTGGGTTAGT TCCATCACTCCCTTCTTCTGA TGTCGCATTACCAAAACCAG Motivul / Tipul nucleotidelor di. 2010 Procedura de lucru adoptată a presupus gruparea microsateliților în 3 kituri multiplex și 2 reacții PCR independente (tabelul 3.2. 1997a ZAG7 ZAG9 ZAG11 ZAG20 ZAG39 ZAG87 ZAG96 ZAG110 ZAG112 Microsate-liți EST (engl./ TC di. Tabelul 3. ii) microsateliții EST care sunt localizați în regiunile unor gene./ TC di. 1997a Kampfer et al. 1x buffer PCR (Promega). 2000).. o excepție este reprezentată de locusul microsatelitic PIE227. 0.dintr-o genă (DHN3).. Reacțiile de polimerizare în lanț s-au efectuat pe una din cele două mașini PCR (eng./ TGG Grupul linkage 2 7 10 1 5 2 10 8 12 3 11 12 2 Culoarea Beckmann D4 (albastru) D2 (negru) D3 (verde) D3 (verde) D2 (negru) D2 (negru) D3 (verde) D4 (albastru) D4 (albastru) D2 (negru) D3 (verde) D4 (albastru) D3 (verde) D4 (albastru) M13 nemarcat Vornam et al./ AG di.. respectiv primerul M13. Totuși. 1998 Steinkellner et al. Expressed Sequence Tag) (eSSRs) GOT021 PIE040 PIE215 PIE223 PIE239 PIE227 DHN3 Durand et al. volumul necesar acestei reacții PCR a fost de 5µl./ TC di./ TC di. Cei 15 microsateliți sunt de două tipuri: i) microsateliți genomici. Toate reacțiile de polimerizare în lanț (PCR) s -au realizat într-un volum optimizat de 10µl care a conținut 20ng ADN./ TTC tri. După 20 ./ TC di.60µl primerul înapoi. 2011 Steinkellner et al.2.. care este marcat cu primerul fluorescent universal M13 (Schuelke. 0.2 mM dNTP (Fermentas).. câte 0.

37.efectuarea unor teste și optimizări. elongarea catenelor timp de 1 minut și 30 secunde.30 0. În acest caz.223 203 . s-a utilizat o enzimă mai puternică.3. 2) intervalul este estimat vizual după o scară BenchTop PCR Markers (Promega). programul nested PCR are următoarea configurație: denaturarea inițială la 94°C timp de 15 minute. timp de 15 minute.05 0. La final. Disposal of markers in PCR kits Kitul Locus ZAG112 ZAG39 ZAG96 ZAG110 ZAG11 ZAG87 ZAG7 ZAG20 ZAG9 GOT021 PIE040 PIE215 PIE223 PIE239 PIE227 DHN3 Culoarea Beckmann D4 (albastru) D2 (negru) D3 (verde) D4 (albastru) D3 (verde) D2 (negru) D4 (albastru) D3 (verde) D2 (negru) D2 (negru) D3 (verde) D4 (albastru) D3 (verde) D4 (albastru) M13-D4 (albastru) nemarcat Concentrația primerilor (µM) 0.25 0.68 SLS și 0.15 0. Citirea genotipurilor s-a 21 . Ultimul compus are rolul de etalon pentru secvențele analizate și este marcat cu culoarea fluorescentă D1 (roșu). Anterior rulării electroforezei capilare s-au pregătit probele într-un volum de 40μl pentru fiecare probă analizată. Tabelul 3.30 0. urmat de 30 de cicluri cu următoarea structură: ruperea punților de hidrogen dintre nucleotidele complementare la 95°C. legarea primerilor la temperatura de 56°C. La probele care au prezentat o calitate mai slabă a ADN-ului izolat. legarea primerului M13 la temperatura de 53°C.195 117 .32μl Size Standard 400.40 0. programul prevede menținerea unei temperaturi constante de 4-8°C în blocul mașinii până la preluarea.20 0. legarea primerilor la 55°C timp de 1 minut. urmată de 30 de cicluri necesare amplificării regiunii de interes (denaturare la 94°C.311 99 . sintetizarea noilor catene la temperatura de 72°C.17 0. Aranjarea markerilor în kituri PCR Table 3.5 Lungimea alelelor (pb) 74 . timp de 3 minute.233 80 .192 190 . timp de 30 secunde.260 97 . timp de 2 minute.199 178 . Acest program constă într-un prim pas de denaturare inițială a ADN-ului la temperatura de 95°C. Etapa finală presupune o sintetizare suplimentară. timp de 15 minute.140 103 . denumită HotStarTaq (Qiagen). la 72°C) și 8 cicluri necesare atașării primerului M13 de primerul înapoi (denaturare la 95°C.173 155 . Elongarea finală a catenelor se produce la 72°C.273 243 .209 140 – 186 203 . Genotiparea cu ajutorul electroforezei capilare. Un program PCR diferit a fost creat și pentru locusul microsatelitic PIE227.30 0. 2 și 3. dar și pentru reacția simplex la locusul DHN3. timp de 45 secunde. elongarea catenelor timp de 45 secunde.3. care a conținut 2μl produs PCR. timp de 45 secunde.108 170 – 197 1) 290 – 330 2) 1 2 3 4 5 * 1) alelele adăvărate au lungimea mai mică cu 18 perechi de baze din cauza secvenței de nucleotide fosforescente necesare metodei M13. la temperatura de 72°C.28 0. timp de 1 minut. la 72°C). s-a creat un singur program PCR pentru kiturile 1.121 169 . Genotiparea arborilor la 15 dintre loci s-a realizat cu ajutorul electroforezei capilare rulată pe aparatul GenomeLab GeXP (Beckman-Coulter).30 0. dotat cu un set de opt capilare. timp de 40 de secunde.35 0.35 0.35 0.

A heterozygous individual has two lines of different lenghts and a homozygous individual has one line. Pentru a genotipa indivizii analizați la locusul genic DHN3. In the first hole there is the BenchTop standard.1. iar un individ homozigot are o singură bandă. Variația locusului genic DHN3 evidențiat prin electroforeză orizontală.3 Analiza setului de date genetice Datele obținute în urma electroforezelor capilară și orizontală s-au trecut într-un fișier Excel (Microsoft) în care s-au realizat rotunjirile lungimilor alelelor la numere întregi și s-au construit genotipurile multilocus ale celor 492 de indivizi. colorat cu GelRed (Biotium). deoarece altfel exista riscul de a nu fi identificate alelele mai puțin puternice. s-a utilizat electroforeza orizontală. Figura 3. Figure 3.2. Parametrii electroforezei au fost următorii: 100 V.1. Alleles of a smaller lenght have migrated faster. Stejarii sunt specii diploide. Variation of the DHN3 genic locus highlighted by horizontal electrophoresis.2. Alelele de lungime mai mică au migrat mai repede. timp de 90 de minute. deci 22 . Un individ heterozigot prezintă două benzi de lungimi diferite. Figure 3. iar un individ homozigot are un singur peak. Genotiparea cu ajutorul electroforezei orizontale. Câte 4μl de produs PCR s-a introdus în fiecare godeu. Genotipul fiecărui arbore s-a citit în lumină ultravioletă cu ajutorul transiluminatorului GelDoc-It TS Imaging System (UVP). În primul godeu se află etalonul BenchTop.2. Un exemplu al rezultatelor furnizate de electroforeza capilară este redat în figura 3. iar ca etalon s-a folosit scara BenchTop PCR Markers (Promega) cu 50 de linii.realizat vizual.2.1. Mediul de migrare al produselor PCR a fost gelul de agaroză de concentrație 2%. Electroforegramă pentru cinci microsateliți. Figura 3. 3. 300 W. Un exemplu de interpretare al rezultatelor obținute în urma electroforezei orizontale sunt afișate în figura 3. A heterozygous individual has two peaks of different lenghts and a homozygous individual has just one peak. Electrophoregram for 5 microsatellites. 300 mA. Un individ heterozigot prezintă două peak-uri de lungimi diferite.

13 PIE239 18. stuttering) la locusul PIE239. Un individ este considerat homozigot la un locus genic dacă cele două alele au lungimi egale. cu un interval de încredere de 95%. una moștenită de la arborele donator de polen și cealaltă de la arborele-mamă (semincer)..25 PIE227 5.1. Tabel 3.prezintă câte două alele la fiecare locus genic. ZAG7 la trei populații (excepție Q. Frecvențele alelelor nule calculate cu metota Oosterhout Table 3. Evaluarea erorilor de citire și a alelelor nule din setul de date Cu ajutorul programului Microchecker 2.3. Testele au presupus 1000 de randomizări ale alelelor la fiecare locus din oricare populație. 2004) s-a evaluat setul de date pentru posibile erori de citire (engl. petraea și Q. cu frecvențe ale acestora situate între 8. 2004). la speciile Quercus petraea.421 Quercus frainetto Quercus pubescens 1 PIE239 24. 23 .17 Quercus petraea PIE239 25.4.81 Quercus pubescens ZAG7 3.4. un individ heterozigot la un locus genic prezintă două alele de lungimi diferite pe cromozomii pereche. Q.3 (Van Oosterhout et al. large allele drop-out). Frequencies of the null alleles calculated with the Oosterhout method Frecvență alele Frecvență alele Specia Locus nule – Oosterhout Specia Locus nule . robur. pubescens) și 25.Oosterhout (%) (%) 1 ZAG39 6.671 Quercus robur ZAG20 4. frainetto. respectiv Q. În schimb. Pentru analiza genetică a setului de date.2. 3.. pubescens. Rezultatele indică o posibilă apariție a alelelor nule la 6 din cei 16 loci analizați (tabelul 3. astfel încât pe electroforegrame sunt două peak-uri diferite.941 1 situație în care s-au calculat frecvențele alelelor ajustate Programul Microchecker a identificat apariția unor posibile erori datorate prezenţei unor alele care diferă doar printr-o pereche de baze (engl.4). Erori de citire cauzate de omiterea unei alele de lungime mare (engl. scoring errors) și existența alelelor nule (neamplificate).28 ZAG39 6.861 ZAG11 3. frainetto și Q. petraea). s-au constituit pe criterii morfologice patru populații corespunzătoare speciilor de cvercinee analizate.93 ZAG7 2. ii) prezenţa unor alele care diferă doar printr-o pereche de baze (engl. ZAG11 și PIE227 la Q.86% (Q. ZAG39 la Q. doar ZAG20 este identificat la o singură populație. Cel mai predispus locus genic la alele nule pare să fie PIE239. Cele mai frecvente erori de citire sunt: i) omiterea unei alele de lungime mare datorită unei semnal foarte slab al peak-ului corespunzător acesteia (engl.81 ZAG11 2. robur.34 PIE227 4.2. Totuși. stuttering) din cauza unor mutaţii care crează o abatere de la respectarea motivului cunoscut (Van Oosterhout et al. locusul PIE239 prezintă alele nule la toate cele patru populații. frainetto).21 ZAG7 3. large allele drop-out) nu au fost identificate în niciunul dintre cazuri.86 PIE239 8.67% (Q.

2. 2006). prin metoda testului exact (engl. s-a calculat cu programul FSTAT 2. în condițiile specifice utilizării unui anumit set de markeri genetici. frecvențele alelelor. Echilibrul Hardy-Weinberg la fiecare populație (specie în cazul de față) sau la fiecare locus pentru întregul eșantion. Parametrii genetici Pentru fiecare locus genic s-a evaluat intervalul de variație al alelelor. 2008). se recomandă calcularea următorilor parametrii (Vaha și Primmer. Stabilirea celei mai bune metode de grupare pe specii Metodele de alocare a indivizilor la specii sau hibrizi (engl.2 (Raymond și Rousset.3.. He (heterozigoția așteptată.3.5 (Peakall și Smouse. Parametrul AR (engl. permițând estimarea proporției de apartenență la speciile parentale a genomului indivizilor hibrizi. Cu toate că la ora actuală există mai multe programe de alocare genetică a indivizilor la specii. s-a stabilit următoarea strategie pentru efectuarea testării: cu ajutorul programului STRUCTURE 2.3. acuratețea și performanța globală. a fost testat cu ajutorul programului GenePop 4. Pentru îndeplinirea acestui scop. exact test). F (indicele de fixare). prezența alelelor specifice (care apar doar la o singură specie). cu ajutorul programului genetic GenAlEx 6. 1998). patru din cele mai des utilizate programe. diversitatea genetică). genetic assignment) sunt un set de abordări statistice puternice care pot fi folosite pentru a stabili apartenența indivizilor la o anumită populație sau taxon. În acest studiu. Rousset.3 (Pritchard et al. Ho (heterozigoția observată). pentru condițiile specifice Pădurii Bejan.9. Pentru evaluarea caracteristicilor genetice ale complexului de cverci nee din Pădurea Bejan-Deva au fost calculați următorii parametrii genetici. Na (numărul mediu de alele pe locus). cu coeficientul de apartenență q>0.90. mărimea acestui parametru s-a calculat pentru 63 de indivizi. Rezultatele au indicat că cel mai bun program de alocare genetică este STRUCTURE și din această cauză va fi utilizat la identificarea hibrizilor. într-un articol recent (Crăciunesc et al.3. 2006) cu scopul de a indica cel mai potrivit prag (o proporție din genomul arborilor) care delimitează arborii care aparțin unei anumite specii de exemplarele hibride: eficiența. 2013) s-au testat.3. 2012): Ne (numărul efectiv de alele pe locus). 2006. După analiza rezultatelor s-au selectat cele mai probabile 35 de exemplare. al căror genotip să aparțină la 24 . 1995. o măsură a diversității independentă de mărimea eșantionajului (Petit et al..2.5 (Peakall și Smouse. cu ajutorului programului GenAlEx 6.3. Pentru identificarea cât mai exactă a hibrizilor. 3. valoare corespunzătoare celui mai mic eșantion.2.. 2002). 2000) s-au rulat cei 492 de arbori eșantionați în suprafața de cercetare. allelic richness).2 (Goudet. Cu același program s-a încercat evaluarea dezechilibrului linkage dintre locii analizați.

2011).3. 1999). Cu ajutorul acestor 140 de genotipuri multilocus și a programului HYBRIDLAB v1. Acest indice face parte din categoria indicilor de diferențiere. La ora actuală. Recoltarea ghindelor Pentru caracterizarea sistemului reproducător al stejarilor s-au recoltat ghinde din suprafața de cercetare. specii sau chiar studii (Bird et al. 2012). 1984) și ΦST generat de AMOVA (Excoffier et al. de mare importanță este deducerea valorii K care corespunde numărului de clustere pentru eșantionul studiat.2.5 și Genepop 4. O altă abordare a fost propusă de Jost (2008) care a folosit adevărata diversitate alelică (Δ) pentru a deriva o măsură a diferențierii genetice: Dest.fiecare din cele patru specii.2.6 (Earl și vonHoldt. urmați de 500000 repetări MCMC. unul dintre obiectivele importante este identificarea.0 (Nielsen et al..3.2. diferențierea genetică este subestimată prin folosirea indicilor de fixare (Hedrick. În studiul de față s-au utilizat indici de fixare și indici de diferențiere. cuantificarea și compararea diferențierii genetice populații.3.. Stabilirea numărului de clustere genetice Pentru evaluarea structurii genetice și stabilirea numărului de clustere genetice din meta-populația eșantionată a fost folosită metoda Bayesiană implementată în programul STRUCTURE 2.. Diferențierea interspecifică În genetica populațiilor. cu 200000 de pași pentru burn-in.3. Material și metodă de cercetare pentru evaluarea fluxului genic actual 3.1. Pentru fiecare K s-au efectuat 10 rulări independente. în categoria indicilor de fixare sunt catalogați următorii parametri: GST (Nei 1973.3 (Pritchard et al. calculați cu ajutorul programelor GenAlEx 6. Cel mai potrivit prag de discriminare între exemplarele pure și hibride este cel corespunzător celei mai ridicate performanțe a programului STRUCTURE. După terminarea rulării programului STRUCTURE. 0. θ (Cockerman 1969.5.. 1992). din care 8 au putut fi alocați 25 . de sub coroana unor arbori considerați arbori-mamă. În studiile care folosesc markeri foarte polimorfici (de ex. 3. În toamna anului 2012 s-a recoltat un număr de 313 ghinde de la 15 arbori-mamă.4. Numărul de clustere genetice (K) a fost setat în intervalul 1-10. La ora actuală majoritatea studiilor care utilizează programul STRUCTURE iau în considerare metoda propusă de Evanno et al. 3. 2006) s-au simulat în total 4900 de indivizi pentru mai multe categorii pure sau hibride. 3. 2000). Pentru realizarea acestui deziderat sa utilizat programul online Structure Harvester v.. (2005).3. Weir și Cockerham. microsateliții). 1973. 1987).

Genotiparea la cei 10 loci s-a realizat prin electroforeză capilară cu două rulări pentru fiecare ghindă. ZAG96. Analizele de paternitate Pentru a determina arborii donatori de polen pentru ghindele recoltate din suprafața de cercetare s-a utilizat programul CERVUS 3. 1hibrid între Q.3. Parametrii utilizați au fost următorii: numărul de urmași . robur. ZAG20. pentru a realiza analizele de paternitate. pubescens) și 7 arbori au fost considerați hibrizi din punct de vedere genetic. numărul minim de loci etichetați . Următoarea etapă este analiza parentală propriu-zisă prin care s-au calculat probabilitățile maxime de identificare a potențialilor arbori-tată din eșantion. PIE215 și PIE223). Numărul ghindelor recoltate de la un arbore-mamă a variat între 8 și 31. proporția eșantionată . 2007). 3 hibrizi între Q.genetic la o specie de stejar (4 arbori de Q.5. grupați în două kituri multiplex: kitul 1 (ZAG9. unde au fost păstrate la temperaturi de -20°C până la momentul extracției ADN-ului.2. După ce s-a creat un fișier cu toate genotipurile disponibile.05. s-au introdus numerele arborilor maturi și ale ghindelor în alte două fișiere text. robur.700. părinți candidați . 26 . pubescens. petraea și 2 arbori de Q. pe baza statisticii Delta (Δ) care exprimă diferența dintre scorurile LOD ale celor mai posibili doi candidați.3. 3. Pentru izolarea ADN-ului s-au secționat ghindele transversal și s-au extras secțiuni din embrionul ghindei. corespunzătoare celor două kituri PCR. Aproximativ 40-60 mg de material vegetal a fost mărunțit cu bisturiul și introdus într-un tub de 2ml împreună cu 2 bile de wolfram.30000. frainetto și Q. Pasul următor constă în analiza frecvențelor alelice pe care se bazează analizele ulterioare. robur). După testarea concentrației soluției stoc de ADN cu ajutorul spectrofotometrului NanoDrop 8000. Reacțiile de polimerizare în lanț s-au efectuat cu 10 din microsateliții utilizați la genotiparea arborilor maturi. s-a realizat o analiză de simulare parentală. 2 arbori de Q. pubescens. petraea și Q.0. ZAG87. petraea și Q. s-au realizat diluțiile la concentrația 1: 20.3. Pentru a estima valorile critice ale statisticii log-likelihood (LOD) sau Delta necesare unei evaluări statistice ale intervalului de încredere pentru analizele parentale. s-au urmat pașii descriși în protocoalele de lucru ale kitului de extracție a ADN-ului Bioline (ISOLATE Plant DNA kit). între diferite perechi de specii (2 arbori hibrizi între Q.7. respectiv 1 arbore hibrid între Q. După o macerare cu ajutorul morii cu bile Tissue Lyser Rotch MM400. proporția locilor etichetați greșit . Genotiparea ghindelor Ghindele recoltate din rezervația naturală Bejan-Deva au fost transportate în laboratorul de Genetică forestieră dinBrașov. 3. ZAG11.0. ZAG110 și ZAG112) și kitul 2 (ZAG7.. frainetto și Q.0 (Kalinowski et al.

4. Date climatice în anul 2011 Datele brute raportate de senzorul de temperatură și umiditate relativă a aerului au fost prelucrate și s-au obținut mediile zilnice pentru perioada 15 martie – 8 mai 2011. Temperatura minimă absolută din interiorul arboretului a fost de 0.1.8°C.1. În perioada temporală analizată.. iar temperatura medie a fost de 12. Date climatice în anul 2013 Anul 2013 s-a caracterizat printr-o primăvară cu temperaturi scăzute care nu au depășit pragul de 10°C până în data de 12 aprilie. Ultima zi cu temperaturi negative din primăvara anului 2012 s-a înregistrat în afara intervalului analizat. înregistrată în data de 22 martie 2011 (ora 6:00).6°C (22 aprilie 2011). În acest intervalul temperaturile medii zilnice au fost cuprinse între 5.9°C. 4. iar temperatura maximă absolută a fost de 25. înregistrată în data de 2 aprilie 2012 (ora 6:30).9°C.1. Astfel. Amplitudinea medie din acest inteval a fost de 10. ceea ce marchează o amplitudine medie de 22. amplitudinea absolută din intervalul analizat a fost de 18.3°C în data de 17 martie 2013 (ora 8:00). Datele climatice pentru cei trei ani de observații fenologice 4. Temperatura minimă absolută din interiorul arboretului a fost de 2.2. Astfel. și anume în data de 9 martie.4°C. în interiorul arboretului s-a înregistrat temperatura minimă absolută de 1. în timp ce temperatura maximă absolută s-a produs în data de 3 mai 2012 (ora 14:30) cu valoarea de 26.5°C.0°C (20 martie 2011) și 15. Temperatura medie în perioada 15 martie – 8 mai a fost de doar 10. Astfel.1.2°C. amplitudinea absolută din intervalul analizat a fost de 26.7°C (3 mai). raportată în data de 30 aprilie 2013 (ora 18:00).3. fiind cea mai ridicată în cei trei ani de observații: cu 0.8°C. 27 .1.1.2°C (16 și 17 martie) și 22.9°C.1.1. REZULTATE ȘI DISCUȚII 4.1. amplitudinea absolută a fost de 27. Amplitudinea medie din inteval 15 martie – 8 mai a fost de 19.9°C. în timp ce temperatura maximă absolută s-a produs în data de 4 aprilie 2011 (ora 15:00) cu valoarea de 21.1°C (3 mai 2012).7°C mai mare decât în anul 2012 și cu 8.6°C.8°C. 4.3°C superioară celei din anul 2011.1°C. Date climatice în anul 2012 În intervalul analizat temperaturile medii zilnice au fost cuprinse între 3.7°C (9 aprilie 2012) și 23. iar temperatura medie a fost de 11.4°C. În intervalul de timp analizat temperaturile medii au variat între -0.1.6°C. Structura fenologică în complexul de cvercinee Bejan-Deva 4.

6 apr. Data Nr. The percentage of the flushing trees in 2011 (the first day of bud burst was the 3rd of April. 13 apr. 22 24 apr. Data 11 apr. când s-a observat deschiderea mugurilor la 84% din totalul exemplarelor (figura 4. Procentul arborilor porniți în vegetație în anul 2011 (prima zi de înmugurire a fost în 3 aprilie. Fenofaza de deschidere a mugurilor foliari 4. 9 apr. Această zi va fi folosită ca reper. 18 20 apr. diferențele față de celelalte specii nu sunt mari. Nr.1). fiind numerotată cu numărul 1 (tabelul 4.1. 17 19 apr.2.1). 4 apr.2. Tabelul 4. 16 18 apr 20 22 apr. deoarece în acest an temperaturile negative au apărut cu cel puțin 20 de zile mai târziu. deoarece gârnița a atins pragul de 100% arbori înmuguriți în 17 zile. Data Nr.2°C). 19 21 apr.1. 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Figura 4. 10 apr. 21 23 apr. ultima zi în 24 aprilie) Figure 4.Interesant este că în anul 2013 ultima zi cu temperaturi negative a fost 29 martie (0. 13 15 apr. 1 2 3 4 Data 3 apr. respectiv 41% în data de 12 aprilie 2011. Numerotarea zilelor calendaristice în anul 2011 Table 4. Zilele în care la o specie s-a înregistrat deschiderea mugurilor în cea mai mare proporție sunt următoarele: ziua a 7a de la debutul fenofazei (9 aprilie 2011) pentru gorun. 15 17 apr. stejarul pedunculat în 18 zile.1). Debutul acestei fenofaze s-a înregistrat în data de 3 aprilie 2011. Deschiderea mugurilor foliari în anul 2011 Observațiile fenologice privind deschiderea mugurilor s-au efectuat în perioada 1 aprilie – 26 aprilie. 8 apr. 14 apr. în timp ce gârnița este specia care prezintă cel mai mare procent al deschiderii mugurilor într-o singură zi. după 4 zile în care temperaturile maxime au depășit 15°C.1. 4. 5 apr. Nr. 5 6 7 8 Data 7 apr. the lasy day was the 24th of April) FRA PET PUB ROB 28 . Day numbers of the year 2011 Data Nr. Totuși. Gorunul a avut nevoie de cel mai mic interval de timp (16 zile) în care toți arborii eșantionați la această specie au atins stadiul 2 al deschiderii mugurilor (figura 4. stejarul pufos și stejarul pedunculat.1.1. 14 16 apr. Acest aspect diferențiază anul 2013 de ceilalți doi ani.1. iar stejarul pufos în 20 de zile. 9 10 11 12 Gorunul este specia care a dominat această fenofază în prima săptămână. 12 apr.1. Nr.

s-a produs o stagnare a procesului de deschidere a mugurilor care s-a manifestat pe un interval de o săptămână. pubescens. urmată de Q. frainetto.2. 7 apr. Data Nr. minima zilnică fiind de 0.Interesantă este și viteza cu care speciile au atins pragul de 90% din totalul arborilor porniți în vegetație.2.6°C în data de 10 aprilie. Totuși. Nr.2. 27 2 mai 16 21 apr. 9 apr.2). Nr. Tabelul 4. Nr. 4. petraea. În acest interval mediile termice zilnice s-au situat sub 10°C. Ziua de 18 29 . toate celelalte zile fiind numerotate în funcție de această zi (tabelul 4. Q. Data Nr. despărțite între ele de câte o zi. Ziua de 6 aprilie va fi folosită în acest studiu ca zi de reper și va fi notată cu ziua 1. 17 apr. robur.2. Data 13 18 apr. ultimele două cu o diferență foarte mică între ele. Procentul arborilor porniți în vegetație în anul 2012 Figure 4. 18 23 apr. 16 apr. 5 6 7 8 Data 10 apr. din cauză că în următoarele zile temperatura a scăzut destul de mult.2). 22 27 apr.2. 26 1 mai 15 20 apr. 12 apr. 1 2 3 4 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Data 6 apr. 13 apr. Q. robur și Q. Deschiderea mugurilor foliari în anul 2012 În anul 2012 pornirea în vegetație a arborilor a debutat în data de 6 aprilie care coincide cu un prim maxim de temperatură realizat în zilele de 5 și 6 aprilie.3 Deschiderea mugurilor foliari în anul 2013 Fenofaza deschiderea mugurilor a fost influențată semnificativ de temperaturile scăzute înregistrate în lunile martie și aprilie. Numerotarea zilelor calendaristice în anul 2012 Table 4.1. frainetto. la un avans considerabil (5 zile) de Q. FRA PET PUB 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Figura 4. 24 29 apr. 17 22 apr. Debutul acestei fenofaze a fost consemnat în data de 18 aprilie.1. 23 28 apr. Data Nr. 25 30 apr. Pragul de 90% al arborilor la care s-a consemnat deschiderea mugurilor este atins cel mai repede de specia Q. 19 24 apr. 9 10 11 12 Data 14 apr. 11 apr. pubescens și Q. probabil sub influența celor 7 zile anterioare cu temperaturi mai mari de 10°C.2. 15 apr.2. Day numbers of the year 2012 Nr. 14 19 apr. 8 apr. The percentage of the flushing trees in 2012 Diferențe interspecifice există la intervalul format între primul și ultimul arbore care a pornit în vegetație (figura 4. 4. 20 25 apr. 21 26 apr. Primul loc în clasament este ocupat de Quercus petraea.

3). Q. frainetto. 6 23 apr. Pe fondul creșterii progresive a temperaturii are loc o evoluție treptată a fenofazei deschiderea mugurilor. 4. 7 24 apr.5% din arborii eșantionați. Cea mai mare diferență interspecifică observată la această fenofază s-a consemnat în ziua a șaptea.4. Data Nr. Day numbers of the year 2013 Nr. în ordine. Q.3. Tabelul 4. 5 22 apr. 4 21 apr. Din analiza datelor fenologice ale deschiderii mugurilor din cei trei ani de observații se poate observa că gorunul a pornit primul în 30 .1.3. Data 1 18 apr. pubescens debutul acestei fenofaze a fost în ziua de 19 aprilie. acoording to the species În ceea ce privește dinamica și comportamentul observat la fenofaza deschiderea mugurilor la cele patru specii de cvercinee trebuie precizat faptul că Q. 11 28 apr. Concluzii privind fenofaza deschiderea mugurilor În general. iar la Q. robur în data de 21 aprilie. 2 19 apr. petraea și de doar 26% pentru Q. intervalul temporal pe care aceasta s-a manifestat a fost de doar 12 zile.3. s-a observat un interval mediu de 4-5 zile în care un arbore din eșantion a ajuns din stadiul 2 în stadiul 4 al deschiderii mugurilor foliari.3. 10 27 apr. 3 20 apr. la Q. Procentul arborilor porniți în vegetație în anul 2013. La specia Q. iar toate celelalte zile în care s -a consemnat deschiderea mugurilor în suprafața cercetată sunt dependente de aceasta (tabelul 4. Speciile clasate pe următoarele locuri au fost. când proporția arborilor la care s-a declanșat deschiderea mugurilor a fost de 97% pentru Q.2.3). frainetto. The percentage of the flushing trees in 2013. Data Nr. 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 0 1 2 3 4 5 6 7 8 9 10 11 12 FRA PET PUB ROB Figura 4. petraea a fost specia cu cea mai rapidă rată de avans observată la pragul de 90% (figura 4. la o diferență semnificativă de gorun. 12 29 apr. Data Nr. 9 26 apr. 8 25 apr. Din cauza debutului târziu al acestei fenofaze. în funcție de specie Figure 4. robur și Q. Numerotarea zilelor calendaristice în anul 2013 Table 4.aprilie este reper pentru această fenofază în anul 2013. frainetto în ziua de 22 aprilie. care a culminat în data de 24 aprilie (ziua a șaptea de la începutul fenofazei) când s -a observat stadiul 2 al acestei fenofaze la 36. pubescens.

Arborii la care nu s-au observat flori mascule vor fi tratați într-un subcapitol separat. 80% 60% 40% 20% 0% 1 2 3 4 Figura 4.4. Totuși. foarte apropiată de valoarea observată în acest studiu în anul 2011 (22 de zile). (2009) au raportat o lungime a intervalului deschiderii mugurilor de 21 de zile.4.1. De remarcat este faptul că în anii 2012 și 2013 acest clasament a rămas nemodificat.3. Înflorirea în anul 2011 Fenofaza înflorire a debutat în anul 2011 în data de 24 aprilie când 25 de arbori (23%) din eșantion au afișat stadiul 2 al acestei fenofaze (figura 4. Din metodologia aplicată în acest studiu reiese faptul că eliberarea polenului din florile mascule se realizează între stadiile 2 și 4. ultima este 27 aprilie 2011) Figure 4. Clasarea gorunului pe primul loc în cei trei ani este explicată prin cerințele acestuia față de căldură.3. the last day is the 27th of April 2011) FRA PET PUB ROB 31 . diferențele dintre speciile clasate pe locurile 2-4 sunt destul de mici.4). în pofida unor intervale de timp cu lungimi diferite. cu un avans care s-a menținut până la final. Distribution by days of the 2nd stage of flowering (pollination beginning) for the oaks species in 2011 (the first day of flowering is the 24th of April 2011. Totuși.1. ceea ce înseamnă că durata eliberării efective a polenului unui arbore este mai mare. pubescens). respectiv să înceapă eliberarea polenului. Astfel. deoarece există o variație individuală la apariția florilor mascule. Cerințele ecologice față de temperatură ale celorlalte specii de cvercinne sunt următoarele: stejarul pufos este specie eutermă. robur. iar stejarul pedunculat este mezotermăeutermă (Șofletea și Curtu. dar și Q. Fenofaza de înflorire 4. Cheșnoiu et al. ci sunt valori medii. durata medie eliberării polenului unui arbore este de 2. 4. 2007).vegetație. Într-un studiu fenologic realizat în estul României într-un arboret mixt de cvercinee (în principal alcătuit din taxonii Quercus pedunculiflora și Q.1.5 zile. În ziua de 27 aprilie toți arborii la care s-au observat flori mascule (95 de exemplare) au trecut prin stadiul 2. din observațiile noastre fenologice. aceste date nu acoperă toate florile din coroană. gârnița este eutermă-mezotermă. petraea sau Q. fiind o specie mezotermă situată la limita inferioară a arealului altitudinal în zona studiată. ceea ce înseamnă că într-un interval de doar 4 zile toți arborii au început să înflorească. Repartiția pe zile a stadiului 2 de înflorire (începutul polenizării) pentru speciile de cvercinee în anul 2011 (prima zi de înflorire este 24 aprilie 2011.

frainetto procentul din această zi fiind mai scăzut (66%).5.3.5. Astfel. doar în ziua a patra fiind observat un procent mai mare. ceea ce constituie o premisă p entru realizarea hibridării interspecifice. de 3 ori mai lungă decât în anul precedent.În ceea ce privește diferențele interspecifice ale înfloririi în anul 2011 reiese faptul că sunt nesemnificative. atunci când toți arborii de stejar pedunculat au atins stadiul 2 al înfloririi iar aproximativ 95% din goruni și stejarii pufoși erau la acest stadiu. dacă ținem cont de faptul că durata medie în care un arbore eliberează polen este de 3 zile. the last day is the 8th of May 2012) FRA PET PUB ROB În ceea ce privește diferențierea interspecifică înregistrată la această fenofază.2. petraea și Q. în ziua a treia de la debutul înfloririi (29 aprilie) peste 90% din arborii încadrați la Quercus robur. în primele trei zile au început să elibereze polen aproximativ 84% din arborii cu flori mascule. Astfel. Repartiția pe zile a stadiului 2 de înflorire (începutul polenizării) pentru speciile de cvercinee în anul 2012 (prima zi de înflorire este 27 aprilie 2012. Înflorirea în anul 2012 În anul 2012 lungimea efectivă a fenofazei înflorire a fost de 12 zile în 2012 (figura 4. în ziua a doua au început polenizarea aproximativ 76% din totalul arborilor cu flori mascule și în ziua a patra toți arborii au înflorit. rezultă că în acest an înflorirea în complexul Bejan-Deva s-a suprapus la cele patru specii de cvercinee. Un procent de aproximativ 90% la gârniță este atins în ziua a cincea. Totuși. În restul zilelor progresul a fost lent. frainetto (aproximativ 6% din totalul arborilor cu amenți). au mai început să elibereze polen 12% din arborii cu amenți. 32 . pubescens au început să elibereze polen. Distribution by days of the second stage of flowering (pollination beginning) for the oaks species in 2012 (the first day of flowering is the 27th of april 2012. Începând cu ziua a șasea a înflorii și până în cea dea 12-a zi. de 17% din arborii încadrați la Q. Astfel. toate exemplarele de gorun și stejar pedunculat încep polenizarea în trei zile. 70% 60% 50% 40% 30% 20% 10% 0% 1 2 3 4 5 6 7 8 9 10 11 12 Figura 4. ținând cont de faptul că intervalul de timp mediu în care un arbore eliberează polen este de 3 zile (ca și în primul an) este posibilă polenizarea interspecifică pentru major itatea indivizilor eșantionați în acest an de observații.1. dar majoritatea (>95%. respectiv 85%) ating stadiul 2 în două zile. ultima este 8 mai 2012) Figure 4. 4.5). doar la Q. Q.

4.4.. (1994) pentru un arboret mixt de stejar și gorun. The flowering intensity in 2011 and 2012 33 . s -a observat pe arbori din lizieră că florile femele devin receptive în perioada în care are loc și polenizarea. petraea și Q.3..4. Intensitatea înfloririi în doi ani de observații În cei doi ani de observații. Q. P 2012 50% 0% TOTAL FRA PET PUB ROB P 2011. care într-un arboret mixt de Q.6). în intervalul 20-25 aprilie. (1994). pubescens (Cheșnoiu et al. S-a observat faptul că peste jumătate dintre arborii analizați au avut aceeași intensitate în cei doi ani (figura 4. respectiv 6% au prezentat un număr mare de amenți (M). Q. petraea din nord-vestul Franței au observat o durată a perioadei de înflorire cuprinsă între 10 și 12 zile. Deși acest studiu nu a vizat observațiile acestui tip de flori din cauza condițiilor dificile de evaluare.1. de la 4 zile în anul 2011. O situație opusă s-a întâmplat la Q. respectiv 12%) sunt comparabile cu cele comunicate de Bacilieri et al. M 2012 P 2011+2012 M 2011+2012 Figura 4. unde s-au observat între 2 și 8% arbori sterili. petraea unde aproape jumătate din arbori (47%) au avut un număr redus de amenți (P). Totuși.3. datele din literatura de specialitate sunt contradictorii în ceea ce privește apariția florilor la stejarii albi (Sharp și Sprague.. 2009).1. Procentele arborilor sterili din acest studiu (5.6. Intensitatea înfloririi în anii 2011 și 2012 Figure 4.3.6. Concluzii privind fenofaza înfloririi Din observațiile fenologice privind deschiderea amenților masculi în cei doi ani consecutivi (2011-2012) s-a constatat o variație a lungimii începutului acestei fenofaze. În anul 2008. 4. Important este și modul în care s-a realizat polenizarea florilor femele. 1967. 100% M 2011. la taxonii Quercus pedunculiflora. în estul României (pădurea Fundeanu). până la 12 zile în anul 2012. s-a analizat intensitatea acesteia.3. 2011). în timp ce doar 4% au avut un număr redus de amenți (P). concomitent cu fenologia înfloririi. s-a observat o perioadă de 6 zile în care majoritatea florilor mascule au fost mature. Franjic et al. robur și Q. în funcție de an și specie.1.5. robur. Aceste rezultate sunt în concordanță cu cele comunicate de Bacilieri et al. Androsterilitatea fenotipică în pădurea Bejan În cei doi ani de observații fenologice privind înflorirea s-a observat absența florilor mascule la unii dintre arborii studiați. Interesant este faptul că mulți indivizi de Quercus robur (65%) au prezentat un număr mare de amenți (M) în cei doi ani.

Acest lucru subliniază faptul că în cei doi ani de observații.4. aproximativ 24% din exemplarele studiate și-au păstrat ordinea în această fenofază.. Astfel.820 320 <0. 1994). ci probabil este influențată de variabilitatea de la nivelul arborilor.4. iar rezultatele indică faptul că la gârniță. intensitatea înfloririi unui arbore nu depinde de intervalul temporal. ceea ce scoate în evidență faptul că o proporție semnificativă din arborii eșantionați își păstrează ordinea la deschiderea mugurilor foliari în intervalul de timp analizat. 4. la stejarul pedunculat corelația este semnificativă. Pentru întregul eșantion corelația înfloririi în cei doi ani consecutivi este semnificativă. The correlation of the leaf bud burst in three consecutive study years Coeficientul de corelație Numărul de Semnificația. Anii de observații fenologice Spearman. 34 . Rezultatele indică lipsa unei corelații între cei doi ani de observații. 4.741 312 <0.1. Analiza stadiilor fenologice individuale de înflorire în ani consecutivi de observații Corelația pentru anii 2011 și 2012 a fenofazei înflorire s-a efectuat prin utilizarea codurile numerice ale zilelor calendaristice în care a debutat înflorirea în suprafața de cercetare. 2008) s-a confirmat faptul că ordinea în care se realizează deschiderea mugurilor foliari se păstrează între doi ani de observații (2006 și 2007).1.4.1. Analiza categoriilor fenologice individuale de deschidere a mugurilor foliari în ani consecutivi de observații Pentru a permite efectuarea unei corelații ale acestei fenofaze în ani consecutivi s-au utilizat codurile numerice ale zilelor calendaristice în care a debutat deschiderea mugurilor.4. recent (Lepais.2.Corelația dintre valorile intensității înfloririi în cei doi ani s-a testat cu ajutorul testului neparametric Spearman.4) sunt foarte ridicate între cei trei ani de observații. ceea ce implică folosirea testului de corelație neparametric Spearman. Totuși.05). deși are o valoare mică. Totuși. Testarea corelației s-a realizat cu ajutorul coeficientului neparametric Spearman (tabelul 4. Corelația deschiderii mugurilor foliari în trei ani consecutivi de observații Table 4. Evaluarea corelațiilor fenologice 4.729 305 <0. Evaluarea distribuțiilor valorilor din cei trei ani indică lipsa unei distribuții normale în toate cazurile. gorun și stejar pufos nu există o corelație semnificativă (p<0.5). Valorile corelației fenofazei analizate (tabelul 4. Tabelul 4.01 Rezultate diferite au fost observate într-un studiu fenologic din Franța (Bacilieri et al. rS arbori p 2011 2012 0.4.01 2011 2013 0.01 2012 2013 0.1.

284 0.3. într-o proporție de 54%.p 32 17 17 26 92 0.05 <0. ceea permite restrângerea observațiilor fenologice privind înflorirea la evaluări 35 . în cei doi ani de observații. ceea ce explică o influență a deschiderii mugurilor asupra înfloririi într-o proporție de 60%. The correlation between the foliar buds burst and flowering in 2011 Numărul de Semnificația Coeficientul de corelație Spearman.05 <0.05 <0.4.427 0.239 >0.05 <0.05 <0.6.640 0.7.063 0.517 0. cu un maxim la gârniță și un minim la stejarul pedunculat.6. The correlation of the cvercinee flowering between 2011 and 2012 Numărul de Semnificația Coeficientul de corelație Spearman. La cele patru specii corelațiile sunt semnificative (tabelul 4.434 0. Analiza comparativă dintre fenofazele de deschidere a frunzelor și înflorire în ani consecutivi Testarea acestei corelații s-a realizat cu ajutorul testului neparametric Spearman (al corelației diferențelor rangurilor). r S arbori .05 <0. Pe eșantionul de 84 de arbori corelația dintre cele două fenofaze a fost semnificativă. există corelații semnificative între cele două fenofaze studiate.595 <0. Singurul caz în care corelația a fost nesemnificativă este la gorun (tabelul 4.05 Specia Quercus frainetto Quercus petraea Quercus pubescens Quercus robur Cvercinee-Bejan În anul 2012 corelația dintre cele două fenofaze s-a realizat pe un eșantion de 96 de exemplare. Tabelul 4.579 0. pe întregul eșantion există o corelație semnificativă între cele două fenofaze.541 <0. Corelația dintre deschiderea mugurilor foliari și înflorire în anul 2011 Table 4.701 0.05 4.05 >0. The correlation between the foliar buds burst and flowering in 2012 Numărul de Semnificația Coeficientul de corelație Spearman.05 <0. Corelația dintre deschiderea mugurilor foliari și înflorire în anul 2012 Table 4.05 <0. fenofaza deschiderii mugurilor s-a corelat direct cu înflorirea amenților în anul 2011.566 0.639 0. Astfel. Corelația dintre înflorirea cvercineelor între anii 2011 și 2012 Table 4.Specia Quercus frainetto Quercus petraea Quercus pubescens Quercus robur Cvercinee-Bejan Tabelul 4.05 <0.396 0.1.145 -0.p 32 17 20 27 96 0.5.05 >0. r S arbori . Astfel.05 >0. r S arbori .p 27 19 16 22 84 0. Tabelul 4.6).7.7).5.05 Specia Quercus frainetto Quercus petraea Quercus pubescens Quercus robur Cvercinee-Bejan În concluzie.

dar într-un arboret mixt alcătuit din 273 de arbori (stejari pedunculați și goruni) în Franța. Echilibrul Hardy-Weinberg și dezechilibrul linkage Unul dintre cele mai cunoscute principii în genetica populațională este echilibrul Hardy – Weinberg.2.. pubescens (13). Situații asemănătoare ale spectrului alelic s-au comunicat și în alte studii care au analizat aceste specii la locusul ZAG112 (Lepais et al.2. la stejarul pufos și stejarul pedunculat alela 88 pb prezintă o frecvență relativă de aproximativ 30% și există alte alele cu frecvențe peste 20% (alelele 92 și 96). iar cele mai puține la Q. 2010). Cea mai frecventă alelă pentru toate cele patru specii a fost cea cu lungimea de 88 pb. care în complexul de cvercinee studiat a avut o frecvență relativă de 57%. observații care sunt mult mai ușor de efectuat decât pentru fenofaza înflorire.2. robur (10).1. Enescu. La două specii asiatice de cvercinee (Q. 2012: 80 124 pb). Există totuși câteva diferențe între speciile studiate: dacă la gârniță și gorun acest locus este aproape monomorfic pentru această alelă (87%.1. 4. petraea și Q. suber și Q. ilex un număr de 17 alele în intervalul 80-112 pb (Lumaret și Jabbour-Zahab. La toate cele patru specii analizate s-au observat abateri de la echilibrul Hardy-Weinberg.. iar la Q. cel mai afectat locus fiind PIE239.2. Structura alelică a celor patru specii de stejari în complexul Bejan-Deva 4. 2009). conform căruia frecvențele alelelor și genotipurilor rămân constante de la o generație la alta în absența unor factori destabilizatori. respectiv 81%). ceea ce înseamnă că toate alelele au avut o diferență între ele de doar o pereche de baze. Moldovan. La cei mai mulți loci nu se observă abateri de la echilibrul Hardy-Weinberg. (2011) au recenzat 12 alele în intervalul 85-96 pb.05) ca acesta să existe.ale deschiderii mugurilor foliari. 4. Curtu et al. Structura genetică evaluată prin analize de markeri moleculari 4. 2011: 78 – 122 pb.2. s-au identificat 22 de cazuri în care există o probabilitate semnificativă (p<0. 2011: 82 – 112 pb. cele mai numeroase cazuri s-au găsit la Q. mongolica și Q. liaotungensis) s-au identificat 19 alele cu lungimi între 73-115 pb (Zeng et al.2. Markerul ZAG112 La markerul ZAG112 au fost recenzate un număr total de 21 de alele la cele 4 specii. Guichoux et al.. Din cele 120 de teste ale dezechilibrului linkage între perechile de loci. 36 . în intervalul 74 – 140 pb (perechi de baze). 2006: 72-106 pb.

4. (2009) sau Neophytou et al. la stejarul pedunculat. Guichoux et al. cu excepția alelei 148 pb la Q. la Quercus robur alela 140 pb se găsește la 75% din genotipurile recenzate dar este prezentă în proporții scăzute (<10%) la celelate 3 specii. cu 22 de alele. Markerul ZAG96 Markerul ZAG96 a prezentat 24 de alele cu lungimi cuprinse între 140 și 186 pb. frainetto (19%). de către Guichoux et al. cu secvența repetitivă de 2 pb care a fost respectată la toate alelele.2. (2006) au comunicat 26 de alele cu lungimi cuprinse între 204 și 268 pb. iar pentru Zeng et al. 37 . Un studiu realizat în nordul Turciei (Yucedag și Gailing. respectiv alela 117 pb la Q. Lepais et al. 2013) a subliniat că există mai multe alele identificate la stejarul pedunculat decât la gorun. Un interval puțin mai restrâns (206-262 pb) a fost identificat pentru cele mai răspândite două specii de stejari europeni.1% și 7. 4.1%). Deoarece acest locus este foarte polimorfic. în intervalul 193-235 pb. gorun și stejarul pufos (18 alele în total). mongolica și Q. dar cu alt tip de secvențiator (136-182 pb. În Franța. (2010). Markerul ZAG110 La markerul ZAG110 au fost recenzate 29 de alele în intervalul 203 – 273 pb. toate celelalte alele ale acestui locus prezintă o frecvență mai mică de 15% la toate cele 4 specii. De remarcat că același spectru alelic a fost observat de Curtu et al. ceea ce este situația opusă pentru Pădurea Bejan și pentru alte studii care au analizat acest locus la cele două specii. la Q. (2011). respectiv 135-181 pb). Un spectru alelic mai mic a fost observat la un eșantion de 90 de stejari albi din Franța (103-139 pb) de către Lepais et al. (2006). În aceeași zonă geografică. petraea. robur și Q. amplitudinea intervalului de variație a alelelor la acest loc us este cea mai mare. Zhang et al. (2006) au descoperit unele alele diferite.2. robur (24%). liaotungensis.2.2. Q.5%).5% pentru întreaga metapopulație de stejari) și una singură la gârniță (alela 209 pb cu o frecvență relativă de 1. pe de altă parte. Tiparul frecvențelor relative ale alelelor identificat la acest locus are două trăsături care pot juca rol în diferențierea speciilor: pe de o parte. alela 115 pb la Q. Markerul ZAG39 La acest marker au fost identificate 46 de alele cu lungimi cuprinse între 103 – 209 pb. aquifolioides.4. La acest locus.2.3. petraea (18%).2. Dintre toți microsateliții utilizați. spectrul alelic a fost situat între 190-244 pb. 4. pubescens (15. dar pentru specia endemică Q. Frecvențe mult mai scăzute prezintă cele 8 alele private identificate la gorun (între 1. cu 16 alele. de 106 pb. (2011) au recenzat 18 alele în intervalul 135-194 pb. foarte puține alele prezintă frecvențe relative ridicate: alela 113 pb la Quercus petraea (22%) și Q.2. (2010).

2.2%). petraea. Cea de-a doua alelă ca importanță la acest locus este cea de 115 pb (16%). (2006). Numărul de alele specifice la locusul ZAG87 este de 11 (7 la stejarul pedunculat. iar restul alelelor au ponderi mai mici de 8% din total. respectiv 32% la Q.9%). 29. Într-un studiu realizat în Franța. a fost comunicat de Ortego și Bonal (2010) care au evaluat hibridarea dintre Q.2. 36% la Q. fiind răspândite în intervalul de lungimi 99 – 195 pb. 3 la gorun și 1 la gârniță). Pentru toate speciile de cvercinee analizate. Markerul ZAG11 Dintre cei 16 markeri moleculari analizați. În schimb.3% la Q. Markerulul ZAG87 Pentru markerul ZAG87 au fost recenzate 37 de alele care respectă motivul secvenței repetitive. frainetto alelele 253 pb (51. dar cu frecvențe foarte mici din ponderea globală (0. doar cîteva prezintă valori mai ridicate: la Q. cu o frecvență de 40%. Lepais et al. (2011) au comunicat doar 21 de alele. inclusiv alelele nule. ilex L. cu lungimi cuprinse între 246 și 304 pb. Totuși. 259 pb (20. 4.9% la Q.4%). Guichoux et al. Q. la Q. petraea.1 . la alela 113 pb se înregistrează cele mai mari frecvențe relative: 44. pubescens. în intervalul 238-267 pb. Lepais et al. coccifera L. pubescens. Dintre acestea. (2006) au găsit doar 16 alele în intervalul 242-286 pb. robur alelele 271 pb (21. mult superioară alelei clasate pe locul doi (alela 221 pb cu o frecvență de 7. fiind identificate 48 de alele diferite cu lungimi care au variat între 243 și 311 pb.5. doar 16 alele s-au observat la Q. respectiv 23.3%). cu spectrul alelic situat între 97-185 pb.0. 25% la Q. și Q. 38 . (2010) la două specii asiatice de stejari. frainetto. la 90 de exemplare de stejari albi europeni a identificat 18 alele în intervalul 101 – 141 pb.3%). De altfel. jumătate din numărul alocat celei mai polimorfice specii la acest locus.4%) și 253 pb (20. 4. 4 găsite la stejarul pufos și 5 la stejarul pedunculat. 259 pb (14.2%).6.5% la Q. la Q. Din numărul însemnat de alele. robur.2.1%). la Q. Un număr asemănător de alele (17). respectiv 265 pb (11. Un număr ridicat de alele (36) a fost consemnat și de către Zeng et al. Astfel.2%) și 270 pb (15. pubescens alelele 253 pb (37. Restul alelelor au valori scăzute (<10%). locusul ZAG11 se caracterizează prin cel mai ridicat grad de polimorfism. robur (32 de alele). această alelă apare într-o proporție de 30% în zona studiată. dintre toate alelele identificate la cele patru specii.5%) și 270 pb (14. frainetto și Q. petraea alelele 246 pb (33. frainetto. cea mai des întâlnită alelă la acest locus este cea cu lungimea de 207 pb.7%).2.1%). robur.În complexul de cvercinee Bejan. alela 207 pb prezintă cea mai ridicată frecvență: 51% la Q. trebuie menționat că primerii au fost puțin modificați.

2. petraea (22). cât și la nivel de specie. ceea ce ar putea indica o eventuală discriminare interspecifică la acest marker. Asemenea locusui ZAG7. grupate în intervalul 117 – 173 pb. 2004b).1%. ilex.Locusul ZAG87 a fost unul dintre locii care au realizat o discriminare a proveniențelor într-un studiu asupra gorunului și stejarului pedunculat (Neophytou et al. cu 21%. 4. dar cu frecvențe scăzute (2. Un număr mai mare de alele (24) a fost comunicat de Ortego și Bonal (2010) la speciile Q.. 2010) și se presupune că se află într-o regiune a genomului unde are loc codificarea proteinelor implicate în deschiderea mugurilor (Scotti-Saintagne et al. La Q. numărul de alele identificate a fost de 23. Totuși. Markerul ZAG20 La locusul microsatelitic ZAG20 au fost recenzate în total 21 de alele cu lungimi cuprinse între 155 și 199 pb. 2011). ambele la gorun.. pubescens. la care s-au observat 22 de alele. 131 pb) care au frecvențe relative cuprinse între 21 și 25%. dar una singură este într-o proporție mai mare de 10% (alela 117 pb cu 15%). (2011) la Q.6%).1%). frainetto există trei alele (117. respectiv 0. petraea s-au observat 19 alele în intervalul 160-200 pb (Guichoux et al. dar cu valori modeste (0. Totuși. Într-un arboret mixt de Q. fiecare specie prezintă un model propriu al frecvențelor alelelor. din punct de vedere al diversității alelice. 4. robur și Q. nici acest marker nu prezintă o segregare pentru o anumită alelă. respectiv 15 %.1% la toate trei). toate în concordanță cu motivul secvenței repetitive.2. Mai puține alele (19) au fost recenzate de Guichoux et al.7. alelele 133 pb și 123 pb sunt cele mai bine reprezentate. această constatare se datorează faptului că toate cele patru specii ating maximul frecvențelor relative la această alelă. La Q. există câte o alelă privată pentru fiecare specie. restul sunt într-o proporție mai mică de 10%. petraea. ceea ce îl clasează pe ultimul loc dintre microsateliții genomici. O situație asemănătoare se observă la Q. cea mai des întâlnită în populația globală fiind alela 169 pb (20. Ortego și Bonal (2010) au identificat doar 6 alele cu lungimi cuprinse între 110 și 122 pb. La locusul ZAG7 s-au observat doar două alele private. Markerul ZAG7 La markerul ZAG7. situate în intervalul 115-153 pb.2. Un aspect interesant la acest locus îl constituie lipsa unei alele dominante. atât pentru întreaga comunitate de cvercinee. robur.. Cu excepția stejarului pufos. ilex cu spectrul alelic situat între 159 și 191 pb. Un interval asemănător (117-169 pb) a fost comunicat de către Zeng et al. robur și Q. (2010) pentru două specii asiatice. unde alelele 137 pb (18%) și 133 pb (13%) sunt singurele într-o proporție mai mare de 10%. 129.8. suber și Q. suber și Q. chiar dacă valorile înregistrate nu sunt mari (în jurul proporției de 20%).2. pentru restul de 11 alele frecvențele sunt reduse (<8%). Cele mai multe alele la acest locus s-au observat la Q. 39 . În studiul hibridării dintre Q.

cea mai frecventă alelă în arboret (19.. este cea mai des întâlnită la Q. La două specii de stejari roșii. frainetto acest microsatelit este aproape monomorf. cu lungimea de 194 pb. care este foarte asemănător cu cel comunicat de Curtu et al. petraea. una singură nu respectă motivul de două perechi de baze (alela 98pb). La Q. 40 . dar care apare la toate cele patru specii studiate. Q. care au remarcat la locusul ZAG9 apariția homoplaziei la unele alele lungi. Pentru cele patru specii de cvercinee din Pădurea Bejan. robur și Q. dintre care alela 223 pb are o frecvență de aproximativ 55%. 2002).2. 2007a). la care pe un eșantion de 390 de arbori din Thailanda s-au identificat 15 alele cu lungimi de 235 – 274 pb (Pakkad et al.. 2006). cu doar 3 alele identificate. humboldii s-au identificat doar 5 alele cu lungimi între 250 și 256 pb (Fernandez et al. cu lungimi mai mari (223 – 259 pb).5% în genotipurile indivizilor analizați. La Q. ceea ce se traduce printr-o diferențiere interspecifică redusă la nivelul acestui locus. 2000) sau 241 – 253 pb (Fernandez și Sork. respectiv 146 de arbori. Totuși. O situație asemănătoare a fost semnalată pentru specia Q. Lind și Gailing (2013) au comunicat un spectru alelic mai redus.9. pubescens maximul este atins în dreptul alelei 186 pb. La nivelul alelelor specifice unui anumit taxon. Deși diversitatea alelică este puțin mai scăzută la gârniță și stejarul pedunculat (13. 4. deoarece frecvența relativă a alelei 97 pb este de 94%. semiserrata. cea mai des întâlnită alelă la acest locus este cea cu lungimea de 97 pb. În schimb. 2007). cerris s-au identificat doar 9 alele în același arboret (Curtu et al. Markerul GOT021 Din cele 13 alele recenzate la markerul GOT021 în intervalul 97 – 121 pb. În acest studiu. la specia tropicală de stejar roșu Q.. rubra și Q..2. aquifolioides. douglasii (Craft et al. ceea ce denotă un mecanism evolutiv diferit între secțiile Robur și Cerris. la celelalte alele frecvențele sunt asemănătoare între speciile analizate.. care se observă într-o proporție de 67. fiind mai ales alele de lungimi mari care apar doar în componența heterozigoților. respectiv 14 alele). O altă situație a fost semnalată de Curtu et al. lobata și Q.10. pe un eșantion de 73.2. Markerul ZAG9 La markerul ZAG9 au fost identificate 23 de alele situate în spectrul 178 – 262 pb. O situație asemănătoare se observă la Q.6%). între 95 și 103 pb. (2006).4. iar la Q. la Q. 2008). Interesant este că la acest locus s-au observat 26 de alele în intervalul 204-286 pb la specia asiatică endemică Q. Un număr de 16 alele cu lungimi mai mari la acest locus (237 – 276 pb) au fost recenzate și la două specii endemice de stejari albi din California (SUA). ellipsoidalis. Q. (2009) în același complex de cvercinee (179-259 pb).2. frainetto cea mai mare proporție este atinsă la alela 198 pb. la nici una nu există o pondere semnificativă. din cele cinci observate. cu excepția alelei 184 pb la care există o diferență de 10% între gârniță și celelalte trei specii. pe un eșantion de 159 indivizi grupați în cinci populații (Zhang et al.

cu excepția alelei 208 pb (11.2% din populația de cvercinee analizată).1 – 0. Cea mai des întâlnită alelă în arboretul studiat este cea cu lungimea de 180 pb (într-o proporție de 36. robur. robur. La Q.1%). Alela 180 pb este cea mai întâlnită și în cazul speciei Q. deoarece în intervalul 169 – 192 pb au fost identificate 22 de alele.11. Alela 180 pb are cea mai mare pondere la Q. petraea alela cu cea mai ridicată frecvență este 196 pb (36%). La Q. Toate alelele recenzate păstrează motivul secvenței repetitive de trei perechi de baze. La ambele alele se observă frecvențele cele mai ridicate pentru Q. robur. Într-un arboret cu 273 de arbori din speciile Q.1%. La gârniță. cu o frecvență de 43.2. robur.3%. există anumite diferențe între speciile studiate.2%). iar alelele 174 pb.3%). La Q. La aceste două specii. Totuși. dar sunt alele care se abat de la acest model (14 alele).12. frainetto și Q. robur (46. deoarece secvența repetitivă (TTC) are lungimea de trei perechi de baze. La gorun. iar cea cu lungimeaa de 183 pb doar 17. această caracteristică a locusului PIE040 se datorează foarte probabil unor mutații în regiunea flanc a microsatelitului. s-au observat trei alele specifice la gorun și una singură la stejarul pedunculat. alela 180 pb are frecvența de 39. deoarece la fiecare specie se atinge maximul în dreptul acesteia. respectiv 18. Totuși. Alelele cu cele mai ridicate frecvențe în arboretul studiat sunt cele cu lungimea de 196 pb (30%) și 205 pb (28%). 181 pb și 183 pb au frecvențe cuprinse între 12% și 19%. o altă alelă importantă este 181 pb (15. Markerul PIE215 Locusul microsatelitic PIE215 cuprinde 13 alele cu lungimi cuprinse între 190 și 223 pb.5%). 4. care au identificat 8 alele cu lungimi cuprinse între 155 și 179 pb. petraea și Q.6%). dar are o frecvență de doar 22% la Q. Q. urmată în ordine 41 .2%. petraea. unde această alelă are o pondere de 89%. De asemenea. pubescens. Guichoux et al. (2011) au comunicat doar 6 alele în intervalul 188-206 pb. Markerul PIE040 Markerul PIE040 se caracterizează prin cea mai mare diversitate a alelelor între microsateliții de tipul EST. cu excepția alelei 198 pb care apare la Quercus petraea și Q.5%) și încă două alele cu frecvențe peste 10% (alelele 101 pb și 107 pb). prezintă o alelă dominantă (97pb. O diversitate mai scăzută a alelelor a fost consemnată de Lind și Gailing (2013). De asemenea. situate între 37% și 39%.2. toate celelalte alele au valori mai mici de 10%.7%) și 101 pb (31.2. alelele 182 pb și 183 pb au valori apropiate de cele ale alelei 180 pb (21.2.pubescens. la stejarul pedunculat s-au observat trei alele specifice dar puțin importante ca pondere (<1%). 4. specia cu cele mai multe alele la acest locus (13). frainetto (54%). dar cu frecvențe foarte reduse (0.7%) la stejarul pedunculat și 202 pb (10%) la gârniță. petraea cea mai mare frecvență de apariție o au alelele 97 pb (59.

13. pubescens. frainetto (45. la această alelă sunt observate frecvențe de 58. Cele mai frecvente alele în complexul de cvercinee analizat sunt cele cu lungimea de 84 pb (46. frainetto. dar și alela 221 pb este destul de frecventă (30%). însă s-au consemnat patru alele care nu respectă acest model: alelele 87 pb. iar celelalte alele au frecvențe globale mai mici de 13%. dar care prezintă o frecvență foarte redusă în arboretul studiat (0. (2011) au comunicat 11 alele cu lungimi situate în intervalul 70-83 pb.14.8% ale indivizilor care aparțin de Q. 4. 91 pb. dacă ne raportăm la specii. Interesant de consemnat e faptul că la acest locus nu s-a identificat nici o alelă specifică unui taxon. Guichoux et al. atrag atenția alelele 214 pb (17. repartizate astfel: două la Q. Secvența repetitivă are lungimea de 2 pb. petraea (81%). Totuși.9%). La acest locus s-a identificat o singură alelă specifică.4%) și 202 pb (15.. De altfel. dar toate cu frecvențe mai mici de 0. La Q. multe care nu respectă modelul de 2pb. Markerul PIE239 La microsatelitul PIE239 au fost genotipate 18 alele cu lungimi cuprinse între 80 pb și 108 pb.9%). iar la toate celelalte frecvențele sunt mai mici de 10%. Interesant este faptul că în studiul dintr un arboret mixt de gorun și stejar pedunculat situat în Franța. robur nu se detașează o alelă principală.1%) care apar cu frecvențe ridicate și la alte specii. la acest locus alelele private sunt în număr consistent (8).5%. pubescens (25. respectiv 13. alela 84 pb este cea mai frecventă doar pentru Q. alela 224 pb are cea mai mare pondere (36.2) și 211 pb (11. Alela 221 se găsește în cea mai mare proporție în arboretul studiat. 42 . 4. cu un procent de 38.5%) și 86 pb (29. Spre deosebire de celelalte trei specii. 209 pb și 221 pb). ci sunt observate trei alele cu o pondere de 22 – 24% (alelele 212 pb. 89 pb. petraea și câte trei la Q. petraea. pubescens (57. dar nu este alelă privată deoarece apare cu frecvențe reduse și la câțiva goruni (4. respectiv alela 223 pb la gorun. Markerul PIE223 Pentru locusul PIE223 au fost recenzate toate cele 11 alele situate în intervalul de variație 203 – 233 pb.4%). iar alelele 212 pb și 224 pb au frecvențe considerabile (19.descrescătoare de alela 205 pb (21.8%).8%.6%).2. 97 pb.7%) și 208 pb (18. Totuși. pubescens.5%). La Q. Cu toate acestea. 2011). Într-un arboret mixt de stejar pedunculat și gorun au fost comunicate 9 alele cu lungimi de 197 – 221 pb (Guichoux et al. robur (53%). frainetto și Q. Pe de altă parte.2. la Q. pe lângă alelele 205 pb (20.3%).6%) deoarece la celelalte specii au frecvențe scăzute (<5%).8%) și Q.2.1%. secvența repetitivă având o lungime de 3 pb.2. genotipați la acest locus. iar alela 86 pb are cea mai mare pondere pentru Q. alela 82 pb este caracteristică speciei Q.8%). alela 221 pb este cea mai frecventă și în cazul speciei Q.

Q. Cu toate acestea frecvențele acestor trei alele principale sunt diferite în funcție de specie.16.31 Relative frequency of the alleles for the PIE227 (FRA . petraea și Q. frainetto doar 5%.2. PUB . dar la Q.7). petraea. ROB – Q. robur doar 3%.6%. petraea și unul de Q. La alela 158 pb. Guichoux et al. alela 164 pb prezintă un maxim al frecvențelor pentru Q. la Q. PET . cu un eșantion de 273 de arbori. pubescens prezintă frecvențe ridicate (67%. PET .4. petraea valori moderate (29%). iar Q. robur) Figure 4. situate în intervalul 152 – 179 pb (figura 4.800 0. 43 . petraea are cea mai ridicată frecvență (38.000 152 155 158 161 164 167 170 173 176 179 pb PIE 227 Figura 4. cele trei alele au lungimi estimate de 290 pb. În schimb. speciile Q.3%) și 161 pb (21. pubescens au 24. frainetto. robur) FRA PET PUB ROB Alelele cu cele mai ridicate proporții în pădurea Bejan sunt cele cu lungimea de 158 pb (38. În studiul de față s-au observat doar 3 alele la acest locus.Q. pubescens frecvențe de aproximativ 15%.200 0. La acest locus.400 0.2%). ale căror lungimi au fost estimate în raport cu scara BenchTop Markers (Promega) utilizată. robur (73%). (2011) a identificat doar 5 alele cu lungimi cuprinse între 156 – 177 pb.7%) la alela 161 pb. respectiv 11. respectiv 66%).6%). Astfel. iar la Q. Frecvența relativă a alelelor pentru locusul PIE227 (FRA .Q. PUB . ultima alelă apare în frecvențe foarte reduse (figura 4. fiind identificată la doar doi indivizi de Q. frainetto și Q. Totuși. unde Q.8). pubescens.2. interesante sunt doar frecvențele celorlalte două alele.Q. ci prin electroforeză orizontală.600 0. pubescens. frainetto și Q. petraea. în toate cazurile împreună cu alela 310 pb. Markerul DHN3 Locusul genic DHN3 face parte din familia genelor dehidrine și este singurul din cei 16 utilizați în acest studiu la care genotiparea nu s-a realizat cu ajutorul electroforezei capilare. pubescens. cele 10 alele respectând fără excepție motivul secvenței repetitive în lungime de trei perechi de baze. În aceste condiții.Q. 0. 4. 310 pb și 330 pb. iar celelalte alele au frecvențe globale mai mici de 4%. într-un arboret mixt de stejar pedunculat și gorun. la Q.2. robur frecvențele sunt reduse (9%).Q.2%. 164 pb (27. Q.7.15 Markerul PIE227 Locusul microsatelitic PIE227 se caracterizează printr-un număr mic de alele.2. frainetto. ROB – Q. care împreună formează un model foarte bine conturat și propriu fiecărei specii.

000 290 310 DHN 3 Figura 4. s-au identificat 362 de alele. 4. robur) Figure 4.3. Numărul efectiv de alele (Ne) Acest parametru. respectiv 51%).8 Frecvența relativă a alelelor pentru locusul DHN3 (FRA . robur. robur) 330 pb FRA PET PUB ROB La Q.Q.Q. dar cu o distribuție diferită între specii: câte 29 de alele private la Q.800 0.2. PUB .2. la cei 16 loci genici analizați. robur și Q.1. într-o anumită populație. unde alela 310 pb este cea mai frecventă (90%) iar alela 290 pb mai puțin întâlnită (10%). la stejarul pufos 70%. frainetto doar 9. Estimarea parametrilor genetici 4. Numărul mediu de alele (Na) Datorită evaluării diversității genetice cu ajutorul unor markeri moleculari extrem de polimorfici. pubescens ambele alele sunt prezente.Q. La Q.1. O situație diametral opusă se observă la Q. La Q. frainetto. pubescens și Q.2. respectiv 8. În eșantionul analizat s-au identificat 75 de alele private.3. iar la gârniță doar 56%.2. petraea (18. La nivelul întregului eșantion (492 arbori).3).Q. petraea. la stejarul pedunculat 72%.200 0. Totuși.400 0.3. 4. PUB .8).600 0. dar într-o pondere mai ridicată pentru alela 290 pb (72%) comparativ cu alela 310 pb (28%).Q. Cele mai mari valori medii ale acestui indice sunt atinse la Q. PET .Q. frainetto alela 290 pb este foarte frecventă (94%) iar alela 310 pb cu frecvență scăzută (6%). frainetto sunt înregistrate cele mai reduse valori (12. în timp ce la locusul DHN3 doar 3 alele. PET . numărul de alele identificate a fost destul de mare. acest locus poate ajuta foarte mult la diferențierea interspecifică a taxonilor de cvercinee. De altfel. ROB – Q. ROB – Q. Din aceste considerente. în timp ce la Q. care se bazează pe frecvența relativă a alelelor.000 0. ceea ce înseamnă o medie de aproximativ 23 de alele pe locus.32 Relative frequency of the alleles for the DHN3 locus (FRA . la cel mai polimorfic locus (ZAG11) s -au observat 48 de alele. petraea iar la Q. 44 . petraea cele două alele se găsesc în proporții relativ egale (48%. frainetto. petraea. pubescens. ne indică câte alele sunt cu adevărat importante în caracterizarea unui locus. pubescens. la gorun apar 81% din totalul alelelor identificate în suprafața de cercetare intensivă.

Comparativ cu numărul mediu de alele pe locus, se observă o altă clasificare a speciilor: pe primul loc se află Q. pubescens, care e devansat Q. petraea și Q. robur, dar Q. frainetto a rămas pe ultimul loc și la acest parametru. Dacă se evaluează procentul alelelor importante din totalul alelelor obervate într-o populație, cel mai bine se situează tot Q. pubescens (41%), urmat de Q. frainetto (36%), Q. petraea (34%) și Q. robur (33%). Totuși, la nivelul întregului eșantion, doar 30% dintre alelele identificate prezintă frecvențe semnificative. 4.2.3.3 Bogăția alelică (AR) Acest indice (El-Mousadik și Petit, 1996) ne ajută să comparăm cele patru populații de cvercinee independent de mărimea eșantionului, care variază destul de mult între cele patru specii analizate. Rezultatele obținute pentru acest parametru sunt evidențiate în tabelul 4.8.
Tabelul 4.8. Bogăția alelică la cele patru specii de stejari din Pădurea Bejan Table 4.8. The allelic richness at the four oaks species from Bejan Forest Q. frainetto Q. petraea Q. pubescens Q. robur Bejan 6,95 6,52 9,04 16,00 12,75 18,86 20,58 22,19 12,27 20,95 18,67 19,94 16,26 19,20 19,15 16,68 20,28 24,23 28,63 28,34 15,59 19,36 18,90 25,60 22,15 13,86 19,40 16,99 18,08 19,17 13,95 16,51 15,49 12,10 16,82 7,97 11,55 10,36 9,03 10,99 10,97 9,91 9,90 9,41 10,24 12,98 14,34 16,13 12,58 14,78 13,98 14,00 14,10 9,77 14,47 28,00 32,92 22,89 24,22 31,32 4,86 7,50 6,46 11,93 10,12 10,86 7,63 9,31 6,31 9,65 5,91 7,83 8,10 7,50 8,56 2,00 2,59 2,55 2,00 2,35 12,63 14,43 13,93 14,04 15,74

Locus ZAG112 ZAG96 ZAG110 ZAG11 ZAG87 ZAG7 ZAG20 PIE215 PIE223 ZAG9 PIE040 ZAG39 GOT021 PIE 239 PIE 227 DHN 3 Media

Cele mai mari valori ale acestui parametru se înregistrează la locusul ZAG39 pentru Q. frainetto (28,0) și Q. petraea (32,9), iar pentru celelalte două specii la locusul ZAG11 (24,2 la Q. pubescens, respectiv 28,6 la Q. robur). Cele mai mici valori pentru toate speciile se observă la locusul DHN3. În clasamentul bazat pe media parametrului AR se află pe primul loc Q. petraea, urmată de Q. robur și Q. pubescens (valori foarte apropiate), iar pe ultimul loc, la o distanță destul de mare, este Q. frainetto. Acest clasament se explică prin faptul că la șase loci gorunul are cele mai mari valori, la câte patru loci stejarul pedunculat și stejarul pufos sunt pe primul loc, iar gârnița doar la doi loci depășește celelalte trei specii.

45

4.2.3.4. Heterozigoția observată (Ho) La specia Q. frainetto s-a observat că nivelul heterozigoției a variat destul de mult, de la 0,106 la locusul GOT021, la 0,924 la ZAG96. La aceiași microsateliți se găsesc valorile extreme și la Q. pubescens (0,198, respectiv 0,940). La Q. petraea, un minim de 0,107 este atins la locusul PIE239, iar un maxim de 0,890 la ZAG39. În schimb, la Q. robur, cei mai mulți heterozigoți se identifică la ZAG11 (0,858), iar cei mai puțini la DHN3 (0,193). Media heterozigoției pentru cei 16 loci analizați, la cele patru specii de cvercinee, indică cea mai mare ponderere a heterozigoților la stejarul pufos (0,738), iar cea mai scăzută la gârniță (0,616). Acest clasament se suprapune perfect cu cel identificat la parametrul Ne, ceea ce subliniază o legătură strânsă între numărul efectiv de alele la o specie și numărul de genotipuri heterozigote care rezultă din combinarea lor. 4.2.3.5. Heterozigoția așteptată (He) Acest parametru este unul dintre cei mai utilizați pentru caracterizarea structurii genetice a populațiilor. Valorile acestui parametru pentru fiecare locus și specie, dar și valorile medii pe specie sau pe ansamblul complexului de cvercinee analizat sunt redate în tabelul 4.9.
Tabelul 4.9. Heterozigoția așteptată la cele patru specii de stejari din Pădurea Bejan Table 4.9. Expected heterozygosity at the four oaks species from Bejan Forest Locus Q. frainetto Q. petraea Q. pubescens Q. robur Bejan 0,237 0,327 0,801 0,835 0,642 ZAG112 0,908 0,913 0,938 0,426 0,910 ZAG96 0,715 0,858 0,822 0,714 0,813 ZAG110 0,697 0,804 0,823 0,907 0,890 ZAG11 0,779 0,877 0,761 0,880 0,864 ZAG87 0,823 0,926 0,898 0,905 0,931 ZAG7 0,856 0,892 0,890 0,850 0,900 ZAG20 0,700 0,788 0,857 0,693 0,802 PIE215 0,751 0,627 0,846 0,815 0,795 PIE223 0,886 0,879 0,890 0,853 0,885 ZAG9 0,673 0,844 0,793 0,713 0,813 PIE040 0,907 0,916 0,919 0,894 0,925 ZAG39 0,116 0,545 0,208 0,761 0,514 GOT021 0,713 0,335 0,602 0,630 0,681 PIE 239 0,484 0,736 0,535 0,451 0,729 PIE 227 0,114 0,505 0,410 0,188 0,503 DHN 3 Media 0,648 0,736 0,750 0,720 0,787 0,067 0,051 0,052 0,051 0,035 SE *SE: eroarea standard.

La Q. frainetto se poate observa că există doi markeri (GOT021 și DHN3) la care se așteaptă puțini heterozigoți (11%). În schimb, la ceilalți loci heterozigoția așteptată crește până la un maxim de 91% la ZAG96 și ZAG39. Heterozigoția așteptată medie la această specie are cea mai mică valoare dintre cvercineele studiate.

46

Heterozigoția așteptată la Q. petraea se caracterizează prin faptul că la microsatelitul PIE239 prezintă o înjumătățire a valorii comparativ cu celelalte specii, iar la locii PIE227 și DHN3 are cele mai mari valori dintre cvercineele analizate. La Q. pubescens se remarcă o scădere a heterozigoției așteptate la locusul GOT021 (21%), aceasta fiind o asemănare cu Q. frainetto. Deoarece majoritatea valorilor la ceilalți loci au valori ridicate ale acestui parametru genetic, se observă că valoarea globală este cea mai ridicată dintre speciile analizate. Locusul ZAG96 reprezintă un tipar aparte pentru heterozigoția așteptată la Q. robur, deoarece la această specie există o valoare înjumătățită a acestui parametru, comparativ cu celelalte trei specii. De asemenea, la locusul ZAG112 există un procent mult mai ridicat al heterozigoților la stejarul pedunculat și la stejarul pufos, comparativ cu valorile observate la gorun și gârniță.

4.2.3.6. Indicele de fixare (F) Indicele de fixare F poate fi considerat un parametru care măsoară proporția abaterii de la echilibrul Hardy-Weinberg a heterozigoției observate la un locus genic față de heterozigoția așteptată. Pentru cele patru specii, la majoritatea locilor valorile acestui indice sunt apropiate de 0, ceea ce denotă că încrucișările s-au realizat în mod aleatoriu. Totuși, există o excepție, locusul PIE239, la care valorile sunt puternic pozitive. Deoarece s-au observat alele nule la acest locus, se presupune că acestea sunt motivul pentru aceste valori ridicate. Rezultatele indică faptul că încrucișările nu prezintă un nivel ridicat de întâmplare, ci respectă o anumită afinitate pentru încrucișări intraspecifice, aspect care va fi discutat la analiza hibrizilor din Pădurea Bejan. 4.2.3.7. Recomandări pentru diferențierea interspecifică și analizele de alocare genetică a indivizilor la specii Datorită faptului că microsateliții ZAG39, PIE040 și PIE239 nu se află în echilibru Hardy-Weinberg la mai multe specii, la locii ZAG39 și PIE239 s-au identificat proporții importante ale alelelor nule și se observă valori mari ale indicelui de fixare la markerul PIE239, se recomandă ca pentru analizele de diferențiere interspecifică și de alocare genetică a indivizilor la specii (engl. assignment) cei trei microsateliți cu probleme să fie eliminați. 4.2.4. Diferențierea interspecifică Diferențierea genetică reprezintă acumularea diferențelor în frecvențele alelelor dintre populații complet sau parțial izolate datorită forțelor evolutive, în special al selecției și driftului

47

genetic. În continuare se vor prezenta valorile detaliate pentru fiecare locus ale indicelui de diferențiere (Dest) și ale indicelui de fixare (Fst). 4.2.4.1. Indicele de diferențiere Dest Cea mai mare valoare a indicelui de diferențiere Dest între Q. frainetto și Q. petraea este atinsă de către locusul ZAG7 (0,525). Acest microsatelit discriminează cel mai bine și perechea de specii Q. frainetto - Q. pubescens (0,530). De altfel, la cele două perechi de specii, cei doi loci sunt singurii care au valori ale parametrului Dest mai mari de 0,50. În ceea ce privește perechea Q. petraea – Q. pubescens cea mai importantă valoare a indicelui Dest este raportată la locusul ZAG11 (0,462). Cea mai bună diferențiere între Q. robur și celelalte trei specii se realizează cu ajutorul markerilor ZAG96, ZAG11 și PIE227 care ating valori foarte ridicate. Astfel, între Q. robur și Q. frainetto, locusul ZAG96 are cea mai mare valoare (0,934) dintre toate cazurile analizate, iar locii ZAG11, DHN3 și PIE227 au valori în int ervalul 0,810,85. Între Q. robur și Q. pubescens locusul ZAG96 are o valoare foarte mare a indicelui Dest (0,899), urmat de locii ZAG11, PIE227 și DHN3 cu valori cuprinse între 0,53 și 0,73. Speciile Q. robur și Q. petraea se diferențiază cel mai bine la nivelul locusului ZAG96 (0,75), dar și cu valori peste 0,50 la ZAG11 și PIE227. La nivel global, cea mai bună diferențiere genetică pe baza celor 13 markeri se realizează între gârniță și stejarul pedunculat (0,520), dar și între stejarul pedunculat și stejar pufos, respectiv gorun. Cea mai scăzută discriminare are loc între gârniță și stejarul pufos (0,143), ceea ce explică și justifică și din punct de vedere genetic încadrarea taxonomică a acestora în aceeași secție (Dascia). 4.2.4.2. Indicele de fixare Fst Cea mai mare diferențiere dintre toate cazurile analizate este generată de locusul DHN3 între speciile Q. frainetto și Q. robur, la care s-a reușit cea mai bună diferențiere la nivelul celor 13 markeri. De altfel, acest locus prezintă cea mai mare diferențiere și între speciile Q. frainetto și Q. petraea, respectiv Q. robur și Q. pubescens. Pentru perechile Q. petraea – Q. pubescens și Q. frainetto și Q. pubescens cea mai mare valoare a acestui indice a fost atinsă la nivelul microsatelitului ZAG112. Un alt locus, PIE227, este răspunzător pentru cea mai mare diferențiere dintre speciile Q. petraea și Q. robur. Indicele Fst calculat pe baza estimatorului Weir-Cockerham La ora actuală, cel mai utilizat estimator al parametrului FST este cel calculat conform Weir și Cockerham (1984), notat cu θST în cele mai multe cazuri. Valorile pentru fiecare locus sunt mai mari decât cele raportate de indicele FST al lui Wright, la toate combinațiile posibile între specii

48

4. frainetto.170 0. G'stN: Gst index standardized by Nei. Fst: indicele de fixare (Wright.413 Dest Aceste rezultate.116 0. robur și Q. pubescens și Q. O diferențiere clasată la un nivel inferior s-a observat între Q. 1965). s-au centralizat valorile tuturor indicilor de fixare și diferențiere utilizați în studiile genetice actuale (tabelul 4. Tabelul 4.4.3. robur și celelalte două specii analizate.143 0. Q.039 0.200 0.Totuși. θst: Weir-Cockerham Fst estimator (Weir and Cockerham. G'stH.5.131 θst 0.047 0.060 0. 1965). cea mai însemnată diferențiere se observă între Q.2.032 0.061 0.131 G'stN 0.060 0.375 0. Dacă această probabilitate este mai mare sau egală cu pragul Tq la un anumit cluster.225 0.037 0. deoarece sunt complementare și convergente.268 0. 1984).20). Gst: Nei’s Fst estimator (Nei. Valoarea pragului Tq folosită în această teză pentru identificarea exemplarelor pure și hibride a fost calculată prin simulări.520 0. Gst: estimatorul lui Nei pentru Fst (Nei.071 0. Dest: indicele de diferențiere (Jost. FRA .10. pe baza genotipurilor multilocus.3.280 0.337 0.PUB PET . atunci se consideră că respectivul individ are o origine pură. Acest lucru se datorează faptului că între stejarul pedunculat și gârniță există 5 markeri care au o putere de discriminare mare (>0.072 Fst 0.044 0. 2008).109 0. frainetto. A fost investigat 49 . 2000) calculează.081 0. Valori globale ale indicelor de fixare și diferențiere Pentru o imagine de ansamblu a diferențierii genetice dintre cele patru specii de cvercinee analizate. 1973).236 0. frainetto și Q.254 0. 2008). Indici de fixare și diferențiere. (2007a) cu ajutorul a 6 microsateliți.454 G'stH 0. Testarea analizei genetice a grupării exemplarelor studiate pe specii Programul STRUCTURE 2.. G'stN: indicele Gst standardizat de Nei. cluster). și la acest parametru. pubescens.574 0.3 (Pritchard et al. G''st: indici standardizați de Hedrick (2005).409 0. O situație asemănătoare a fost comunicată în Pădurea Bejan și de către Curtu et al.035 0.2.058 0.084 0. frainetto și Q. G'stH.201 0.617 0.ROB 0.490 G''st 0. 1973).ROB PUB . robur iar cea mai scăzută între Q. probabilitatea ca un anumit individ să aparțină unui grup genetic (engl.PET FRA .PUB FRA . Dest: differentiation index (Jost.070 Gst 0.203 0. petraea și cele două specii din secția Dascia. Totodată.196 0.ROB PET . θst: estimatorul Weir-Cockerham pentru Fst (Weir și Cockerham. 1984). Table 4. între stejarul pufos și gârniță se observă și cea mai mică diferențiere genetică la nivelului suprafeței de cercetare.110 0. Fixation and differentiation indeces. sugerează că cea mai mare diferențiere interspecifică există între Q.10). Fst: fixation index (Wright.10. G''st: indeces standardized by Hedrick (2005).071 0.113 0. 4. De remarcat că o diferențiere ridicată există între Q.

Practic. ceea ce indică faptul că în eșantionul studiat există 2 grupuri omogene din punct de vedere genetic.100 q ≥ 0. Determination of the optimal threshold for the STRUCTURE software based on the overall performance Eficiența Acuratețea 4. pentru analiza grupării arborilor pe specii s -a convenit ca să fie folosite rezultatele provenite de la cazul k=4. Determinarea pragului optim pentru programul STRUCTURE în funcție de performanța globală Figure 4.5. indivizii care au prezentat un coeficient de apartenență q ≥ 0.05 pentru cel puțin două clustere au fost etichetați în categoria speciilor pure.05 pentru hibrizi. au fost catalogați la clasa hibridă alcătuită din cele două specii parentale. 100% 95% 90% 85% 80% 75% q ≥ 0.un număr de 8 praguri pentru setul de 4900 genotipuri simulate aparținând speciilor pure și categoriilor hibride.95. În continuare va fi prezentată situația fiecărei specii în parte.6. cu cea mai redusă rată a clasificării greșite. Trebuie remarcat faptul că pentru cazul k=4 majoritatea arborilor grupați genetic în clustere corespund în linii generale celor patru entități determinate pe criterii morfologice.050 pentru hibrizi (figura 4. cu pragul Tq=0.9. Analiza alocării arborilor din Pădurea Bejan la specii și hibrizi Programul STRUCTURE 2. Totuși.9. 50 . sunt patru perechi de praguri complementare care se aplică indivizilor hibrizi. însă există un compromis optim între acești doi parametrii.05 ≤ q < 0. în timp ce indivizii la care nu există un procent de 0. o probabilitate importantă este atribuită și cazurilor k=3 . s-a dovedit a fi atinsă cu ajutorul pragului Tq ≥ 0.3 (Pritchard et al.05 la un anumit grup genetic (cluster) au fost grupați ca indivizi hibrizi între speciile corespunzătoare clusterelor cu cele mai mari procente. inclusiv exemplarele introgresive. respectiv puri din punct de vedere genetic.3.050 q ≥ 0.2. Cea mai bună diferențiere între arborii puri și cei hibrizi. Astfel. pentru care coeficientul de apartenență este cuprins în intervalul 0..875 q ≥ 0.950 Figura 4.900 q ≥ 0.075 q ≥ 0.125 q ≥ 0.9). Ulterior s-a trecut la ordonarea arborilor în funcție de coeficienții de apartenență la specii. 2000) folosește metoda Bayesiană pentru evaluarea probabilității ca genotipurile multilocus analizate provin de la un anumit număr de populații (K). S-a observat faptul că valorile medii ale eficienței și acurateței nu sunt maxime la acest prag. Prin analiza de identificare a numărului de clustere s-a observat că valoarea maximă atinsă de parametrul ΔK este în dreptul K=2.925 q ≥ 0. Hibrizii. Din această cauză.

6. pubescens. pubescens și Q. frainetto: doi arbori hibrizi între Q. Alți trei indivizi sunt hibrizi formați fără participarea majoră a speciei Q. pubescens. robur Figure 4. Pet = Q. frainetto. ROB – Q. frainetto și Q.11. Fra = Q. Pub = Q.5% 18.05 pentru hibrizi (FRA .Q.5% 3. Pet = Q.10.  30 de arbori prezintă probabilitate de hibridare (45. The ordering of the trees that are morphologically assigned to Q. frainetto și Q. PUB . frainetto 53. robur (FRA-020). petraea. Hib a – b = hybrid between the species a and b. frainetto după coeficienții de apartenență la cele 4 clustere.0% 1.2. Analiza alocării genetice a arborilor încadrați morfologic la Quercus frainetto Cei 66 de arbori încadrați după caracterele morfologice la specia Q. PET . respectiv un hibrid între Q. frainetto according to the coefficients of membership for the 4 clusters. Ordonarea arborilor încadrați morfologic la Q.Rob Hib Pet .Q. frainetto. PET .5% 1. frainetto. frainetto și Q.Q. The allocation in purebreeds or hybrids of the trees that are morphologically assigned to Q. ROB – Q. pubescens. robur.0% 1.11.2% 21. Rob = Q. Rob = Q. robur) Q. pubescens (FRA-447 și FRA-517). with the threshold q≥0. PUB . Fra = Q. petraea. frainetto.4. 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 294 315 298 286 306 314 296 303 293 295 305 433 301 307 1 290 302 288 304 289 56 511 316 318 312 309 297 317 300 299 313 287 626 55 291 311 108 568 319 78 292 308 115 310 114 223 109 283 422 53 107 102 39 320 416 450 570 631 54 52 66 425 517 443 447 20 FRA PET PUB ROB Figura 4.10. Hib a – b= hibrid între speciile a și b. cu pragul q≥0.10):  35 de indivizi au prezentat un genom specific acestui taxon.Q. pubescens și un exemplar hibrid între Q.5%) (figura 4. petraea și Q. frainetto au fost grupați la clusterul corespunzător astfel (figura 4. frainetto. dintre care 14 hibrizi sunt între Q.05 for hybrids (FRA . pubescens. 12 hibrizi sunt între Q.Q. Pub = Q. robur) Figure 4.2% Q. petraea. pubescens Hib Fra .Pub Hib Pub .Pet Hib Fra .11). frainetto species.Rob Figura 4. pubescens (arborele FRA-443). iar un arbore prezintă o probabilitate ridicată pentru clusterul Q. Repartizarea pe categorii de specii pure sau hibrizi a arborilor încadrați morfologic la specia Q.1. robur 51 .Q. petraea. petraea.Pub Hib Fra .

petraea și Q. pubescens și 31 de hibrizi între Q.2. with the threshold q≥0. Fra = Q. petraea au fost grupați pe considerente genetice astfel (figura 4. cu pragul q≥0. Rob = Q.4. robur (PET-118). Ordonarea arborilor încadrați morfologic la Q.13) dintre care 24 hibrizi sunt între Q. pubescens (PET-509). pubescens.5% 0. frainetto și Q. robur. dar la primii doi arbori există o probabilitate de apartenență la clusterul gorunului mai mare de 0.12):  109 arbori sunt goruni puri din punct de vedere genetic.Q. petraea. petraea. The ordering of the trees that are morphologically assigned to Q. Pub = Q. respectiv Q.6%) sunt posibili hibrizi (figura 4. petraea. Fra = Q. frainetto și Q.10.Q. petraea Hib Fra . fiind a treia specie ca importanță.6.05 for hybrids (FRA . 81 474 545 125 516 464 276 506 413 510 101 488 80 83 440 120 489 501 487 410 265 479 273 451 279 130 532 456 459 628 461 492 460 497 483 703 486 551 515 267 480 463 457 84 403 550 87 527 282 448 435 70 269 503 466 630 241 533 561 478 271 263 465 513 138 556 104 262 627 260 261 651 88 521 419 126 566 277 539 562 485 548 454 471 453 500 538 537 224 264 535 552 490 540 509 FRA PET PUB ROB Q. robur. De asemenea.5% 0. Analiza alocării genetice a arborilor încadrați morfologic la Quercus petraea Cei 190 de arbori încadrați după caracterele morfologice la specia Q. Pet = Q.Pub Hib Pet .12. Pub = Q. robur) Figure 4. petraea according to the coefficients of membership to the 4 clusters. petraea species.Rob Hib Pub . petraea după coeficienții de apartenență la cele 4 clustere. pubescens.3% 12. Figure 4. pubescens.Rob 16. Q.1% 12. petraea.13. PET . robur.Q.Rob 52 .05 pentru hibrizi (FRA .Pet 57.5% Hib Pet . 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Figura 4.6% Hib Fra . frainetto.38. frainetto. petraea. frainetto și Q. Repartizarea pe categorii de specii pure sau hibrizi a arborilor încadrați morfologic la specia Q.  81 de indivizi (42. robur) Figura 4. La ultimul arbore nu s-au consemnat urme genetice semnificative pentru clusterul gorunului. s-a identificat câte un individ hibrid între perechile de specii Q. pubescens.Pub Hib Fra . frainetto. Hib a – b= hibrid între speciile a și b. ROB – Q. ROB – Q. robur (PET-560). PET .Q. 23 hibrizi sunt între Q. petraea și Q. Pet = Q. The allocation in purebreeds or hybrids of the trees that are morphologically assigned to Q. PUB .4% 0.2.Q. PUB Q. pubescens și Q. frainetto. Rob = Q. petraea. Hib a – b= hybrid between the species a and b.39.

robur 53 . pubescens.  59 de arbori (50. PET . ROB – Q.15). 40.4. Pub = Q. petraea. 18 hibrizi între Q.41 The allocation in purebreeds or hybrids of the trees that are morphologically assigned to Q.0% Q. Pet = Q. petraea.6. petraea și Q.15 Repartizarea pe categorii de specii pure sau hibrizi a arborilor încadrați morfologic la specia Q. pubescens. pubescens according to the coefficients of membership to the 4 clusters.14. robur) Figure 4. pubescens Hib Fra .Q.Q.Pet Hib Pet . frainetto. frainetto și Q. robur.8% 15. pubescens.7% 0. PUB . dar stejarul pufos este doar a treia specie ca importanță din compoziția genomului.15. pubescens. pubescens este mai scăzută de 0. Fra = Q.14):  57 de indivizi au fost alocați stejarului pufos. Pet = Q.1% 1. Rob = Q. ROB – Q. frainetto. De asemenea. 100% 80% 60% 40% 20% 0% 782 76 603 32 255 234 625 29 605 62 257 643 445 31 231 57 17 637 641 28 284 228 802 635 247 251 13 105 638 4 254 74 25 30 60 600 238 75 26 16 246 237 73 253 619 618 27 59 801 634 227 5 128 587 58 19 646 111 FRA PET PUB ROB Figura 4. pubescens species. petraea.9%) au fost catalogați hibrizi (figura 4. with the threshold q≥0. pubescens. Pub = Q. Dacă la hibrizii dintre gorun și stejarul pedunculat proporția clusterului Q.Rob Figura 4. dintre care 22 între Q.Pub Hib Pub .5% 19.Q. frainetto.9% 13. frainetto și Q. Fra = Q. PET . pubescens după coeficienții de apartenență la cele 4 clustere. la arborele PUB-058 proporția acestui cluster este de 0. pubescens.Q. robur (PUB-024 și PUB-111) și un hibrid între Q. petraea. Ordonarea arborilor încadrați morfologic la Q.Q.2.Pub Hib Pet . robur Figure 4. petraea și Q.05 for hybrids (FRA .05 pentru hibrizi (FRA .Q. robur) 49. respectiv 16 între Q.3. Hib a – b = hybrid between the species a and b. PUB . frainetto.Rob Hib Fra . cu pragul q≥0. Hib a – b= hibrid între speciile a și b. Rob = Q. pubescens și Q. petraea (PUB-058). s-au identificat alte două cazuri de hibridare la care ponderea principală a hibrizilor este alocată altor specii: doi hibrizi între Q. pubescens au prezentat următoarea grupare genetică (figura 4. pubescens. Analiza alocării genetice a arborilor încadrați morfologic la Quercus pubescens Cei 116 arbori încadrați după caracterele morfologice la specia Q.05. The ordering of the trees that are morphologically assigned to Q.

Repartizarea pe categorii de specii pure sau hibrizi a arborilor încadrați morfologic la specia Q. robur. robur Hib Fra .16):  91 de arbori au fost alocați genetic speciei Q.17). frainetto.05 pentru hibrizi (FRA .Q. PET . with the threshold q≥0.Pub 0. petraea. ROB – Q.05 for hybrids (FRA . pubescens (ROB-229). robur după coeficienții de apartenență la cele 4 clustere. dintre care 7 între Q. La ultimii doi arbori. ROB – Q.1% Q. robur according to the coefficients of membership to the 4 clusters.Q. petraea și Q. cu pragul q≥0. deși stejarul pedunculat nu apare ca participant direct la hibridare. Analiza alocării genetice a arborilor încadrați morfologic la Quercus robur Cei 118 arbori încadrați după caracterele morfologice la specia Q.8% 11. PUB . robur.17. petraea. Hib a – b = hybrid between the species a and b. robur) Figure 4.  27 de indivizi (22.16 Ordonarea arborilor încadrați morfologic la Q. Rob = Q.Pet Hib Pet .Rob Hib Pub .8% 0. 14 între Q. 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 47 558 590 195 218 621 185 14 49 572 663 582 46 194 214 622 574 591 620 202 653 186 662 38 99 42 193 589 184 588 187 45 43 100 198 592 220 654 221 701 201 92 93 196 90 805 206 586 656 519 183 242 204 63 268 67 522 68 44 50 FRA PET PUB ROB Figura 4.Q. robur) 77. robur. Pub = Q. Hib a – b= hibrid între speciile a și b. PUB . robur species. The allocation in purebreeds or hybrids of the trees that are morphologically assigned to Q. frainetto. Fra = Q. Fra = Q. Figure 4.162. 6 hibrizi între Q. robur. petraea și Q.9%) au fost catalogați hibrizi (figura 4. Rob = Q. robur. PET .2.43. pubescens. pubescens. respectiv 0.4. frainetto și Q. frainetto și Q. Pub = Q. pubescens. există o probabilitate semnificativă (0. robur.Q.Q. robur și câte un exemplar hibrid între Q.9% 5. robur. petraea (ROB-050). pubescens și Q.9% Figura 4.Q.1% 5. petraea.4. Pet = Q. respectiv Q. frainetto. Pet = Q. petraea.Rob Hib Pet .42 The ordering of the trees that are morphologically assigned to Q. 54 .152) ca arborii să aparțină clusterului Q. robur au prezentat următoarea grupare genetică (figura 4.6. pubescens. frainetto.Rob Hib Fra .

pubescens și Q. s-au identificat 293 de exemplare care prezintă un genotip caracteristic unei anumite specii. dacă se dorește evaluarea nivelului hibridării între perechile de specii. cu aceste informații genetice. Astfel. 292 (99. petraea. frainetto. (2012) au identificat un nivel al hibridării de 20. Tabelul 4. frainetto și Q. robur Numărul arborilor alocați genetic la alte specii comparativ cu încadrarea morfologică În suprafața de cercetare. pubescens Q. se extrage procentul hibrizilor din eșantionul arborilor alocați genetic la perechea de specii constituente (tabelul 4. folosind datele din tabelul 4. pubescens (22.11. frainetto Q.6. Viscosi et al.4.12).5%. robur.11. Q. petraea Q.12) între toate cele patru specii de cvercinee din complexul Bejan-Deva. petraea. Mărimea eșantioanelor celor patru specii de cvercinee analizate este raportată în tabelul 4. cu ajutorul markerilor moleculari. există rate de hibridare între 4.5%. Deoarece în acest studiu dispunem de constituția genetică a genomului la 13 markeri moleculari pentru fiecare individ analizat. frainetto și Q.5%). Dintre acești arbori. petraea Q. robur 1 1 0 56 58 4 4 3 181 192 5 2 2 108 117 1 6 3 115 125 10 9 8 5 32 Q. în timp ce un individ a fost alocat genetic unei alte specii. robur) și 20. au fost identificați 199 de hibrizi (tabelul 4. Pentru a evalua hibridarea naturală între perechile de specii analizate trebuie determinate eșantioanele efective ale acestora.2.11. pubescens și 35 de exemplare de Q. într-un arboret din Italia alcătuit din speciile Q. în care proporția hibrizilor a variat între 19. The size of the samples that are genetically determined for each oaks species Clusterul genetic Total Q. pubescens Q. fiecare arbore este alocat acelui taxon pentru care există cea mai mare proporție din clusterul genetic.1 și 30. 91 de arbori Q. frainetto Q.0% (Q. pubescens). se poate calcula mărimea eșantionului unei specii pe criterii genetice.5 Concluzii privind analiza alocării genetice a arborilor din Pădurea Bejan Din cei 492 de arbori din complexul mixt Bejan-Deva. La nivelul suprafeței de cercetare intensivă cei mai mulți hibrizi s-au observat între speciile Q. petraea și Q. Mărimea eșantioanelor determinate genetic pentru fiecare specie de stejari Table 4.4% din totalul arborilor analizați. analizați cu ajutorul setului de 13 markeri moleculari. frainetto și Q. (2009) în trei arborete mixte de cvercinee din Franța. De asemenea. ceea ce reprezintă un procent de 40. se poate calcula structura pe specii a arborilor puri genetic în suprafața de cercetare intensivă: 109 arbori Q. 58 de exemplare Q.7%) au corespuns speciei la care au fost încadrați prin caracterele morfologice.9% (Q.11. robur (4. frainetto.1% din totalul hibrizilor) iar cei mai puțini între Q. Astfel. Această valoare este puțin superioară celor comunicate de Lepais et al. Astfel. 55 . Totuși.

18 Proporția de participare a speciilor pure și a perechilor de hibrizi în suprafața de cercetare Bejan -Deva. 6. frainetto Q. Pet = Q. 23. (2009).9 44 22. Pet = Q. Rob = Q. Figure 4. pubescens Q.1% Q. The percentage of participation of purebreeds and hybrid pairs in Bejan – Deva study area.Rob Hib Pub .1 250 16.6 317 12. petraea.5% 7. iar celelalte două specii. Proporția hibrizilor în arboret și între specii Table 4. pubescens și 11. petraea Q.3 32 16. pubescens (28%).12. frainetto sunt mai bine reprezentate la formarea hibrizilor decât s-ar fi așteptat din abundența lor în arboret. robur Q.9% 1. frainetto.Hibrizi observați între speciile Q. Hib a – b= hibrid între speciile a și b.1% 18. pubescens și Q. Fra = Q.9% 8. pubescens. formează hibrizi într-o proporție mai scăzută decât procentul de participare în arboret. Q. petraea (31%) și Q. Deoarece arborii maturi eșantionați au coordonatele geografice cunoscute. frainetto x Q. cu ajutorul datelor genetice s-a realizat o identificare a arborilor puri și a hibrizilor dintre cele patru specii de cvercinee.8% 7.18. Pub = Q. în care speciile rare tind să fie mai bine reprezentate între hibrizi. Acest mecanism al hibridării. Hib a – b= hybrid between the species a and b. s-a realizat o hartă care a înglobat proporția de participare a fiecărei specii în genomul acestor arbori (figura 4. Din compararea acestor date cu proporțiile de participare ale speciilor la formarea hibrizilor se pot trage următoarele concluzii: cele mai reprezentative specii din arboret. robur.Rob Hib Pet .0 9 4. robur (20%). frainetto x Q.2 39 19.Pet Hib Fra . cei mai puțin implicați taxoni fiind Q.18. petraea Q. robur Total Tabelul 4. pubescens Q. frainetto. The percentage of hybrids in stand and between species Mărimea Proporția Hibrizi sau Proporția hibrizilor eșantionului celor hibrizilor în indivizi în funcție de clasa două specii eșantionul celor introgresivi hibridă (%) determinate pe două specii criterii genetice parentale (%) 40 20. pubescens.5 183 4.8% 22. robur 56 . În concluzie. robur Hib Fra . Q.8% Q.Pub Hib Fra .2% 7. pubescens x Q. Fra = Q.2 199 100 Speciile cu cea mai mare pondere de participare la formarea hibrizilor sunt Q.Pub Hib Pet . robur Q. frainetto (21%) și Q. petrea x Q.1 242 13.1 309 14.5% 11. Rob = Q. petraea. robur. pe baza genotipurilor multilocus și a programului STRUCTURE se observă următoarele procente ale abundenței relative a speciilor în fitocenoza studiată: 39% Q. petraea și Q. a fost observat și de către Lepais et al.19).0 35 17. frainetto. pubescens Q. petraea.1% 8. frainetto x Q.8% Q. robur.4% Q. 25.6 175 20. ale căror proporții de apariție în suprafața de cercetare sunt afișate în figura 4. Pub = Q.12. Totuși. petraea x Q.Rob Figura 4.

6. corespunzătoare speciilor parentale Figure 4. Identificarea arborilor donatori de polen Cu ajutorul genotipurilor la 10 loci microsatelitici a arborilor maturi și a programului Cervus 3. Compararea analizei de grupare a indivizilor la specii în două studii diferite Deoarece în Pădurea Bejan au fost analizați genetic.3. de către Curtu et al. Distribuția spațială a arborilor eșantionați în Rezervația naturală Bejan-Deva. Totuși.30m. 2007) s-a încercat identificarea arborilor donatori de polen pentru cele 313 ghinde recoltate de la 15 arbori din suprafața de cercetare intensivă din rezervația naturală Bejan-Deva. Compararea celor două seturi de date prin analiza genetică a relevat o rezoluție mai bună a programului de alocare a arborilor potențiali hibrizi o dată cu creșterea numărului de loci analizați în studiul de față. corresponding to the parental species 4. sub coroana arborilor mamă.2.Figura 4.46. Purebreeds are represented in only one colour and hybrids are represented by at least two colours. (2007b). Each tree is represented by a circle that is proportional with the diameter of the trunk at the hight of 1.30 m.0 (Kalinowski et al. iar arborii hibrizi prezintă cel puțin două culori. Estimarea fluxului genic actual prin analize de paternitate 4. s-a putut evalua gradul de convergență al rezultatelor obținute cu cele două seturi de date moleculare.6. 268 de arbori comuni cu cei din acest studiu. Deoarece ghindele au fost recoltate de la suprafața solului. o altă cauză a diferenței dintre cele două studii este dată de utilizarea unor praguri diferite pentru alocarea genetică în cele două studii. Spatial distribution of sampled trees in the natural reservation Bejan-Deva. Arborii puri sunt reprezentați de o singură culoare. 4.3.1.19. s-au identificat câteva cazuri în care alți arbori din imediata vecinătate sunt 57 . Fiecare arbore este reprezentat de un cerc proporțional cu diametrul trunchiului la înălțimea de 1.. cu ajutorul a șase microsateliți.

Astfel.20. la ghindele recoltate de sub coroana arborelui 223 s-au identificat încă doi arbori-mamă (224 și 539). deci fluxul genic din afara acestei suprafețe este mai ridicat decât la cele două cercetări din Pădurea 58 .4% polen provenit din exteriorul ariei determinată de cei 269 de arbori adulți eșantionați. la arborii-mamă 14. Acești arbori au polenizat 140 din cele 304 ghinde analizate (46. pentru cele 304 ghinde rămase s-a rulat programul CERVUS și s-au analizat cei 492 de arbori maturi ca potențiali arbori donatori de polen.9%. Astfel. Astfel. Totuși. Această valoare este puțin mai mare decât cea raportată de Curtu et al. 40 și 558 există un total de nouă ghinde la care nu s-a raportat un arbore-mamă din suprafața de cercetare. sau identificat 167 ghinde (26. ale căror grosime este proporțională cu numărul de ghinde fecundate Figure 4. (2009) în aceeași rezervație naturală. The provenience of the pollen grains that fertilized the eggs of the tree 487. Proveniența grăunciorilor de polen care au fecundat ovulele arborelui 487. The trajectory of the pollen grain is represented by black lines that have the thickness proportional with the number of the fertilized acorns La cei 19 arbori-mamă s-au identificat 80 de arbori donatori de polen diferiți din suprafața de cercetare intensivă (16%). Un exemplu de polenizare al unui arbore-mamă este redat în figura 4. Într-un studiu recent la care s-au utilizat analizele de paternitate într-un arboret cu patru specii de stejari albi (Lepais și Gerber. pentru toți arborii-mamă. Din această cauză aceste ghinde s-au eliminat din eșantionul pentru analizele de paternitate. Traiectoria grăunciorilor de polen este redată de linii negre. Figura 4. care la 8 arbori-mamă și un total de 320 de ghinde au raportat o proporție de 48.1%). 2011).20.20.adevărații arbori-mamă pentru ghinde. la arborele 81 trei ghinde cu arborele-mamă 82 iar la arborele 102 s-au identificat 11 ghinde cu arborele-mamă 104.1%) cu ambii părinți din interiorul suprafeței de cercetare. proporția ghindelor polenizate cu polen provenit din afara suprafeței de cercetare este de 53.

la aproximativ 380 m de marginea estică a perimetrului suprafeței de cercetare. 8 s-au observat la câte doi arbori seminceri. Majoritatea arborilor donatori de polen identificați în suprafața de cercetare (68. (2009) au relatat că distanța medie dintre arborii-mamă și polenizatorii identificați a fost de 57 m. Jensen et al. În schimb.5 ha. Lepais și Gerber. iar restul arborilor (15%) au polenizat între 3 și 11 ghinde din cele analizate.2. petraea) și 232 (Q. cât și pe cel de arbore donator de polen. robur și Q. În schimb. 2009. iar arborii 226 (Q.. de 283 m. 2011). petraea (Streiff et al. din cei 10 arbori donatori de polen care au polenizat mai mulți arbori-mamă. În anul recoltării celor 304 ghinde eșantionate (2012) s-au identificat 93 de cazuri de polenizare în suprafața de cercetare.3. respectiv 23-27% la stejarul pedunculat. Majoritatea arborilor donatori de polen (87. Jensen et al. La un arboret compus din aceleași două specii. într-un arboret alcătuit din Q. 2009. O distanță medie mult mai mare. Distanța medie a dispersiei polenului în interiorul suprafeței de cercetare este redată în tabelul 4. În interiorul perimetrului determinat de arborii eșantionați.. Astfel. a fost raportată recent de Chybicki și Burczyk (2013) într-un arboret regenerat artificial în Polonia. petraea. distanța medie de 59 . localizat în Danemarca. În literatura de specialitate s-au comunicat valori destul de diverse ale dispersiei polenului speciilor de cvercinee. iar diagonala pe direcția NV – SE are lungimea de 330 m. Interesant este faptul că 7 din arborii eșantionați au jucat atât rolul de arbore-mamă. Pentru toate cazurile de polenizare identificate.. Într-un arboret din Spania.13 pentru fiecare arbore-mamă. Valorile medii observate au variat considerabil între arborii-mamă. 1999). (2009) au comunicat o proporție scăzută a polenului provenit din exteriorul suprafeței cercetate: 11-13% la gorun. 4.9% au polenizat mai mult de două ghinde. 16. iar din această cauză se așteaptă ca polenul să parcurgă distanțe mari. robur.5%) au polenizat un singur arbore-mamă.8%) au polenizat o singură ghindă. între 10 și 260 m.2% au polenizat două ghinde. frainetto) au polenizat 3. respectiv între 22 – 58 m la arborii de Q. doar 11. suprafața de cercetare în care sunt localizați 490 de arbori eșantionați are aproximativ 8. diagonala pe direcția SV – NE are lungimea de 505 m. Dispersia polenului Speciile din genul Quercus sunt anemofile. iar 2 arbori sunt situați la liziera arboret ului. spre deosebire de alte studii la cvercinee unde s-a raportat (Curtu et al. În acest studiu. pentru stejarii europeni. distanțele au variat între 18 – 64 m la arborii de Q. Jensen et al. distanța medie a dispersiei polenului în suprafața de cercetare este de 71 m. petraea x Q. Lepais și Gerber (2011) au comunicat că din cei 126 de arbori-tată identificați din suprafața analizată. respectiv 4 arbori-mamă. Astfel. dar situat în Danemarca. dar la nici unul nu s-a consemnat autofecundarea.Bejan.

4.5 558 Rob 1 260 260.5 La specia cu cel mai întins areal european (Q.0 10 94. robur) s-a studiat fluxul genic pentru două populații marginale cu origine străveche (relicte). c – mother-tree identified in the acorns from under the crown of the tree 102 Numărul Intervalul Distanța minimă Proporția Distanța Abaterea Apartenenarborilor de variație a dispersiei polenului Arbomedie a standard a ța donatori de al polenului din din exterireledispersiei dispersiei arboreluipolen din dispersiei exteriorul orul suprafemamă polenului polenului mamă suprafața de polenului suprafeței de ței de cerce(m) (m) cercetare (m) cercetare (m) tare (%) 487 Pet 10 12 – 60 25.8 81 Pet 10 6 .5 615 Pub 3 11 – 108 63. frainetto. transportul pe distanțe mari al polenului contribuie la menținerea unei diversități genetice ridicate. petraea. Fra – Q.9 15 Pet x Pub 3 29 – 51 39.4 75 33. robur.9 69.4 223 Fra x Pub 5 8 – 101 38. În funcție de apartenența arborelui-mamă.0 238 Pet x Pub 4 8 .0 102 Fra x Pub 1 34 34.199 84.0 805 Rob 7 21 – 123 54.0 224b Pet x Rob 2 9 . Astfel.0 118 Fra x Rob 6 124 – 281 191. Pet – Q.polenizare a fost de 92 m pentru Q.0 40 Rob 4 12 – 22 15. 2005).0 1.2 66 54. Tabelul 4.5 0. robur.8 75 36.4 32 37. Dispersia polenului în suprafața de cercetare studiată.3 556 Pet x Rob 7 14 – 110 65.0 14 Rob 11 52 – 190 117.5 10 81.9 49. pyrenaica (ValbuenaCarabana et al.1 94 70.125 48. Rob – Q. situate în estul Munților Ural la o distanță de aproximativ 80 km de arealul continuu al speciei.5 38. b – mother-tree identified in the acorns from under the crown of the tree 223.7 64 33. b – arbore-mamă identificat în ghindele de sub coroana arborelui 223.4 94 50. dar și cu cel al alocării genetice a arborilor adulți la specii sau categorii hibride (subcapitolul 4.5 47 75.3 47 56.0 28 61.6).6 36. Fra – Q.23 20. se poate determina direct tipul de eveniment reproductiv dintre participanții la încrucișare.4 5.0 84 25.3 11.0 20 56. Rob – Q..5 12.6 79. Pollen dispersal in the study area.71 68. a – arbore-mamă identificat în ghindele de sub coroana arborelui 81.4 30.4 5.11 10.8 50.8 57. Pet – Q.13.0 66 50. Pub – Q. pubescens.3. petraea.13.3 804 Pub 4 23 – 96 51. petraea. se pot defini următoarele tipuri de evenimente reproductive: 60 .3. Pub – Q.5 517 Pet x Pub 8 21 .8 60 23.7 10 62. c – arbore-mamă identificat în ghindele de sub coroana arborelui 102 Table 4. Analiza încrucișărilor din suprafața de cercetare Cu ajutorul analizelor de paternitate efectuate asupra ghindelor eșantionate s-au determinat arborii din suprafața de cercetare care au polenizat arborii-mamă.8 82a Pet 2 66 . Analizele au indicat faptul că cel puțin 35% din polenizările reușite provin de la arbori situați la mai mult de 80 km depărtare.3 35. Cu ajutorul acestor informații. frainetto.6 25. a – mother-tree identified in the acorns from under the crown of the tree 81.0 43 20. chiar și în populațiile izolate.0 104c Pet x Pub 4 6 – 214 82. respectiv 270 m la Q. pubescens.2.

o trihibridare: arborele donator de polen este un hibrid între două specii diferite de cea a arborelui-mamă. arbore-mamă hibrid între speciile a și b: o hibridare de generația a II-a (F2): părinții sunt din aceeași categorie hibridă. Curtu et al. însumând procentele anterioare se observă o preferință a arborilor-mamă hibrizi (69%) pentru polenul provenit de la arbori care au în comun una sau ambele specii parentale ale acestora. alocați uneia dintre speciile parentale ale arborelui-mamă.4%). de cercetare este raportată în tabelul 4. Încrucișările între hibrizi de același tip genetic dețin o pondere de 31%. o retroîncrucișare: arborele donator de polen este alocat uneia dintre speciile a sau b. dintre care una este comună cu a arborelui-mamă.5% pentru arborii-mamă puri. Arborii-mamă alocați speciilor pure sunt în principal fertilizați de polenul provenit de la arbori conspecifici: 71% din evenimentele reproductive identificate la acești indivizi sunt încrucișări intraspecifice. Astfel. unde la cei 6 arbori seminceri au predominat încrucișările intraspecifice (63%). alocat unei specii c.6%). o trihibridare: arborele donator de polen este fie un arbore pur. (2009) au comunicat o proporție a încrucișărilor intraspecifice de 64%. o hibridare de generația I (F1): părinții aparțin la două specii diferite. c și d). hibridările între arbori puri din punct de vedere genetic sunt relativ rare (8. În ceea ce privește încrucișările la care au fost implicați arborii-mamă hibrizi. Totuși. există o proporție 61 . Caracterizarea directă pentru cele 140 de cazuri de încrucișări din interiorul suprafeței 2.14. O proporție mai scăzută este corespunzătoare hibridărilor din generația I (F1). o tetrahibridare: arborele donator de polen este un hibrid între două specii diferite de cele ale arborelui-mamă (de ex. Încrucișările de tipul trihibridărilor sunt rare și reprezintă doar 2. o retroîncrucișare: arborele donator de polen este un hibrid între două specii. arbore-mamă pur din punct de vedere genetic: o încrucișare intraspecifică: părinții aparțin aceleiași specii. cea mai mare proporție s-a observat pentru retroîncrucișări (38%). urmate de retroîncrucișări (23%) și hibridări F1 (9%).1. ceea ce denotă o afinitate pentru polenul arborilor puri. Într-o suprafață de cercetare situată în aceeași Pădure Bejan. Totuși. fie un arbore hibrid între speciile a sau b și o altă specie (de ex. c). De asemenea. deoarece există doar 6 cazuri de încrucișare între specii pure diferite (7. retroîncrucișările sunt frecvente deoarece 19% din polenul primit de acești arbori-mamă provine de la indivizi hibrizi al căror genom conține o pondere pentru specia comună cu arborele semincer. rata hibridării la generația ghindelor fiind 36%. O situație asemănătoare pentru arbori-mamă puri genetic a fost relatată într-un studiu recent de Lepais și Gerber (2011).

frainetto. c . b . pentru cei 18 arbori-mamă. Reproductive event: Intrasp= intraspecific mating.arbore mamă identificat în ghindele de sub coroana arborelui 102.6 0. b – mother tree identified in the acorns from under the crown of the tree 102.arbore mamă identificat în ghindele de sub coroana arborelui 223.0 4. Eveniment reproductiv: Intrasp= încrucișare intraspecifică.importantă (28%) a încrucișărilor care imprimă o informație genetică de la trei specii diferite (trihibridare). a – mother-tree identified in the acorns from under the crown of the tree 81. pubescens.3 13. Rezultate relativ diferite au fost comunicate de Lepais și Gerber (2011) la 10 arbori-mamă hibrizi. Fra – Q.0 2. Pet – Q.7 27.14.5 0 223 Fra x Pub 5 16 0 0 11 1 2 2 102 Fra x Pub 1 3 0 0 3 0 0 0 118 Fra x Rob 6 6 0 0 0 6 0 0 238 Pet x Pub 4 9 0 0 0 3 6 0 104c Pet x Pub 4 5 0 0 0 5 0 0 517 Pet x Pub 8 8 0 0 1 2 5 0 15 Pet x Pub 3 3 0 0 1 1 1 0 556 Pet x Rob 7 9 0 0 2 5 2 0 b 224 Pet x Rob 2 2 0 0 1 0 1 0 Total 61 0 0 19 23 17 2 Hibrizi % 0. a – arbore-mamă identificat în ghindele de sub coroana arborelui 81.9 3. robur. indică faptul că cele mai multe încrucișări sau realizat între arbori conspecifici (40%). Bc= retro -încrucișare.0 0. F1= hybridisation from the first generation. Tipuri de evenimente reproductive identificate în suprafața de cercetare. Table 4. respectiv 19%). Bc= backcrossing. Types of reproductive events identified in the study area. Trihib= trihybridisation.6 27. Pub – Q.4 Totalul global. frainetto.9 7.0 31.1 37. Tetrahib= tetrahibridare. Tetrahib= tetrahybridisation. F2= hibridare din a doua generație. petraea. F2= hybridisation from the second generation. în timp ce tetrahibridările sunt puțin importante (3%). O proporție importantă este observată pentru retroîncrucișări (27%). deoarece proporția retroîncrucișărilor este mult mai mare (68%) iar evenimentele de tipul hibridării F2 și trihibridărilor sunt mai puțin frecvente (13%.0 19. Pub – Q. robur. Rob – Q. F1= hibridare din prima gnerație. Fra – Q. Trihib= trihibridare. Tabelul 4. pubescens.3 Total global 140 56 6 19 38 19 2 % 40. petraea. iar încrucișările mai complexe (hibridare de ordinul 2 și trihibridare) 62 .14. Rob – Q.6 1.1 13. Evenimentul reproductiv AparteNumărul arborilor Numărul Arborele nența donatori de polen ghindelor cu Tri Tetra Intrasp F1 F2 Bc -mamă arboreluidin suprafața de ambii părinți hib hib mamă cercetare identificați 487 Pet 10 19 16 0 0 3 0 0 81 Pet 10 16 12 1 0 3 0 0 82a Pet 2 2 2 0 0 0 0 0 804 Pub 4 5 0 0 0 5 0 0 615 Pub 3 4 3 0 0 1 0 0 14 Rob 11 11 4 5 0 0 2 0 805 Rob 7 11 8 0 0 3 0 0 40 Rob 4 10 10 0 0 0 0 0 558 Rob 1 1 1 0 0 0 0 0 Total 79 56 6 0 15 2 0 Specii pure % 70. Pet – Q.

) și III (26 apr. iar tetrahibridările sunt cele mai rar întâlnite (1%). 2009. încadrarea fenologică a încrucișărilor analizate poate fi influențată de delimitarea celor trei intervale ale fenofazei deschiderea mugurilor foliari. Rezultatele analizei au relevat că 62. – 29 apr. – 9 apr. – 14 apr.). deoarece observațiile fenologice ale înfloririi sunt limitate la un număr redus de arbori.) și III (18 apr. acestea pot fi deosebit de importante deoarece ne pot indica decalajul în zile calendaristice dintre arborii-mamă și cei donatori de polen. Rezultate similare au fost comunicate în alte studii (Salvini et al. Trebuie menționat faptul că intervalele în care a avut loc deschiderea mugurilor foliari s-au împărțit în trei intervale de timp egale.3.).dețin o pondere de aproximativ 14% fiecare. s-au realizat încrucișări între indivizi cu diferențe ale debutului acestei fenofaze de 9 sau 10 zile. ceea ce confirmă faptul că produc polen viabil. 63 . II (15 apr. 4. 2011) privind viabilitatea polenului și proporția de germinare a hibrizilor din complexul de stejari albi europeni.). se poate presupune că în acel an procentul arborilor donatori de polen aflați în aceeași categorie fenologică cu arboriimamă este mai mare.). II (10 apr. Astfel. după cum urmează: o anul 2011 (22 zile): I (3 apr. Totuși. Sinteză comparativă a analizelor de paternitate și a datelor fenologice Deoarece în acest studiu dispunem de date fenologice ale deschiderii mugurilor și ale înfloririi. se poate realiza o comparație a acestora pentru a determina în ce clase fenologice se găsesc arborii parentali.4. – 17 apr. încrucișările între specii pure (F1) dețin o pondere limitată (4%). Totuși.).8% pentru acești arbori. – 21 apr. o anul 2013 (12 zile): I (18 apr. II (22 apr. o anul 2012 (27 zile): I (6 apr. – 25 apr. – 24 apr. Lepais și Gerber. – 23 apr. Pe de altă parte. Deoarece ghindele utilizate la analizele de paternitate s-au recoltat din arboret în anul 2012. s-au utilizat doar informațiile fenologice provenite de la studiul deschiderii mugurilor foliari cu scopul de a estima procentul suprapunerilor intervalelor fenologice.) și III (24 apr. Totuși. dar și de analize de paternitate ale ghindelor și date ale apartenenței genetice ale arborilor parentali. aceste observații confirmă corelația semnificativă dintre fenofazele deschiderea mugurilor foliari și înflorire (subcapitolul 4. Din această cercetare se poate observa că în Pădurea Bejan arborii hibrizi sunt polenizatori de succes. Chiar dacă datele fenologice pentru anul 2012 sunt mai reduse.2% din arborii care au participat la polenizare sunt din aceeași categorie fenologică cu arborele-mamă în cei trei ani în care s-au realizat observațiile fenologice.1) și indică o comasare a intervalului înfloririi. analiza pentru anul 2012 a indicat un procen t de 60. – 2 mai).. Cu toate că la majoritatea arborilor polenizatori s-a observat debutul deschiderii mugurilor foliari în zile apropiate de cele observate la arborii-mamă.

5.1. dar mai ales prezintă utilitate pentru aprecierea nivelului de suprapunere a fenofazei de înflorire la nivelul metapopulației analizate. Concluzii rezultate din efectuarea observațiilor fenologice  Referitor la obiectivul 1 . deoarece dinamica înfloririi este mult mai accentuată și poate fi influențată mult mai mult decât înfrunzirea de condițiile climatice specifice din ani consecutivi.  Deoarece intervalele în care a avut loc înflorirea celor patru specii de cvercinee analizate în rezervația naturală Bejan-Deva se suprapun. condițiile climatice dintr-un anumit an pot determina creșterea posibilității hibridării prin suprapunerea perioadelor de înflorire. pentru aceste patru specii de cvercinee din Pădurea Bejan.  Observațiile efectuate pentru cele două fenofaze în ani consecutivi indică o mai puternică corelație a categoriilor fenologice referitoare la deschiderea mugurilor foliari. coroborate cu faptul că acesta se află în zona studiată la limita inferioară a arealului altitudinal.  Corelația existentă între deschiderea mugurilor foliari și înflorire. Astfel. 64 . Concluzii finale 5. comportament explicabil prin cerințele ecologice față de temperatură ale gorunului. permite desemnarea cu suficientă acuratețe a categoriei fenologice de înflorire (care este dificil de evaluat direct) prin intermediul observațiilor privind deschiderea mugurilor.1. ca atare. există premisele necesare realizării acestui fenomen.  Observațiile fenologice au subliniat dependența fenofazelor deschiderea mugurilor foliari și înflorire de temperaturile ridicate din timpul primăverii. petraea prezintă un avans temporal față de celelalte trei specii simpatrice. deși este de intensitate medie. înseamnă că nu există bariere prezigotice pentru împiedicarea fenomenului de hibridare naturală și.1. CONCLUZII FINALE. CONTRIBUȚII ORIGINALE.evaluarea fenologiei deschiderii mugurilor foliari și înfloririi într-un arboret mixt de stejari albi:  În cei trei ani consecutivi ai observațiilor asupra deschiderii mugurilor foliari s-a remarcat că specia Q. DISEMINAREA REZULTATELOR. DIRECȚII VIITOARE DE CERCETARE 5. Astfel. fenologia nu deține un rol semnificativ în izolarea reproductivă.

robur și cele mai mici între Q. frainetto și Q.1. utilizat în premieră pentru a diferenția patru specii diferite din cadrul genului Quercus. ceea ce indică faptul că nu există bariere reproductive stricte între cele patru specii de cvercinee. în cadrul programului STRUCTURE. robur.4%) se află la limita superioară observată în diferite studii genetice la speciile din genul Quercus. a fost determinat statistic prin evaluarea performanței setului de markeri moleculari într-un scenariu de hibridare artificială.și interspecifică. aceste rezultate trebuie interpretate cu atenție deoarece eșantioanele speciilor conțin și indivizi hibrizi. subgenul Lepidobalanus. S-a utilizat criteriul genetic pentru identificarea speciilor.  S-a observat existența unei corelații între numărul de hibrizi și intensitatea diferențierii interspecifice. așadar nu s-a recurs la nici o altă informație în afara genotipului arborilor. deoarece cei mai mulți hibrizi se observă între Q.  Prin analize comparative s-a observat că o utilizare a unui set de microsateliți cu un nivel mai ridicat de diferențiere interspecifică produce o identificare mai detaliată a indivizilor cu urme mai fine de introgresie în genotipul lor. frainetto și Q.  Proporția hibrizilor în eșantionul studiat (40.  S-a consemnat o variație a tipurilor de hibrizi dependentă de participarea mai intensă la încrucișările interspecifice a taxonilor mai puțin abundenți în zona studiată.  Pragul optim de diferențiere a speciilor pure de indivizii proveniți din hibridări. pubescens.  S-au identificat cele mai mari diferențe genetice între speciile Q.estimarea diversității și diferențierii genetice în interiorul și între speciile de cvercinee și identificarea hibrizilor interspecifici pentru arborii maturi din arboret:  În această cercetare de evaluare a hibrizilor într-o fitocenoză forestieră cu patru specii de cvercinee cu potențial ridicat de hibridare s-a folosit un set de markeri moleculari caracterizați printr-un nivel ridicat de variație genetică intra. frainetto și Q. Dintre acești markeri se remarcă locusul funcțional DHN3.2 Concluzii rezultate din evaluarea hibridării arborilor maturi  Referitor la obiectivul 2 .  S-a reușit identificarea unor hibrizi sau indivizi introgresivi între toate combinațiile posibile de specii. 65 . Totuși.  În suprafața de cercetare intensivă din Pădurea Bejan majoritatea arborilor care au fost încadrați genetic la specii pure au respectat clasificarea pe criterii morfologice.5. pubescens iar cei mai puțini între Q. frainetto și Q. Acest comportament sugerează faptul că rezultatul hibridării naturale este influențat de condițiile locale. ceea ce demonstrează că hibridarea este un fenomen frecvent în rezervația naturală studiată.

estimarea fluxului genic actual cu ajutorul analizelor de paternitate:  Fluxul genic actual.  Pentru lotul de ghinde eșantionate s-a identificat o proporție importantă a arborilor donatori de polen din suprafața de cercetare și s-a confirmat polenizarea pe distanțe relativ mari (circa 71 m) a arborilor-mamă din Pădurea Bejan. Concluzii rezultate din evaluarea fluxului genic actual  Referitor la obiectivul 3 . S-a estimat faptul că la nivelul suprafeței de cercetare cele mai frecvente evenimente reproductive sunt încrucișările intraspecifice. dinamică observată în general la speciile de cvercinee.3. Astfel. s-a realizat o analiză de paternitate pentru a aloca fiecărei ghinde un tată compatibil din punct de vedere genetic. o dată formați. alocați genetic unei specii sau unei categorii hibride. urmate de retroîncrucișări.  În suprafața de cercetare hibridările F1 (între două specii parentale diferite. ceea ce demonstrează menținerea parțială a barierelor reproducătoare la acești arbori. Totuși. care poate indica prezența fenomenului de hibridare într-o anumită suprafață cercetată.5.  În concordanță cu rezultate anterioare care au arătat că hibrizii nu sunt limitați la prima generație. 66 . Proporții importante sunt observate și la hibridările mai complexe (hibridări F2 și trihibridări). vor constitui sursa de menținere a efectivului arborilor hibrizi din arboret. cercetările din această teză confirmă fertilitatea hibrizilor din complexul de cvercinee analizat. Arborii-mamă hibrizi preferă polenul provenit de la speciile parentale sau de la hibrizi de același tip. a fost estimat prin analiza genotipică a ghindelor recoltate de sub coroana arborilor-mamă. acești hibrizi. s-a putut creiona o imagine instantanee de ansamblu a comportamentului de reproducere a unui număr limitat de stejari.  Pe baza analizelor de alocare genetică a arborilor la specii sau hibrizi și a analizelor de paternitate s-au determinat direct tipurile de evenimente reproductive dintre participanții la încrucișare.  Cunoscând genotipurile tuturor stejarilor eșantionați în suprafața de cercetare. Totuși. o proporție importantă (54%) a polenului a provenit din exteriorul suprafeței de cercetare. pure genetic) sunt puțin frecvente (5%).1.  Raportarea analizelor de paternitate la observațiile fenologice în ani consecutivi de observații a indicat că o proporție importantă (aproximativ 2/3) din participanții la încrucișare se află în aceeași categorie fenologică.

al cvercineelor din România. provenit dintr-o porțiune informativă a genomului stejarilor.. în vederea reducerii costurilor de analiză genetică. eficientă și cu costuri reduse. alocarea genetică și identificarea hibrizilor dintr-o fitoceneză forestieră cu patru specii de cvercinee simpatrice. S-a prezentat o metodă simplă.. I. 7. Şofletea. 1: 275282. 5. S-au calculat corelațiile multianuale dintre fenofazele deschiderea mugurilor foliari și înflorire și s-a determinat relevanța utilizării primei fenofaze. I. pentru realizarea analizelor de paternitate ale cvercineelor. Caracterul de noutate al cercetărilor în această direcție rezultă și din corelarea datelor fenologice cu cele climatice de mare precizie preluate din fitocenoza studiată cu un senzor de temperatură și umiditate. Vol. and Q. S-a utilizat în premieră markerul molecular DHN3. 2. cu utilitate pentru etapele viitoare de cercetare. Nr. N.M.C. Moldovan.2. 3. Curtu. prin care se analizează implicațiile fenofazelor de primăvară asupra realizării hibridării naturale. 1. S-au realizat optimizări metodologice pentru markerii moleculari utilizați. S-a realizat în premieră o sinteză comparativă între analizele de paternitate și datele fenologice. care este mai ușor de evaluat. Notulae Botanicae Horti Agrobotanici Cluj-Napoca. in Romania. Contribuții originale S-a realizat primul studiu fenologic la scară redusă. C. 5.L. pubescens Willd. S-a constituit banca de ADN pentru 492 de arbori maturi şi 313 ghinde recoltate din suprafaţa de cercetare localizată în rezervaţia naturală Bejan-Deva.. pentru estimarea înfloririi.5. bazată pe două reacții de polimerizare în lanț de tip multiplex. Lucrari publicate în reviste ISI: 1. Enescu.. Crăciunesc. 6. care a devenit astfel o bază de date cu ridicat nivel de investigare genetică din România. pentru diferențierea. 39. în ani consecutivi de observații. 4. într-o suprafață intensivă conspecifică.3. fiind utilizate de asemenea și analizele de alocare genetică pentru arborii participanți la încrucișări în suprafața de cercetare. Diseminarea rezultatelor A. A. 2011: Genetic Differentiation between Quercus frainetto Ten.. 67 .

Întrucât în viitorul apropiat datele privind genomul cvercineelor vor deveni tot mai accesibile. natural oak forest of Romania. Brașov. (prezentare): Structura fenologică de primăvară în complexul de cvercinee Bejan-Deva și implicațiile acesteia în producerea hibridărilor interspecifice. M. Revista Pădurilor anul 126. 2.) in Prejmer Natural Reserve. ar fi utilă testarea comportării descendenților hibrizi în cultură/culturi instalate în condiții de mediu uniforme.B. A.L. E. Crăciunesc.L.. Conferința Biennial International Symposium Forest and Sustainable Development.L.. Academia de Științe Agricole și Silvice “Gheorghe IonescuȘișești”.4.L. N. 2. Crăciunesc. Ciocîrlan. I.C. I.. Proceedings of the Biennial International Symposium. 19-20th October 2012: 51-56. Curtu. 1: 6-11. Nr. 68 .. Braşov... A... N. A. Şofletea. Lucrări publicate în reviste indexate în baze de date internaționale (BDI): 1. 5. Forest and Sustainable Development. Curtu. (prezentare): Identification of hybrids between oak species. C. Şofletea. 2011: Consideraţii privind identificarea hibrizilor între speciile autohtone de cvercinee.. N.. Crăciunesc. I. 2013: Identification of hybrids between oak species. Totodată. Enescu. I. N. N. Crăciunesc. I. Şofletea. Curtu.. 2011: Genetic diversity of pedunculate oak (Quercus robur L.. Curtu..... Crăciunesc. Secția de Silvicultură. 4 (53).. Şofletea. Crăciunesc. Simpozionul: Stadiul actual și perspective în dezvoltarea dendrologiei. Curtu.. M. Nr. Moldovan. 13 septembrie 2012. 3. Conferința IUFRO „Genetics of Fagaceae and Nothofagaceae”. Lucrări prezentate la simpozioane și conferințe naționale sau internaționale: 1. A.L. A.. N. Enescu. 15-16 octombrie 2012. dar și pentru identificarea genelor implicate în izolarea reproductivă dintre specii.C. Bordeaux (Franța). Direcții viitoare de cercetare Pentru a analiza existența unei posibile selecții împotriva sau în favoarea exemplarelor hibride apărută între stadiul de ghindă și cel de plantulă este nevoie de evaluarea procentului hibrizilor pe eșantioane de puieți stabiliți sub coroana arborilor-mamă la care s-au realizat analize de paternitate. A. se va putea realiza o amprentare genetică cu ajutorul locilor funcționali pentru a evalua diferențierea speciilor și a populațiilor intraspecifice. I. Romania. Bulletin of the Transilvania University of Braşov..L. 1: 15-20. 9-12 octombrie 2012.. Vol. Şofletea.C. În acest mod se pot identifica trăsăturile importante pentru anumite adaptări la condițiile de mediu locale. Şofletea. I. Seria a II-a. (poster): Floral phenology in a mixed species. București. 3. Curtu..

Romero-Severson. 9.. H. H. E. Burg. For. Kremer. 12. Aldrich... C. R. Aitken. C. Steinkellner. Evolution 50: 900–908.Lexer. nr. F. 1983: Biogeography of oaks in the Arcto-Tertiary province.. J.V. S. morphological. (pedunculate oak) based on RAPD. Akkak. R. R. Fluch. isozyme and 5S rDNA markers. Roussel. C... Labbe. G. CRC Press. Galop. 2. A. Aldrich. I.. 1993: Hybridization and mating system in a mixed stand of sessile and pedunculate oak. Yeaman.. T. 17. Missouri Bot. Oxford University Press.. A. 1953: Dare de seamă asupra observațiilor fenologice forestiere efectuate în anul 1949.) Liebl. Kremer. Bălănică. And Quercus robur L.. R.. Bacilieri. pag..H. A. 6. Molecular Ecology Notes 2: 472-474. S. Plomion.. Sun. Annals of Forest Science. Barreneche. S. Karl. Ann.. 1998: A genetic linkage map of Quercus robur L. nr. Bacilieri. migration or extirpation: climate change outcomes for tree populations. 1996b: Comparison of morphological characters and molecular markers for the analysis of hybridization in sessile and pedunculate oak... Axelrod. Bakker. 2001: Towards molecular tools for management of oak forests.. 1994: Intraspecific genetic structure in a mixed population of Quercus petraea (Matt. F. Ducousso. Meddour. Streiff. 1997: Natural hybridization and evolution. M. in a mixed stand of Nortwest of France.. 1949: Hybridization of the habitat.. 50: 122–127. G. Molecular Ecology 19: 2626–2639. Villani. Critical Reviews in Plant 29(3): 148-161. A. Kremer. Derory.) Liebl. C. T.. robur L. Kremer.. J.. C. SCAR... Wang..H. A.J. 18. A. Petit.. ecological and phenological differentiation between Quercus petrea (Matt. R. D. 1995: Genetic. Analele ICAS 13 (1): 71-80.44. 14... 1996a: Mating system and asymmetric hybridization in a mixed stand of European oaks. Kremer. Niort. Ducousso. O. Gard. Roussel. 4. A. M. T. Tomescu. W. 15.. 2011: Detecting and measuring genetic differentiation. 31-55... Alterra. Appl. Bird. 10. Ducousso... S.E. R.1: 1-10. Barreneche. Evol. Arnold. In: Phylogeography and Population Genetics in Crustacea. 8..A.N. D.. R. Russell.... J. 2010: Plant Parentage. Glössl... Olanda.. Curtis-McLane. J. microsatellite.1: 95–111.. 69 .Trontin.R. Silvae Genetica 52 (3-4): 176-179. Silvae Genetica.. R.. Jagtap. Ann. E. Romero-Severson.. A.. M. 2008: Adaptation.... 2010: Population differentiation of sessile oak at the altitudinal front of migration in the French Pyrenees. A. Bacilieri.. vol. Michler. Theoretical and Applied Genetics 97: 1090-1103. J. P. 70: 629–657. Toonen.. 2002: Microsatellite markers for northern red oak (Fagaceae: Quercus rubra). Favre.-F. Ashley...L. P. 5. A. Theoretical and Applied Genetics 108: 558–566. J. Bacilieri.A... C. Kremer. 16. A.BIBLIOGRAFIE 1. Kremer. 3. J..L.. Plomion.. A. R. P. and Dispersal: How DNA microsatellites have altered the landscape. Holliday. A. M.. K. 2004: Comparative mapping between Quercus and Castanea using simplesequence repeats (SSRs).. T.. S. Evolution 2: 1 – 9. Heredity 73 (2): 130-141. Smouse. Teză de doctorat. Pollination. minisatellite. Alberto. Casasoli. Bodenes. C.E. 2003: Amplification of North American Red Oak Microsatellite Markers.Wageningen.. J. 7. 13. Ducousso.-M. Anderson .. Oxford. K. Michler. Vitalis.53: 79-91.. R. G.... Bacilieri. Sci.. J. T. Lepais. 11. and Q.

M. J.. Annals of Forest Research 52: 199.. 2002: The spread of deciduous Quercus throughout Europe since the last glacial period.. A. Koelewijn.G. Ashley... M. Burgarella. Taxon 24: 45-50. M..G. W. Evolution 23: 72–84.. Genetics 74: 679–700. ilex)... F. J. P. Bagnoli. 33.. G.. C.L. O. C. G. F. Cheddadi. 24.D.L.J. A. Lumaret. Z. R.. Cravador.. Plant Biosystems 141 (2): 181-193. 25.] in Flemish populations . Toader. Lootens. K. Jabbour-Zahab. P. W.. Bovenschenl. Forest Genetics 8(4): 331-337. Coart. 21. 1969: Variance of gene frequencies.206. Heredity 102: 442-452. Boury.19. Heredity 78: 433—444. Petit.. J. Burczyk.C.. B.. A.G.G.aob..N.. petraea. and Q-suber L. 2009: Detection of hybrids in nature: application to oaks (Quercus suber and Q. I. Coyne . S. Cristofolini. S.. 22. C.. Salse.. Bakker. Koenig.. C. 2007: Molecular evidence for hybrid origin of Quercus crenata Lam.. V. Bruschi. I... Soto. 2001: Paternity analysis in a seed orchard of Quercus robur L. Appl.. BMC Plant Biology 12: 153.. R. Kremer... 23. R.. C. E. Gailing. 2009: Bud burst and flowering phenology in a mixed oak forest from Eastern Romania.. Beaulieu. 70 .J. Molecular Ecology 19: 2137–2151... Reille.... De Loose. P. 2012: Comparative mapping in the Fagaceae and beyond with EST-SSRs. J. Burczyk.. Lorenzo. J..oxfordjournals.. Goicoechea. C. Craft. E.. Joandet. Chancerel... L. F. Laigret. Murat.. 1973: Analyses of gene frequencies.) Liebi... I. 30. J. R.J.C. and estimation of the amount of background pollination using microsatellite markers. Buiteveld. de Vries. 32..... 2013: Seeing the forest through the trees: comprehensive inference on individual mating patterns in a mixed stand of Quercus robur and Q. F. 26. 1997: Detection of genomic regions differentiating two closely related oak species Quercus petraea (Matt. L. E. C. Genet..M.. American Journal of Botany 89 (11): 1792–1798.J. Burger. M. Soliani. Cotti. (Fagaceae) in Northern and Central Italy. 2000: Morphological and molecular differentiation between Quercus petraea (Matt. revealed at the stage of naturally established seedling.G. R. Chybicki. Roussel. petraea (Matt. A. P.) L. Evolution 48: 19 – 30. D. Bussotti. Durand.. (Fagaceae) from Q-cerris L. 2002: AFLP markers demonstrate local genetic differentiation between two indigenous oak species [Quercus robur L. 2010: Realized gene flow within mixed stands of Quercus robur L. J. Cockerham. Annals of Botany.. 31. and Quercus robur L. G. C. G. 34. Cockerham.C.org. Forest Ecology and Management 156: 27-48. Guichoux. J. Coelho. N. Lima.. and Q.. Grossoni.)] in Portugal using AFLP markers. Gil. 2006: Genetic diversity of two evergreen oaks [Quercus suber (L. A. C.) Liebl. Lamote. Șofletea.) Liebl. Villani. Annals of Botany 85: 325-333... 105: 431–439.... Plomion.. Chybicki. Chesnoiu.. Brewer.. F. S. C... A. E. 1994: Ernst Mayr and the origin of species.P.. 27. E. A. Conte. And Quercus pubescens Willd. Curtu. M. Alberto. and Quercus petraea (Matt.. Silvae Genetica 55 (3): 105-118. Kremer. Radu. Roldán-Ruiz. 1975: The species concept in Quercus. Neves. Enescu. E. acces online de la www.V. Mattioni. F. 35.. Vendramin. Bodénès. Theor. 28. A. 20. H. Bodénès. 29. Van Bockstaele. Vendramin.. C... 2002: Limited hybridization between Quercus lobata and Quercus douglasii (Fagaceae) in a mixed stand in central coastal California .) and Quercus ilex subsp rotundifolia (Lam.

Denk. Bulletin of the Transilvania University of Braşov. Alberto. Ashley.. Kashani. Taxon 59: 351–366....D. Grimm. Genet.J. Curtu. Ikaran. 46.. Dow. R.M.. Z... Notulae Botanicae Horti Agrobotanici Cluj-Napoca 39 (1): 275-282. A.J. 42. Nr. Curtu.. 38. pubescens Willd.. Şofletea.. Crăciunesc. Șofletea. Demesure. Theoretical and Applied Genetics 107: 884-892. 47.. Finkeldey. S. Ciocîrlan. 40. R... Cuvillier Verlag. Shaw. Theor.. C. 44. Dumolin. 1960: Arbori şi arbuşti forestieri şi ornamentali cultivaţi în R. N. Gailing. Bucureşti..biomedcentral. Dow.V. Vol. S. B.. B..-P.. Leinemann. Howe.. Forest and Sustainable Development. E. B. Davis.B. L. 159 p. Cabané.. A. V. Fineschi. S. Durand.36. J. S. T. Göttingen.L. Editura Agro-Silvică. E..R. O. I.. Petit. de Daruvar.. Koelewijn. Finkeldey..S. disponibil online la http://www.).) community. A. Goicoechea. Schirone. I. Curtu. Romania.. F. 2011: Genetic Differentiation between Quercus frainetto Ten. 2007b: Evidence for hybridization and introgression within a species-rich oak (Quercus spp.. 1995: Karyotype analysis in Quercus ssp. 1995: Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Șofletea.G. Mattioni.. Medagli. 2011: Genetic diversity of pedunculate oak (Quercus robur L. R.P. Guichoux.. Curtu.. H. Petit. 50. Dumitriu – Tătăranu. I.. Dumolin-Lapègue.. disponibil online la www. E. Dumoulin. Herrán. P. 45. Enescu. 2006: Patterns of genetic variation and hybridization in a mixed oak (Quercus spp. 1997: Phylogeographic Structure of White Oaks Throughout the European Continent. N.. R. 4 (53). Kremer. 91: 1253–1256. Finkeldey.biomedcentral. 52. 37. Curtu. R. Ouercus macrocarpa. 1998: High levels of gene flow in bur oak revealed by paternity analysis using microsatellites. Frigerio..) in Prejmer Natural Reserve. 48.F.) forest. 71 . Curtu. 810 p. 2007a: Genetic variation and differentiation within a natural community of five oak species (Quercus spp. 91: 137-141.G. M.W. Le Corre. A. R. D. Germania..... S. B. Petit. S. C.L... G. Appl. 2009: Patterns of contemporary hybridization inferred from paternity analysis in a four-oak-species forest. Proceedings of the Biennial International Symposium... G.L. V. Demesure. Crăciunesc...9: 284.. Moldovan. Gailing. B. O.. Demesure. and Q. D’Emerico. Gailing.L. O. Curtu. Genet. C.L. 19-20th October 2012: 51-56. Bianco. 1: 15-20.J. 43. Braşov... Appl. I... 2013: Identification of hybrids between oak species. H.M. BMC Evolutionary Biology. Sebastiani. 1995: Dumolin. A.. 2010: The oaks of western Eurasia: Traditional classifications and evidence from two nuclear markers.. 41.. N. Chancerel. Dodd. Cherubini. A. Buonamici.. J.. P. Theor. Crăciunesc. B. M. C. Seria a II-a.C. Villani. Journal of Heredity 89: 62–70. 2003: Molecular differentiation and diversity among the California red oaks section Lobatae.. A. 1995: Characterization of highly variable (GA/CT)n microsatellites in the bur oak. Gailing.. I. Bodénès.. O. Vendramin.com/1471-2164/11/570.. Plomion. BMC Evolutionary Biology 7: 218. P.. Genetics 146: 1475-1487. P. Y.. R. Silvae Genet 44:66–70.. C.. 51. A. A. 49. N. M. in Romania.. 2010: A fast and cost-effective approach to develop and map EST-SSR markers: oak as a case study.. Ueno. A. 2001: Range shifts and adaptive responses to Quaternary climate change.. (Fagaceae). F. Ashley. vol. A. M.. Plant Biology 9: 116–126. F.. BMC Genomics 11: 570.com/1471-2148/9/284.. L.. 39....Science292: 673–679. R.L.

Le Provost. R. R. Kremer. 2007: Genetic variation in fragmented forest stands of the andean oak Quercus humboldtii Bonpl. Biotropica 39(1): 72-78. A.) Oerst.) Skeels] endemic to Morocco. 61. Schmidtova..L. Bergès. Ž. S. Gerber. Evol. 1992: Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. J.. Franjic.. BMC Genomics 12: 292. 2012: Evaluări morfologice și genetice în populații autohtone de cvercinee din secția Dascia. 72 . K. J. A. J..... Skvorc. Chybicki. Georgescu. subgen. Ferris. Dzialuk. Liber..J.. (Fagaceae)..C.. Idžojtić. 2007: Extent of nuclear genome sharing among white oak species (Quercus L. Fortini. M. J.. A. M. Welc. J. Z. El Mousadik. Genet. Sliwinska..E. 62. Gömöry. Hewitt... Teză de doctorat. J. Streiff. Genetics 131: 479–491.. S. 63. Sork. Fernández.53.. 2011: Phenological asynchronization as a restrictive factor of efficient pollination in clonal seed orchads of pedunculate oak (Quercus robur L. Bodénès. seria Lanuginosae. Molecular Ecology 9: 1037–1048. vonHoldt.M. 2000: Crossamplification of microsatellite loci in a neotropical Quercus species and standardization of DNA extraction from mature leaves dried in silica gel.. 59. 2005: Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study.F.. J. 57.. Boussardon. Molecular Ecology 14: 2611-2620. I. Lopez. 60. Annals of Botany 99: 959–964.. Acta Societatis Botanicorum Poloniae 75 (2): 123 – 130. Davy. Krstonosic. Smouse... Mariette. Vendramin.F. B.. Burczyk. Regnaut. M.. Šoštarić. Lepidobalanus (Endl. 2000: Comparison of microsatellites and amplified fragment length polymorphism markers for parentage analysis. H. D. Škvorc. Bodénès. J. 64.. Lesur. Goudet. 66. Universitatea Transilvania din Braşov. Croatian Journal of Forest Engineering 32 (1): 141156.. S. Z. 2012: STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. L. Evanno. I. 2011: Analysis of BAC end sequences in oak. Editura Universul.. 58.. Pl. G.. P...P. 266: 253–264. 54. Z.. A... 2007: Presence of Triploids among Oak Species.. Molecular Ecology 2: 337–344. providing insights into the composition of the genome of this keystone species. C. G... C. A. Plant Molecular Biology Reporter 18: 397a-397e.. Petit R. J.. Sork. 67. Maiuro. R. L.). C.M.M. F. Tohme.. Syst. Earl. P.. S..L. Excoffier. Moraru. Oliver. 2006: Morphological and molecular differentiation of the Croatian populations of Quercus pubescens Willd..G... 36 p. Bitton. D. Bucureşti. V.. S. Fluch. 1993: Native oak chloroplasts reveal an ancient divide across Europe. Fernández. 55. 4 (2): 359-361. Kremer. C... G... V. Viscosi.... V. 1996: High level of genetic differentiation for allelic richness among populations of the argan tree [Argania spinosa (L. Plomion. 3: 543-554. C. (Fagaceae). E. Conservation Genetics Resources vol. C. G. Bohorques. Quattro. C. P. Gallego. Fineschi... Stančić.. I. A. 56. Plant Biosystems 143. 2009: Comparative leaf surface morphology and molecular data of five oaks of the subgenus Quercus Oerst (Fagaceae). Bogdan. 65. Nr.. Sever.. 1948: Monografia stejarilor din România. S. Franjić. 92: 832–839. Enescu.. Appl. Theor. G.. 68. A..) in Slovakia estimated by allozymes. J. Faivre Rampant.J. D.

Hattori. Bertocchi. 2009: Hybridization between Quercus robur and Q.L. 85. Scotti-Saintagne.R. Springer.. S.S.W. Arias.. Scalfi. MPG Books Group. Lagache. S. 81. C. 1998: World checklist and bibliography of Fagales (Betulaceae. C. K.. Jensen... Berlin: 161-187.. Barreneche. Derory. C. Corylaceae.. Govaerts. Evolution 53: 313–318. 83. 2003: Differentiation and hybridization between Quercus crispula and Q. Leonardi. amplified fragment length polymorphism markers. American Journal of Botany 90(5): 769–776. Goudet.. 80. H. G. dentata (Fagaceae): insights from morphological traits. Bakker. H.. Hedrick. P. J... Kelleher.. G. Disponibil la: http://unil. M.69. Larsen. M. Nielsen. P. J... Forest Trees. R. 2011: Two highly validated multiplexes (12-plex and 8-plex) for species delimitation and parentage analysis in oaks (Quercus spp. Ann For Sci 66: 706–717...M... Guichoux.. J. Fenchel.. Marshall. laurina (Fagaceae). Hereditas 129: 183-186. Lepais. E. M. Molecular Ecology Resources 11: 578-585.. C. Version 2. Taper. Molecular Ecology 6: 897899. Isagi. L’Université Bordeaux 1. 73. Casasoli. 2008: GST and its relatives do not measure differentiation. two mexican red oaks. González-Rodríguez. Molecular Ecology 17: 4015–4026. Vol 7.. Glossl. Petit. C. 76. Lexer. Lexer..L.. 75. robur: Morphological versus Molecular Analyses. C... petraea in a mixed oak stand in Denmark. 2004: Morphological and RAPD analysis of hybridization between Quercus affinis and Q. Rogers.. P. Evolution 51: 747–755. 77.. 70... 2nd Edition. Fagaceae and Ticodendraceae). P. Evolution 59: 1633– 1638. Preszler. Porth. T... Shifley.. F.. J... Romero-Severson. L. J. 2005: Species Distinction in Irish Populations of Quercus petraea and Q. Cottrell. (ed) Genome Mapping and Molecular Breeding in Plants.W. Y.. 72.. 2007: Fagaceae Trees. Valencia. S.T.R. L. J. Bodénès.. O. Carlson.. Kampfer.. 73 .html.-P. Hebard. Kimura.9. Sato.. T. Clark. P. T. A. 2009: The Ecology and Silviculture of Oaks... M. Sisco..J.3. Plomion. Johnson. 2005: A standardized genetic differentiation measure. Boecklen.. Hedrick. Douglas. Hodkinson.. Wagner. 74. J.C. S. K.J. Oyama. Buiteveld.. Suhandono. 1999: Highly variable loci and their interpretation in evolution and conservation. D. 79. Molecular Ecology 16: 1099-1006.ch/izea/softwares/fstat. Leger. H. S. Franța.T. American Journal of Botany 91(3): 401–409. D. K. Koelewijn..W. Kremer. F..R.. Kew. 82. T. Royal Botanic Gardens. 84. Ishida. 2002: FSTAT: a program to estimate and test gene diversities and fixation indices. 1998: Characterization of (GA)n microsatellite loci from Quercus robur.C. 1997: How discrete are oak species? Insights from a hybrid zone between Quercus grisea and Quercus gambelii. 2007: Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. and leafminer composition.T. E.Williams.. 2008: Dynamique d'hybridation dans le complexe d'espèces des chênes blancs européens.... Villani. S. Arumuganathan. Bodmin... T. Jost... Annals of Botany 96: 1237–1246.. Kubisiak. R. Kelly. R. S. D. UK. L.). J.. 1997: PCR primers amplifying microsatellite loci of Quercus myrsinifolia Blume and their conservation between oak species. S. Howard. R. În: Kole C.A. 78. C. D. Frodin.E.... Steinkellner. Kalinowski.. M. J. 71....2. Roussel. I. A. A.

J.. A. Int... Leger.E... 91. O..... R. S. Botany 87. 90. petraea (MATT. Sebastiani.) LIEBL. T. Ann.. Tsumura. Trends in Ecology and Evolution Vol. 87.. 100. 2007: Fingerprinting and genetic variability in cork oak (Quercus suber L. J.) elite trees using ISSR and SSR markers. I. 2008: The genic view of plant speciation: recent progress and emerging questions.. Nr... O. Lumaret.. J. Petit. Aguinagalde. 12... H. Bodénès..S. L.. 99. J.. Kawahara. 88..J...J.. Kremer. and Q. C. V. Petit. P. 92. Munro. Vendramin. J.G.. 65. M. Science Publishers. Annals of Botany 104: 725–736.. J. Lepais. 97... 2005: Hybridization as an invasion of the genome. K. Nr. A. R. Silvae Genetica 55 (4-5): 238-240. Gailing. Vol. P. Martin.. Kremer. 64: 773–779. Lopez-Aljorna.. 2002: Comparison of Levels of Genetic Diversity Detected with AFLP and Microsatellite Markers within and among Mixed Q. P. 101. Lexer. F.... A. robur L. Gyllenstrand. Mir. 2009: Differentiation of three closely related Japanese oak species and detection of interspecific hybrids using AFLP markers. Kanazashi... A. 95. 2006: Short Note: High Throughput Microsatellite Genotyping in Oak Species. K.. B. A. Jabbour-Zahab. M. 2013: Genetic structure of Quercus rubra L.. Manos. Y.. Lumaret. 2005: Oaks of Asia... Menitsky. K. 2009: Ancient and current gene flow between two distantly related Mediterranean oak species. Tabbener. Goikoechea. Nr. Lesur. Vol. J. 1999: Phylogeny. Takahashi. Kremer.C. R. Doyle.. Lepais.. Yoshimaru. U.M. E. 74 . Burg...C. A. Sarda. Alberto. M. Matsumoto. G. R. Manos. Sci. A. Bueno.. 2: 145-153. R.. C... I. ilex. Plomion. Groppe. Cottrell. Sci. V. C.. Csaikl. Durand.. 2011: A sample view of the pedunculate oak (Quercus robur) genome from the sequencing of hypomethylated and random genomic libraries. J. C. Molecular Ecology 15: 2007–2012. R. 2009: Contrasting nuclear and cytoplasmic exchanges between phylogenetically distant oak species (Quercus suber L.. Guichoux.. Stands. 2001: The historical biogeography of Fagaceae: Tracking the tertiary history of temperate and subtropical forests of the Northern Hemisphere. Philosophical Transactions of the Royal Society B: Biological Sciences 363: 3023-3036. Jarne.S. Lepais. Tree Genetics & Genomes 7: 1277–1285. 89.C. Kremer. H. Streiff. A...J. Van Dam. Gerber.. O. J. Lavabre. 96.J.. For...86. Hill populations at gene-based EST-SSR and nuclear SSR markers. Bonin. and Processes of Molecular Differentiation in Quercus Subgenus Quercus (Fagaceae).. Y. 94. 162: S77–S93. Mallet. O. P. A. Lind. S. C. Molecular Phylogenetics and Evolution. Nixon. R.. and Quercus ellipsoidalis E. T. Biogeography. 2009: Species relative abundance and direction of introgression in oaks. A. S.M. C. Evolution. F. 3: 333–349. 5: 229-237. Tree Genetics & Genomes 9: 707–722. Stanford. issue 1: 156-170..F. A. 93. 2011: Reproductive patterns shape introgression dynamics and species succession within the European white oak species complex. Quercus suber and Q.. Lowe. S... Barreneche. Bodénès. P.20. 2–3: 72-79. Gerber.. Gerber. Silvae Genetica 51. Lexer.. Lascoux. Widmer. A. König. Pl. A. Molecular Ecology 18: 2228–2242. Mariette. 98. 2006: Shared alleles in sympatric oaks: recurrent gene flow is a more parsimonious explanation than ancestral polymorphism.. N.

K. A multipopulation study. (red. 1987: Molecular Evolutionary Genetics. 104. S.. Fagaceae). Schlötterer. F. 64: 37–45..A. Natl. A.) in Southern France: inferring crosses and dynamics. Plant Biology 12: 234–238.A. J.C. 115.. C. E. Kotlicki. A.. Săvulescu). F. 2010: Natural hybridisation between kermes (Quercus coccifera L. American Journal of Botany 99(1): 92–100. Methods in Enzymology. H. Teză de doctorat. S. Bonal. I. G. Muir. G. N. Fink..... ilex L. in northern Thailand revealed by nuclear and chloroplast microsatellite markers. Limited hybridization between Quercus alnifolia Poech and Q. H. E.) revealed by microsatellite markers. L.) Liebl. Molecular Ecology 14: 4469-4478. C. Moran. Nei. 112. Tomaru..) using small set of microsatellite markers. 114. Nyarady. E. II.C.. Manabe.. 1987: Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction.. Fleming. I. Editura Academiei Republicii Populare Române. C. P. pag. 2000: Species status of hybridizing oaks. et al. 2011a: Interfertile oaks in an island environment. Evolution 6: 147–161. Nakanishi.102. 107. J. Forest Ecology and Management 259: 2026–2035. Dounavi. Aravanopoulos. Ueno. Sci.) and holm oaks (Q. 2011b: Interfertile oaks in an island environment. 224-256. alnifolia and Q. Neophytou... 103. Nei..) Liebl.. Muir. in a mixed stand. Columbia University Press. H. 118... Molecular Ecology 14: 549–561. Clark. Molecular Ecology Notes 6: 971– 973... Yamamoto.). Nature 405: 1016–1016. F. A. F. 1952: Flora Republicii Populare Române Vol. 1973: Analysis of gene diversity in subdivided populations.. Nielsen. USA 70: 3321–3323. Olrik. 111. A.D... Dounavi.C. coccifera in Cyprus. C. 106.. Ortego. S.) şi a gorunului [Quercus petraea (Matt. Aravanopoulos. 117. 109.. D..S. G. 75 . S. T. For... Fink. robur F1-hybrid in back-crossing situations. Yoshimaru. Muller. C. New York.. Bach.. A. 2005: Interannual genetic heterogeneity of pollen pools accepted by Quercus salicina individuals. I. B. coccifera L. and Q. robur L.. Moldovan. Faloona. J.. Sci.] în populaţii din estul României cu ajutorul markerilor ADN. Universitatea Transilvania din Braşov. Yoshimaru. E. R. 2011: Evaluarea variabilităţii genetice a stejarului pedunculat (Quercus robur L. Lobatae . Proc.V. Ann. 105. 2008: Genetic diversity and differentiation of Quercus semiserrata Roxb.. 113.E. Neophytou. Plant Biology 11: 213–226. European Journal of Forest Research 130:623–635.. 2005: Evidence for shared ancestral polymorphism rather than recurrent gene flow at microsatellite loci differentiating two hybridizing oaks (Quercus spp. 108. Fink. Forest Ecology and Management 255: 1067–1077.. 2007: The reproductive success of a Quercus petraea × Q.. T. 1952: Ecological control of hybridization in Quercus: A factor in the mechanism of evolution. M. Schlötterer. C. 2010: Detecting interspecific and geographic differentation patterns in two interfertile oak species (Quercus petraea (Matt. 116. And Q. Neophytou. M.I..A. European Journal of Forest Research 130: 543–555. Willis.0): a program for generating simulated hybrids from population samples. Mullis.. Aravanopoulos. 110. Dounavi. C. S. 2012: Genetic evidence for hybridization in red oaks (Quercus sect. Kjaer... High nuclear genetic differentiation and high degree of chloroplast DNA sharing between Q..A. ilex L. Acad. 155: 335... Pakkad. 2006: HYBRIDLAB (version 1.

. Demesure. 2004: Hybridization as a mechanism of invasion in oaks. assessment. S... A.. J. Burg. Natl.E. M.. Petit.B. Tabbener. G. 1993: Geographic structure of chloroplast DNA polymorphisms in European oaks. A. Gillies.. Smouse. Peñaloza-Ramírez.J. 2010: Interspecific gene flow in a multispecies oak hybrid zone in the Sierra Tarahumara of Mexico. Glaz. Pluess.J. G. Deans. Donnelly. Brewer. Phylogeography and patterns of diversity based on data from over 2600 populations. A. van Dam. Madsen. M. K. Molecular Ecology Notes 6 (1): 288-295. E.. Quercus lobata (Fagaceae)... monitoring and analysis of the effects of air pollution on forests.. 122.. Cottrell. J. Fineschi... Papp. Popescu... Hered.E. Cottrell. J. G. Lowe.. G. R. B. Burg. Ann. P. R. Sork. Genetics 155: 945–959. Slade..E. Peakall. Analele ICAS. A. P. Finkeldey. 133. Lowe. Mátyás..W. M. C. Goicoechea. Petit. Coart. D. M... Ducousso. O. U.-H.. Popescu... Kremer.K. 126. Part IX.. Caron.. K. A. D. König.J. A. Merg. S. Rousset.. Appl. Ducousso.. S. Wagner. D.5: genetic analysis in Excel. A. 5–26. H. J. B. Grivet. Matyas. Population genetic software for teaching and research. Biodiversity.. Olalde.. P. Dumolin-Lapegue. New Phytologist 161:151–164. A. R. Oyama...R. Taurchini. M. J. Konig. Ziegenhagen.. Van Dam. Petit. Ziegenhagen.L. S. 4... Pineau. P.. G. Pemonge. 156: 49–74.. Kremer.. Sci. R.. S. A. Phenological observations.. Forest Ecology and Management. 1997: Chloroplast DNA footprints of postglacial recolonization by oaks.. S. O.J. M. S.. A. R.. Petit. D. 121. R. J. 87: 122–128. S. Smouse. R. 2002b: Identification of refugia and post-glacial colonisation routes of European white oaks based on chloroplast DNA and fossil pollen evidence.. Bioinformatics 28: 2537-2539. Pons. 76 .... and Kremer. Goicoechea. 1998: Identifying populations for conservation on the basis of genetic markers. González-Rodríguez.. Acad. Csaikl. C... I. R. Kremer. K.. Vol. L. 132. B. 125. Kremer. M.. 131. 2009: Impact of forest management on genetic diversity of Quercus petraea populations: a case study from the Krivoklatsko Protected Landscape Area (Czech Republic). Fineschi. A. 120. V. 12: 844-855. de Vries. Bot. O. B... Preuhsler. 86: 248-249. Petit. D.. A. Pritchard. F. 1999: Manual on methods and criteria for harmonized sampling.. Stephens. C. S.. S.... P.. G.1: 231-247... Bordács. Munro. Davis... R. Cheddadi. Petit. J. Mendoza-Cuenca. A. E.. Proc. Deans. Genet... F.. 105: 389–399.. Bacilieri. J. A. I.119. T. 2006: GenALEx 6: genetic analysis in Excel. Roussel. Csaikl. J. K... R. 1995: GENEPOP Version 1.. Slade.. R.. Smouse. Bodenes. H.. 2009: Short distance pollen movement in a wind-pollinated tree. 123.. 2002a: Chloroplast DNA variation in European white oaks. F. Pospíšková.. Espinel. S. R. De Beaulieu..M. Coart. Theor.. M. Research and Conservation 13: 37-42. El Mousadik.. B. Munro. Rădulescu 1938: Observațiuni fenologice la speciile lemnoase din București... Forest Ecology and Management 258:735–744.. F.. Raymond. Tabbener. Forest Ecology and Management 156. 128. Finkeldey... L. F. Glaz. USA 94: 9996–10001. J.... B. 130. G... A. De Vries. D. UNECE. A.. S. S. Dostálek.2: population genetics software for exact tests and ecumenicism. J. Population genetic software for teaching and research-an update. J. D.. făcute în sezonul de vegetație 1937.. J. 129. Peakall. J. 35 p. Conserv. F. Nr.. R.. R. E. Dolan.. 2012: GenAlEx 6. J. Madsen. U. 2000: Inference of population structure using multilocus genotype data. Biol. Jensen.. H. Bordacs.. Jensen. 127. 124.. Kremer. P.

. 1967: Flowering and fruiting in the white oaks. T. 174 p.. N.. A. 2004: Atlas Florae Romaniae III Genus Quercus. Pl. San Diego. Ecology 42: 365-372. S. Samuel.) Liebl. B. S. 18(2): 233-234. 135. Syst. Teză de doctorat. L. Aldrich. Editura “Ion Borcea”. 1993: Introgression and its consequences in plants. Şofletea. 451 p. Sharp..M. Harrison [ed. Universitatea Transilvania din Braşov.. Staminate flowering through pollen dispersal.A. Theor Appl Genet 109: 1648–1659. L. Textband. New York.. Bacău. 137.. Nature Biotechnol... C.. 138. A. N. 1961: Flowering and fruiting in the white oaks. Wendel. O. E. J. Rieseberg. Stanciu. 151.. I. Schuelke. Goicoechea.. within an Italian standas revealed by microsatellite fingerprinting. 140p. robur (Fagaceae): results obtained with RAPD markers confirm allozyme studies based on the Got-2 locus. 217: 137-146. Bulletin of the Agricultural and Forestry Science 21: 217–225. G. A. Sharp. 1997: Cercetări taxonomice. Kremer. E. Burg.. 2004b: Detection of quantitative trait loci controlling bud burst and height growth in Quercus robur L. 2008: Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux. Şofletea.. Salvini. 2004: Integration of populations and differentiation of species. A. 2000: An economic method for the fluorescent labeling of PCR fragments. 70 – 109. Rieseberg. Schwarz. 77 ..G.. Genetics 168: 1615–1626. 148. C..G.H. Molecular Ecology Resources 8: 103-106. 2009: Natural hybridisation between Quercus petraea (Matt. O. Reactualization and genetic prospections. Rieseberg.S... Stanciu.]. Dahlem.)Liebl. C. 1991: Oak tree hybrids in the Bejan forest –Deva. S. W. 1993: Natural hybridization within the genus Quercus L. P. Pistillate flowering. 145. Rousset. Plomion.. M. USA.. USA. P. 150. Ştefănuţ. P.. Editura Ceres.). Mapes. 140.. 142. New York. N. morfologice şi ecologice privind hibrizii genului Quercus din rezervaţia ştiinţifică Bejan-Deva. Kjær. C. Stebbins. S..L... J. 2004a: Genome scanning for interspecific differentiation between two closely related oak species [Quercus robur L. 152...M. E... V. Barreneche. New Phytologist 161: 59–69. 1937: Monographie der Eichen Europas und des Mittelmeergebietes I. Fineschi. 139. Kremer. Romero-Severson.. I. V. 149. Sanda... G. Carney. C. 143.. H. 146. Popescu... P. nr.] . W.. Berlin. W.. Scotti-Saintagne.. Stănescu. 144.. C. G.134. D. judeţul Hunedoara.. petraea (Matt.... Scotti-Saintagne. Vendramin. V. T. weather and yields. Plant Biology 11: 758–765. Sprague. Church. Bucureşti. F. K. 1950: Variation and evolution in plants. Hybrid zones and the evolutionary process. Evol. Bruschi.. 1997: Flora forestieră lemnoasă a României. L.. 147.. 141. Oxford University Press.. Bodénès. 1999: Identification of hybrids between Quercus petraea and Q.. Rushton. Morjan.. Annals of Forest Science. Porth. In R. Mariette. 136. Bodénès. Barabaş. Sun.L. Plant & Animal XI Genome Conf.D. acorn development. 2003: Genetic mapping in northern red oak (Quercus rubra L. Chisman. R. Grossoni.H.. Stănescu. 1998: Plant hybridization. E. Bertocchi. and Quercus pubescens Willd.. Columbia University Press. Barreneche. 50: 73 -90. S. New Phytologist 140: 599– 624. V. H. Ecology 48(2): 243-251. and Q.

R.153.. R. 158... 155.. N.... 157..-P.. C. P. București. Gloessl. Nr. V. 156. Taxon 25: 233-239. 160. Dorog. Valbuena-Carabana. 1976: Ecological species. Mihalache. Streiff. Collada. L. E. Genet. Avramescu. 1993: Results of species hybridization with Quercus robur L and Quercus petraea (Matt) Liebl.. A.L.. Glössl. Florescu I. M... Valbuena-Carabaña. C. S. A.. Plant Molecular Biology 33: 1093–1096. S. Vähä. T. 78 .J... L. Bucovina Forestieră 12 (1-2): 47-68.F. 2007: Fine-scale spatial genetic structure in mixed oak stands with different levels of hybridization.. 2004: MICROCHECKER: software for identifying and correcting genotyping errors in microsatellite data. crispula by database mining. Şofletea. 164.. I. Lexer.microsatellite loci from Quercus petraea. 1967: Cercetări fenologice la principalele specii forestiere autohtone din RSR – Sinteza pentru perioada 1956-1965. Sci. Crăciunesc.. Ann. Curtu. E. Molecular Ecology Notes 4(3): 535–538. Labbe. Molecular Ecology 6: 1189-1194. S. D. Enescu.C. G. Molecular Ecology 7: 317–328. Şofletea. Steinkellner. Lexer. 165. Heredity 95: 457-465.. Editura Universităţii Transilvania.. Ueno...... Streiff. 2006: Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci.. Turetschek. J.. 2005: Gene flow and hybridisation in a mixed oak forest (Quercus pyrenaica Willd. Molecular Ecology 15: 63–72. M. 154. Centrul de documentare tehnică pentru economia forestieră.L. O. petraea (Matt. Gonzalez-Martinez.R. A. J. E. Ștrimbei. Wills.. Shipley. 2011: Consideraţii privind identificarea hibrizilor între speciile autohtone de cvercinee. R.G. O sinteză. 1: 6-11.. L. Soto. A. E.. 1998: Withinpopulation genetic structure in Quercus robur L. H. Coandă. S.. M. Lexer. H. 167. Gil. Goicoechea. Gil. Kremer. S. Glössl.. 472p... Frățilă. Guiman. A.. C. E.. Teodosiu. M. Analele ICAS 48 (1): 73-83. Gonzalez-Martinez. Ducousso. P. multispecies. W.. 2005: Fenologia – dezvoltare și perspective. I. and oaks. C.C.C. 159.. 1997a: Identification and characterization of (GA/CT)n. H. Y. Conserv. Mateescu... Hăruță. Kremer.. A. Steinkellner. Van Valen.. For. Steinkellner. 221 p. Tsamura. J. 162. R. Sork. Tomescu.. assessed with isozymes and microsatellites.) in central Spain. Glössl. H. Bacilieri.. Molecular Ecology 16: 1207–1219. Hutchinson. J.C... Braşov. Moldovan.I.. A. Tovar-Sánchez. J. S.... Oyama. Teodosiu. 2007: Dendrologie.M. Turetschek. Steinkellner. Kremer. Revista Pădurilor anul 126. 168...) Liebl.. K.. M. and Quercus petraea (Matt.P. and Quercus petraea (Matt.... M. 2005: Observații fenologice la specii forestiere în sezonul de vegetație 2004.) Liebl. American Journal of Botany 91(9): 1352–1363. Curtu. 161.. 50: 137–143. Fluch. K..) Liebl. 9: 1083–1085. Primmer. 163. N. and Q. Bujilă. C. Hardy. 1999: Pollen dispersal inferred from paternity analysis in a mixed oak stand of Quercus robur L. Streiff. 2004: Natural hybridization and hybrid zones between Quercus crassifolia and Quercus crassipes (Fagaceae) in Mexico: morphological and molecular evidence. Molecular Ecology 8: 831-841.. C. O. 166.. A.. 169. L. C. 2008: Development of ten microsatellite markers for Quercus mongolica var. M.. Burg. Steinhoff. Van Oosterhout. 1997b: Conservation of (GA)n microsatellite loci between Quercus species.... C..

Zane.-F.. Zhang.. 2010: Exploring Species Limits in Two Closely Related Chinese Oaks. T.-Y. W..) Liebl.. Kremer. 171. Zanetto..org. 1991: Interspecific gene flow in sympatric oaks. V. 182..-F. Gerber. 172.. Gailing. Derory. 173(8): 875–884. Y. L. Int. Evol. 1984: Estimating F–statistics for the analysis of population structure..H. Boecklen. Plos One 5(11): accesat online de la www. Whittemore... B. Y. B.T. Viscosi. Monolocus patterns of variation.. Turkish Journal of Botany 37.. Fortini..X. D. Finkeldey. Heredity 75: 506–517. Plant Sci. W. 1995: Geographical structure of gene diversity in Quercus petraea (Matt.. H..K. 14: 851–865.. W. 2013: Molecular characterization and genetic structure of Quercus acutissima germplasm in China using microsatellites. C. 88: 2540-2544.. Plomion.plosone. S.. Patarnello. 177. Y... G. C. S. Molecular Ecology 20: 4995–5011. Y. 183. A.170.A. 2001: Reproductive processes in two oak (Quercus) contact zones with different levels of hybridization. Mol Biol Rep 40: 4083–4090. O. Loy. Petit. Liao..J. Petit. 2005: Molecular markers for characterising diversity in forest trees. O. Molecular Ecology 11: 1-16. 2013: Morphological and genetic variation within and among four Quercus petraea and Q. 175. T. Fang. Wu.. Schaal.. P. M.. X. Evolution 19: 395–420. Heredity 87: 680-690. R.. Yucedag. C.G. A.. O.. 184.. Nati. B.J.. Zeng.. Liao.. C. D. 176. Antonecchia. L.. Kremer.C. A.. robur natural populations. Williams. Zhang. 179...-Y. Bargelloni. 79 . Zhang. A. Vornam. 173. pag. Zhang. Cockerham. USA. Vol. 181. 1965: The interpretation of population structure by F–statistics with special regard to systems of mating. Lepais.J. J. Editura Arbora.... 2011: Geographic variation in the structure of oak hybrid zones provides insights into the dynamics of speciation. 2011: Characterisation and natural variation of a dehydrin gene in Quercus petraea (Matt. 2001: The genic view of the process of speciation. Li.. R. R. Yu. J.. Hansen. 178. I. W.. G.. Li.S. J. Biol. Plant Biology 13: 881–887.) Liebl. O.H. Evolution 38: 1358–1370.. 2006: Microsatellite variation of Quercus aquifolioides populations at varying altitudes in the Wolong Natural Reserve of China. Wright.. Zeng. 2002: Strategies for microsatellite isolation: a review. Gailing. Howard. Korpelainen. In: Conservation and management of forest genetic resources in Europe. 180.-J. Weir. Evolution Proc. Acad.M. D. Sci.. 174. J. 337-368. Zvolen. I. A. 2012: Leaf shape and size differentiation in white oaks: assessment of allometric relationships among three sympatric species and their hybrids.-J. Xia. Vendramin. C.

5 ha) au indicat un procent ridicat al hibridării (40. Analizele de alocare genetică pentru cei 492 de arbori eșantionați în suprafața de cercetare intensivă (8. ABSTRACT The natural hybridization level within a complex of four oak species was assessed with the help of a set of 13 molecular markers.REZUMAT Nivelul de hibridare naturală într-un complex de patru specii de cvercinee a fost evaluat cu ajutorul unui set de 13 markeri moleculari. pubescens. The genetic differentiation indeces of the species highligthed the highest differentiation between the Quercus frainetto – Q. These observations indicated the possibility of interspecific hybridization production in the Natural Reserve Bejan-Deva. 80 . frainetto și Q. respectively the most reduced differentiation between the Q. frainetto and Q. De asemenea.2% din arborii participanți la încrucișări sunt în aceeași categorie fenologică cu arborelemamă. pubescens species. O sinteză comparativă între analizele de paternitate și observațiile fenologice a indicat că 62. robur species pair.5 ha) indicated a high hybridization rate (40. Out of the total of the crosses identified inside the study area. A comparative synthesis between the paternity analysis and the phenological observations indicated that 62. the most numerous were the intraspecific ones (40%). for the investigation of the phenologic barriers for the accomplishment of this phenomenon. phenological observations of the foliar buds burst and flowering were made. The paternity analysis accomplished for 304 acorns cropped from 18 mother-trees highlighted a percentage of 46% of the pollinations due to a number of 80 trees situated in the study area. The hybrids proved to be fertiles and indicated a partial keeping of the reproductive barriers for the pollen from other species. s-au efectuat observații fenologice ale deschiderii mugurilor foliari și ale înfloririi care au indicat posibilitatea producerii hibridărilor interspecifice în rezervația naturală Bejan-Deva. Arborii hibrizi s-au dovedit fertili și au indicat o menținere parțială a barierelor reproducătoare asupra polenului provenit de la alte specii. respectiv cea mai redusă între speciile Q.2% of the trees participant in crosses are from the same phenological category as the mother-tree.4%). pentru investigarea barierelor fenologice în calea realizării acestui fenomen. robur. Analizele de paternitate efectuate pentru 304 ghinde recoltate de la 18 arbori-mamă au surprins o proporție de 46% a polenizărilor datorate unui număr de 80 de arbori situați în suprafața de cercetare. cele mai numeroase au fost cele intraspecifice (40%). followed by backcrosses (27%). The genetic assignment analysis for the 492 sampled trees in the intensive study area (8. Indicii de diferențiere genetică a speciilor au scos în evidență cea mai ridicată diferențiere între perechea de specii Quercus frainetto – Q. Moreover. Din totalul încrucișărilor identificate în interiorul suprafeței de cercetare.4%). urmate de retroîncrucișări (27%).

2000-2004: Liceul Teoretic “Mihai Eminescu” Petroșani. Diplomă de bacalaureat. Lucrări publicate în reviste ISI: 1 (coautor) B.craciunesc@unitbv.CURRICULUM VITAE Date personale Nume: CRĂCIUNESC Prenume: Iacob Adresa: str. Lucrări prezentate la simpozioane și conferințe naționale sau internaționale: 3 81 . specializarea matematică-informatică. Hunedoara Cetățenie: română Starea civilă: necăsătorit Telefon: 0724384209 E-mail: iacob.1985.01. jud. Universitatea Transilvania din Brașov. nr. Vilelor. jud. Petroșani. Lucrări publicate în reviste indexate în baze de date internaționale (BDI): 3 (2 ca prim autor) C. Lucrări publicate în proceeding-urile conferințelor internaționale: 1 (prim autor) D. Publicații A. Diplomă de inginer. Petroșani.2.ro Educație 2004-2009: Facultatea de Silvicultură și Exploatări Forestiere. Hunedoara Data și locul nașterii: 22.

Papers published in BDI journals: 3 (2 as first author) C.craciunesc@unitbv. Hunedoara County Date and place of birth: 22nd of January 1985. Vilelor Street. Matematics-Informatics.ro Education 2004-2009: Faculty of Silviculture and Forest Engineering.CURRICULUM VITAE Personal data Name: CRĂCIUNESC First name: Iacob Address: 2. Hunedoara County Nationality: Romanian Marital status: unmarried Phone: 0724384209 E-mail: iacob. Diploma of Forest Engineer 2000-2004: Theoretical Highschool “Mihai Eminescu” Petroșani. Petroșani. Baccalaureate Diploma Publication A. Petroșani. Papers published in ISI journals: 1 (coauthor) B. Papers published in proccedings of international conferences: 1 (first author) D. Transilvania University of Brașov. Papers presented at national or international conferences and symposia: 3 82 .

Sign up to vote on this title
UsefulNot useful