You are on page 1of 1

Nurul Hikmah 1111096000018

Panda oleosa isolate OH1601 trnC-ycf6 intergenic spacer, partial sequence; chloroplast
GenBank: KF488001.1
>gi|557790003|gb|KF488001.1| Panda oleosa isolate OH1601 trnCycf6 intergenic spacer, partial sequence; chloroplast TTATTCCGTTTGCTGATATAACTTGTCGAATTTGTCCCCAACAGAAACACGTGAAAGAAAAG AACTTTTG ATACTTTCTTGATTCTAACCATCTGAAGGTTCTGTTCTCTAAAGTGTTGTAAATTTTTGCGT CTAGGATT CAAGGAAAGTTTATGGTAGTGAAAGAGAATCGGTAAATCTTGATATAATAGCCCTCCCACTA CTATATAC TATACTGGCTGGGACTTGAATTAGATTGGATAGTGGGTAGTTAGTAGTTGTGGAAAGGGCGG AAGATACT TTATATACAAACTCATGAGAATTCCTGAGTACTCGGGAATTCAATCAATTTAATAGTGATTG AATGGATA AGTGGCTTTTACTTATCTATTTTTTTACATATATTTTTACTTATTTATATAAAGTACAAATA TATATCAA ATAAATATACATAAAATATACATATTAAATATACATATAAAGTACAAAAAGAAATTCTTTCT TTTAGGTA ACTCCTAGTCAAGAGGAAAGAATGGAATAGGCTATCTTCCAATTGTTTTACAGAGACAATCG GGAGACGA TAAGGATTAGATCAAATGGAAAAAGAGTATGTAAAAAAAAATAGGGGTATGTAATAGATAGT GATCCGCC TTGATTCTATATTTTTATATTTTTGACTTAATGAAGAGCAACAAAAGAAAGAATAGGTCTTA TTATTTTT CCATCTTAGTAGGATTTTTTTTTGATACTTCCAAGGGCGTCGCTGCGTATATTTCGTTTGTG CTTAATGT TTCCCAATTTTACTAGCAATCATATAAGAACTTCTTATAATTTATTGGATTCTTTGGAGTGT TTCATCAA TGGTATTGGGCGGAATCCCTTTTTTTGACTCTGCACCAGCGATTCTACTATTATTAGTGAAC AATAATGG AAAAA

Rhizopus oryzae arginine-specific carbamyl-phosphate synthetase mRNA, partial cds


GenBank: AF025850.1
>gi|3603176|gb|AF025850.1| Rhizopus oryzae arginine-specific carbamyl-phosphate synthetase mRNA, partial cds AAATCAAGGATGAATTTGGTCTCTTCAAATATTTTGAATCTGATCGTATCCAAGTTCAAGGT ATCATCGT CAATGACTATGCTACCGAGTACTCTCACTGGACTGCTGTTGAATCTCTTGGTGAATG