You are on page 1of 192

1

PRESENTACIN

Benemrita Universidad Autnoma de Puebla
Vicerrectora de Docencia

DIRECCION GENERAL DE EDUCACION MEDIA SUPERIOR
MODELO UNIVERSITARIO MINERVA
PLAN 06
Academia General de Biologa
G GU U A A M ME ET TO OD D L LO OG GI IC CA A D DE E
B BI IO OL LO OG G A A
NIVEL EN QUE SE IMPARTE: SEGUNDO AO

CICLO ESCOLAR
2010 2011

FECHA: JULIO 2010
AUTORES:
Profa. Ma Dolores Ramos Vera
Prof. Pascual Vicente Muoz
Profa. Mnica Muoz Lobato
2

PRESENTACIN
El trabajo que a continuacin se presenta es producto de la conjuncin entre los objetivos
trabajados en ciclos anteriores con el modelo constructivista del conocimiento dentro del
Modelo Universitario Minerva de la Benemrita Universidad Autnoma de Puebla y el
enfoque en el desarrollo de competencias de acuerdo a la Reforma Integral de la
Educacin Media Superior (RIEMS), integrando la Asignatura de Biologa al Marco
Curricular Comn (MCC) que permitir dar en un futuro la flexibilidad y el enriquecimiento
del currculo del bachillerato.
Los bloques que se presentan son los siguientes en esta primera parte del Programa
son:
BLOQUE 1. LA BIOLOGA COMO CIENCIA
BLOQUE 2. LAS MOLCULAS DE LA VIDA
BLOQUE 3. CLULA, UNIDAD DE LA VIDA
BLOQUE 4. HERENCIA Y VARIACIN
En cada bloque se especifican las competencias genricas y sus atributos,
posteriormente se presentan las tablas de objetivos especficos; conocimientos previos,
declarativos, procedimentales y actitudinales/valorales, as como los contenidos
especficos, mapas conceptuales, los criterios de evaluacin de acuerdo al Programa de
Estudios de la Asignatura, orientaciones didctico -pedaggicas y la bibliografa, vnculos a
sitios web de inters (TICs y TACs) y material audiovisual para desarrollar las actividades.
En la unidad 1, La Biologa como ciencia, te hablar del conocimiento de la
Biologa como una construccin social a travs de la conceptualizacin de los paradigmas
biolgicos, procesos de construccin del conocimiento cientfico en la ciencia biolgica. Se
abordar a la Biologa dentro del contexto de otras ciencias, su objeto de estudio, su
importancia en la solucin de problemas del entorno social adems de la organizacin de
los seres vivos desde el nivel microscpico al macroscpico.
3

En la unidad 2, Las molculas de la vida, los estudiantes valorarn la importancia y
trascendencia del agua como molcula fundamental de la vida, situando a los
bioelementos que dan estructura a las biomolculas y su relacin como soporte
bioqumico fundamental en el metabolismo celular. Analizarn la relacin e importancia
de los bioelementos y biomolculas con la nutricin modificando sus hbitos alimenticios
para una mejora de la calidad de vida. Finalmente, analizar la estructura de la molcula
maestra de la vida, el ADN, reflexionando cmo los seres vivos almacenan y trasmiten la
informacin gentica.
En la unidad 3, Clula, unidad de la vida, los estudiantes fundamentarn los
postulados de la Teora Celular como base del estudio de la clula y establecern
diferencias y semejanzas entre procariontes y eucariontes, relacionando los componentes
celulares a travs de sus respectivas funciones. Globalmente, analizarn y reflexionarn
acerca de los procesos metablicos celulares y la importancia del ciclo celular en el
proceso de la continuidad de la vida a travs del proceso de la divisin celular.
En la unidad 4, Herencia y la variacin, se reflexionar, a travs del desarrollo
histrico de la Gentica, cmo desde la prehistoria el hombre ha realizado seleccin
gentica en forma emprica hasta llegar a su propia conceptualizacin con respecto a las
leyes de Mendel, que sirvieron como base para el desarrollo, investigacin y aplicacin
actual de la Gentica.
Se analizarn los distintos conceptos relativos a la Gentica para comprender cmo
funcionan los distintos patrones hereditarios tanto mendelianos como no mendelianos;
as como los mecanismos que producen variacin en las poblaciones, adaptaciones al
ambiente y la consecuente evolucin biolgica tales como: la herencia, las mutaciones, la
recombinacin gentica y el medio ambiente. Del mismo modo, se estudiarn los
diferentes tipos y a qu nivel se dan las mutaciones y sus repercusiones en el ser humano.
Se fomentar una postura crtica y tica acerca de los impactos de algunos avances
biotecnolgicos en la produccin de alimentos, la salud y el ambiente.
4

JUSTIFICACIN
El Nivel Medio Superior de La Benemrita Universidad Autnoma de Puebla se encuentra
en una nueva etapa de su desarrollo que le exige reorientar su quehacer acadmico y
fortalecer su interrelacin con la sociedad. Por ello, como gua para su quehacer se
propone un modelo educativo y acadmico congruente con la funcin social de una
universidad pblica que se oriente a la formacin integral, humanista y se centre en el
aprender a aprender, basndose en la teora constructivista socioparticipativa, paradigma
que ha dado respuesta a las necesidades educativas actuales. Como toda institucin
educativa, se encuentra inmersa en una sociedad cambiante por lo que mantiene
actualizados y competitivos los planes y programas educativos en el Nivel Medio Superior,
creando, recreando, aplicando y difundiendo el conocimiento de las ciencias y los saberes
cotidianos para beneficio de nuestro pas
El programa de Biologa se enmarca en el Modelo Acadmico y Educativo Minerva,
con un enfoque metodolgico constructivista socio-cultural, que promueva en los
estudiantes la responsabilidad de su aprendizaje, generando conocimientos que impacten
en el desarrollo social contribuyendo al avance de la cultura, la ciencia y la tecnologa.
Los propsitos generales de este enfoque son:
Contribuir a la formacin del alumno mediante la adquisicin de conocimientos y
principios propios de la disciplina, as como favorecer el desarrollo de habilidades,
actitudes y valores que le permitan enfrentar con xito los problemas relativos al
aprendizaje de nuevos conocimientos en el campo de la Biologa
Se busca enfatizar las relaciones cientficotecnolgicas para que pueda desarrollar
una tica que contribuya a establecer una relacin armnica entre la sociedad y el
ambiente.
Tomar en cuenta los referentes contextuales del alumno con la finalidad de formarlos
con un perfil critico, analtico y propositivo hacia los problemas socioculturales de su
entorno y que adems le sirvan para obtener el bagaje de conocimientos del rea que
los vincule hacia la educacin superior.
5

Apliquen de manera responsable sus conocimientos a situaciones de la vida diaria

Considerando lo anterior el rea de Ciencias Naturales del Bachillerato
Universitario, plantea trabajar esta ciencia desde una perspectiva amplia y con una visin
constructivista sociocultural, que permita al alumno comprender los fenmenos naturales
vinculados con su realidad inmediata.
Dicha perspectiva implica fortalecer el pensamiento racional en el educando, la
adquisicin de habilidades de percepcin no slo para el estudio de la disciplina, tambin
para integrarlas a sus hbitos de estudio y actividades cotidianas que le permita un mejor
desarrollo metacognitivo.
La asignatura de Biologa, por su carcter experimental, no puede ser concebida sin
la aplicacin de actividades experimentales de sus contenidos, a fin de propiciar la
formacin integral del alumno. Por lo que se deben generar ambientes de aprendizaje
donde se puedan desarrollar un conjunto de competencias que integran conocimientos,
habilidades y actitudes. Dicho de otra manera, estas competencias formulan las
cualidades individuales, de carcter tico, acadmico, y social que debe reunir el alumno.
El diseo de las estrategias de enseanza, aprendizaje y didcticas, en la medida de
lo posible, debe coincidir con los fundamentos psicopedaggicos del plan de estudios y la
concepcin de aprendizaje.
Por todo esto se han seleccionado los siguientes materiales de apoyo que
conforman la presente gua metodolgica. Se han incorporado estrategias bajo un
enfoque en competencias que permitirn la movilizacin de los conocimientos,
habilidades, actitudes y valores en un contexto especfico, todo ello contribuir a alcanzar
los objetivos de calidad y pertinencia del bachillerato.
6

PROGRAMA EDUCATIVO (PE): NIVEL MEDIO SUPERIOR

ASIGNATURA: BIOLOGA
CDIGO: PROG 0015
NIVEL: MEDIO SUPERIOR
CRDITOS: 10

UNIDAD ACADMICA: NIVEL MEDIO SUPERIOR
PROGRAMA EDUCATIVO: PLAN 06
MODALIDAD EDUCATIVA: ESCOLARIZADA
NIVEL EDUCATIVO: BACHILLERATO
CDIGO: 0015
NOMBRE DE LA ASIGNATURA: BIOLOGA
UBICACIN EN EL MAPA CURRICULAR: SEGUNDO AO
CORRELACIN: La relacin vertical que tiene este programa con respecto a su
ubicacin en el mapa curricular es con Qumica, Psicologa y Desarrollo Humano en
primer ao; Fsica y materias propeduticas como Educacin Ambiental y para la
Salud, Temas Selectos de Biologa y Bioqumica en tercer ao; y una relacin
horizontal con Matemticas, Cultura Fsica e Informtica en segundo ao
ASIGNATURAS PRECEDENTES: Qumica, Psicologa y Desarrollo Humano
ASIGNATURAS CONSECUENTES: Fsica, Educacin Ambiental y Salud, Temas
Selectos de Biologa y Bioqumica.
CARGA HORARIA DEL ESTUDIANTE
TEORA PRCTICA
ESTUDIO
INDEPENDIENTE
TOTAL
HORAS CRDITOS HORAS CRDITOS HORAS CRDITOS HORAS CRDITOS
4 2 6 10



7
OBJETIVOS DE LA ASIGNATURA:

EDUCACIONAL GENERAL ESPECFICOS
Formar estudiantes con
una visin cientfica,
propedutica, crtica,
humana y social sobre
el rea.
Analizar y reflexionar sobre los
conceptos y principios biolgicos
sustentados en el respeto hacia
la naturaleza del ser vivo y su
entorno, construyendo el
conocimiento sobre su estructura
y funcin para generar mejores
explicaciones acerca de los
fenmenos biolgicos de los
seres vivos de manera crtica,
reflexiva y creativa, que permitan
promover aprendizajes
significativos de manera que
puedan ser aplicados en la
solucin de problemas de la vida
cotidiana.

Bloque I: Valora que la Biologa es una ciencia construida desde lo social, a travs de diversos paradigmas, haciendo nfasis
en el estudio de los seres vivos, sus relaciones entre ellos y con el medio que los rodea, contrastando el carcter intra e
interdisciplinario de la Biologa para la preservacin de la salud y del medio ambiente.
Bloque II: Analiza y compara la estructura y funcin de los bioelementos y biomolculas en los seres vivos y examina la
clasificacin de las diferentes biomolculas para identificarlas en los alimentos que conforman su dieta cotidiana
fomentando una actitud crtica frente a los alimentos procesados y dietticos y reflexiona acerca de como los seres vivos
almacenan y trasmiten la informacin gentica.
Bloque III: Fundamenta los postulados de la Teora Celular como base del estudio de la clula y establece diferencias y
semejanzas entre procariontes y eucariontes e interrelaciona los componentes celulares a travs de sus respectivas
funciones para reflexionar la importancia estructural y funcional de la clula en los seres vivos como parte integral de los
procesos metablicos celulares.
Bloque IV: Conceptualiza los fundamentos que permiten delinear las bases genticas de la herencia y documenta su
desarrollo histrico, as como su impacto en la vida actual, valorando la trascendencia del proyecto genoma humano y su
alcance en las aplicaciones de la biotecnologa.
Bloque V: Analiza y contrasta los antecedentes y las principales teoras sobre el origen y evolucin de los sistemas vivos,
dando origen a la radiacin adaptativa y que conllev a la biodiversidad del planeta, comparando y relacionando las
distintas pruebas de la biognesis y de la evolucin, para reflexionar acerca de nuestra postura e influencia en el proceso
evolutivo de las especies.
Bloque VI: Analiza a los virus y clasifica a los seres vivos de acuerdo a sus caractersticas e importancia para el hombre y la
naturaleza, utilizando el sistema de clasificacin actual de los organismos as como la aplicacin de las reglas de
nomenclatura binomial de Linneo para valorar su importancia econmica, mdica y biolgica.
Bloque VII: Diferencia los conceptos bsicos de la ecologa y los analiza con los factores de los ecosistemas, relacionndolos
con el flujo de la materia y la energa y argumentando que las adaptaciones de los seres vivos dependen de su ambiente,
para fundamentar la importancia del uso sustentable con el desarrollo de una actitud de respeto hacia la naturaleza.
Bloque VIII: Diferencia los rganos que componen a cada sistema del cuerpo humano y especifica su funcin de manera
general, relacionndolos entre s para reflexionar de manera crtica e informada sobre la importancia de la higiene y salud
para una buena calidad de vida.


8
BLOQUE I. LA BIOLOGA COMO CIENCIA.

BLOQUE I
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES
LA
BIOLOGA
COMO
CIENCIA
Valora que la Biologa
es una ciencia
construida desde lo
social, a travs de
diversos paradigmas,
haciendo nfasis en el
estudio de los seres
vivos, sus relaciones
entre ellos y con el
medio que los rodea,
contrastando el
carcter intra e
interdisciplinario de la
Biologa para la
preservacin de la salud
y del medio ambiente.

Concepto general
de ciencia.
Historia general
del Naturalismo.
Metodologa
Cientfica.
Partculas, tomo,
molcula,
compuestos,
clula, rganos,
tejidos y sistemas.

Concepta a la Biologa como
resultado de una Construccin
social.
Analiza e interrrelaciona los
cuatro Paradigmas que dan el
carcter de cientificidad a la
Biologa.
Integra las caractersticas
distintivas de los seres vivos y
las ejemplifica.
Fundamenta el campo de
accin de la Biologa y sus
principales ramas.
Aplica criterios cientficos para
interpretar los fenmenos que
involucran a los seres vivos y
los ejemplifica a travs de los
pasos del mtodo cientfico
utilizado en la Biologa.
Analiza la relacin que guarda
la Biologa con la Tecnologa y
la Sociedad.
Diferencia y ejemplifica los
niveles de organizacin de la
materia viva: qumico, celular,
tisular, orgnico, individual y
ecolgico.
Debate sobre las
aportaciones y
aplicaciones de la
Biologa y sus ramas
en la vida cotidiana.
Aplica los
lineamientos
bsicos para
elaborar un
proyecto de
investigacin a
partir de un
problema
empleando el
mtodo cientfico
para su
entendimiento.
Esquematiza los
diferentes niveles
de organizacin de
la materia viva y los
relaciona con el
campo de estudio
de las ramas de la
Biologa, mediante
la elaboracin de un
collage

Valora el impacto de los
avances de la Biologa
en la Sociedad actual
Fomenta la tolerancia y
disponibilidad en el
trabajo colaborativo
durante la realizacin
de proyectos
Reflexiona de manera
informada y crtica las
implicaciones de la
investigacin cientfica
en los diferentes
mbitos social, familiar
y personal
Respeta y valora la vida
y sus manifestaciones y
se asume integralmente
como parte de ella.
Reflexiona crticamente
sobre los aspectos
ticos del uso de las
nuevas tecnologas
aplicadas a la Biologa,
salud y en la
preservacin del medio
ambiente

Qu relacin tiene la Biologa
con el desarrollo social?
La Biologa dentro del
contexto de otras ciencias y su
objeto de estudio.
Cules son los paradigmas en los
que se basa la Biologa?
Cul es el objeto de estudio de la
Biologa?
Cul es la importancia de la
Biologa en la solucin de
problemas del entorno social?
Biologa, tecnologa y
sociedad.
Las caractersticas de la
ciencia: mtodo cientfico
Cules son las caractersticas de
los niveles de organizacin de la
materia?



9
BLOQUE II. LAS MOLCULAS DE LA VIDA
BLOQUE II
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

LAS MOLCULAS
DE LA VIDA

Analiza y compara la
estructura y funcin de los
bioelementos y biomolculas
en los seres vivos y examina
la clasificacin de las
diferentes biomolculas para
identificarlas en los
alimentos que conforman su
dieta cotidiana fomentando
una actitud crtica frente a
los alimentos procesados y
dietticos y reflexiona acerca
de como los seres vivos
almacenan y trasmiten la
informacin gentica.

Conocimiento
sobre tomo,
molcula,
elemento,
compuesto,
enlaces inico y
covalente; grupos
funcionales
Comprensin
sobre sustancias
orgnicas e
inorgnicas.
Conocimiento de
las diferentes
biomolculas.
Diferencia entre
los conceptos de
bioelemento y
biomolcula.
Investiga los
bioelementos y su
importancia.

Cataloga al agua
como una
molcula
bioinorgnica
esencial para la
vida

Investiga la
estructura y
funcin de las
biomolculas y su
importancia como
nutrientes y
componentes
estructurales de
los seres vivos.

Concepta al
Dogma Central de
la Biologa como
un proceso
universal en los
seres vivos donde
a partir del ADN
se codifica para la
produccin de
protenas.
Esquematiza la
formacin de puentes
de hidrgeno en la
molcula del agua
para conceptuar sus
propiedades fsicas.
Demuestra
experimentalmente la
presencia de
biomolculas en
diferentes alimentos y
con base a ello
elabore una dieta
balanceada para que
la aplique a su vida
diaria.
Valora la importancia
de desarrollar hbitos
alimenticios saludables
y para la prevencin de
enfermedades
Cules son los bioelementos
necesarios para la vida?

Cul es la importancia de las
biomolculas inorgnicas?
agua
sales minerales

Cules son las biomolculas
orgnicas?
Monmeros y Polmeros
Carbohidratos
Lpidos
Vitaminas
Protenas
Aminocidos
Enzimas
cidos nuclecos.

El Dogma Central de la Biologa
es Universal?
Duplicacin
Transcripcin
Traduccin


10

BLOQUE III. CLULA UNIDAD DE LA VIDA
BLOQUE III
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

CLULA
UNIDAD DE
LA VIDA
Fundamenta los
postulados de la
Teora Celular como
base del estudio de
la clula y establece
diferencias y
semejanzas entre
procariontes y
eucariontes e
interrelaciona los
componentes
celulares a travs
de sus respectivas
funciones para
reflexionar la
importancia
estructural y
funcional de la
clula en los seres
vivos como parte
integral de los
procesos
metablicos
celulares.

Conceptos
bsicos sobre:
Grupos
funcionales de
Qumica
Orgnica,
Bioelementos y
biomolculas
inorgnicas y
Orgnicas,
Tipos de enlace
qumicos, y de
soluciones.

Analizar y fundamentar la
importancia del ciclo celular en el
proceso de la continuidad de la vida,
tanto en los organismos unicelulares
como pluricelulares, as como la
importante participacin de los
cromosomas en el proceso de
mitosis y meiosis.
Integrar y analizar la importancia de
la historia y el origen de la clula
Analizar y contrastar las diferencias y
semejanzas de la organizacin entre
clulas procariontes y eucariontes.
Analizar la organizacin estructural y
funcional de la clula en los seres
vivos como parte integral de los
procesos biolgicos.
Fundamentar los procesos
metablicos celulares y estructurales
como unidad bsica en la diversidad
de los seres vivos.
Analizar y valorar la importancia de
la estructura y metabolismo celular
de los tejidos, rganos y sistemas del
cuerpo humano, aspectos
fundamentales de unidad y
diversidad de la vida.
.
Fundamentar el contexto
histrico con respecto al
origen de la clula que
conllev al
establecimiento de la
Teora Celular
Compara la organizacin
celular procarionte con la
eucarionte, as como la
vegetal con la animal.
Interrelaciona y
esquematiza
integralmente los
organelos y estructuras
celulares a travs de sus
respectivas funciones.
Analiza la importancia del
ciclo celular en el proceso
de crecimiento y
continuidad de la vida.
Valora la
adquisicin de
una vida saludable
a travs del buen
funcionamiento
del cuerpo desde
el nivel celular
hasta el
pluricelular.
Cules hechos histricos
condujeron al planteamiento de la
Teora celular?

Qu diferencia hay entre clula
procarionte y eucarionte?

Cmo est estructurada y cmo
funciona una clula?
Membrana celular
Retculo endoplsmico
Complejo de Golgi
Lisosomas
Vacuolas
Cloroplastos
Mitocondrias
Ribosomas
Citoplasma
Citoesqueleto
Centriolo
Ncleo

Cmo se reproducen las clulas?
Ciclo celular
Divisin celular: mitosis y
meiosis

Cmo se pasa de una clula a la
pluricelularidad?

Cmo es la relacin tejido
rgano sistema?



11
BLOQUE IV. HERENCIA Y VARIACIN
BLOQUE IV
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

HERENCIA
Y
VARIACIN
Conceptualiza
los
fundamentos
que permiten
delinear las
bases genticas
de la herencia y
documenta su
desarrollo
histrico, as
como su
impacto en la
vida actual,
valorando la
trascendencia
del proyecto
genoma
humano y su
alcance en las
aplicaciones de
la
biotecnologa.

Comprensin
de
biomolculas
(cidos
nuclecos),
estructura y
funcin celular
(mitosis y
meiosis).

Delinea los hechos
histricos que
condujeron al
estudio de la
Gentica

Establece las
diferencias y
similitudes de
algunos conceptos
de la Gentica.

Analiza las leyes de
la gentica
mendeliana para
comprender el
mecanismo de la
herencia.

Compara los
patrones
hereditarios
mendelianos y no
mendelianos

Analiza las
mutaciones como
mecanismos de
variabilidad
gentica.
Ejemplifica las
aplicaciones ms
importantes de la
Gentica.
Investiga el desarrollo
histrico del campo de
la Gentica

Aplica los conceptos de
la gentica en las leyes
de la herencia para la
resolucin de
problemas de gentica.

Ejemplifica los distintos
patrones hereditarios
para identificarlos en
los seres vivos
haciendo nfasis en el
humano

Compara los rasgos de
sus compaeros para
diferenciar entre
fenotipo y genotipo.

Categoriza las
mutaciones como
mecanismos que
producen
enfermedades
hereditarias y las
detecta mediante el
empleo de cariotipos.

Investiga el impacto de
las aplicaciones de la
Gentica sobre algunas
actividades humanas.
Fomenta el
respeto y
tolerancia hacia
personas con
enfermedades
hereditarias y/o
con rasgos
fsicos
diferentes
Valora el
respecto a la
decisin de los
padres a tener
o no un hijo con
alguna
enfermedad
hereditaria.

Critica de forma
informada las
aplicaciones
actuales de la
Gentica que
permita la toma
de decisiones
apegadas a la
Biotica.
Cules hechos histricos condujeron al desarrollo de la
gentica?
Ideas premendelianas
El experimento y las Leyes de Mendel

Qu diferencia y similitudes encontramos en los conceptos
de Gentica?: Genotipo, Fenotipo, Alelo, Gen, Cromosoma,
Locus

En qu consisten las leyes establecidas por Mendel sobre la
herencia?

Qu diferencia hay entre los patrones hereditarios
mendelianos y los no mendelianos?
Herencia mendeliana:
herencia autosmica dominante y recesiva,
determinacin del sexo
Herencia no mendeliana:
herencia ligada al sexo, herencia multifactorial, alelos
mltiples, codominancia, herencia intermedia, poligenia

Qu es una mutacin?
Gnicas o puntuales
Cromosmicas
Genmicas

Cules son las aplicaciones ms importantes de la Gentica?:
Consejo gentico
Proyecto Genoma Humano
Consejo gentico
Clonacin,
Clulas madre
Implicaciones bioticas en la gentica


12
BLOQUE V. EVOLUCIN DE LOS SERES VIVOS
BLOQUE V
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado) CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

EVOLUCIN DE
LOS SERES VIVOS
Analiza y contrasta los
antecedentes y las
principales teoras sobre
el origen y evolucin de
los sistemas vivos, dando
origen a la radiacin
adaptativa y que conllev
a la biodiversidad del
planeta, comparando y
relacionando las distintas
pruebas de la biognesis y
de la evolucin, para
reflexionar acerca de
nuestra postura e
influencia en el proceso
evolutivo de las especies.

El alumno debe
tener presente el
concepto de clula,
y el desarrollo de la
gentica y la
variacin, y estar
familiarizado con la
biodiversidad, para
establecer las
relaciones entre los
organismos,
conocimiento de la
ecologa y los
niveles de
organizacin.
Comprueba que la
evolucin es un
mecanismo inherente a
los seres vivos.
Documenta las
diferentes teoras
acerca del origen de la
vida, la evolucin
celular y la seleccin
natural como procesos
evolutivos en los seres
vivos.
Determina el impacto
de los factores externos
en la evolucin y su
relacin con la
naturaleza actual.
Comprueba que las
caractersticas y
adaptaciones de los
seres vivos son pruebas
indirectas del proceso
evolutivo.
Compara la viabilidad
de las diferentes
teoras sobre la
evolucin
apoyndose en sus
pruebas a travs de
un de un mapa
conceptual.
Analiza el
pensamiento
darwiniano y
establecer diferencias
por medio de un
cuadro de Venn entre
las ideas previas y
posteriores a ste.

Documenta las causas
que determinan la
evolucin de las
especies y examinar
las pruebas que la
sustentan a travs de
un trabajo de
investigacin
documental.

Fomenta el respeto por
el medio ambiente,
teniendo en cuenta su
importancia en la
historia filogentica de
las especies.

Genera una actitud
crtica y analtica ante
las diferentes teoras
evolucionistas.

Reflexiona en torno a
nuestra postura e
influencia en el proceso
evolutivo de las
especies.

Qu es la evolucin biolgica?

Cmo se origin la vida?
Principales Teoras sobre el
origen de los Sistemas Vivos
Teoras sobre evolucin
celular

Cmo explica la Evolucin la
diversidad de los Seres Vivos en
el planeta?
Antecedentes y desarrollo de
la Teora de la Evolucin.
Variacin y adaptacin
Evidencias de la evolucin


13
BLOQUE VI. LA DIVERSIDAD DE LA VIDA
BLOQUE VI
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

LA DIVERSIDAD DE
LA VIDA
Analiza a los virus y
clasifica a los seres vivos
de acuerdo a sus
caractersticas e
importancia para el
hombre y la naturaleza,
utilizando el sistema de
clasificacin actual de los
organismos as como la
aplicacin de las reglas de
nomenclatura binomial de
Linneo para valorar su
importancia econmica,
mdica y biolgica.
Sobre variabilidad
gentica
Sobre variabilidad y
adaptacin
evolutiva
Sobre el concepto
especie

Concepta la
taxonoma, su estudio
y aplicacin para los
seres vivos a travs de
lecturas sugeridas.
Desglosa las
caractersticas
particulares de los seis
reinos, su
clasificacin,
utilizando ejemplos de
algunos organismos.

Aplica criterios
taxonmicos para
identificar y clasificar
a los seres vivos
utilizando
correctamente las
reglas de la
nomenclatura
binominal de Linneo.
Utiliza el nombre
cientfico en estudios
de campo.
Esquematiza las
caractersticas de los
eres vivos a travs de
un cuadro de doble
entrada

Respeta a las
diversas especies
de su entorno
como parte
integral de la
naturaleza.
Fomenta la
conservacin de
la flora y fauna
de su regin.
Valora la
importancia
econmica,
mdica y social
de los seres vivos.
Cmo se clasifican a los organismos?
Primeras clasificaciones
Nomenclatura binomial de Linneo
Niveles taxonmicos
Uso de nombre cientfico
Reglas de nomenclatura binomial
Virus, Vivo o no vivo?
Cul es el sistema actual de clasificacin
de los seres vivos?
Propuesta de 3 dominios 6 reinos
Dominio Archaea: reino
Archaeabacteria
Domino Bacteria: reino Eubacteria
Dominio Eukarya: reinos Protista,
Fungi, Plantae y Animalia



14
BLOQUE VII. LA RELACION DE LOS SERES VIVOS CON SU MEDIO AMBIENTE

BLOQUE VII
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS
PROCEDIMENTALES
ACTITUDINALES
/VALORALES

LA
RELACION
DE LOS
SERES
VIVOS CON
SU MEDIO
AMBIENTE
Diferencia los
conceptos bsicos
de la ecologa y los
analiza con los
factores de los
ecosistemas,
relacionndolos con
el flujo de la
materia y la energa
y argumentando
que las
adaptaciones de los
seres vivos
dependen de su
ambiente, para
fundamentar la
importancia del uso
sustentable con el
desarrollo de una
actitud de respeto
hacia la naturaleza.

Investigar y
definir
conceptos
sobre ecologa.
Buscar las
caractersticas
de los factores
abiticos y
biticos de los
ecosistemas.
Analizar los
ciclos
biogeoqumicos
en la
naturaleza.

Fundamenta que la ecologa es el estudio
de las relaciones de los organismos con su
ambiente.
Analiza el objeto de estudio de la Ecologa,
su desarrollo histrico, y su carcter
interdisciplinario, as como su ubicacin
dentro de los niveles de organizacin
(especie, poblacin, comunidad,
ecosistema, bioma y biosfera).
Analiza la estructura y funcionamiento de
los ecosistemas haciendo nfasis en el
papel de la materia y la energa en la
determinacin de las relaciones entre sus
componentes.
Esquematiza los ciclos biogeoqumicos (del
agua, nitrgeno, carbono, azufre y fsforo).
Analiza y relacionar conceptos bsicos de
ecologa como son hbitat, nicho, niveles
trficos, cadenas, redes y pirmides
alimenticias, destacando la manera en que
se integran dentro del ecosistema.
Distingue los diferentes tipos de
ecosistemas, sus recursos e importancia
haciendo nfasis en los mexicanos y
vincularlos con los problemas ambientales
de nuestro pas, analizando sus causas,
necesidad de estudio y conocimiento para
su adecuado aprovechamiento y cuidado
mediante una actitud responsable y
respetuosa.
Realiza visitas de
campo a jardines
botnicos, museos o
reas naturales.
Organiza grupos y
mesas redondas para
debatir sobre las
causas y
consecuencias del
deterioro ambiental y
las alternativas para
el manejo
responsable de la
biosfera.
Investiga en
peridicos y otras
fuentes noticias sobre
problemas
ambientales para
identificar sus causas
y proponer soluciones
a travs de un
debate.
Realiza actividades
experimentales para
observar la influencia
de los factores
ambientales en los
ecosistemas.
Fundamenta la
importancia del uso
sustentable
desarrollando una
actitud de respeto
hacia el ambiente.

Elige un problema
ambiental, sus
causas,
repercusiones y
soluciones
proponiendo
soluciones y
retomando valores
y conciencia por el
medio ambiente.
Cmo se relaciona la
biodiversidad con el medio
ambiente?
Concepto de ecologa
La Ecologa dentro de los
niveles de organizacin de la
naturaleza
Factores Biticos y Abiticos
Adaptaciones al ambiente
Flujo de materia y energa
Ciclos biogeoqumicos

Cul es la estructura de los
ecosistemas?
Caractersticas dinmicas de la
poblacin
Hbitat y nicho ecolgico
Potencial bitico y resistencia
ambiental
Relaciones intra e
interespecficas
Estratificacin de las
comunidades
Densidad y diversidad en las
comunidades
Sucesin ecolgica

Cules son las grandes divisiones
de la biosfera?
Biomas terrestres
Ecosistemas acuticos


15
UNIDAD VIII ANATOMA HUMANA
BLOQUE VIII
OBJETIVO
ESPECFICO
CONOCIMIENTOS
(Contribucin al perfil del egresado)
CONTENIDO TEMTICO
PREVIOS DECLARATIVOS PROCEDIMENTALES
ACTITUDINALES
/VALORALES

ANATOMIA
HUMANA
Diferencia los rganos
que componen a cada
sistema del cuerpo
humano y especifica
su funcin de manera
general,
relacionndolos entre
s para reflexionar de
manera crtica e
informada sobre la
importancia de la
higiene y salud para
una buena calidad de
vida.
Niveles de
organizacin
Bioelementos y
biomolculas
Clula
Divisin celular
Higiene y
enfermedades







Documenta los cuatro
tejidos fundamentales
que conforman el cuerpo
humano
Investiga la anatoma de
los diferentes sistemas en
diversas fuentes
bibliogrficas.
Identifica y define cada
uno de los rganos que
conforman los diferentes
sistemas del humano.
Relaciona el rgano con
su funcin.
Integra la informacin de los
tejidos en la anatoma de los
rganos del cuerpo
Elabora modelos anatmicos
para identificar los rganos
de cada sistema.
Interrelaciona los rganos
con su funcin a travs de un
mapa conceptual.

Esquematiza en un cuadro de
doble entrada el sistema, la
estructura y la funcin de
cada rgano
Demuestra una actitud tica
y de respeto hacia si mismo.
Reflexiona de manera crtica
e informada de la
importancia de la higiene y
salud de sus sistemas para
tener una buena calidad de
vida.

Promueve y difunde por
medio de peridicos
murales, conferencias,
trpticos la importancia del
cuidado de la salud.
Cules son los tejidos que
conforman a los rganos?
Epitelial
Muscular
Conectivo
Nervioso

Cules son los sistemas que
conforman al cuerpo
humano?

Que rganos forman parte
de cada uno de ellos y cul
es su funcin?
Tegumentario
Esqueltico
Muscular
Digestivo
Circulatorio
Linftico
Respiratorio
Excretor
Nervioso
Sentidos
Endocrino
Reproductor
Gua Metodolgica de Biologa

16

CRITERIOS DE EVALUACIN
Para una mejor evaluacin de los procesos Aprendizaje Enseanza tomar en cuenta los
diferentes tipos de evaluacin.
DIAGNSTICA: Se realiza antes de cualquier ciclo o proceso educativo Permite planificar.
Con la finalidad de obtener informacin valiosa respecto a valorar las caractersticas de
ingreso de los alumnos las( concepciones previas, expectativas, motivaciones previas,
competencia cognitiva en general , los hbitos de trabajo y las actitudes del estudiante al
inicio de un proceso de enseanza-aprendizaje, con el propsito de realizar ajustes en la
organizacin y secuencia de las experiencias de aprendizaje enseanza.
FORMATIVA: Informa del proceso. Ocurre en forma concurrente con el proceso de
enseanza-aprendizaje, Dicha evaluacin exige un nivel mnimo de anlisis de los procesos de
interactividad entre la situacin de enseanza y los procesos de aprendizaje que realizan los
alumnos sobre los contenidos curriculares. Con la finalidad de proporcionar una ayuda
ajustada a los procesos de construccin de conocimientos que realizan los alumnos.
En este modelo las actividades tienen una funcin reguladora de las dificultades, obstculos
o errores que se van manifestando.
SUMATIVA: (Examen tipo Ceneval). Se realiza al trmino de la situacin, ciclo o proceso de
aprendizaje-enseanza. El fin principal de esta evaluacin consiste en valorar si el proceso de
enseanza fue eficaz para que los alumnos alcancen las intenciones educativas planeadas
previamente.

CRITERIOS DE EVALUACIN
EXAMEN DEPARTAMENTAL TIPO CENEVAL O PISA 30%
LABORATORIO (EVALUACION V-GOWIN) 20%
ACTIVIDADES DE APRENDIZAJE 20%
ACTIVIDAD ESPECFICA POR UNIDAD 30%




Gua Metodolgica de Biologa

17


BLOQUE ACTIVIDADES ESPECFICAS: EVALUACIN CON:
I PROYECTO RBRICA
II PORTAFOLIO RBRICA
III MAPA MENTAL O MAPA CONCEPTUAL RBRICA
IV ENSAYO RBRICA



REQUISITOS DE ACREDITACIN
Estar inscrito oficialmente como alumno del PE en la BUAP
Haber aprobado las asignaturas que son prerrequisitos de sta
Aparecer en el acta
El promedio de las calificaciones de los exmenes aplicados deber ser igual o mayor que 6
Cumplir con las actividades propuestas por el profesor




Gua Metodolgica de Biologa

18



G
G
U
U

A
A

M
M
E
E
T
T
O
O
D
D
O
O
L
L

G
G
I
I
C
C
A
A

D
D
E
E
B
B
I
I
O
O
L
L
O
O
G
G

A
A

AUTORES:
PASCUAL VICENTE MUOZ
MA. DOLORES RAMOS VERA
MNICA MUOZ LOBATO
Gua Metodolgica de Biologa

19

NDICE
Presentacin 2
Justificacin 4
Programa 6
ndice 19

BLOQUE 1 LA BIOLOGA COMO CIENCIA 22
1.1 Qu relacin tiene la Biologa con el desarrollo social 25
La Biologa dentro del contexto de otras ciencias 26
1.2 Cules son los paradigmas en los que se basa de la Biologa? 29
1.3 Cul es el objeto de estudio de la Biologa? 33
1.4 Cul es la importancia de la Biologa en la solucin de problemas del entorno
social?
36
Biologa, tecnologa y sociedad 36
Las caractersticas de la ciencia: mtodo cientfico 40
1.5 Cules son las caractersticas de los niveles de organizacin de la materia? 42
Orientaciones didctico-pedaggicas del Bloque1 46

BLOQUE 2 LAS MOLCULAS DE LA VIDA 48
2.1 Cules son los bioelementos necesarios para la vida? 51
Bioelementos primarios o macroelementos 51
Bioelementos secundarios o microelementos 52
Oligoelementos 53
2.2 Cul es la importancia de las biomolculas inorgnicas? 57
Agua 57
Sales minerales 59
2.3 Cules son las biomolculas orgnicas? 66
Monmeros y polmeros 66
Carbohidratos 66
Lpidos 71
Vitaminas 82
Protenas 85
Gua Metodolgica de Biologa

20

Enzimas 92
cidos nuclicos 96
2.4 El Dogma Central de la Biologa es Universal? 103
Duplicacin 106
Transcripcin 107
Traduccin 108
Orientaciones didctico-pedaggicas del Bloque 2 115

BLOQUE 3 CLULA, UNIDAD DE LA VIDA 117
3.1 Cules hechos histricos condujeron al planteamiento de la Teora Celular? 120
3.2 Qu diferencia hay entre clula procarionte y eucarionte? 123
3.3 Cmo est estructurada y cmo funciona una clula? 127
Membrana celular 128
Retculo endoplsmico 131
Complejo de Golgi 132
Lisosomas 135
Vacuolas 136
Ribosomas 137
Citoesqueleto 137
Centriolo y huso 139
Cloroplastos 140
Mitocondrias 142
Citoplasma 144
Ncleo 144
3.4 Cmo se reproducen las clulas? 146
Ciclo celular 146
Divisin celular: mitosis y meiosis 148
3.5 Cmo se pasa de una clula a la pluricelularidad? 152
3.6 Cul es la relacin tejido-rgano-sistema? 155
Orientaciones didctico-pedaggicas del Bloque 3 157


Gua Metodolgica de Biologa

21

BLOQUE 4 - HERENCIA Y VARIACIN 159
4.1 Cules hechos histricos condujeron al desarrollo de la Gentica? 162
Las ideas premendelianas 162
El experimento de Mendel 162
4.2 Qu diferencias y similitudes encontramos en los conceptos de Gentica? 164
4.3 En qu consisten las leyes establecidas por Mendel sobre la herencia? 165
4.4 Qu diferencia hay entre los patrones hereditarios mendelianos y los no
mendelianos?
167
Herencia mendeliana: herencia autosmica dominante y recesiva, determinacin
del sexo
167
Herencia no mendeliana: herencia ligada al sexo, herencia multifactorial, alelos
mltiples, codominancia, herencia intermedia, poligenia
169

4.5 Qu es una mutacin? 175
Mutaciones gnicas o puntuales 176
Mutaciones cromosmicas 177
Mutaciones genmicas 179
4.5 Cules son las aplicaciones ms importantes de la Gentica? 181
Consejo Gentico 181
Cariotipo humano 182
Proyecto genoma Humano 184
Ingeniera gentica 184
Implicaciones bioticas de la Gentica 190
Orientaciones didctico-pedaggicas del Bloque 4 191
Gua Metodolgica de Biologa

22

BLOQUE 1
La Biologa como ciencia

Gua Metodolgica de Biologa

23



Gua Metodolgica de Biologa

24



COMPETENCIAS GENRICAS Y SUS ATRIBUTOS A DESARROLLAR EN EL BLOQUE 1
Se expresa y comunica
Escucha, interpreta y emite mensajes pertinentes en distintos contextos mediante
la utilizacin de medios, cdigos y herramientas apropiados.

Piensa crtica y reflexivamente
Desarrolla innovaciones y propone soluciones a problemas a partir de mtodos
establecidos.
Sustenta una postura personal sobre temas de inters y relevancia general,
considerando otros puntos de vista de manera crtica y reflexiva.

Aprende de forma autnoma
Aprende por iniciativa e inters propio a lo largo de su vida.

Trabaja de forma colaborativa
Participa y colabora de manera efectiva en equipos diversos.



Gua Metodolgica de Biologa

25

1.1 QU RELACIN TIENE LA BIOLOGA CON EL DESARROLLO SOCIAL?
La Biologa es la ciencia que estudia a los seres vivos. Surge de manera formal en el
siglo XIX y ha definido su objeto de estudio a lo largo de la historia; ha establecido
conceptos, teoras y principios y varios enfoques metodolgicos para abordar el
estudio de la vida.
Este campo de conocimiento que inici como la descripcin y la clasificacin del
mundo viviente, se ha transformado en una ciencia que busca comprender las
funciones y las estructuras de los seres vivos; integra temas fundamentales en el
estudio de los organismos, como son: el desarrollo, la herencia, la evolucin, la
interaccin con el medio y con otros organismos. Tiene tambin una amplia gama de
aplicaciones prcticas y ha contribuido al desarrollo de una gran cantidad de campos
aplicados, como la medicina, la ingeniera gentica, la biotecnologa, la agricultura y la
cra y mejora de animales, entre otras.
La Biologa en la actualidad ha conformado una gran trama conceptual y
metodolgica que ha logrado comprender y explicar la enorme complejidad de los
seres vivos. Adems, sus conocimientos tienen importantes consecuencias en la
sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el
uso de los recursos naturales, donde el conocimiento biolgico es fundamental.

ACTIVIDAD
Elabora por equipo un cuadro mental colocando en el centro un esquema de la naturaleza y en los
radios dibujos e ideas relacionadas con la Biologa. Exponerlo en plenaria.


Gua Metodolgica de Biologa

26

LA BIOLOGA DENTRO DEL CONTEXTO DE OTRAS CIENCIAS
La Biologa es una ciencia tan compleja que para alcanzar sus objeticos, se apoya en
otras disciplinas cientficas. Las ciencias que auxilian a la Biologa para lograr
investigaciones completas se denominan ciencias auxiliares. Las principales se
enuncian a continuacin: Qumica, Matemticas, Fsica, Geografa, Historia.
Ya vimos que la Biologa es una ciencia muy extensa, con ramas muy variadas que
se dividen a su vez en otras disciplinas.
RAMA OBJETO DE ESTUDIO
Anatoma Estructura de los organismos
Bacteriologa Bacterias
Bioqumica Composicin qumica de la materia viva
Botnica Plantas
Citologa Estructura y funciones de las clulas
Ecologa Ecosistemas.
Embriologa Desarrollo de los vulos fecundados
Etologa Comportamiento animal
Evolucin Variacin de las especies a lo largo del tiempo.
Filogenia Relaciones evolutivas entre los seres vivos
Fisiologa Funciones orgnicas de los seres vivos
Gentica Herencia de los caracteres biolgicos
Histologa Estructura y funciones de los tejidos
Morfologa Estructura de los seres vivos.
Paleontologa Vida en el pasado
Taxonoma Clasificacin y nomenclatura de los seres vivos
Virologa Virus
Zoologa Animales
Gua Metodolgica de Biologa

27

ACTIVIDAD
Haz una investigacin documental de otras ramas de la Biologa que no estn en el cuadro anterior y
llnalo en la siguiente tabla

Rama Objeto de estudio




























Gua Metodolgica de Biologa

28


Responde las siguientes preguntas

1. Cmo puede contribuir la entomologa a las investigaciones de otras ciencias?

___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________
2. Cmo puede contribuir la bioqumica a las investigaciones de otras ciencias?

___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________

3. Cmo puede contribuir la Gentica a las investigaciones de otras ciencias?

___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________


Gua Metodolgica de Biologa

29

1.2 CULES SON LOS PARADIGMAS EN LOS QUE SE BASA LA BIOLOGA?
Han existido una gran cantidad de investigaciones en los diferentes campos de
estudio de la Biologa, sin embargo las que se retoman por su gran contribucin al
campo de estudio de la Biologa ya que se definieron nuevos conceptos, mtodos y
objetos de estudio; es decir, grandes programas de investigacin que se encuentran
en el origen de la Biologa moderna son los siguientes:
Teora Celular
Teora de la evolucin
Teora del gen
Teora de la homeostasis

El paradigma constituye un cuerpo de conocimientos tericos y metodolgicos
que son reconocidos durante cierto tiempo, como modelo de problemas y soluciones
de una sociedad cientfica determinada (Kuhn).
El paradigma incluye los problemas relevantes a resolver, las formas reconocidas
como vlidas para solucionarlos, los procedimientos experimentales, los conceptos y
las teoras, los datos empricos, los criterios y juicios de valor compartidos por la
comunidad, etc. De esta manera, lo que se considera cientfico o ms en particular,
lo objetivo queda determinado por las convenciones de los miembros de la
comunidad y as resulta imposible decidir la superioridad cientfica de un paradigma
sobre otro.
La Biologa se constituy como ciencia hasta el siglo XIX en un proceso que inici
en 1838 con la formulacin de la teora celular y que culmin en 1900 con el
descubrimiento de las leyes de la herencia. Es en esta etapa cuando se formulan
paradigmas de orden superior; esto es, que abordan problemas de carcter general y
que por ello se denominan como paradigmas globales de la Biologa, siendo en este
periodo cuando por vez primera contamos con conceptos unificadores de orden
general y con una posible aceptacin universal.
Gua Metodolgica de Biologa

30

En este orden de ideas, el primer paradigma global es la teora celular formulada
por Teodoro Schwann y Matias J Schleiden, quienes escriben la versin definitiva de
su enunciado en 1839 (fig. 3.3)
El segundo paradigma es la teora de la evolucin formulada por Charles Darwin
en su obra El origen de las especies (1859), la cual, aunque es rechazada por ciertos
sectores, genera una polmica que ya se da en el seno de una comunidad cientfica
constituida. A esta teora hay que aadir a Alfred Rusell Wallace, coautor quien lleg a
las mismas conclusiones de manera independiente a Darwin.
El tercer paradigma es la teora de la homeostasis, esto es, de la regulacin del
medio interno de los organismos, enunciado por Claude Bernard y contenido en la
obra Lecciones sobre los Fenmenos de la Vida Comunes a los Animales y los
Vegetales, publicado en 1878.
El cuarto paradigma son las leyes de la herencia formuladas por el monje
agustino Gregorio Mendel en 1865, en el texto Experimentos sobre Hibridacin de las
Plantas, pero que carece de impacto cientfico hasta su redescubrimiento en 1900 al
haber llegado a esas mismas conclusiones Carl Correns, Erich Tschermak y Hugo De
Vries.

Fig. 1.1. Un principio unificador de los seres vivos: el AD est presente en todos ellos


Gua Metodolgica de Biologa

31


ACTIVIDAD
En cada espacio escribe el nombre de cada uno de los paradigmas de la biologa, su autor(es) y el ao
de su creacin. Escribe en cada inciso la relacin existente entre los dos paradigmas interrelacionados
segn indican las flechas.

a)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
b)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
Gua Metodolgica de Biologa

32

c)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
d)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
e)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
f)
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
Finalmente, qu puedes concluir al concluir est actividad con respecto a los paradigmas de la Biologa
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
Gua Metodolgica de Biologa

33

1.3 CUL ES EL OBJETO DE ESTUDIO DE LA BIOLOGA?
Cualquier persona puede reconocer que una hormiga, un rosal o una gallina son seres
vivos; en tanto que una piedra o el agua de lluvia no lo son. A pesar de su enorme
diversidad, los seres vivos de nuestro planeta comparten una lista de caractersticas
que los distinguen como tales; stas son las siguientes.
Organizacin. Los seres vivos tienen una estructura organizada. Su unidad primordial
es la clula; a partir de ella, la organizacin se hace ms compleja, pues sta permite
generar tejidos, rganos y sistemas. Tu cuerpo est formado por clulas que a su vez
constituyen tejidos (como la piel) rganos como el corazn).
Irritabilidad. Responden a estmulos del medio ambiente. Por ejemplo, las plantas
crecen en direccin a la luz y las personas nos rascamos cuando nos pica un mosquito.
Reproduccin. Los seres vivos producen descendencia similar a ellos. Has observado
cachorros de algunas mascotas?
Crecimiento. Multiplican su nmero de clulas a partir de una sola, lo que los hace
crecer. T crecers varios centmetros ms y al llegar a cierta edad, tu crecimiento se
detendr.
Metabolismo. Tu cuerpo est formado por sustancias en constante transformacin,
las cuales obtienes mediante la alimentacin y la respiracin. En tu interior stas se
combinan y se descomponen, es decir, participan en reacciones qumicas. El conjunto
de reacciones qumicas ocurridas en un ser vivo se lama metabolismo.
Adaptacin. Los seres vivos tienen capacidad para adaptarse y sobrevivir en un
ambiente determinado. Por ejemplo, los osos polares tienen una gruesa capa de grasa
bajo la piel que los ayuda a sobrevivir en temperaturas por debajo de los cero grados
centgrados.
Movimiento. Es la facultad de desplazar el cuerpo de un punto a otro, o al menos una
parte de l, como las plantas, que orientan sus hojas hacia la luz. Generalmente el
movimiento ocurre para conseguir alimento, protegerse para huir de algn
depredador.
Gua Metodolgica de Biologa

34

A pesar de que algunos objetos no vivos pueden tener una o ms de estas
caractersticas (algunos cristales de roca pueden crecer, nicamente los seres vivos las
renen todas. Esto hace suponer que todos los seres vivos tienen un mismo origen:
una especie que evolucion de maneras distintas para dar lugar a la enorme
cantidad de especies. A esa primera especie se le llama ancestro comn y una prueba
irrefutable de su existencia es que todos los seres vivos del planeta usan la misma
sustancia qumica para heredar sus caractersticas: el cido desoxirribonucleico (ADN)
(fig. 1.1)
ACTIVIDAD
1. Organizados en equipos, observen con una lupa las caractersticas de 1 roca, 1 planta, 1 lombriz de
tierra..
2. En el siguiente cuadro comparativo de los tres objetos de estudio marquen el recuadro que seale la
caracterstica correspondiente que posea.

a) La roca posee alguna caracterstica por la que pudiera ser considerada ser vivo?, por qu?
__________________________________________________________________________
__________________________________________________________________________
b) Para que se considere que un ser est vivo, puede tener una sola de las caractersticas analizadas o
debe tenerlas todas? Explcalo.
__________________________________________________________________________
__________________________________________________________________________
c) Cul es la unidad fundamental de la que estamos constituidos todos los seres vivos? ____________
Gua Metodolgica de Biologa

35


MI PROYECTO
Por equipo, escojan un tema sobre Biologa que les guste para trabajar un proyecto que desarrollarn
durante esta unidad. Considera los siguientes aspectos para desarrollarlo.
1. Nombre del tema
2. Por qu eligieron dicho tema?
3. Qu saben acerca del tema?
4. Descripcin detallada del experimento que deseas hacer
5. Formulen una suposicin de lo que esperan observar.
6. Qu medios necesitan para hacer sus observaciones?
7. Qu pasos seguiran?
8. Hay caractersticas que puedan medir?, descrbanlas
9. Escriban sus conclusiones
10. Cmo se relaciona lo observado con la Biologa?

Revisa la siguiente rubrica para que conozcas los rasgos que sern evaluados.

Aspectos
a evaluar
Indicadores
Inicial (0-1) Bsico (2-3) Autnomo (4-5)
Organizacin de la
informacin
La informacin carece de
un orden lgico, y el tema
se presenta de manera
dispersa
En su mayor parte, el reporte
esta organizado con base en
una secuencia lgica
La organizacin del reporte
mantiene una secuencia
lgica a lo largo del texto
Informacin y
observaciones
especficas sobre el
experimento
Se limita a mencionar que
se presentan cambios en el
experimento. No establece
relacin entre su trabajo, el
carcter cientfico y el
objeto de estudio de la
Biologa
Presenta informacin bsica
sobre el experimento, pero
no reporta detalles
especficos. Relaciona
limitadamente el carcter
cientfico y objeto de estudio
de la Biologa con su
proyecto
Aporta informacin
detallada sobre el
experimento durante sus
distintas etapas. Relaciona
claramente su trabajo con
el carcter cientfico y el
objeto de estudio de la
Biologa
Redaccin del
reporte
La redaccin es
descuidada, informal y poco
clara
Se tuvo cuidado en la
redaccin, a pesar de lo cual
no resulta del todo adecuada
para un reporte acadmico
Presenta una redaccin
coherente y clara,
adecuada al formato de
reporte acadmico
Calendarizacin del
proceso
El reporte carece de una
calendarizacin formal
La calendarizacin del
proceso omite algunas
etapas del experimento
El reporte presenta una
bitcora calendarizada
sobre el proceso del
experimento

Gua Metodolgica de Biologa

36

1.5 CUL ES LA IMPORTANCIA DE LA BIOLOGA EN LA SOLUCIN DE
PROBLEMAS DEL ENTORNO SOCIAL?

BIOLOGA, TECNOLOGA Y SOCIEDAD
La Biologa es la ciencia que se encarga del estudio de los seres vivos y de los
fenmenos y procesos que ocurren en los en los seres vivos. Su definicin deriva
etimolgicamente del griego bios, vida, y de logos, tratado o estudio. Aunque el
trmino se utiliz por primera vez hasta el siglo XIX, la disciplina se ejerca desde
muchos aos atrs con otros nombres. La Biologa se cuestiona exclusivamente sobre
el mundo natural y se caracteriza, al igual que las otras ciencias, por seguir un mtodo
que surge de la observacin, de la comparacin de hechos y de la aceptacin o
rechazo de argumentos para aceptar una idea como valida.
La Biologa en la actualidad ha conformado una gran trama conceptual y
metodolgica que ha logrado comprender y explicar la enorme complejidad de los
seres vivos. Adems, sus conocimientos tienen importantes consecuencias en la
sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el
uso de los recursos naturales, donde el conocimiento biolgico es fundamental.
La Biologa es una ciencia. El trmino biologa surgi en el siglo XIX dndole a la
biologa un sentido ms amplio que el de historia natural. Sin embargo, el estudio de
los seres vivos se remonta a pocas muy antiguas de la humanidad, aunque sin duda
ha tenido una etapa de intensa actividad durante los siglos XIX y XX. En esta seccin se
relatan algunos aspectos de la historia de la biologa que han contribuido a su
consolidacin como una ciencia.
A lo largo de la historia la bsqueda de conocimiento sobre la naturaleza ha sido
abordada de muy diferentes formas y ha perseguido fines diversos. Las primeras
explicaciones sobre el mundo natural recurrieron a la intervencin de factores
sobrenaturales. En la actualidad la ciencia ha eliminado estos elementos metafsicos y
basa sus explicaciones en causas naturales. Para ello las comunidades de cientficos
han establecido normas y criterios que hacen que sus explicaciones tengan un
considerable grado de certeza. Sin embargo, estos criterios no han sido siempre los
Gua Metodolgica de Biologa

37

mismos; han cambiado en diferentes pocas, en funcin de factores cientficos,
filosficos, sociales e histricos.
Al iniciar el camino de la racionalidad, la ciencia se convirti en una actividad
fundamental ya que plante una alternativa a las posturas metafsicas para
comprender el mundo que nos rodea. Desde el ao 580 a.C. hasta nuestros das, la
bsqueda de explicaciones sobre la naturaleza transit por diferentes rutas hasta
llegar a nuestra poca en que la ciencia en general (y la biologa en particular) se ha
convertido en una actividad social fundamental.
La Biologa como ciencia surge de manera formal en el siglo XIX, cuando se define
con precisin su objeto de estudio y se establecen referentes tericos y
metodolgicos que unifican el estudio de los seres vivos. Pero, por qu se dice que la
biologa es una ciencia? Qu es lo que caracteriza al conocimiento cientfico que lo
hace distinto a otro tipo de conocimiento? Cmo se construyen las teoras
cientficas?
En el siglo XIX, la revolucin industrial y la burguesa impulsaron de manera
importante el desarrollo de las ciencias naturales. La fsica, la qumica y la biologa
servan para desarrollar la industria y, por lo tanto, se otorgaron grandes
presupuestos para impulsarlas. El mtodo experimental cobr gran importancia y, a
travs de los aos, se convirti en el mtodo de demostracin que estableca la
diferencia entre la metafsica y la ciencia; las ciencias que utilizaban el experimento
comenzaron a destacar y a ofrecer resultados aceptables. Debido a esta situacin se
construyeron enfoques filosficos que se propusieron explicar la actividad de los
cientficos; uno de ellos fue el positivismo de Augusto Comte (1798-1857), que
trascendi hasta nuestros das, y en algunos aspectos es una concepcin que se
mantiene en la enseanza de la ciencia. El positivismo afirma que:
Las teoras se construyen a travs del mtodo experimental.
La ciencia est formada por conocimientos verdaderos.
Existe un nico mtodo para estudiar la realidad.
La actividad cientfica es socialmente neutra.
Gua Metodolgica de Biologa

38

La ciencia busca la organizacin sistemtica del conocimiento acerca del mundo,
pretende formular teoras que expliquen las relaciones que existen entre diferentes
clases de fenmenos y procura explicar por qu los hechos ocurren de cierta manera
y bajo ciertas condiciones. Puede reelaborar problemas antiguos, pero una de sus
intenciones es generar conocimiento nuevo acerca del universo.
La ciencia no es slo un conjunto de diferentes formas de conocimiento, sino que
es tambin el producto de una actividad humana que tiene una naturaleza especfica.
La ciencia es el resultado del esfuerzo de generaciones anteriores y la cooperacin de
las contemporneas y stas son fundamentales para su desarrollo futuro, su
naturaleza es claramente social.
La Biologa adems ha promovido el desarrollo del quehacer humano con la
generacin de frmacos y vacunas para evitar enfermedades, con la creacin y
mejoramiento de nuevas cepas de organismos vivos de uso agrcola, ganadero y
forestal o incluso en campos como la Genmica, donde el desarrollo de Terapia
Gnica o estudiando el genoma humano por completo ha abierto las posibilidades de
evitar patologas asociadas a factores genticos. El Proyecto Genoma Humano ha
generado la participacin de pases de todo el mundo que colaboran de manera
coordinada, para cumplir los objetivos planteados inicialmente: crear un mapa
gentico de las posiciones relativas de los genes, un mapa fsico de las posiciones
reales, y la determinacin de la secuencia de bases del ADN

Novedades en la ciencia
El Proyecto Genoma Humano se propuso en 1990 como un estudio a 15 aos, en el
que se secuenciara el genoma humano completo, de ms de 3,000 millones de pares
de bases. En un principio no quedaba claro si toda la informacin que se obtuviera
sera del dominio pblico o solo propiedad de empresas privadas. Sin embargo, en
febrero de 1996 establecieron varios acuerdos los participantes (ms de 2000
cientficos de ms de 20 institutos en 6 pases). El ms importante acuerdo fue que se
proveera de una serie de datos para toda la comunidad cientfica, ya que la
informacin gentica se considera como la "verdadera herencia" humana. El primer
cromosoma completo (el cromosoma humano 22) se public en diciembre de 1999.
Gua Metodolgica de Biologa

39

En el verano del ao 2000 se public el genoma "en bruto"; para abril de 2003 se
termin la secuencia completa y se public en agosto de 2004. Desde entonces se
abrieron varios caminos a seguir. Aunque en un principio se pens que las
aplicaciones y los beneficios seran inmediatos, fcilmente se dieron cuenta de que
hay mucho trabajo por delante.
En el caso de las leguminosas, como el frjol, se encuentran bacterias del genero
Rhizobium, que tienen la capacidad de transformar el nitrgeno disuelto en el suelo
en compuestos que las plantas pueden aprovechar (sales de amonio) y con ellos
fabricar cidos nuclicos (ADN y ARM) y protenas (fijacin del nitrgeno). Se ha
calculado que ms de 70 millones de toneladas mtricos de nitrgeno se incorporan
anualmente a la biosfera mediante este proceso.
Mediante una asociacin simbitica entre la bacteria y la raz se forma una
protuberancia, donde habita la bacteria y pasa sales de amonio a la raz. Este tipo
particular de bacterias que "infectan" al frjol son de la especie Rhizobium etli.
Esta asociacin y formacin del ndulo est determinada por un "dialogo"
molecular entre ambas partes, por lo que resulta muy importante identificar los
"sucesos" moleculares que intervienen en este proceso. En el Centro de Ciencias
Genmicas (CCG) de la UNAM, en Cuernavaca, Morelos, un grupo de investigadores
mexicanos se ha dedicado a analizar la secuencia completa del genoma de Rhizobium
etli. De manera que se ha encontrado que una seccin llamada "plsmido simbitico"
en las molculas de ADN que porta la mayor parte de los genes involucrados en la
capacidad de nodular al frjol y fijar nitrgeno. Otro descubrimiento aun ms
interesante es que este plsmido tiene genes que se parecen a otros presentes en
bacterias patgenas (dainas) de plantas, como Agrobacterium que provoca tumores,
y en bacterias patgenas del ser humano, como Brucella, que provoca una infeccin
grave llamada brucelosis. Esto sugiere que, aunque no son bacterias iguales, podran
utilizar formas comunes para interactuar con diferentes tipos de clulas.
En Amrica Latina, el desarrollo de la innovacin cientfico/tecnolgica se ha
estancado, colocndonos en desventaja con los dems pases del llamado "primer
mundo". En pases como Japn o China se ha comprendido que el desarrollo cientfico
es la base del crecimiento, por lo que invierten gran parte de su producto interno
Gua Metodolgica de Biologa

40

bruto en la generacin de nuevas patentes de las tecnologas creadas por sus
cientficos. Aunque en Mxico se cuenta con un buen nivel de desarrollo cientfico y
con la capacidad de vincularlo a la generacin de nuevas tecnologas, hace falta la
participacin de la sociedad civil y del Estado para aumentar la inversin en estos
rubros y para forjar una cultura cientfica ms slida.

LAS CARACTERSTICAS DE LA CIENCIA: EL MTODO CIENTFICO
La ciencia (del latn scientia, conocimiento) es un proceso dinmico de adquisicin,
organizacin y acervo de conocimientos que son el resultado de aplicar el mtodo
cientfico. La ciencia se basa exclusivamente en los hechos del mundo natural y no en
las creencias, lo cual permite que sea, hasta cierto punto, objetiva. Por ejemplo, en un
estudio cientfico de los sismos que ocurren frecuentemente en Mxico, se buscan las
causas y las consecuencias del fenmeno y se trata de explicarlo sin que en ningn
momento las creencias religiosas o de cualquier otra ndole afecten el estudio. As nos
damos cuenta de que la ciencia es sistemtica, analtica y comunicable porque sigue
un mtodo para sus estudios y los analiza antes de tomar cualquier resolucin.
Adems, siempre trata que los otros especialistas estn enterados de los resultados
para escuchar sugerencias y crticas. Siguiendo en el ejemplo de los sismos, se informa
a la poblacin para que tome las medidas pertinentes y se minimicen los daos. La
ciencia es explicativa por su naturaleza clara e informativa, pero sobre todo es
verificable porque los resultados pueden reproducirse para confirmar los
conocimientos; es predictiva porque genera modelos que se adelantan a los hechos.
De esta forma se pueden evitar algunas catstrofes, como en el caso de los modelos
preventivos para el desalojo de edificios durante un sismo.
El mtodo cientfico plantea los siguientes pasos: planteamiento del problema,
composicin del marco terico, formulacin de hiptesis, experimentacin
confirmacin o rechazo de la hiptesis.
El planteamiento del problema, consiste en hacer una pregunta que gue todo el
proceso de la investigacin. Es lo que se va a explicar cientficamente en algn grado.
Gua Metodolgica de Biologa

41

La composicin del marco terico implica: la revisin de la literatura sobre el
tema, la seleccin de planteamientos de diversas ideas y hasta contrapuestas
corrientes tericas y la elaboracin propia del texto.
La formulacin de la hiptesis consiste en simples afirmaciones sujetas a
comprobacin que lleguen a explicar los fenmenos.
A travs de la experimentacin la hiptesis puede comprobada una y otra vez,
estableciendo con el tiempo una teora o ley. Si no es as, entonces hay que replantear
la hiptesis original para volver a comenzar. Finalmente, se alcanza una conclusin
que recopila los resultados y la comprobacin o no de la hiptesis.

ACTIVIDAD
Identifica y subraya de distinto color cada uno de los pasos del mtodo experimental que sigui Louis
Pasteur: observacin y planteamiento del problema (amarillo), hiptesis (verde), experimentacin (rojo),
resultados y conclusin (azul).
A mediados del siglo XIX, Pasteur se dedic a estudiar una enfermedad llamada clera de las
gallinas, que causaba gran mortandad entre las aves. Pasteur haba observado a travs de
microscopios, a muchos microorganismos, supona que algunas enfermedades, si no es que todas, bien
podan ser causadas por ellos.
As, Pasteur se dedic a estudiar diferentes tejidos de las gallinas enfermas, con la finalidad de
encontrar y obtener microorganismos.
Por fin, obtuvo algunos que l consider podan ser los causantes de la enfermedad, y los cultiv en
caldos especiales, donde se mantenan vivos por varias semanas
Posteriormente, inyect algunos de estos microorganismos en gallinas sanas: todas enfermaron de
clera y murieron.




ACTIVIDAD
Elaborar un cuadro conceptual por equipo en donde expliquen con los pasos del mtodo cientfico,
como se pudo haber elaborado una ley o de una teora de cualquier disciplina que elijan, hacerlo en
cartulina o en presentacin power point y exponerlo en clase. Realizar una plenaria.


Gua Metodolgica de Biologa

42

1.5 CULES SON LAS CARACTERSTICAS DE LOS NIVELES DE ORGANIZACIN DE LA
MATERIA?
Por sorprendente que parezca, las interacciones entre las distintas molculas que
ocurren a nivel microscpico, pueden producir a nivel macroscpico una clula viva.
A qu se llama materia? Todo lo que podemos ver y tocar es materia. Pero
tambin son materia algunas cosas que no podemos ver, como el aire, por ejemplo.
La materia ocupa una cierta porcin de espacio que se denomina volumen. En el caso
especfico del aire esto no es tan evidente.
Qu es la materia viva? Dentro de los niveles de organizacin, la materia viva
ocupa los cuatro ltimos lugares. La materia viva llamada tambin materia orgnica,
esta formada principalmente por carbono, hidrgeno, oxigeno y nitrgeno. Estos
elementos, al combinarse, forman sustancias que interactan entre si dentro de la
forma viva mas simple que es la clula.
La clula es la unidad fundamental por la cual estn constituidos todos los seres
vivos. Todos los organismos vivos estn formados por clulas, y en general se acepta
que, ningn organismo es un ser vivo si no consta al menos de una clula

LOS NIVELES DE ORGANIZACIN DE LA MATERIA
Los seres vivos pueden ser estudiados a diferentes niveles. Como toda la materia del
universo, estn compuestos de tomos organizados en diferentes niveles de
complejidad. Muchos de esos tomos forman molculas con propiedades que se
manifiestan en las clulas, las que a su vez se organizan en tejidos y rganos. El
conjunto de los seres vivos forma parte de la biosfera.
La materia en el universo est organizada. Los seres vivos estn formados por
materia. La materia est formada por elementos qumicos (como el nitrgeno, calcio,
carbono) que estn formados por tomos. Las investigaciones de los fsicos han
descubierto un variado nmero de partculas subatmicas como protones, neutrones
y electrones. Si combinamos tomos de hidrgeno entre s obtenemos hidrgeno
Gua Metodolgica de Biologa

43

molecular (H
2
), que es un gas incoloro; si, en cambio, combinamos el H
2
con oxgeno,
otro gas, obtenemos agua, una molcula
La vida surgi a partir de tomos y molculas. Si combinamos molculas entre s,
formamos grandes y complejas molculas: las macromolculas, como protenas y
cidos nuclecos. Estas constituyen la materia prima que forman los virus y las clulas.
En el nivel subcelular mltiples molculas se ensamblan y dan lugar a estructuras
especializadas como los organelos celulares (mitocondrias, cloroplastos, entre otros).
Se puede decir que la vida aparece como propiedad definitoria en el nivel celular, es
decir, la clula es la porcin ms sencilla de la materia viva que es capaz de realizar
todas las funciones vitales.
En la mayor parte de los individuos pluricelulares, las clulas se organizan de
acuerdo a sus caractersticas y funciones conformando tejidos como el conectivo,
muscular, epitelial, nervioso. Los tejidos estn ordenados en estructuras funcionales,
denominadas rganos como el corazn y los pulmones en los animales, o las hojas y
las races en las plantas. Las funciones biolgicas bsicas se llevan a cabo por un
sistema o aparato, que es una asociacin coordinada de tejidos y rganos. Los
organismos pluricelulares estn formados por sistemas que actan en forma
coordinada y precisa.
Un individuo es un solo organismo de una especie determinada, por ejemplo el
hombre, el tiburn y la hormiga. Cuando se renen a todos los individuos de una
misma especie que viven en un mismo lugar, en el mismo tiempo, y que comparten el
mismo hbitat forman una poblacin. Estas poblaciones interactan de distinta
manera con otras poblaciones del lugar constituyendo una comunidad, por ejemplo la
poblacin de elefantes de la sabana africana. Esta comunidad comparte el mismo
lugar fsico que presenta caractersticas particulares y cuando se relacionan con el
medio fsico constituye a un ecosistema, y el conjunto de ecosistemas forman un
bioma caracterizado por las condiciones climticas que determinan un gran
biosistema regional. Por ejemplo, cuando se habla de la selva, no nos referimos a la
selva amaznica o a la africana sino a todas las selvas del orbe. El conjunto de todos
los biomas integran a la biosfera, que es la capa de la Tierra donde se existe vida.

Gua Metodolgica de Biologa

44

Desde aqu, surgen otros niveles superiores de organizacin que estudian los
astrnomos como que nuestro planeta Tierra es parte de un Sistema Solar que a su
vez pertenece a una galaxia, la Va Lctea, que es una de las miles de millones de
galaxias que conforman el Universo.


NIVELES DE ORGANIZACIN DE LA MATERIA
Subatmico Protones, neutrones y electrones
Atmico Carbono, Hidrgeno, Oxgeno
Molecular Monosacridos, aminocidos, nucletidos.
Macromolecular Polisacridos, protenas, cidos nuclicos, lpidos complejos, virus
Subcelular Organelos celulares: mitocondrias, cloroplastos, ribosomas,
Celular
Clula procarionte y eucarionte Organismos unicelulares: bacterias, algas,
levaduras, protozoarios
Tisular Tejidos conectivo, epitelial, muscular, nervioso
rganos Corazn, pulmones, estmago
Sistmico Sistema circulatorio, digestivo, respiratorio
Organismos Individuos pluricelulares, animales y vegetales superiores
Poblacional Parvada de aves, banco de atunes
Comunitario Bosque
Ecosistema Ecosistemas y biomas terrestres y acuticos: Bosque tropical, arrecifes de coral
Biosfera Todos los biomas del planeta
Cosmolgico Planetas, estrellas, galaxias y universo
Gua Metodolgica de Biologa

45



ACTIVIDAD
Escribe en una hoja de tu libreta y en forma de lista, los niveles de organizacin de la materia de forma
descendente. Con el trabajado documental de las ramas de la biologa investigadas, ubica cada ciencia
utilizando llaves o corchetes de acuerdo al nivel o los niveles correspondientes a su campo de estudio.
Primero delimita el campo de accin de la Biologa.
En forma grupal, el profesor o algn alumno voluntario har lo mismo tratando de incluir todas las
ciencias investigadas por todos los alumnos.




ACTIVIDAD
Elabora un collage por equipo referente a los niveles de organizacin de la materia, exponerlo en
plenaria.


Gua Metodolgica de Biologa

46

LECTURAS SUGERIDAS
Biggs, Kapicka y Lundgren; (1999); Biologa, la dinmica de la vida; Mc Graw
Hill, Mxico; 737 pginas.
Buican, D; (1996); Historia de la Biologa; segunda edicin; Acento editorial,
serie Flash; Espaa; 91pginas.
Consejo Nacional para la enseanza de las Biologa; (1975); Biologa; CECSA,
Mxico. 960 paginas.
Garca, H. (1997). La vuelta al mundo del doctor Balmis o los desconocidos
Nios Hroes en Gentica para el Futuro. Coleccin Esto es Qumica y
qu?, Facultad de Qumica, UNAM. Mxico. pp. 6074
Gmez Caballero, J. A. y Pantoja Alor, Jerjes (2003) El origen de la vida desde
un punto de vista geolgico. Boletn de la Sociedad Geolgica Mexicana.
Tomo LVI, Nm. 1. Mxico. pp. 5686.
http://www.geociencias.unam.mx/~alaniz/SGM/200356Gomez.pdf
Lazcano Araujo, A.; (1996) El origen de la vida; Quinta reimpresin; Trillas;
Mxico; 107 pginas.
Ledesma M., I. (1993), Biologa: "Ciencia o naturalismo, en Ciencia y
Desarrollo, CONACYT, mayo junio. Mxico. pp. 7077.
Llera Domnguez; (1984); Temas para un futuro bilogo; Segunda Edicin,
UNAM; Mxico; 569 pginas.
Paul de Kruife Los cazadores de microbios.
Gua Metodolgica de Biologa

47

Rodrguez, L.F.; (1986); Un universo en expansin; Fondo de cultura
econmica, Mxico; 111pginas.
Rojas Pea, I. (2004) El Origen de la Vida sobre la Tierra. Universit`a degli studi
di Genova. Italia. 36 pginas.
http://www.lunanueva.cl/files/articulos/El_Origen_de_la_Vida_en_la_Tierra_v3.pdf

VIDEOS RECOMENDADOS
Cosmos de Carl Sagan

TIC
Proyecto Bisfera.
http://recursos.cnice.mec.es/biosfera/

BIBLIOGRAFA
Bernal, J.D. (1994). La Ciencia en la Historia. Nueva Imagen UNAM. Mxico. pp
1226
Cervantes, M. y Hernndez, M. (2004) Biologa General. Publicaciones
Cultural. Mxico. pp 1242
Gonzlez, Vector. Genomica en Mxico, Como ves? Ao I, Nm. 1. Mxico,
1998, p 26.
Prez Granados P. Alejandro y Molina Cern Mara de la Luz. Biologa Ed.,
Santillana, Mxico. Primera edicin 2007
Vzquez, C.R. (2006). Biologa I. Publicaciones Cultural. Mxico. pp 48
Gua Metodolgica de Biologa

48

BLOQUE 2
Las molculas de la vida

Gua Metodolgica de Biologa

49



Gua Metodolgica de Biologa

50


COMPETENCIAS GENRICAS Y SUS ATRIBUTOS A DESARROLLAR EN EL BLOQUE 2

Se autodetermina y cuida de si
Se reconoce y valora a si mismo y aborda problemas y retos teniendo en cuenta
los objetivos que se persigue.
Elige y practica estilos de vida saludables.

Se expresa y comunica
Escucha, interpreta y emite mensajes pertinentes en distintos contextos mediante
la utilizacin de medios, cdigos y herramientas apropiados.

Piensa crtica y reflexivamente
Desarrolla innovaciones y propone soluciones a problemas a partir de mtodos
establecidos.
Sustenta una postura personal sobre temas de inters y relevancia general,
considerando otros puntos de vista de manera crtica y reflexiva.

Aprende de forma autnoma
Aprende por iniciativa e inters propio a lo largo de su vida.

Trabaja de forma colaborativa
Participa y colabora de manera efectiva en equipos diversos.

Participa con responsabilidad en la sociedad
Participa con una conciencia cvica y tica en la vida de su comunidad, regin,
Mxico y el mundo.

Gua Metodolgica de Biologa

51

2.1. CULES SON LOS BIOELEMENTOS NECESARIOS PARA LA VIDA?
Todos los seres vivos estn constituidos, cualitativa y cuantitativamente por los
mismos elementos qumicos. De todos los elementos que se hallan en la corteza
terrestre, slo unos 25 son componentes de los seres vivos. Esto confirma la idea de
que la vida se ha desarrollado sobre unos elementos concretos que poseen unas
propiedades fisicoqumicas idneas acordes con los procesos qumicos que se
desarrollan en los seres vivos.
Se denominan elementos biogensicos o bioelementos a aquellos elementos
qumicos que forman parte de los seres vivos. Atendiendo a su abundancia (no
importancia) se pueden agrupar en tres categoras: Bioelementos principales o
primarios, secundarios o microelementos y oligoelementos.

BIOELEMENTOS PRINCIPALES O PRIMARIOS (C, H, O, N).
Son los elementos mayoritarios de la materia viva, constituyen el 95% de la masa
total. Las propiedades fisicoqumicas que los hacen idneos son las siguientes:
Forman entre ellos enlaces covalentes, compartiendo electrones
El carbono, nitrgeno y oxgeno, pueden compartir ms de un par de electrones,
formando enlaces dobles y triples, lo cual les dota de una gran versatilidad para el
enlace qumico
Son los elementos ms ligeros con capacidad de formar enlace covalente, por lo
que dichos enlaces son muy estables.
A causa de la configuracin tetradrica de los enlaces del carbono, los diferentes
tipos de molculas orgnicas tienen estructuras tridimensionales diferentes (fig.
2.1). Esta conformacin espacial es responsable de la actividad biolgica.
Las combinaciones del carbono con otros elementos, como el oxgeno, el
hidrgeno, el nitrgeno, etc., permiten la aparicin de muchos grupos funcionales
que dan lugar a las diferentes familias de sustancias orgnicas. Estos presentan
Gua Metodolgica de Biologa

52

caractersticas fsicas y qumicas distintas, y dan a las molculas orgnicas
propiedades especficas, lo que aumenta las posibilidades de crear nuevas
molculas orgnicas por reaccin entre los diferentes grupos.
Los enlaces entre los tomos de carbono pueden ser simples (C - C), dobles (C = C)
o triples.
Fig. 2.1 Estructura tridimensional del carbono

BIOELEMENTOS SECUNDARIOS
Los encontramos formando a todos los seres vivos, y en una proporcin del 4.5%.
BIOELEMENTOS SECUNDARIOS
Azufre
Se encuentra en dos aminocidos (cistena y metionina), presentes en todas las
protenas. Tambin en sustancias como la coenzima A
Fsforo
Forma parte de los nucletidos de los cidos nucleicos, de coenzimas y fosfolpidos
(esenciales de las membranas celulares). Forma parte de los fosfatos, sales minerales
abundantes en los seres vivos.
Magnesio
Forma parte de la clorofila, y en forma inica acta como catalizador, junto con las
enzimas, en muchas reacciones qumicas del organismo.
Calcio
Forma el carbonato de calcio de los huesos. En forma inica interviene en la contraccin
muscular, coagulacin sangunea y transmisin del impulso nervioso.
Sodio
Catin abundante en el medio extracelular; necesario para la conduccin nerviosa y la
contraccin muscular
Potasio
Catin ms abundante en el interior de las clulas; necesario para la conduccin nerviosa
y la contraccin muscular
Cloro Anin ms frecuente; mantiene el balance de agua en la sangre y fluido intersticial
Gua Metodolgica de Biologa

53

OLIGOELEMENTOS
Se denominan as al conjunto de elementos qumicos que estn presentes en los
organismos en forma vestigial, pero que son indispensables para el desarrollo
armnico del organismo.
OLIGOELEMENTOS
Hierro
Esencial para la sntesis de clorofila, catalizador en reacciones qumicas y forma parte
de los citocromos de la respiracin celular, y en la hemoglobina para el transporte de
oxgeno.
Manganeso Interviene en la fotolisis del agua, durante el proceso de fotosntesis en las plantas.
Iodo Necesario para la sntesis de la tiroxina, hormona que interviene en el metabolismo
Flor Forma el esmalte dentario y de los huesos.
Cobalto Forma parte de la vitamina B12, necesaria para la sntesis de hemoglobina.
Silicio
Proporciona resistencia al tejido conjuntivo, endurece tejidos vegetales como en las
gramneas.
Cromo Interviene junto a la insulina en la regulacin de glucosa en sangre.
Zinc Acta como catalizador en muchas reacciones del organismo.
Litio
Acta sobre los neurotransmisores y la permeabilidad celular. En dosis adecuada puede
prevenir estados depresivos.
Molibdeno
Forma parte de las enzimas vegetales que actan en la reduccin de los nitratos por
parte de las plantas.
Nquel Importante para el buen funcionamiento del pncreas.
Cobre
Interviene en la fotosntesis, contribuye a la formacin de glbulos rojos y al
mantenimiento de vasos sanguneos, nervios, sistema inmunolgico y huesos.
Boro
En las plantas es esencial para el mantenimiento de la estructura de la pared celular y
de las membranas.
Vanadio Regulacin del metabolismo de los lpidos
Estao
Importante para el crecimiento capilar, mejora el funcionamiento del sistema
inmunolgico y de los reflejos.
Selenio
Es un antioxidante, estimula el sistema inmunolgico e interviene en el funcionamiento
de la glndula tiroides.
Gua Metodolgica de Biologa

54

Se han aislado unos 60 oligoelementos en los seres vivos, pero solamente 16 de
ellos pueden considerarse comunes para casi todos, y estos son: hierro, manganeso,
nquel, cobre, zinc, flor, iodo, boro, silicio, vanadio, cromo, cobalto, selenio, estao y
molibdeno. Las funciones que desempean, se pueden apreciar en el cuadro anterior.
ACTIVIDAD
Localiza en una tabla peridica y escribe el smbolo de los bioelementos que constituyen a los seres
vivos en el espacio correspondiente a la cuadricula que se representa en la tabla peridica de los
elementos de abajo. Ilumina con tres colores distintos los bioelementos principales, los bioelementos
secundarios y los oligoelementos o elementos traza.


Gua Metodolgica de Biologa

55


ACTIVIDAD
Completa el siguiente cuadro realizando una investigacin documental.

bioelemento
alimentos que lo
contienen
funcin que desempea en los
seres vivos
Cules serian las
consecuencias de una
deficiencia?
















Gua Metodolgica de Biologa

56











Qu bioelementos eliminaras de un organismo? Por qu?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
Qu criterio se sigue para clasificar a los bioelementos en principales, secundarios y oligoelementos?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
Escribe el bioelemento cuya carencia est relacionada con las siguientes enfermedades:

Caries dental__________________ Anemia ______________________
Bocio________________________ Osteoporosis__________________
Gua Metodolgica de Biologa

57

2.2. CUL ES LA IMPORTANCIA DE LAS BIOMOLCULAS INORGNICAS?
Las biomolculas son todas aquellas molculas que constituyen a los seres vivos, las
cuales pueden ser de naturaleza inorgnica, como el agua, y de origen orgnico, como
carbohidratos, lpidos, protenas y cidos nuclicos.

EL AGUA
El agua es un compuesto inorgnico indispensable para la existencia y desarrollo de
todos los tipos de vida. Se encuentra en la naturaleza en tres estados: lquido en los
ocanos y en las aguas continentales, en estado slido en los polos y en la nieve de las
montaas, y en estado gaseoso en forma de vapor en la atmosfera.
Debido a que no sufre cambios apreciables durante su utilizacin biolgica, en mu-
chas ocasiones no se le da importancia; sin embargo, gracias a ella se llevan a cabo las
diferentes reacciones bioqumicas que sustentan la vida. La principal funcin biolgica
del agua se basa en su capacidad para disolver sustancias o mantener otras en
suspensin o en forma coloidal, las cuales se describen a continuacin:
Solucin: Sistema homogneo que consta de un disolvente y uno o varios solutos, en
el cual no podemos distinguir su separacin. Por ejemplo, en el agua de mar las sales
son solutos y el agua es el solvente.
Coloide: Sistema intermedio, es decir, entre homogneo y heterogneo con una fase
dispersa y otra dispersora; a simple vista presenta el efecto Tyndall (dispersin de la
luz). Los coloides son importantes, ya que 90% de la materia viva se encuentra en este
estado. Por ejemplo, el protoplasma celular, humor vtreo y el plasma sanguneo.
Suspensin: Sistema heterogneo que consta de dos fases: dispersa y dispersora, y es
posible distinguir la separacin de una con la otra. Por ejemplo, agua y arena; la fase
dispersora es el agua y la fase dispersa, la arena.
La diferencia entre los tres sistemas est determinada por el tamao de las
partculas. La mayora de los organismos contienen gran cantidad de agua; en algunos
Gua Metodolgica de Biologa

58

casos hasta 95% de su peso (ej., medusas); cerca de 70% del cuerpo humano es agua y
solo ciertos tejidos, como huesos, pelos y dientes, contienen una baja concentracin.
El cuerpo humano pierde agua de manera continua a travs de diferentes medios
como el sudor, la orina, la respiracin y las heces; el hombre requiere recuperar
aproximadamente 1.5 litros de agua como mnimo al da para efectuar todas sus
funciones biolgicas en forma adecuada. Una prdida de 10% del contenido de agua
es causa de enfermedad y una prdida de 20% puede causar la muerte.

ESTRUCTURA DE LA MOLCULA DEL AGUA
La molcula del agua no es lineal, es altamente polar; constituida por dos tomos de
hidrgeno unidos por enlace covalente con un tomo de oxgeno que forma una
estructura tridimensional. Los dos tomos de hidrgeno se unen a uno de oxgeno e
integran una molcula de forma irregular, pues los tomos de hidrgeno quedan a los
lados del oxgeno en un ngulo de 104.5, producindose una desigual distribucin de
las cargas elctricas (fig. 2.2).

Fig. 2.2 Estructura tridimensional del agua

PROPIEDADES FISICOQUMICAS DEL AGUA
Dentro de las propiedades qumicas del agua destaca la polaridad.
La electronegatividad del oxgeno hace a la molcula de agua muy polar; adems de
que la hace capaz de formar puentes de hidrgeno con otras molculas de agua y con
diferentes biomolculas, como protenas y carbohidratos principalmente. Los puentes
de hidrgeno que se forman entre molculas de agua son muy dbiles comparados
Gua Metodolgica de Biologa

59

con los enlaces covalentes que existen entre los tomos de oxgeno e hidrgeno, pero
al ser muchos van a permitir que se estabilicen estructuras en protenas y cidos
nuclicos.
La temperatura tiene un efecto importante sobre la intensidad de interaccin que
existe entre las molculas de agua, de tal forma que a bajas temperaturas se favore-
cen los puentes de hidrgeno, mientras que a altas se inhibe su formacin. El hielo
tiene 100% de puentes de hidrgeno, mientras que el vapor de agua carece de ellos.
Las funciones biolgicas humanas ocurren normalmente en un intervalo de tempe-
ratura muy corto, alrededor de 37C, que es la del cuerpo humano; se considera que a
esta temperatura se conservan de 35 a 47% de puentes de hidrgeno.

Propiedades fsicas del agua
El agua es inodora, incolora, inspida y transparente, siendo la nica sustancia en
estado natural sobre la Tierra en abundancia y en sus tres estados al mismo tiempo
(lquido, slido y gaseoso), siempre y cuando la temperatura sea de 0.098C y la
presin sea de 4.58 mm de mercurio. A este fenmeno se le denomina punto triple
del agua.
A continuacin estudiaremos sus caractersticas fsicas que son:
Densidad: El agua se comporta diferente a los dems lquidos (ya que stos se
contraen al enfriarse y se congelan alcanzando su mxima densidad), en tanto que el
agua alcanza su mxima densidad a los 4C sin congelarse y esta densidad es de
0.9999, o sea, prcticamente 1.0, valor que se considera como valor patrn de
comparacin para las densidades de los dems lquidos.
Gracias a los puentes de hidrgeno (fig. 2.3), el estado slido presenta separacin
entre las molculas y, por tanto, su densidad es menor que la del agua lquida, por lo
que flota en ella. Esta caracterstica permite la vida acutica en zonas fras, ya que en
lagos, ros y mares de estas zonas se forma una capa de hielo en la superficie al
descender la temperatura, la cual protege el agua situada bajo ella de los descensos
trmicos del exterior.
Gua Metodolgica de Biologa

60


2.2. Formacin de puentes de hidrgeno

Punto de ebullicin y de congelacin: Son muy altos, lo que permite que exista en
estado lquido en una amplia gama de temperaturas y favorece la existencia de seres
vivos en ambientes con temperatura extrema.
Calor especfico. ste es muy alto y permite que el agua, cuando se encuentra en
grandes extensiones y volmenes, sea regulador de la tempera-tura ambiental. En un
organismo realiza los cambios en la temperatura corporal.
Calor latente de vaporizacin. Es el nmero de caloras requerido para transformar
un gramo de lquido a vapor. Al ser elevado convierte el agua en un termorregulador
en los organismos tanto vegetales como animales.
Capilaridad. Es el resultado tanto de la cohesin como de la adhesin del agua y se
manifiesta en fenmenos como la ascensin del agua de la raz a las hojas de las
plantas.
Cohesin. Es la fuerza de unin entre dos partculas de la misma naturaleza.
Adhesin. Es la fuerza de unin entre dos partculas de distinta naturaleza.
Disociacin. En el agua lquida, adems de molculas de agua (aisladas o agrupadas
por puentes de hidrgeno), existe una pequea proporcin de molculas disociadas
en sus iones.
Gua Metodolgica de Biologa

61

En el agua pura la concentracin de los iones H
+
e OH

es la misma, por lo que


resulta neutra. El pH en este caso es de 7.0, un pH menor de este valor indica acidez y
mayor alcalinidad. En los fluidos biolgicos, las variaciones del pH afectan en gran
medida la actividad de muchas molculas.
ste es el caso de las protenas y, en concreto, de las enzimas. Por ello, en el
transcurso de la evolucin, los seres vivos han adquirido mecanismos que mantienen
constante el pH: son los sistemas tampn o amortiguadores.


ACTIVIDAD
Investiga, cules serian los sntomas o alteraciones que se presentaran como consecuencia de la
deshidratacin en los humanos?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
____________________________________________________________________
______________________________________________________________________
______________________________________________________________________



Gua Metodolgica de Biologa

62

ACTIVIDAD
Durante el invierno, en ecosistemas muy fros, como ros, lagos, mares y estanques se congelan en su
superficie y forman una capa de hielo que flota sobre el agua, mientras el agua permanece en estado
lquido sin congelarse, permitiendo que la vida contine. Cul es la razn para que el agua se
comporte de esta manera?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
A qu se debe que las molculas de agua se puedan unir entre s, lo cual le confiere mayor presin?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
Porque es tan importante la tensin superficial para los insectos?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________

Gua Metodolgica de Biologa

63

ACTIVIDAD
Haz una investigacin documental sobre las propiedades biolgicas del agua. Con esa informacin y de
las propiedades fisicoqumicas del agua, elabora un mapa conceptual donde integres las propiedades
fsicas, qumicas, y biolgicas del agua y las diversas funciones que el agua desempea en los seres
vivos.



















Gua Metodolgica de Biologa

64

LAS SALES MINERALES
Las sales minerales son molculas inorgnicas que desempean una funcin en el
organismo dependiendo del estado fsico en que se encuentran:
1. Sales insolubles o precipitadas. Forman estructuras slidas que suelen cumplir
funciones de proteccin y sostn, por ejemplo:
Caparazones de CaCO3 de crustceos y moluscos o caparazones silceos de
radiolarios y diatomeas.
Esqueleto interno de vertebrados, cuya parte mineral est formada por la
asociacin de varios compuestos minerales (fosfato, cloruro, fluoruro y CaCO3).
Determinadas clulas vegetales incorporan sales minerales en su pared de
celulosa, por ejemplo: las clulas que se encuentran en los bordes de la caa (las
impregnaciones silceas las transforman en cuchillos afilados) o las que forman
parte de los pelos de la ortiga, que se vuelven frgiles y al rozarlos se fracturan y
se convierten en jeringuillas que inyectan su contenido custico.
Tambin en el citoplasma de clulas de algunos vegetales se acumulan cristales de
oxalato clcico, as que el exceso de su ingesta puede contribuir al desarrollo de
clculos renales o biliares.
En las clulas animales existen cmulos de minerales con muy diferentes misiones;
por ejemplo, los otolitos del odo interno que son cristales de CaCO3 que
intervienen en el mantenimiento del equilibrio, o las partculas de xidos de hierro
presentes en numerosas especies y que el parecer utilizan como brjula interna
para orientarse en su desplazamiento.
Asociadas a otras molculas como la hemoglobina.

2. Sales solubles en agua o en disolucin. Se encuentran disociadas en sus formas
inicas (cationes y aniones) correspondientes, las cuales son responsables de su
actividad biolgica.
Los principales cationes (+) son: sodio, potasio, magnesio, amonio, el catin
ferroso y el frrico. Los principales aniones () son: cloruro, carbonato,
bicarbonato y fosfato.
Gua Metodolgica de Biologa

65

Como funciones de los cationes podemos mencionar:
La participacin en reacciones bioqumicas.
La regulacin de la concentracin de agua en el interior del organismo, a fin de
mantener el equilibrio hdrico de los seres vivos.
La regulacin de fenmenos vitales como la transmisin del impulso nervioso, la
contraccin muscular y la coagulacin de la sangre (Na
+
, K
+
y Ca
++
).
La regulacin del pH tanto intracelular como extracelular.
La regulacin de la solubilidad de determinadas protenas que son activas y
estables en disoluciones salinas y no lo son en agua pura.

ACTIVIDAD
Elabora un mapa mental donde integres los dos estados en que se encuentran las sales minerales, y
las funciones que realizan en los organismos.













Gua Metodolgica de Biologa

66

2.3. CULES SON LAS BIOMOLCULAS ORGNICAS?
Existen cuatro grupos principales de biomolculas orgnicas: carbohidratos (cuyos
monmeros son los monosacridos), lpidos (sus monmeros son los cidos grasos),
protenas (sus unidades son los aminocidos) y los cidos nuclicos (formados por
monmeros conocidos como nucletidos).

MONMEROS Y POLMEROS
Para entender cmo se encuentran estructurados los seres vivos y la manera en qu
funcionan, es necesario contar con un conocimiento bsico de los tomos y de las
molculas que los forman; as pues las interacciones entre estos tomos y molculas
producen estructuras, mismas que son las responsables del crecimiento, el
movimiento y todas las dems caractersticas de un ser vivo.
La mayora de las biomolculas son muy grandes y estn constituidas por grandes
cadenas, por la unin de pequeas molculas o monmeros. A las molculas resultan-
tes se les llama polmeros. Cuando estos polmeros son muy grandes se les denomina
macromolculas como en el caso de muchas protenas y el ADN.




CARBOHIDRATOS
Los carbohidratos son miembros de una familia de compuestos orgnicos que se
caracterizan por tener varios grupos hidroxilos y por lo menos potencialmente un
grupo aldehdico o cetnico. Un alcohol polivalente es una molcula orgnica que
tiene ms de un radical alcohlico (C OH), por ejemplo el glicerol.
Gua Metodolgica de Biologa

67

La palabra carbohidrato literalmente significa carbn con agua (carbn hidratado)
o hidrato de carbono, y se les conoce as por tener carbn, hidrgeno y oxgeno, stos
dos ltimos en la misma proporcin que en el agua (2:1); sin embargo, en la frmula
emprica se observa que eso no es cierto.
C
n
H
2n
O
n

Tambin se les conoce como sacridos (sacar en latn significa azcar), glcidos
(glucos en griego significa dulce) o azcares; desempean su principal funcin
biolgica como energticos, o sea, que de ellos se obtiene energa para procesos
vitales. Un gramo de carbohidratos proporciona 4 caloras. Adems, desempean
funciones estructurales y de reserva.

Clasificacin de los carbohidratos
Se pueden clasificar segn dos criterios:
De acuerdo con el grupo funcional que poseen: se dividen en aldosas por
presentar un grupo aldehdo en el C1 ( CHO) y cetosas por presentar un grupo
cetona en el C2 ( CO).
De acuerdo con su complejidad estructural o nmero de unidades que contengan
se dividen en: monosacridos o azcares simples (al hidrolizarse no se degradan en
azcares ms sencillos), oligosacridos (al hidrolizarse se producen de dos a diez
unidades de monosacridos) y polisacridos (al hidrolizarse producen gran nmero de
monosacridos).

Monosacridos
Son carbohidratos que no pueden desdoblarse por hidrlisis y se nombran por el
nmero de tomos de carbono en su cadena con la terminacin osa: triosas, tetrosas,
pentosas, hexosas, etctera. La ribosa y desoxirribosa (pentosas) son los azcares que
forman parte de los cidos nuclicos ARN (cido ribonucleico) y ADN (cido
Gua Metodolgica de Biologa

68

desoxirribonucleico). Las hexosas tienen seis tomos de carbono; son las ms
abundantes en la naturaleza y las ms importantes molculas desde el punto de vista
fisiolgico y nutricional.


Glucosa Galactosa Fructuosa

La D-glucosa se encuentra ampliamente distribuida en la naturaleza en frutas y
plantas, tambin se encuentra en la sangre del hombre que contiene cerca de 100 mg
de glucosa por 100 ml. Si la concentracin de glucosa aumenta aparece en la orina; al
exceso de glucosa en la sangre se le denomina hiperglucemia (hiper = elevado, glucos
= dulce, hemo = sangre) y es una de las consecuencias de la enfermedad llamada
diabetes.
Cuando nivel sanguneo de glucosa es menor que el normal, se presenta
hipoglucemia (hipo = bajo). La glucosa es la molcula energtica por excelencia;
adems de proveer la energa para el organismo, puede almacenarse en forma de
glucgeno en animales o almidn en las plantas.

Oligosacridos
(oligo = poco, sacar = azcar): El nmero mximo de monosacridos que se
encuentran en los oligosacridos es de 10 a 12; de acuerdo con el nmero de
unidades de monosacridos, los oligosacridos pueden ser: disacridos (dos
monosacridos), trisacridos (tres monosacridos), tetrasacridos (cuatro
monosacridos), etc. Los disacridos ms comunes son: la maltosa, formada por dos
glucosas; la lactosa, el azcar de la leche, formado por una glucosa y una galactosa; y
la sacarosa, el azcar de las frutas, formado por una glucosa y una fructosa.

Gua Metodolgica de Biologa

69



Maltosa Lactosa
Glucosa + glucosa Glucosa + Galactosa

Enlace glucosdico
Los monosacridos se unen entre s para formar oligosacridos y polisacridos; la
unin la realizan por el enlace glucosdico, en el cual dos carbones quedan unidos por
un tomo de oxgeno y durante su formacin se libera una molcula de agua.
El enlace glucosdico puede ser o . El primero se caracteriza por ser fcilmente
digerible, mientras que los compuestos que tienen el enlace beta glucosdico son ms
difciles de digerir.

Polisacridos
Al hidrolizarse producen muchas unidades de monosacridos. Estos carbohidratos se
encuentran de manera abundante en la naturaleza. Sus molculas son muy grandes y
complejas, tienen elevado peso molecular, son ligeramente solubles en agua y no son
muy activos qumicamente. Como ejemplo de polisacridos tenemos sustancias de re-
serva como el almidn (fig. 2.4) y el glucgeno. En el caso de sustancias estructurales,
tenemos al polisacrido celulosa (fig. 2.5), principal constituyente de la pared celular
de las plantas y a la quitina que forma parte del exoesqueleto de los artrpodos.


+ H2O
Glucosa + Fructuosa Sacarosa + Agua
Gua Metodolgica de Biologa

70


Fig. 2.4. Amilosa, polisacrido constituyente del almidn (uniones 1-4)



Fig. 2.5 Celulosa (uniones 1-4)



ACTIVIDAD
Menciona los tres tipos principales de alimentos de los cuales los animales obtienen su energa.
___________________________________________________________________________________
___________________________________________________________________________________
Qu papel desempean los carbohidratos en la dieta?
___________________________________________________________________________________
___________________________________________________________________________________
Qu diferencia existe entre el almidn y la celulosa con respecto a la dieta?
___________________________________________________________________________________
___________________________________________________________________________________
Gua Metodolgica de Biologa

71

___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
Una dieta rica en productos de carne aprovecha de forma menos eficiente la energa capturada
originalmente por las plantas a travs de la fotosntesis que una dieta vegetariana? Explica por qu.
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________

LPIDOS
Los lpidos son un grupo heterogneo de sustancias que se definen por una
caracterstica fsica, ser insolubles en agua pero solubles en disolventes orgnicos
como el ter, cloroformo y benceno; los lpidos son un grupo muy importantes de
biomolculas por las funciones que desarrollan dentro de las clulas, por ejemplo, son
grandes reservas de energa, componentes estructurales de las membranas celulares,
hormonas, vitaminas, etc.

cidos grasos
Los monmeros que constituyen a los lpidos son los cidos grasos, que son cidos
orgnicos que poseen un grupo carboxilo (COOH) y una cadena con ms de cuatro
carbonos. Son los componentes ms abundantes de los lpidos, generalmente no se
encuentran en forma libre, sino de manera esterificada.
Gua Metodolgica de Biologa

72

Bajo ciertas condiciones, un alcohol y un cido orgnico reaccionarn de manera
caracterstica para formar un compuesto llamado ster.


En donde R1 representa el alcohol y R2 el cido carboxlico. Esta reaccin se
efecta por la combinacin del grupo OH del alcohol con el grupo COOH del
cido, originando agua y ster.
Los cidos grasos se han dividido en dos grandes grupos: saturados e insaturados,
dependiendo de la ausencia (saturados) o presencia (insaturados) de dobles ligaduras
en su molcula. Como ejemplos de cidos grasos saturados tenemos a las grasas
animales y son los siguientes:
cido butrico
cido palmtico
cido esterico
cido araqudico

cidos grasos insaturados. stos presentan dobles ligaduras y existen en las grasas
vegetales, por ejemplo:
cido palmitolico
Gua Metodolgica de Biologa

73

cido oleico
cido linolico
cido linolnico

Los cidos grasos esenciales son aquellos que no pueden ser sintetizados por
nuestro organismo y tienen que ser ingeridos en la dieta vegetal, por ejemplo
tenemos el linoleico y el linolnico.

CLASIFICACIN DE LOS LPIDOS
La clasificacin de los lpidos se basa de manera general en determinar que sustancias
estn dentro de la estructura de su molcula; utilizando este criterio se clasifican en:
simples, compuestos y sustancias asociadas a los lpidos.
Lpidos simples
Son steres de cidos grasos con diversos alcoholes; pueden ser grasas neutras o
triacilglicridos y ceras.

Grasas neutras o triacilglicridos
Estn formadas por steres de cidos grasos y glicerol; aquellos con cidos grasos no
saturados o nmero bajo de tomos de carbono se encuentran en forma lquida a
temperatura ambiente y son los aceites. Son importantes como depsito de reserva
del tejido celular subcutneo o como soporte y proteccin de rganos internos.
Gua Metodolgica de Biologa

74

Cuando se encuentran esterificados los tres hidroxilos del glicerol se llaman
triacilglicridos, forma en la que se encuentran en la naturaleza y entran en nuestro
organismo.
Las grasas y los aceites son susceptibles a diferentes reacciones de deterioro que
reducen el valor nutritivo del alimento y adems producen compuestos voltiles que
imparten olores y sabores desagradables. El trmino rancidez se ha usado para
describir los diferentes procesos a travs de los cuales se alteran los lpidos. Existe la
rancidez hidroltica y la rancidez oxidativa.


Triestearina (lpido simple)

La primera se debe bsicamente a la accin de las enzimas lipasas que liberan
cidos grasos de los triacilglicridos; mientras que la segunda se debe a la accin del
oxgeno y de las enzimas lipoxigenasas sobre las instauraciones de los cidos grasos.

Ceras
Son steres de cidos grasos de cadena larga con alcohol, distinto a la glicerina. Como
ejemplo tenemos la cera de abeja y la esperma de ballena. En los animales se
encuentran especialmente como secreciones y pueden servir como cubierta
protectora de la piel o pelambre por actuar como impermeabilizante. La misma
funcin protectora la tienen en las plantas, donde las ceras pueden encontrarse
recubriendo el fruto o las hojas.
Gua Metodolgica de Biologa

75

Lpidos compuestos
Son lpidos constituidos por carbono, hidrgeno, nitrgeno y fsforo, dentro de stos
se encuentran los fosfolpidos, glucolpidos y lipoprotenas.

Fosfolpidos.
Se forman por la unin de un alcohol polivalente (glicerol), cidos grasos y cido
fosfrico. Su funcin consiste en estructurar las membranas de la clula como la
membrana celular o la de organelos como las mitocondrias o el complejo de Golgi.
Los fosfolpidos se dividen en dos zonas: la del glicerol y el grupo fosfato resultan
polares, por lo que son hidroflicas; mientras que las de los cidos grasos son
apolares, por lo que son hidrofbicas. Por poseer ambas caractersticas esta molcula
se llama anfiptica (fig. 2.6). Su importancia radica en su capacidad para formar
bicapas que son la base estructural de las membranas biolgicas.

Glucolpidos o cerebrsidos.
Se forman por la unin de alcoholes polivalentes con cidos grasos, grupos amino y un
azcar que generalmente es la glucosa o la galactosa. Forman parte estructural del
tejido nervioso y sirven como aislantes.


Fosfolpido (lpido compuesto)
Gua Metodolgica de Biologa

76


Fig. 2.6. Estructura de un fosfolpido
Lipoprotenas
Son lpidos simples o compuestos combinados con protenas; forman parte
estructural de membranas celulares y subcelulares; son responsables del transporte
de lpidos en la sangre, tejidos y rganos.

Lpidos derivados
Son sustancias asociadas a los lpidos. Tambin son conocidos como lpidos
miscelneos o insaponificables, son molculas con propiedades de solubilidad muy
semejantes a las de los lpidos. Se les clasifica en esteroides y carotenoides.

Esteroides
Son molculas cuya estructura difiere de la de los lpidos simples y compuestos; se
encuentran en una gran variedad de formas estructurales y muchos son
caractersticos de plantas y animales. Sin embargo, todos los esteroides poseen una
misma estructura general de 17 carbones dispuestos en tres anillos de 6 C, unidos a
uno de 5 C llamado ncleo esteroidal o ciclo-pentanoperhidrofenantreno (CPPF).
Gua Metodolgica de Biologa

77

Los esteroides se dividen en dos grupos de importancia biolgica, son los esteroles
y algunas hormonas; entre los esteroles ms conocidos tenemos el colesterol, que
tiene influencia en la fluidez y estabilidad de las membranas biolgicas, y el ergosterol
que se transforma en vitamina D debido a la radiacin ultravioleta.
Hormonas. Son hormonas esteroideas las producidas en la corteza de la cpsula
suprarrenal (aldosterona y cortisol) y en las glndulas sexuales (testosterona y
estradiol).


Testosterona Progesterona








Estradiol Colesterol
Gua Metodolgica de Biologa

78

Carotenoides
Son sustancias de origen vegetal que se encuentran en forma de pigmentos (rojo,
naranja o amarillo). Tienen importancia por ser precursores en la sntesis de vitaminas
como la A para la vista, la E cuya carencia provoca esterilidad por falta de
desarrollo de las clulas sexuales, y la K que interviene en la coagulacin de la
sangre.


ACTIVIDAD
Elabora un crucigrama con los principales conceptos de lpidos.


















Gua Metodolgica de Biologa

79


ACTIVIDAD
Solicitar a los alumnos que lleven algunos de los productos que consumen a diario y observen en las
etiquetas si en esos alimentos especifican lo que contienen y si tienen lpidos, carbohidratos, vitaminas
y en qu cantidad.
Integren equipos de trabajo colaborativo, compartan sus resultados y reprtenlos en el siguiente cuadro.
Por ltimo analicen si estn consumiendo la cantidad adecuada de estos nutrientes, en caso de haber
deficiencia, especfica cules son y cmo pueden mejorar su dieta.







Gua Metodolgica de Biologa

80


ACTIVIDAD.
Explica la importancia del colesterol en tu organismo y argumenta los daos que puede ocasionar el
exceso.
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
_________________________________________________________________________________

Argumenta cual es la relacin que existe entre el colesterol y el estrgeno?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________

Gua Metodolgica de Biologa

81

ACTIVIDAD
Elabora un cuadro sinptico de los lpidos



























Gua Metodolgica de Biologa

82

VITAMINA FUNCIN CARENCIA FUENTES
L
I
P
O
S
O
L
U
B
L
E
S

Vitamina A
(retinol)
Mantenimiento y crecimiento
de los tejidos, dientes y
huesos; vital para la visin y las
membranas mucosas.
Conjuntivitis, piel seca y rugosa,
visin imperfecta.
Zanahorias, espinacas, vsceras
de animales, perejil,
mantequilla, boniato, atn,
quesos
Vitamina D
(colecalciferol)
Transporta el calcio de los
alimentos hacia el hueso. Se
sintetiza por exposicin a la luz
solar.
Raquitismo, alteraciones
musculares, reblandecimiento
seo
Sardinas, atn, quesos grasos,
margarina, championes,
huevos, pescado, leche,
yogurt.
Vitamina E
(tocoferol)
Mantenimiento de las
membranas celulares y
proteccin de los tejidos de
pulmones, piel, hgado y
pecho.
Distrofias musculares, atrofia
testicular, alteraciones vasculares
degenerativas, implantacin
defectuosa del huevo en el tero.
Aceite de maz, germen de
trigo, avellanas, almendras,
coco, aceite de oliva,
margarina, nueces.
Vitamina K
(fitoquinona)
Coagulacin sangunea y
ligamentos de calcio.
Hemorragias
Hojas de vegetales verdes,
hgado de bacalao
H
I
D
R
O
S
O
L
U
B
L
E
S

Vitamina C
(cido ascrbico)
Mantenimiento de vasos
sanguneos, cicatrizacin,
funciones inmunolgicas y
utilizacin de hierro.
Hemorragias, deficiencias
celulares, alteracin del tejido
seo y retardo en cicatrizacin.
Kiwi, guayaba, pimiento rojo,
perejil, limn, coliflor,
espinaca, fresa, naranja.
Vitamina B1
(tiamina)
Usado para los msculos,
funciones nerviosas,
crecimiento y utilizacin de
carbohidratos.
Inflamacin de los nervios,
reduccin de los reflejos ten-
dinosos, anorexia, fatiga y
trastornos gastrointestinales.
Huevos, carnes de cerdo o de
vaca, cacahuetes, garbanzos,
lentejas, avellanas, nueces,
ajo.
Vitamina B2
(riboflavina)
Metabolismo de cidos grasos
y aminocidos, y formacin de
eritrocitos y anticuerpos.
Dermatitis seborreica, fatiga
visual, y conjuntivitis.
Germen de trigo, almendras,
cocos, championes, huevos,
lentejas.
Vitamina B3
(niacina)
Mantiene saludable al sistema
nervioso, piel y digestin.
Dermatitis, diarrea.
Hgado de ternera, almendras,
germen de trigo, arroz
integral, setas.
Vitamina B5
(cido pantotnico)
Sntesis de cidos grasos y
colesterol, incluyendo bilis,
vitamina D y hormonas
Hiperreflexia, deficiente actividad
de las glndulas suprarrenales.
Vsceras, levadura de cerveza,
yema de huevo, cereales
integrales.
Vitamina B6
(piridoxina)
Metabolismo de protenas,
formacin de anticuerpos y
sntesis de hormonas.
Apata, depresin, calambres,
nauseas, mareo, parestesias
anemia y debilidad muscular.
Sardinas, nueces, lentejas,
vsceras, garbanzos, carne de
pollo, atn, avellana, pltanos.
Vitamina B8
(biotina)
Metabolismo de grasas,
carbohidratos y protenas.
Atrofia de la mucosa digestiva y
abolicin de la sensibilidad
profunda.
Frutos secos, frutas, leche,
hgado, levadura de cerveza.
Vitamina B10
(cido flico)
Formacin de eritrocitos ,
divisin celular. Digestin y
metabolismo de protenas.
Anemias, leucopenias, lesiones
gastrointestinales y diarreas.
Lechuga, levadura de cerveza,
zanahorias, tomate, perejil,
espinacas.
Vitamina B12
(cianocobalamina)
Metabolismo de protenas,
grasas y carbohidratos;
formacin de eritrocitos; y
mantenimiento del sistema
nervioso.
Atrofia de la mucosa digestiva y
abolicin de la sensibilidad
profunda.
Huevos, productos lcteos y
alimentos de origen animal.
Gua Metodolgica de Biologa

83

VITAMINAS
Las vitaminas por s mismas son molculas orgnicas, que se necesitan en pequeas
cantidades en la dieta de los animales superiores. Estas molculas cumplen el mismo
papel en casi todas las formas de vida, pero en el curso de la evolucin los animales
superiores han perdido capacidad de sintetizarlas. El hombre necesita al menos 12
vitaminas en la dieta. Las rutas de la biosntesis de las protenas de las vitaminas son
complejas; por lo tanto, es ms eficaz biolgicamente ingerir vitaminas que sintetizar
las enzimas necesarias para construirlas a partir de molculas ms sencillas. La
deficiencia en vitaminas puede generar enfermedades en todos los organismos que
necesitan estas molculas.
Las vitaminas se clasifican en dos grupos en funcin de su solubilidad en agua o en
disolventes apolares: hidrosolubles y liposolubles (tabla 2.1).
Las vitaminas hidrosolubles estn compuestas por el cido ascrbico (vitamina C)
y una serie conocida como el complejo de las vitaminas B. La serie de vitaminas B son
coenzimas.
La deficiencia en vitaminas origina una serie de trastornos; sin embargo, muchos
de los sntomas pueden generarse a partir de otras condiciones diferentes a la
carencia de una vitamina. Por esta razn, y debido a que las vitaminas se necesitan en
cantidades relativamente pequeas, las situaciones patolgicas que provienen de las
deficiencias de vitaminas a menudo son difciles de diagnosticar.
La necesidad confirmada de vitamina C (cido ascrbico) es relativamente fcil de
demostrar. Esta vitamina hidrosoluble no se utiliza como coenzima, sino que es
necesaria para mantener la actividad de la polihidroxilasa. Esta enzima sintetiza 4-
hidroxiprolina, un aminocido necesario en el colgeno, la protena ms abundante
del tejido conjuntivo en los vertebrados que raramente se encuentra en otra parte.
Las vitaminas liposolubles participan en diferentes tipos de funciones y se
designan con las letras A, D, E, y K (tabla 2.1). La vitamina K funciona en la
coagulacin normal de la sangre. La vitamina A (retinol) es el precursor del retinal,
que es el grupo fotoabsorbente de la rodopsina en el ojo. La deficiencia de esta
vitamina produce cegura nocturna; adems, los animales jvenes necesitan vitamina
Gua Metodolgica de Biologa

84

A para crecer. El cido retinoico, que posee un grupo carboxilato terminal en lugar del
grupo alcohol terminal del retinol, acta como una molcula seal activando la
transcripcin de genes especficos que participan en el crecimiento y desarrollo.
El metabolismo de calcio y fsforo est regulado por una hormona derivada de la
vitamina D; su deficiencia impide la formacin correcta del hueso en animales
jvenes. La deficiencia de vitamina E (-tocoferol) en ratas provoca esterilidad. Esta
vitamina reacciona y neutraliza las especies reactivas del oxgeno, como los radicales
hidroxilos, que pueden oxidar a los lpidos insaturados de las membranas daando las
estructuras celulares.
ACTIVIDAD
Completa el siguiente cuadro de vitaminas
vitamina fuente carencia funcin

Kiwi, guayaba, pimiento
rojo, perejil, limn, coliflor,
espinaca, fresa, naranja
Hemorragias, deficiencias
celulares, alteracin del tejido
seo y retardo en cicatrizacin.

B12
Atrofia de la mucosa digestiva y
abolicin de la sensibilidad
profunda, anemia.


Huevos, carnes de cerdo o de
vaca, cacahuetes, garbanzos,
lentejas, avellanas, nueces, ajo.
Usado para los msculos,
funciones nerviosas,
crecimiento y utilizacin de
carbohidratos.
A
Mantenimiento y crecimiento de
los tejidos, dientes y huesos;
vital para la visin y las
membranas mucosas

Sardinas, atn, quesos
grasos, margarina,
championes, huevos,
pescado, leche, yogurt

Gua Metodolgica de Biologa

85

PROTENAS
Las protenas son polmeros biolgicos de aminocidos. Los aminocidos presentes en
las protenas de todos los seres vivos son 20; stos se caracterizan por poseer un
grupo amino y un grupo carboxilo unido a un carbn y se diferencian por su radical R
(fig. 2.7). Dependiendo de dicho radical pueden ser polares, apolares, con carga o
neutros. La unin entre los aminocidos es por el enlace peptdico, (fig. 2.8) que se
forma al reaccionar el grupo carboxilo de un aminocido al amino de otro con
produccin de una molcula de agua. Una vez formado el enlace peptdico se habla
de residuos de aminocidos.
Los aminocidos, como todos los compuestos orgnicos, presentan ismeros; los
de valor biolgico son los de la forma L. El porqu se eligieron stos durante el
proceso de la evolucin se desconoce (fig. 2.9).

Fig. 2.7. Frmula general de un aminocido


Fig. 2.8. Enlace peptdico
Gua Metodolgica de Biologa

86


Fig. 2.9. Aminocidos naturales
Gua Metodolgica de Biologa

87


ACTIVIDAD
Utiliza el esquema de la figura 2.7 de aminocidos naturales. Observa bien las frmulas y realiza el
siguiente procedimiento.

1. Circula con de azul el grupo carboxilo del carbono alfa de cada aminocido
2. Circula de rojo el grupo amino de cada aminocido
3. Haz lo mismo para el grupo R con color verde

Qu tiene en comn lo que hiciste?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________

Qu tiene de diferente?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________


Las protenas en el ser humano son del orden de 100,000 y debemos recordar que
todas las funciones de los seres vivos involucran al menos una protena, de ah su
importancia. El peso molecular es variable y puede alcanzar hasta millones; por
ejemplo, podemos citar la albmina (del huevo), la insulina, la globulina (en el suero)
y la hemoglobina (en los glbulos rojos). Cada protena tiene una forma espacial nica
(tridimensional) que responde a la funcin especfica que tendr en el organismo.
Gua Metodolgica de Biologa

88

Por la complejidad estructural de las protenas, para facilitar su estudio se han
establecido cuatro niveles estructurales que son: primario, secundario, terciario y
cuaternario. La estructura primaria se refiere al orden en que se encuentran los
aminocidos dentro de la molcula proteica. Dada la naturaleza de cada aminocido
este orden determina los siguientes niveles estructurales.


Fig. 2.10. Estructura de las protenas
Gua Metodolgica de Biologa

[89]

La estructura secundaria es la relacin espacial entre los residuos de aminocidos
que quedan cerca de la molcula proteica. En este nivel podemos encontrar
estructuras repetitivas como la hlice y la hoja plegada (lmina ).
La estructura terciaria es la forma total de la molcula proteica que se estabiliza
por puentes de hidrgeno, de disulfuro (entre cistenas) e interacciones electrostti-
cas. En el caso de protenas con ms de una subunidad se refiere a la forma de cada
una de ellas; por ejemplo, la hemoglobina est constituida por dos subunidades A y
dos B. La estructura cuaternaria es la forma total de una protena integrada por
diferentes subunidades (fig, 2.10)
La estructura de una protena facilita su funcin, la cual est determinada por
diversos factores en el medio; stos son temperatura, pH, salinidad y otras sustancias
qumicas. Cuando una protena por efecto de estos factores pierde su forma y, por
tanto, su funcin, decimos que se ha desnaturalizado.
De acuerdo con su funcin, las protenas se clasifican en:
Catalizadoras: Que reciben el nombre de enzimas y aceleran reacciones qumicas
en los organismos.
Transportadoras: Acarrean elementos de un lugar a otro, como la hemoglobina
que transporta el oxgeno de los alvolos pulmonares a cada una de las clulas del
organismo.
Generadoras de movimiento: Como las que provocan la contraccin muscular.
Anticuerpos: Son protenas principalmente del grupo de las globulinas que
protegen al organismo de sustancias extraas al cuerpo.
Estructurales: Forman parte de las membranas celulares y estructuras
extracelulares. Todos los tejidos las poseen en mayor o en menor grado.
Hormonales: Algunas protenas realizan funciones de control metablico como la
insulina que regula los niveles de azcar en la sangre.

Gua Metodolgica de Biologa

[90]

ACTIVIDAD
A continuacin tienes encerrados en una elipse cada uno de los aminocidos naturales unidos mediante
un enlace llamado ___________________

Colorea de color diferente cada uno y dibuja con una raya el enlace peptdico entre uno y otro.
Los aminocidos estn formados por un grupo ___________, un grupo_________________ y un
________________
Cuntos aminocidos son?_________
Escribe debajo de cada elipse su nombre abreviado
Cuntas molculas de agua de forman?__________
Con quin reacciona el grupo amino?____________
Cmo se llama una cadena de 2 aminocidos?_________________
Cmo se llama una cadena de ms de 2 aminocidos?_______________
Cuntos aminocidos debe tener una protena? _____________
Escribe en el siguiente espacio la reaccin del que se lleva a cabo para formar un enlace peptdico.

Glicina Alanina Valina Leucina Isoceleucina
Cistena
Treonina
Serina Prolina
Fenilanina
Glutamina

Acido
Glutmico
Arginina
Tirosina Triptfano Metionina
Lisina
Histidina
Acido
asprtico
Asparagina
Gua Metodolgica de Biologa

[91]


ACTIVIDAD
A travs de un juego didctico el alumno construye los compuestos qumicos complejos a partir de las
unidades o ladrillos de los que estn formados
Baraja bioqumica
Material: Cartulina o cartoncillo y plumones
La baraja estar formada de una carta de ribosa, una de desoxirribosa, galactosa, fructuosa, cuatro
cartas de glucosa alfa, cuatro de glucosa beta, cuatro de aminocidos, cuatro cidos grasos, dos cartas
de glicerol, dos de grupo fosfato, dos de ATP (que ser el comodn) y, por ltimo, cinco de las diferentes
bases nitrogenadas, es decir, citosina, timina, adenina, guanina y uracilo. Dando un total de 31 cartas.
Por ejemplo el profesor puede pedir: celulosa, protena, lactosa y fosfolpido.
Los alumnos utilizarn las cartas para formar el compuesto orgnico que se les pide.



ACTIVIDAD
Investiga qu padecimientos se generan como consecuencia de una ingesta excesiva de protenas y
cuales por una baja ingesta. En equipo elaboren un cartel promoviendo la ingesta equilibrada de estos
nutrientes y los peligros que representan los desordenes alimenticios. En una plenaria expongan su
cartel al grupo y por ltimo elaboren un reporte de conclusiones.

Gua Metodolgica de Biologa

[92]

ENZIMAS (BIOCATALIZADORES)
Son catalizadores biolgicos por excelencia, todas las reacciones metablicas
dependen de ellas. Hasta 1989 se pensaba que todas las enzimas eran de naturaleza
proteica; los estudios de los premios Nobel de Qumica, el estadounidense Thomas
Cech y el canadiense Sidney Altman, demostraron que molculas de ARN tienen
funciones catalticas durante la sntesis de protenas y la maduracin del propio ARN.
Se ha propuesto que en es-te caso se hable de ribozimas, trmino que deriva de la
combinacin de enzima y cido ribonucleico.
Aunque cada enzima tiene su propio mecanismo de accin, podemos decir que
todas disminuyen la energa de activacin de la reaccin que catalizan.
Debemos recordar que la energa de activacin es aquella que debe aportarse para
que una reaccin ocurra; por lo tanto, si sta disminuye la reaccin se facilita.

Una enzima acta sobre uno o varios reactantes, que reciben el nombre de
sustratos, para lograr uno o varios productos. Esta accin involucra una serie de
cambios conformacionales que permiten la interaccin con los sustratos, su
transformacin y hasta la produccin y liberacin de los mismos.
La unin del sustrato a la enzima se lleva a cabo en el sitio activo, que siempre es
una hendidura o bolsa hidrofbica en la estructura proteica. Esta unin se describe
mediante el modelo del sitio activo inducido, propuesto en 1958.
De acuerdo con este modelo, el sitio activo tiene una conformacin que cambia a
la entrada del sustrato (sufre un cambio conformacional) y obliga a ste a cambiar,
pero al formarse el producto se da un nuevo cambio conformacional que provoca la
salida del mismo. De esta manera, el sitio activo puede compararse con un guante
que adopta la forma exacta de la mano slo hasta que sta se encuentra dentro del
guante; este modelo fue dado por Daniel Koshlan en Berkeley (fig. 2.11).
Gua Metodolgica de Biologa

[93]


Fig. 2.11. Modelo de cambio conformacional

Las enzimas se clasifican de acuerdo con el tipo de reaccin que catalizan. Por
ejemplo, los oxidorreductasas, que catalizan reacciones de oxidoreduccin. Las
transferasas, que transfieren grupos entre compuestos.
Las cinasas, que producen un grupo fosfato desde un compuesto de alta energa
a otro. Las mutasas, que cambian la posicin de grupos dentro de la misma molcula.
Las fosforilasas, que rompen enlaces por adicin de un grupo fosfato. Las hidrolasas,
que rompen un enlace por adicin de una molcula de agua. Las fosfatasas, que
hidrolizan grupos fosfato de compuestos de alta energa. Las liasas, separan grupos
por mecanismos diferentes a la hidrlisis generando dobles enlaces.
Algunas enzimas para funcionar requieren un grupo no proteico que recibe el
nombre de grupo prosttico, como es el caso de la hemoglobina cuyo grupo
prosttico es el hemo; que contiene Fe
2+
. Otros ejemplos son el de la coenzima A y el
del fosfato de piridoxal. La enzima proteica sin el cofactor se llama apoenzima y
cuando se une a ste, holoenzima (fig. 2.12).
Varias enzimas deben sintetizarse como precursores inactivos, stos reciben el
nombre de zimgenos. Como ejemplo de stos tenemos al pepsingeno que por
hidrlisis se transforma en pepsina, que es una enzima proteoltica del estmago; otro
ejemplo es el tripsingeno que se transforma en tripsina, enzima proteoltica del
intestino delgado.
Gua Metodolgica de Biologa

[94]


Fig. 2.12. Estructura de las enzima

Las enzimas resultan inalteradas por las reacciones que catalizan, por lo que la
misma molcula puede utilizarse una y otra vez, lo cual resulta muy econmico para
los organismos, pues no hay un gran recambio de estos compuestos.
La velocidad de reaccin de las enzimas depende de varios factores como son: la
concentracin de la enzima, la concentracin del sustrato, la temperatura, el pH y la
salinidad del medio (fig. 2.13). En los cinco casos existen valores ptimos de
funcionamiento, los cuales coinciden con los va-lores fisiolgicos o con los mrgenes
de vida del organismo.

Fig. 2.13. Efecto de la temperatura y el pH en la efectividad enzimtica

Gua Metodolgica de Biologa

[95]


ACTIVIDAD
Elabora un mapa conceptual de enzimas

















Gua Metodolgica de Biologa

[96]

CIDOS NUCLEICOS

Este grupo de biomolculas son de gran importancia en el avance del conocimiento
del desarrollo de la estructura y funcin los seres vivos, sobre todo en los aspectos de
la reproduccin celular, de la conservacin de la informacin y herencia gentica, y
del control de las funciones celulares.
Se les puede conceptuar de varias maneras, pero en general se les concibe como
macromolculas naturales, polmeros de nucletidos de una cadena (ARN) o dos
cadenas (ADN), cuya funcin principal es la de contener y permitir la transcripcin y
traduccin de la informacin gentica (cdigo gentico), para la elaboracin de
protenas, sustancias importantes para la estructura y funcionamiento de las clulas.
Es importante destacar que los nucletidos son las unidades estructurales
(monmeros) a partir de los cuales se forman las largas cadenas de cidos nucleicos,
por ello, es necesario desarrollar un concepto sobre estas sustancias.

Nucletidos
Son molculas formadas por un azcar, una base nitrogenada y un radical fosfato (fig.
2.14). El azcar puede ser ribosa en los ribonucletidos, o desoxirribosa en los
desoxirribonucleotidos; la diferencia entre estos azcares es que la primera tiene un
grupo OH en la posicin 2 y la segunda slo hidrgeno. Los carbonos de estos
azcares se numeran como primos debido a que los de las bases nitrogenadas a los
que se unen llevan una numeracin natural.

Bases nitrogenadas
Son compuestos derivados de la purina o de la pirimidina. Las pricas son adenina y
guanina; y las pirimdicas son citosina, timina y uracilo. Las frmulas de estas bases se
muestran en la figura 2.15.
Gua Metodolgica de Biologa

[97]


Fig. 2.14. ucletido de adenina Fig. 2.15. Bases nitrogenadas


Algunos nucletidos como monmeros cumplen funciones especficas como el
adenosn trifosfato (ATP), que es la molcula energtica de los organismos.
El adenosn monofosfato (AMP) cclico sirve como mensajero desde la membrana
celular al interior de la clula y otros que actan como parte de coenzimas o en
procesos tales como la fotosntesis.
Sin embargo, su papel ms llamativo lo cumplen como elementos de construccin
de los cidos nuclicos: el cido desoxirribonucleico (ADN) y cido ribonucleico (ARN).
stos contienen la informacin gentica que se transmite de una generacin a otra y
permiten su expresin en la sntesis de protenas.

cidos nucleicos
En los cidos nuclecos el azcar de un nucletido se une al azcar del siguiente a
travs de un grupo fosfato formando un eje (o esqueleto) comn (fig. 2.16). Las bases
de los nucletidos unidos de esta manera quedan perpendiculares al eje mencionado.
Las bases forman pares especficos entre ellas, los cuales se estabilizan por puentes de
hidrgeno como se indica en la figura 2.17.
Gua Metodolgica de Biologa

[98]


Fig. 2.16. Enlace fosfodister


Fig. 2.18. Cadenas polinucleotdicas complementarias




Fig. 2.17. Bases complementarias


El emparejamiento de bases da lugar a la formacin de una doble hlice,
estructura helicoidal constituida por dos hebras que corren en sentidos opuestos (fig.
2.18). Estos pares de bases aportan dos mecanismos, siendo uno de ellos el
responsable de copiar la informacin gentica de una cadena del ADN existente para
formar una nueva cadena doble y otro para pasar informacin a una cadena de ARN.



Gua Metodolgica de Biologa

[99]


ACTIVIDAD
A travs de un Cuadro de Venn establece las diferencias y similitudes de los cidos nuclicos.














Modelo de Watson y Crick
James Watson y Francis Crick dedujeron un modelo estructural tridimensional para el
ADN que explicaba un patrn de difraccin de rayos X y fue tambin la fuente de
conocimientos notables de las propiedades funcionales de los cidos nuclicos (fig.
2.19).
ADN ARN
Gua Metodolgica de Biologa

[100]

Las caractersticas del modelo de ADN de Watson y Crick son:
Hay dos cadenas helicoidales de polinucletidos enrolladas a lo largo de un eje
comn. Las cadenas transcurren en direcciones opuestas.
Los ejes de azcar fosfato se sitan en el exterior y, por tanto, las bases de pricas
y pirimdicas estn en el interior de la hlice.
Las bases son casi perpendiculares al eje de la hlice y las bases adyacentes estn
separadas 3.4 A. La estructura helicoidal se repite cada 3.4 A, de modo que hay
10 bases igual a 3.4 A por vuelta/3.4 A por base por cada vuelta de hlice;
asimismo, hay una rotacin de 36 grados por base (360 por vuelta completa/10
bases por vuelta).
El dimetro de la hlice es de 20 A.

Fig. 2.19. Modelo tridimensional del AD de Watson y Crick

Gua Metodolgica de Biologa

[101]

El modelo de doble hlice del ADN y la presencia de pares de bases especficos
sugiri inmediatamente cmo podra replicarse el material gentico; la secuencia de
bases de una hebra de la doble hlice determina de manera precisa la secuencia la
otra hebra. Una base de guanina de una hebra se empareja siempre con una base de
citosina de la otra hebra; una base de adenina siempre con una de timina y as
sucesivamente; por tanto, la sepa-racin de la doble hlice en sus dos cadenas
componentes producir dos moldes de hebra simple sobre los que se podrn formar
nuevas dobles hlices, cada una con la misma secuencia de bases que la doble hlice
original; como consecuencia, al replicarse el ADN, una de las cadenas de cada
molcula del ADN descendiente se sintetizar de nuevo, mientras que la otra se
transmitir intacta desde la molcula del ADN original; lo que se conoce como
replicacin semiconservativa (fig. 2.20).














Fig. 2.20. Replicacin semiconservativa del AD



Gua Metodolgica de Biologa

[102]

Funciones del ARN
Si bien el ADN contiene la informacin gentica del organismo, el ARN permite que
sta se transforme en protenas. Como se detallar en la unidad 3, existen tres tipos
de ARN; el mensajero (ARNm), que lleva la informacin del ncleo al citoplasma; el
ribosomal (ARNr), que conforma la maquinaria necesaria para la sntesis proteica (y
tiene actividad cataltica), y el de transferencia (ARNt), que transporta los
aminocidos necesarios para sintetizar la nueva cadena proteica.

ACTIVIDAD
Realiza una investigacin documental y completa el siguiente cuadro

tipo de ARN forma localizacin funcin
















Gua Metodolgica de Biologa

[103]

2.4. EL DOGMA CENTRAL DE LA BIOLOGA ES UNIVERSAL?
Watson y Crick sospecharon que una vez esclarecida la estructura del ADN, sera ms
fcil entender su funcin. Razonaron, entonces, que si el ADN era la molcula que
transmita la informacin gentica a las clulas hijas, esta deba funcionar como un
cdigo. Para mitad de los 50s se saba que la secuencia de nucletidos en el ADN
daba origen a una secuencia de polipptidos. Es decir, la molcula de ADN deba
dirigir la sntesis de protenas.
ADN Protenas
Pero si esto era cierto, faltaba dilucidar una pieza del rompecabezas ya que se
saba que las protenas se sintetizaban fuera del ncleo. Cmo poda el ADN, que
estaba dentro del ncleo, dirigir la sntesis de protenas fuera del mismo? A Crick se le
ocurri la idea de que deba existir un intermediario.
ADN ? Protenas
Un posible candidato para intermediario era el ARN, que se encuentra en el
citoplasma. El ARN tena varias caractersticas que lo hacan un firme candidato:
Un esqueleto de azcares y fosfatos (a pesar de que tiene un azcar distinto, ya que el
ARN tiene ribosa en vez de desoxirribosa),
Tanto el ADN como el ARN usan las mismas bases nitrogenadas, pero el ARN tiene
uracilo en vez de timina,
El uracilo se puede unir a la adenina como lo hace la timina,
El ARN es una cadena sencilla.

Crick sintetiz esta idea a lo que llam el Dogma Central de la Biologa, que
especifica que el ADN se traduce en ARN y este, a su vez, dirige la produccin de
protenas.
Gua Metodolgica de Biologa

[104]


Segn este postulado, la informacin fluye de manera unidireccional: no puede
moverse de las protenas al ADN. Es decir, una vez que la informacin llega a las
protenas, estas no pueden ser cambiadas o, lo que es lo mismo, las protenas no
pueden influir en los genes. Si bien Crick us el trmino dogma en un sentido figurado
y quiz con humor, ya que las ideas cientficas slo son aceptadas hasta que aparezca
evidencia experimental que las desmienta, durante algn tiempo esta idea adquiri
cierta dimensin de verdad absoluta en la mayora de los libros de texto.
No obstante, la ciencia es un ente dinmico, que no se asienta en dogmas, salvo
notables excepciones. Actualmente el dogma ha sufrido cierta fisura, pues han
surgido una serie de elementos que implican la ampliacin de este dogma tan
categrico. Estas excepciones ataen, entre otras situaciones o elementos, a los
priones, ribozimas y la enzima transcriptasa inversa.
En 1971 se descubri que algunos virus, como el VIH, llevan su informacin en
forma de ARN, y que esta puede pasar al ADN de sus huspedes. Ese proceso ocurre
en sentido contrario al esquema de Crick, ya que la informacin pasa del ARN al ADN.
Adems, actualmente se sabe que tanto el ARN como las protenas pueden influir en
la expresin del cdigo gentico.

Gua Metodolgica de Biologa

[105]

Podemos resumir el Dogma Central de la Biologa como sigue (fig. 2.21):
1. La informacin contenida en el ADN se transcribe a una molcula de ARN (proceso
llamado transcripcin) que recibe el nombre de ARN mensajero o ARNm.
2. La informacin contenida en el ARNm es "leda" por estructuras llamadas ribosomas,
traduciendo el lenguaje nuclico al lenguaje proteco. La relacin que hay entre ambos
lenguajes recibe el nombre de Cdigo Gentico (fig. 2.24). As, la palabra GTG en
cidos nuclicos en protena se traduce por Histidina; TTT por Lisina, y as
sucesivamente. Este proceso se denomina traduccin.
El flujo de informacin para la expresin de los genes, es por lo tanto:
ADN ARN Protenas

Fig. 2.21. Dogma Central de la Biologa

Gua Metodolgica de Biologa

[106]

Pero la otra funcin del ADN es la de transmitirse a su descendencia. Esto lo hace el
ADN duplicndose a s mismo en el proceso conocido como replicacin. Ahora bien: en la
reproduccin sexual, el nuevo individuo recibe la mitad del ADN de cada uno de sus
padres. As, este individuo es genticamente distinto de ambos: as es como la re-
produccin sexual genera variabilidad. Si el ADN se transmitiera a la clula o al individuo
hijo sin variacin, como copia exacta del ADN parental, estaramos ante la reproduccin
clnica (fig. 2.22).

REPLICACIN O DUPLICACIN DEL ADN
La transmisin de informacin implica que el ADN es capaz de duplicarse de tal
manera que se obtengan dos molculas idnticas a partir de la molcula inicial. Este
proceso se llama replicacin o duplicacin.
El ADN se replica de una manera semiconservativa, es decir que la nueva cadena se
sintetiza utilizando una de las hebras preexistentes como molde. Las molculas de ADN
hijas estn formadas por una cadena nueva y una original que sirve como molde.
Para que esto ocurra, la clula debe abrir la doble cadena de ADN en una secuencia
especfica y copiar cada cadena. En la replicacin participan varias enzimas. Las ADN
polimerasas sintetizan una nueva cadena de ADN. Para esto utilizan como molde una de
las hebras y un segmento corto de ADN, al que se le agregan los nuevos nucletidos
complementarios. Este segmento funciona como cebador (primer, en ingls). La ADN
polimerasa agrega nucletidos al extremo 3 de la cadena en crecimiento.
La ADN polimerasa copia la cadena molde con alta fidelidad. Sin embargo, introduce
en promedio un error cada 107 nucletidos incorporados. Tiene, adems, la capacidad de
corregir sus propios errores, ya que puede degradar ADN que acaba de sintetizar.
Otras enzimas que participan en este proceso son: la ADN primasa (que sintetiza el
primer de ARN), la ADN ligasa (que une extremos 5 con 3 que hayan quedado luego de la
sntesis), la ADN helicasa y las ADN topoisomerasas ADN (que evitan que el ADN se
enrede en el proceso), las rotenas de unin al ADN (facilitan la apertura de la doble
hebra).
Gua Metodolgica de Biologa

[107]


Fig. 2.22. Replicacin del AD

TRANSCRIPCIN
Cuando una parte de la informacin contenida en la molcula de ADN debe ser
utilizada en el citoplasma de la clula para la construccin de las protenas, esta es
transcrita como ARNm utilizando las mismas correspondencias de base que el ADN
visto anteriormente, pero con la diferencia ya sealada de que la timina es
reemplazada por el uracilo. Uno a uno se van aadiendo los ribonucletidos en
direccin 5- 3, usando de molde slo una de las hebras de la cadena de ADN y a la
ARN polimerasa como catalizador (fig. 2.23).
La operacin de trascripcin slo puede llevarse a cabo cuando dos secuencias
particulares estn presentes en el ADN: la promotora al comienzo de la secuencia y la
de corte propiamente dicha -conocida como cola de poli A (compuesto de hasta 200
nucletidos de adenina).

Gua Metodolgica de Biologa

[108]


Fig. 2.23. Transcripcin del AD

TRADUCCIN SNTESIS DE PROTENAS
La informacin gentica llevada por el ARNm deber ser traducida en el citoplasma
por una fbrica de protenas: el ribosoma. Existen muchos tipos de ARNt y cada uno
es capaz de reconocer determinados tripletes de bases (codones) del ARNm. A cada
triplete de nucletidos, los ARNt hacen corresponder uno de los veinte aminocidos
que constituyen las mayores cadenas polipeptdicas, las protenas (fig. 2.23). En los
organismos superiores la informacin gentica constituye un mosaico en los que la
Gua Metodolgica de Biologa

[109]

informacin til es interrumpida por secuencias no codificantes, aparentemente
intiles, llamadas intrones (las secuencias codificantes son llamadas exones). En la
clula eucarionte el ARNm transcribe todo, intrones incluidos.
Las secuencias supernumerarias formarn los lazos que sern cortados al mismo
tiempo que los pedazos tiles del ARN sern recolectados. Este proceso es llamado
engrosado (el cual puede dar origen a ms de una forma diferente de empalme o
empalmes alternativos de los que puede resultar la formacin de ms de un poli-
pptido funcional, a partir de una trascripcin inicialmente idntica; recin entonces,
la molcula engrosada de ARNm maduro atraviesa la membrana nuclear por los poros
nucleares, ayudada por protenas particulares de ribonucleoprotenas.


Fig. 2.23. Traduccin

Gua Metodolgica de Biologa

[110]


Fig. 2.24. Cdigo Gentico

La nueva cadena va adquiriendo su estructura secundaria y terciaria a la vez que
se va formando, de tal manera que al finalizar ya tiene su conformacin. En ocasiones
la protena no es todava funcional y debe ser procesada, aadindole algo, recortn-
dole algo o, incluso, debe unirse a otros pptidos para adquirir estructura cuaternaria.


ACTIVIDAD
Supn que la protena OMEGAS es necesaria para que la paloma mensajera vea; dicha protena est
formada por los aminocidos O, M, E, G, A y S. Supn adems que los aminocidos A y S son
esenciales. Al comer sorgo, la paloma mensajera consume abundantes aminocidos O y M. Algunos de
los aminocidos O y M sern convertidos en aminocidos E y G. Sin embargo, a menos que se
consuman trigo (rico en el aminocido A) y maz (rico en aminocido S), la protena OMEGAS no puede
ser sintetizada.
Qu ocurrira si el trigo y el maz escasearan?
Gua Metodolgica de Biologa

[111]

___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
_______________________________________________________________________________
Cmo sera la visin de las palomas mensajeras si no hubiera trigo y maz?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________

ACTIVIDAD
Utilizando el cdigo gentico deduce, Cul sera el ARNm y el polipptido resultantes de la siguientes
secuencia de ADN?
CCGCGGCATATTTATGGCAAAAGC
ARNm

Polipptido

Cuntos codones posee el ARNm? __________________
Cuntos aminocidos formaran el polipptido? __________________

Gua Metodolgica de Biologa

[112]


ACTIVIDAD
Toma tiras de cartoncillo de 5 X 15 cm y forma un eslabn, el cul representar a un monmero y nelo
con otros eslabones iguales lo cual representar al polmero. Construye tres cadenas ms, en cada una
escribe sobre cada eslabn el nombre del monmero que corresponda a uno de los cuatro polmeros
(biomolculas). Finalmente etiqueta la cadena con el respectivo nombre del polmero.
En esta actividad representars los procesos del Dogma Central: replicacin, transcripcin y traduccin.
Necesitars 200 chinches de por lo menos 5 colores distintos y 6 placas de unicel (o cartn de cajas) de
3 X 20 cm.
Replicacin.
1. Agrupa las chinches por color para representar las cinco bases nitrogenadas (amarilla = adenina,
azul = timina, verde = guanina, rojo = citosina y blanco = uracilo) del ADN y ARN
2. Usa la regla para dividir las seis tiras de unicel en seis secciones iguales. Escribe con el marcador
el ttulo de ADN.
3. Crea la secuencia de bases CCGAGTTAACCGACGTAA, utilizando las chinches del color que
hayas elegido para cada base.
4. Coloca en forma paralela otra placa de unicel y arma la secuencia complementaria de bases. Ya
tenemos nuestra secuencia y molcula completa de ADN.
5. Ahora separa ambas tiras y alinea al lado de cada una las dos tiras sobrantes. Usa mas chinches
para aparear las bases complementarias en la secuencia de la tira del ADN. Anota las secuencias
en cada seccin.

Transcripcin y Traduccin
1. Escribe con el marcador en cada tira los siguientes ttulos: ADN, ARNm y ARNt.
2. Utiliza la secuencia de bases CCGAGTTAACCGACGTAA, previamente construida, utilizando las
chinches del color que hayas elegido para cada base.
3. En la tira de unicel del ADN, pon un codn de cada seccin marcada y anota debajo de cada uno
las bases complementarias que lo constituyen. Alinea la tira de ARNm con la del ADN.
4. Usa las chinches para aparear las bases complementarias en la secuencia de la tira del ARNm.
Anota las secuencias en cada seccin.
5. Alinea la tira de ARNt con la del ARNm. Utiliza las chinches para modelar los anticodones en la tira
de ARNt.
6. Anota esta secuencia de bases en cada seccin.
Gua Metodolgica de Biologa

[113]

7. Usa el cdigo gentico de la figura para determinar los nombres de los aminocidos codificados por
la secuencia de bases del ARNm y antalos en el Unicel.
Responde las siguientes preguntas
1. Cul es la secuencia de las molculas hijas de ADN con respecto a la original?
___________________________________________________________________________________
2. En qu momento del ciclo celular ocurre la replicacin del ADN?
___________________________________________________________________________________
1. Qu pasara si el ADN no se duplicara antes de la divisin celular?
___________________________________________________________________________________
_______________________________________________________________________________
2. Qu sucede para separar las dos hebras de ADN?
___________________________________________________________________________________
_______________________________________________________________________________
3. En el modelo que construiste qu sera la polimerasa?
___________________________________________________________________________________
4. Cul es la finalidad de construir una secuencia de bases de ADN?
___________________________________________________________________________________
_______________________________________________________________________________
5. Qu paso de este modelo representa la transcripcin?
___________________________________________________________________________________
_______________________________________________________________________________
6. Qu pasos del modelo representan la traduccin?
Gua Metodolgica de Biologa

[114]

___________________________________________________________________________________
_______________________________________________________________________________
7. Cmo modificaras este modelo para explicar el apareamiento de la molcula de ARN?
___________________________________________________________________________________
_______________________________________________________________________________
8. Cmo est relacionada la secuencia de bases en los cidos nuclicos con la secuencia de
aminocidos en las protenas?
___________________________________________________________________________________
_______________________________________________________________________________


ACTIVIDAD
Si hiciramos la analoga de la sntesis proteica con la construccin de un edificio, cules seran los
protagonistas de dicha obra y por qu? Escribe la letra dentro del parntesis que corresponda


Gua Metodolgica de Biologa

[115]

LECTURAS SUGERIDAS
Frenk, Julio (1993). Triptofanito, Un Viaje por el Cuerpo Humano. Editorial Joaqun
Mortiz. Mxico.
Snchez Salinas Enrique y Ortiz Hernndez, Ma. Laura. (1998). Biologa, Sus bases
moleculares en el umbral del siglo XXI. Universidad Autnoma del Estado de
Morelos.
Cmo ves? Hormonas sexuales y el cerebro Ao 4, N 43 Revista de divulgacin de la
ciencia de la UNAM.p.p.10-14
Cmo ves? Alimentos Funcionales Salud a la carta Ao 4, N 42 Revista de
divulgacin de la ciencia de la UNAM.p.p.11-17

VIDEOS RECOMENDADOS
Un Milagro para Lorenzo
Y t que $%! Sabes?
Maravillas de la Creacin
TICs
Biologa de Curtis
http://iescarin.educa.aragon.es/depart/biogeo/varios/BiologiaCurtis/Indice%20de%20seccio
nes.htm
Biomodel Complemento al estudio de Bioqumica y Biologa Celular
http://biomodel.uah.es/

Bioxeo Recursos Biologa
http://www.bioxeo.com/plabioca.htm
Gua Metodolgica de Biologa

[116]

Cells alive
http://www.cellsalive.com

Proyecto Bisfera
http://recursos.cnice.mec.es/biosfera/

BIBLIOGRAFA
Audesirk, T, Audesirk, G y Byers, B.E. (2002). Biologa, Ciencia y Naturaleza. Prentice
Hall. Mxico. pp. 37-53
Bourges,H., Butruille, D., Villaseor J. P. y Villareal F.(1985) Qumica de la Vida. Trillas.
Temas Bsicos rea: Qumica. pp. 16-48, 62-95, 125-136.
Harper, H.A. (1976) Qumica Fisiolgica. 5 Ed. Manual Moderno. pp. 1-66
Stryer, L., Berg, J.M. y Tymoczko, J.L. (2003) Bioqumica. Revert 5. Ed. pp. 41-73,
295-328.
Gua Metodolgica de Biologa

[117]

BLOQUE 3
Clula, unidad de la vida


Gua Metodolgica de Biologa

[118]




Gua Metodolgica de Biologa

[119]


COMPETENCIAS GENRICAS Y SUS ATRIBUTOS A DESARROLLAR EN EL BLOQUE 3

Se autodetermina y cuida de si
Elige y practica estilos de vida saludables.

Se expresa y comunica
Escucha, interpreta y emite mensajes pertinentes en distintos contextos mediante
la utilizacin de medios, cdigos y herramientas apropiados.

Piensa crtica y reflexivamente
Sustenta una postura personal sobre temas de inters y relevancia general,
considerando otros puntos de vista de manera crtica y reflexiva.

Aprende de forma autnoma
Aprende por iniciativa e inters propio a lo largo de su vida.

Trabaja de forma colaborativa
Participa y colabora de manera efectiva en equipos diversos.





Gua Metodolgica de Biologa

[120]

3.1 CULES HECHOS HISTRICOS CONDUJERON AL PLANTEAMIENTO DE LA
TEORA CELULAR?

Las clulas son la unidad fundamental, estructural y funcional de los seres vivos, son la
parte ms pequea de estos. Las clulas son comparadas con una fbrica porque en
ellas se requiere de materia prima para la produccin de sustancias tiles y los
obreros son las enzimas. Algunas molculas reguladoras hacen las veces de capataces,
ya que vigilan que las actividades se realicen de acuerdo con las indicaciones
contenidas en el centro de control o ncleo, que se encuentra dentro de la molcula
de ADN.

Descubrimiento de la clula
En 1665 el cientfico ingls Robert Hooke (fig.3.1) al observar un corte fino de corcho,
identific una serie de estructuras parecidas a un panal de abejas. A estos espacios los
llam celdillas debido a que se parecan mucho a las celdas que ocupaban los monjes
en el monasterio, de ah deriv el trmino de clula. Sin embargo, a pesar de que es a
Hooke a quien se le da el crdito de descubrir las clulas, no fue el primero en
observarlas; ya que en el siglo XVII el holands llamado Anton van Leeuwenhoek, fue
el primero en observar bacterias, glbulos rojos, protozoarios y espermatozoides (fig.
3.2).
En el siglo XVII, el desarrollo tecnolgico, particularmente la invencin del
microscopio, permiti la exploracin de un mundo que antes era inaccesible para el
ojo humano; esto abri un sinfn de posibilidades y formas de aproximacin al estudio
del mundo microscpico. Sin embargo, no fue suficiente con tener instrumentos o
tcnicas que permitieran observar las estructuras o fenmenos vivos para poder
entenderlos y explicarlos, fue necesario tambin contar con marcos conceptuales que
permitieran interpretarlos. Un ejemplo de ello lo constituye el planteamiento de la
teora celular.

Gua Metodolgica de Biologa

[121]


Fig. 3.1 Robert Hooke Fig. 3.2 A. Leeuwenhoek




ACTIVIDAD
Haz una investigacin documental y con esa informacin realiza una lnea del tiempo de los personajes
y sus descubrimientos que contribuyeron al estudio de la clula. Anota en ella el ao, nombre del
cientfico y una breve oracin de la aportacin que hizo. Acurdate de llevar una secuencia cronolgica
de los acontecimientos.

A partir del descubrimiento de Hooke, una serie de naturalistas y cientficos
iniciaron la bsqueda de clulas en tejidos animales y vegetales, entre ellos se
encuentran los alemanes Friedrich Theodor Schwann y Matthias Jakob Schleiden,
zologo y botnico, respectivamente, quienes en 1838 y 1839 descubrieron que todos
los animales y vegetales estn formados de clulas (fig. 3.3).
Con ello se formulan los dos primeros principios de la teora celular:
1. Todos los seres vivos estn compuestos de una o ms clulas.
2. La clula es la unidad estructural de la vida.
Fue en 1855 que el patlogo alemn Rudolf Virchow (fig.3.3) concluy que las
clulas proceden de otras clulas semejantes, su hiptesis dio lugar al tercer
postulado de la teora celular:
3. Las clulas slo pueden originarse por divisin de una clula preexistente.
Gua Metodolgica de Biologa

[122]



Fig. 3.3 M. Schleiden, T. Schwann y R. Virchow

De aqu se concluye que la clula es la unidad:
Anatmica. Los seres vivos estn formados por una o ms clulas.
Fisiolgica. Cada clula leva a cabo todas las unciones vitales.
De origen. La clula se origina a partir de clulas preexistentes.


ACTIVIDAD
Contesta las preguntas siguientes con respecto a la Teora Celular
1. Las clulas de tu piel respiran, se nutren, excretan; si no efectuaran estas funciones, moriran. Con
cul de los postulados de la teora celular se relaciona el hecho de que las clulas de tu piel se
mantengan vivas? Por qu?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
Gua Metodolgica de Biologa

[123]

2. Despus de haber tenido un raspn, se forma una costra con sangre coagulada y los restos
muertos de clulas, y bajo la costra tu piel se regenera Con cul de los postulados de la teora celular
se relaciona la regeneracin de tu piel? Por qu?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
3. Tu cuerpo est formado por piel, msculos, huesos, etc. Estas partes, a su vez, estn constituidas
por clulas. Este hecho, Con cul de los postulados de la teora celular se relaciona? Por qu?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________
3.2 QU DIFERENCIAS HAY ENTRE CLULAS PROCARIONTES Y EUCARIONTES?
Existen dos tipos celulares bsicos clasificados con base en su organizacin y
complejidad estructural: procarionte y eucarionte.
Las clulas procariontes (pro, antes y carion, ncleo) no tienen ncleo verdadero,
el ADN se encuentra disperso en el citoplasma constituyendo un solo cromosoma o
unido a la membrana citoplsmica (fig.3.4); el ejemplo caracterstico son las bacterias.
Gua Metodolgica de Biologa

[124]

Las clulas procariontes son de menor tamao que las eucariontes. Presentan
una pared celular que rodea completamente a la membrana celular, protegindola de
las agresiones del medio externo y da forma a la clula. Los dos tipos celulares poseen
ribosomas encargados de la sntesis de protenas, sin embargo, presentan una
diferencia sustancial en cuanto al tipo de ARN ribosomal que lo forman. De aqu que
los ribosomas procariontes se denominen 70s y los eucariontes 80s por su coeficiente
de sedimentacin.
La divisin celular de las clulas procariontes se da por divisin binaria o
biparticin, el ADN se duplica y las dos copias se separan y se forman dos clulas hijas,
por esta razn la reproduccin es ms rpida que en las eucariontes; por ejemplo, una
nueva generacin de bacterias puede aparecer cada 20 o 40 minutos.
Las clulas procariontes son microorganismos asexuados (sin sexo). En algunas
bacterias se ha observado in vitro (en laboratorio) que bajo ciertas circunstancias
realizan un proceso llamado conjugacin, en el que un fragmento de ADN
denominado plsmido puede pasar de una bacteria a otra.
Por otro lado, las clulas eucariontes (eu, verdadero y carion, ncleo) son mucho
ms complejas, tanto estructural como funcionalmente. El ADN se localiza dentro de
una doble membrana llamada envoltura nuclear que lo separa del resto del
citoplasma y conforma un ncleo verdadero. La complejidad de las clulas
eucariontes se basa en el desarrollo de compartimentos internos que originan
diversas estructuras subcelulares denominadas organelos como mitocondrias,
cloroplastos, ribosomas, lisosomas, aparato de Golgi, centriolos, vacuolas, retculo
endoplsmico, peroxisomas y citoesqueleto; cada organelo tiene una funcin
especializada (fig.3.5).
Por lo general, las clulas eucariontes se dividen por mitosis, donde el material
gentico (ADN) duplicado se condensa en estructuras llamadas cromosomas y se
divide en dos clulas hijas. Las clulas germinales sufren meiosis, a partir de la cual se
producen clulas hijas con la mitad del nmero de cromosomas de la clula madre,
siendo la base de la reproduccin sexual.
Gua Metodolgica de Biologa

[125]

De acuerdo con la clasificacin de seis reinos, las clulas procariontes slo estn
presentes en los reinos Arqueobacteria y Eubacteria. De ellas derivaron las clulas
eucariontes actuales presentes en los cuatro reinos restantes: Protista, Fungi, Plantae
y Animalia.

Fig. 3.4. Morfologa de una clula procarionte


Fig. 3.5. Morfologa de una clula eucarionte
Gua Metodolgica de Biologa

[126]


ACTIVIDAD
Realiza una investigacin documental para completar el siguiente cuadro comparativo entre clula
procarionte y eucarionte, escribiendo las caractersticas que las hacen distintas.

Caracterstica Clula procarionte Clula eucarionte
























Gua Metodolgica de Biologa

[127]

3.3. CMO EST ESTRUCTURADA Y CMO FUNCIONA UNA CLULA?
Entre las propiedades que comparten las clulas y que a la vez pueden considerarse
como caractersticas de los seres vivos, se encuentra su complejidad, el intercambio
de materia y energa con el medio, el mantenimiento de su medio interno, la
capacidad de autorregularse, el que tienen ADN necesario para la reproduccin, el
crecimiento y el desarrollo, as como la especializacin celular y la capacidad de
responder a estmulos.
Las clulas son entidades complejas y organizadas en trminos de orden y
regularidad. Esta estructura est basada en molculas orgnicas e inorgnicas.
La complejidad de la vida va desde las partculas subatmicas y los tomos; la
organizacin de estos tomos en molculas de pequeo y gran tamao como agua,
protenas y cidos nucleicos a su vez se organizan en estructuras subcelulares que
constituyen las clulas.
Las clulas intercambian materia y energa con el medio, esto se refiere a que las
clulas incorporan nutrientes para transformarlos a partir de una serie de reacciones
qumicas que realizan el metabolismo y con ello obtienen la energa til a la clula
para realizar todas sus actividades, como el movimiento, la reproduccin, el
crecimiento, etc. Esta energa se encuentra almacenada en una molcula altamente
energtica denominada ATP (adenosntrifosfato), la cual pertenece al grupo
bioqumico de los nucletidos.
Todos los seres vivos se alimentan, esto es, toman del medio las sustancias
necesarias para obtener energa. Los auttrofos transforman la energa solar en
energa qumica a travs de la fotosntesis; en cambio, los hetertrofos tienen que
transformar los alimentos en otros ms sencillos y a partir de stos sus clulas se
encargan de sintetizar otros compuestos ms complejos que utilizan para reparar
tejidos y llevar a cabo todas sus actividades. Toda esta serie de reacciones que se
realizan en el interior de la clula en conjunto se llama metabolismo. ste consta de
dos fases: una fase de degradacin de molculas grandes en molculas pequeas
llamada catabolismo y una fase de sntesis de molculas grandes a partir de
molculas pequeas llamada anabolismo.
Gua Metodolgica de Biologa

[128]

Las clulas mantienen constante su medio interno a travs de un proceso de
equilibrio fisiolgico denominado homestasis, propiedad importante para el
funcionamiento celular, ya que si falla se presentan alteraciones que pueden ser
determinantes y causar la muerte celular. La clula, por tanto, posee mecanismos
reguladores de todo su funcionamiento, como la reproduccin, la sntesis de
protenas, la cantidad de electrlitos, la cantidad de agua, etctera.
Las clulas tienen ADN que molcula que identifica a cada ser vivo y que contiene
las instrucciones para todo el funcionamiento celular: la reproduccin, el desarrollo,
crecimiento y funcionamiento de la clula se encuentra contenida en la secuencia de
nucletidos del ADN. Los mecanismos reguladores de la clula son tan importantes
que un cambio en la secuencia del ADN debe ser identificado y corregido por la clula,
si no se presentar una mutacin. Algunas mutaciones son tan severas que causan la
muerte del organismo. Sin embargo, las mutaciones no letales y no dainas producen
la variabilidad gentica que permite que los seres vivos evolucionen.
Las clulas responden a los estmulos del medio como el alimento, la luz, las
hormonas, los factores de crecimiento, las sustancias qumicas, la presin o la
cantidad de agua. Todas las clulas responden de manera especfica para cada
sustancia o agente externo o interno. Esto permite a las clulas sobrevivir, moverse,
iniciar la divisin celular, modificar su actividad metablica, etc. A esta capacidad de
respuesta celular se le denomina irritabilidad.

MEMBRANA CELULAR
En la dcada de 1950 se observaron por primera vez al microscopio electrnico las
membranas celulares. Qumicamente estn constituidas por una doble capa de
lpidos, carbohidratos y protenas. Para explicar su estructura, los bilogos S.J. Singer
y G.L. Nicholson, en 1972, elaboraron un modelo llamado mosaico fluido (fig. 3.6). Lo
importante de este modelo es que denota la calidad dinmica de la membrana
celular. Existen varios mecanismos por medio de los cuales la membrana es
selectivamente permeable: a) el tamao del poro, b) la solubilidad en lpidos y c) el
potencial elctrico de la membrana.
Gua Metodolgica de Biologa

[129]

Las molculas cuyo tamao coincida con el tamao del poro o sean ms
pequeas que ste podrn atravesar la membrana fcilmente. Algunas molculas
como los gases pueden atravesar la membrana debido a que son solubles en los
lpidos de sta y finalmente, la carga elctrica de los iones determina en un momento
dado qu tipo de molculas la atraviesan.


ACTIVIDAD
Elabora un mapa conceptual de las caractersticas que distinguen a las clulas
















Gua Metodolgica de Biologa

[130]

Los lpidos ms abundantes en la membrana son los fosfolpidos. En ciertas
membranas tambin existe colesterol, sustancia que en ciertas clulas animales
puede constituir hasta 50%. Las membranas de la mayor parte de los vegetales y de
las bacterias no contienen colesterol. Los grupos polares de cada capa de fosfolpidos
se orientan hacia el exterior de la bicapa y pueden interactuar con las molculas de
agua que los rodean, las cadenas hidrofbicas del fosfolpido se encuentran
orientadas hacia el interior de la bicapa. Esta bicapa de lpidos tiene consecuencias en
la estructura y funcionamiento de las clulas. Debido a la cohesin y formacin
espontnea de las bicapas nunca se observan membranas con bordes libres; siempre
son estructuras ntegras continuas. Gracias a la flexibilidad de la bicapa de lpidos, las
membranas son deformables y pueden cambiar toda su forma como ocurre durante
la locomocin o la divisin celular.
La composicin de carbohidratos de la membrana depende del tipo de clula, y la
cantidad de stos vara entre 2 y 10% del peso total. Se encuentran unidos a los
lpidos y las protenas en forma de glucolpidos y glucoprotenas, respectivamente.
Las protenas de la membrana varan desde una docena hasta 50 tipos diferentes.
Cada una se encuentra localizada y dirigida en una posicin particular de la bicapa
lipdica. Pueden ser protenas integrales, que penetran en la bicapa de lpidos; la
mayora atraviesan completamente la bicapa y tienen regiones que sobresalen en
ambos lados de la membrana hacia el espacio extracelular y el citoplsmico. Otro tipo
de protenas son las perifricas, que se localizan por completo fuera de la bicapa de
lpidos, pero ancladas por grupos de cidos grasos o por otras protenas a la superficie
extracelular o citoplsmica.

Funciones de la membrana
La membrana celular cumple varias funciones:
a) Delimita y protege la clula.
b) Es una barrera selectivamente permeable, ya que impide el libre intercambio de
materiales de un lado a otro, pero al mismo tiempo proporcionan el medio para
comunicar un espacio con otro.
Gua Metodolgica de Biologa

[131]

c) Permite el paso o transporte de solutos de un lado a otro de la clula, pues regula
el intercambio de sustancias entre el interior y el exterior de la clula siguiendo un
gradiente de concentracin;
d) Poseen receptores qumicos que se combinan con molculas especficas que
permiten a la membrana recibir seales y responder de manera especfica, por
ejemplo, inhibiendo o estimulando actividades internas como el inicio de la
divisin celular, la elaboracin de ms glucgeno, movimiento celular, liberacin
de calcio de las reservas internas, etc.


Fig. 3.6. Modelo de mosaico fluido de la membrana celular

RETCULO ENDOPLSMICO
El retculo endoplsmico es un organelo que se distribuye a travs del citoplasma,
desde la membrana nuclear hasta la membrana plasmtica. Se observan dos tipos de
retculos endoplsmicos; el rugoso (RER) y el liso (REL) (fig. 3.12), que se diferencian
entre s por los siguientes aspectos:
Gua Metodolgica de Biologa

[132]

a) Porque el RER presenta ribosomas adheridos a sus membranas y el REL no las
tiene.
b) El RER es un conjunto de canales con forma de cisternas en cuyas paredes
membranosas se realiza la sntesis de protenas con la intervencin de los
ribosomas (ARNr), el ARN mensajero y el ARN de transferencia.
c) A medida que el RER se aleja de la membrana nuclear externa y se distribuye en el
citoplasma, hay una zona de transicin donde cambia de forma (canales y cisterna)
y se observan los retculos con tubos anastomosados entre s y cuyas paredes
membranosas carecen de ribosomas.
d) Como consecuencia desarrollan funciones diferentes. En el retculo endoplsmico
liso se sintetizan algunos fosfolpidos, hormonas esteroides y cidos grasos.
Mientras que en el retculo endoplsmico rugoso se realiza la sntesis proteica y la
maduracin de las protenas de exportacin y las que se transportan a otros
organelos celulares.
Las clulas tienen cantidades distintas de REL o RER, segn sus actividades. Por
ejemplo, las clulas que secretan gran cantidad de protenas tienen una gran actividad
de RER.

COMPLEJO DE GOLGI
El complejo de Golgi, tambin conocido como aparato de Golgi (fig. 3.13 y 3.14),
consiste en cisternas aplanadas, discordes con rebordes amplios relacionados con
vesculas emergentes. Realiza funciones especficas, tales como la distribucin de
protenas y lpidos que reciben del retculo endoplsmico, algunas de estas protenas
son enzimas que se envan a los lisosomas. Transforma las protenas y los residuos de
carbohidratos para formar glucoprotenas presentes en la superficie externa de la
membrana celular. Almacena las glucoprotenas en vesculas para ser enviadas a otras
partes de la clula.
Gua Metodolgica de Biologa

[133]


Fig. 3.12. Retculo endoplsmico rugoso

Fig. 3.13. Complejo de Golgi

Fig. 3.14 Relacin entre RER y complejo de Golgi

ACTIVIDAD
Para determinar el lugar de sntesis y el camino que siguen las protenas segregadas por las clulas del
pncreas antes de salir de la clula, se realiza la siguiente experiencia: se toma el pncreas de una rata
y se corta en fragmentos hasta. Estos fragmentos se mantienen en un medio fisiolgico que contiene un
aminocido marcado, por ejemplo, leucina tritiada. Despus de un tiempo (de tres a cinco minutos), los
fragmentos de pncreas se transfieren a un medio que contiene el mismo aminocido pero sin marcar
(no radiactivo). Se toman muestras a lo largo del tiempo despus de aplicar el marcador radiactivo.
Gua Metodolgica de Biologa

[134]




Inmediatamente despus de tomarlas, las muestras son fijadas y preparadas para su examen histoauto-
radiogrfico.
a) Muestra A: se constata que tras 5 minutos se puede observar radiactividad en la regin basal de la
clula, a nivel del retculo endoplsmico rugoso
b) Muestra B: 15 minutos despus del marcado con leucina tritiada, se constata que la radiactividad
est localizada en la regin del retculo endoplsmico rugoso situada en la proximidad de los
dictiosomas del aparato de Golgi.
Gua Metodolgica de Biologa

[135]

c) Muestra C: cuando se examina una muestra tomada 20 minutos despus del marcado, se observan
protenas radiactivas en los dictiosomas
d) Muestra D: en las muestras tomadas 60 minutos despus de la experiencia, slo se observa
radiactividad en las vesculas que rodean las cisternas del aparato de Golgi, en la cara de maduracin
de los dictiosomas.
e) Muestra E: 4 horas despus, la radiactividad slo se detecta en el exterior de la clula.
Analizando esta experiencia, explica dnde se sintetizan las protenas segregadas por las clulas
pancreticas y cul es el camino que siguen hasta que salen de la clula.
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
______________________________________________________________________________
Qu relacin hay entre el retculo endoplsmico y el aparato de Golgi?
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
________________________________________________________________________________


LISOSOMAS
Los lisosomas son vesculas con una estructura muy sencilla y estn rodeados
solamente por una membrana. Contienen gran cantidad de enzimas hidrolticas
(digestivas) que degradan todas las molculas inservibles para la clula. Funcionan
como estmagos de la clula y adems de digerir cualquier sustancia que ingrese del
exterior (lisosomas secundarios o vacuolas digestivas), ingieren restos celulares viejos
Gua Metodolgica de Biologa

[136]

para digerirlos tambin, por tanto son llamados autofagosomas o vacuolas autofgi-
cas o digestivas (fig. 7.15). Cuando las clulas enferman, los lisosomas rompen su
membrana y las enzimas encerradas en su interior destruyen toda la clula en un
proceso denominado autolisis.
Actualmente se conocen unas 40 enzimas lisosmicas, todas ellas son hidrolasas
cidas del tipo de las proteasas, nucleasas, lipasas, fosfolipasas, fosfatasas,
glucosidasas y sulfatasas. Las enzimas hidrolticas de los lisosomas se forman a partir
del retculo endoplsmico rugoso y posteriormente son empaquetadas por el
complejo de Golgi, originndose as los lisosomas.


Fig. 3.15. Formacin de lisosomas a partir del complejo de Golgi

VACUOLAS
Son sacos rodeados tambin por una sola membrana. Hay diferentes tipos de
vacuolas, unas son temporales y otras permanentes. Algunas de soporte, otras de
almacenamiento de agua, desechos metablicos o alimentos y otras ayudan a la
clula a eliminar el exceso de agua del interior.
Gua Metodolgica de Biologa

[137]

RIBOSOMAS
Los ribosomas se encuentran libres en el citoplasma, aislados en grupos llamados
polirribosomas o en la parte externa del retculo endoplsmico rugoso. stos realizan
la sntesis de protenas de membrana y de protenas que algunas clulas secretoras
exportan hacia sus alrededores, como las enzimas digestivas y las hormonas
proteicas; por ejemplo: insulina. Las protenas que son transportadas dentro de los
canales, se mueven por los extremos cercanos al complejo de Golgi.
Los ribosomas completos estn formados por dos subunidades de diferente
tamao. La subunidad pequea se ajusta a la ms grande como un engrane solamente
si hay ARNm que deba ser traducido. La subunidad ms pequea contiene ms o
menos 30 protenas diferentes y las ms grandes de 45 a 50, todas estrechamente
unidas con los ARN ribosomales (fig. 3.16).
Durante la sntesis de protenas se establece un contacto entre los ARNm, ARNt y
ARNr. La superficie del ribosoma tiene cuatro sitios de unin, uno para secuencia
corta de tres nucletidos del ARNm, otro para el ARNt nuevo que lleva el aminocido
especfico para que se ensamble a la cadena polipptidica nueva, otro para el ARNt
que ha descargado el aminocido y un sitio donde la enzima peptidil transferasa
trabaja formando enlaces peptdicos entre los aminocidos adyacentes.

CITOESQUELETO
La gran variedad de filamentos protenicos del interior de las clulas le confieren
cierta consistencia a stas, que en conjunto se llaman citoesqueleto. Entre estas
estructuras se encuentran las siguientes:

Microtbulos
Estas estructuras, se localizan en el citoplasma, son cilindros huecos de 25 nm de
grosor. Dan soporte a las clulas, forman el huso acromtico durante la mitosis,
permiten el desplazamiento de los cromosomas a travs del huso mittico o
acromtico y participan activamente en transportar organelos o nutrientes dentro de
la clula.
Gua Metodolgica de Biologa

[138]


Fig. 3.16. Estructura de un ribosoma


Fig. 3.17. Estructura de un cilio

Figura 3.18. Fibras del citoesqueleto


Fig. 3.19. Disposicin del citoesqueleto en la
clula


Fig. 3.20. Estructura de un centriolo

Gua Metodolgica de Biologa

[139]

Los microtbulos estn formados por una glucoprotena que se conoce con el
nombre de tubulina (figuras. 3.18 y 3.19). En los axones nerviosos de las neuronas, los
microtbulos participan en el transporte de las protenas y otros compuestos, como
las hormonas de la hipfisis y del hipotlamo.
Los cilios y flagelos de algunos organismos unicelulares estn formados por
microtbulos y participan en la locomocin y desplazamiento de estos. Los cilios, que
son estructuras en forma de pelos microscpicos, existen en cantidad abundante
alrededor de la clula para que al agitarse les permitan desplazarse en el medio que
generalmente es lquido (fig. 3.17).

Filamentos de actina o microfilamentos
Existen otras estructuras que forman el citoesqueleto compuestas de protenas
contrctiles y presentes en gran cantidad en las clulas de msculo esqueltico. A
estos filamentos se les denomina de actina porque estn formados por la protena o
microfilamentos, ya que su grosor es de 6 a 8 nm (fig. 3.18). Se pueden asociar con
otras protenas, tales como la miosina o participan en la formacin de las uniones
intercelulares.

Filamentos intermedios
Los filamentos intermedios tienen un dimetro de 10 nm, estn formados por una
gran variedad de protenas y participan directamente en mantener la forma de la
clula y darle fuerza tnsil a sta (figs. 3.17, 3.18 y 3.19).

CENTROLO Y HUSO
Cerca del ncleo hay una pequea estructura que se llama centriolo o centro
organizador de microtbulos. Cuando inicia la divisin celular, se replica y da lugar a
dos estructuras iguales. Los centriolos son estructuras cilndricas de las clulas
animales y de las clulas de algunos vegetales inferiores (fig. 3.20). Los pares de
cilindros se separan lentamente, emigrando cada para los polos opuestos de la clula.
Durante su trayectoria organizan poco a poco entre ellos el huso acromtico.
Gua Metodolgica de Biologa

[140]

Los centriolos vistos al microscopio electrnico se aprecian como cilindros huecos
formados por nueve tripletes de microtbulos (fig. 3.20). Al inicio de la divisin
celular, como ya se mencion anteriormente, los centriolos emigran a polos opuestos.
De cada centriolo se proyecta un racimo de filamentos de protena contrctil
formando figuras llamadas ster. Cuando los filamentos han llegado a polos opuestos
se obtiene una figura semejante a dos conos unidos por su base, es decir,
ensanchadas en el ecuador, estrechas en los extremos y a la que llamamos huso
acromtico.

CLOROPLASTOS
Los cloroplastos son organelos de doble membrana, presentes nicamente en las
clulas vegetales y en protistas fotosintticos, los cuales almacenan el pigmento verde
llamado clorofila que capta la luz solar. Los cloroplastos estn constituidos de una
membrana externa que delimita al organelo del citoplasma y rodea al estroma dentro
del cual se encuentran sacos membranosos llamados tilacoides, que forman la
membrana interna; stos se apilan formando estructuras llamadas granas (fig. 3.21).


Fig. 3.21. Estructura de un cloroplasto
Gua Metodolgica de Biologa

[141]

La fotosntesis es un proceso que utilizan las plantas, algas y algunas bacterias
para sintetizar su alimento, usando como fuente de energa la luz solar que
transforma en energa de enlaces qumicos. En los organismos eucariontes, la
fotosntesis se lleva a cabo en los cloroplastos.
La luz solar contiene energa que ingresa a la atmsfera terrestre, slo una
pequea fraccin de sta es interceptada por los organismos fotosintticos. En el
interior de las clulas vegetales se encuentran los cloroplastos, que contienen un
pigmento de color verde llamado clorofila. Este pigmento absorbe la energa de la luz
solar y la cede para la elaboracin (sntesis) de carbohidratos como la glucosa, a partir
de dos compuestos disponibles en el medio ambiente: el agua y el dixido de carbono
del aire. El oxgeno que se libera en la atmsfera sirve para efectuar el proceso
respiratorio. La fotosntesis se resume en la siguiente ecuacin qumica:

La fotosntesis (fig. 3.22) tiene dos etapas: la fase luminosa que incluye una serie
de reacciones que dependen de la luz, y la fase oscura, que no requiere la luz. Se le
conoce como oscura porque no importa que la luz del Sol est o no presente
irradiando luz, se efecta de cualquier forma. Cada ao la fotosntesis de todos los
vegetales del planeta fija unos 100 millones de toneladas de carbono, desde el CO
2

hasta los compuestos orgnicos. Se ha calculado que si el CO
2
consumido en la
fotosntesis no fuera repuesto por los procesos de respiracin celular, cuantos meses.
Por el contrario, lento que todo el O
2
en unos 2,000 aos.

Fig. 3.22. Esquema general de la fotosntesis
Gua Metodolgica de Biologa

[142]

MITOCONDRIA
Con el microscopio ptico las mitocondrias aparecen como bastones o raquetas.
Fueron descritas por primera vez por Altman en 1884. Fue Benda, en 1897, quien las
denomin mitocondrias (mito = hilo, chondrios = grnulo).
Su tamao, nmero y forma son muy variables. En el hgado se calcula que hay
unas 1000 mitocondrias por clula; sin embargo, en las clulas del corazn, los
tbulos distales del rin y otras clulas que necesitan una gran fuente de energa son
mucho ms abundantes. Se distribuyen dentro de la clula en relacin con los lugares
donde la aplicacin de esa fuente de energa es ms intensa. Las dimensiones de la
mitocondria pueden ser desde 0.5 m hasta 5 o 7 m de longitud.
Por regla general, todas las clulas de los organismos eucariontes tienen
mitocondrias, pero hay excepciones. Nuestros glbulos rojos y las amibas carecen de
mitocondrias, y en un estadio del ciclo de vida del microorganismo protista
denominado Tripanosoma brucei sus mitocondrias prcticamente desaparecen.
Estos organelos presentan una doble membrana (externa e interna). Cada una de
unos 7 m de espesor y entre ambas membranas hay un espacio de unos 8 m
(espacio perimitocondrial o intermembranal). La membrana interna presenta
invaginaciones hacia el interior, que constituyen tabiques denominados crestas. stas
no llegan de un lado a otro de la mitocondria, por lo que la compartimentacin que
introducen es abierta.
Tridimensionalmente, la forma de la mitocondria podra compararse muy bien a
la de un cacahuate. El interior de la mitocondria est constituido por un contenido
ms o menos lquido denominado matriz mitocondrial (fig. 3.22).
El oxgeno del aire que respiramos llega a cada una de nuestras clulas a travs de
los glbulos rojos que lo acarrean, pero, qu pasa dentro de stas? Es aqu donde
comienza la respiracin celular, proceso que en las clulas eucariontes se lleva a cabo
en un organelo especializado que es la mitocondria. Durante este proceso, parte de la
energa desprendida de la glucosa, con ayuda del oxgeno, se incorpora a una
molcula de ATP (adenosn trifosfato).
Gua Metodolgica de Biologa

[143]


Fig. 3.22. Estructura de una mitocondria

La ecuacin general de la respiracin celular es:

Una vez sintetizadas, las molculas de ATP salen de las mitocondrias y viajan a
todas las clulas del cuerpo. Ah son utilizadas en las funciones celulares de los
rganos y tambin ayudan para todas las actividades diarias del cuerpo (fig. 3.23).

Fig. 3.23 Esquema general de la respiracin celular
Gua Metodolgica de Biologa
[144]

CITOPLASMA
El citoplasma o protoplasma es la masa coloidal qumica y morfolgicamente
compleja, comprendida entre la membrana citoplasmtica y la membrana nuclear.
Es un lquido viscoso de consistencia gelatinosa y su estructura corresponde a la de
un coloide (sistema constituido por agua y diferentes molculas de elevado peso
molecular); en el que estn suspendidos los organelos y las microestructuras
celulares. La parte del citoplasma que est atravesado por una red de fibras y
filamentos denominada citoesqueleto, recibe el nombre de morfoplasma (parte
coloidal); a toda la porcin citoplasmtica que carece de esta estructura se le da el
nombre de citosol o hialoplasma (parte lquida del citoplasma), por tanto, el
citoplasma presenta un estado fluido (sol) y otro viscoso (gel), lo cual permite que
se encuentre en movimiento continuo (ciclosis) favoreciendo el intercambio de
sustancias con el medio exterior.

NCLEO
Es el organelo ms prominente de la clula y se localiza en cualquier sitio del
citoplasma. Est rodeado por un par de membranas concntricas denominadas en
conjunto envoltura nuclear o membrana nuclear. No es continua, sino que posee
poros que permiten el paso de las cadenas de ARNm, sintetizadas del ncleo al
citoplasma para que realicen su funcin. El poro es un complejo protenico que
controla el paso de sustancias a travs de la envoltura nuclear. Adems de que
esta envoltura separa el contenido nuclear o nucleoplasma del citoplasma. El
nucleoplasma es un medio acuoso de solucin coloidal en estado semigel, rica en
protenas y es donde estn suspendidos los cromosomas.
Se considera que esta membrana y el ncleo tienen la misma relacin que la
membrana plasmtica y el citoplasma, o sea, que regulan de la misma manera los
materiales que pasan hacia dentro y fuera del ncleo.
Dentro del ncleo se encuentra uno o ms nuclolos que son pequeos
cuerpos amorfos, los cuales a menudo cambian de forma y tamao. Cuando una
clula inicia su divisin stos desaparecen y cuando termina la divisin celular
aparecen nuevamente (fig. 3.24).


Gua Metodolgica de Biologa
[145]



Fig. 3.24. Estructura del ncleo

Los cromosomas son estructuras que se forman de ADN altamente
compactado. Cuando se encuentran en este estado, se utiliza el trmino
cromatina.
La cromatina se encuentra formada por una nucleoprotena. Las
nucleoprotenas son estructuras complejas formadas por cidos nucleicos y
protenas del tipo de las histonas que en conjunto se denominan nucleosomas. Las
histonas son protenas bsicas, pues son ricas en aminocidos, tales como la lisina
y la arginina; stos contienen un grupo amino libre capaz de adquirir un protn por
poseer un par de electrones no compartido, por lo tanto tienen carga positiva (fig.
3.25).
El ADN lleva carga negativa debido a la presencia de numerosos grupos
fosfatos, por lo cual las histonas se enlazan fuertemente con el ADN. La clula
inicia la divisin y la cromatina se organiza en los cromosomas, trmino que quiere
decir cuerpos coloreados. El ncleo es el centro de regulacin de la clula, cuyas
principales funciones son:
1. La continuidad celular: Es necesario para la reproduccin y regeneracin de las
partes perdidas. En general, es el centro de control.
2. Contiene los factores hereditarios de la clula, permitiendo as que sus
caractersticas pasen a sus descendientes.
Gua Metodolgica de Biologa
[146]



3.25. Estructura de la cromatina

Nuclolo
Aqu se sintetizan los tipos de molculas de ARNr que se usan en la formacin de
los ribosomas. Los nuclolos son esenciales para la sntesis de protenas y de
cidos ribonucleicos.


ACTIVIDAD
Por equipo, elabora un mapa conceptual de una clula eucarionte hipottica donde interrelaciones a
todos los organelos celulares con sus funciones. Debido a la complejidad del mismo, se recomienda
que se construya en varios pliegos de papel bond para poder extenderse. Este mapa conceptual se
expondr al grupo para su evaluacin.


3.4 CMO SE REPRODUCEN LAS CELULAS?
CICLO CELULAR
La reproduccin es una funcin bsica de los seres vivos, es un proceso que les
permite a las especies la continuidad de la vida tanto en el tiempo porque las
Gua Metodolgica de Biologa
[147]

perpetua, como en el espacio porque sustituye a los organismos que mueren y se
mantiene el nmero de individuos. La reproduccin tiene una ntima relacin con
la transmisin de caracteres hereditarios y la evolucin de las especies.
El proceso de divisin celular por el cual una clula da origen a dos clulas
idnticas con igual dotacin de cromosomas, se denomina mitosis. En el caso de
las clulas somticas humanas cada clula que se divide da lugar a dos clulas hijas
con 46 cromosomas.
Cuando no se manifiestan los fenmenos de la divisin, se dice que la clula
est en el periodo de interfase, en el cual el ADN no est compactado y forma una
fina red dentro del ncleo.
La mayora de las clulas del organismo se divide peridicamente, siendo
notables excepciones las neuronas y los miocitos. Para lograr esta divisin, ocurren
transformaciones y fenmenos que se suceden de manera cclica, constituyendo lo
que se denomina el ciclo celular. Para dividirse, la clula ha tenido que duplicar
previamente su material gentico, lo cual ocurre durante el periodo S o fase de
sntesis (de ADN), por lo que en el periodo G1, previo a la fase S, cada cromosoma
estar constituido por una simple cromtida, mientras que, despus del periodo S,
en el periodo G2 los cromosomas ya aparecern formados por dos cromtidas
unidas por el centrmero. Al final del periodo G2 ocurren las fases de la mitosis, las
cuales se suceden en un tiempo de una a dos horas.

3.26. Ciclo celular
Gua Metodolgica de Biologa
[148]

DIVISIN CELULAR
Mitosis
Es un proceso continuo con fases consecutivas que se definen segn las
caractersticas morfolgicas que presentan los cromosomas (fig. 3.27).
En la profase, los cromosomas que ya se haban duplicado en el periodo de
sntesis de la interfase, se acortan y aparecen como bastones compactos. La
membrana nuclear deja de hacerse visible y se observan los centrolos, que
tambin se han duplicado, migrando uno de ellos por la periferia del ncleo hacia
el otro polo de la clula; los centrolos son los sitios donde se ensambla la tubulina,
la cual es la subunidad proteica de los microtbulos, que forma el huso mittico.
En la metafase, los cromosomas se colocan en el plano ecuatorial de la clula
y aparecen unidos por el centrmero con el huso acromtico.
En la anafase ocurre la divisin longitudinal del centrmero, lo que permite
que cada cromtida se separe y, unida por su centrmero al huso acromtico,
migre hacia el polo respectivo de la clula.
En la telofase se forman dos ncleos hijos (cariocinesis) y el citoplasma
tambin completa su divisin (citocinesis) mediante un plegamiento de la
membrana que comienza desde la periferia en la parte media y progresa hacia el
centro de la clula, de tal manera que finalmente se obtienen dos clulas hijas con
igual dotacin de cromosomas y citoplasma (divisin ecuatorial).
La mitosis asegura la distribucin exacta y equitativa de los cromosomas en
cada una de las clulas hijas, de modo que cada clula tenga exactamente el
mismo nmero y tipo de cromosomas que las dems clulas de la misma especie.
Esto garantiza que la informacin gentica (juego de cromosomas) se distribuya
exactamente en cada uno de los ncleos hijos, en donde cada clula tendr toda la
informacin gentica para la totalidad de las caractersticas del organismo.
En los organismos pluricelulares, la divisin mittica no solamente puede dar
origen a nuevos individuos por reproduccin vegetativa en plantas o por
fragmentacin en animales, sino que adems, restituye las clulas muertas, sana
heridas y en algunos casos, regenera tejidos daados o perdidos del cuerpo. En
organismos unicelulares, la mitosis es una forma de producir mucha progenie
idntica. Esto conlleva una variabilidad mnima, formando, por su capacidad de
adaptabilidad, una ventaja en condiciones ambientales estables y una desventaja
Gua Metodolgica de Biologa
[149]

cuando estas condiciones cambian. Los organismos unicelulares se reproducen
habitualmente mediante mitosis, as que las clulas hijas son exactamente iguales
a la progenitora. En este mecanismo de reproduccin no interviene el sexo, por lo
que se denomina reproduccin asexual. Otros tipos de reproduccin asexual
ocurren tambin en organismos unicelulares e incluso pueden darse en organismo
superiores, como muchas plantas, en los que es un medio auxiliar de reproduccin.
Con una rama de un rbol se puede obtener un rbol entero idntico
genticamente al original.


3.27. Fases de la mitosis

Meiosis
Un mecanismo ms complejo y perfecto de reproduccin es la reproduccin sexual
que acontece en los organismos con diferenciacin sexual y est mediada por
clulas gamticas haploides que se fusionan para formar un cigoto diploide. Como
compensacin, este mecanismo exige que clulas diploides que originan gametos,
directamente o indirectamente despus de una serie de divisiones mitticas,
lleven a cabo un tipo de divisin especial denominado meiosis (fig. 3.28).
Gua Metodolgica de Biologa
[150]

La meiosis permite la reduccin del nmero de cromosomas por medio de dos
sucesivas divisiones celulares, denominadas primera y segunda divisiones
meiticas; slo una de ellas, la primera, es precedida de la duplicacin de los
cromosomas. Los cromosomas homlogos se aparean en la primera divisin de la
meiosis y realizan un proceso de intercambio de material gentico, denominado
entrecruzamiento (crossingover), que tiene notable importancia en la evolucin y
variacin gentica de las especies que se reproducen sexualmente.
En la profase I, los cromosomas homlogos se aparean o sinapsan en toda su
longitud, formando los llamados cromosomas bivalentes y luego intercambian
porciones de su material en lo que constituye el punto de entrecruzamiento, el
cual se manifiesta citolgicamente por los llamados quiasmas.
En la metafase I, los cromosomas bivalentes, despus de haber llevado a cabo
el entrecruzamiento, se colocan en el plano ecuatorial de la clula, orientando sus
centrmeros hacia cada uno de los polos, Durante la anafase I, los dos
cromosomas de cada par se separan, dirigindose cada uno al polo celular
correspondiente. Esta separacin de los homlogos constituye la base fsica de la
segregacin de los alelos. En la telofase I se completa la primera divisin de
meiosis, la cual es seguida por la meiosis II.
En la metafase II, los cromosomas se colocan en el plano ecuatorial de la
clula y en la anafase II ocurre la divisin longitudinal del centrmero,
completndose la migracin hacia los polos en la telofase II.
Por consiguiente, cada una de las dos clulas obtenidas en la meiosis I
originar a su vez otras dos, o sea, cuatro en total, cada una de ellas con un
nmero simple o haploide de cromosomas en condiciones normales.


ACTIVIDAD
Completa la siguiente tabla de diferencias entre mitosis y meiosis escribiendo en el espacio el
enunciado correspondiente a la descripcin

Gua Metodolgica de Biologa
[151]




3.28. Fases de la meiosis
MITOSIS MEIOSIS
Ocurre en todos los tejidos en crecimiento
(clulas somticas)

Los cromosomas homlogos se aparean
No hay entrecruzamiento
Se producen cuatro clulas hijas haploides (n)
Consta de una sola divisin celular
Gua Metodolgica de Biologa
[152]


3.5 CMO SE PASA DE UNA CLULA A LA PLURICELULARIDAD?

Tamao, forma y funcin de las clulas
Casi todas las clulas son microscpicas. Las clulas se miden en micras (m), es
decir, la milsima parte de un milmetro, por tanto las clulas procariontes miden
entre 1-5 m y las eucariontes de 10 a 30 m en animales y hasta 100 m en
vegetales (fig. 3.29). Se considera a los protozoarios como los paramecios y las
amibas organismos unicelulares complejos, ya que todas las actividades celulares
que realizan, como responder ante estmulos del ambiente, procurarse alimento,
excretar el exceso de lquido y evadir a los depredadores, las lleva a cabo cada
clula.
Las clulas presentan formas diversas que en general se relacionan con su
funcin. Por ejemplo, los espermatozoides poseen un flagelo que les da una gran
movilidad, pues su funcin reproductora as lo requiere; las clulas del msculo
esqueltico contienen una red de filamentos alineados con precisin y compuestos
de protenas contrctiles; las clulas del cartlago se rodean de una matriz
caracterstica que contiene polisacridos y la protena colgeno, que juntos
suministran apoyo mecnico; los eritrocitos se convierten en sacos de forma
discoidal llenos de hemoglobina, que transporta oxgeno.


ACTIVIDAD
Investiga y dibuja tres o mas tipos diferentes de clulas humanas; compralas entre s de acuerdo a
su funcin y explica porqu tienen esa estructura.






Gua Metodolgica de Biologa
[153]











Clula procarionte. El ncleo carece de membrana nuclear, por lo que se
encuentra disperso en el citoplasma; son ms pequeas.
Clula eucarionte animal. Son ms complejas y organizadas, contienen una
serie de estructuras donde se realizan las diferentes actividades celulares. Posee
un ncleo delimitado por una membrana.
Clula eucarionte vegetal. Son auttrofas, poseen cloroplastos y pared
celular.


ACTIVIDAD
El tamao de seres vivos, clulas y molculas
En esta actividad seguiremos desarrollando ideas sobre el tamao de algunas estructuras que
se estudian en la biologa. En esta segunda parte pasaremos al mundo microscpico.
La gran mayora de las clulas que forman a los organismos tienen un tamao mucho menor
que un milmetro. Una medida tpica de una clula es de una centsima de milmetro (0.01 mm).
Suponiendo esta medida, cuntas clulas se requieren para formar con ellas una lnea de un
milmetro de largo? ________ Cuntas clulas se requieren para formar una lnea de ellas de un
centmetro de largo? ________ Cuantas clulas se necesitarn para formar una pared de un tejido
de un centmetro cuadrado? (sugerencia: 1,000 por lado seran en total, 1000 1000)
____________ Cuntas clulas se necesitarn para formar un centmetro cbico de un tejido?
(1000 1000 000 =) ____________________________
Gua Metodolgica de Biologa
[154]

An cuando las clulas son, por lo general estructuras muy pequeas, es curioso que algunas
clulas nerviosas y musculares lleguen a alcanzar una longitud de un metro! Sorprendente, no?
Una unidad ms apropiada para expresar estas medidas es el micrmetro (m), que se define
como la milsima parte del milmetro. En esta unidad, la medida tpica de la clula citada antes, de
0.01 mm, equivale a 10 m. Los glbulos rojos (eritrocitos) son clulas que miden aproximada-
mente 8 m.
La gran mayora de las clulas vegetales y animales en tejidos estn en el rango de 10 m a
100 m. La mayora de las bacterias, que son animales unicelulares, tienen un tamao en el rango
de 1 m a 10 m, an cuando algunas de ellas miden tan slo unas cuntas dcimas de
micrmetro. Esto puede observarse en la siguiente escala de medidas.
Un cloroplasto, organelo en clulas vegetales que contiene a la clorofila, tiene una dimensin
aproximada de 4 m. Representa esta magnitud en la escala de abajo con una flecha y su nombre.
Las mitocondrias son estructuras subcelulares muy importantes que miden alrededor de 1 m.
Representa esta magnitud en la escala de arriba con una flecha y su nombre.
Algunos otros organelos de la clula que se estudiarn ms adelante, tienen dimensiones
menores que un micrmetro.


Dnde quedan los virus? No en el rango anterior ya que son todava ms pequeos.
Los virus son microorganismos no celulares, que miden menos de una dcima de micrmetro
(entre 0.03 y 0.1 m). Para expresar estas dimensiones tan pequeas, podemos usar una unidad
todava ms pequea que el micrmetro llamado el nanmetro (nm). Un nanmetro es la milsima
parte de un micrmetro. Las dimensiones de los virus se encuentran entre 30 y 100 nm.
Gua Metodolgica de Biologa
[155]

Las molculas, por ser constituyentes de las clulas, tienen magnitudes mucho menores que
stas. Las protenas que son molculas muy grandes, miden entre 4 y 10 nm. Los lpidos, otro tipo
de molculas, miden entre 1 y 4 nm.
Las medidas de virus y protenas estn representadas en el diagrama siguiente. Incluye las
medidas de los lpidos dadas en el prrafo anterior:

Los lpidos y las protenas se conocen como macromolculas. Los tamaos ms normales de
molculas se encuentran en el rango de 0.3 a 1 nm. Representa estas molculas en la escala de
arriba.
An cuando las molculas son tpicamente muy pequeas, podemos encontrar en muchos
organismos molculas como la de AND, que pueden llegar a medir hasta 2 metros! Cmo crees
que quepan entonces dentro de la clula?
Por ltimo, los tomos tienen medidas de entre 0.05 y 0.4 nm. Represntalos en la escala de
arriba.

3.6. CUL ES LA RELACIN TEJIDO-RGANO-SISTEMA?
El cuerpo animal est compuesto de sistemas los cuales a su vez estn formados
por dos o ms rganos. Los rganos estn compuestos de tejidos los cuales se
componen de clulas. Un tejido es un grupo de clulas y de material extracelular
que forman una unidad estructural y funcional, especializada para una tarea
especfica. Los tejidos animales incluyen el tejido epitelial, conectivo, muscular y
nervioso.
El tejido epitelial forma membranas que cubren las superficies corporales
interna y externa y tambin origina las glndulas
Gua Metodolgica de Biologa
[156]

El tejido conectivo generalmente contiene una cantidad considerable de
material extracelular e incluye a la dermis, hueso, cartlago tendones,
ligamentos, el tejido adiposo y la sangre
El tejido muscular est especializado en el movimiento y utiliza filamentos
proteicos que se deslizan, la actina y la miosina. Existen tres tipos de tejido
muscular: el esqueltico, liso y cardiaco.
El tejido nervioso est especializado en la generacin y conduccin de seales
elctricas.
Gua Metodolgica de Biologa
[157]

LECTURAS SUGERIDAS
Bojorquez Castro, Luis (2000) La vida celular Programa Nacional de Formacin de
Profesores. Asociacin Nacional de Universidades e Institutos de Enseanza
Superior
George Dreyfus (2002). La clula. SEP/Santillana. Coleccin Espejo de Urania.
Mxico
Pea, Antonio. Las membranas de las clulas. La ciencia/ 18 desde Mxico, 1986,
Fondo de Cultura Econmica, Consejo Nacional de Ciencia y Tecnologa
Tapia, Ricardo. (1987) Las clulas de la mente. La ciencia/ 30 desde Mxico. Fondo
de Cultura Econmica, Consejo Nacional de Ciencia y Tecnologa

VIDEOS RECOMENDADOS
Gran Planeta Celular
Cosmos de Carl Sagan

TICs
Bioxeo Recursos Biologa
http://www.bioxeo.com/plabioca.htm

Cells alive
http://www.cellsalive.com

Proyecto Bisfera.
http://recursos.cnice.mec.es/biosfera/

BIBLIOGRAFA
Atlas de Biologa. Los mecanismos de la vida; Ediciones Cultural, Madrid Espaa
p.p.50,52,53,y 62-64.
Cervantes M. y Hernandez M. (2005) Biologa General. Publicaciones Cultural 2
reimpresin. Mxico pp. 126-141
Gua Metodolgica de Biologa
[158]

Loewy y Siekevitz; (1983); Estructura y Funcin Celular. CECSA, Mxico; 572
pginas.
Lodish, Harvey (2005). Biologa Celular y Molecular 5 edicin de Editorial Medica
Panamericana
Overmire. (2003). Biologa. Ed. Limusa Mxico. 611pginas.
Smallwood,N.L.y Green, E.(1991) .Biologa.21.reim. Ed Publicaciones Cultural,
Mxico. pp. 97-117
Salomn B Martn. (2001) Biologa 3 edicin Ed Mc Graw-Hill pp. 75-95
Valdivia, B. Granillo y P, Villarreal, M.S. (2006) Biologa, La vida y sus procesos. Ed.
Publicaciones Cultural. Mxico.pp. 70-100
Vzquez C. R. (2004). Biologa. Bachillerato General Publicaciones Cultural Primera
Edicin. Mxico. pp. 72-125
Ville, C. A. (1990) Biologa. Ed. McGraw Hill Interamericana de Mxico.


Gua Metodolgica de Biologa
[159]

BLOQUE 4
Herencia y variacin






Gua Metodolgica de Biologa
[160]



Gua Metodolgica de Biologa
[161]


COMPETENCIAS GENRICAS Y SUS ATRIBUTOS A DESARROLLAR EN EL BLOQUE 4

Se autodetermina y cuida de si
Se reconoce y valora a si mismo y aborda problemas y retos teniendo en cuenta
los objetivos que se persigue.
Elige y practica estilos de vida saludables.

Se expresa y comunica
Escucha, interpreta y emite mensajes pertinentes en distintos contextos
mediante la utilizacin de medios, cdigos y herramientas apropiados.

Piensa crtica y reflexivamente
Desarrolla innovaciones y propone soluciones a problemas a partir de mtodos
establecidos.
Sustenta una postura personal sobre temas de inters y relevancia general,
considerando otros puntos de vista de manera crtica y reflexiva.

Aprende de forma autnoma
Aprende por iniciativa e inters propio a lo largo de su vida.

Trabaja de forma colaborativa
Participa y colabora de manera efectiva en equipos diversos.

Participa con responsabilidad en la sociedad
Participa con una conciencia cvica y tica en la vida de su comunidad, regin,
Mxico y el mundo.


Gua Metodolgica de Biologa
[162]

4.1 CULES HECHOS HISTRICOS CONDUJERON AL ESTUDIO DE LA
GENTICA?
LAS IDEAS PREMENDELIANAS
Desde la antigedad, el ser humano sabe que lo semejante engendra lo
semejante; o sea, que los hijos se parecen a los padres. Esta tendencia de
parecernos a nuestros padres se conoce como herencia. La ciencia que estudia la
herencia y variacin, y las leyes que rigen las similitudes y diferencias entre los
sujetos con ascendientes comunes se llama Gentica.
A lo largo de la historia de la humanidad se desconocan los detalles cientficos
de cmo funcionaba la herencia. Se procreaba y se observaba cierta semejanza
entre padres e hijos, pero los mecanismos no eran conocidos. Los filsofos griegos
sostenan varias ideas: Hipcrates (460-377 a. C.) enunci la teora de la
pangnesis, segn la cual cada parte del organismo enviaba su informacin
hereditaria a los rganos reproductores, y posteriormente la informacin de
ambos padres se mezclaba como un fluido. Aristteles pensaba que el semen
masculino y el flujo menstrual se mezclaban en la concepcin, mientras que otros
ni siquiera consideraban que este tipo de mezclas eran necesarias, las formas
"simples" (gusanos, moscas, etc.) nacan por generacin espontnea.
Durante el siglo XVIII, el holands Anton van Leeuwenhoek descubre
"animculos" en el esperma humano y de otros animales. Algunos otros, como los
espermistas, imaginaron ver a un "pequeo hombrecito" al que llamaron
homnculo, dentro de cada espermatozoide (Fig. 4.1) y afirmaban que la hembra
slo provea el ambiente para el desarrollo de la futura generacin. Por el
contrario, la escuela ovista pensaba que el futuro ser se encontraba dentro del
vulo, y que el esperma solo lo estimulaba.
En el siglo XIX, la teora de la mezcla explicaba que la unin de vulos y
espermatozoides produca una descendencia que era una "mezcla" de los rasgos
de los padres.

EL EXPERIMENTO DE MENDEL
Se podra decir que el nacimiento de la Gentica ocurri cuando el fraile agustino
Gregor Mendel (1822-1884) realiz experimentos acerca de la herencia en
chcharos (Fig. 4.2) y en 1865 present su investigacin a la Sociedad de Historia
Gua Metodolgica de Biologa
[163]

Natural de Brnn (actual Repblica Checa), con el ttulo Experimentos en
Hibridaciones de Plantas.
Mendel ciment las bases de la Gentica actual explicando que los rasgos
heredables son contenidos en unidades discretas, llamadas genes, que se heredan
por separado en cada generacin. No fue hasta 1930 cuando se comprendi
completamente el alcance de su obra, especficamente en relacin con la teora de
la evolucin de Darwin.
Mendel seleccion para su investigacin siete rasgos del chcharo: textura y
color de la semilla, posicin y color de la flor, forma y color de la vaina y longitud
del tallo (tabla 4.1)


Tabla 4.1. Los siete rasgos del chcharo que estudi Mendel

Mendel ide un mecanismo para simbolizar y comprender la transmisin de
los rasgos hereditarios. Emple un par de letras que representan los genes que
intervienen en cada rasgo estudiado. Por ejemplo, en el tamao de la planta, la
letra A mayscula representa al gen para tallo alto, que es un rasgo dominante,
mientras que la letra a minscula refiere al gen para el tallo bajo que
corresponde a un rasgo recesivo.
Gua Metodolgica de Biologa
[164]


Fig. 4.1 El homnculo

Fig. 4.2 Gregor Mendel


4.2 QU DIFERENCIAS Y SIMILITUDES ENCONTRAMOS EN LOS CONCEPTOS
DE LA GENTICA?

La gentica actual, a partir del trabajo de Mendel, expone varios conceptos bsicos
para la comprensin de los mecanismos de la herencia:
El fenotipo es la apariencia de un organismo, todo lo que podemos observar
como resultado de la expresin de la informacin gentica. Por ejemplo, el color
de cabello, color de piel, altura, color de ojos, posicin de las flores, forma de la
hoja, etc. Por otro lado, el genotipo es la constitucin gentica de un organismo
que determina al fenotipo y que no es observable directamente, aunque se puede
inferir al analizar las proporciones fenotpicas.
Los genes alelos son determinados segmentos de ADN que determinan un
rasgo hereditario. Cada gen se ubica en uno de los cromosomas homlogos, lo que
permite su segregacin en distintos gametos durante la meiosis. En el ejemplo
anterior, los genes A y a son alelos porque ambos codifican para la misma
caracterstica (tamao de la planta), aunque con expresiones distintas: alta y baja,
respectivamente. Adems, cada gen se ubica en un cromosoma del par homlogo,
en un lugar fsico especfico, conocido como locus. Los cromosomas homlogos
tienen los mismos genes, ubicados en los mismos loci (plural de locus).
Gua Metodolgica de Biologa
[165]

Cuando un organismo tiene alelos iguales, se dice que el genotipo es
homocigoto, dominante y recesivo, el primero tiene slo alelos dominantes (AA) y
el segundo lleva slo alelos recesivos (aa). Cuando el individuo porta alelos
distintos (Aa), su genotipo es heterocigoto.
Para facilitar la notacin, el cruzamiento inicial entre dos variedades se llama
generacin paterna, o P1, y su descendencia, ya fuese para la forma de las semillas
o para las plantas, se llama primera generacin filial, o F1. Las generaciones
sucesivas a partir de este cruzamiento se denominan F2 y as sucesivamente.

4.3 EN QU CONSISTEN LAS LEYES, ESTABLECIDAS POR MENDEL, SOBRE LA
HERENCIA?

Primera ley - Ley de la uniformidad de la primera generacin
Al cruzar entre s individuos de razas puras distintas para un determinado carcter,
se obtiene una generacin de individuos hbridos, genticamente iguales para ese
carcter y cuyo fenotipo es producto del carcter dominante.
Segunda ley - Ley de la segregacin de los caracteres
Los alelos de un carcter en los hbridos de la primera generacin se segregan
durante la formacin de los gametos sin mezclarse y se renen de nuevo de todas
las formas posibles en la fecundacin para originar a los individuos de la segunda
generacin (fig. 4.3).
Tercera ley - Ley de la herencia independiente de los caracteres
Cada uno de los caracteres hereditarios se transmite a los descendientes con
absoluta independencia de los dems (fig. 4.4)

Cruzamiento de prueba
Al cruzar un fenotipo con el padre homocigoto recesivo se puede determinar
el genotipo desconocido. Si se producen dos fenotipos distintos quiere decir que el
progenitor desconocido era heterocigoto para ese carcter. Si por el contrario
aparece un solo fenotipo entonces es homocigoto (fig. 4.5).
Gua Metodolgica de Biologa
[166]


Fig. 4.3 Primera y segunda leyes de Mendel Fig. 4.4 Tercera ley de Mendel


Fig. 4.5 Cruzamiento de prueba

Gua Metodolgica de Biologa
[167]


ACTIVIDAD
1. Realiza un collage que muestre a personas de 5 distintas nacionalidades.
2. En tu libreta, observa y enlista las diferencias fsicas encontradas en ellas.
3. Realiza un cuadro comparativo de las diferentes caractersticas fenotpicas de cada una de las personas del collage y
relacinalas con las leyes de Mendel y con los conceptos estudiados de la Gentica.


4.4 QU DIFERENCIA HAY ENTRE LOS PATRONES HEREDITARIOS
MENDELIANOS Y LOS NO MENDELIANOS?

Los principios establecidos por Mendel se agrupan en un modelo gentico
denominado herencia mendeliana. Esto implica que los patrones hereditarios,
tanto rasgos normales como alteraciones hereditarias, se rigen por las leyes de
Mendel (por ejemplo, herencia autosmica dominante y recesiva, determinacin
del sexo).
Por otro lado, aquellos rasgos que no las cumplen dichas leyes quedan
incluidos en la herencia no mendeliana. Por ejemplo, herencia ligada al sexo,
herencia multifactorial, alelos mltiples, codominancia, herencia intermedia,
poligenia.

HERENCIA MENDELIANA
Herencia autosmica dominante
Slo se necesita uno de los genes para que se exprese una mutacin (Fig. 4.6). Si
una persona tiene un alelo dominante defectuoso desarrollar la enfermedad. Se
conoce como autosmica porque el gen se encuentra en un cromosoma somtico
o autosoma. La anomala ser ms extrema o severa en los individuos homocigotos
que en los heterocigotos. Se heredan de esta forma: braquidactilia, acondroplasia,
enfermedad de Hutington, polidactilia y aniridia.
Herencia autosmica recesiva
Se expresa nicamente cuando en el genotipo de un individuo estn los dos alelos
recesivos que pueden ser normales o mutados (Fig. 4.7). Casi todas las
Gua Metodolgica de Biologa
[168]

enfermedades causadas por la falta de una enzima esencial, se heredan de esta
forma. Los portadores son heterocigotos para el gen puesto que llevan un alelo
normal y otro alterado. Son personas fenotpicamente normales pero que pueden
transmitir su alelo defectuoso a sus hijos.
Se heredan de forma autosmica recesiva la anemia drepanoctica (o
falciforme), albinismo, fenilcetonuria y fibrosis qustica, entre otras.

Fig. 4.6 Herencia autosmica dominante

Fig. 4.7 Herencia autosmica recesiva

Determinacin del sexo
Existen dos tipos de cromosomas: autosomas que contienen genes que
determinan las caractersticas somticas, y cromosomas sexuales, que definen los
caracteres sexuales. En el humano, cuya dotacin cromosmica es de 46, cada
clula somtica contiene 22 pares de autosomas ms un par XX si se trata de una
mujer (homogamticas) y 22 pares de autosomas y un par XY si se trata de un
varn (heterogamticos).
En la mujer ocurre la inactivacin de uno de los cromosomas X (que resulta en
la formacin del corpsculo de Barr observado en los ncleos interfsicos),
proceso que mantiene el equilibrio gnico en ambos sexos al igualar el contenido
de ADN cromosmico activo.
La determinacin del sexo ocurre en la fecundacin y depende de los gametos.
Al ser aleatoria, un vulo puede ser fecundado por cualquiera de los dos tipos de
espermatozoides que se han producido, por lo que en el 50% de los casos se
formarn mujeres y en el otro 50% se formarn hombres (fig. 4.8).

Gua Metodolgica de Biologa
[169]


Fig. 4.8 Determinacin del sexo

HERENCIA NO MENDELIANA
Herencia intermedia
Al cruzar distintas lneas puras entre s (dominantes y recesivas), se obtiene en la
primera generacin individuos con un rasgo intermedio al de los dos progenitores
puros. Por ejemplo, en la camelia, al cruzarse plantas con flores rojas con plantas
con flores blancas la F1 resulta de color rosa. Si stas se cruzan entre s, en la F2 se
produce 25% de plantas de flores rojas, 50% de flores rosadas y 25% de flores
blancas, con lo que se obtiene una proporcin fenotpica de 1:2:1 (Fig. 4.9). Esto
ocurre porque uno de los alelos para el color ejerce una dominancia incompleta
sobre el otro alelo. Otros rasgos con herencia intermedia son la braquidactilia y
anemia falciforme.

Genes ligados
Los genes se separan independientemente durante la meiosis; sin embargo,
existen grupos de genes en un mismo cromosoma. Un ejemplo de ligamiento lo
constituyen los genes del grupo sanguneo Rh y los genes HLA (complejo de
histocompatibilidad)
Gua Metodolgica de Biologa
[170]

Fig. 4.9 Herencia intermedia Fig. 4.10 Genes ligados

Por ejemplo, en el chcharo dulce (Fig. 4.10), el color de flor prpura (P)
domina sobre el rojo (p), y la forma larga de polen (L) domina sobre la redonda (l).
Cuando un chcharo homocigoto de polen largo y de flor prpura se cruza con uno
de polen redondo y de flor roja, toda la F1 tiene flores prpuras y polen largo.
As los fenotipos de la F2 no se presentan como 9:3:3:1, sino que tienen 75%
de plantas de polen largo y flor prpura y 25% de polen redondo y flor roja. Sin
embargo, los genes para el color de la flor y la forma del polen estn en el mismo
cromosoma de tal manera que los genes se distribuyen juntos durante la meiosis y
se heredan juntos.


Gua Metodolgica de Biologa
[171]

Herencia ligada al sexo
Existen rasgos determinados por genes que se encuentran en cualquiera de los dos
cromosomas sexuales: X o Y. Por esta razn, las proporciones que se obtienen en
la descendencia, as como los mecanismos por los cuales se heredan, cambian
respecto a los genes que se encuentran en los cromosomas somticos.
En este tipo de herencia, los genes anmalos se hallan en el cromosoma X y
son dominantes sobre los mutados, por lo que se debe tener el gen daado en
dosis doble (homocigosis) para que se produzca la enfermedad (Fig. 4.11). Las
mujeres con fenotipo normal pueden no llevar el gen (homocigotas dominantes), o
llevar uno normal y uno daado (heterocigota o portadora). Si una mujer
portadora se une a un hombre sano, en cada fecundacin tendr una probabilidad
del 25% de hijas sanas (que no lleven el gen), 25% de hijas portadoras
(heterocigotas), 25% de hijos sanos (su cromosoma X lleva el gen dominante) y
25% de hijos enfermos (su cromosoma X lleva el alelo daado).


Fig. 4.11 Herencia ligada al cromosoma X:
daltonismo



Fig. 4.12 Experimento de Morgan

Gua Metodolgica de Biologa
[172]

El descubrimiento de los genes ligados al sexo fue hecho en 1910 por Thomas
H. Morgan en la mosca de la fruta, Drosophila melanogaster (Fig. 4.12). Esta mosca
posee caractersticas externas claramente observables. Una de ellas es el color de
ojos. El color natural o silvestre es rojo, pero hay una serie de variantes en este
rasgo hereditario. Morgan estudi esta caracterstica y observ que algunas
moscas tenan ojos de color blanco. A travs de sus investigaciones logr
determinar qu ese rasgo estaba ligado al cromosoma X.
En sus trabajos, Morgan cruz machos de ojos blancos con hembras de ojos
rojos. En la F1, todos los individuos de ambos sexos tenan ojos rojos Cuando las
moscas de la F1 se cruzaron entre s, el 25% de los descendientes de la F2
presentaron ojos blancos y el 75% restante ojos rojos. Estos resultados permiten
inferir que el rasgo de color de ojos est controlado por dos alelos, en donde el
gen que determina el color rojo es dominante sobre el gen para el color blanco.
Si se analiza el sexo y color de ojos de los individuos de la F2, se puede
comprobar que todas las hembras son de ojos rojos, en tanto que los machos, slo
la mitad es de ojos de color rojo y la otra mitad, de color blanco.
Las moscas de ojos blancos tienen alelos puros para ese rasgo, ya que originan
solo progenie con ojos blancos. En cambio, las moscas hembras de ojos rojos
pueden tener genes para ojos de color rojo o blanco, ya que la descendencia
obtenida de ellas presenta las dos caractersticas.


ACTIVIDAD
Lee material bibliogrfico, subraya y elabora un cuadro sinptico sobre los trabajos de Morgan,
destacando la teora cromosmica y su influencia en la determinacin del sexo; as como las
posibles mutaciones que se puedan generar.


Codominancia y alelos mltiples
Los alelos mltiples son una condicin en la que hay ms de dos alelos alternativos
probables que definen ciertos rasgos. Un ejemplo clsico son los alelos del sistema
de grupos sanguneos ABO (Tabla 4.2 y Fig. 4.13) y los del complejo de
histocompatibilidad (HLA). Los alelos mltiples se originan por diferentes
Gua Metodolgica de Biologa
[173]

mutaciones en un mismo gen. Los 4 grupos sanguneos, A, B, AB u O, son
consecuencia de tres distintos alelos de un slo gen (i
A
, i
B
e i
O
). A su vez, los
alelos i
A
e i
B
son codominantes sobre i
O
que es recesivo, es decir, ambos son
fenotpicamente detectables en heterocigosis por lo que tienen sangre tipo AB.


Tabla 4.2 Grupos sanguneos












Fig. 4.13 Codominancia y alelos mltiples



Poligenia y herencia multifactorial
En la poligenia, muchos rasgos estn controlados por ms de un gen, debido a un
efecto acumulativo de los genes que determinan la caracterstica. Se heredan de
esta forma la altura, peso, metabolismo, color de ojos y piel, muchas formas de
comportamiento, etc.
La herencia polignica se expresa como graduaciones de pequeas diferencias
fenotpicas. Por ejemplo, el color de piel obedece a la concentracin de melanina
en la piel. Supngase que el grupo de genes que controla la cantidad de melanina
consta de 4 alelos. Los alelos dominantes AABBCCDD producen la mayor cantidad
de melanina y piel ms oscura. Los genes recesivos aabbccdd producen una menor
cantidad de melanina y en consecuencia una piel clara. Los descendientes de la
unin entre una persona de piel negra y una de piel clara heredaran los genes
Gua Metodolgica de Biologa
[174]

AaBbCcDd; por lo tanto deberan tener una piel de color intermedio (mulato). Sin
embargo, hay numerosas variaciones posibles en cuanto al color de piel debido a
los numerosos tipos de gametos posibles a partir de una combinacin gentica tal
como AaBbCcDd: ABCD, abcd, AbCd, aBcD, etc.
Adems, el ambiente influye sobre muchos rasgos polignicos. A la suma de
los factores herencia-ambiente se le conoce como herencia multifactorial. Entre
los padecimientos que se heredan en forma multifactorial se encuentran la
mayora de los defectos del nacimiento: labio y paladar hendido, defectos del tubo
neural, luxacin congnita de cadera, estenosis pilrica, cardiopatas, etc y muchos
padecimientos sistmicos: lupus eritromatoso, diabetes mellitus, esquizofrenia,
epilepsia, hipertensin arterial, psicosis maniacodepresiva.



PROBLEMARIO

Resuelve en tu libreta los siguientes problemas de gentica. Lelos con detenimiento y razona el
patrn hereditario.

1. Un varn de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de
ojos azules, el padre de ojos pardos y tena un hermano de ojos azules. Del matrimonio naci
un hijo con ojos pardos. Razonar cmo ser el genotipo de todos ellos, sabiendo que el color
pardo domina sobre el color azul. Elabora un rbol genealgico para explicarlo.

2. En la especie vacuna, la falta de cuernos F, es dominante sobre la presencia f. Un toro sin
cuernos se cruza con tres vacas:
a) Con la vaca A que tiene cuernos se obtiene un ternero sin cuernos.
b) Con la vaca B tambin con cuernos se produce un ternero con cuernos.
c) Con la vaca C que no tiene cuernos se produce un ternero con cuernos.
Cules son los genotipos del toro y de las tres vacas y qu descendencia cabra esperar de
estos cruzamientos?

3. Un perro de pelo negro, cuyo padre era de pelo blanco, se cruza con una perra de pelo gris,
cuya madre era negra. Sabiendo que el color negro del pelaje domina sobre el blanco en los
machos, y que en las hembras negro y blanco presentan herencia intermedia, explicar cmo
sern los genotipos de los perros que se cruzan y tipos de hijos que pueden tener respecto del
carcter considerado.

4. Un ratn A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es
de pelo blanco. Otro ratn B tambin de pelo blanco se cruza tambin con uno de pelo negro y
se obtiene una descendencia formada por 5 ratones de pelo blanco y 5 de pelo negro. Cul de
los ratones A y B ser homocigoto y cul heterocigoto? Razona la respuesta.

Gua Metodolgica de Biologa
[175]

5. Qu proporcin genotpica cabe esperar en un matrimonio entre un hombre daltnico y una
mujer portadora? Qu proporcin de daltnicos cabe esperar en la familia si tiene ocho hijos?

6. Si los padres tienen, uno sangre tipo A y, el otro, A qu posibilidades hay de que tengan un
hijo con el tipo sanguneo O? Fundamente tu respuesta

7. Se cruzan tomates rojos hbridos y de tamao normal homocigotos con la variedad amarilla
enana. Qu proporcin de tomates rojos que salen en la F2 sern enanos? (Los alelos
dominantes son rojos y el tamao es normal).

8. Se cruzan dos plantas de flores color naranja y se obtiene una descendencia formada por 30
plantas de flores rojas, 60 de flores naranja y 30 de flores amarillas. Qu descendencia se
obtendr al cruzar las plantas de flores naranjas obtenidas, con las rojas y con las amarillas
tambin obtenidas? Razona los tres cruzamientos.

9. El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante sobre su
alelo r para el amarillo. El tamao normal de la planta se debe a un gen N dominante sobre el
tamao enano n.

10. Se cruza una planta de pulpa roja y tamao normal, con otra amarilla y normal y se obtienen: 30
plantas rojas normales, 31 amarillas normales, 9 rojas enanas y 10 amarillas enanas. Cules
son los genotipos de las plantas que se cruza. Comprobar el resultado realizando el
cruzamiento

11. La aniridia (dificultades en la visin) en el hombre se debe a un factor dominante (A). La jaqueca
es debida a otro gen tambin dominante (J). Un hombre que padeca de aniridia y cuya madre
no, se cas con una mujer que sufra jaqueca, pero cuyo padre no la sufra. Qu proporcin de
sus hijos sufrirn ambos males?




4.5 QU ES UNA MUTACIN?

En 1902, Hugo De Vries, estudiando herencia mendeliana en la "hierba del asno",
descubri que aparecan rasgos que no estaban en los antecesores de las plantas,
concluy que estos rasgos surgan por un cambio del factor que determinaba el
carcter (gen) y que este cambio se transmita a la descendencia. A este cambio lo
denomin mutacin.
Las mutaciones junto con la recombinacin gentica aumentan la variabilidad
gentica de las especies, lo que contribuye a su adaptacin al medio ambiente y,
en definitiva, a la evolucin de las mismas. Si no existieran las mutaciones no
existira la gran biodiversidad planetaria.
Gua Metodolgica de Biologa
[176]

De acuerdo al dogma central de la biologa, la informacin gentica reside en
el ADN, al cambiar la informacin gentica, tambin lo har la secuencia de
aminocidos en las protenas formadas.
Por lo general, el ADN es una molcula estable y tiene la facultad de mantener
la informacin gentica. Las alteraciones que se producen generalmente son
corregidas a travs de diferentes mecanismos de reparacin; no obstante, pueden
generarse cambios en la secuencia de bases.
Las mutaciones ocurren al azar y espontneamente. Podemos establecer dos
grandes grupos de mutaciones en relacin con el tipo de clulas en las que se
producen: somticas y germinales. Los mutgenos inducen varias clases de
cambios heredables perjudiciales o benficos y pueden ser: fsicos (rayos
ultravioleta, X, gamma), qumicos (agentes alquilantes, oxidantes) y biolgicos
(virus y transposones).

TIPOS DE MUTACIONES
Las mutaciones pueden darse en tres niveles diferentes: molecular (gnicas o
puntuales), cromosmico y genmico

MUTACIONES GNICAS O PUNTUALES
Las mutaciones a nivel molecular son llamadas gnicas o puntuales y afectan la
constitucin qumica de los genes (Tabla 4.3). Se originan por:
Sustitucin. Donde debera haber un nucletido se inserta otro. Por ejemplo,
en lugar de la citosina se instala una timina.
Inversin, mediante dos giros de 180 dos segmentos de nucletidos de
hebras complementarias se invierten y se intercambian.
Translocacin. Ocurre un traslape de pares de nucletidos complementarios
de una zona del ADN a otra
Desfasamiento. Al insertarse (insercin) o eliminarse (deleccin) uno o ms
nucletidos se produce un error de lectura durante la traduccin que conlleva a la
formacin de protenas no funcionales.
Gua Metodolgica de Biologa
[177]


Tabla 4.3 Mutaciones puntuales o gnicas

MUTACIONES CROMOSMICAS
El cambio afecta a un segmento de cromosoma (mayor de un gen), por tanto a su
estructura. Estas mutaciones pueden ocurrir por:
Deleccin. Es la prdida de un segmento cromosmico, que puede ser terminal o
intercalar (Fig. 4.15). Cuando ocurre en los dos extremos, la porcin que porta el
centrmero une sus extremos rotos y forma un cromosoma anular (Fig. 4.14).
Inversin. Cuando un segmento cromosmico rota 180 sobre s mismo y se coloca
en forma invertida, por lo que se altera el orden de los genes en el cromosoma
(Fig. 4.15).
Translocacin. Intercambio de segmentos entre cromosomas no homlogos, que
puede ser o no recproca (Fig. 4.16). Algunos tipos de translocaciones producen
abortos tempranos. Tambin se pueden formar portadores de trisomas como la
del 21 (sndrome de Down); al translocarse todo el cromosoma 21 a otro
cromosoma como el 14 (14/21), los gametos de esa persona llevarn el
cromosoma translocado ms uno normal, por lo que al fecundarse con el gameto
contrario, el producto resultante tendr tres cromosomas 21.
Isocromosomas. Estos se forman cuando el centrmero, en lugar de dividirse
longitudinalmente, lo hace en forma transversal (Fig. 4.17)
Gua Metodolgica de Biologa
[178]



ACTIVIDAD
La anemia falciforme es una enfermedad que se debe a una mutacin en un nucletido del gen que
tiene informacin para la fabricacin de la hemoglobina. A partir del alelo mutado se generan
molculas de hemoglobina anormales. La secuencia de ADN que se muestra a continuacin
pertenece al gen que tiene la informacin para fabricar un fragmento de la hemoglobina normal:
GTGCACCTGACTCCTGAGGAG
CACGTGGACTGAGGACTCCTC

a. Utilizando la tabla del cdigo gentico escribe la secuencia de aminocidos que se sintetiza a
partir de la hebra inferior del ADN.

Secuencia de ARNm:
Secuencia proteica:

Acurdate que la hebra de ARNm obtenido a partir de leer la hebra inferior del ADN es de
secuencia igual a la hebra superior, slo que en vez de T tiene U.
b. El fragmento de protena que figura a continuacin pertenece a la hemoglobina falciforme.

Val-His-Leu-Trip-Pro-Val-Glu


Compara esta secuencia con la anterior y determina cul es el nucletido que sufri la mutacin
responsable de la anemia falciforme

De los tres tipos principales de mutacin que existen sta es de tipo? _______________________

Y a la vez a cual subtipo pertenece? ____________________________

Qu sucedi? ___________________________________________________________________


Gua Metodolgica de Biologa
[179]


Fig. 4.14 Formacin de cromosomas anulares

Fig. 4.15 Deleccin, duplicacin e inversin

Fig. 4.16 Translocacin Fig. 4.17 Formacin de isocromosomas

MUTACIONES GENMICAS
Euploida.
Afecta a todo el genoma, aumentando el nmero de juegos cromosmicos
(poliploida) o reducindolo a una sola serie (haploida o monoploida). Son causa-
das por errores en la separacin de los pares de cromosomas homlogos durante
la meiosis, no separndose ninguno de estos. Los organismos poliploides gene-
ralmente son ms grandes y vigorosos, y frecuentemente presentan gigantismo.
En numerosas plantas cultivadas esto se ha capitalizado, especialmente donde el
tamao de hojas, semilla, fruto o flor es econmicamente importante, por ejemplo
en alfalfa, tabaco, caf, pltano, manzana, pera, lila y crisantemo.
Gua Metodolgica de Biologa
[180]

Aneuploida
Afecta al nmero de cromosomas individualmente. Se debe al fenmeno de no
disyuncin, que ocurre durante la meiosis cuando los cromosomas homlogos no
se separan y ambos se incorporan a un mismo gameto (Fig. 4.18). Cuando este
gameto fecunda a otro se originar un cromosoma triplicado (trisoma); de igual
forma tambin habr gametos que tendrn un cromosoma menos y, por ello,
cuando fecunden a otro normal, el individuo tendr un cromosoma menos
(monosoma)


Fig. 4.18 La no disyuncin produce monosomas y
trisomas



Fig. 4.19 Trisomas y monosomas en cromosomas
sexuales


Trisomas. La trisoma del cromosoma 21 produce el sndrome de Down (47, XX +
21 47, XY + 21). Los afectados tienen retardo mental en diferente grado, corazn
defectuoso, baja estatura, prpados rasgados, boca pequea, lengua salida, crneo
ancho y marcha lenta. Las mujeres son frtiles y los transmiten al 50% de su
progenie; los hombres son estriles.
Los cromosomas sexuales tambin pueden afectarse por una trisoma (Fig.
4.19). Los individuos afectados por el sndrome de Klinefelter (47, XXY) son varones
estriles con rasgos femeninos y retraso mental. Son frtiles, altos y de conducta
controversial. Sus clulas tienen un nmero anormal de cuerpos de Barr. En el
sndrome triequis o metahembras (47, XXX) son mujeres frtiles de apariencia
normal pero con tendencia al retardo mental. En la polisoma XYY (47, XYY) Los
Gua Metodolgica de Biologa
[181]

afectados presentan estatura elevada, acn, un tamao mayor de dientes,
conducta agresiva y la espermatognesis puede o no estar alterada.
Monosomas. La falta de un cromosoma produce una monosoma conocida como
el sndrome de Turner (45, X) que ocurre en mujeres quines desarrollan baja
estatura, dobleces caractersticos en el cuello y retardo mental moderado (Fig.
4.19). En la pubertad no menstran ni desarrollan caracteres sexuales secundarios.
No presentan cuerpo de Barr como las mujeres normales, pues el nico
cromosoma X que presentan est activado.

4.6 CULES SON LAS APLICACIONES MS IMPORTANTES DE LA GENTICA?
La domesticacin, la elaboracin de la cerveza y vino, y la fabricacin de pan,
queso y yogurt son tcnicas de la biotecnologa que el hombre ha aplicado desde
la antigedad. Hoy en da, diversos organismos se han manipulado genticamente
en el laboratorio.


Consejo Gentico
La prctica del asesoramiento o consejo gentico es muy importante en la
prevencin de enfermedades hereditarias y sndromes con malformaciones
congnitas (que se presentan al nacimiento).
El equipo que lo imparte est conformado por varios especialistas (ginecobs-
tetras, psiclogos, endocrinlogos, cirujanos, trabajadores sociales, etc), coordina-
dos por un genetista. Para impartir consejo gentico se deben tener en cuenta los
aspectos mdicos y psicolgicos tanto del paciente como de su familia. El estudio
deber explicar cul ser la evolucin del defecto de nacimiento o enfermedad por
la que se consulta, sobre el manejo teraputico, diettico o de rehabilitacin y,
sobre todo, informar sobre las medidas preventivas que pueden tomarse.
Las causas ms frecuentes para solicitar asesoramiento gentico son: personas
que sufren un padecimiento gentico, parejas con un hijo afectado, familias con
parientes afectados, aborto de repeticin, consanguinidad y mismo grupo tnico.
Algunos trastornos genticos se pueden descubrir antes del nacimiento por
medio de una serie de pruebas que constituyen el diagnstico prenatal. Entre
estos procedimientos est la amniocentesis, que consiste en tomar una muestra
de lquido amnitico que se analiza por medio de un cariotipo, detectndose
Gua Metodolgica de Biologa
[182]

cualquier anomala cromosmica numrica o estructural. La fetoscopa, que
permite ver al feto por medio del endoscopio, y la ultrasonografa, que utiliza
ondas de sonido de alta frecuencia para producir una imagen del feto en una
pantalla, es de gran valor para el diagnstico de algunas malformaciones fetales. Al
confirmar el diagnstico se toman las medidas teraputicas y preventivas
requeridas, tales como restricciones dietticas, administracin de enzimas,
trasplantes de clulas, manipulacin gentica y tratamiento quirrgico prenatal,
entre otras.

CARIOTIPO HUMANO
El cariotipo es una fotografa o representacin grfica de los cromosomas indi-
viduales ordenados en un formato normatizado que muestra el nmero, tamao y
forma de cada tipo de cromosoma (Figs. 4.20, 4.21 y 4.22; Tabla 4.4). Se usa para
correlacionar anormalidades cromosmicas con determinadas enfermedades.

Fig. 4.20 Tipos morfolgicos de cromosomas


Tabla 4.4. Clasificacin de Denver para los
cromosomas humanos
grupo
pares de
cromosomas
caractersticas morfolgicas
A 1 3
metacntricos grandes y
submetacntricos
B 4 5 submetacntricos grandes
C 6 12 y X submetacntricos medianos
D 13 15 acrocntricos medianos
E 16 18 submetacntricos cortos
F 19 20 metacntricos cortos
G 21 22 y Y acrocntricos muy pequeos

Fig. 4.21 Morfologa cromosmica



Fig. 4.22 Cariotipo de una mujer normal- 46, XX



Gua Metodolgica de Biologa
[183]


ACTIVIDAD
Construye tu rbol genealgico. Un rbol genealgico o genograma es un grfico que muestra las
relaciones de parentesco y la transferencia de los rasgos hereditarios a travs de varias
generaciones en una familia. Se elabora con el fin de detectar algunas anomalas genticas y para
establecer las probabilidades que tiene un padre de procrear un hijo con un rasgo determinado. El
anlisis genealgico puede detectar la herencia autosmica dominante y recesiva, y la herencia
ligada al sexo as como pueden observarse las relaciones de consanguinidad y la unin entre
personas estrechamente relacionadas. En las familias reales puede observarse en sus genogramas
un alto grado de consanguinidad, ya que era tradicional y beneficioso casarse entre los miembros
de la realeza. Los consejeros genticos emplean la genealoga para determinar en las parejas si
sern capaces de producir hijos sanos.


Expn tu rbol genealgico explicando el fenotipo entre los familiares presentados y el origen
posible de las enfermedades, refiriendo las leyes de Mendel y, especficamente, a la transmisin de
caracteres hereditarios (genotipo).

Gua Metodolgica de Biologa
[184]

PROYECTO GENOMA HUMANO
El Proyecto Genoma Humano (PGH) se inici en 1988 y se concluy en el 2004.
Consisti en obtener la secuencia completa de ms de 3,000 millones de pares de
bases del ADN del genoma humano, codificada en 23 pares de cromosomas
contenidos en cada una de las clulas del cuerpo. Se estima que, en total, deben
ser unos treinta mil genes.
En los ltimos aos la localizacin de genes ha tenido un notable avance, pues
en 1990 ya se haban localizado ms de 600. Es importante hacer notar que para
algunos cromosomas las investigaciones han resultado muy fructferas, como es el
caso del cromosoma X.
INGENIERA GENTICA
Es un conjunto de tcnicas cuyo objetivo principal es la creacin de nuevas
combinaciones genticas basndose en la manipulacin directa del ADN.

ADN Recombinante
A fines de los 70s, la gentica entr en una nueva era con el descubrimiento y
uso de las endonucleasas o enzimas de restriccin, que cortan el ADN en lugares
especficos. De esta manera se pudo manipular y formar una molcula de ADN con
una secuencia conocida, dando como resultado una molcula denominada ADN
recombinante (Fig. ). Este fue la base para el impulso de dos nuevas ramas de la
Gentica: la ingeniera gentica y la biotecnologa.
Se han transferido genes de mamferos a bacterias, que as producen
protenas de gran importancia econmica, como la insulina, la hormona del
crecimiento y el interfern (tabla ). Tambin se han desarrollado microorganismos
que degradan el petrleo, proceso de gran importancia ecolgica.

Transgnicos
Es la insercin de genes de un organismo a otro para mejorar su expresin. El
proceso consiste en la transferencia de un gen responsable de determinada
caracterstica en un organismo, hacia otro al cual se pretende incorporar esta
caracterstica. Los organismos transgnicos (llamados organismos genticamente
modificados, OGM) han sido manipulados genticamente en el laboratorio para
aumentar la productividad y rendimiento econmico de cultivos como maz, papa,
Gua Metodolgica de Biologa
[185]

tomate, chcharo, soya o algodn, as como del ganado vacuno y ovino. A partir de
estos organismos se elaboran alimentos llamados productos transgnicos.
Los beneficios que se alcanzan aplicando ingeniera gentica a las plantas son:
Adaptacin a condiciones desfavorables: temperaturas extremas, salinidad,
sequa, metales presentes en niveles txicos
Resistencia a herbicidas menos contaminantes para el medio ambiente.
Cualidades nutricionales mejoradas, como perfil de cidos grasos.
Caractersticas funcionales mejoradas, como disminucin de perecibilidad o
mayor vida en el estante.
Resistencia a enfermedades y plagas que reduzca el requerimiento de
agroqumicos.

En animales, se producen vacas que segregan en su leche una protena
humana, o que tengan un contenido menor de lactosa; cerdos con genes que
sinteticen hemoglobina humana, para usarla como sustituto de la sangre; cabras
cuya leche contenga el activador tisular del plasmingeno humano que disuelve los
cogulos sanguneos y se utiliza en el tratamiento de enfermos con cardiopatas.


ACTIVIDAD
El caso de la nuez del Brasil. El propsito de la actividad es analizar beneficios y riesgos de salud
por la aplicacin de nuevas tecnologas.
1. Lee con atencin la siguiente noticia:
La soya es una leguminosa de origen asitico que tiene muchos beneficios para la salud.
Posiblemente es el alimento natural con mayor contenido en protenas, vitaminas y minerales, lo
que le da una extraordinaria capacidad para nutrir. Una empresa cre soya transgnica rica en
metionina para elevar su valor nutricional, ya que es pobre en este aminocido. Para ello se us un
gen procedente de a nuez de Brasil.
Sin embargo, dado que un porcentaje de la poblacin es alrgica a la nuez de Brasil, antes de
sacar al mercado la soya, se hicieron varias pruebas de alergenicidad que resultaron negativas en
animales, pero cuando se hicieron pruebas con suero sanguneo de personas alrgicas, si hubo
reaccin, que se Confirm con pruebas en la piel.
2. Con base en la lectura responde las preguntas y elabora una conclusin.
Gua Metodolgica de Biologa
[186]

3. Cules son las ventajas y desventajas de la soya transgnica?
4. Por qu piensas que deben hacerse pruebas preliminares antes de liberar un producto
transgnico?
5. Por un lado, la soya transgnica beneficiara la nutricin de mucha gente, por otro lado podra
perjudicarla cmo lo solucionaras?
6. Investiga que especies vegetales y animales se han manipulado genticamente en nuestro pas y
cules son sus repercusiones, marcando sus ventajas y desventajas a nivel biolgico.
7. Elabora conclusiones sobre lo que determina la variedad de especies como las presentadas en el
cuadro comparativo y las exponga sealando las implicaciones, ticas, biolgicas, sociales y
econmicas ante el grupo.


Fig. 4.22 AD recombinante

Tabla 4.5 Pptidos y protenas producidos por
ingeniera gentica

pptido o
protena
uso o tratamiento
potencial
-antitripsina Enfisema
, , -interferones
Agentes antivirales,
antitumorales y
antinflamatorios.
Factor de
coagulacin VIII
Hemofilia
Calcitonina Osteomalacia
Factor de
crecimiento
epidrmico
Heridas
Eritropoyetina Anemia
Hormona del
crecimiento
Promocin del
crecimiento
Insulina Diabetes
Interleucinas 1, 2 y 3
Trastornos inmunitarios
y tumores
Relaxina Auxiliar del parto
Somatostatina Acromegalia
Estreptoquinasa Anticoagulante
Activador del
plasmingeno
tisular
Anticoagulante
Factor de necrosis
tumoral
Cncer
Clonacin
La clonacin es la accin de reproducir a un ser de manera perfecta en el aspecto
fisiolgico y bioqumico de una clula originaria, es decir que a partir de una clula
de un individuo se crea otro exactamente igual al anterior. Un clon es el conjunto
Gua Metodolgica de Biologa
[187]

de individuos que desciende de otro por va vegetativa o asexual. La clonacin
existe en la naturaleza paralelamente a la reproduccin sexual. Los descendientes
de los microorganismos que iniciaron la vida, eran idnticos a sus padres.
En 1997, Ian Wilmut, anunci que haba clonado una oveja llamada Dolly. Esta
oveja se convirti en el primer mamfero clonado. En la clonacin de Dolly se
obtuvo un vulo de oveja, se elimina su ncleo, se sustituye por un ncleo de
clula de oveja adulta procedente del tejido mamario y se implanta en una tercera
oveja que sirve como mam de "alquiler" puesto que ser la que lleve el embarazo
(Fig. 3.25).

Fig. 4.25. Clonacin de la oveja Dolly
Terapia Gnica
Es un tratamiento que reemplaza genes defectuosos por otros sanos. En el futuro,
las enfermedades hereditarias podrn detectarse y curarse a tiempo gracias a este
procedimiento. En 1990, se inici el primer estudio clnico de terapia gnica
humana, con una nia que recibi una transfusin de leucocitos procesados
Gua Metodolgica de Biologa
[188]

mediante ingeniera gentica, para contener el alelo normal; en la actualidad la
nia tiene un sistema inmune funcional.
En 1994 se iniciaron estudios experimentales para combatir la fibrosis qustica,
una enfermedad pulmonar hereditaria. Con tcnicas de ingeniera gentica se
incluy en un virus el gen normal. El virus se introdujo en los pulmones por medio
de un aerosol bucal para que penetrara a las clulas que con esta informacin,
pudieran sintetizar la protena que al faltar produce la enfermedad.


ACTIVIDAD
Leche curativa
El propsito de esta actividad es identificar los avances de la manipulacin gentica.
1. Lee con atencin la siguiente noticia
Cientficos argentinos han creado una vaca transgnica que produce insulina en su leche. El ADN
de las vacas se ha modificado para que generen leche con el precursor de la insulina. De l se
extrae una molcula idntica a la del ser humano; mediante un proceso qumico, se purifica y se
transforma en un medicamento inyectable. As se ha conseguido que el frmaco final sea igual a la
hormona que los humanos sanos producen naturalmente. Y adems, es muy rentable: con ella, slo
en Argentina los precios de a insulina bajaran 30%.
Fuente: Vacas clonadas para producir insulina. Consultado el 6 de julio de 2010.
Disponible en http:///www.biotecnologica.com/vacas-clonadas-para-producir-insulina/(Adaptacin)
2. Investiga como se obtena anteriormente la insulina y responde las siguientes preguntas en tu
cuaderno.
3. Crees que esta tcnica sea mejor que las anteriores? , Por qu?
4. Si fueras diabtico usaras insulina con este origen?
5. Elabora una conclusin con base en la lectura y en tus respuestas.




Gua Metodolgica de Biologa
[189]

Clulas madre
Clula madre o stem cell se define como una clula progenitora, autorenovable,
capaz de regenerar uno o ms tipos celulares diferenciados. En animales
superiores, se clasifican en dos grupos:
Clulas madre embrionarias pluripotenciales que derivan de la masa celular
interna del blatocisto del embrin (7-14 das), y son capaces de generar todos los
diferentes tipos celulares del cuerpo.
Clulas madre rgano-especficas multipotenciales, es decir, capaces de
originar las clulas de un rgano concreto en el embrin, y tambin, en el adulto.
Un ejemplo de clulas madre rgano-especficas, es el de las clulas de la
mdula sea, que pueden generar todos los tipos celulares de la sangre y del
sistema inmune. Tambin existen en ms rganos como piel, grasa subcutnea,
msculo cardaco y esqueltico, cerebro, retina, pncreas, etc. Se cultivan tanto en
in vitro (en el laboratorio), como in vivo (en un modelo animal) utilizndolas en la
reparacin de tejidos daados. A pesar de todo, la aplicacin de estas tcnicas de
trasferencia de clulas madre de adulto para el recambio y reparacin de tejidos
enfermos est todava en sus comienzos.
Se ha comprobado que clulas madre de adulto pueden reprogramarse
(transdiferenciarse), y dar lugar a otros tipos celulares que hasta ahora se pensaba
que eran incapaces de generar. Es decir, ya no seran multipotenciales, si no
pluripotenciales.
En la lnea germinal se pide su prohibicin en todo aquello que sea
recomponer un programa gentico humano. Los trabajos con embriones humanos
con fines puramente experimentales se consideran un atentado a la dignidad de la
especie humana.
Por todo ello, es preciso que los conocimientos y avances en Ingeniera
Gentica se consideren patrimonio de la humanidad, y que los organismos
internacionales creados para ello sean capaces de vencer las reticencias que crean
los intereses polticos y econmicos, logrando una legislacin adecuada y justa,
que recoja las voces razonables de todos los sectores sociales.


Gua Metodolgica de Biologa
[190]

IMPLICACIONES BIOTICAS EN LA GENTICA
Los avances vertiginosos de la gentica y otras ciencias nos hacen preguntarnos si
el ser humano est listo para manejarlos correctamente. La tica y las leyes no han
avanzado al mismo ritmo que la ciencia, por lo que es imperioso el desarrollo de la
Biotica y de una legislacin adecuada para que estos nuevos conocimientos
generen un desarrollo positivo y no se conviertan en una forma de control y
exterminio.
Frente a los mltiples beneficios que ofrece este campo, se encuentran
algunos problemas que causa la aplicacin de la Ingeniera Gentica:
Sanitarios. Pueden aparecer nuevos microorganismos patgenos que causen
enfermedades desconocidas, o que el uso de frmacos de diseo provoque efectos
secundarios no deseados.
Ecolgicos. Al liberar nuevos organismos en el ambiente puede provocarse la
desaparicin de especies contra las que se lucha, con consecuencias an
desconocidas, ya que cumplen una funcin en la cadena trfica de la naturaleza. Se
puede pensar en posibles nuevas contaminaciones debidas a un metabolismo
incontrolado.
Sociales y polticos. Las aplicaciones de la biotecnologa en el campo de la
produccin industrial, agrcola y ganadera, pueden crear diferencias an ms
grandes entre pases ricos y pobres. El sondeo gnico en personas puede llevar a
consecuencias nefastas en la contratacin laboral, por ejemplo, y atenta contra la
intimidad a que tiene derecho toda persona.
ticos y morales. La experimentacin en la especie humana puede atentar
contra su misma dignidad. En el campo de la Terapia Gnica es defendible este
procedimiento cuando se utilice en clulas somticas para corregir enfermedades.
Gua Metodolgica de Biologa
[191]

LECTURAS SUGERIDAS
Cherfas, Jeremy (2003). El Genoma Humano. SEP/Planeta. Coleccin Espejo de
Urania. Mxico.
Claybourne, Ana. (2006) El Gran Libro de los Genes y el ADN. SEP/Usborne.
Coleccin Astrolabio. Mxico.
Garca, H. (1997). Gentica para el Futuro. Coleccin Esto es Qumica y qu?,
Facultad de Qumica, UNAM. Mxico.
Gmez Roig, E. (2003) La Clonacin 1. SEP/Libros del Escarabajo. Coleccin
Astrolabio. Mxico.
Gmez Roig, E. (2004) Los Transgnicos. SEP/Libros del Escarabajo. Coleccin
Espejo de Urania. Mxico.
Walter, R. (2004) Genes y ADN. SEP/Altea. Coleccin Espejo de Urania. Mxico.

VIDEOS RECOMENDADOS
Pelcula GATACA
La Eva Gentica Discovery Channel

TICs
Action Bioscience
http://actionbioscience.org/esp/genomica/index.html

Proyecto Bisfera.
http://recursos.cnice.mec.es/biosfera/

Embryos
http://www.embryos.org

My Heritage
http://www.myheritage.es/genealogia

Genograma
http://chato.cl/blog/2001/01/genograma_arbol_genealogico.html
Gua Metodolgica de Biologa
[192]

BIBLIOGRAFA
Audesirk, T, Audesirk, G y Byers, B.E. Biologa, Ciencia y Naturaleza. Prentice Hall.
Mxico, 2004.
Garca, H. Gentica para el Futuro. Coleccin Esto es Qumica y qu?, Facultad de
Qumica, UNAM. Mxico, 1997.
Nelson, Gideon E. Principios de Biologa. 3ra. Reimpresin de la Segunda Edicin,
Editorial Limusa Willey. Mxico, 2002.
Valdivia. B, Granillo.P, Villarreal M. S. Biologa, La Vida y sus Procesos.
Publicaciones Cultural. Mxico, 2006.
Villee, Claude A. Biologa. Octava Edicin. Editorial Mc Graw-Hilll, 2000