You are on page 1of 7

CMT

UNIVERSIDAD ANDRÉS BELLO


solemne 3 seccion 1

Asignatura: BIO034
Profesor: Claudio Villota Arcos

Instrucciones:

1. Responda solamente la alternativa correcta en cada pregunta.


2. Debe traspasar el identificador de la prueba a la hoja de respuestas, en el campo Forma

1) La replicacion corresponde a un proceso - Categoría:

a) semi conservativo
b) conservativo
c) segmentado
d) al azar
e) todas

2) durante la replicación, el primer de RNA es - Categoría:

a) removido por la DNA pol I


b) removido por la primasa
c) no se utilizan partidores en la replicacion en eucariontes
d) es mantenido y se hace parte del DNA de la hebra hija
e) ninguna

3) con respecto de la replicación es correcto afirmar que: - Categoría:

a) la hebra lider es copiada en el mismo sentido en el cual se mueve la orquilla de replicación


b) la hebra tardía es copiada en el mismo sentido en el cual se mueve la orquilla de replicación
c) la hebra lider es copiada en sentido opuesto al cual se mueve la orquilla de replicación
d) la hebra lider y la tardía son copiadas en el mismo sentido en el cual se mueve la orquilla de
replicación
e) ninguna

-1-
CMT

4) con respecto a la replicacion es correcto afirmar que: - Categoría:

a) la hebra lider se genera mediante un proceso continuo


b) la hebra lider se genera mediante un proceso discontinuo
c) la hebra tardia se genera mediante un proceso continuo
d) Ambas hebras se generan mediante un proceso discontinuo
e) ninguna

5) Es correcto afirmar que: - Categoría:

a) los eucariontes poseen multiples origenes de replicación


b) los procariontes poseen multiples origenes de replicación
c) los eucariontes poseen un unico origen de replicación
d) los eucariontes y procariontes poseen multiples origenes de replicación
e) ninguna

6) la estructura del promotor de procariontes esta formada por: - Categoría:

a) la secuencia ubicada en el -35 y en el -10 (TATA box)


b) la secuencia ubicada en el -35
c) la secuencia ubicada en el -10 (TATA box)
d) la secuencia Shine-Dalgarno
e) ninguna

7) Es correcto afirmar que: - Categoría:

a) el operador forma parte del promotor


b) el promotor forma parte del operador
c) el operador forma parte del represor
d) el operador forma parte del activador
e) ninguna

8) Es correcto afirmar que: - Categoría:

a) los eucariontes poseen tres RNAs Polimerasas (I, II y III)


b) los eucariontes poseen una sola RNA Polimerasa (I)
c) los procariontes poseen tres RNAs Polimerasas (I, II y III)
d) los eucariontes y los procariontes poseen tres RNAs Polimerasas (I, II y III)
e) ninguna

-2-
CMT

9) con respecto a la traducción es correcto afirmar que: - Categoría:

a) la region denominada codon se ubica en el RNA mensajero


b) la región denominada anticodon se ubica en el RNA mensajero
c) la región denominada codon se ubica en el RNA de transferencia
d) la región denominada codon se ubica en el ribosoma
e) ninguna

10) el enlace peptidico es aquel que: - Categoría:

a) se forma entre los aminoacidos que conforman una proteina


b) se forma entre las bases nitrogenadas que conforman una cadena nucleotida
c) se forma entre los aminoacidos que conforman una nucleotidica
d) se forma entre los nucleotidos que conforman una proteina
e) ninguna

11) una de la principales diferencias entre eucariontes y procariontes es: - Categoría:

a) que los eucariontes poseen mensajeros monocistronicos


b) que los procariontes poseen mensajeros monocistronicos
c) que los eucariontes poseen mensajeros policistronicos
d) no hay diferencias entre los mesajeros de procariontes y eucariontes
e) ninguna

12) el codon de inicio corresponde a - Categoría:

a) AUG
b) UGA
c) AAG
d) AGA
e) AUU

13) los codones de termino son: - Categoría:

a) UAA, UAG y UGA


b) UAA, AUG y UGA
c) AUG, UAG y UGA
d) UAA, UAG y AUG
e) UAA, UAG y AAA

-3-
CMT

14) cual de las siguientes secuencias presenta un marco de lectura abierto - Categoría:

a) AGUGAUGCCUAGCUACCUCCAAGCUUAACGC
b) AGUGAUGCCUAGCUACCUCCAAGCUAACGC
c) AGUGAUGCCUAGCUACCUCCAAGCUAACGC
d) AGUGuUGCCUAGCUACCUCCAAGCUUAACGC
e) ninguna

15) el operon Lac solo se activa cuando: - Categoría:

a) hay lactosa y no hay glucosa


b) hay lactosa y hay glucosa
c) no hay lactosa y hay glucosa
d) no hay lactosa y no hay glucosa
e) ninguna

16) el imprinting corresponde a: - Categoría:

a) el silenciamiento de uno de los dos alelos de un gen


b) la activavion de uno de los dos alelos de un gen
c) el silenciamiento de los dos alelos de un gen
d) la activacion de los dos alelos de un gen
e) ninguna

17) la acetilacion de la histonas esta asociada con: - Categoría:

a) la formación de eucromatina y la activacion de la expresión genica


b) la formación de heterocromatina y la activacion de la expresión genica
c) la formación de eucromatina y la inactivacion de la expresión genica
d) la formación de heterocromatina y la inactivacion de la expresión genica
e) ninguna

18) la eucromatina corresponde a: - Categoría:

a) la region relajada de la cromatina que es transcripcionalmente activa


b) la region relajada de la cromatina que es transcripcionalmente inactiva
c) la region condensada de la cromatina que es transcripcionalmente activa
d) la region condensada de la cromatina que es transcripcionalmente inactiva
e) ninguna

-4-
CMT

19) La primera divisón meiotica en la mujer se completa a partir de: - Categoría:

a) la pubertad
b) la etapa fetal
c) comienzo de la vida sexual activa
d) luego de la fecundación
e) en la infancia

20) la etapa de Hiperactivación de los espermios ocurre: - Categoría:

a) un aumento en el ATP intracelular y aumento en la movilidad del espermio


b) aumento en la movilidad del espermio
c) un aumento en el ATP intracelular y aumento del acrosoma
d) perdida de la cola del espermio
e) aumento en la movilidad del espermio y aumento del acrosoma

21) los nucleosomas se forman por interacción de las histonas: - Categoría:

a) H4, H3, H2a y H2b


b) H4, H3, H2a, H2b y H1
c) H4, H3, H1a y H1b
d) H1, H2, H3 y H4
e) ninguna

22) El DNA enrrollado sobre un nucleosoma corresponde a una longitud de: - Categoría:

a) 146 pares de bases


b) 200 pares de bases
c) 100 pares de bases
d) 250 pares de bases
e) ninguna

23) la estructura denominada solenoide corresponde a una fibra de: - Categoría:

a) 30 nm
b) 11 nm
c) 300 nm
d) 700 nm
e) 1400 nm

-5-
CMT

24) El tamaño de un poro nuclear se de aproximadamente: - Categoría:

a) 9 nm
b) 6 nm
c) 2 nm
d) 10 nm
e) 11 nm

25) la señal de localización nuclear es rica en residuos de: - Categoría:

a) K
b) L
c) A
d) G
e) Q

26) con respecto a la histona H1 es falso afirmar que: - Categoría:

a) forma parte del nucleosoma


b) forma parte del solenoide
c) mantiene la union del DNA y el nucleosoma
d) puede ser acetilada o fosforilada para generar relajacion o condensación de la cromatina
e) ninguna

27) Las Ribonucleoproteinas partcicipan de: - Categoría:

a) el transporte de RNA fuera del nucleo


b) el transporte de RNA hacia en nucleo
c) el transporte de proteinas fuera del nucleo
d) el transporte de proteinas hacia el nucleo
e) son chaperonas de otras proteinas

28) El óvulo corresponde un: - Categoría:

a) oocito secundario
b) oocito primario
c) oogonia
d) oocito fecundado
e) ninguna

-6-
CMT

29) el acortamiento de los telomeros esta asociado a: - Categoría:

a) el proceso de envejecimiento celular por efecto de muchas diviones celulares


b) infecciones virales
c) cancer
d) mal funcionamiento del ribosoma
e) todas

30) Con respecto a la replicación en procariontes es correcto afirmar que: - Categoría:Selección_Multiple

a) existen tres DNAs polimerasas demoninadas I, II y III


b) existe solo una DNA polimerasa
c) existen cinco DNAs polimerasas denominadas a,b,c, d y e
d) ninguna
e) existe una DNA polimerasa formada por las subunidades a, b, b’ y g

31) Con respecto a la traduccion es correcto afirmar que: - Categoría:Selección_Multiple

a) el aminoácido se une al extremo 3’ del tRNA


b) el aminoácido se une al extremo 5’ del tRNA
c) el aminoácido se une a la región del anticodon del tRNA
d) ninguna
e) el aminoácido se une al codon del tRNA

32) Con respecto a la meiosis es correcto afirmar que: - Categoría:Selección_Multiple

a) a partir de una celula se generan cuatro celulas hijas con diferente material genetico y
haploide
b) a partir de una celula se generan cuatro celulas hijas con diferente material genetico y diploide
c) a partir de una celula se generan cuatro celulas hijas con identico material genetico y haploide
d) a partir de una celula se generan cuatro celulas hijas con identico material genetico y diploide
e) ninguno

-7-