You are on page 1of 5

Inciso a)

GGTATGATAGTACCTACATATATCTATATCCCGGATTTAA

GGTATGATAGTACCTACATATATCCCCGGTTCGCCCCTAT

GGTATGATAGTACCTACATATATCTATTTATGGCGGCTCC

Inciso b)
GCATAGCTCATGATGCTCGATACGTCGAGTACAGCTGCAT

CAGTATACTGACTCGTAGCAGATGCGCATTAGCATGCCGT

ATGCGCATTAGCATGCCGTACGTATACGCGATGACTCGTA

Inciso c)

Oligo: 5'TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC
-3'
Primer1: 60 bases
Composition 15 A; 15 C; 15 G; 15 T; 0 OTHER
Percentage: 25% A; 25% C; 25% G; 25% T; 0%OTHER
MW=18.52 kDa

Hybridization: D:D
Salt: 50 mM
Formamide: 0%
Mismatch: 0 bp
Thermo Tm = 75.4 C %GC Tm = 72.1 C GC+AT Tm = 180.0C

Oligo: 5'-TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC-3'
Primer1: 32 bases
Composition 8

A; 8

C; 8

G; 8

T; 0 OTHER

Percentage: 25% A; 25% C; 25% G; 25% T; 0%OTHER


MW=9.88 kDa
Hybridization: D:D
Salt: 50 mM
Formamide: 0%
Mismatch: 0 bp
Thermo Tm = 63.8 C %GC Tm = 64.8 C GC+AT Tm = 96.0 C

Oligo: 5'-TAGCTAGCTAGCTAGCTAGC-3'
Primer1: 20 bases
Composition 5

A; 5

C; 5

G; 5

T; 0 OTHER

Percentage: 25% A; 25% C; 25% G; 25% T; 0%OTHER


MW=6.17 kDa
Hybridization: D:D
Salt: 50 mM
Formamide: 0%
Mismatch: 0 bp

Thermo Tm = 49.6 C %GC Tm = 55.4 C GC+AT Tm = 60.0 C