You are on page 1of 11

Prova Escrita de Biologia e Geologia (Teste 3)

11. Ano de Escolaridade


Durao da Prova: 90 minutos

11 pginas

Utilize apenas caneta ou esferogrfica de tinta indelvel, azul ou preta.


No permitido o uso de corretor. Em caso de engano, deve riscar de forma inequvoca
aquilo que pretende que no seja classificado.
Escreva de forma legvel a numerao dos grupos e dos itens, bem como as respetivas
respostas.
As respostas ilegveis ou que no possam ser claramente identificadas so classificadas
com zero pontos.
Para cada item, apresente apenas uma resposta. Se escrever mais do que uma resposta
a um mesmo item, apenas classificada a resposta apresentada em primeiro lugar.
Para responder aos itens de escolha mltipla, escreva, na folha de respostas:
o nmero do item;
a letra que identifica a nica opo escolhida.
Para responder aos itens de associao/correspondncia, escreva, na folha de
respostas:
o nmero do item;
a letra que identifica cada elemento da coluna A e o nmero que identifica o nico
elemento da coluna B que lhe corresponde.
Para responder aos itens de ordenao, escreva, na folha de respostas:
o nmero do item;
a sequncia de letras que identificam os elementos a ordenar.
As cotaes dos itens encontram-se no final do enunciado da prova.
A ortografia dos textos e de outros documentos segue o Acordo Ortogrfico de 1990.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 1 de 11

Escola: ______________________________ 11. ano Turma_____ Data ___/___/_____


Nome_________________________________________ N.____ Classificao________

Grupo I
Experincia de Luria e Delbrck
A experincia de Luria e Delbrck, tambm conhecida por teste de flutuao, foi publicada em 1943 e
tornou-se um marco no estudo dos mecanismos responsveis pelas mutaes nos organismos. Em
resultado, Max Delbrck e Salvador Luria ganharam o prmio Nobel da Medicina em 1969.
Na dcada de 40 do sculo XX, pensava-se que as bactrias eram capazes de alterar o seu DNA em funo
das condies do meio ambiente, mas no existiam evidncias experimentais. Luria e Delbrck
implementaram uma experincia para testar se as mutaes eram:

pr-adaptativas ocorreriam de forma aleatria, antes de as bactrias serem expostas ao agente


de seleo;

ps-adaptativas resultariam de presses resultantes do agente de seleo.


Estas duas hipteses encontram-se representadas na figura 1.

Figura 1 Hipteses levantadas por Luria e Delbrck.


Luria e Delbrck inocularam bactrias da espcie Escherichia coli em tubos de cultura distintos. Aps o
crescimento, transferiram iguais volumes de cultura celular para placas de Petri contendo agar (meio
slido) e repleto de bacterifagos T1 (vrus que destroem as bactrias).
Luria e Delbrck esperavam que as mutaes que causam resistncia aos bacterifagos fossem causadas
pela exposio aos mesmos, originando uma distribuio semelhante entre as placas de Petri. Os seus
resultados encontram-se representados na figura 2.

Figura 2 Resultados da experincia de Luria e Delbrck. Os pontos nas placas de Petri correspondem a
colnias de bactrias que foram capazes de resistir aos bacterifagos.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 2 de 11

Na resposta a cada um dos itens de 1. a 6., selecione a nica opo que permite obter uma afirmao
correta.
1.

De acordo com os dados, no incio da experincia Luria e Delbrck defendiam a hiptese ____, pois
esperavam que as mutaes ocorressem ____ da exposio ao agente de seleo.
(A) A () antes
(B) A () em resultado
(C)
B () antes
(D) B () em resultado

2.

Com base nos resultados da figura 2, possvel verificar que as mutaes ocorreram de forma
(A) aleatria e so pr-adaptativas, pois ocorreram antes do contacto das bactrias com os
bacterifagos.
(B) aleatria e so ps-adaptativas, pois ocorreram depois do contacto das bactrias com os
bacterifagos.
(C)
direcionada e so pr-adaptativas, pois ocorreram antes do contacto das bactrias com os
bacterifagos.
(D) direcionada e so ps-adaptativas, pois ocorreram depois do contacto das bactrias com
os bacterifagos.

3.

Relativamente experincia de Luria e Delbrck, possvel afirmar que


(A) nos tubos 2 e 9 os meios de cultura no tinham nutrientes suficientes para a proliferao
das bactrias, ao contrrio do tubo 3.
(B) as possveis mutaes nas bactrias do tubo 4 criaram resistncia aos bacterifagos.
(C)
nas bactrias as mutaes genticas surgem de forma independente do agente de seleo.
(D) a seleo natural apenas pode ser aplicada em seres vivos complexos.

4.

A bactria Escherichia coli pode distinguir-se de uma clula vegetal


(A) por no ocorrer processamento do RNA mensageiro transcrito a partir do DNA.
(B) pela quantidade de energia acumulada na molcula de ATP ser menor na bactria.
(C)
por possuir um ncleo menos complexo e com menor quantidade de DNA
comparativamente segunda.
(D) pela primeira apresentar a capacidade de acumular mutaes no seu material gentico.

5.

De acordo com o sistema de classificao de Whittaker modificado, o critrio que permite colocar a
bactria Escherichia coli inequivocamente no reino Monera
(A) ser unicelular.
(B) ser microconsumidor.
(C)
possuir parede celular.
(D) ser constituda por uma clula procaritica.

6.

Na designao da bactria Escherichia coli, o termo


(A) Escherichia refere-se ordem e coli ao restritivo especfico.
(B) Escherichia refere-se ao gnero e coli ao restritivo especfico.
(C)
Escherichia refere-se ordem e coli ao gnero.
(D) Escherichia refere-se ao gnero e coli ao restritivo subespecfico.

7.

Luria e Delbrck deixaram crescer as bactrias e depois transferiram iguais volumes de cultura
celular para placas de Petri.
Refira a importncia destes dois procedimentos experimentais.

8.

Explique em que medida a experincia de Luria e Delbrck constituiu um forte argumento a favor
das ideias de Darwin, em detrimento das ideias defendidas por Lamarck.

9.

O mecanismo de resistncia ao bacterifago T1 est relacionado com uma mutao que ocorre ao
nvel de um gene responsvel pela sntese de uma protena membranar que atua como recetor do
vrus e que permite a sua entrada na bactria.
Explique, numa perspetiva neodarwinista, o aparecimento de novas estirpes de bacterifagos que
so capazes de infetar as bactrias resistentes.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 3 de 11

Grupo II
Evoluo dos homindeos
A evoluo da nossa espcie ainda pouco conhecida. Contudo, a partir dos dados obtidos atravs do
estudo dos fsseis encontrados por todo o globo e de dados moleculares possvel construir rvores
filogenticas.
Na figura 3 encontra-se uma possvel relao filogentica que ter conduzido evoluo da nossa espcie.

Figura 3 Possvel evoluo dos homindeos.


O DNA mitocondrial de humanos modernos foi comparado com o DNA mitocondrial de chimpanzs
(0 primata filogeneticamente mais prximo) e com amostras recolhidas de vrios Neandertais, um
homindeo que desapareceu da Europa h cerca de 28 000 anos, com resultados que podem ser avaliados
na tabela I.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 4 de 11

Tabela I Comparao da sequncia de DNA mitocondrial de diferentes organismos. A letra X indica que
o nucletido de DNA igual ao da sequncia humana.
Organismo

Humano moderno
Chimpanz
Neandertal 1
Neandertal 2
Neandertal 3

Sequncia de DNA mitocondrial analisado

AATTCCCCGACTGCAATTCACGCACCATCCT
XXXXXXTXATTXXXXXACTGAAAXXXXGXXX
GGXCTTTTATTCXTCCCTGTAAGTATGCTXC
GGXXXXXXATTXATCCCCTGTAAXTATGCTT
XCXXXXXXATTXATCCCCTGTAAXTATGCTT

Na resposta a cada um dos itens de 1. a 5., selecione a nica opo que permite obter uma afirmao
correta.
1.

A partir da rvore filogentica representada na figura 3, podemos concluir que


(A) os genros Paranthropus e Homo tm origem em ancestrais diferentes.
(B) a espcie mais prxima da nossa o Homo erectus.
(C)
o gnero Homo teve origem no gnero Paranthropus.
(D) a divergncia do gnero Australopithecus dos gneros Homo e Paranthropus ocorreu h
menos de 3,5 milhes de anos.

2.

A explicao mais plausvel para a elevada variabilidade no DNA mitocondrial das populaes
humanas dispersas pelo continente africano o facto de
(A) 0 homem moderno ter surgido em frica e estar h mais tempo a evoluir neste continente.
(B) o DNA mitocondrial ter uma taxa de mutao superior em frica, quando comparado com
outros continentes.
(C)
0 homem moderno ter surgido em frica e estar h menos tempo a evoluir neste
continente.
(D) a seleo natural no operar no DNA mitocondrial dos organismos que habitam o
continente africano.

3.

Paranthropus aethiopicus, Paranthropus boisei e Homo habilis so designaes de trs espcies


que pertencem famlia Hominidae. Com base nesta nomenclatura, podemos concluir que
(A)
P. aethiopicus e P. boisei partilham o mesmo restritivo especfico.
(B) P. boisei e H. habilis partilham a mesma ordem.
(C)
P. aethiopicus e H. habilis pertencem ao mesmo gnero.
(D) as trs espcies pertencem a ordens diferentes.

4.

Os homindeos, tal como os restantes mamferos, so homeotrmicos, ou seja, tm temperatura


corporal ____ e produzem a maioria do seu calor atravs do metabolismo, sendo por isso
designados ____.
(A)
constante () ectotrmicos
(B) varivel () endotrmicos
(C)
constante () endotrmicos
(D) varivel () exotrmico

5.

No constitui um argumento a favor da teoria endossimbitica, o facto de


(A) o DNA mitocondrial ser circular e codificar todo o tRNA.
(B) os complexos proteicos envolvidos na fosforilao oxidativa estarem presentes na face
interior da membrana interna da mitocndria e na face interna da membrana plasmtica das
bactrias.
(C)
alguns organismos eucariontes sem mitocndrias possurem genes que codificam
protenas semelhantes s protenas mitocondriais.
(D) os ribossomas mitocondriais serem pequenos e semelhantes aos das bactrias.

6.

Mencione o primata do gnero Australopithecus ancestral dos homindeos.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 5 de 11

7.

Classifique como verdadeira (V) ou falsa (F) cada uma das afirmaes seguintes tendo como base o
estudo comparativo de DNA mitocondrial (Tabela I).
A. Existem mais diferenas entre a sequncia de DNA mitocondrial do homem e do chimpanz,
do que do homem e do neandertal 1.
B. Existem mais diferenas entre as sequncias de DNA mitocondrial dos neandertais 2 e 3, do
que do homem moderno e do chimpanz.
C. Existem menos diferenas entre as sequncias de DNA mitocondrial dos neandertais 2 e 3, do
que dos neandertais 1 e 2.
D. Com base na semelhana entre as sequncias, os chimpanzs so mais prximos do neandertal 1
do que dos humanos modernos.
E. Se as sequncias de DNA fossem transcritas e traduzidas, a sequncia de aminocidos
resultantes seria mais prxima entre os chimpanzs e o homem moderno do que entre este o
neandertal 1.
F. Embora pertenam todos mesma espcie, o neandertal 2 e o neandertal 3 devem partilhar
um maior nmero de rgos homlogos do que o neandertal 1 e o 2.
G. O RNA resultante da transcrio do DNA mitocondrial humano analisado ter menos
nucletidos de uracilos do que o resultante da transcrio do DNA mitocondrial do
chimpanz.
H. Uma vez que as sequncias de DNA analisadas no so iguais, estes dados contrariam a teoria
da evoluo a partir de um ancestral comum.

8.

Faa corresponder a cada uma das letras de A a E, que correspondem a afirmaes relativas
evoluo da espcie humana, um dos nmeros romanos da chave. Utilize cada letra apenas uma vez.
Afirmaes:
A. Numa populao de homindeos h caractersticas que so transmitidas descendncia e que
resultaram de modificaes que os organismos sofreram para responder s variaes
ambientais.
B. A espcie humana permanece imutvel no tempo desde o momento da sua criao.
C. Numa populao de homindeos da mesma espcie, os indivduos que apresentam
caractersticas mais vantajosas conseguem adaptar-se de forma mais eficaz s variaes do
meio.
D. O Homo sapiens resulta de mecanismos evolutivos que atuaram ao longo do tempo.
E. Ao nvel do material gentico ocorrem mutaes que podem promover o aparecimento de
novos genes e, consequentemente, a produo de fentipos que permitem uma melhor
adaptao ao meio.
Chave:
I. Darwinismo
II. Fixismo
III. Fixismo e darwinismo
IV. Lamarckismo
V. Fixismo e neodarwinismo
VI. Lamarckismo, darwinismo e neodarwinismo
VII. Neodarwinismo
VIII. Lamarckismo e neodarwinismo

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 6 de 11

Grupo III
Ciclo de vida de cogumelos
Os fungos incluem um conjunto de organismos com ciclos de vida muito diversos, com formas de obteno
de alimento muito prprias, sendo um grupo essencial na reciclagem de nutrientes nas cadeias
alimentares.
Embora muitos dos aspetos do ciclo de vida dos fungos sejam ainda desconhecidos, alguns organismos,
como os cogumelos, possuem ciclos de vida j bem caracterizados.
Os cogumelos tm a maioria da sua massa no solo, sob a forma de hifas, formando o basidiocarpo. Esta
estrutura area vulgarmente designada por cogumelo apenas numa fase restrita do seu ciclo de vida, que
se encontra representado na figura 4.

Figura 4

Na resposta a cada um dos itens de 1. a 5., selecione a nica opo que permite obter uma afirmao
correta.
1.

Nos primeiros sistemas de classificao, o organismo representado na figura era includo no reino
____, e na classificao de Whittaker modificada foi includo no reino ____.
(A) Plantae () Monera
(B) Plantae () Fungi
(C)
Protista () Fungi
(D) Fungi () Protista

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 7 de 11

2.

No passado, alguns cientistas consideravam que todos os fungos tinham evoludo a partir de uma
alga, que teria
(A) perdido os cloroplastos.
(B) ganho os cloroplastos.
(C)
perdido as mitocndrias.
(D) ganho as mitocndrias.

3.

Os fungos so seres ____ quanto fonte de carbono, quanto organizao celular ____.
(A) heterotrficos () so todos multicelulares
(B) heterotrficos () podem ser multicelulares ou unicelulares
(C)
autotrficos () so todos multicelulares
(D) autotrficos () podem ser multicelulares ou unicelulares

4.

Todos os fungos, nos quais se inclui o cogumelo cujo ciclo est representado na figura 4, so
organismos ____ e realizam ____.
(A) procariontes () digesto intracorporal
(B) procariontes () fotossntese
(C)
eucariontes () digesto extracorporal
(D) eucariontes () fotossntese

5.

Para que ocorra a replicao do DNA nos ncleos das clulas de fungos necessrio
(A) DNA polimerase e nucletidos contendo ribose.
(B) glicose, ATP e mRNA.
(C)
RNA ribossmico e aminocidos.
(D) DNA polimerase e nucletidos contendo desoxirribose.

6.

As afirmaes seguintes so respeitantes ao ciclo de vida representado na figura 4.


Utilize cada um dos termos da chave para avaliar cada uma das afirmaes de A a H.
Chave:
I. Afirmao apoiada pelos dados
II. Afirmao contrariada pelos dados
III. Afirmao sem relao com os dados
Afirmaes:
A. O basidiocarpo uma estrutura cujas clulas so haplontes e possuem apenas um ncleo.
B. No basidiocarpo, aps a unio dos dois ncleos, ocorre uma diviso que no mantm o
nmero de cromossomas, formando esporos.
C. Aps a formao dos esporos, estes so espalhados no meio ambiente pela ao da gua e do
vento.
D. A germinao dos esporos depende da ocorrncia de meioses sucessivas.
E. O ciclo de vida representado na figura 4 evidencia apenas mecanismos de reproduo
assexuada, com predominncia de uma fase haplonte.
F. O organismo representado possui rgos sexuais especializados.
G. Imediatamente aps a fuso das hifas de organismos diferentes, ocorre a fuso dos respetivos
ncleos.
H. Os fungos obtm os nutrientes que necessitam por absoro, sendo por isso designados por
microconsumidores.

7.

Em 1928, o investigador Alexander Fleming observou que esporos libertados por fungos
decompositores do po e da fruta impediram o crescimento de bactrias. Desde 1941 que se usa a
penicilina extrada a partir dos fungos como antibitico, no tratamento de diversas doenas
causadas por bactrias. A penicilina interfere na sntese da parede das bactrias, cujo citoplasma
hipertnico relativamente ao meio.
7.1. Relacione a eficcia da penicilina enquanto antibitico com o seu modo de atuao.
7.2. Explique em que medida a produo e libertao de penicilina pelos fungos confere uma
vantagem competitiva sobre as bactrias decompositoras vizinhas.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 8 de 11

Grupo IV
Sismologia
Os estudos na rea da sismologia so essenciais para compreendermos a dinmica interna do nosso
planeta e permitir prever a ocorrncia do prximo grande sismo.
Algumas regies da superfcie terrestre possuem maior atividade que outras. Por exemplo, na zona das
ilhas Aleutas, cuja localizao se encontra assinalada na figura 5, desde 1990 at ao final de 2014
registaram-se 202 sismos com magnitude superior a 5.
Com base no padro dos sismos possvel concluir que nas ilhas Aleutas existe uma zona de subduco.

Fonte: USGS, National Earthquake Information Center


Figura 4 (A) Principais placas litosfricas, com indicao da localizao das ilhas Aleutas.
(B) Sismicidade histrica desde 1990 at 2014.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 9 de 11

Na resposta a cada um dos itens de 1. a 5., selecione a nica opo que permite obter uma afirmao
correta.
1.

A partir da distribuio dos sismos, possvel concluir que na fossa das Aleutas ocorre a subduco
da placa ____ sob a placa ____.
(A) norte-americana () euro-asitica
(B) euro-asitica () norte-americana
(C)
do pacfico () euro-asitica
(D) do pacfico () norte-americana

2.

No contexto tectnico das ilhas Aleutas expetvel que, com o afastamento para norte da zona de
subduco, o ____ dos sismos se torne mais ____.
(A) hipocentro () profundo
(B) hipocentro () superficial
(C)
epicentro () profundo
(D) epicentro () superficial

3.

Nas zonas de subduco o vulcanismo tende a ser do tipo ____, com emisso de lavas cujo teor em
slica as permite incluir no grupo das lavas com composio ____.
(A) explosivo () bsica
(B) efusivo () bsica
(C)
explosivo () intermdia
(D) efusivo () intermdia

4.

Em termos morfolgicos, uma zona de subduco est habitualmente marcada por uma ____, e um
rifte submarino est no centro de uma ____.
(A) fossa ocenica () plataforma continental
(B) fossa ocenica () dorsal mdio ocenica
(C)
plataforma continental () dorsal mdio ocenica
(D) plancie abissal (..) dorsal mdio ocenica

5.

Na figura 4B est representado um limite tectnico do tipo ____, em que ocorre ____ das placas
litosfricas.
(A) convergente () destruio
(B) convergente () produo
(C)
divergente () destruio
(D) divergente () produo

6.

Num sismo de magnitude elevada que seja gerado na zona de subduco na regio das Aleutas, no
sero registadas ondas ssmicas ____ por sismgrafos que se encontrem a uma distncia angular
de, aproximadamente, ____ relativamente ao epicentro.
(A) P () 103 e 180
(B) S () 103 e 180
(C)
P () 143 e 180
(D) S () 43 e 180

7.

Ordene as letras de A a E de modo a reconstituir a sequncia cronolgica de acontecimentos que


ocorrem na propagao de ondas ssmicas.
A. Chegada das ondas P ao epicentro.
B. Propagao de ondas superficiais a partir do epicentro.
C. Propagao de ondas S e P a partir do hipocentro.
D. Chegada das ondas P a uma estao sismogrfica situada 3000 km a oeste do epicentro,
seguida de ondas S.
E. Acumulao de energia nas rochas em profundidade, ao longo do tempo que antecede o sismo.

8.

A maioria dos tsunamis so gerados em ambientes tectnicos semelhantes ao das ilhas Aleutas.
Relacione a formao dos tsunamis com a magnitude dos sismos e o ambiente tectnico em que se
geram.

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 10 de 11

Prova Escrita de Biologia e Geologia (Teste 3)


11. Ano de Escolaridade

COTAES
GRUPO I
1. ........................................................................................................................................
2. ........................................................................................................................................
3. ........................................................................................................................................
4. ........................................................................................................................................
5. ........................................................................................................................................
6. ........................................................................................................................................
7. ........................................................................................................................................
8. ........................................................................................................................................
9. ........................................................................................................................................

5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
10 pontos
10 pontos

55 pontos
GRUPO II
1. ........................................................................................................................................ 5 pontos
2. ........................................................................................................................................ 5 pontos
3. ........................................................................................................................................ 5 pontos
4. ........................................................................................................................................ 5 pontos
5. ........................................................................................................................................ 5 pontos
6. ........................................................................................................................................ 5 pontos
7. ........................................................................................................................................ 10 pontos
8. ........................................................................................................................................ 10 pontos
50 pontos
GRUPO III
1. ........................................................................................................................................ 5 pontos
2. ........................................................................................................................................ 5 pontos
3. ........................................................................................................................................ 5 pontos
4. ........................................................................................................................................ 5 pontos
5. ........................................................................................................................................ 5 pontos
6. ........................................................................................................................................ 10 pontos
7.1 ....................................................................................................................................... 5 pontos
7.2 ...................................................................................................................................... 10 pontos
50 pontos
GRUPO IV
1. ........................................................................................................................................
2. ........................................................................................................................................
3. ........................................................................................................................................
4. ........................................................................................................................................
5. ........................................................................................................................................
6. ........................................................................................................................................
7. ........................................................................................................................................
8. ........................................................................................................................................

5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
5 pontos
10 pontos

45 pontos
TOTAL .............................. 200 pontos

Desafios, Biologia e Geologia 11. ano


ASA, 2015

Pgina 11 de 11