Plant Mol Biol Rep (2014) 32:8291

DOI 10.1007/s11105-013-0603-2

ORIGINAL PAPER

Molecular Cloning and Characterization of a Trichome-Specific

Promoter of Artemisinic Aldehyde 11(13) Reductase (DBR2)
in Artemisia annua
Weimin Jiang & Xu Lu & Bo Qiu & Fangyuan Zhang & Qian Shen &
Zongyou Lv & Xueqing Fu & Tingxiang Yan & Erdi Gao & Mengmeng Zhu &
Lingxian Chen & Ling Zhang & Guofeng Wang & Xiaofen Sun & Kexuan Tang

Published online: 26 May 2013

# Springer Science+Business Media New York 2013

Abstract Artemisinin is widely used as an antimalarial drug

around the world. Artemisinic aldehyde 11(13) reductase
(DBR2) is a key enzyme which reduces artemisinic aldehyde
to dihydroartemisinic aldehyde in the biosynthesis of artemisinin.
In this study, two fragments encompassing a putative promoter of
DBR2, designated as DBR2pro1 and DBR2pro2, were isolated
using genomic DNA walking. The transcription start site and the
putative cis-elements of each version of promoter were predicted
using bioinformatic analysis. In order to study the function of the
cloned promoter, Artemisia annua was transformed with glucuronidase (GUS) reporter gene driven by DBR2pro1 and
DBR2pro2, respectively. GUS staining results demonstrated that
both DBR2pro1 and DBR2pro2 were strongly expressed in
glandular secretory trichomes (GSTs) of leaf primordia and
flower buds, but were not obviously expressed in roots, stems,
old leaves, and fully developed flowers, thus indicating that the
two versions of promoter were functional and specifically
expressed in GSTs.
Weimin Jiang and Xu Lu contributed equally to this work
Electronic supplementary material The online version of this article
(doi:10.1007/s11105-013-0603-2) contains supplementary material,
which is available to authorized users.
W. Jiang : X. Lu : B. Qiu : F. Zhang : Q. Shen : Z. Lv : X. Fu :
T. Yan : E. Gao : M. Zhu : L. Chen : L. Zhang : G. Wang :
X. Sun : K. Tang
Fudan-SJTU-Nottingham Plant Biotechnology R&D Center,
School of Agriculture and Biology, Shanghai Jiao Tong University,
Shanghai 200240, Peoples Republic of China
W. Jiang : X. Lu : B. Qiu : F. Zhang : Q. Shen : Z. Lv : X. Fu :
T. Yan : E. Gao : M. Zhu : L. Chen : L. Zhang : G. Wang :
X. Sun : K. Tang (*)
Plant Biotechnology Research Center, School of Agriculture and
Biology, Shanghai Jiao Tong University, Shanghai 200240,
Peoples Republic of China
e-mail: kxtang1@yahoo.com

Keywords DBR2 . Artemisia annua . Promoter . GUS .

Artemisinin . Transformation

Introduction
Artemisia annua has been used as a medicinal plant in China
for a long time (Hsu 2006; Miller and Su 2011).
Artemisinin, which is extracted from A. annua, is widely
used as drugs for treating malaria (Miller and Su 2011).
Artemisinin-based combination therapy is the most effective
method against malaria (Bhattarai et al. 2007). Artemisinin
might also play a role in the treatment of other diseases,
such as cancer and hepatitis B virus (Romero et al. 2005;
Singh and Lai 2004). However, the yield of artemisinin is
too limited to meet the demand of market (Covello 2008;
Graham et al. 2010), while metabolic engineering is very
promising to produce artemisinin. Artemisinin could be
partly synthesized in Escherichia coli and the engineered
yeast Saccharomyces cerevisiae (Chang et al. 2007; Martin
et al. 2003; Ro et al. 2006). The content of artemisinin could
be increased by suppressing the expression of squalene
synthase, a key enzyme of sterol pathway which competes
with the pathway of artemisinin biosynthesis (Zhang et al.
2009), or by overexpression of the key enzymes of
artemisinin biosynthesis pathway (Chen et al. 2012).
The artemisinin biosynthesis pathway has been studied
for many years, and most of the enzymes have already been
cloned (Arsenault et al. 2010; Covello et al. 2007). The
precursor of artemisinin biosynthesis is isopentenyl diphosphate (IPP) which originates from both mevalonate pathway
and nonmevalonate pathway (Towler and Weathers 2007).
IPP and dimethylallyl diphosphate form farnesyl diphosphate (FPP) by farnesyl diphosphate synthase. Amorpha4,11-diene synthase (ADS) is the first key enzyme in the

Plant Mol Biol Rep (2014) 32:8291

artemisinin biosynthesis pathway, which converts FPP to

amorpha-4,11-diene (Bouwmeester et al. 1999; Picaud et al.
2005; Pu et al. 2013; Wallaart et al. 2001). Amorpha-4,11diene is gradually oxidized to artemisinic alcohol, artemisinic
aldehyde, and artemisinic acid through cytochrome P450
enzyme CYP71AV1 (CYP) (Teoh et al. 2006). Artemisinic
aldehyde could be reduced to dihydroartemisinic aldehyde by
artemisinic aldehyde 11(13) reductase (DBR2) (Zhang et al.
2008). Dihydroartemisinic aldehyde is further oxidized to
dihydroartemisinic acid (DHAA) through an aldehyde dehydrogenase (ALDH1) (Teoh et al. 2009). DHAA could be
converted into artemisinin with unknown mechanism (Sy
and Brown 2002). At the same time, some transcription factors regulating the artemisinin biosynthesis pathway have
been cloned. AaWRKY1 could positively regulate the expression of ADS in the artemisinin biosynthesis pathway (Ma et al.
2009); AaERF1 and AaERF2 were supposed to bind to both
ADS and CYP promoters (Yu et al. 2012).
Trichomes are small protrusions of epidermal origin on the
surfaces of leaves, flowers, and other organs of plants
(Schilmiller et al. 2008). Many genes related with trichome
development have been reported (Schellmann and Hlskamp
2005). Trichomes are generally divided into two categories:
glandular trichomes and nonglandular trichomes. Artemisinin
is produced in glandular secretory trichomes (GSTs) (Olsson et
al. 2009; Tellez et al. 1999). The content of artemisinin changes
with the amount and growth stages of trichomes (Lommen et al.
2006). Most of the enzymes in artemisinin biosynthesis pathway
are preferentially expressed in GSTs (Olofsson et al. 2011).
Therefore, the study of promoters of genes in artemisinin biosynthesis pathway would be significantly important. It was
reported that the promoter of ADS is specifically expressed in
glandular trichomes (Kim et al. 2008; Wang et al. 2011a). The
promoter of CYP was isolated in our lab previously, which was
trichome-specific promoter (Wang et al. 2011b). Recently, another copy of CYP was cloned (Wang et al. 2012). However,
there was no study about the promoters of DBR2 and ALDH1.
In this study, two versions of DBR2 promoter were cloned
through genomic DNA walking method. Moreover, using glucuronidase (GUS) assay, the activities of the promoter were
studied by stable transformation in A. annua. These results
could make us better understand the artemisinin biosynthesis
pathway. It may bring us great progresses to produce
artemisinin in metabolic engineering.

Materials and Methods

Plant Materials and Growth Conditions
Seeds of A. annua were obtained from Southwest University
(Chongqing, China), surface-sterilized with 70 % ethanol for
2 min and then with 0.5 % sodium hypochlorite solution for

83

7 min, and then rinsed with sterilized distilled water for four
times. Seeds were germinated on one-half strength Murashige
and Skoog (1962) (1/2 MS) medium under a 16-h photoperiod, providing 4060 mol m2 s1 light intensity, at 231 C
(Lu et al. 2012a). The seedlings were transferred into soil after
10 days, and some of them were transferred to the green house
after 6 weeks (Zhang et al. 2012).
DNA Extraction and Isolation of DNA Fragments
of the DBR2 Promoter of A. annua
Genomic DNA was extracted from young leaves and flower
buds of A. annua through the cetyltrimethylammonium bromide
(CTAB) method (Lu et al. 2011, 2012b; Porebski et al. 1997). To
isolate the promoter of DBR2, GenomeWalkerTM Universal Kits
(Clontech, 638904) were used. Three blunt end restriction enzymes, DraI, EcoRV, and PvuII, were used to digest the A. annua
genomic DNA. All the digested products were purified and
linked with the Genome Walker adapters. The primary PCR
was operated using nested gene-specific primers DBR2-SP1
and the adapter primer AP1 (Table 1). The secondary PCR was
operated using 1 L of 50 dilution of the primary PCR products
as the PCR templates and using nested gene-specific primer
DBR2-SP2 and the adapter primer AP2 (Table 1) (Wang et al.
2011b).
DNA Sequence Analysis
Two sequences from the genomic DNA walking method above
were cloned to pMD18-T simple vector according to the instructions (TaKaRa D103A). Nucleotide acid sequences were
analyzed using Vector NTI software (Invitrogen, USA).
Bioinformatic analyses of the two sequences were carried out
online BLASTN at the NCBI database and EBI database (Lu et
al. 2012a). The transcription start site (TSS) and the elements of
the cloned promoter were analyzed by the TSSP software (http://
linux1.softberry.com/berry.phtml), the PlantCARE software
(http://bioinformatics.psb.ugent.be/webtools/plantcare/html/),
Table 1 Primers used in this study
Primers

Primer sequences

AP1
AP2
DBR2-SP1
DBR2-SP2
DBR2pro1-up
DBR2pro1down
DBR2pro2-up
DBR2pro2down
GUS-down

GTAATACGACTCACTATAGGGC
ACTATAGGGCACGCGTGGT
ATAAGAAAGCCACCAGCAGTTGA
ATTGAACTTGCCCATCTTGTAGG
GACTGCAGTGAAGGATGACCAAAAGCATAA
GCGGATCCTATTGAATTTGATGTTGATCAGG
GACTGCAGTGAAGGATGACCAAAAGCATAA
GCGGATCCTATTGAGTTTGATGTTGATCAGG
GCCTGCCCAACCTTTCGGTATA

84

Plant Mol Biol Rep (2014) 32:8291

Table 2 The length and the accession number of DBR2pro1/2 at

GenBank
Name

Length

Accession no. at NCBI

DBR2pro1
DBR2pro2

1,813 bp
1,780 bp

KC347592
KC347593

and the PLACE software (http://www.dna.affrc.go.jp/PLACE/

signalscan.html).
Construction of Overexpression Vectors and A. annua
Transformation
pCAMBIA1391Z-DBR2pro1 and pCAMBIA1391ZDBR2pro2 were constructed by amplifying the promoter with

Fig. 1 Sequence of DBR2pro1 with putative TSS and cis-elements

the specific primers DBR2pro1/DBR2pro2-up and

DBR2pro1/DBR2pro2-down (Table 1) and then excising the
full sequences of DBR2pro1/DBR2pro2 with PstI and BamHI.
The two constructs were introduced into Agrobacterium
tumefaciens strain EHA105.
When the plants grew to 5 cm in length, young leaves from
the seedlings were cut into about 0.5 cm diameter discs, which
were used as the explants in A. tumefaciens-mediated transformation (Vergauwe et al. 1996; Zhang et al. 2009). The l/2
MS suspension, with the activated EHA105 harboring
DBR2pro1 or DBR2pro2, completely covered the explants.
The mixture was then cultured at 28 C in the dark for 48 h.
After cocultivation, the explants were washed with sterile
distilled water containing cefotaxime (200 mg/L) for four
times. After hygromycin B selection in the selective shoot-

Plant Mol Biol Rep (2014) 32:8291

induction medium MS1 (MS0+2 mg/L N6-benzoyladenine+

0.2 mg/L naphthalene-1-acetic acid+25 mg/L hygromycin B),
the hygromycin B-resistant plantlets were regenerated and
transferred into rooting medium MS2 (MS0 + 0.3 mg/L
naphthalene-1-acetic acid) for root induction. When the roots
were formed, the rooted plantlets were transferred into soil for
further growth in the green house.
After genomic DNAs were extracted by CTAB method,
using primers DBR2pro1-up/DBR2pro2-up and GUS-down
(Table 1), DBR2pro1 and DBR2pro2 transgenic plants were
identified from regenerated A. annua plants by PCR analysis.
GUS Assay
Roots, stems, leaf primordia, young leaves, and old leaves
were analyzed from 8-week-old transgenic A. annua and the

Fig. 2 Sequence of DBR2pro2 with putative TSS and cis-elements

85

wild A. annua by GUS staining assay to perform GUS

analysis. When the plants flowered, flower buds and flowers
were analyzed by the same methods. GUS staining of the
various plant tissues was performed as previously described
(Kang et al. 2009). Stained tissues were cleared in 70 %
ethanol and detected under a microscope (Olympus BX51)
with a digital camera (Olympus DP70).
RT-PCR
Total RNA was extracted from the different tissues of A. annua
plants using RNAprep pure Plant Kit (Tiangen Biotech, Beijing)
according to the instructions. Concentration of the A. annua total
RNA was measured by a NanoDrop spectrophotometer
(NanoDrop, Wilmington, USA) and analyzed by agarose gel
electrophoresis. First-strand synthesis of cDNA was carried out

86

Plant Mol Biol Rep (2014) 32:8291

Structure Analysis of DBR2pro1 and DBR2pro2

Fig. 3 Construction of pCAMBIA1391Z-DBR2pro1/ DBR2pro2

vectors

by PrimeScript RT Master Mix (TaKaRa, Japan) according to

the manufacturers instructions.
Expression of the genes in A. annua were analyzed by
quantitative reverse transcription (RT)-PCR (qPCR) using
the fluorescent intercalating dye SYBR Green (TaKaRa,
Japan) in a detection system (Opticon3; MJ Research).
qPCR was performed as previously described (Lu et al.
2012a). The data were analyzed by 2-CT method
(Livak and Schmittgen 2001). AaActin1 was used as a
standard control in the qPCR analysis.

Results
Cloning of DBR2 Promoter
To isolate DBR2 promoter, genomic DNA walking method
was used from three different genomic DNA libraries, and
two DNA fragments were identified. Sequence analysis
showed that both of the two sequences overlapped 50 bp
at the 5 end of the ORF of DBR2. Upstream of the ORF of
DBR2, we acquired two upstream sequences of DBR2,
1,813 bp and 1,780 bp, named DBR2pro1 and DBR2pro2,
respectively (Table 2). The similarity of the two sequences
was 75 %.

The TSSs of the cloned promoter were predicted by the

TSSP software (http://linux1.softberry.com/berry.phtml).
For DBR2pro1, a putative TSS of the promoter (labeled +1
in Fig. 1) was predicted 86 bp upstream of the translation
initiation ATG codon (labeled ORF in Fig. 1). A putative
TATA box was found at the position from 34 to
28 bp (labeled TATA box in Fig. 1) in the upstream of
the putative TSS.
For DBR2pro2, a putative TSS of the promoter (labeled +1
in Fig. 2) was predicted 1,142 bp upstream of the translation
initiation site ATG (labeled ORF in Fig. 2). A putative TATA
box was found at the position from 11 to 8 bp (labeled
TATA box in Fig. 2) in the upstream of the putative TSS.
Putative cis-elements of the promoter were predicted by the
PlantCARE software (http://bioinformatics.psb.ugent.be/
webtools/plantcare/html/) and the PLACE software (http://
www.dna.affrc.go.jp/PLACE/signalscan.html). For
DBR2pro1, many elements were found in the sequence
(Fig. 1): ABRE motifs were found at the positions from 1,264
to 1,259 bp and from 1,222 to 1,217 bp; G boxes at the
positions from 1,264 to 1,259 bp, from 1,223 to
1,218 bp, from 165 to 160 bp, and from 62 to
57 bp; CAT box at the position from 1,237 to 1,232 bp;
W boxes at the positions from 955 to 950 bp, from 750
to 745 bp, and from 247 to 242 bp; 5-UTR Py-rich stretch
at the position from 662 to 657 bp; CRTDREHVCBF2
(CBF2) motifs at the positions from 1,049 to 1,044 bp,
from 469 to 464 bp, and from 367 to 362 bp; and
RAV1AAT (RAA) motifs at the positions from 1,202 to
1,198 bp, from 782 to 778 bp, from 714 to 710 bp,
from 23 to 19 bp, from 22 to 26 bp, from 69 to 73 bp,
and from 98 to 94 bp.

Fig. 4 GUS staining of high-density GSTs tissues of transgenic A. annua containing pCAMBIA1391Z-DBR2pro1. a, b Leaf primordia; c flower
buds; d CK; eh fluorescence images of (a)(d). Scale bars in (a, d, e, h) = 200 m; scale bars in (b, c, f, g) = 100 m

Plant Mol Biol Rep (2014) 32:8291

87

Fig. 5 GUS staining of high density GSTs tissues of transgenic A. annua containing pCAMBIA1391Z-DBR2pro2. a, b Leaf primordia; c Flower
buds; d CK; e-h Fluorescence images of (a)-(d). Scale bar in (a, d, e, h)= 200 m; scale bars in (b, c, f, g) = 100 m

For DBR2pro2, many elements were also found in

the sequence (Fig. 2): TGA element was found at the
position from 529 to 524 bp; box 4 at the position
from 419 to 414 bp; GT1 motif at the position from 323
to 318 bp; AE box at the position from 216 to 209 bp; G
boxes at the positions from 179 to 174 bp and from 138
to 133 bp; GAG motif at the position from 126 to 132 bp; 5UTR Py-rich stretch at the position from 582 to 591 bp; MYB
binding site at the position from 628 to 633 bp; W box
at the position from 803 to 808 bp; CBF2 motifs at the
positions from 656 to 661 bp and from 391 to 396 bp; and
Fig. 6 GUS staining of young
leaves of transgenic A. annua. a
Young leaves of transgenic A.
annua containing
pCAMBIA1391Z-DBR2pro1;
b Young leaves of transgenic A.
annua containing
pCAMBIA1391Z-DBR2pro2;
c-d Fluorescence images of
(a)-(b). Scale bars = 200 m

RAA motifs at the positions from 117 to 113 bp, from 194
to 198 bp, from 462 to 466 bp, from 1,034 to 1,038 bp, from
1,078 to 1,082 bp, from 1,125 to 1,129 bp, and from 962 to
966 bp.
Expression Pattern of DBR2pro1 and DBR2pro2
To investigate the expression patterns of DBR2pro1 and
DBR2pro2, we placed the GUS reporter gene under the
control of DBR2pro1 and DBR2pro2, respectively (Fig. 3).
Then, the two constructs were introduced into A. annua by A.

88

Plant Mol Biol Rep (2014) 32:8291

DBR2 is a key enzyme in artemisinin biosynthesis pathway

(Zhang et al. 2008). Therefore, cloning the promoter of
DBR2 is extremely important to basic research. Two versions of DBR2 promoter were cloned. These two sequences
overlapped 50 bp at the 5 end of the ORF of DBR2. In A.

annua, 12-oxophytodienoate reductase 3 (OPR3), which

encodes a key enzyme in jasmonate biosynthesis pathway
(Sanders et al. 2000; Schaller and Stintzi 2009; Stintzi and
Browse 2000), has high similarity with DBR2 in nucleotide
acid sequences. But, they have totally different expression
patterns: DBR2 is preferentially expressed in young leaves
and flower buds and had almost no expression in roots,
stems, and old leaves, while AaOPR3 is mainly expressed
in stems and had no obvious expression in young leaves and
flower buds (Olofsson et al. 2011; Zhang et al. 2008). The
results of expression of DBR2 in various tissues also were
confirmed by qPCR. According to GUS staining and qPCR
results, we suppose that both sequences are promoters of
DBR2, and they are promoters of different copies of the
gene. Alternatively, there might be only one copy of
DBR2, and the two versions are the promoter of the same
ORF because A. annua cannot self-fertilize.
The TSSs of the promoter were predicted. Through prediction, a typical TATA box was found at the position from
34 to 28 bp in the upstream of the putative TSS in
DBR2pro1. For DBR2pro2, two probable TSSs were found
at the DBR2pro2: one was the +1 site and the other was +
424 site. There was no TATA box in 150 bp upstream of the
latter putative TSS. Therefore, we prefer the former TSS,
but the RACE PCR would be required to verify the true
TSS. Three W boxes (TTGACC[T]) were found in
DBR2pro1 and one W box in DBR2pro2. Most WRKYs
regulate the targets by binding to W box (Rushton et al.
2010), and AaWRKY1 regulated the expression of ADS by
binding to the W box of ADSpro (Ma et al. 2009). It
suggests that AaWRKY1 or other WRKYs may bind to
the promoter of DBR2. Three CBF2 ([G/A][T/C]CGAC)

Fig. 7 GUS staining of mature tissues of transgenic A. annua. a Roots of

transgenic A. annua containing pCAMBIA1391Z-DBR2pro1; b Stems of
transgenic A. annua containing pCAMBIA1391Z-DBR2pro1; c Old leaves
of transgenic A. annua containing pCAMBIA1391Z-DBR2pro1; d fully
developed flowers of transgenic A. annua containing pCAMBIA1391Z-

D BR 2 p r o 1 ; e R o o t s o f tr a n s ge n i c A . a n n u a c on t a i n i n g
pCAMBIA1391ZDBR2pro2; f Stems of transgenic A. annua containing
pCAMBIA1391Z-DBR2pro2; g Old leaves of transgenic A. annua containing
pCAMBIA1391Z-DBR2pro2; h fully developed flowers of transgenic A.
annua containing pCAMBIA1391Z-DBR2pro2. Scale bars = 200 m

tumefaciens-mediated leaf-disc transformation method.

Twenty four independent lines of DBR2pro1-GUS and 23
independent lines of DBR2pro2-GUS were obtained and confirmed by PCR analysis.
The GUS staining results showed that DBR2pro1 and
DBR2pro2 exhibited similar expression pattern which varied in different growth stages and tissues. The strong GUS
staining was observed in the GSTs of leaf primordia and
flower buds, and only the GSTs of them were stained
(Figs. 4 and 5). The GUS staining decreased in young leaves
(Fig. 6) and disappeared in old leaves and fully developed
flowers, and no GUS staining was detected in roots and
stems either (Fig. 7).
Expression patterns of the DBRpro1 and DBRpro2 were
also analyzed by qPCR (Fig. 8). The results of qPCR analysis are similar with the GUS staining results. DBR2pro1
and DBR2pro2 were strongly expressed in leaf primordia
and flower buds. The expression of both DBRpro1 and
DBRpro2 became weaker as the leaves and flowers were
developing. There were quite weak expression in roots and
stems. Furthermore, the activity of DBRpro1 and DBRpro2
were compared by qPCR (Fig. 8). The activity of DBRpro1
was higher than that of DBRpro2.

Discussion

Plant Mol Biol Rep (2014) 32:8291

89

Fig. 8 Expression of gene in

various tissues of transgenic A.
annua. a Expression levels of
DBRpro1:GUS in roots (R),
stems (S), leaf primordia (LP),
young leaves (YL), old leaves
(OL), flower buds (FB), and
fully developed flowers (FDF);
b expression levels of
DBRpro2:GUS in roots (R),
stems (S), leaf primordia (LP),
young leaves (YL), old leaves
(OL), flower buds (FB), and
fully developed flowers (FDF);
c comparison of activity of
DBRpro1 and DBRpro2

motifs and seven RAA (CAACA) motifs were found in

DBR2pro1; two CBF motifs and seven RAA motifs were
found in DBR2pro2. AaERF1 and AaERF2 are able to bind
to the CBF2 and RAA motifs present in both ADS and CYP
promoters (Yu et al. 2012). This indicates that AaERF1 and
AaERF2 may also be able to bind to the promoter of DBR2.
There may be other ERFs regulating the expression of ADS,
CYP, and DBR2 by CBF2 motif and RAA motif. DBR2pro2
carried an MBS motif which is the binding site for MYB
transcription factors. It indicates that AaMYBs may be
involved in the artemisinin biosynthesis. However, the functions of transcription factors above containing certain regulatory motifs are only prediction. It could be verified
experimentally by DNAprotein binding assay. These

regulatory elements existed in the different areas of

DBR2pro1 and DBR2pro2. The homologous areas of
DBR2pro1 and DBR2pro2 are 5 end and 3 end, while the
middle part is diverse. From the position of the regulatory
elements and distribution of the homologous areas, we think
that the uneven homology might result from evolution.
Both DBR2pro1 and DBR2pro2 are strongly expressed in
GSTs of leaf primordia and flower buds but have no obvious
expression in other tissues. Temporally, the expression of
DBR2pro1 and DBR2pro2 gradually decreased with the development of leaves and flowers. The expression patterns
were almost the same with ADS and CYP (Kim et al. 2008;
Ma et al. 2009; Olofsson et al. 2011; Wang et al. 2012; Zeng et
al. 2009). The expression pattern of DBR2 indicates the

90

reduction of artemisinic aldehyde to dihydroartemisinic aldehyde by DBR2 should mainly take place in GSTs of leaf
primordial, young leaf tissues, and flower buds. Since ADS,
CYP, DBR2, and ALDH1 were expressed in GSTs (Olofsson et
al. 2011), we propose that all the biosynthesis of artemisinin
precursors amorpha-4,11-diene, artemisinic alcohol,
artemisinic aldehyde, dihydroartemisinic aldehyde, and
DHAA mainly occurs in GSTs of leaf primordial, young leaf
tissues, and flower buds.
In this study, two trichome-specific versions of DBR2
promoter were cloned, which would bring great help to metabolic engineering to produce artemisinin. Plant metabolic
engineering is used to increase the content of artemisinin
using constitutive promoters. Overexpression of one or more
genes in artemisinin biosynthesis pathway increased the yield
of artemisinin in transgenic A. annua (Alam and Abdin 2011;
Aquil et al. 2009; Banyai et al. 2010; Chen et al. 2012; Nafis et
al. 2011). Downregulation of enzymes competing with the
artemisinin biosynthesis also led to an improved yield of
artemisinin (Chen et al. 2011; Feng et al. 2009; Zhang et al.
2009). Since many trichome-specific promoters were cloned
(Kim et al. 2008; Ma et al. 2009; Wang et al. 2012, 2011a, b),
it should be worth determining whether these promoters could
be used to more effectively improve the yield of artemisinin
compared to constitutive promoters by metabolic engineering.
Acknowledgments This work was funded by China 863 Program
(grant no. 2011AA100605), China Transgenic Research Program
(grant no. 2011ZX08002001), and Shanghai Leading Academic Discipline Project (Horticulture).

References
Alam P, Abdin MZ (2011) Over-expression of HMG-CoA reductase and
amorpha-4,11-diene synthase genes in Artemisia annua L. and its
influence on artemisinin content. Plant Cell Rep 30:19191928
Aquil S, Husaini AM, Abdin MZ, Rather GM (2009) Overexpression of the
HMG-CoA reductase gene leads to enhanced artemisinin biosynthesis
in transgenic Artemisia annua plants. Planta Med 75:14531458
Arsenault PR, Vail D, Wobbe KK, Erickson K, Weathers PJ (2010)
Reproductive development modulates gene expression and metabolite levels with possible feedback inhibition of artemisinin in
Artemisia annua. Plant Physiol 154:958968
Banyai W, Kirdmanee C, Mii M, Supaibulwatana K (2010)
Overexpression of farnesyl pyrophosphate synthase (FPS) gene
affected Artemisinin content and growth of Artemisia annua L.
Plant Cell Tissue Organ Cult 103:255265
Bhattarai A, Ali AS, Kachur SP, Mrtensson A, Abbas AK, Khatib R, Almafazy AW, Ramsan M, Rotllant G, Gerstenmaier JF, Molteni F,
Abdulla S, Montgomery SM, Kaneko A, Bjrkman A (2007)
Impact of artemisinin-based combination therapy and insecticidetreated nets on malaria burden in Zanzibar. PLoS Med 4:17841790
Bouwmeester HJ, Wallaart TE, Janssen MHA, Van Loo B, Jansen BJM,
Posthumus MA, Schmidt CO, De Kraker JW, Knig WA, Franssen
MCR (1999) Amorpha-4,11-diene synthase catalyses the first probable step in artemisinin biosynthesis. Phytochemistry 52:843854

Plant Mol Biol Rep (2014) 32:8291

Chang MCY, Eachus RA, Trieu W, Ro DK, Keasling JD (2007)
Engineering Escherichia coli for production of functionalized
terpenoids using plant P450s. Nat Chem Biol 3:274277
Chen JL, Fang HM, Ji YP, Pu GB, Guo YW, Huang LL, Du ZG, Liu BY,
Ye HC, Li GF, Wang H (2011) Artemisinin biosynthesis enhancement in transgenic Artemisia annua plants by downregulation of
the-Caryophyllene synthase gene. Planta Med 77:17591765
Chen Y, Shen Q, Wang Y, Wang T, Wu S, Zhang L, Lu X, Zhang F, Jiang
W, Qiu B, Gao E, Sun X, Tang K (2012) The stacked overexpression of FPS, CYP71AV1 and CPR genes leads to the increase
of artemisinin level in Artemisia annua L. Plant Biotechnol Rep.
doi:10.1007/s11816-012-0262-z
Covello PS (2008) Making artemisinin. Phytochemistry 69:28812885
Covello PS, Teoh KH, Polichuk DR, Reed DW, Nowak G (2007) Functional
genomics and the biosynthesis of artemisinin. Phytochemistry
68:18641871
Feng LL, Yang RY, Yang XQ, Zeng XM, Lu WJ, Zeng QP (2009)
Synergistic re-channeling of mevalonate pathway for enhanced
artemisinin production in transgenic Artemisia annua. Plant Sci
177:5767
Graham LA, Besser K, Blumer S, Branigan CA, Czechowski T, Elias L,
Guterman I, Harvey D, Isaac PG, Khan AM, Larson TR, Li Y, Pawson
T, Penfield T, Rae AM, Rathbone DA, Reid S, Ross J, Smallwood MF,
Segura V, Townsend T, Vyas D, Winzer T, Bowles D (2010) The
genetic map of Artemisia annua L identifies loci affecting yield of
the antimalarial drug artemisinin. Science 327:328331
Hsu E (2006) The history of qing hao in the Chinese materia medica.
Trans R Soc Trop Med Hyg 100:505508
Kang CY, Lian HL, Wang FF, Huang JR, Yang HQ (2009) Cryptochromes,
phytochromes, and COP1 regulate light-controlled stomatal development in Arabidopsis. Plant Cell 21:26242641
Kim SH, Chang YJ, Kim SU (2008) Tissue specificity and developmental pattern of amorpha-4,11-diene synthase (ADS) proved by
ADS promoter-driven GUS expression in the heterologous plant,
Arabidopsis thaliana. Planta Med 74:188193
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2-CT method.
Methods 25:402408
Lommen WJM, Schenk E, Bouwmeester HJ, Verstappen FWA (2006)
Trichome dynamics and artemisinin accumulation during development and senescence of Artemisia annua leaves. Planta Med
72:336345
Lu X, Jiang W, Zhang L, Zhang F, Shen Q, Wang T, Chen Y, Wu S, Lv
Z, Gao E, Qiu B, Tang K (2012a) Characterization of a novel ERF
transcription factor in Artemisia annua and its induction kinetics
after hormones and stress treatments. Mol Biol Rep 39:9521
9527
Lu X, Lin X, Shen Q, Zhang F, Wang Y, Chen Y, Wang T, Wu S, Tang
K (2011) Characterization of the jasmonate biosynthetic gene
allene oxide cyclase in Artemisia annua L., source of the
antimalarial drug artemisinin. Plant Mol Biol Rep 29:489
497
Lu X, Zhang F, Jiang W, Lin X, Chen Y, Shen Q, Wang T, Wu S, Sun
X, Tang K (2012b) Characterization of the first specific jasmonate
biosynthetic pathway gene allene oxide synthase from Artemisia
annua. Mol Biol Rep 39:22672274
Ma D, Pu G, Lei C, Ma L, Wang H, Guo Y, Chen J, Du Z, Li G, Ye H,
Liu B (2009) Isolation and characterization of AaWRKY1, an
Artemisia annua transcription factor that regulates the amorpha4,11-diene synthase gene, a key gene of artemisinin biosynthesis.
Plant Cell Physiol 50:21462161
Martin VJJ, Piteral DJ, Withers ST, Newman JD, Keasling JD (2003)
Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat Biotechnol 21:796802
Miller LH, Su X (2011) Artemisinin: discovery from the Chinese
herbal garden. Cell 146:855858

Plant Mol Biol Rep (2014) 32:8291

Murashige T, Skoog F (1962) A revised medium for rapid growth and
bio-assays with tobacco tissue cultures. Physiol Plant 15:473497
Nafis T, Akmal M, Ram M, Alam P, Ahlawat S, Mohd A, Abdin MZ
(2011) Enhancement of artemisinin content by constitutive expression of the HMG-CoA reductase gene in high-yielding strain
of Artemisia annua L. Plant Biotechnol Rep 5:5360
Olofsson L, Engstrm A, Lundgren A, Brodelius PE (2011) Relative
expression of genes of terpene metabolism in different tissues of
Artemisia annua L. BMC Plant Biol 11:45
Olsson ME, Olofsson LM, Lindahl AL, Lundgren A, Brodelius M,
Brodelius PE (2009) Localization of enzymes of artemisinin
biosynthesis to the apical cells of glandular secretory trichomes
of Artemisia annua L. Phytochemistry 70:11231128
Picaud S, Olofsson L, Brodelius M, Brodelius PE (2005) Expression,
purification, and characterization of recombinant amorpha-4,11diene synthase from Artemisia annua L. Arch Biochem Biophys
436:215226
Porebski S, Bailey LG, Baum BR (1997) Modification of a CTAB
DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Rep 15:815
Pu GB, Ma DM, Wang H, Ye HC, Liu BY (2013) Expression and
localization of amorpha-4,11-diene synthase in Artemisia annua
L. Plant Mol Biol Rep 31:3237
Ro DK, Paradise EM, Quellet M, Fisher KJ, Newman KL, Ndungu
JM, Ho KA, Eachus RA, Ham TS, Kirby J, Chang MCY, Withers
ST, Shiba Y, Sarpong R, Keasling JD (2006) Production of the
antimalarial drug precursor artemisinic acid in engineered yeast.
Nature 440:940943
Romero MR, Efferth T, Serrano MA, Castao B, MacIas RIR, Briz O,
Marin JJG (2005) Effect of artemisinin/artesunate as inhibitors of
hepatitis B virus production in an in vitro replicative system.
Antiviral Res 68:7583
Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcription factors. Trends Plant Sci 15:247258
Sanders PM, Lee PY, Biesgen C, Boone JD, Beals TP, Weiler EW,
Goldberg RB (2000) The Arabidopsis DELAYED DEHISCENCE1
gene encodes an enzyme in the jasmonic acid synthesis pathway.
Plant Cell 12:10411061
Schaller A, Stintzi A (2009) Enzymes in jasmonate biosynthesisstructure,
function, regulation. Phytochemistry 70:15321538
Schellmann S, Hlskamp M (2005) Epidermal differentiation: trichomes in Arabidopsis as a model system. Int J Dev Biol
49:579584
Schilmiller AL, Last RL, Pichersky E (2008) Harnessing plant trichome biochemistry for the production of useful compounds.
Plant J 54:702711
Singh NP, Lai HC (2004) Artemisinin induces apoptosis in human
cancer cells. Anticancer Res 24:22772280
Stintzi A, Browse J (2000) The Arabidopsis male-sterile mutant, opr3,
lacks the 12-oxophytodienoic acid reductase required for
jasmonate synthesis. Proc Natl Acad Sci U S A 97:1062510630
Sy LK, Brown GD (2002) The mechanism of the spontaneous autoxidation of dihydroartemisinic acid. Tetrahedron 58:897908
Tellez MR, Canel C, Rimando AM, Duke SO (1999) Differential
accumulation of isoprenoids in glanded and glandless Artemisia
annua L. Phytochemistry 52:10351040

91
Teoh KH, Polichuk DR, Reed DW, Covello PS (2009) Molecular
cloning of an aldehyde dehydrogenase implicated in artemisinin
biosynthesis in Artemisia annua. Bot 87:635642
Teoh KH, Polichuk DR, Reed DW, Nowak G, Covello PS (2006)
Artemisia annua L. (Asteraceae) trichome-specific cDNAs reveal
CYP71AV1, a cytochrome P450 with a key role in the biosynthesis of the antimalarial sesquiterpene lactone artemisinin. FEBS
Lett 580:14111416
Towler MJ, Weathers PJ (2007) Evidence of artemisinin production
from IPP stemming from both the mevalonate and the
nonmevalonate pathways. Plant Cell Rep 26:21292136
Vergauwe A, Cammaert R, Vandenberghe D, Genetello C, Inze D, Van
Montagu M, Van den Eeckhout E (1996) Agrobacterium
tumefaciens-mediated transformation of Artemisia annua L. and
regeneration of transgenic plants. Plant Cell Rep 15:929933
Wallaart TE, Bouwmeester HJ, Hille J, Poppinga L, Maijers NCA
(2001) Amorpha-4,11-diene synthase: cloning and functional expression of a key enzyme in the biosynthetic pathway of the novel
antimalarial drug artemisinin. Planta 212:460465
Wang H, Han J, Kanagarajan S, Lundgren A, Brodelius PE (2012)
Trichome-specific expression of the amorpha-4,11-diene 12hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisinin
biosynthesis in Artemisia annua, as reported by a promoter-GUS
fusion. Plant Mol Biol. doi:10.1007/s11103-012-9986-y
Wang H, Olofsson L, Lundgren A, Brodelius PE (2011a) Trichomespecific expression of amorpha-4,11-diene synthase, a key enzyme of artemisinin biosynthesis in Artemisia annua L., as
reported by a promoter-GUS fusion. Am J Plant Sci 2:619628
Wang Y, Yang K, Jing F, Li M, Deng T, Huang R, Wang B, Wang G, Sun
X, Tang KX (2011b) Cloning and characterization of trichomespecific promoter of cpr71av1 gene involved in artemisinin biosynthesis in Artemisia annua L. Mol Biol 45:751758
Yu ZX, Li JX, Yang CQ, Hu WL, Wang LJ, Chen XY (2012) The
jasmonate-responsive AP2/ERF transcription factors AaERF1
and AaERF2 positively regulate artemisinin biosynthesis in
Artemisia annua L. Mol Plant 5:353365
Zeng QP, Zeng XM, Yin LL, Yang RY, Feng LL, Yang XQ (2009)
Quantification of three key enzymes involved in artemisinin biogenesis in Artemisia annua by polyclonal antisera-based ELISA.
Plant Mol Biol Rep 27:5057
Zhang L, Jing F, Li F, Li M, Wang Y, Wang G, Sun X, Tang K (2009)
Development of transgenic Artemisia annua (Chinese wormwood) plants with an enhanced content of artemisinin, an effective anti-malarial drug, by hairpin-RNA-mediated gene silencing.
Biotechnol Appl Biochem 52:199207
Zhang L, Lu X, Shen Q, Chen Y, Wang T, Zhang F, Wu S, Jiang W, Liu
P, Wang Y, Tang K (2012) Identification of putative Artemisia
annua ABCG transporter unigenes related to artemisinin yield
following expression analysis in different plant tissues and in
response to methyl jasmonate and abscisic acid treatments. Plant
Mol Biol Rep 30:838847
Zhang Y, Teoh KH, Reed DW, Maes L, Goossens A, Olson DJH, Ross
ARS, Covello PS (2008) The molecular cloning of artemisinic
aldehyde 11(13) reductase and its role in glandular trichomedependent biosynthesis of artemisinin in Artemisia annua. J Biol
Chem 283:2150121508