You are on page 1of 5

MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)
Lecture 1
1. What is the primary mutation-repair mechanism? Polymerase proofreading
2. Name one way to repair a double stranded break NHEJ, homologous recombination
3. What could happen to your DNA if you don’t wear sunscreen? mutations, UV damage
4. What is a pseudogene? A region of genomic DNA that is similar in structure to a gene
but is non-functional
5. If an individual carries a particular mutation in its lungs but not in any other tissues, is it a
somatic or germline mutation? somatic
in sperm/eggs? germline
6. High-energy radiation can cause double strand breaks (DSBs) in DNA. Name two
mechanisms that repair these mutations. HR, NHEJ
7. NHEJ and HR are the major pathways for double strand break repair. Why is HR
considered a more accurate repair system than NHEJ? NHEJ joins the two strands
together non-specifically and sometimes there are insertions/deletions because of this
while HR uses the homologous DNA has a template to repair.
8. You found a hypermorphic mutation in Gene A, but the protein-coding region of the
mutant allele is same as that of wt allele. You reasoned that the phenotype could be
caused by a transposon insertion, so you sequenced the DNA around the gene, and
found there is, in fact, a transposon insertion around the gene A.
a. In which region did you probably find the transposon? [2points]
Gene expression regulatory regions, Promoter, or enhancer regions
b. What are the possible mechanisms by which this transposon insertion
caused this hypermorphic mutation? Write an example [2points]
TE might include enhancer, promoter or the protein coding region of gene A
itself; many answers possible but must be compatible with the answer to a)
Lecture 2
1. What is the difference between a conservative and nonconservative missense mutation?
The former changes an amino acid to one with similar chemical properties, while the
latter changes it to one with different properties
2. A point mutation that leads to an early stop codon is called what? nonsense
3. A point mutation that causes no change in the amino acid sequence of a protein is called
what? silent
4. Why do mutations in DNA that encode hydrophobic regions of proteins tend to have a
stronger effect than those that encode hydrophilic regions?
5. The same genetic mutation can result in (variable) phenotypes in different individuals.
What are the two terms that describe this? Incomplete penetrance, variable expressivity
6. If a doctor told you you had a “silent point mutation” in the protein coding region of an
important gene, would you worry? What if the doctor told you it was a “nonsense
mutation”? Why? No, because the amino acid sequence would be the same; yes,
because the protein would be short/truncated

MCB 104 Quiz 1 combined answer key (Different sections had different questions. Do you expect a mutant phenotype from this heterozygous gene? Answer why or why not. copy number inc. we review the tbx-9 mutant. is also transcribed and the part of the mRNA transcript including the mutation is AUGACUUGGCUAAGAACUUGAAAA (each sequence starts with the first letter of a codon) a. it encodes the same (wt) protein (the changed codon still encodes leucine) b. To explain expressivity and penetrance of a mutation. You find that you are heterozygous for a gene: Allele A is transcribed and a part of the mRNA transcript is AUGACUUGGCUGAGAACUUGAAAA Allele A’. 4. Siamese cats have a temperature-sensitive tyrosinase mutation . Because of this. which is a mutant allele. transcription inc.what kind of allele is this? conditional 2. What type of mutation is it called? [2points] Silent mutation Lecture 3: 1. and only a couple (have white fur) are white-furred. many explanations possible 8. environment. Give two (one-two word) reasons why a mutation might have variable expressivity or penetrance. (cancer cells from) many cancer patients have been found to have mutations in one of . tbx-9 individuals with high expression of daf-21 are normal whereas those with low expression of daf-21 are abnormal. How do you explain this phenomenon? Genetic background (other genes besides tbx-9 and daf-21). However.) 7. duplication. Give two (one-two word) ways that a mutation could make a gene hypermorphic. [2points] No. genetic background. protein activity inc. p53 is a protein that helps prevent cancer through various mechanisms. you’ll find that some abnormal individuals have the same level of expression of daf-21 as normal individuals. environmental conditions and stochastic events . which phenotype would you guess is the wildtype phenotype? Why? Brown fur. if you examine individual animals. stochastic events 3. If you have a population of rats where nearly all of them (have brown fur) are brownfurred. 9. translation inc.

6. If you find a mutant phenotype that only seems to appear in male mice. white. Wild-type puffskeins have flat hair. by preventing wild-type p53 from binding to the promoter of its target genes 5. Snapdragon flowers come in three possible colors: Red. but there will be no gene function at the restrictive temperature. Among your population of puffskeins.) their p53 alleles. some have fluffier hair than others. and fungi . Describe and explain the penetrance and expressivity of this mutation. but individuals with the fluffy mutation all have fluffy hair. What would be your strategy to eliminate the gene function while still being able to grow the cells? Conditional allele or TS allele. Complete penetrance (all individuals with the mutation have a phenotype) and variable expressivity (the phenotype is variable) 7. however. controlled by a single color gene. If you make a null mutant of your gene of interest the yeast won’t grow. This process occurs in all sexually reproducing eukaryotes (both singlecelled and multicellular) including animals. What is the effect that explains the pink color of the flower? [2points] haploinsufficiency (or incomplete dominance/codominance) Lecture 4: 1. What are sister chromatids? A chromosome and its replicated copy 3. Snapdragons with red flowers are homozygous for the R allele (R/R). a.MCB 104 Quiz 1 combined answer key (Different sections had different questions. what kind of mutation is it? sex-linked mutation 2. while snapdragons with white flowers are homozygous for the r allele (r/r).r b. These mutant p53 proteins have a (_dominant negative/antimorphic_) effect on the wild-type p53 protein. plants. (___Meiosis___) is a specialized type of cell division which reduces the chromosome number by half. which will allow your yeast to grow at permissive temperature. The problem you have is fairly simple. using as model organism Saccharomyces cerevisiae. You’re studying the function of an essential gene. What do you think is the genotype of the pink flower’s color gene? [2points] R. and pink. you find a mutation you name fluffy.

Imagine you’re doing Mendel’s experiments. half of the F1 progeny are green and the other half are yellow.) . If. squares are male. one with Yellow peas (which is a dominant mutation) and the other with Green peas (which is a recessive mutation). what was the genotype of the parents? If you plant two of the yellow pea from the F1 progeny and cross them. what would be the genotypes of their F2 progeny? Parents genotypes are heterozygous (Yy) and recessive homozygous (yy).MCB 104 Quiz 1 combined answer key (Different sections had different questions. progeny are YY:Yy:yy in 1:2:1 ratio. after crossing them.) 4. What kind of inheritance pattern is consistent with the disease in the pedigree below? Why? (Note that circles are female. and black shapes have the disease phenotype while white shapes are wild-type. You crossed two plants. Label the indicated items on this image 5. 6.

A woman happened to check her karyotype and was surprised to find that her sex chromosomes were XY instead of XX. Mendel crossed plants that are pure breeding for yellow peas with plants that are pure breeding for green peas. 50% extra gene product of an entire chromosome’s worth of genes is very bad 7. X and Y chromosomes can pair with each other during meiosis because of their (__Pseudoautosomal/homologous__) regions. (a) Explain how this could be the case. but same answer. (Name the types. with an explanation of how it created its offspring 6. [2 points] 8:1 (Yellow = 1-P(Green) = 1. (b) What genetic mechanism might have caused the mutation you listed in a? Probably her Y chromosome is the one without SRY.MCB 104 Quiz 1 combined answer key (Different sections had different questions. As the expression of that gene is necessary for determining the maleness. got all yellow peas in F1. She probably lost the gene via recombination between the pseudoautosomal regions on the X and Y chromosomes. Explain how aneuploidy occurs. Various explanations possible. fusion of the gametes results in zygote with abnormal chromosome number 5. she became female even with XY (and also having only one X is enough to be a female .) 4. What was “exceptional” about Morgan’s white-eyed female. 3. the sex determining gene. but aneuploidy of _autosomal____ chromosomes are often fatal. a. 3 copies of one chromosome.) [Different pedigrees for different sections. that allowed it to have a small number of white-eyed female offspring and red-eyed sterile male offspring? It had a meiosis defect that allowed nondisjunction of its X chromosomes to occur occasionally. Many possible answers.turner syndrome). it was XXY. and why nearly all of them are fatal in humans. Explain what a trisomy is. What are the genotypes of F1 and F2 progeny? [1points] F1=> all Yy // F2 => YY + 2Yy + yy c. what would be the ratio of Yellow : Green in F3? Explain why. If he crosses among yellow peas that he got from F2. and got 3 yellow : 1 green ratio in F2.(⅔*⅔*1/4) = 8/9) or write a table Lecture 5: 1. 7. or gene mutation (loss of function) in SRY etc.] Autosomal recessive. Which phenotype is dominant and which one is recessive? [1point]Y(yellow) is dominant b. alternately. . [1point] 2. meiosis defect. nondisjunction. Aneuploidy of _____sex_______ chromosomes are okay. (__Nondisjunction__) is the failure of homologous chromosomes or sister chromatids to separate properly during cell division.