Faculty of Science Institute of Biological Science Bioinformatics SHGB 6111 Assignment


Matric no. :

SGF 090001

Lecturer : Dr. Geok Yuam Annie Tan


Q1)Below is the protein sequence of DNA-directed RNA polymerase alpha subunit/40kD subunit in Fasta format. The data is for the organisms:Archaeoglobus fulgidus Thermoplasma acidophilum Thermoplasma volcanium Mycobacterium tuberculosis Mycobacterium leprae Haemophilus influenzae






1a) Use ClustalW to align these sequences, choose phylip format for the out put

6 356 tuberculos leprae influenzae acidophilu volcanium falgidus







HQLGLSLKDS HQLGLSLKDS ASRGLSLGMR ----------------------------

PPSFDPSEVA PDSFDPSEVA LENWPPASIA ----------------------------

GYDVATGTWS GYDVTTGTWS ED-----------------------------------

TEGAYDEQDY TDGAYDSQDY -------------------------------------

1b) Calculate a distance matrix using BLOSUM62 and Draw NJ tree

1c) ALIGNMENT WITH DELETED SEQUENCES Phylip output format of Multiple alaignment using ClustalW2 after the delition of half the sequences.

Multiple alaignment by exchanging some part of sequences between falgidus and influenzae, acidophilum and volcanium, and tuberculosis and leprae

CLUSTALW2 phylip output format of MULTIPLE ALIGNMENT of mixed sequences.
5 751 sp|O28002| sp|P66701| sp|Q9X798| sp|Q9HJD9| sp|Q97B93| ------------------MLISQRPTLS ------------------------------------EDILTDNRSQ ------------------------------------FVIEPLEPGF ------------------------------------GYTLGNSLRR ------------------------------------TLLSSIPGAA -------------------

---------- ---------- ---------- ---------- ------------------- ---------- ---------- ---------- ----------



---------- ---------- --GKGCSLCT VTYSINKIGP ASVMSGDIQA ---------- ---VAYKYHR EFEVNKKLFE DWAKIKERCP KSVLSEDENT RTEVELLKTP RTESDLLDIR DDPDVVFAID ISHPDLVPVD IVFTDDYGCN ---------ATGTWSTEGA IPEIVVNENC ---------NRLMDRWGIL ------------------EMNAISVNET ------------------Q NLGKKSLTEI NFGQKSIDEV NIPVLELFEG PDIPIVKLGA DLSILFESDG ---------YDEQDYAETE NGCGDCIEAC ---------VESLSE---------------------NNFLFTVEGT ------------------KDVLASRGLS KIKLHQLGLS QQLMLEAVAR KQAIL----VQIKEDDSRF ---------QL-------PRNVFEKDGD ------------------------------------GALPVREVMK ------------------LGM--RLENW LKD--SPPSF LGTGREHAKF ---------IFHFETDGSL ------------------KVRVKNVMAC ------------------------------------KALEILRSKA ------------------PPASIAED-DPSEVAGYDV QPVSVCVYKI ---------TAEETLSYAL ------------------SMCGECVEVC ------------------------------------EEMNKIIEEI -------------------

2. Sulfolobus solfataricus gene for 16S ribosomal RNA


Thermococcus marinus 16S ribosomal RNA gene, partial sequence

D.radiodurans 16S rRNA gene


T.aquaticus (1) 16S ribosomal RNA, part

Bacillus subtilis 16S rRNA gene, strain DSM10


Sulfolobus Thermococcus radiodurans Bacillus Thermus


54 55 33 41 58

Sulfolobus Thermococcus radiodurans Bacillus Thermus

102 102 79 101 104

Sulfolobus Thermococcus radiodurans Bacillus Thermus

162 162 139 161 164

Sulfolobus Thermococcus radiodurans Bacillus Thermus

222 205 173 206 198

Sulfolobus Thermococcus radiodurans Bacillus Thermus


282 265 233 266 258

Sulfolobus Thermococcus radiodurans Bacillus Thermus

342 325 293 326 318

Sulfolobus Thermococcus radiodurans Bacillus Thermus

402 385 353 386 378

Sulfolobus Thermococcus radiodurans


Bacillus Thermus


Sulfolobus Thermococcus radiodurans Bacillus Thermus

Sulfolobus Thermococcus radiodurans Bacillus Thermus

535 522 519 566 545

Sulfolobus Thermococcus radiodurans Bacillus Thermus

594 582 579 626 605

Sulfolobus Thermococcus radiodurans Bacillus Thermus

654 642 638 685 664

Sulfolobus Thermococcus radiodurans Bacillus Thermus

714 702 698 745 724

Sulfolobus Thermococcus radiodurans Bacillus Thermus

774 762 758 805 784

Sulfolobus Thermococcus radiodurans Bacillus Thermus

832 822 809 860 833

Sulfolobus Thermococcus radiodurans Bacillus Thermus

892 882 869 920 893



Thermococcus radiodurans Bacillus Thermus


942 928 979 952

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1001 991 986 1035 1012

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1061 1051 1046 1095 1072

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1119 1111 1096 1145 1124

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1178 1171 1155 1205 1183

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1238 1231 1215 1265 1243

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1297 1291 1275 1325 1303

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1356 1350 1334 1384 1363

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1414 1408 1392 1444 1420

Sulfolobus Thermococcus radiodurans Bacillus Thermus


1467 1461 1448 1504 1477

Sulfolobus Thermococcus radiodurans Bacillus Thermus

1527 1493 1466 1517 1508

Sulfolobus Thermococcus radiodurans Bacillus Thermus

TTCACTAAAACTCGTAATCTTCCCTTTTATAGATGCAGTTCTCCTCTTGGGCCAGAGGGG 1587 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Sulfolobus Thermococcus radiodurans Bacillus Thermus

AATGAAGTGCCTAGGGCCCATTTGGCAGAGACATACAAATATGTCTCTGCCAAGTTAGGG 1647 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Sulfolobus Thermococcus radiodurans Bacillus Thermus

CTCAATGAGGCTAGTACTAGGTAGCCACATTATAGCCGTCTAGGAGTTCTACCCAGGGGC 1707 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Sulfolobus Thermococcus radiodurans Bacillus Thermus

CGAAGCCTCCCGGTGGATGGCT 1729 -------------------------------------------------------------------------------------


radiodurans Bacillus subtilis Thermus aquaticus Sulfolobus solfataricus Thermococcus marinus

evolutionary distances that were computed using the Maximum Composite Likelihood method appeared to reduce between radiodurans and B. subtillis as compared to their position in original NJ-tree above)
radiodurans Bacillus subtilis Thermus aquaticus Sulfolobus solfataricus Thermococcus marinus

Sulfolobus solfataricus Thermococcus marinus Thermus aquaticus radiodurans Bacillus subtilis

Sulfolobus solfataricus Thermococcus marinus Thermus aquaticus radiodurans Bacillus subtilis

Sign up to vote on this title
UsefulNot useful