You are on page 1of 39

“Nucleic Acid Technique”

:
Metode dalam
Diagnostik Molekuler
Marissa Arifin, M.Kes
Farmasi 2015

Diagnostik Molekuler
•Deteksi dan/atau analisis molekul asam
nukleat (DNA atau RNA) untuk
memberikan informasi klinis.
(John Brunstein, Medical Laboratory Observer, 2012)

MDx
Deteksi
Patogen

Pemeriksaan
Genetik

Asam Nukleat

6 µm = 6000 nm

2,5 nm

Apa yang bisa ditawarkan oleh
pemeriksaan DNA/RNA?
Bagaimana kita bisa mendeteksi
DNA/RNA?
Metode apa saja yang bisa digunakan?

Sensitivitas, Spesifisitas
Amplifikasi / Perbanyakan

RFLP Multiplex PCR Nested PCR .Metode dalam MDx Reverse Transcription PCR PCR – Melting / HRM Polymerase Chain Reaction (PCR) Real Time PCR PCR .Sequencing Nucleic Acid Sequence Based Amplification (NASBA) PCR .

Metode dalam MDx Branched DNA (bDNA) Hybrid Capture .

RFLP PCR Sequencing Nested PCR Hybrid Capture .Prodia PCR Reverse Transcription PCR Real Time PCR Mutiplex PCR PCR .Metode dalam MDx .

Kary Mullis.What is PCR? Polymerase Chain Reaction Menggunakan enzim Taq Polymerase Reaksi Berantai (Chain)  Menggunakan perubahan suhu berulang-ulang  Melakukan perbanyakan kopi DNA dalam ukuran pendek (100 – 10. the inventor of PCR. was awarded the 1993 Nobel Prize in Chemistry .000 bp).

.

Taq Polymerase Buffer MgCl2 9 .

Step 1: Denaturation 94/95 oC Template DNA Step 1: Annealling 50 .60 oC Primer Forward and Reverse Step 1: Extension 72 oC dNTPs MgCl2 .

Primer Annealing 5’ AGACTGATGACAGATAGAGGACCCTACGATACTGTTACAGATACGACCAGATC 3’ 3’ TATGCTGC TCTGACTACTGTCTATCTCCTGGGATGCTATGACAATGTCTATGCTGGTCTAG 5` 3` 3` 5` 5’ GATGACA .

PCR • Video PCR .

PCR .

Deteksi Hasil PCR Run di elektrophoresis menggunakan gel agarose 2 % 10^6 copies Baca di bawah sinar UV + ethidium bromide .

Nested PCR  2 round of PCR  In 2nd round: the PCR product of the 1st round PCR become the DNA template  Increase sensitivity and specificity  Higher risk of contamination .

Reverse Transcription PCR •PCR yang dilakukan jika target yang ingin dideteksi berupa RNA. dll) RNA manusia (mis. HIV. Virus RNA (HCV. dll) RNA Reverse Transcription (Reverse Transcriptase) DNA PCR . mRNA bcr-abl.

hybridization probe.Real Time PCR + intercalating dye (SYBR Green I. molecular beacon. dll) or +probes (taqman probe. dll) .

Intercalating Dye Amplification Curve  Ct value Melting Curve  Tm .

Amplification Curve Siklus 1  2 kopi Siklus 2  4 kopi Siklus 25  10^6 kopi Siklus 35  10^9 kopi Ct/Cp value Critical Threshold/Crossing Point .

20 .75 24.51 21.11 31.72 27. 1 2 3 4 5 6 Name NTC 10-1 10-2 10-3 10-4 10-5 Ct 35.Real Time PCR  quantitative PCR (qPCR) 10^5 10^4 10^3 10^2 10^1 NTC No.

Melting Curve 5’ AGACTGATGACAGATAGAGGACCCTACGATACTGTTACAGATACGACCAGATC 3’ TCTGACTACTGTCTATCTCCTGGGATGCTATGACAATGTCTATGCTGGTCTAG 3 ’ 5’ TCTGACTACTGTCTATCTCCTGGGATGCTATGACAATGTCTATGCTGGTCTAG 3 ’ Suhu 50 oC Suhu 60 oC Suhu 82 oC 5’ Suhu 90 oC .

LC Green.High Resolution Melting (HRM)  Profil Melting yang lebih detil  Bahkan perubahan satu basa. Syto 9)  Memerlukan instrumen dengan software khusus (HRM Software) Difference Graph .  Menggunakan Dye tertentu (Evagreen. dapat dideteksi.

Probes 5’ AGACTGATGACAGATAGAGGACCCTACGATACTGTTACAGATACGACCAGATC 3’ TCTGACTACTGTCTATCTCCTGGGATGCTATGACAATGTCTATGCTGGTCTAG 3’ 5’ .Real Time PCR .

TaqMan Probes Hidrolysis Probes Label: FAM. VIC. dll Quencher: BHQ. dll . Tamra. HEX. TET.

Taqman Probe Sinyal dibaca di tahap Extension .

LC705. Cy5. dll . dll Akseptor: Fluorescein.Hybridization Probes Donor: LC640.5.

Hybridization Probes Sinyal dibaca di tahap annealling .

300 bp dengan 100 bp Dimungkinkan juga pada Real Time PCR dengan penggunaan Probe . mis.Mutiplex PCR Dimungkinkan pada end-point PCR jika panjang amplicon PCR berbeda.

mis. • EcoRI  dapat memotong DNA dengan urutan 5' – GAATTC – 3‘ • SmaI  dapat memotong DNA dengan urutan 5' – GGGCCC – 3‘ • Digunakan untuk mendeteksi polimorfisme/perubahan urutan basa • Perubahan 1 basa : GGGCCC  GGACCC • (wildtype) (mutant) .PCR .RFLP • Restriction Fragment Length Polymorphism • Menggunakan endonuclease yang dapat memotong urutan DNA tertentu (spesifik).

PCR RFLP Wild Type 5’ 3’ 3’ GGGCCC CCCGGG wt hm ht 350 bp 5’ Sma I 120 bp 230 bp 500 bp 400 bp 300 bp 200 bp 100 bp Mutant Homozygot 5’ 3’ 3’ GGACCC CCTGGG 5’ 350 bp Sma I 120 bp 230 bp 30 .

Hybrid Capture • HPV DNA .

Sequencing •Sanger Sequencing  1st gen Sequencing Fred Sanger. . A two-nobel prize winner Nobel kedua diperoleh atas sumbangsihnya dalam penemuan metode untuk menentukan sequence DNA Sequencing  menentukan urutan basa dalam sekuens target tertentu.PCR .

Sanger Sequencing Jika ditambahkan ddNTP  extention berhenti .

.

Questions? .

• http://media.invitrogen.swf .com.edgesuite.net/ ab/applications-technologies/pharmabiotherapeutics/DNA_sequencing.

Methods in MDx • Pcr  • • • • • • Reverse Transcription PCR end point PCR Real time PCR Multiplex PCR PCR – RFLP PCR – hybridization • Sequencing • Hybrid capture • NASBA • Branched DNA .

.

T. dan primer reverse Taq polymerase (tahan panas) dNTP (basa A. KCL) MgCL2 Template DNA Dye (SYBR Green I). C Buffer (Tris HCL. atau Probes 39 . G.• - Reaksi Real Time PCR: Primer forward.