Amanda Wilson

#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

DNA/PCR–Lab Paper

Amanda Wilson #594648

Bio 2450 GENETICS

Wednesday 11-2pm 3/2/10

T.A. Amanda Schultz

Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

Abstract

Polymerase chain reaction (PCR) has many applications in modern genetics but it has

become particularly important in the use of forensic genetic profiling. PCR was invented in 1983

but has come quite a long way since. The development of Real Time PCR has improved

conceptualization but is also accompanied with increased risks of error. This experiment

chronicles the investigation of muscle tissue purchased from a meat market in Texas to assess its

originating specie. PCR techniques used are a modification of those in the McGrath and Dooley,

(2000) experiment. Electrophoresis difficulties experienced did not prevent the success of PCR.

Despite necessary editing on the electropherogram, Basic Local Alignment Search Tool

deciphered the tissue to be the mitochondrial genetics of Lama paco, with a max identity value

of 98% and a low E-value of 0.0. The arduous, but positive, identification of originating specie

from the given tissue sample exposes the need for practitioner experience in the laboratory and

more investigation to improve PCR techniques.

Introduction

The continual expansion of known life and the diverse mechanisms with which they

function has directly led to the necessity of complex techniques to deduce genetic identity and

Polymerase Chain Reaction (PCR) has been the solution. PCR’s ability to disseminate species’

tissue samples and viral hosts, such as the koi herpes virus, in both flora and fauna expediently

makes it particularly valuable to the scientific community (Gray et al., 2002). In addition to the

distinction of varying genomic identities of living organisms, modified PCR techniques have

allowed insight on ancient or extinct organisms (d’Abbadie et al., 2007). Recent examination of

38,000 year old Neanderthal DNA from Croatia has allowed evolutionary biologist to
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

conceptualize a genomic divergence, but also how the linguistic capabilities of modern man may

have developed (Green et al., 2006; Krings et al., 1997). While elucidation of earthly heredity

habits, past and present, is tacitly beneficial, its potential for understanding future non-terrestrial

existence is just as critical (Mullis, 1990). Such consideration is not as preposterous when related

to the bizarre thermophillic organisms, extremophilles which thrive in normally in hospitable

conditions, that make PCR possible (Dabrowski et al., 2002; Gibbs et al., 2009).

PCR was developed in 1983 by geneticist Kary Mullis, for which he was given the Nobel

Peace Prize in Chemistry (Sinclair, 2002; Mullis, 2000). His associations with Albert Hofmann

have likely been the source where speculative rumor claims the idea came to him during a

hallucination on LSD (Cohen, 1995). PCR is a quick and simple way of cloning genes in a test

tube, without the need of bacteria; the geneticist’s photocopier, if you will. It can generate

billions of copies of a specific DNA sequence in a limited amount of time. Though it has usurped

conventional cloning techniques in many areas of molecular genetics, it can only be performed

when some sequence information of the DNA is known prior.

Mullis and Faloona (1987) insist PCR reactions necessitate a highly specific pair of DNA

primers, short stretches of single-stranded DNA complementary to following the gene to be

copied. These primers, in addition to the DNA sample, DNA polymerase enzyme and copious

amounts of ATCG nucleotides, are placed in a test tube to begin cycling. PCR reactions are

performed in a thermocycler –a machine that can rapidly shift between temperatures in a pre-

programmed array. Ordinary DNA polymerase won’t work at the high temperatures involved in

PCR, thusly a special heat-resistant variety, derived from the bacterium Thermus aquaticus (T.

aquaticus) or Geobacillus thermoleovorans (G. thermoleovorans), is required. T. aquaticus lives

Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

in hot springs at temps of up to 90 ̊C, while G. thermoleovorans thrives in the oceanic thermal

vents (Sharkey et al., 2003).

Cycling is a process of three steps, lasting around a minute each, repeated several times

to produce molecular copies of a particular DNA sequence. In the first step the reaction mixture

is heated up to about 90 ̊C to separate DNA into two strands. The right temperature is critical. At

this point the temperature is too high for the primers to bind, so the second step is to lower it

̊ allowing the primers to make complementary strands for the two single strands of
around 50 C,

DNA. The third step requires increasing the temp to 72 ̊C where DNA polymerase will

synthesize new DNA from the each of the two primer sequences. The repetition of these three

steps will yield an analogous increase of DNA molecules for every cycle performed. 30 cycles

will have increased the original DNA molecules to about a billion DNA copies. The effective

range of PCR—PCR works best on segments of DNA that are longer than 100 base pairs and

shorter than about 3,000 (Mullis and Faloona, 1987).

The standard PCR method was used on an unknown muscle tissue with the

intentions of positively identifying its originating specie through genetic profiling. Success of

this experiment proves the utility of PCR in several scientific fields and urges application of the

technique in collegiate genetic course work.

Materials & Methods

DNA Extraction

The muscle tissue used for excising the mitochondrial DNA (mtDNA) template from an

unknown, labeled simply 102 B, was per-purchased at a wild game butchery shop in Texas.

DNA extraction was carried out using the animal tissue DNeasy extraction kit from Quiagen (#
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

69506) and enumerated protocol steps. About 25 mg of tissue was extracted from the unknown

sample for homogenization with the intent of collecting cells to be lysed; concurrently

preventing osmotic damage, which has a propensity to jeopardize the cellular integrity of

samples used, during the course of testing. Unknown tissue and Lysis Master Mix, 180 µl of

Buffer ATL in conjunction with 20 µl of Proteinase K, was mixed thoroughly in a vortex for 15s

at 115 rpm, and incubated at 56 ̊C for 45 minutes to lyse the cellular membrane and digest

proteins. Lysis and digestion were then halted by adding 200 µl of Buffer AL to the sample mix

and incubated for 10 min. at 70 ̊C; this process was followed by the addition 200 µl of EtOH and

spun-down for 10s to precipitate the DNA. This was followed by centrifugation at 8000rpm for 1

min., addition of 500 µl Buffer AW1 centrifuged again with the same specifications, addition of

500 µl Buffer AW2 centrifuged at 14,000 rpm for 3 min., followed by relegation of flow-through

waste and an additional spin at 14,000 rpm for 1 min. to ensure proper anhydration. The addition

of 500 µl Buffer AE to the mixture, incubated for 1 min., and followed by centrifugation at 8,000

rpm for 1 min. at room temperature, was used to elute the DNA. The success of DNA extraction

was then assayed via gel electrophoresis in a 1% agarose gel and the resulting bands stained with

Ethidium bromide to enhance visualization. The DNA was then victualled in storage at 4 ̊C for

later use in PCR.

PCR

A pre-made Master Mix totaling in 49.5 µl, containing 37.75 µl ddH2O, 10.0 µl buffer A,

0.05 µl dNTPs, and 0.25 µl Taq polymerase, 0.05 µl of forward primer (ND4), 0.05 µl reverse

primer (PII), was added 0.05 µl of the warmed DNA material. Thermal cycling of this mixture,

which consisted of 3 phases at specific varying times and temperatures, was then performed
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

using the GeneAmp® PCR System 9700 to obtain a target sequence for cycle sequencing. The

success of PCR was then assayed via gel electrophoresis in a 1% agarose gel and the resulting

bands stained with Ethidium bromide to enhance visualization. The PCR product was again

victualled in storage at 4 ̊C for later use in PCR clean up.

PCR Clean-up

The Wizard SV Gel and OCR Clean-up System from Promega were used to purify the

PCR product of materials that would inhibit cycle sequencing. The PCR product was then

prepped for cycle sequencing by adding 40 µl of Membrane Wash Solution and incubated for 1

min., followed by centrifugation at 13,200 rpm for 1min. Relegation of flow-through waste was

carried out proceeded by the addition of 700 µL Membrane Wash Solution and centrifuged at

16,000 rpm for 1 min. Yet again, relegation of flow-through waste was carried out, superseded

by the addition of 500 µL Membrane Wash Solution and centrifuged at 16,000 rpm for 5 min.

Relegation of flow-through waste was repeated and mixture was again centrifuged at 16,000 rpm

for 1 min. to evaporate remaining ethanol. 50 µl of nuclease-free water was aspirated in with the

clean PCR product, allowed to incubate for 1 min., and then centrifuged at 16,000 rpm for 1 min.

The success of PCR clean up, was then assayed via gel electrophoresis in a 2% agarose gel, and

the resulting bands stained with Ethidium bromide to enhance visualization. The intensity of the

clean PCR product band was compared to a control of standard PCR product (pGEM) band. The

clean PCR product was then victualled in storage at 4 ̊C for later use in cycle sequencing.

Cycle Sequencing

2.0 µl of clean PCR product was combined with 2.0 µl DTCS Quick Start Mix from

Beckman Coulter Inc., 1.0 µl primer (ND4), and 15 µl ddH2O, totaling in 20 µl. Thermal cycling
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

of this mixture, which consisted of 3 phases at specific varying times and temperatures, was then

performed using the GeneAmp® PCR System 9700. The cycled product was then victualled in

storage at 4 ̊C for later use in cycle sequencing clean up.

Cycle Sequencing Clean Up

The cycle sequencing product was combined with 5.0 µl of Prep Solution; the Prep

Solution contained 2.0µ l 100mM EDTA, 2.0 µl 3M NaOAc and 1.0 µl Glycogen. This mixture

was pooled with 60 µl of cold 95% EtOh, mixed and centrifuged at 13,200 rpm for 15 min. to

pellet supernatant for removal. 200µl cold 70% EtOH was then added and again, centrifuged at

13,200 rpm for 5 min. to pellet supernatant for removal, and again repeated. The samples were

then air-dried for 25 min. to evaporate all EtOH. The success of cycle sequencing was assayed

by gel electrophoresis using a 6% polyacrylamide gel in the Beckman Coulter CEQ 800 DNA

Sequencer. The sequencer relayed information obtained by fluoresced ddNTPs to a computer

which interpreted the sequence material and produced an electropherogram of the results.

Results

The results of the PCR cycle sequence clean up, as seen in Figure 1; display the successful

location of target sequences for unknowns labeled 105, 107, 109, 111 and 113. Unknowns 102,

103, 104, 106, 108, 110, and 112 proved to be unsuccessful.

The distinctive peaks of electropherogram produced by cycle sequencing of the unknown

sample 102B, had relatively minor background noise, which yielded 368, from 500, for use in

Basic Local Alignment Search Tool (BLAST):

[CTAGGAGGCTACGGCATACTACGCCTCACAGCTATACTAAATCCCCTCACAGAGTATATAG

CATATCCATTCCTAATACTATCCCTCTGAGGCATAATCATGACCAGCTCCATCTGCTTACGC
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

CAAACTGACCTAAAGTCACTTATTGCCTACTCCTCAGTTAGTCACATGGCCCTGGTTATGTA

CCTATCCTAATCCAAACTCCCTGAAGCTACATAGGGGCTACCACCCTCATAGTCGCCCACG

GACTCACATCCTCTATACTTTTCTGTCTACAAATACAAATTATGAACGTACCCACAGTCGAA

CAATAATTCTGGCGCGAGGCCTGCAAACACTACTACCTTTAATACAATATGATGATTACTGG

CA]. BLAST found the DNA to best match species Alpaca, accession AJ566364.1 , Lama pacos.

The top three matches revealed by GeneBank can be viewed in Table 1; Lama pacos, Lama

glama, and Lama guanicoe with Max Identity values of 98%, 98%, and 96%, respectively. The

E-values and Query Coverage values were constant among all three species E-values being 0.0

and Query Coverage of 98%.

Discussion

The PCR process adequately identified a species of lama; however, it was not without difficulty.

The failure of the second electrophoresis was attributed to poor constitution of master mix. It is

likely that some form of contamination or inadequate amounts of some substance impaired

functioning. Some sources point to the type of polymerase and 5’ to 3’ nuclease activity

characterizations as a source of noise in result development; considering the success of alternate

experiments in this study, this does not account for the errors (Huang et al., 2009). The success

of identification came selective editing of the electropherogram result prior to BLAST search

and the resulting low E-values expressed during matching. Deepak et al. (2007) discusses the use

of Real Time PCR as a more sensitive version of the standard PCR and may have aided in better

quantification of expressive gene profiles but also insists the sampling risks are amplified due to

this sensitivity. Research done by Kubista et al. (2006) appear to agree that Real Time PCR

increases elucidation of biochemical and biophysical processes of gene expression. Future

Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

development of both methods will hopefully yield increasingly efficient methods of genetic

profiling, in the mean time; it may simply be a case of enhancing experience of practitioners

(Rohde and Oates, 2004).

Literature Cited

Cohen, J. 1995. Genes and behavior make an appearance in the O.J. trial. Science, 268(5207), 22.

Retrieved from Academic Search Complete database.

d'Abbadie, M., Hofreiter, M., Vaisman, A., Loakes, D., Gasparutto, D., Cadet, J., et al. (2007).

Molecular breeding of polymerases for amplification of ancient DNA. Nature

Biotechnology, 25(8), 939-943. doi:10.1038/nbt1321.

Dąbrowski, S., Olszewski, M., Piątek, R., & Kur, J. 2002. Novel thermostable ssDNA-binding

proteins from Thermus thermophilus and T. aquaticus—expression and purification.

Protein Expression & Purification, 26: 131.

Deepak, S., Kottapalli, K., Rakwal, R., Oros, G., Rangappa, K., Iwahashi, H., et al. (2007). Real-

Time PCR: Revolutionizing Detection and Expression Analysis of Genes. Current

Genomics, 8(4), 234-251. doi:10.2174/138920207781386960.

Gibbs, M., Reeves, R., Mandelman, D., Qingli, M., Jun, L., & Bergquist, P. (2009). Molecular

diversity and catalytic activity of Thermus DNA polymerases. Extremophiles, 13(5), 817-

826. doi:10.1007/s00792-009-0269-8.

Green, R. E., Krause, J., Ptak, S. E., Briggs, A.W., Ronan, M. T., Simons, J. F., Du, L., Egholm,

M., Rothberg, J. M., Paunovic, M., and Paabo, S. 2006. Analysis of one million base

pairs of Neanderthal DNA. Nature 444:330-336.

Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

Gray, W., Mullis, L., LaPatra, S., Groff, J., & Goodwin, A. (2002). Detection of koi herpesvirus

DNA in tissues of infected fish. Journal of Fish Diseases, 25(3), 171-178.

doi:10.1046/j.1365-2761.2002.00355.x.

Huang, Q., & Li, Q. (2009). Characterization of the 5′ to 3′ nuclease activity of Thermus

aquaticus DNA polymerase on fluorogenic double-stranded probes. Molecular &

Cellular Probes, 23(3/4), 188-194. doi:10.1016/j.mcp.2009.04.002.

Krings, M., Stone, A., Schmitz, R. W., Krainitzki, H., Stoneking, M., Paabo, S. 1997.

Neanderthal DNA sequences and the origin of modern humans. Cell 90:19-30.

Kubista, M., Andrade, J., Bengtsson, M., Forootan, A., Jonák, J., Lind, K., et al. (2006). The

real-time polymerase chain reaction. Molecular Aspects of Medicine, 27(2/3), 95-125.

doi:10.1016/j.mam.2005.12.007.

McGrath, S., and Dooley, J. (2000). Quantification of Clostridium botulinum Toxin Gene

Expression by Competitive Reverse.. Applied & Environmental Microbiology, 66(4),

1423. Retrieved from Academic Search Complete database.

Mullis, K. B., 2000. Dancing naked in the mind field. New York: Vintage Books.

Mullis, K. B., 1990. The unusual origin of the polymerase chain reaction. Sci Am. 262 (Apr):56-

65.

Mullis, K. B., and Faloona, F. A. 1987. Specific synthesis of DNA in vitro via a polymerase-

catalyzed chain reaction. Methods Enzymol, 155:335-350.

Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz

Rohde, R., and Mulawski, O.K. 2004. National laboratory training network public health series

course: Molecular diagnostic techniques for the public health laboratory. Laboratory

Medicine, 35:497-501.

Sharkey, F., Banat, I., & Marchant, R. (2004). A rapid and effective method of extracting fully

intact RNA from thermophilic geobacilli that is suitable for gene expression analysis.

Extremophiles, 8:73-77. doi:10.1007/s00792-003-0363-2.

Sinclair, A. (2002). Genetics 101: polymerase chain reaction. CMAJ: Canadian Medical

Association Journal, 167:1032-1033.

Appendix
Amanda Wilson
#594648
Aw1435@txstate.edu
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz