Genoma Humano y Biotecnología

Liceo San Pedro Poveda Prof.: Ma. José Espinoza A 4to medio

Genoma: 

Conjunto de todos los genes de un organismo y de todo el patrimonio genético almacenado en el conjunto de su ADN o de sus cromosomas.

Proyecto Genoma Humano 

Este proyecto se puso en marcha el 1 de Octubre de 1990. Es considerado el proyecto científico más importante de todos los tiempos y se reconoce internacionalmente a ese día como el de su nacimiento. Participan en el mismo 18 países, entre ellos: ALEMANIA, ESTADOS UNIDOS, FRANCIA, GRAN BRETAÑA E ITALIA. La inversión ha alcanzado los 3.000 millones de dólares. El PROYECTO GENOMA HUMANO intenta determinar en qué cromosoma, y dentro de éstos en qué lugar se encuentra ubicado cada gen (unidad principal en la transformación de las características hereditarias).  

Finalidad 

obtener informaciones para el futuro desarrollo de la medicina y de la biología posibilitando la invención de una nueva generación de medicamentos y el advenimiento de una planificación estratégica de prevención.

La secuenciación del genoma humano abre posibilidades. éticamente inaceptable. Sería posible la modificación del óvulo. pero también nos enfrenta a interrogantes éticos:    El diagnóstico prenatal será más certero y alcanzará un número muy amplio de enfermedades. Esto agudizará la discusión ética sobre el aborto y el derecho a la vida del no nacido. del huevo (cigoto) o del embrión de pocas células. . Se podrá modificar la base genética de las células somáticas (generales) responsables de determinadas enfermedades.

garantizando la justicia y la imparcialidad en las decisiones que incluyen personas así como la confidencialidad en la información obtenida. Debemos considerar el genoma humano como un bien público y el capital genético individual como una información de orden privado. sanitarias y sociales adecuadas evitará los abusos discriminatorios a portadores de enfermedades genéticas por parte de empresas laborales o de salud. Tomar éstas medidas así como la creación de estructuras jurídicas. administrativas. y la libertad a no saber si se es o no portador de una enfermedad genética.  .

la UNESCO aprobó la DECLARACIÓN UNIVERSAL SOBRE GENOMA HUMANO Y LOS DERECHOS DEL HOMBRE. ¿EL GENOMA HUMANO ES PATENTABLE?      El 11 de Noviembre de 1997. Rechazo al determinismo genético. . afectándonos directa o indirectamente a todos. nuestras creencias y valores. El Genoma Humano es PATRIMONIO DE LA HUMANIDAD.Finalmente. fijando tres principios: La dignidad del individuo cualesquiera sean sus características genéticas. Como se puede ver el descubrimiento del mapa genético moviliza hasta los cimientos mismos de la cultura.

Intrones.Genoma Humano:   Describe el total de la información (Contenido de ADN) en las células humanas. es inactivo). con lo que se distribuye en un 10% ADN Codificante y 90% ADN No Codificante. Genoma Nuclear: 33000Mb: 80 mil genes (25% implica genes y secuencias que están relacionados. ADN no codificante: (Pseudogenes (Deriva de un gen por mutación. genes fragmentados) .

  Genoma Mitocondrial: 16.6 Kb. 22 genes ARNt y 13 genes que codifican para 13 polipéptidos . Aprox. 37 genes codificantes para 2 ARNr.

farmacología.Biotecnología    Disciplina que engloba conocimientos de microbiología. Esta transformación se realiza por la acción de un ser vivo. Estos conocimientos se aplican para transformar una sustancia en un producto de interés. ingeniería industrial. ciencias medioambientales e informática. bioquímica. inmunología. genética molecular. .

incluso.  Ingeniería genética: Manipular el ADN. proteínas humanas que ayudan a paliar enfermedades como anemia. Con la aplicación de la Biotecnología no sólo se persigue la obtención de alimentos elaborados. La consecución de estos logros se está llevando a cabo gracias a la aparición de las técnicas de ingeniería genética. incluso. introducir nuevos genes en el genoma de un ser vivo. mejora de especies vegetales y animales. secuenciarlos e identificar los genes del genoma de un individuo. También se consiguen medicamentos. enanismo o diabetes. modificar su secuencia e. regeneración de medio ambiente dañado e.C. Uso en la obtención de cerveza a partir de cereales utilizando levaduras desde antes del año 6. obtener fragmentos del mismo. obteniendo con ello una nueva variedad biológica con nuevas características.  .000 a.

bajando la concentración de iones y removiendo el alca) vuelvo a Renaturar. Con un aumento de la temperatura o en presencia de NaOH (Hidróxido de Sodio) se separan las 2 cadenas. . este proceso se llama Desnaturalización o Melting.Técnicas Básicas en Biología Molecular   El ADN tiene la particularidad de NO Hidrolizarse . Si saco los agentes denaturantes (Bajando la temperatura lentamente evitando aberraciones.pero si se abre la hebra.

Proceso de crear una hebra híbrida de ADN/ARN   Las dos hebras de la molécula de ADN son denaturadas por la aplicación de calor. b-a). a-b). . a 100°C (Figs. aproximadamente. Este proceso se llama renaturación del ADN o hibridización. La denaturación del ADN es reversible cuando se mantienen las dos hebras simples de ADN durante cierto tiempo a 65°C (Figs. A esta temperatura los pares de bases complementarios que mantienen el duplex se disocian en dos hebras simples.

ADN/ARN. Si un transcripto de ARN se adiciona durante el proceso de renaturación.  Hibridizaciones similares pueden ocurrir entre cadenas únicas de cualquier ácido nucleico: ADN/ADN. . c-d). ARN/ARN. la molécula de ARN competirá con la hebra de ADN codificante y formará una molécula híbrida doble hebra de ADN/ARN (Figs. Estas reacciones pueden ser usadas para detectar y caracterizar secuencias nucleotídicas usando una secuencia nucleotídica particular como una sonda o prueba radioactiva.

clonaje de ADN y la ingeniería genética . la fragmentación. hibridación de ácidos nucleicos.Tecnologías de ADN recombinante  Las tecnologías de ADN recombinante constituye una mezcla de técnicas. la separación. que permiten. . secuenciación.

cortan la molécula de ADN de doble cadena en lugares definidos por la secuencia de nucleótidos. Partimos de células con núcleo. si se hace pasar varias veces la suspensión de ADN a través de la aguja de una jeringa. que deben ser lisadas (rotas). su función dentro de la célula bacteriana es degradar moléculas de ADN extrañas. . ya que el ADN debe separarse y concentrarse. Distintas especies de bacterias fabrican diferentes endonucleasas. El ADN se puede fragmentar mecánicamente. La obtención de fragmentos específicos será posible tras el descubrimiento de las enzimas de restricción (endonucleasas).Fragmentación de moléculas de ADN      Es la parte esencial del proceso. produciendo fragmentos de ADN de doble hebra de tamaños bien definidos. Estas enzimas pueden aislarse de bacterias. pero por este medio la ruptura se produce al azar.

con otros fragmentos producidos por la misma enzima (o con otra que genere los mismos extremos ). b) que luego pueden unirse. por apareamiento de bases complementarias. estas moléculas de ADN producidas se denominan moléculas de ADN recombinante. Otras cortan de manera escalonada. a ). dejando extremos pegajosos o cohesivos (Fig. Esto hace posible combinar segmentos de ADN de fuentes diferentes .  Algunas enzimas de restricción producen cortes de la molécula de ADN que dejan extremos rectos o romos (Fig.

.

Este proceso permite sintetizar grandes cantidades. que codifique para la producción de una cierta proteína). . generalmente bacterias. el gen (o genes) responsable del fenotipo se fusiona con otros fragmentos de DNA para formar moléculas de DNA recombinante.   El primer paso consiste en identificar y aislar el DNA responsable de un determinado fenotipo (es decir. Una vez obtenido. El DNA recombinante se multiplica (clonación de genes) para lo cual se inserta en una célula. tanto de genes aislados como de los productos de ellos (proteínas).

Actualmente los científicos disponen de múltiples variedades de enzimas de restricción que reconocen muchas secuencias específicas diferentes. protegen la célula huésped destruyendo el DNA extraño tras su penetración en la célula. que se utilizan para preparar fragmentos de DNA que contienen genes o porciones de genes específicos. cortar) las dos cadenas del DNA en sitios específicos. En condiciones normales. .   La producción de moléculas de DNA recombinante se basa en la propiedad de las enzimas microbianas llamadas enzimas de restricción (o endonucleasas) de escindir (separar.

.

deben generar algo así como un lenguaje tipo DNA. ellos no poseen DNA. son virus cuya información genética esta contenida en ARN. . pero para utilizar la maquinaria celular.  Los retrovirus. Este especial DNA se denomina DNA complementario (cDNA). Este descubrimiento permitió sintetizar genes o porciones principales de genes también a partir del RNA mensajero (mRNA). En 1970 se descubrió que los retrovirus poseen un tipo especial de enzima. que permite al virus producir una copia tipo DNA de su información genética. llamada transcriptasa reversa.

Separación o aislamiento de fragmentos de ADN    La electroforesis en gel es una técnica que se utiliza para determinar con exactitud la longitud y la pureza de las moléculas de ADN. se utilizan geles mucho más porosos formados por agarosa. Para el caso de fragmentos de ADN menores de 500 nucleótidos de largo. se usan geles de poliacrilamida. En el caso de moléculas de mayor tamaño. .

Para marcar moléculas de ADN aisladas se utiliza la enzima polinucleótido quinasa para transferir un P 32 hasta el extremo 5¶ de cada hebra de ADN.   En la electroforesis. Las bandas de ADN serán invisibles a menos que el ADN esté marcado o teñido de alguna manera. se colocan partículas cargadas en un campo eléctrico y se les permite que migren hacia los polos positivo o negativo. Un método sensible de tinción del ADN consiste en sumergir el gel después de la electroforesis en el colorante bromuro de etidio que cuando se encuentra unido al DNA. Las moléculas se separan porque se mueven a diferentes velocidades en función de su carga y su tamaño. es fluorescente con luz ultravioleta. .

.

en la primera etapa las hebras de ADN se disocian y se someten a un tratamiento suave con un agente químico que destruye una de las cuatro bases. Esto genera distintos fragmentos de ADN de distintas longitudes. .Secuenciación de una molécula de ADN   A finales de los años 70 se desarrollaron métodos que permitieron determinar de manera simple y rápida la secuencia nucleotídica de cualquier fragmento de ADN purificado. que reflejan los lugares en que se produjo la destrucción de la base. Uno de los métodos más utilizados es el de Maxam y Gilbert o también conocido como el método químico. al azar. Este proceso se inicia con la obtención de un conjunto de moléculas de ADN de doble hebra marcadas en un extremo con P 32. Solo se destruye una de las bases.

utilizando compuestos químicos que rompan el ADN de forma preferente por T en la primera muestra. . por C en la segunda. se realizan procedimientos similares a cuatro muestras separadas de la misma molécula de ADN.  Los fragmentos se separan en un gel y se detectan por autorradiografía. Para determinar la secuencia completa. por G en la tercera y por A en la cuarta.

Actividad: a partir del siguiente esquema determine. obteniéndose un patrón de bandas de ADN radiactivas a partir de las cuales se lee la secuencia de ADN. . la secuencia de la molécula de ADN. recuerde que se lee en dirección 5¶ 3¶.T C ___ G A 3¶ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 5¶ Los fragmentos resultantes son separados en carriles paralelos del mismo gel.

.

Transferencia de genes en animales Cultivo de Células Vegetales Fármacos Anti-cáncer Diagnósticos Solución de crimenes Tecnología del ADN Bancos de ADN. Marcadores Síntesis de Sondas de ADN Localización de desórdenes genéticos . ARN Proteínas Mapas de Genomas completos Síntesis de Nuevas Proteínas Nuevas Plantas y Animales Nuevos Alimentos Nuevos Antibióticos Biología Molecular Ingeniería Genética Clonación Producción de Proteínas humanas Recursos humanos químicos raros Terapia Génica .

. la capa epidérmica de la piel y los tejidos hematopoyéticos.     La misión de la célula madre no consiste en llegar a diferenciarse sino que producir células que se diferencien.Células Madres     Muchos tejidos. Cuando se divide. o puede iniciar una vía que conduce irreversiblemente hacia la diferenciación. se renuevan mediante células madres. Pluripotenciales: dan lugar a muchos tipos celulares. especialmente los que tienen un desgaste y una proliferación rápida. las cuales no pueden dividirse por si mismas. tales como el revestimiento intestinal. cada célula hija puede permanecer como célula madre. Las células madres se clasifican de acuerdo al número de células que dará origen en: Unipotenciales: dará origen a un solo tipo de célula diferenciada. por lo menos durante el ciclo vital del animal. Las propiedades que las define son las siguientes: No está totalmente diferenciada Se puede dividir sin límites.  Las células madres son necesarias en aquellos tejidos que se requiere un reemplazo de células diferenciadas.

Célula pluripotente del sistema hematopoyético Auto-renovación Línea linfoide Línea mieloide .

.

sistemas o procesos biológicos.  . Terapia génica: Se refiere al uso de la manipulación genética para la corrección /curación de enfermedades genéticas y no genéticas.Biotecnología: Hoy el término engloba todo tipo de producción industrial de ³bienes y servicios´ por medio de procesos que utilizan organismos.    Aplicaciones de la biotecnología: Aplicaciones en la medicina. Existen dos tipos de terapia génica: en células germinales y en células somáticas. Contribuyen a la medicina. la industria y la agricultura. además al campo de la investigación básica.

el cual será transmitido a las generaciones futuras. la inyección de genes en cigotos. no se tienen consecuencias en las siguientes generaciones. La terapia génica en células somáticas: se trata a un individuo. La terapia génica germinal: implica la transfección de un embrión. un órgano o tejido específico de esa persona. La inserción de estos genes en el genoma del cigoto provocará un cambio genético en el embrión. sin afectar a las células germinales. Por lo tanto. Este tipo de terapia génica no ha sido aplicada en seres humanos. es decir.  .

al ser dominante. en el caso de enfermedades genéticas dominantes. Para el tratamiento de infecciones virales. pues la proteína defectuosa. El reemplazo de genes defectuosos por genes funcionales.Dependiendo del tratamiento requerido existen varias formas de terapia génica. estas incluyen:    La introducción de genes supresores. ³competería´ con la proteína viral normal. para controlar la acción de genes que se sobre expresan. . sintetizada por el huésped. impidiendo por ejemplo la producción del virus. como aquellos relacionados con el cáncer. la introducción de genes que codifiquen para una proteína viral mutante podría ser de gran utilidad. la única alternativa de cura implica la remoción del gen defectuoso.

Trangénesis  

  

Se puede definir como la introducción de ADN extraño en un genoma, de modo que se mantenga estable en forma hereditaria y afecte a todas las células en los organismos multicelulares. La introducción de genes se ha practicado tanto en plantas como animales. Generalmente en animales, el ADN extraño, llamado transgén, se introduce en cigotos, y los embriones que hayan integrado el ADN extraño en su genoma, previamente a la primera división, producirán un organismo transgenico, de modo que el transgén pasará a las siguientes generaciones a través de la línea germinal (gametos). Hoy se tienen una gran cantidad de vegetales y animales trangénicos entre los que se pueden nombrar vegetales como, el tomate , el tabaco, algodón, arroz, cítricos, maíz, papas, etc. Entre los animales transgénicos se encuentran las siguientes especies: ratón , rata, conejo, cerdo, vaca, cabra y oveja.

2. Transgénesis por manipulación de células embrionarias. 
 

Esta implica la introducción de ADN extraño en células embrionarias madres. Estas células se toman del interior de la blástula en desarrollo y se pasan a un medio dónde se tratan con distintos productos con lo que conseguirá que las células no se diferencien, y se mantienen en estado embrionario. El ADN extraño se introduce en las células madre de diversas técnicas, posteriormente las células transfectadas son reintroducidas en una blástula y ésta reimplantada en una hembra.

3. Transgénesis por genes clonados en vegetales. 
Primero

se requiere clonar en un vector (plásmido) el gen de interés. Ese vector debe asegurar la integración estable de los genes deseados en los cromosomas de las células vegetales, y luego mediante técnicas de cultivo de tejidos finalmente se obtienen las plantas transgénicas.  Las plantas transgénicas obtenidas hasta la fecha se desarrollan a partir de diversos métodos de transformación genética. Un método muy empleado es el basado en cepas bacterianas agrobacterium tumefaciens , este microorganismo puede transferir ADN proveniente de uno de sus plasmidos, llamado plasmido Ti (ADN circular) al genoma de las células vegetales.

segundo procedimiento utilizado para la transformación de plantas es la biobalística. Esta es una técnica basada en principios físicos que permite literalmente disparar genes a las plantas. Para ello, el ácido nucleico que codifica los genes de interés se deposita en minúsculas partículas de oro , las que posteriormente son impulsadas por una fuerte columna de un gas (generalmente helio), hasta impactar los tejidos blanco de la especie a transformar. De esta manera, al penetrar las micropartículas en la célula blanco, éstas alcanzan el núcleo y depositan el DNA que portan transformando la célula con un nuevo gen. 

El

Se consigue sometiendo a las hembras a un tratamiento hormonal para provocar una superovulación. los cigotos obtenidos se manipulan uno a uno y con una micropipeta a modo de aguja. El primer alimento completo desarrollado mediante ingeniería genética el tomate Flavr Savr. se aíslan un número grande de óvulos fertilizados. Este tomate resiste aproximadamente 10 días más de lo normal antes de pudrirse y por lo tanto puede dejarse más tiempo en la planta para madurar y desarrollar más sabor. Esta enzima degrada la pectina. Ejemplos. lo que ablanda el tomate. En la segunda fase. .Transgénesis por microinyección de cigotos       Se realiza de la siguiente forma: En la primera fase. En este tipo de tomate el gen que codifica la poligalacturonasa no se expresa. La fertilización puede hacerse in vitro o in vivo. En la tercera fase.4. estos óvulos son reimplantados en hembras que actuarán como nodrizas permitiendo la gestación hasta término. se introduce una solución que contiene ADN.

  Se ha invertido un esfuerzo considerable en la transferencia a otras plantas de cultivo de las capacidades fijadoras de nitrógeno de las bacterias asociadas a las legumbres. . las células receptoras no han sido capaces de fijar el nitrógeno. existe cierta preocupación en torno al hecho de que las nuevas variedades fijadoras de nitrógeno pudieran propagarse de forma indiscriminada como malas hierbas o alterar el ciclo de nitrógeno del suelo. Si se tuviera éxito en este proyecto. los beneficios potenciales para plantas de cultivo tales como el maíz serían importantes. No obstante. Los principales genes responsables de este proceso se han clonado y se han transferido al genoma de las células de plantas. sin embargo.

También se han desarrollado variedades de algodón y de maíz fértil transgénico resistentes a los herbicidas. se aislaron de mutantes de Salmonella typhimurium los genes responsables de la detoxificación de los herbicidas a base de glifosato. y se introdujeron en células de la planta del tabaco utilizando el plásmido Ti. Las plantas de cultivo resistentes no sufrirían ningún efecto derivado de los agentes químicos empleados para el control de las malas hierbas. ya que numerosas plantas sufren efectos adversos al ser tratadas con herbicidas. Este hecho tiene una importancia considerable. y las cosechas probablemente serían mucho mayores. Las plantas regeneradas a partir de las células recombinantes eran resistentes al herbicida. . Los intentos de conferir a las plantas resistencia a las condiciones ambientales adversas han tenido más éxito. Por ejemplo.

Finalmente. se están desarrollando cepas de soja. Esta toxina destruye muchas plagas de insectos. Un buen ejemplo lo constituye una cepa alterada de Pseudomonas syringae. papa. . Se está invirtiendo un gran esfuerzo en la protección de las plantas frente a plagas sin el uso de pesticidas químicos y se está estudiando una cepa de Pseudomonas fluorescens que contiene el gen que codifica la toxina de Bacillus thuringiensis . que protege a las plantas de los daños por congelación porque no puede producir la proteína que induce la formación de cristales de hielo. Se están explorando muchas otras aplicaciones en agricultura. arroz y otras plantas resistentes frente a virus.

levadura. la insulina. a fin de evitar la elevada síntesis de la proteína extraña interfiera con el crecimiento de la célula transfectada. se utilizan vectores de expresión.   Se ha utilizado en la producción de proteínas como la hemoglobina. la somatotrofina ( hormona del crecimiento). Para la producción de RNAm. Las cuales pueden potencialmente ser usadas en el tratamientos de enfermedades. Llegando a producir grandes cantidades de cualquier proteína. célula de mamífero. el cual esta diseñado para producir grandes cantidades de RNAm que será traducido eficientemente en una proteína en el interior de una bacteria. . la somatostatina. En principio es posible producir grandes cantidades de una proteína pura si se sintetiza una gran cantidad de RNAm que codifica dicha proteína.

hoy se produce artificialmente fusionándola con el gen para la beta-galactosidasa de un plásmido bacteriano. El ganado parece estar destinado a desempeñar un papel importante en la biotecnología de orientación médica mediante el uso de un enfoque que en ocasiones ha recibido el nombre de ganadería molecular. El bromuro de cianógeno escinde la proteína. Técnicas relativamente similares a ésta han producido cabras cuya leche contiene hasta 3 gramos de activador tisular del plasminógeno humano por litro. este plásmido dirige la síntesis de una proteína híbrida. La somatostatina. una hormona polipeptídica de 14 residuos sintetizada en el hipotalamo.   . coli. Un solo cerdo podría aportar 20 unidades de sangre humana al año. Esta hormona es utilizada en el tratamiento de la acromegalia. Los planes actuales consisten en purificar la hemoglobina y utilizarla como sustituto de la sangre. pero termina como somatostatina. El activador tisular del plasminógeno (TPA) disuelve los coágulos sanguíneos y se utiliza en el tratamiento de los pacientes con cardiopatías. Los embriones de cerdo a los que se inyectan genes que codifican la hemoglobina humana se convierten en cerdos que sintetizan hemoglobina humana. liberando así la hormona intacta. Introducido en E. que comienza como betagalactosidasa.

. vacunas contra el paludismo y la rabia) mediante técnicas recombinantes. en glucosa. producida en la naturaleza por ciertos hongos. la molécula alimenticia de gran importancia. Los ratones manipulados mediante ingeniería genética pueden en la actualidad producir anticuerpos monoclonales completamente humanos. Esta enzima convierte a la celulosa. que no es digerible por la mayoría de los organismos.  La enzima renina. que se extrae del estómago de terneros y se usa en la industria láctea para elaborar queso. También se están desarrollando vacunas sintéticas (por ejemplo. También puede ser posible utilizar plantas desarrolladas mediante ingeniería genética para producir vacunas orales. Ya se encuentra disponible en el mercado una vacuna contra la hepatitis B. ha sido producida por tecnología de DNA recombinante. Un avance especialmente interesante es el uso de maíz para producir anticuerpos monoclonales para uso médico. Más recientemente se ha logrado inducir la síntesis bacteriana de la enzima celulasa.

indicando que el gen humano se había incorporado al genoma del ratón y estaba produciendo hormona de crecimiento. Dado que el DNA se había inyectado en los óvulos. los ratones que expresan el nuevo gen crecen de 2 a 3 veces más rápido que los ratones que carecen de él y. la llamada hormona del crecimiento se requiere para el tratamiento del enanismo hipofisiario. como adultos. y así pudo ser transmitido a la generación siguiente.  La somatotrofina. tienen el doble del tamaño normal . incluyendo las células germinales. esta se obtenía de la hipofisis de cadáveres. Después de la integración. estando disponible solo en cantidades limitadas hoy Por ejemplo. apareció en todas las células. se combinó el gen de la hormona de crecimiento somatotrofina humana con la porción reguladora de un gen de ratón y se inyectó en óvulos fecundados de ratón. Los ratones transgénicos resultantes crecieron hasta el doble del tamaño normal. el nuevo gen en el genoma de la hembra de ratón se transmitió a su progenie. En promedio.

Estas bacterias pueden construirse ensamblando los genes catabólicos necesarios en un único plásmido y a continuación transformando el microorganismo adecuado. hongos y células de mamíferos cultivadas como verdaderas fábricas.    Aplicaciones industriales Entre las aplicaciones industriales se encuentra: la fabricación de productos proteicos utilizando bacterias. . Aplicaciones en agricultura Recientemente se ha utilizado hormona del crecimiento bovina para aumentar la producción de leche al menos un 10 %. Se han desarrollado bacterias que metabolizan petróleo y otros materiales tóxicos. Es posible que también puedan mejorarse la resistencia a la enfermedad y la tolerancia a condiciones ambientales extremas de los animales de granja.

Resistentes a las plagas .Prolongado el carácter crujiente en el momento de corte.Incrementado el sabor dulce Resistentes a las heladas .

Mej r do el roma. Ampliada la vida media del fruto (más duradero). Mej r su rendi ient . Mejorada la resistencia a virus. Disminuido el contenido en cafeína. sin pepitas.Mej r l resistenci l s insect s. Conseguidas nuevas variedades. . Disminuir su capacidad de absorber aceite durante la fritura. Obtener variedades más dulces. Aumentar resistencia a insectos.

Terapia génica El virus infecta a la célula Gen bueno El gen es transportado por un vector Miles de células con el gen incorporado (corrección génica) .

¿En qué consiste la Terapia Génica? .

.

un trozo de ADN En Animales superiores consiste en obtener un individuo a partir de una célula o de un nucleo de otro individuo . o en general.Obtención de organismos genéticamente idénticos En el campo de la Ingeniería genética consiste en aislar y multiplicar un gen.

Conjunto de técnicas nacidas de la Biología molecular que permiten manipular el genoma de un ser vivo Homo sapiens cromosoma gen Mediante la ingeniería genética se pueden introducir genes Escherichia coli en el genoma de un individuo que carece de ellos .

Arber W.Aislamiento y manipulación de fragmentos de ADN de un organismo para introducirlo en otro (ADN recombinante) Nathans D. y Smith H. (premio Nobel de Fisiología y Medicina en 1978 por el descubrimiento de las enzimas de restricción y su aplicación en Genética Molecular) ...

BamHI Extremos cohesivos Mezclar Tratar con ADN-ligasa ADN recombinante .Molécula A Molécula B Digestión de ambas moléculas con la misma enzima de restricción.

En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento Es un proceso cíclico (cada ciclo consta de 3 pasos) 94ºC desnaturalización (separación de las dos hebras de ADN) ADN) 50ºC Anillamiento de "cebadores" 72ºC copia de cada una de las hebras de ADN por la ADN polimerasa 35 ciclos 236= 68 billones de copias .

.

1 Plás i Plás i gen e resistencia a la a picilina s 2 Extre s c hesiv s ¡   ¢ 3 ¡ ¡  M lécula e ADN rec binante .

Pl smido .

1 Vir s 2 3 .

Ciclo lisogénico Ciclo lítico (f) (g) (h) .

Genoma de hongos: 44 millones de pares de bases Huesped: Escherichia coli Vector: Bacteriófagos capacidad: 20 mil pares de bases Genoma humano: 3000 millones de pares de bases Huesped: Saccharomyces cerevisiae Vector: YAC (cromosoma artificial de levadura) MegaYAC (capacidad: 1 millón de pares de bases) .

Secuenciación de genomas ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCC AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA .

o el comercio ilegal de especies en peligro ‡Secuenciación de genomas Conocimiento b sico y aplicado de diferentes organismos (incluido el genoma humano) .‡Detección de mutaciones Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual) ‡Secuenciación de ADNs fósiles Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría est n dañadas o degradadas) ‡Diagnóstico de enfermedades genéticas Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de fecundación in vitro ‡Identificación de especies y control de cruces entre animales Para descubrir fraudes comerciales. tales como vender carne de una especie m s barata a los precios de otra m s cara.

Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad Marco de trabajo para el desarrollo de nuevas terapias. 15 de Febrero de 2001 Consorcio público internacional . adem s de nuevas estrategias para la terapia génica 2.16 de Febrero de 2001 Celera Genomics Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes m s f cil y r pidamente y sienta las bases para averiguar la función de los genes identificados Beneficios médicos tras el conocimiento de la estructura de cada gen humano 1.

etc.. comercial. factores de coagulación antes se obtenían a partir de los tejidos que las producen o fluidos corporales) .. (insulina. hormona del crecimiento.Obtención de proteínas de interés médico.

Obtención de vacunas recombinantes Extracción del ADN del virus (aternativa al uso de organismos patógenos inactivos) ADN pl smido bacteriano Integración del pl smido híbrido en el núcleo de una célula de levadura La levadura fabrica las proteínas víricas con poder inmunológico Inyección de proteínas víricas en un chimpancé £ £ .

Diagnóstico de enfermedades de origen genético ADN sano ADN enfermo Conocimiento previo de la secuencia de ADN enfermo Mediante ingeniería genética se construye una sonda de ADN. con la secuencia complementaria del ADN enfermo ADN complementario del ADN enfermo DIAGNÓSTICO ¤ ¤ © © ¨ ¦§ ¦¥ Bioc ip Microarray DNAc ip Si aparecen andas fluorescentes demuestra ue la persona presenta la anomalía ¤ ¦ § § ¿ i ridación? enaturali ación Desnatura ¿No i ridación? del ADN con la li ación sonda del ADN fluorescente ADN de la persona ue se uiere diagnosticar . marcada (marcaje fluorescente).

Ingeniero genético natural tras sutitución de genes onc por genes de interés inductor de tumores contiene oncogenes (genes onc) cromosoma célula vegetal tumores Proliferación de hormonas crecimiento.Produce tumores Agrobacterium Pl smido Ti núcleo cromosoma Transgénesis= introducción de ADN extraño en un genoma. Se forman tumores en las zonas de la lesión  .Plantas transgénicas Agrobacterium tumefaciens es patógena de plantas. de modo que se mantenga estable de forma hereditaria y afecte a todas las células en los organismos multicelulares.

Larvas de especies de insectos predadores benéficos (larvas verdes de crisopa) murieron cuando fueron alimentadas con el gusano barrenador europeo Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A Mejora de la calidad de los productos agrícolas Producción de aceites modificados ‡Síntesis de productos de interés comercial Anticuerpos animales.‡Resistencia a herbicidas. La toxina puede ser transmitida a través de la cadena alimenticia. insectos y enfermedades microbianas El maíz transgénico de Novartis es resistente al herbicida Basta y también es resistente al gusano barrenador europeo (contiene el Gen de resistencia a la toxina Bt de Bacillus thuringiensis) produce su propio insecticida Problemas:La toxina Bt en las plantas transgénicas tiene propiedades sustancialmente diferentes a la toxina Bt en su forma natural. interferón. un efecto que nunca ha sido observado en la toxina Bt en su forma natural. e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables .

Transgénesis en animales (por microinyección de zigotos) Gen humano Secuencia promotora para la síntesis de una proteína de la leche Gen híbrido humano vulos de cerda ecundados rata   esarrollo de una cerda transgénica .

Clonación de animales (TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS) .

Clonación de animales (TRANSFERENCIA DEL NÚCLEO DE UNA CELULA SOMATICA: CÉLULA DIFERENCIADA) .

como hepatitis.Clonan terneros en EE UU para producir anticuerpos humanos efe.Washington .agosto 2002 Terneros clonados y manipulados genéticamente (f brica de anticuerpos humanos) genes para anticuerpos humanos recombinantes células dérmicas clonación Objetivo: Tratamiento de enfermedades inmunológicas Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus. ántrax (utilizada como arma biológica) .

Clonan cerdos destinados a trasplantar sus órganos a humanos La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos "alfa 1.3 galactosil transferasa" Enero 2002. AP Photo/Roanoke Times. Gene Dalton (IDEAL-EFE) Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra) Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo .

un fin sin explorar cuya sola posibilidad había desencadenado ya el almacenamiento de células de mascotas por parte de sus ricos propietarios febrero 2002 Universidad College Station (Texas) El sexto día El ataque de los clones .Un laboratorio de Texas clona al primer animal doméstico "Copycat" es el primer gatito nacido mediante clonación" El experimento abre las puertas de la clonación masiva de animales domésticos.

Para obtener a Dolly: 277 fusiones de abortos y malformaciones ovocitos con células mamarias. solo genéticas 29 embriones fueron aptos. De estos solo uno resultó un éxito . no existen garantías como para decir 'Vamos a clonar un ser humano' Por cada intento de clonación hay detr s miles de fallos.La clonación humana ya se esté intentando de forma clandestina por varios laboratorios en el mundo La clonación reproductiva no arroja los resultados suficientes.

-embrión som tico- 1 Cultivo de blastocisto Fecundación 2 Eliminación de la capa externa Embrión temprano 4 Transferencia de los agregados celulares a un nuevo pozo 6 dición de factores de diferenciación seleccionados En caso de existir deficiencias a nivel genético se puede hacer ter pia génica a nivel de células madre 7 dministración de células diferenciadas a tejidos dañados 5 Formación de células diferenciadas a tejidos dañados  dición de sustancias ue disgregan la masa celular interna Fusión de célula som tica y ovulo enucleado     OBJETIVO ÚLTIMO: TR T MIENTO de ENFERMED DES OBJETIVO ÚLTIMO: (no hay rechazo) UTOTR SPL NTES   CRE CIÓN DE UN EMBRIÓN (con células adultas) RTIFICI L         .

Retos técnicos 1.Las células madre abren la posibilidad a un nuevo mundo en las terapias de los trasplantes Calificada como una técnica "ineficaz e imperfecta" por científicos como Iam Wilmut. "padre" de la oveja Dolly. 3. 2. Las células embrionarias de ratón originan teratomas y teratocarcinomas en animales adultos Conocimiento de las señales implicadas en el desarrollo y diferenciación Asegurar la salud a largo plazo de las células a transplantar (edad biológica de las células) . la clonación ha encontrado en las células "madre" su primera razón de ser.

etc..). nuevas contaminaciones debidas a un metabolismo incontrolado. . agrícola y ganadera.. desaparición de especies con consecuencias desconocidas. discriminación. agencias de seguros. efectos secundarios de nuevos f rmacos de diseño. Problemas éticos y morales Poder conocer y modificar el patrimonio genético humano puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a través del perfeccionamiento de las características hereditarias". por ejemplo. etc.continuación en las investigaciones y la salvaguarda de los derechos humanos) Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997). pueden crear diferencias aún m s grandes entre países ricos y pobres. Problemas sociales y políticos en el campo de la producción industrial. adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas Problemas sanitarios nuevos Problemas ecológicos microorganismos patógenos. y atenta contra la intimidad a que tiene derecho toda persona (empleo.. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral...

.

para la obtención de diferentes productos utilizados en la alimentación. Bioética: Disciplina científica que estudia los aspectos éticos de la medicina y la biología en general. la Biomedicina fundamenta su existencia en el soporte que proporciona el conocimiento de los procesos biológicos a nivel molecular para entender las manifestaciones clínicas de una patología. partes de ellos o sus derivados. Biomedicina: Área de investigación que sigue un camino ascendente desde el fenotipo hasta el genotipo. desde la expresión de un gen en una proteína hasta el papel que ésta desempeña en una vía metabólica.GLOSARIO      ADN recombinante: Molécula de ADN formada por combinación de fragmentos de ADN de orígenes diferentes. medicina y otros usos culturales . así como las relaciones del hombre con los restantes seres vivos. 1992). La proteína que codifica éste es una proteína recombinante. no maleficencia y justicia. autonomía. (Convenio sobre Diversidad Biológica de las Naciones Unidas. Biotecnología Tradicional: Uso de organismos vivos o de compuestos obtenidos de organismos vivos para obtener productos de valor para el hombre. Son las tecnologías y procedimientos fruto del conocimiento y experimentación realizada de forma colectiva y acumulativa de generación en generación por agricultores y productores que involucran el uso y procesamiento de plantas. animales y microorganismos. Se basa en cuatro principios fundamentales: beneficencia. Biotecnología Moderna: Toda aplicación tecnológica que utilice sistemas biológicos y organismos vivos o sus derivados para la creación o modificación de productos o procesos en usos específicos.

y finalmente se diferencian al tipo de célula o tejido para la terapia celular o el injerto. . Genoma: Conjunto de todos los genes de un organismo y de todo el patrimonio genético almacenado en el conjunto de su ADN o de sus cromosomas. se crea un ³embrión artificial´ (embrión somático) hasta la fase de blastocisto. sin los problemas del rechazo (autotrasplante). Genómica: Área de investigación que estudia los genomas completos de los organismos vivos y que busca comprender la estructura. Clonación Terapéutica o transferencia de núcleo de célula somática: Procedimiento en que el paciente suministra células somáticas. a partir de un mismo ancestro. luego se toman las células de su masa interna. Células Somáticas: Cualquier célula del cuerpo. se transfiere el núcleo a un ovocito desnucleado. se cultivan como células madre. genéticamente idénticas. función y evolución de los genes para responder a cuestiones biológicas fundamentales. excepto los gametos.      Células Madre: Célula precursora que sufre división y da lugar a diferentes linajes de células diferenciadas. Clonación: El proceso de producción asexual de un grupo de células (clones).

plásmido bacteriano u otro sistema vector. Manipulación Genética: Formación de nuevas combinaciones de material hereditario por inserción de moléculas de ácido nucleico obtenidas fuera de la célula. en el interior de cualquier virus. Marcador Genético Molecular: Secuencia de ADN que es utilizada para identificar una localización particular en un cromosoma de un gen o característica genotípica o detectar la presencia de un agente infeccioso (bacteria. La alteración del contenido genético tiene como objetivo que la especie modificada adquiera unas propiedades que por ella misma no posee. . hongo o virus). Organismos Genéticamente Modificados. a través de la introducción de uno o más genes provenientes de otra especie o de origen artificial o mediante la manipulación o recombinación genética de sus propios genes. OGM: Cualquier organismo cuyo material genético ha sido modificado de una manera que no se produce de forma natural en el apareamiento (multiplicación) o en la recombinación natural.     Ingeniería Genética: Conjunto de técnicas utilizadas para modificar el material genético de un organismo vivo. también se pueden producir manipulando las cruzas Organismos Transgénicos: Animal o planta en el que se ha introducido un gen perteneciente a otra especie.

Esta técnica permite la asociación de genes que no existe en la naturaleza. haciendo que ciertos genes se activen o se silencien para producir o dejar de producir ciertas proteínas. saltándose las barreras entre especies y entre reinos. .    Proteómica: Área de investigación que busca identificar y caracterizar un conjunto completo de proteínas y la interacción entre ellas en una especie dada. que generalmente puede transmitirlo a su descendencia. Terapia Génica: Conjunto de los procesos destinados a la introducción in vitro o in vivo de un gen normal en células en las que el mismo gen. anormal. provoca una deficiencia funcional o es el origen de una enfermedad. Silenciamiento y Activación de Genes: Proceso que permite "conectar" o "desconectar" genes. Transgénesis o Transgenia: Conjunto de procesos que permiten la transferencia de un gen (que se convierte en transgen) a un organismo receptor (llamado transgénico).

Sign up to vote on this title
UsefulNot useful