P. 1
Duplicacion de ADN

Duplicacion de ADN

4.27

|Views: 73,040|Likes:

More info:

Published by: marielba velandia v. on Jul 05, 2008
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPT, PDF, TXT or read online from Scribd
See more
See less

03/07/2015

pdf

text

original

Por: Lic.

Marielba Velandia

En el interior de una célula encontramos diferentes orgánulos cada uno con una función determinada. En el núcleo existen unas estructuras llamadas cromosomas, que están formadas por ADN, es decir, son las portadoras del material genético. El número de cromosomas es constante para cada

En el ser humano hay 23 pares de cromosomas

El ADN es un ácido nucleico, llamado así por encontrarse fundamentalmente en el núcleo de las células. Existen dos tipos fundamentales de ácidos nucleicos: el ácido desoxirribonucleico ADN- (DNA en inglés) y el ácido ribonucleico ARN- (RNA en inglés)

Los ácidos nucleicos son sustancias sintetizadas por los seres vivos que se encargan de codificar, almacenar y transcribir la información genética. Por tanto, EL ADN ES EL MATERIAL HEREDITARIO.

Los ácidos nucleicos están compuestos por una reducida variedad de moléculas más pequeñas llamadas nucleótidos. Los nucleótidos están constituidos por: 1- un azúcar de 5 carbonos: la ribosa o desoxirribosa

2- Un compuesto de fósforo, el ácido fosfórico. 3- Una base nitrogenada, que puede ser una purina o una pirimidina.

La unión del azúcar con una base constituye un nucleósido. La unión entre el nucleósido y el ácido fosfórico, da lugar al nucleótido.

Posee 5 carbonos y se llama ribosa. Si posee un átomo menos de oxígeno se la denomina desoxirribosa. Por lo tanto hay dos tipos de ácidos nucleicos según tengan una u otra azúcar: Los ácidos ribonucleicos o ARN: que tienen como azúcar a la ribosa.

Los ácidos desoxiribonucleicos o ADN: que tienen como azúcar a la desoxirribosa.

Se une al carbono en posición 5 del azúcar. Se llama ácido porque el grupo fosfórico tiene un ion hidrógeno disociado (PO4H+). Por la pérdida de un electrón el ion H+ tiene una carga positiva lo que permite combinarse. Por lo general un ion metálico (Na, Ca, Mg) se halla unido al grupo fosfórico.

Se asocia al carbono en posición 1 del azúcar. Este grupo presenta uno o dos anillos de C y N, y puede actuar como una base aceptando iones de H. Las bases con un solo anillo son las pirimidinas y las que tienen dos anillos purinas.

Existen cuatro tipos de nucleótidos, según la base nitrogenada que los forme. Nucleótido de Adenina, De Timina o Uracilo De Guanina De Citosina.

Las cadenas de nucleótidos que lo forman se enrollan formando, una en torno a otra, una estructura especial que se conoce como doble hélice ( α -hélice ). Son cadenas complementarias con dirección

La molécula de ADN, tiene los nucléotidos de cada cadena unidos entre sí por uniones fosfodiester ; y las bases nitrogenadas tienen un "apareamiento específico" por medio de enlaces de hidrogeno, de forma que la Adenina siempre se une con la Timina ( A - T ), y la Citosina siempre se une con la Guanina ( C - G), o viceversa.

De esta manera si existe una cadena de ADN que lleve la siguiente secuencia de bases nitrogenadas: ATTTATGGGCGTTATGCGTAGTCA TGC 3'-------------------------------------------------------------5' Tiene la banda complementaria con dirección opuesta, que corresponde con este orden de las bases nitrogenadas: TAAATACCCGCAATACGCATCAGT ACG

Es la capacidad que tiene el ADN de hacer copias o réplicas de su molécula. Este proceso es fundamental para la transferencia de la información genética de generación en generación.

Se dieron muchas hipótesis sobre cómo se duplicaba el ADN MODELOS DE REPLICACIÓN PROPUESTOS: SEMICONSERVATIVO, CONSERVATIVO Y DISPERSIVO

Cuando el ADN doble hélice se replica se producen dos dobles hélices, una de ellas tiene las dos hebras viejas (está intacta, se conserva) y la otra doble hélice posee ambas hebras de nueva síntesis.

Cuando el ADN doble hélice se replica se originan dos dobles hélices, cada una de ellas con hebras que poseen tramos viejos y tramos de nueva síntesis en diferentes proporciones.

Este modelo de ADN propuesto por Watson y Crick responde de forma ideal al mecanismo de la duplicación.
Se sabe que los cromosomas, durante la división celular, hacen una copia de sí mismos para pasar a las células hijas la misma información que tenía la célula madre.

Para tratar de averiguar como tiene lugar la replicación de los cromatidios, realizaron un experimento con células de raíz de Vicia faba (judía) . El experimento consistió en someter a las raíces durante un periodo de Síntesis a la acción de la Timidina tritiada (TH3) y, posteriormente observar el patrón de marcaje radiactivo de los cromosomas en la primera metafase mitótica después de la incorporación del isótopo y en la segunda metafase mitótica. Para ello trabajaron con autorradiografía.

AUTORADIOGRAFIAS
Las autorradiografías obtenidas ponían de manifiesto que las células de la primera metafase mitótica después de la incorporación del isótopo tenían todos sus cromosomas marcados en sus dos cromatidios con timidina tritiada (TH3).

Sin embargo, las células de la segunda metafase mitótica después de la incorporación del isótopo tenían todos sus cromosomas marcados pero solamente en uno de sus dos cromatidios

El siguiente esquema pone de manifiesto que si se supone que el cromatidio es una doble hélice de ADN que se replica de forma semiconservativa, se obtienen los resultados observador por Taylor y colaboradores, es decir, todos los cromosomas de la célula están marcados en sus dos cromatidios en la 1ª Metafase y todos los cromosomas de la célula están marcados en un solo cromatidio en la 2ª Metafase.

Meselson y Stahl (1957) diseñaron un experimento para tratar de averiguar la forma en la que se realiza la replicación del ADN en E. coli. Para contestar a esta pregunta, diseñaron un experimento en el que marcaban el ADN de la bacteria E. coli con Nitrógeno pesado N15, para ello hicieron crecer las bacterias durante 14 generaciones sucesivas en un medio que contenía como única fuente de Nitrógeno N15.

Cuando extraían el ADN de la bacterias que llevaban una generación creciendo en N14 y centrifugaban en CsCl, obtenían una sola banda de densidad intermedia (N14-15)entre la del ADN N14 y el ADN N15. Si extraían el ADN de las bacterias que llevaban dos generaciones creciendo en N14 y centrifugaban en gradiente de CsCl obtenían dos bandas, una correspondiente al ADN N14 y otra de densidad intermedia (N14-15) entre la

Los resultados obtenidos por Meselson y Stahl (1958) se ajustaban a un modelo de replicación semiconservativo.

Si la replicación de E. coli se ajustaba al modelo semiconservativo, una de las hélices debería estar construida con N15 (la vieja) y la otra hélice con N14 (la nueva) y, al centrifugar en gradiente de densidad esperaríamos obtener dos bandas una más densa correspondiente a la hélice construida con N15 y otra menos densa sintetizada con  N14. El resultado obtenido por Meselson y Stahl (1958) fue precisamente el esperado para una replicación semiconservativa.

El significado genético de la replicación es el de conservar la información información genética, de manera que cuando una bacteria se divide, de lugar a una bacteria hija que contenga la misma información genética. En organismos eucariontes el significado de la división celular es el mismo, una célula cuando se divide origina dos células hijas idénticas con la misma información genética.

El modelo de replicación semiconservativo se basa en la complementareidad de las bases nitrogenadas. De esta manera, una hebra de ADN puede servir de molde para sintetizar una nueva.

La escalera en forma de hélice se abre, como si fuese una cremallera, en dos bandas sencillas de nucleótidos que se separan.

Al abrirse la molécula, cada filamento sirve de patrón. Al lado de cada filamento se forma una nueva cadena complementaria, dando origen a dos moléculas idénticas. Cada una de ellas conserva una mitad de la molécula original. Por eso se llama duplicación semiconservativa

Este proceso se lleva a cabo cada vez que hay división celular, la duplicación del ADN que se lleva a cabo en el Ciclo Celular, es la duplicación del material genético de la célula. Como cualquier reacción metabólica, para que sé de a cabo, se necesitan enzimas especiales que aceleren el proceso.

Primero se necesitan de unas enzima que desenrollen la hélice, estas enzima reciben el nombre de Helicasas

Una vez separadas las cadenas otra enzima muy importante se encarga de ir uniendo nucleótidos trifosfóricos a las tiras de acuerdo al apareamiento específico que existe; los nucleótidos que se pegan son desoxinucleótidos, de esta manera la ADN-Polimerasa va construyendo una copia complementaria sobre una matriz (3' a 5') de un solo hilo de ADN

De esta manera al sobreponer una cadena con otra se obtiene: 3 '--------------------------------------------------------------5' ATTTATGGGCGTTATGCGTA GTCATGC TAAATACCCGCAATACGCAT CAGTACG 5'-----------------------------------------------------

La duplicación comienza en sitios específicos llamados ORÍGENES DE DUPLICACIÓN.

Las enzimas HELICASAS separan las cadenas formando las BURBUJAS DE REPLICACIÓN

Ambas cadenas se duplican al mismo tiempo en una estructura en forma de Y que se conoce como HORQUILLA DE DUPLICACIÓN.

Una vez separadas las cadenas, unas proteínas se unen a la cadena, impidiendo que vuelva a formarse la doble hélice mientras se copian otras cadenas. Las topoisomerasas relajan la tensión producida por el desenrrollamiento.

Las enzimas que catalizan la unión de los nucleótidos , las ADN- polimerasas, presentan las características siguientes: 1- Utilizan nucleótidos activados, conteniendo tres grupos fosfatos unidos al carbono 5’ del azúcar.

2- Pueden agregar nucleótidos sólo en el extremo 3’ de una cadena que se está sintetizando. Así, la nueva cadena siempre crece en el sentido 5’ 3’.

La síntesis de ADN debe iniciarse con la incorporación de un pequeño fragmento de ARN llamado ARN cebador o “primer”. Tiene como función facilitar el extremo 3’ para iniciar la incorporación de los siguientes nucleótidos de acuerdo a la secuencia de la cadena patrón en dirección 5’ 3’.

El cebador es degradado después por enzimas específicas y el espacio es ocupado por nucleótidos de ADN.

El extremo 3’ de las nuevas cadenas siempre crece hacia la horquilla. Esta cadena puede formarse con facilidad y de manera contínua y se llama CADENA DIRECTORA.

El extremo 3’ de la otra cadena nueva siempre crece en sentido opuesto a la horquilla de duplicación. Esta cadena es llamada SEGUIDORA o REZAGADA. Se sintetiza en fragmentos cortos (de 100 a 1000 nucleótidos), llamados “Fragmentos de Okazaki”.

Cada fragmento es iniciado por un ARN cebador distinto y crece hacia el extremo 5’ del fragmento previamente sintetizado por la ADN polimerasa. Cuando un fragmento llega a otro ya sintetizado, una parte del ADN polimerasa degrada al cebador, permitiendo que los fragmentos sean unidos por los extremos 3’ y 5’ mediante una enzima ADN LIGASA.

Debido a que las dos horquillas avanzan hasta completar la formación de dos moléculas de ADN, se dice que la duplicación es BIDIRECCIONAL.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->