You are on page 1of 25

PROCESSO SELETIVO/2004 − UFV 4 – BIOLOGIA

77

Carlos Roberto de Carvalho, Clóvis Andrade Neves, Francisco Murilo Zerbini Júnior, Marco Aurélio Pedron e Silva.

4.1 – QUESTÕES OBJETIVAS 01. A figura abaixo corresponde a duas plantas com parte de suas estruturas morfológicas e reprodutivas indicadas por I, II, III e IV.

II I

III

IV

Observe a representação e assinale a afirmativa CORRETA: a) III corresponde a soros 2n que produzem os esporos nas pteridófitas. b) A estrutura indicada por I é diplóide e corresponde ao prótalo. c) II indica os anterozóides haplóides produzidos pelo esporângio. d) As duas plantas são vascularizadas e apresentam folhas clorofiladas. e) As estruturas indicadas por IV são gametófitos haplóides. CONTEÚDO: CARACTERÍSTICAS GERAIS DA REPRODUÇÃO E DO DESENVOLVIMENTO – Aparelho reprodutor, gametogênese e reprodução dos vegetais. DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Características gerais das plantas. RESPOSTA: Letra (a).

78 RESOLUÇÃO:

PROCESSO SELETIVO/2004 − UFV

A questão envolve conhecimentos básicos das estruturas morfológicas e reprodutivas de briófitas e pteridófitas. A estrutura indicada por (I), na alternativa (b), é realmente diplóide, mas corresponde ao esporófito e não ao prótalo, que é o gametófito (haplóide) das samambaias. Na alternativa (c), (II) indica os esporos (haplóides) produzidos pelos esporângios. Os anterozóides são produzidos pelo anterídio. A alternativa (d) está incorreta, uma vez que apenas a pteridófita é vascularizada. Na alternativa (e) a indicação (IV) deveria corresponder apenas à estrutura pertencente à briófita, considerando-se que, nas pteridófitas, a estrutura indicada corresponde ao esporófito diplóide. A alternativa (a) está correta uma vez que (III) corresponde aos soros (diplóides) que contêm os esporângios, que produzem os esporos nas pteridófitas.

02. A obesidade já se transformou num problema de saúde pública em vários países do mundo. As células que acumulam gordura no corpo chamam-se células adiposas ou adipócitos. Quanto às características dos adipócitos em adultos, é INCORRETO afirmar que: a) são um tipo de célula do tecido conjuntivo frouxo. b) aumentam em número com a alimentação excessiva. c) fazem parte de um tecido ricamente vascularizado. d) têm função de armazenar energia química para o organismo. e) são capazes de converter carboidratos em gordura. CONTEÚDO: CARACTERÍSTICAS GERAIS DOS TECIDOS – Classificação, estrutura e função dos diversos tecidos animais. RESPOSTA: Letra (b). RESOLUÇÃO: A obesidade está relacionada com um aumento no tamanho e/ou no número de células adiposas (adipócitos) no organismo. Estas células fazem parte do conjunto de células que formam o tecido conjuntivo propriamente dito frouxo, contemplando portanto a alternativa (a). Entretanto, devido à importância da obesidade na sociedade atual, os adipócitos têm sido descritos à parte, na forma de um tecido adiposo, mas esta descrição em separado não invalida sua classificação, apenas

PROCESSO SELETIVO/2004 − UFV

79

demonstra a importância que tem sido dada a estas células atualmente. Apesar de grande parte do citoplasma dos adipócitos estar ocupado por uma gotícula de gordura, que, na maioria das vezes, desloca quase todas as organelas e o núcleo para a periferia celular, sabe-se que a vascularização deste tecido é comparável à do músculo esquelético, o que está em compasso com a alternativa (c). Como afirmado na alternativa (d) a função de reserva energética na forma de gordura é a principal função dos adipócitos e a gordura que eles armazenam podem ser oriundas da alimentação ou da conversão de carboidratos em gordura, que ocorre nos hepatócitos bem como nos próprios adipócitos, como afirma a alternativa (e). O erro contido nesta questão decorre da afirmação de que os adipócitos aumentam em número em decorrência da alimentação excessiva. Mas, sabe-se que isto só se aplica aos recémnascidos. Nos adultos, citado no enunciado da questão, o aumento do peso é decorrente da hipertrofia dos adipócitos e não da hiperplasia que é observada apenas no feto e nos bebês alimentados com dieta hipercalórica. Portanto a alternativa que deve ser assinalada é a (b).

80

PROCESSO SELETIVO/2004 − UFV

03. Aproximadamente 1.500.000 espécies de organismos foram descritas e nomeadas até a última década. As frações correspondentes a certos grupos taxonômicos estão representadas abaixo.

Protistas Procariotas

Fungos

Todas as outras plantas Angiospermas

Insetos

Todos os outros animais Moluscos

Todos os outros artrópodes

Cordados

Com base no gráfico, assinale a alternativa CORRETA: a) Os escorpiões estão incluídos na fração que representa quase a metade do total. b) A sardinha, o pardal, a cascavel e a baleia estão incluídos na fração que é muito maior que a da água-viva, da planária e da minhoca. c) A soma das frações dos eucariontes não-vegetais corresponde aproximadamente a 25% do total. d) As frações que incluem a levedura e a samambaia são distintas, mas a soma das duas é menor que a fração que inclui a Biomphalaria. e) A fração que inclui a rosa, a tulipa e a margarida é menor que a fração que inclui a aranha. CONTEÚDO: DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Características gerais de moneras, protistas, fungos, plantas e animais. RESPOSTA: Letra (d).

PROCESSO SELETIVO/2004 − UFV RESOLUÇÃO:

81

A alternativa (a) está incorreta, pois os escorpiões pertencem à classe Arachnidea. Esta classe está incluída na fração “Todos os outros artrópodos” e, portanto, representa muito menos da metade do total. A alternativa (b) está incorreta, pois inclui exemplos que estão na fração “Cordados”, que é menor que a fração “Todos os outros animais”, onde estão incluídas a água-viva (celenterado), a planária (platelmintos) e a minhoca (anelídeos). A alternativa (c) está incorreta, considerando-se que a soma das frações dos eucariontes não-vegetais correponde a mais de 75% do total. Na alternativa (e), rosa, tulipa e margarida são exemplos de angiospermas. Portanto, esta fração é maior que a fração na qual os aracnídeos estão incluídos (“Todos os outros artrópodos). Portanto, a resposta correta é a letra (d), uma vez que a soma das frações que inclui a levedura (“Fungos”) e a samambaia (“Todas as outras plantas”) é menor que a fração que inclui a Biomphalaria (“Moluscos”).

04. Os gráficos abaixo ilustram as três formas básicas de seleção natural. A distribuição dos fenótipos da progênie, após a seleção, é representada pela linha sólida. Comparativamente, a linha pontilhada representa a geração parental pré-seleção.

Freqüência de fenótipos na populacão

I

II

III

Com base na observação dos gráficos, é INCORRETO afirmar: a) Em I, a seleção é estabilizadora, pois favorece os atributos médios. b) Em II, a seleção é direcional, pois favorece um dos atributos extremos. c) Em III, a seleção é disruptiva, pois favorece os atributos extremos. d) Em II, a freqüência dos alelos no patrimônio genético é alterada. e) Em I, a seleção resulta em maior variabilidade fenotípica. CONTEÚDO: EVOLUÇÃO – Principais teorias da evolução. Mecanismos evolutivos e de especiação e princípios básicos de genética de populações.

82 RESPOSTA: Letra (e). RESOLUÇÃO:

PROCESSO SELETIVO/2004 − UFV

Esta questão envolve as três formas básicas de seleção natural: seleção estabilizadora, seleção direcional e seleção disruptiva. O gráfico exemplifica situações de seleção em relação à freqüência de fenótipos na população. A única alternativa incorreta é a letra (e), pois a seleção resulta em maior freqüência fenotípica, mas em menor variabilidade.

05. Suponha que um evento de mutação permitiu ao homem-aranha secretar a seda formadora de teia. Esse único evento resultou na formação de um alelo (S) autossômico e dominante, mas com expressão influenciada pelo sexo. Desta forma, mulheres-aranha seriam esperadas na população apenas se tal alelo ocorresse em homozigose (SS). Considerando que o homem-aranha é o único a ter essa mutação, a expectativa quanto aos fenótipos de seus futuros descendentes poderá ser uma entre as possibilidades abaixo. Assinale a afirmativa CORRETA: a) Na geração F1, 25% poderá ser de meninos-aranha. b) Todos os seus meninos deverão ter o fenótipo ‘aranha’. c) Analisando apenas as filhas, 50% delas deverão ser normais. d) Terá filhas-aranha se casar com uma prima de primeiro grau. e) Quem herdar o cromossomo Y deverá ser uma criança-aranha. CONTEÚDO: GENÉTICA – Leis de Mendel, noções de probabilidade, herança e sexo e mutação. RESPOSTA: Letra (a). RESOLUÇÃO: Considerando-se os dados acima, a alternativa (b) está incorreta, pois espera-se que apenas 50% dos seus filhos (meninos) herdem o alelo S. A alternativa (c) também está incorreta, ou seja, o homem-aranha não poderia ter 50% de filhas normais e 50% de filhos-aranha. Todas as suas eventuais filhas serão normais. A alternativa (d) está incorreta, pelos mesmos motivos apresentados na alternativa (c). Mesmo que o homem-

PROCESSO SELETIVO/2004 − UFV

83

aranha venha a se casar com uma prima de primeiro grau, ou qualquer outra mulher, nunca terá filhas-aranha, pois a mutação que produziu o único alelo (S) não se encontra na população. Para que uma pessoa do sexo feminino seja fenótipo “aranha’, teria que ter um par de alelos SS. A letra (e) está incorreta, pois o cromossomo Y determina o sexo masculino, mas não tem o loco do alelo S. Este loco gênico é autossômico e considerando-se que o homem-aranha é heterozigoto, uma criança poderá herdar o cromossomo Y e o alelo s (não-aranha). Portanto, a alternativa correta é (a), ou seja, 25% da F1 poderá ser de meninosaranha.

06. Pesticidas são produtos químicos utilizados para combater pragas que prejudicam plantas cultivadas, animais de criadouros e o ser humano. Entre os problemas associados à sua utilização está a forma indiscriminada de aplicação dessas substâncias. Com relação aos pesticidas, assinale a afirmativa INCORRETA: a) O uso abusivo dos pesticidas tem favorecido a seleção de pragas resistentes. b) Assim como no uso de medicamentos, o limite entre o “remédio” e o “veneno” está na dose aplicada. c) Alguns pesticidas podem se degradar rapidamente no solo após o período de aplicação. d) Pesticidas seletivos combatem insetos benéficos e pragas indiscriminadamente. e) O princípio ativo de alguns pesticidas pode se acumular no ecossistema ao longo de diversos níveis tróficos. CONTEÚDO: ECOLOGIA – Transferência de matéria, ciclos biogeoquímicos. Desequilíbrio ecológico: causas e conseqüências. RESPOSTA: Letra (d). RESOLUÇÃO: A única alternativa incorreta é a letra (d), pois pesticidas seletivos são apropriados para combater apenas pragas. O seu princípio ativo não tem eficácia contra insetos benéficos.

84

PROCESSO SELETIVO/2004 − UFV

07. As células-tronco têm sido muito estudadas com o objetivo de produzir órgãos que possam ser utilizados em transplantes. Além dos problemas éticos envolvidos nesta questão, conceitos errôneos têm sido veiculados pela mídia não especializada. Em relação às células-tronco humanas, assinale a afirmativa CORRETA: a) São células transgênicas. b) São o mesmo que células totipotentes. c) São encontradas apenas em embriões. d) Se transplantadas não provocam rejeição. e) Originam linhagens celulares específicas. CONTEÚDO: CARACTERÍSTICAS GERAIS DAS CÉLULAS – Diversidade celular. RESPOSTA: Letra (e). RESOLUÇÃO: As discussões sobre as descobertas recentes da Biologia não ficam mais restritas ao meio científico. Cada vez mais estes avanços são difundidos e discutidos em toda a sociedade. Exemplos destas afirmações são as discussões sobre a clonagem, organismos transgênicos e as pesquisas com células-tronco. Por um lado, isto é muito bom e acreditamos que este é o melhor caminho. Entretanto, a avalanche de conhecimentos e informações que são gerados nos laboratórios e que alcançam os nossos lares a todo momento, podem gerar certa confusão se não tivermos um conhecimento básico mínimo sobre o assunto. Além disso, muitas vezes esses conceitos são repassados de maneira equivocada pela mídia não especializada. As alternativas dessa questão foram extraídas de afirmativas veiculadas em importantes telejornais, jornais e revistas brasileiras que não são especializadas, mas que têm repassado informações relativas às células-tronco. Como se pode ver, algumas afirmativas são equivocadas. A alternativa (a) baseia-se numa confusão típica que as células-tronco são células geneticamente modificadas. Nada impede que isto seja feito, mas uma coisa não implica na outra. Na alternativa (b) observa-se um outro equívoco muito comum, pois quando se diz que as células-tronco poderiam gerar qualquer célula do organismo, como se pode depreender de alguns textos não especializados, confundese as células-tronco com as células totipotentes, que por definição são as células-ovo (zigoto) e os blastômeros iniciais dos embriões de espécies, com desenvolvimento regulativo. A infinidade de discussões sobre o uso

PROCESSO SELETIVO/2004 − UFV

85

de embriões humanos, na pesquisa com células-tronco, leva a crença de que estas células existiriam apenas nos embriões, o que não é verdade. Nos adultos estas células são fundamentais na formação e na manutenção de várias linhagens celulares específicas. Na (d), explora-se a diferença entre a realidade e a ficção. No estágio atual das pesquisas não temos ainda acesso aos bancos de células-tronco que poderiam ser usados por qualquer pessoa a qualquer tempo. As células-tronco de uma pessoa seria rejeitada por outra geneticamente diferente, ou seja, não seria compatível. O que se tem feito até agora e com alguns bons resultados é o autotransplante, que é feito, por exemplo, quando uma pessoa com câncer na medula óssea tem células-tronco retiradas e depois repostas no mesmo indivíduo, após irradiação. Resta-nos, portanto, a alternativa (e) que, apesar de ser a mais singela, é a única que reflete a realidade. As células-tronco geram linhagens celulares específicas. Por exemplo, as células-tronco da linhagem hematopoiética, em condições normais, geram células sangüíneas e não um neurônio ou célula muscular. Sendo assim, a alternativa correta é (e). 08. Observe a figura abaixo, de um corpúsculo renal, e assinale a afirmativa CORRETA:

I

II III
a) Esta estrutura está presente em todos os cordados. b) Denomina-se urina o líquido encontrado na região II. c) O líquido presente na região II é rico em sais e proteínas. d) O líquido que passa pela região III é reabsorvido na bexiga. e) A região I corresponde ao glomérulo renal.

86 CONTEÚDO:

PROCESSO SELETIVO/2004 − UFV

DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Aspectos anatômicos e fisiológicos dos seres vivos. RESPOSTA: Letra (e). RESOLUÇÃO: Trata-se de uma questão simples que aborda conhecimentos básicos acerca da estrutura e da função do néfron; permeando também algum conhecimento sobre a diversidade anatômica e fisiológica dos seres vivos. O esquema indica o corpúsculo renal típico de um amniota adulto, descaracterizando, portanto, a alternativa (a). Sabe-se que o líquido que passa para o espaço indicado por II (espaço capsular ou de Bowman) é um ultra-filtrado do sangue, denominado filtrado glomerular. Este filtrado tem composição química próxima da observada para o plasma e muito diferente da composição da urina. Este filtrado será extremamente modificado pela ação das células dos túbulos contorcidos proximais e distais, alça de Henle e ainda parte dos túbulos coletores. O que nós definimos como urina forma-se apenas no final do túbulos coletores, que desembocam nos cálices renais ou mesmo na pelve renal, como acontece em algumas espécies. Portanto, a afirmativa (b) também está errada. A diferença básica entre o filtrado glomerular e o plasma é a ausência de proteínas no primeiro. Tamanho, forma e cargas impedem que proteínas passem para o filtrado. Então, no filtrado, encontramos os mesmos sais observados no plasma, mas não proteínas, o que inviabiliza a alternativa (c). Grande parte do filtrado é reabsorvido à medida que passa pelos túbulos renais. Isto é fundamental para evitar a perda de substâncias importantes para o organismo. Por exemplo, a maior parte da glicose, aminoácidos, água e certos íons são reabsorvidos ainda nos túbulos contorcidos proximais. Reabsorção ocorre ainda nos outros túbulos renais, mas não na bexiga. A alternativa (d), portanto, é incorreta. Resta a alternativa (e), onde está indicado o glomérulo renal (ou de Malpighi) que é o nome dado ao tufo de capilares presente no corpúsculo renal. Portanto, a alternativa (e) está correta.

PROCESSO SELETIVO/2004 − UFV

87

09. A cultura de tecidos vegetais constitui uma forma de regeneração de plantas a partir de fragmentos de tecido denominados explantes. Os explantes são transferidos para meio de cultura que contém fitormônios ou reguladores de crescimento. O uso destas substâncias em concentrações adequadas induz a formação de raízes, ramos e folhas, regenerando-se uma planta com a mesma constituição genética do explante. Dentre as afirmativas abaixo, assinale a INCORRETA: a) A formação de raízes pode ser induzida pela adição de auxina ao meio. b) Mutações somáticas podem ocorrer durante a regeneração. c) A planta regenerada a partir do explante constitui um clone. d) A regeneração da planta independe da ocorrência de meiose. e) A adição de citocinina ao meio irá regenerar uma planta estéril. CONTEÚDO: CARACTERÍSTICAS GERAIS DA REPRODUÇÃO E DO DESENVOLVIMENTO – Reprodução de vegetais. DIVERSIDADE DOS SERES VIVOS – Aspectos fisiológicos dos seres vivos. GENÉTICA – Mutações e variabilidade. RESPOSTA: Letra (e). RESOLUÇÃO: A questão aborda o desenvolvimento dos vegetais, principalmente, o efeito de reguladores de crescimento. Todas as alternativas estão corretas, exceto a letra (e). As auxinas, em certas concentrações, induzem o desenvolvimento do tecido radicular (a). Mutações somáticas podem ocorrer durante o processo de regeneração (b), gerando a chamada “variação somaclonal”. A planta regenerada possui o mesmo conteúdo genético do explante, constituindo assim um clone (c), uma vez que durante a regeneração não ocorre meiose (d). As citocininas estão envolvidas no desenvolvimento dos tecidos vegetativos, não possuindo nenhum efeito negativo na formação das estruturas reprodutivas. Assim, a alternativa (e) está incorreta.

88

PROCESSO SELETIVO/2004 − UFV

10. Os vírus são parasitas intracelulares obrigatórios que realizam todas as fases de seu ciclo no interior de uma célula hospedeira. Sem contato com a célula, as partículas virais são inertes e não apresentam atividade biológica aparente. Com relação aos vírus que infectam eucariotos, assinale a afirmativa INCORRETA: a) Alguns vírus são capazes de infectar células animais e vegetais, multiplicando-se em ambos os organismos. b) Os retrovírus integram seu genoma ao genoma da célula e alguns estão associados à ocorrência de câncer. c) Os vírus que infectam animais normalmente penetram na célula por meio de endocitose mediada por receptores. d) A infecção de uma célula vegetal por vírus com genoma de DNA tem como desfecho a lise da parede celular. e) Morcegos hematófagos e roedores são exemplos de vetores de vírus que infectam seres humanos. CONTEÚDO: DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Características gerais dos vírus. RESPOSTA: Letra (d). RESOLUÇÃO: A questão aborda diversos aspectos da replicação de vírus, importantes patógenos de plantas e animais. À exceção da letra (d), todas as alternativas estão corretas. Alguns vírus de plantas também se multiplicam no inseto vetor (a). Retrovírus, como o HIV, inserem o seu genoma no genoma da célula hospedeira, e outros como o HTLV estão associados à ocorrência de câncer (b). A endocitose mediada por receptores é o principal mecanismo de penetração de vírus que infectam células animais (c). Morcegos hematófagos transmitem o vírus da raiva, e determinadas espécies de roedores transmitem os hantavírus (e). A parede celular de células vegetais é rígida, prevenindo a ocorrência de lise celular. Assim, a alternativa (d) está incorreta.

PROCESSO SELETIVO/2004 − UFV

89

11. Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). Dentre as afirmativas abaixo, assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. b) A polimerização de uma fita simples de DNA é dita semiconservativa, pois independe da existência de uma fita molde. c) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. d) As duas cadeias de uma dupla-hélice possuem a mesma orientação, e suas seqüências de bases são complementares. e) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. CONTEÚDO: CARACTERÍSTICAS GERAIS DA CÉLULA – Estrutura e função dos componentes nucleares. RESPOSTA: Letra (c). RESOLUÇÃO: A elucidação da estrutura do DNA foi um dos eventos científicos mais relevantes do século XX, cujas conseqüências são evidentes ainda hoje. A letra (a) está incorreta, pois os nucleotídeos são formados por um fosfato, uma desoxirribose e uma base nitrogenada (e não um aminoácido). A letra (b) está incorreta, pois a síntese de uma nova fita de DNA depende da existência de uma fita molde. As duas cadeias da dupla hélice possuem orientação oposta, logo a letra (d) está incorreta. A polimerização dos nucleotídeos ocorre entre o fosfato e a desoxirribose, portanto, a letra (e) está incorreta. A alternativa (c) está correta, pois a dupla hélice ocorre quando há formação de pontes de hidrogênio entre os átomos que compõem as bases nitrogenadas de duas cadeias simples.

90 12. Considere as seguintes afirmativas: I. II.

PROCESSO SELETIVO/2004 − UFV

Cólera, rubéola e botulismo são exemplos de infecções bacterianas. Bactérias se reproduzem principalmente por meio de conjugação, um mecanismo de reprodução assexuada. III. Bactérias possuem um único cromossomo. Entretanto, podem conter material genético adicional na forma de plasmídeos. IV. Existem bactérias cujo habitat natural apresenta temperatura em torno o de 72 C. Assinale a alternativa que contém as afirmativas CORRETAS: a) I e II. b) II, III e IV. c) III e IV. d) II e III. e) I, II e III. CONTEÚDO: DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Características gerais de bactérias (monera). RESPOSTA: Letra (c). RESOLUÇÃO: A questão aborda alguns aspectos da reprodução de bactérias, requerendo algum conhecimento sobre doenças causadas por esses organismos. A afirmativa (I) está incorreta, pois a rubéola é uma doença de etiologia viral, e o botulismo é uma intoxicação, e não uma infecção. A afirmativa (II) também está incorreta, pois o principal mecanismo de reprodução de bactérias é a fissão binária. As bactérias contêm apenas um cromossomo, porém diversas espécies possuem material genético adicional (e não essencial) na forma de plasmídeos. Assim, a afirmativa (III) está correta. Algumas bactérias, como Thermus aquaticus, vivem o próximas a fontes termais onde a temperatura média é em torno de 72 C. Assim, a afirmativa (IV) está correta. Conseqüentemente, a alternativa que contém as afirmativas corretas é (c) (III e IV).

PROCESSO SELETIVO/2004 − UFV

91

13. Como reconhecimento de seus trabalhos pioneiros relacionados ao ciclo celular, Leland H. Hartwell, Tim Hunt e Paul Nurse receberam o Prêmio Nobel de Medicina e Fisiologia em 2001. Com relação ao ciclo celular em eucariotos, assinale a afirmativa CORRETA: a) A célula em G1 perde as suas atividades metabólicas. b) Em células totalmente diferenciadas o ciclo é suspenso em S. c) A fase S caracteriza-se principalmente por intensa atividade nucleolar. d) A célula em G1 possui metade da quantidade de DNA comparada a G2. e) A síntese de DNA e RNA é mais intensa durante a fase G2. CONTEÚDO: CARACTERÍSTICAS GERAIS DA CÉLULA – Ciclo celular. RESPOSTA: Letra (d). RESOLUÇÃO: O estudo do ciclo celular em eucariotos vem recebendo grande atenção e destaque nos últimos anos. O ciclo é composto pelas fases G1, S, G2 e M. Nas fases G1 e G2, a célula executa a grande maioria de suas atividades metabólicas normais, incluindo a síntese de proteínas. A fase S é caracterizada pela replicação do genoma (síntese de DNA). A fase M é a fase de divisão celular (mitose). Portanto, a célula em G1 possui intensa atividade metabólica, tornando a alternativa (a) incorreta. Células totalmente diferenciadas, que não sofrerão nova divisão celular, normalmente, têm o ciclo celular suspenso na fase G1 (em alguns casos G2), mas nunca na fase S. Logo, a alternativa (b) está incorreta. A fase S apresenta intensa atividade no núcleo (local da síntese de DNA), mas não no nucléolo, local de transcrição de RNA ribossomal, o que ocorre nas fases G1 e G2. Logo, a alternativa (c) está incorreta. A síntese de DNA ocorre durante a fase S, logo a alternativa (e) também está incorreta. A célula em G2 acabou de ter seu genoma replicado, enquanto a célula em G1, logo após a mitose, ainda não replicou seu genoma. Logo, a célula, em G1, tem a metade do conteúdo de DNA da célula em G2, tornando a alternativa (d) correta.

92

PROCESSO SELETIVO/2004 − UFV

14. A comercialização de carne clandestina tem contribuído para o aumento de parasitoses que acometem o ser humano. Destacam-se entre essas doenças as que são causadas por cestódeos, que poderiam ser evitadas caso medidas preventivas fossem observadas. Entre as diversas medidas que devem ser tomadas, assinale a alternativa CORRETA que apresenta uma medida preventiva, específica para parasitas dessa classe do filo Platyhelminthes: a) Inspecionar a carne em busca de ovos de Fasciola hepatica. b) Evitar que o boi ou o porco beba água contaminada com miracídios. c) Verificar se a carne suína ou bovina contém cistos de cercária grávidos. d) Examinar visualmente se a carne a ser consumida contém cisticercos. e) Não comprar carne clandestina, que pode conter larvas de ancilóstoma. CONTEÚDO: DIVERSIDADE E CLASSIFICAÇÃO DOS SERES VIVOS – Características gerais dos animais. SAÚDE E SANEAMENTO – Aspectos biológicos, preventivos e de controle. RESPOSTA: Letra (d). RESOLUÇÃO: A despeito dos avanços que têm sido obtidos na fiscalização sanitária no Brasil, muito ainda há de ser feito, principalmente em cidades do interior, em relação às condições de criação e abate de animais para consumo humano. O conhecimento, por parte da população sobre o ciclo de vida de alguns parasitas, poderia contribuir para evitar certas doenças graves, como a cisticercose, que é endêmica em várias áreas do país. Nesta questão, busca-se analisar os conhecimentos dos estudantes em relação às características básicas da classificação e dos aspectos biológicos de alguns importantes parasitas que fazem parte da Classe Cestoda, do filo Platyhelminthes. A alternativa (a) não se aplica, dentre outras coisas, pelo fato de a Fasciola hepatica não ser um Cestoda e de seus ovos não alcançarem a musculatura dos animais. As alternativas (b) e (c) também não se aplicam, pois miracídios e cistos, com metacercárias, fazem parte do ciclo dos trematodos. Os miracídios são formas infectantes para os caramujos, e os cistos com metacercárias são encontrados na vegetação. A alternativa (e), apesar de dar um bom conselho em relação à compra de carne, nos remete para um outro Filo e, portanto, não pode ser considerada. Resta-nos a alternativa (d). Uma medida simples e eficaz é examinar visualmente se a carne contém cisticercos (canjiquinha), que contaminariam os indivíduos. Portanto, a alternativa correta é a (d).

PROCESSO SELETIVO/2004 − UFV

93

15. O desenvolvimento embrionário de um ser humano se assemelha em muitos aspectos ao de um jacaré. Porém, existem diferenças importantes. Assinale a afirmativa CORRETA: a) No desenvolvimento embrionário do jacaré o córion foi substituído pela casca calcárea. b) O alantóide tem funções respiratória e de acúmulo de excretas no embrião do jacaré, mas não no do ser humano. c) No desenvolvimento embrionário do jacaré não há formação do âmnio, já que a ovoposição ocorre em locais úmidos. d) No desenvolvimento embrionário humano a vesícula ou saco vitelínico está ausente, pois a nutrição é placentária. e) A fecundação interna ocorre no ser humano, que é vivíparo, mas não no jacaré, que é ovíparo. CONTEÚDO: CARACTERÍSTICAS GERAIS DA REPRODUÇÃO E DO DESENVOLVIMENTO – Tipos de ovos e desenvolvimento embrionário. Tipo e função de anexos embrionários. RESPOSTA: Letra (b). RESOLUÇÃO: Nesta questão, compara-se o desenvolvimento de um amniota ovíparo com outro vivíparo. A alternativa (a) faz uma afirmação falsa, pois o córion está presente abaixo da casca dos ovos dos jacarés. Portanto, não houve substituição do córion pela casca. A letra (c) também não é válida, pois, como já foi dito, trata-se de dois amniotas. Na alternativa (d), faz-se uma afirmativa incorreta, seguida por uma correta; pois apesar de ter função muito restrita no embrião humano, a vesícula vitelina está presente. A alternativa (e) também está incorreta, pois, nessas duas espécies, ocorre a fecundação interna, que não tem nada a ver com o fato de serem ovíparos ou vivíparos. Sendo assim, a única alternativa correta é a (b). Nos crocodilianos, o alantóide é uma bolsa que acumula os excretas nitrogenados, que não podem ser eliminados através da casca. À medida que os vasos sangüíneos da parede deste anexo vão se desenvolvendo, cada vez mais vão adquirindo importância como sítios de troca de gases entre o feto e o ambiente. Geralmente a parede do alantóide colaba-se com a parede do córion originando a membrana alanto-coriônica. Nos embriões e fetos humanos, as excretas são eliminadas pela mãe, via placenta e nunca chegam a ser acumuladas no alantóide, pouquíssimo desenvolvido. A única afirmativa correta, então é a (b).

94 4.2 – QUESTÕES DISCURSIVAS

PROCESSO SELETIVO/2004 − UFV

01. Os ecólogos consideram muito importante compreender a base energética de um ecossistema. Na figura abaixo, os números I, II, III, IV e V fazem parte dos aspectos básicos deste processo.

LUZ I

III

II IV V

Com base na observação da figura, faça o que se pede: a) A assimilação total está sendo representada por qual(is) número(s)? b) A produção primária líquida está sendo representada por qual(is) número(s)? c) O que significa, do ponto de vista ecológico, a taxa de produtividade primária? d) Cite dois exemplos de atividades biológicas que poderiam substituir corretamente o número IV: CONTEÚDO: ECOLOGIA – Ecossistemas, componentes, inter-relação, transferência de matéria e energia.

PROCESSO SELETIVO/2004 − UFV RESOLUÇÃO:

95

A questão engloba aspectos básicos do fluxo de energia dentro de um ecossistema. As indicações dos números, no esquema, correspondem a: (I) (II) (III) (IV) (V) Parte da energia produzida que será gasta no processo de respiração da planta. Produtividade primária líquida. Energia calorífica não aproveitada pelo ecossistema. Atividades biológicas que transferem a energia útil para o ecossistema. Produtos (p. ex., frutos) que contêm a energia disponibilizada para o ecossistema.

As respostas consideradas corretas para as alternativas são: (a) I e II. (b) II. (c) A taxa energética útil que é disponibilizada para o ecossistema. (d) Reprodução, crescimento.

96

PROCESSO SELETIVO/2004 − UFV

02. Considere que os genes autossômicos, identificados nos cromossomos (I e II), correspondam a aptidões para aprender biologia (B), matemática (M) e tocar guitarra (G). Em um dado loco, um indivíduo com genótipo recessivo não apresenta aptidão; um indivíduo heterozigoto apresenta aptidão mediana; e um indivíduo homozigoto dominante apresenta maior aptidão.

I

B G

II

M

Com base nessas informações, faça o que se pede: a) Um casal (P1), formado por um indivíduo triplo homozigoto dominante e outro triplo homozigoto recessivo, poderá esperar descendentes (F1) com qual(is) genótipo(s)? b) Se um descendente (F1) se casar com um indivíduo sem aptidão para as três habilidades, qual a probabilidade desse casal ter uma criança com aptidão mediana para matemática? c) Qual o nome do mecanismo genético, proposto por Thomas Hunt Morgan, que permitiria ao casal do item b ter filhos com aptidão mediana para aprender biologia mas sem aptidão para tocar guitarra? d) Quais os locos cuja herança não resultará em proporções segregantes dentro dos padrões da segunda Lei de Mendel? e) Uma mãe sem aptidão para aprender biologia e tocar guitarra, mas com aptidão mediana para aprender matemática, terá 100% dos filhos(as) com aptidão no mínimo mediana para as três características, ao se casar com um indivíduo com genótipo: CONTEÚDO: GENÉTICA – Leis de Mendel, noções de probabilidade, ligação e mapeamento genético.

PROCESSO SELETIVO/2004 − UFV RESOLUÇÃO:

97

A questão envolve situações com dois locos (B e G) ligados no cromossomo I e um loco (M) no cromossomo II, em termos de segregação independente e recombinação entre alelos. Portanto, as respostas consideradas corretas são: (a) BbGgMm (b) 50% (c) Recombinação (permutação ou crossing-over) (d) B e G (e) BBGGMM Na letra (a), os genótipos do casal são BBGGMM e bbggmm. Portanto, o único genótipo possível na F1 será BbGgMm. Na letra (b), se o indivíduo F1 (BbGgMm) se casar com alguém sem aptidão para as três habilidades (bbggmm) poderá ter 50% dos descendentes com aptidão mediana para matemática (Mm). Observa-se assim que os locos B e G não participam desta aptidão. Na letra (c), o cientista Thomas Hunt Morgan, que contribuiu com diversas pesquisas pioneiras na área de Genética, descobriu o fenômeno da ligação (“linkage”) entre genes localizados no mesmo cromossomo. Entretanto, estes genes podem ser recombinados em relação aos locos de alelos localizados em cromossomos homólogos, por intermédio de uma troca ou permutação (“crossing-over”) de segmentos entre tais cromossomos. Portanto, para que o casal do item (b) tenha filhos com aptidão mediana para aprender biologia, mas sem aptidão para tocar guitarra, deverá ocorrer uma recombinação entre esses dois locos. Na letra (d), uma mãe sem aptidão para aprender biologia e tocar guitarra, mas com aptidão mediana para aprender matemática (bbggMm), terá 100% dos filhos ou filhas com aptidão, no mínimo, mediana para as três características se casar com um indivíduo BBGGMM.

98

PROCESSO SELETIVO/2004 − UFV

03. Os manguezais constituem um dos mais importantes ecossistemas brasileiros. São áreas de clima quente e solos alagados e pouco aerados. A vegetação típica dos manguezais possui características que lhe conferem alto grau de adaptabilidade a tais condições. Abaixo, encontrase uma representação de um corte transversal de uma folha de Rhizophora mangle, uma planta típica de manguezais.

Com base no texto e na observação da figura, faça o que se pede: a) Cite o nome da estrutura epidérmica indicada em I. b) O tecido indicado em II tem função de armazenamento. Cite a substância que esse tecido armazena. c) Qual a função principal da estrutura indicada em III? d) Cite o nome do tecido indicado em IV. CONTEÚDO: CARACTERÍSTICAS GERAIS DOS TECIDOS – Classificação, estrutura e função dos tecidos vegetais. RESOLUÇÃO: O corte evidencia algumas estruturas especializadas que têm a função de controlar a perda de água e regular a transpiração nos tecidos foliares. (I)

PROCESSO SELETIVO/2004 − UFV

99

representa a cutícula, bastante desenvolvida nesta espécie de planta. O tecido indicado em (II) é um parênquima aqüífero, cuja função principal é o armazenamento de água. O estômato, estrutura representada em (III), tem como função principal regular as trocas gasosas e, consequentemente, a transpiração do vegetal. O tecido indicado em (IV) é um parênquima paliçádico típico. Assim, as respostas corretas são: a) cutícula, b) água, c) regular trocas gasosas, e d) parênquima paliçádico.

04. O gráfico abaixo representa quatro fases aproximadas (I, II, III e IV) da evolução de um quadro típico de Síndrome de Imunodeficiência Adquirida (AIDS).

I

II

III

IV

0

1

2

3

4

5 6 Anos

7

8

9

10

Concentração de HIV Contagem de linfócitos T4

Analise o gráfico e faça o que se pede: a) Cite a fase que corresponde à eliminação da maioria dos vírus pelo sistema imune. b) Cite a condição que caracteriza a imunossupressão observada nas fases III e IV. c) Cite a manifestação geral que acomete a saúde de um indivíduo durante as fases III e IV. d) Cite o nome do órgão no qual os linfócitos T4 se diferenciam. e) Que tipo de proteína específica encontrada no organismo define o indivíduo como soro-positivo?

100 CONTEÚDO:

PROCESSO SELETIVO/2004 − UFV

CARACTERÍSTICAS GERAIS DAS CÉLULAS – Diversidade celular. CARACTERÍSTICAS GERAIS DOS TECIDOS – Estrutura e função dos diversos tecidos animais. SAÚDE E SANEAMENTO – Principais doenças infecto-contagiosas do Brasil. Aspectos biológicos. RESOLUÇÃO: a) Esta questão pode ser respondida apenas com a interpretação do gráfico. Note que a maioria dos vírus foi eliminada na fase I. Mesmo que se considere que houve eliminação de vírus na fase II, isto não configuraria a eliminação da maioria, como se observa na fase I. b) A única condição que caracteriza a imunossupressão que pode ser percebida a partir da análise do gráfico é o quase desaparecimento dos linfócitos T4. c) Em se pensando nas conseqüências advindas da drástica diminuição da contagem dos linfócitos T4, o que se espera é a ocorrência de diversas doenças oportunistas. É exatamente a ocorrência dessas doenças que caracteriza a Síndrome da Imunodeficiência Adquirida. d) Os linfócitos T têm este nome devido ao fato de se diferenciarem num órgão cujo nome inicia-se com a letra T. Trata-se do Timo. A resposta, portanto, é Timo. e) Essa proteína específica é o anticorpo contra o vírus da AIDS. É óbvio que não se trata aqui apenas de um tipo de anticorpo, mas dos vários anticorpos contra os vários antígenos do vírus. Deve ser lembrado ainda que quando se diz que um indivíduo é soro-positivo, não se está dizendo que ele possui a AIDS.

PROCESSO SELETIVO/2004 − UFV

101

05. A tabela abaixo representa uma versão fictícia do código genético. Entretanto, esse código segue o padrão do código genético universal, no qual três bases codificam um aminoácido. Trinca de bases AAC AAU AGG AUA AUC AUG CAU CCU CGA CGC Aminoácido N O C O S iniciação O S W I Trinca de bases CUA GAA GCA GCC GCU GGC GGG UAA UAC UAU UCG Aminoácido R K T N T W S terminação A E A

Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. c) Qual a seqüência de aminoácidos que resultará da tradução da seguinte molécula de RNA mensageiro? 5’ 3’ AUAUGCGAUCGGCUAUCCAUGCCUAUAGGCUACGCAGGGAAUAACUAA d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA, após uma deleção do terceiro nucleotídeo? CONTEÚDO: CARACTERÍSTICAS GERAIS DA CÉLULA – Noções e bioquímica celular. RESOLUÇÃO: A questão avalia alguns conhecimentos básicos de bioquímica celular, principalmente, em relação aos processos de transcrição e tradução. A enzima que catalisa a síntese de mRNA é denominada RNA polimerase. O códon de iniciação é 5’AUG3’, logo, o anticódon correspondente é 5’CAU3’. A tradução da molécula de mRNA será:
AU AUG CGA UCG GCU AUC CAU GCC UAU AGG CUA CGC AGG GAA UAA CUAA inic W A T S O N E C R I C K term

Caso o terceiro nucleotídeo seja deletado, desaparecerá primeiro o códon de iniciação, e a tradução será:
AUUGCGAUCGGCUAUCC AUG CCU AUA GGC UAC GCA GGG AAU AAC UAA Inic S O W A T S O N term

Assim, as respostas corretas são: a) RNA polimerase, b) 5’CAU3’, c) WATSONECRICK, e d) SOWATSON.