P. 1
6101_01_que_20070110

6101_01_que_20070110

|Views: 68|Likes:
Published by X De Note

More info:

Published by: X De Note on Jan 02, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

01/02/2011

pdf

text

original

Surname

Centre
No.

Initial(s)

Paper Reference

6 1 0 1

Candidate
No.

0 1

Signature

Paper Reference(s)

6101/01

Examiner’s use only

Edexcel GCE

Team Leader’s use only

Biology
Biology (Human)
Advanced Subsidiary
Unit Test 1
Wednesday 10 January 2007 – Morning
Time: 1 hour

Question Leave
Number Blank

1
2
3
4
5
6

Materials required for examination
Ruler

Items included with question papers
Nil

7
8

Instructions to Candidates
In the boxes above, write your centre number, candidate number, your surname, initial(s) and
signature. The paper reference is shown above. Check that you have the booklet for the correct unit.
Answer ALL EIGHT questions in the spaces provided in this booklet.
Show all the steps in any calculations and state the units. Calculators may be used.
Include diagrams in your answers where these are helpful.

Information for Candidates
The marks for individual questions and the parts of questions are shown in round brackets: e.g. (2).
The total mark for this question paper is 60.

Advice to Candidates
You will be assessed on your ability to organise and present information, ideas, descriptions and
arguments clearly and logically, taking account of your use of grammar, punctuation and spelling.

Total
This publication may be reproduced only in accordance with
Edexcel Limited copyright policy.
©2007 Edexcel Limited.
Printer’s Log. No.

N24718A
W850/R6101/57570 7/7/7/7/15,100

Turn over

*N24718A0120*

Leave
blank

Answer ALL questions in the spaces provided.
1.

The table below refers to the processes of natural and artificial cloning. If the statement
is correct, place a tick (9) in the appropriate box and if the statement is incorrect, place a
cross (8) in the appropriate box.

Statement

Natural
cloning

Artificial
cloning

Involves mitosis
Occurs in both plants and animals
Produces offspring that are genetically identical
Produces offspring by sexual reproduction

Q1
(Total 4 marks)

2.

Read through the following passage about water, then write on the dotted lines the most
appropriate word or words to complete the passage.
A water molecule consists of two hydrogen atoms and one oxygen atom held
together by ........................................ bonds. There is an unequal distribution of charge
over the molecule. This is called a ........................................ and results in water being a
good ........................................ for many substances such as sodium ions.
Bonds called ........................................ bonds form between water molecules. As a result
water has a high ................................................................ meaning that a lot of
Q2

energy is needed to cause a small rise in temperature.
(Total 5 marks)

2

*N24718A0220*

Leave blank BLANK PAGE *N24718A0320* 3 Turn over .

.................. (2) 4 *N24718A0420* ................. ..........................................................................................................................Leave blank 3.......... X { A C C Y A G U (i) Name the type of bond labelled Y......................................................... ................................... (1) (iii) Explain the meaning of the term anticodon................................................................... .......................................................................................................................................................................................................................... ................... ...................... (a) The diagram below represents a transfer RNA (tRNA) molecule............................................................................................................................................................. ........................................................................ ........................................................................................................................................................................... ........................................ (1) (ii) Name the molecule that is attached to position X during protein synthesis.....

.................................................................................................................................................................................................................................................................................................................................................... ........................................ ................................................................................................................................................ ............................................................................................................... ................................................................................................................................................................................................................................................................................................................................................ 1 ......................................................................................Leave blank (b) State two ways in which the structure of a tRNA molecule differs from the structure of a messenger RNA (mRNA) molecule.............................................................................................................. ............. ............ .................................................................... 2 ...... (2) Q3 (Total 6 marks) *N24718A0520* 5 Turn over ........................................................................... .......

Complete the table below by writing the name of the structure in the box next to its description. involved in spindle organisation. concerned with the modification of proteins. Small spherical structures surrounded by a single membrane. Organelle consisting of stacks of cisternae and vesicles. Q4 (Total 4 marks) 6 *N24718A0620* .Leave blank 4. The table below describes some structures found in eukaryotic cells. containing hydrolytic enzymes. Description Name of structure Cylindrical organelle made up of microtubules. Site where ribosomal RNA is made and the subunits of the ribosomes are assembled.

Leave blank BLANK PAGE *N24718A0720* 7 Turn over .

........................ (a) DNA in eukaryotic organisms is a double helix.................... Bases on one strand bond to bases on the second strand to form base pairs............................. During protein synthesis......................Leave blank 5........................ the non-coding strand of this DNA ....................................... The second strand is known as the non-coding strand................. 2.................. (1) (ii) Give the sequence of the first five bases that would be present in each of the following: 1.................. (2) 8 *N24718A0820* ....................... The base sequence of a small section of the coding strand of a DNA molecule is shown below........................... AGACTTGCAACTTGACATGTA (i) How many codons are shown in this sequence? ..................................... the mRNA molecule transcribed from this DNA strand ....................................................................... one strand of DNA (the coding strand) acts as a template to make mRNA...........

................... (5) Q5 (Total 8 marks) *N24718A0920* 9 Turn over ................................................................................................................................................................. ........................................................... ................................................................................... Calculate the percentage of cytosine in this sample.................................................... ........................................................................ The percentage of adenine was found to be 29............................................................................................................................................... Explanation: ............................................................................................................................................................Leave blank (b) A sample of DNA from a locust was analysed to determine the percentage of each base present................................................................................................................................................................................................................................................................................................................................................................................................................................................ Percentage of cytosine = ......4%................ Show your working and give an explanation for your answer......................... ............. ........................ ................................... .......... ...................................................................................................................... ................................................................... ............................................................................................................................................ ........................................................................................... .................................................................................................................

.............. on the yield of apple juice.......... (3) (b) An experiment was carried out to determine the effect of two enzymes........... ..................................................................................................................... 10 *N24718A01020* ................................ enzyme B and water............................................... An apple was cut into small pieces and blended in a food processor to produce apple pulp.............. Each sample was then placed in a separate filter funnel and the apple juice collected into a measuring cylinder.......................................................................................................................................................................................................................................................................................... Both enzyme solutions were at the same concentration.............................................................. ....... .................................. ............................................. ................................... ... enzyme A and enzyme B................. Sample number Mixture 1 Apple pulp + 5 cm3 enzyme A + 5 cm3 water 2 Apple pulp + 5 cm3 enzyme B + 5 cm3 water 3 Apple pulp + 5 cm3 enzyme A + 5 cm3 enzyme B 4 Apple pulp + 10 cm3 water The samples were incubated at 30 °C for 15 minutes..............................................Leave blank 6...................... as detailed in the table below....................................................................................................... ..... ............. (a) Describe the structure of a plant cell wall......................................................... Four samples of apple pulp of equal mass were mixed with various combinations of enzyme A....... ................................................................................................................................... ............... The volumes of the apple juice collected from each sample are shown in the bar chart opposite...........................................................................................................................................................................................................................................

.............................. *N24718A01120* 11 Turn over ..... .................. (2) QUESTION 6 CONTINUES OVERLEAF.................................................................................................. ............... ......................................................................................................................................................... 2 and 3........ ............................................................................................................................................................................................................. ......................................................................................................................................................... ....................................................................Leave blank 40 ± 3mc / detcelloc 30 ± eciuj elppa fo emuloV 20 ± 10 ± 0± 1 2 3 Sample number 4 (i) Suggest why the apple pulp incubated with water only (sample 4) yielded some apple juice.. (1) (ii) Describe the effect that enzymes A and B have on the yield of apple juice in samples 1................................. ................................................................................................................................................................................................................. ................................

................................................................ ......................................................... ............................................................................... ............................................................................................................................................................................................................................ ............................................................................. .......................... ............................................................................... .................................................Leave blank (iii) Suggest how these enzymes increase the yield of apple juice............................. ...................... ............................................................................ .......................................... ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... ................................................................................. (4) (Total 10 marks) 12 *N24718A01220* Q6 .......................................................................................................................................

Leave blank BLANK PAGE *N24718A01320* 13 Turn over .

0 ± 0. An experiment was carried out to test the effect of different temperatures on beetroot cell membranes. If the membrane is damaged. (a) Beetroot cells contain a red water-soluble pigment in their vacuoles.4 ± red coloration /arbitrary 1. Eight equal-sized discs of beetroot were cut and carefully rinsed in distilled water.8 ± x x x 1.Leave blank 7. After this time.0 ± 1.2 ± units 1.6 ± 0.4 ± 20 30 40 60 70 80 Temperature / 8C 14 *N24718A01420* 90 ± ± ± ± ± 50 ± x x x ± ± 0± x x ± 0. the intensity of red coloration of the liquid in the test tube was measured using a colorimeter. The results of the investigation are shown in the graph below.6 ± Intensity of 1. One disc was transferred to a test tube containing 10 cm3 of distilled water maintained at a temperature of 25 °C and left for 30 minutes. red pigment will leak out of the cell. Each of the other seven discs was treated in a similar way but maintained at a different temperature.8 ± 0. This pigment cannot pass through membranes. 2.2 ± 100 .

............................................................................ ............ (3) (ii) Suggest an explanation for these results....... ....... . (3) QUESTION 7 CONTINUES OVERLEAF......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... ..... ......................................................................................................................................................................................................... .......................................................... ...........................................Leave blank (i) Describe the effect of increasing temperature on the intensity of the red coloration of the solution.................. ............................................ .................................................................................................................................................................................................................................................................................................................................. ................................................ ............................................................................................... ........................................................................................................................................ ........................................................................................................................................................... .......................................... .................................................... .............................................. *N24718A01520* 15 Turn over ....... ................................................................................................................................................................................................ ....... ........................................................................................................................................................................ .............................................................

........................................... ............................................................................................................... ................................................................................................ .................................................................... ............................................................................................................................................Leave blank (b) Some substances pass through membranes by active transport................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... ............................................................................................. ........ (5) (Total 11 marks) 16 *N24718A01620* Q7 ................. ..................................................................................................................................................................................... ............................................................................................................... . .......................................... .................................................. .. Describe the process of active transport.......................................................................................................................... ...................................................................................................................................................................................................................... ...............................................................................................................................

........ Amylase is an enzyme that catalyses the breakdown of starch into maltose................................. . Immediately............................... ................................................................................................................................................................................................................................................................................. ......................................................................................................................... An experiment was carried out to investigate the effect on amylase by keeping it at a high temperature before it was used....... ............................................................................................................................................. .... A 1% solution of amylase was prepared and placed in a waterbath at 60 °C................................................................................................ ....................... These samples were also placed in the 20 °C waterbath......... *N24718A01720* 17 Turn over ................................................. ................................... 2 cm3 of this amylase solution was put into a test tube and placed in another waterbath set at 20 °C.................. The activity of each amylase sample was then determined....................................................... ............................................................................................ ................................................................................................................................................................................................................. (a) Describe how the test for starch can be used to compare the activity of these amylase samples...... (3) QUESTION 8 CONTINUES OVERLEAF.................................................................................................. Five more 2 cm3 samples of amylase were removed at 1 minute intervals from the amylase solution kept at 60 °C......................................Leave blank 8...... .........

.............................................................0 Describe the effect of increasing the length of the incubation time at 60 °C on the activity of amylase..................................................................................................................5 1 4................................ .................................................... . ....... (3) 18 *N24718A01820* .........................................................................................................................................................................2 4 0...................................................................................................................................................... ............................... .............. ........3 3 0........................................................................................... .....................................................................................................9 2 2................................................................1 5 0................................ ......................... Length of time that amylase was in the 60 °C waterbath / mins (Incubation time) Activity of amylase / arbitrary units 0 12......Leave blank (b) The results of this experiment are shown in the table below........................................................................ ................................................................................................................................................................................................ .........................................................................................................................................

............................................................ ......................................... (3) Q8 (Total 12 marks) TOTAL FOR PAPER: 60 MARKS END *N24718A01920* 19 .......................... .......................Leave blank (c) (i) Enzymes are proteins................................. .................................................................. ........................................................................................................................................................................................................................................................................................................................................................................... Describe the tertiary structure of an enzyme...... ...................................................................................................................................... ................................................................... ..................................................................................................................................................................................................................... ........................................................................................................ ................................................................................................. ...................................................................................... .......................................................................................................................... ............................................................................... ........................................................................................................................................................................................................................................................................... . ............................................. ................................................................................................................. ................................................................................................................ (3) (ii) Suggest an explanation for the change in amylase activity with increased incubation time at 60 °C........................................................ ............................................................................................................................................................. ................................................................................................................................................................................................................. ....................................................................................

BLANK PAGE 20 *N24718A02020* .

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->