P. 1
DNA'da SSR (Basit Dizilim Tekrarları) Analizi Yöntemiyle Balarısı (Apis mellifera) Populasyonlarının Genetik Yapısının Araştırılması

DNA'da SSR (Basit Dizilim Tekrarları) Analizi Yöntemiyle Balarısı (Apis mellifera) Populasyonlarının Genetik Yapısının Araştırılması

|Views: 280|Likes:
Published by arimbalimpetegim
MERAL Kence, Mahinur AKKAYA, Aykut KENCE, Çağrı BODUR, Necva HADİMOĞULLARI
MERAL Kence, Mahinur AKKAYA, Aykut KENCE, Çağrı BODUR, Necva HADİMOĞULLARI

More info:

Published by: arimbalimpetegim on Feb 26, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

02/26/2011

pdf

text

original

TÜBITAK

.. .
TURKIYE BILIMSEL VE
İ Ş KURUMU
THE SCIENTIFIC AND TECHNICAL
RESEARCH COUNCIL OF TURKEY
Temel Bilimler ş ı Grubu
Basic Sciences Research Grant Committee
DNA'DA SSR İ İ İ İ TEKRARLARI)
İ İ İ ı ı
(Apis mellifera) POPULASYONLARININ İ
İ ı ı Ş
PROJE NO : TBAG-1934 (IOOTOS3)
Doç.Dr. MERAL KENCE
Prof. Dr. İ AKKAYA
Prof.Dr. AYKUT KENCE
ÇACRIBODUR
NECV A İ
İ 2003
ANKARA
(,
ÖNSÖZ
ı ı İ mellifera L.), gerek bal ve ğ ürünler, gerekse ş yolu ile bitkisel
üretimin ı ş ı ı bulunarak ülke ekonomisine büyük bir girdi ğ bir böcek
ı ş ı ülkemizde üzerinde pek fazla ş ı olmayan bir böcek türüdür. Bu
nedenle ı ı bu türün Türkiye' deki genetik ş ğ üzerine bir dizi
ş ı ı ı ş ı ve ı ı Türkiye ı ı morfometrik ve
elektroforetik ş ı biçimde daha önceki ı ş ı ı ş ve
Türkiye'nin ı ı için bir gen merkezi ğ yönündeki ş ğ ı ş ı
Sunulan ı ş ise ğ seçilimden etkilenmeyen, ı ı ile genetik ı ş ı
zamana ve mutasyon ı ı ğ ı olarak ğ gibi ı ve toplum ğ
ı ş ı ı ı son derece ş moleküler belirleyiciler olan mikrosatelitler
ı ş ı ı ş ı Mikrosatelitler mutasyon ı ı çok yüksek ve çok ğ ş genetik ı
Moleküler belirleyiciler ı ı ı ı sürekli olarak izlemek, gen
havuzunda olabilecek ğ ş belirlemek ve genetik ş ğ korumak mümkün
olabilecektir. ı ı ı ve ekotiplerine ait bir genetik ı ş acil bir
gereksinim olarak görünmektedir. Gezginci ı ı ğ ı Türkiye'nin zengin ı
ş ğ ı ğ ya da etkileyip ğ bu ş bir genetik
ı ı ı sonra ı görebiliriz. Bu ı ş ı ı ve
ekotiplerinin ı ve ana ı ş ğ ı ı son derece gereklidir.
Bu ı ş ı örnekleri toplamak için ı ı olan ı ı ğ ı
yetkililerine ve ı çok ş ederiz. ı ş İ TBAG-1934 (100T053)
no 'lu proje ve ı ğ Teknik Üniversitesi Bilimsel ş ı Projesi ı
ş
2
İ İ İ
ÖNSÖZ .............................................................................................................................................................. 2
İ İ İ ................................................................................................................................................. 3
ÖZ ...................................................................................................................................................................... 4
ABSTRACT ....................................................................................................................................................... 5
İ İ ş ................................................................................................................................................................. 6
1.1. BALARILARINDA İ Ş ........................................................................................ 6
1.2. BALARILARINDA İ Ş İ İ İ İ ................................................................................................... 8
1.3. BALARILARINDA İ İ DNA Ş ......................................................................... 8
1.4. BALARILARfNDA ı Ş ı NÜKLEER DNA İ İ İ ............................................................... 9
L.5. POPULASYON İ İ İ İ (SSR) LOKUSLARININ KULLANIMI ...................................... 9
1.6. BALARILARINDA İ İ İ İ .................................................................................... i O
1.7. ı Ş ı ı ............................................................................................................................... i 1
İ ş ........................................................................................................................................................ 12
2.1. GEREÇ ................................................................................................................................................... 12
2.2.YÖNTEM VE BULGULAR .......................................................................................................................... ı 3
2.2.1. DNA özütlemesi ............................................ ................................................................................ J 3
2.2.2. PZR ile mikrosatelit ğ ı ................ ................ '" ............................................................. J 4
2.2.3. ı belirleyici poliakrilamid jel elektroforezi ......................... '" ................................................. J 6
2.2.3.1. Cam ı temizlenmesi........................................................................ . .......................... 16
2.2.3.2. Poliakrilamidjelin ı ı ............................................................................................................ 16
2.2.4. Jelin dökülmesi .... ........................................................................................................................ J 6
2.2.5. Jelin yüklenmesi ve yürütülmesi .............. ................................................................................... J 7
2.2.6. Otoradyografi ........................................... .................................................................................... J 7
2.2.7. İ analizler ......... .................................................................................................... J 9
2.2.7.1. Ale! ı ve heterozigotluk düzeyleri .......................................................................................... 19
2.2.7.2. Hardy-Weinberg dengesinin ı ı ................................................................................................. 25
2.2.7.3. ğ ı ğ ı ı ........................................................................................................ 27
2.2.7.4. Populasyon ı ı analizleri ................................................................................................................... 29
2.2.7.4.1. F ı ı ile populasyon ş ı ş ı ı ve genetik ı incelemeleri ................................... 30
2.2.7.5. Fenogram ş ı ........................................................................................................................ 32
2.2.7.5.1. Genetik ı ı ....................................................................................................... 32
2.2.7.5.2. Fenogram çizimi ............................................................................................................................ 34
2.2.7.6. Köken belirleme ...................................................................................................... . .................. 34
SONUÇ ............................................................................................................................................................ 46
REFERANSLAR ............................................................................................................................................ 52
EK ı ................................................................................................................................................................. 57
ÖRc"iEK TOPLANAN yERLER .......................................................................................................................... 57
EK 2 ................................................................................................................................................................. 58
Kl1llA:\llAl\ İ İ İ İ ............................................................................................................ 58
öz
Bu ı ş Türkiye'deki ı ı ı ı ğ ı ş ğ
mikrosatelitler ı incelenmesi ı ş ı ş ı alttüre ait ı (Apis
mellifera L) örnekleri ğ Anadolu (Artvin-A.m.caucasica), ğ Anadolu
(Hatay-A.m.syriaca), ğ Anadolu (Hakkari-A.m.meda), orta Anadolu ş
A.m.anatoliaca) ve Türkiye'nin Avrupa ı ı ı ş
mikrosatelit lokusu yönünden ş ı ı ı ş ı ı ş ı 4 Anadolu populasyonunda, ı
mikrosatelitler ı A soy ı (0.234-0.400) ve C soy ı (0.410-0.564) için
bulunan ortalama heterozigotluk düzeylerinden daha yüksek olan 0.641-0.739 ı ğ ş
ortalama heterozitluk ğ ş Bulunan FS
T
ğ Türkiye'deki ı
ı ı ş ı ı ğ ortaya ş Hatay
populasyonu ğ tüm populasyonlardan ı ş (P<0.05). Bu yüzden Hatay
populasyonunun O soy ı ait ğ ş Türkiye' nin Avrupa ı
ı populasyonu bütün Anadolu ı ı ş (P<O.OS) ve C
soy ı ile benzer alelsel içerik ve heterozigotluk düzeyi ş Ortalama alel
ı ı ı (Lokus ş ı 14.6) M (Lokus ş ı 6.4), C (Lokus ş ı 9) ve A soy
ı ı (Lokus ş ı 13.4) yüksek ı ve nadir görülen alellerin ı ğ ı
Anadolu'nun Ruttner'in ğ gibi (1988) ı ğ ı ı için bir
gen merkezi ğ desteklemektedir.
Mikrosatelitler ana an üretimi kalite kontrolünde ğ ş ı ve ekotiplerin ı ı ve
ı ş ı ı ı ümit verici görünmektedir.
Anahtar kelimeler: Mikrosatelit, ı ı İ mellifera, Türkiye, Anadolu, C soy ı O
soy ı
4
ABSTRACT
Genetic variation in honeybee populations of Turkey were aimed to be analysed using
microsatellites, in this study. Five honeybee (Apis mellifera L) populations belonging to
five different subspecies sampled from northeastem Anatolia (Artvin-A.m.caucasica),
southeastem Anatolia (Hatay-A.m.syriaca), eastem Anatolia (Hakkari-A.m.meda), central
Anatolia ş and European part of Turkey ı
were studied using 5 microsatellite loci. A high level of average heterozygosity changing
between 0.641 and 0.739 is detected in four Anatolian populations which is higher than the
average heterozygosity levels reported for populations of A (0.234-0.400) and C lineages
(0.410-0.564) for the same microsatellite loci. Differentiation among the populations in
Turkey was found to be highly significant as measured by F ST values. Hatay population
was significantly (P<0.05) different from the rest of the populations. Therefore Hatay
population can be considered belonging to O lineage. ı population which is located
in the European part of Turkey, is found to be significantly (P<0.05) different from all
Anatolian populations and showing similar allelic composition and heterozygosity levels
with C lineage. Higher value of average alele number (14.6 per locus) than the average
allele number found in M (6.4 per locus), C (9 per locus), and A lineages (13.4 per locus)
and presence of rare alleles support the idea that Anatolia is a genetic center for honeybee
populations ofNear East as suggested by Ruttner (1988).
Microsatellites seem to be promising in discriminating and identifying different races and
ecotypes in quality control ofhoneybees in queen bee rearing.
Keyv/ords: Microsatellite, honeybee, Apis mellifera, Turkey, Anatolia, C lineage, O lineage
5
İ İ ş
1.1. ı morfometrik ı ş
Morfometrik incelemeler ı ı ı ş belirleme ı ş ı
uzun ı boyunca tek yöntem olarak ı ı ş ı Günümüzde dünyada bilimselolarak
ş 26 ı ı alttürü (Tablo 1) ı (Ruttner 1988, 1992; Sheppard ve
ark. 1997).
Ruttner morfometrik karakterlerin çok ğ ş istatistiksel analizlerine dayanarak
Anadolu ı ı Apis mellifera anatoliaca'111n A. ı ğ gen merkezi olarak
ş ğ öne ş ğ ve Kence (1992) ve Kandemir ve ark.
(2000) Oryantal (O) soy ı için potansiyel gen merkezi olan Anadolu ı
morfometrik incelemeler ı ş ı Gezginci ı ı ı hareketlerine ğ Türkiye'deki
ı ı yüksek düzeyde morfometrik ve genetik ş ı ş Trakya ve
ğ Anadolu örnekleri ğ ğ ı ı Karadeniz ve ğ Anadolu
örnekleri, ı Anadolu, Ege ve Akdeniz örnekleri ise beraberce ş ı ş ı
(Kandemir ve ark. 2000).
Morfometrik karakterlerin ı ı (Apis mellifera L) alttürleri için oldukça güçlü ı ı
ı ı ı ı ı ğ DNA düzeyindeki ğ ş için ğ gösterge
ı ı ve birden çok genle belirlenebildikleri için populasyon ğ ı ş ı
ı ı ı ı ğ ı
6
ı ğ alttürleri
Apis mellifera anatoliaca Maa (1953)
A. m. İ Ruttner ( 1975)
A.m. cypria ı (1879)
A. 111. jyriaca Buttel-Reepen (1906)
A. m. meda Skorikov ( 1929)
A. 111. caucasica Gorbachev (1916)
A. JI1. armeniaca Skorikov (1929)
Tropik Afrika alttürleri
Apis mellifera lamarckii Cockerell (1906)
A. 111. yemenirica Ruttner (1975)
A. 111. litorea Smith ( 1961)
A 111. scutellata Lepeletier (1836)
A.111. adansonU Latreille (1804)
A. m. monticola Smith (1961)
A. 111. capensis Escholtz (1821)
A. m. unicolor Latreille (1804)
ı Akdeniz ı ve Kuzey Avrupa ve Kuzey Afrika) alttürleri
Apis mellifera sahariensis Baldensperger (1924)
A. m. intermissa Buttel-Reepen (1906)
A. m. iberica Goetze (1964)
A. 111. mellifera Linnaeus (1758)
A. m. major Ruttner (1978)
Orta Akdeniz ve ğ Avrupa alttürleri
Apis l11ellifera sicula Montagano (1911)
A. 111. ligustica Spinola (1806)
A. m. cecropia Kiesenwetter (1860)
A. m. macedonica Ruttner (1987)
A. 111. camica ı ı (1879)
A. 111. m/neri i Sheppard ve ark. (1997)
Tablo 1: ğ ğ ı ı ı göre ı alttürleri ( Ruttner 1992 ; Sheppard ve ark.
1997)
7
1.2. Balanlannda aIlozim ş ğ
Allozim ş ğ birçok bitki ve hayyan !Üründeki ı genetik ı ı ı ve gen
ı ş ı ı incelemede oldukça ı ş (Ör., Berlocher 1984; Richardson ve ark. 1986,
Roderick 1996). Bununla birlikte allozim incelemesinin ı ı populasyon ğ
ı ş ı ı ı ş düzeydeki ş nedeniyle çok ı (Pamilo ve ark. 1978;
Sheppard 1986; Packer ve Owen 1992). Bu ş ş ğ nedeninin ı
haplo-diploidlik ğ ş (Pamilo ve ark. 1978). Birkaç enzim lokusunun
polimorfik ğ belirlenmesine ğ ı ı alttürleri ı çok ı alel
ı ı ı ğ ı ı ş ı ı ı soy ı ı ı ı alel ı
ı ı ı ş ve bu lokuslar dünya ı ı ş ı ı ş ı (Cornuet 1982;
Nunamaker ve ark. 1984; Sheppard ve Berlocher 1984; Asal ve ark. 1995; Kandemir ve
Kence 1995). ğ MDH 65 aleli Trakya populasyonlannda yüksek frekanslar
segilerken Anadolu ı MDH 65 alelinin ı çok ş Hekzokinaz
enziminde ise HK120 aleli güney ve ğ Anadolu'da yüksek frekansa sahipken
Trakya ı bu alelin ı ı ı ı (Kandemir ve ark. 2000)
Türkiye' deki ı ı allozim ş ğ ı ş ı (Kandemir ve Kence ı 995;
Kandemir ve ark. 2000) A.mellifera populasyonlanndaki dünyada ş kadar bulunan
en yüksek örtalama heterozigotluk olan 0.072 ± O • O O 7 ğ elde ş Yirmi üç
ı kolonisi için ı ğ ortalama heterozigot1uk 0.038'dir (Sheppard
1986).
1.3. ı Mitokondriyel DNA ı ş ı
A.111ell{fera filogenisini anlamak için son ı ı ş ı ı ş olan mitokondriyel DNA
ş ğ alttür düzeyi ı ş için ı ğ ş ilk mitokondriyel
DNA ı ş ı üç evrimsel soy ı A, C ve M'nin ı ğ ı ğ ı ş ı (Smith
1991; Garnery ve ark. 1992). Dördüncü soy ı O'nun ı ğ ı üç sene önce bir
mitokondriyel DNA RFLP ı ş ı ile ğ ı ş ı (Franck ve ark. 2000). Balanlannda
soy ı içi mitokondriyel DNA ş ğ birçok ş ı ı ı ş
(Smith ve ark. 1989,1991; Garnery ve ark. 1993, 1995; Franck ve ark. 1998). Türkiye'deki
balanlannda mtDNA ı ş ı ı ı çok ı (Smith et aL. 1997, Kandemir 1999).
Kandemir Türkiye balanlannda ş düzeyde bir ş ş (Kandemir 1999).
8
ı ı mitokondriyel DNA populasyon ğ ı ı
ğ ı ı alttürleri ı genetik ş ğ belirlemede yeterli ı ı ş ı
(Ari as ve Sheppard 1996, Franck ve ark. 2001).
1.4. Balanlannda ı ş ı nükleer DNA belirleyicileri
Nükleer RFLP, RAPD, AFLP ve VNTR gibi nükleer belirleyiciler ı ı populasyon
ğ ı ş ı ı ı ş ğ DNA belirleyicilerdir (Ör., Hall 1990; Suazo ve
ark. 1998; Suazo ve Hall 1999). Birçok polimorfik lokusu ı ğ pratik olmayan
transfer hibridizasyonu ve ı ş ı ı DNA ı (probe) ı ı
nedeniyle nükleer RFLP metodu büyük ı populasyon ğ ı ş ı fazla
tercih edilmemektedir (Sheppard ve Smith 2000). RAPD yöntemi dominant bir belirleyici
ı ve ğ ş laboratuarlarda tekrar edilmesinin ğ gibi dezavantajlara sahiptir.
Dominant belirleyicilere sahip ı ğ ğ tür ı düzeydeki
yüksek polimorfizmi, ekonomik ı ve ı ı nedeniyle AFLP yöntemi gelecekteki
populasyon ğ ı ş ı için ümit vericidir ( Vos ve ark. 1995, Sheppard ve Smith
2000). VNTR metodu iki tip moleküler belirleyici; mikrosatelitler ve minisatelitler için
geçerlidir. Minisatelit ı 30-60 baz çifti ğ mikrosatelitler gibi ökaryot
ı ğ ı ı halde bulunan Mendel ı ı ı tabi genetik ı
1.5. Populasyon ğ mikrosatelit (SSR) ı ı ı ı
Mikrosatelitler ökaryot ve ı ı ı miktarda prokaryot ı ı araya girerek bölen tekrar
eden DNA baz dizileridir (Estoup ve ark. 1993). Bir ile ı baz ı ğ ş 100 kereye
kadar tekrar edebilen motiflere ı ş ı (Tautz 1993). Ökaryot ı kodlayan
ve kodlamayan bölgelerde bulunabilmektedirler (Braaten ve ark. 1988). Bu çok ğ ş
tekrar bölgelerini ilk gösteren Savatier ve ş ı ş (Savatier ve ark. 1985).
Mikrosatelit ı genom incelemesinde ı ı konusunda ise ı 989'da
ı üç makale öncülük ş ( Litt ve Luty 1989; Tautz 1989; Weber ve May
1989). ş DNA bölgeleri için tasarlanan primerler ı ı PZR
ğ ı ı ile elde edilen mikrosatelit ı poliaakrilamid jel elektroforezi
9
yöntemiyle büyüklük ı ı ı ı Tekrar ı ı ş polimorfizmin
temelidir.
MikTosatelitler için iki ana mutasyon ı ş ı kayma (replication slippage)
ve ş olmayan ş ı ı ı ğ ş (unequal crossing-over). ş kayma yeni
sentezlenen DNA zincirinin ğ zincirden ı ı tekrar ş ı ı ı ı ğ ı
tekTar bölgeleri yüzünden ı ş yerden tekrar ş Bu hata ı DNA
ş yeniden ş ı ğ ı daha ı veya daha uzun bir zincir ş DNA
ı hata ı ğ bu tip kayma ı hatalar konusunda ı ş baz
ş ş göre çok daha ı ı ı ğ ş (Strand ve ark. 1993; Monison ve
ark. 1993). ş olmayan ş ı ı ı ğ ş genellikle tekrar eden ı içeren DNA
moleküllerinde görülen bir ğ mikrosatelit mutasyon ı ı Bu kromozomlar
ı bir ş ş ı ı ı gelirler ve ş ı ı ı ğ ş bir tanesinde silimne (deletion)
ğ ise ı (insertion) tipi mutasyona neden olur.
MikTosatelitler ğ ı incelemesi (linkage analysis), kimlik ı genetik
haritalama ve populasyon ğ ı ş ı oldukça güçlü belirleyiciler olarak kabul
edilmektedirler (Estoup ve ark. 1993). Bu ı benzeri olmayan ş yüksek
mutasyon ı ı sahip ı (10-
4
) ş (Henderson ve Petes 1992). Alel
ı ı ı ğ ş ı ı genomdaki ı ı minisatelitlere oranla daha kolay
belirlem11eleri gibi nedenlerle mikrosatelitler tür ı populasyon ı ı ı ş ı çok
güçlü belirleyiciler olarak ş (Bowcock ve ark. 1994; Estoup ve ark.
1995).
1.6. ı ı İ İ İ
Estoup ve ş ı (1993) ı ı ı genom kütüphanelerinden ı ı 15
ve 34 kilobaz olan 52 (CT)n ve 23 (GT)n mikrosateliti ş Estoup ve
ş ı (1995) morfometrik analizler ve mitokondri DNA analizleri ile öne sürülen üç
ı ı soy ı ı (A, M and c) mikrosatelitler ile ğ ı ğ ğ ı ı ve bu
moleküler belirleyicinin alttür ve ı ı ş ı ı ı ı ı ş ı
ı ş ı herbir lokus için ale! ı ı 7 ile 30 ı ş Ortalama
heterozigotluk ise ğ ş dünya ı 0.291 ile 0.872 ı
LO
ş Üç evrimsel soy ı ı ı ğ ı ı mikrosatelitlerle de ş ve
bu moleküler belirleyiciler alttür ve populasyon düzeyindeki genetik ı ş için uygun
ı ş (Estoup ve ark. 1995).
Türkiye balanlannda ş tek mikrosatelit analizinde tek bir lokus ş
ve Türkiye'nin ş ayn yöresinden ı örneklerde toplam 3 mikrosatelit aleli
ş (Kandemir 1999). Bu ı ş ı örneklerinin ğ
ı ı ğ ı Hatay örneklerinin de kalan Van, Kastamonu ve ı örneklerinden ı
ğ ş
1.7. ı ş ı ı
ı ı
Türkiye balanlanndaki mikrosatelit ş düzeyini belirlemek
Mikrosatelitlerin dört bilinen Anadolu alttürü ve bir Avrupa alttürünü (Trakya yöresi)
ı ğ ı
Anadolu'nun ı ğ balanlan için bir gen merkezi ğ ve ı ı ı
dünyadaki evriminde çok önemli ı ğ ı ş ı ı
Bu ı ş örnekler ş ı ı ı alttürü ı ı ı ğ ı öne sürülen (Kandemir ve
ark. 2000) yörelerden, bu ş alttürün ı ğ ı ı ı ı ı ş ı Bu
ı ş ı ı ş ı ğ ı Anadolu'nun O soy ı ı evrimi ı ı önemi eklenecek yeni
mikrosatelit verileri ile desteklencbilecektir.
11
İ ş
ı ı ı ğ özellikle Hazar Denizi'nin güney ı ı ı ş ve
evrimleri ı ı onlarca alttürün ş yol ı ş (Ruttner ı 988).
Ruttner ı ğ ı morfometrik incelemeler sonucunda ı ş merkezine çok
ı olan Türkiye'nin Orta ğ balanlan için gen merkezi ğ öne ş
(Ruttner ı 988). Kendisi ı ı ğ ve Taksonomisi" ı ı
morfometrik karakterlerin çok ğ ş analizi ı balanlan (Apis mellifera L.)
için dört ana soy ı ve 24 alttür önermektedir. Ruttner'e göre dört ana soy ı Oryantal
(O) soy ı ğ A soyu (Tropik Afrika), ı Akdeniz M soyu (Kuzey Afrika, ı
ve kuzey Avrupa) ve C soyudur (Orta Akdeniz ve ğ Avrupa). Daha sonra
Türkiye'de elektroforetik lokuslar ı ı ı ş Türkiye'deki
ı ş ğ oldukça yüksek ğ ş (Kandemir ve ark. 2000).
Ş kadar ş olan 26 ı alttüründen 5 tanesinin Türkiye ı ı içinde
içiçe ğ öngörülmektedir: Bu ş alttür Trakya'da Apis mellifera carnica, Anadolu'da
A. mellifera anataliaca, ğ Anadolu'da A.m. caucasica, ğ Anadolu'da A.111.
meda ve ğ Anadolu'da A. mellifera ı
Bu ı ş ı ı Türkiye' deki populasyonlannda gözlenen genetik ı ş
mikrosatelitler ı ş ı ortaya ı
2.1. Gereç
Populasyon ı ş ı örnekleme büyük önem ş ı ı Rasgele ı
örneklemenin incelenen ğ populasyondaki ş ğ yüksek oranda ı ı
ı Bir ı kolonisindeki tüm ş anlar bir tek ana andan türedikleri için
bir lokasyondaki örneklemenin sadece birkaç koloniden ı gerçek bir ş ğ
ı Bunun yerine o lokasyondaki yüksek ı ğ ş koloninin her
birinden birkaç tane ı örneklemek daha yerindedir.
12
Bu ı ş ş ı yöreye ait toplam 14 lokasyondan ı belirtilen esaslara göre
ş ş ı ı örnekleri ı ı ş ı Yörelerin isimleri, lokasyonlar, kovanlar
ve her birinden toplanan ı ı ı ı Ek 1 'de ş Örnekler DNA özütlemesi
ş ı kadar saf etil alkolde ş ı
2.2.yöntem ve bulgular
2.2.1. DNA özütlemesi
ı ı örnekleri alkolden ı ı ı soma kafa bölümleri ı ı ş ve bu kafalar 1.5
ml'lik santrifüj tüplerinde ı ı nitrojene ı ı ı steril ezicilerle ezilip ğ ş Bu
tüplere daha sonra 750 Wilson tampon solüsyonu (Ek 2) ve 25 10 mg/ml'lik Proteinaz
K solüsyonu ş Bu tüpler ı ş ı ı ı sonra 2 saat 50 °C'lik su banyosunda
ş ı Onbin rpm' de 10 ı bir santrifüj ş ı soma üst ı ı
kalan çözeltiler yem steril tüplere ı ı ş ve herbir tüpe 750
fenol:kloroform:izoamilalkol (25:24: 1 hacmen) ı ş ı ı eklenip tüpler 5 dakika ş
hareketlerle ş ş ğ ı çevrilip ğ ş ı Daha sonra bu tüpler 10000 rpm' de 20
dakika santrifüj ş ve herbir tüpün üst ı ı 600 lik sulu çözelti yeni bir tüpe
ı ı ş ve ı bahsedilen ş ilkinde 600 fenol:klorofonn:izoamilalkol
(25:24: 1 hacmen) ı ş ı ı eklenerek ikincisinde de ı 450 sulu üst ı 450
kloroform: izoamilalkol (24: 1 hacmen) ı ş ı ı eklenerek iki defa daha tekrar ş
Bundan sonra her bir tüpten 300 sulu üst ı ı ı ş ve yeni bir tüpe ş
Bu tüpe 3 M sodyum asetat ve 600 saf etil alkol eklenip birkaç dakika vorteks ile
ı ş ı ı ı soma -20 oC' de bir gece ş
Tüpler 13,000 rpm'de 30 dakika santrifüj ş ve çözeltinin üstte kalan ı ı ı ı ş ı
Kalan ı 900 % 70 etil alkol ş ve tüpler 13000 rpm' de 20 dakika santrifüj
ş Üstteki alkol ı ı ı ı sonra altta kalan çökelti 30 dakika kadar bir
vakumlu kurutucuda 30 dakika döndürülerek ş ş çökeltilere 50
steril su eklenip tüpler oda ı ı ğ ı 1 saat tutulduktan sonra DNA çözeltilerinin 230,
260 ve 280 ilin dalga ı ı ş ı emme kapasiteleri içlerindeki protein, DNA ve
R.NA ı ı belirlemek için ş DNA bulunan tüpler % 1 'lik agaroz jel
elektroforezine tabi ş \'e içlerindeki DNA ı ğ ı bant ş ğ ı ş ı
13
Spektrofotometrik ölçümlerde 260 l1ln'de ı ğ elde edilen ve agaroz jel
elektroforezinde genom ı veren DNA çözeltileri Ş 1) daha somaki ş
ı ı ş ı
Ş 1. Genomik DNA ı ı ve ı
gösteren %1 'lik agarozjel ğ ı
2.2.2. PZR ile mikrosatelit ğ ı ı
Bu ı ş daha önce Estoup ve ş ı ı ı ş ı ı ş olan A24, Al13, A 7,
A43 ve A28 kodlu ş Apis mellifera SSR (mikrosatelit) lokusli ı ı ş ı Bu
lokuslann tekrar bölgeleri ve primer baz ı ı Tablo 2 ve 3 'te ş
Lokus
A24
All3
A7
A43
A28
Tekrar ı ı
(CT)]]
ı TT(TC)5 TT(TC)g TT(TC)
(CT)3(T)7CCTTCG( ı
(CT) 13
(CCT)3GCT(CCT)6(CT)s TT(CT)4
Tablo 2. Mikrosatelit ı ı tekrar bölgeleri
14
Lokus İ primer Geri primer
A24 5'CACAAGTTCCAACAA TGC3' 5'CACA TTGAGGATGAGCG3'
A 113 5'CTCGAA TCGTGGCGTCC3' 5'CCTGT ATTTTGCAACCTCGC3
A 7 5'GTT AGTGCCCTCCTCTTGC3' 5'CCCTTCCTCTTTCATCTTCC3'
A43 5'CACCGAAACAAGATGCAAG3 5'CCGCTCATT AAGAT ATCCG3'
A28 5GAAGAGCGTTGGTTGCAGG3 5'GCCGTTCATGGTT ACCACG3'
Tablo 3. Mikrosatelit ğ ı ı için ı ileri ve geri primerler
ı ömeklerinin genom ı ı polimeraz zincir reaksiyonu ile ğ ı ı
Estoup ve ş ı ı (Estoup ve ark. ı 995) makalelerinde ğ gibi ı ı ş ı
ş ı ı ğ ı 50 ng genom ı herbir primerden 400 nM,
herbir 2'-deoksitimidin 5'-trifosfat (dTTP), 2'-deoksiguanidin 5'-trifosfat (dGTP) ve 2'-
deoksisitidin 5'-trifosfat (dCTP)'den 75 ı ı 7.5 ı ı 2'-deoksiadenozin 5'trifosfat (dATP),
0.25 ı ı a
33
P_dATP, 20 ı ı ı ğ ı serum albumini (BSA), (NH4)2S04 içeren Ix
reaksiyon tampon çözeltisi, 0.4 ünite Taq polimeraz ve ı -ı mM MgCh ş PZR 3
ı 94 °C'de denatürasyon ş ı ş ı 30 saniyelik 94 °C'de denatürasyon
süresi, 30 saniyelik optimum ı ı ş süresi ve 30 saniyelik 72 °C'de ı
süresini içeren 30 döngü ile ş Son ı süresi tüm polimerizasyonun eksiksiz
tamamlanabilmesi için ı O dakikaya ı ı ı ş ı Mikrosatelit ı için ı
DNA zincirlerinin ş ı ı ı ve MgCh ı Tablo 4'te ş
Lokus
A24
AIl3
A7
A43
A28
ş ı ı ğ ı (oC)
56
60
60
55
54
MgCh konsantrasyonu CM)
1.2
1.2
1.0
1.5
1.7
Tablo 4. Optimum ş ı ı ı ve magnezyum klorid ı
15
2.2.3. ı belirleyici poliakrilamid jel elektroforezi
ı belirleyici jel elektroforezi bir ya da birkaç baz ı olan alelleri belirlemek ı
ı ı ş ı
2.2.3. ı Cam ı temizlemnesi
Elektroforez ş ı 20x45 cm cam levhalar ı ı ş ı Cam ı bir yüzü
önce deiyonize su sonra da etil alkol ile dikkatlice silinip ş Bu ş
temizlemenin ı cam yüzeyde elektroforez ı ı DNA ı ı ş
engelleyecek herhangi bir ş ı ı ğ ı Daha sonra cam levhalardan
birinin iç yüzeyine jelin ı ı ı ş ı ı silikon içeren bir solüsyon
ı ş ı
2.2.3.2. Poliakrilamid jelin ı ı
Elektroforez ş ı % ı denatüre edici poliakrilamid jel ı ı ş ı Sekiz
molar üre içeren % ı akrilamid-bisakrilamid-üre ı ş ı ı (Ek 2) ı ı ı ş ı
geçirmeyecek ş 4 oC' de ı ş ı Jel ı ı 50 ml akrilamidlüre ı ş ı ı
650 ı ı %10 (v/v) amonyumpersülfat (APS) ve 30 ı ı N,N,N,N-tetramethylethylenediamine
(TEMED) eklenip ı ş ı ı ı ş ı
2.2.4. Jelin dökülmesi
Jelin İ ş ı bir jel ı ı ı mekanizma, bir tarak ve 0.4 mm ı ı ğ ı
plastik ı ı ı ı ş ı TEMED'in eklemnesinden hemen sonra jel ı ş ı ı jel
ı ı ı mekanizmaya ş olan cam levhalardan birinin üzerine ş
dökülmeye ş ı ş ı Bu ı ğ cam levha üzerine jel dökülen ı üzerindeki
plastik ı ı ı ı ı ı ı ş ı ş ı ı ş ı ğ ı
iki cam levha ı ş jelle ı Bu ş sonra cam ı
içerisindeki jel ş önce plastik tarak ı ı ş ve cam ı bir arada
ı ı tutmak ı metal ı ı ş ı ı ı ı ş ı
16
2.2.5. Jelin yüklenmesi ve yürütülmesi
ş ı ı PZR tüplerine 10'ar ı ı durdunna solüsyonu (Ek 2) eklendikten sonra bu
ı ş ı ı 2.5 ).ll, dikey bir ş elektroforez aletine (Owl 4S4) ş olan jeldeki
kuyucuklara bir ı ı ı ş USB Sequenase Version 2.0 DNA
Sequencing Kit ve u
33
P_dA ı kullamlarak ı bir ı belirleme reaksiyon
çözeltisinden mikrosatelit alelleri için bir büyüklük belirleyicisi olarak ı ş ı ı
belirleyici jel elektroforez aletinin alt ve üst tampon bölmelerine 1 x tris-borik asit-edta
(IBE) tampon solüsyonu ş ve elektroforez aleti 40 Watt elektrik ı ı 2.5-3 saat
ı ş ı ı ı ş ı
2.2.6. ı
ı sonunda iki cam levha birbirinden ı ı ş ve ı ş cam levhada kalan
jel kromatografi ğ ı ı (Whatman 3MM) üzerine ı ı ş ı Bir streç filmle kaplanan jel
vakumlu bir kurutucu ile 80 °C'de 20 dakika kurutulup özel bir otoradyografi film (Kodak
Biomax MR) ile birlikte ı ş ı geçirmeyen metal kasetlere konup 2-5 gün ı
ş Bu süre sonunda kasetler ı ı filmler banyo ş
Ş 2. A24 ale1lerinin ğ bir otoradyogram
17
Ş 3. A24 alellerinin ğ bir otoradyogram (Sondaki iki ş büyüklük belirleyici
DNA, ı ise ı baz çifti ğ göstermektedir).
Ş 4. A7 alellerini gösteren bir otoradyogram
Ş 5. A43 alellerini gösteren bir otoradyogram
18
Ş 6. A28 alellerini gösteren bir otoradyogram
2.2.7. İ analizler
Otoradyogramlarda ı büyüklükleri ı sonra alel ı
heterozigotluk düzeyleri, gen ı ı ikili F
ST
ğ populasyon ı ş ı Hardy
Weinberg dengesi, ğ ı ğ testleri, genetik ı ı ve fenogram
çizimleri ş populasyon ğ ı ı ı ı ş ş
2.2.7.1. Alel ı ve heterozigotluk düzeyleri
Ale! frekanslan her bir ı ı populasyonu için gözlenen belli bir mikrosatelit aleli
ı ı ı o populasyonda gözlenen toplam mikrosatelit aleli ı ı ı elde
ş Gözlenen ve beklenen heterozigotluk düzeyleri Arlequin ver. 2.00 ı ı ı ı
(Schneider ve ark. 2000) Hardy-Weinberg dengesi ı opsiyonu ı
ı ş ı Her bir populasyon için ortalama heterozigotluk (Nei 1978) ve her bir lokus
ve tümü için gen ı ş (Ht) Nei (1973)'e göre DISPAN ı ı ı (Ota 1993)
ı ı ş
Türkiye'nin 5 yöresinden toplam 142 ş ı ı ğ bu ı ş A24 lokusu
için 6, AI13 için 15, A 7 için 41, A43 için 9 ve A28 lokusu için 4 tane ı ale i
ş Ş 2, 3,4 ,5 ve 6). Her ş lokus tüm populasyonlar için polimorfiktir.
Sadece bir populasyona özgü aleller tablo I' de ş En fazla populasyona özgü ale!
Hatay örneklerinde ş (8), bunlardan Al13 aleli 212 ve A43 ale!i 1 i 9 ı ı
0,20 ve 0,I8'lik yüksek frekanslanyla dikkat çekmektedir. Hakkari ve Artvin
ı ı ı 6 ve 5 populasyona özgü alelle Hatay populasyonunu
izlemektedirler. ı ve ş ı ise populasyona özgü ş alel
ş Alel ı gözlenen ve beklenen heterozigotluk ğ tüm
19
populasyonlar ve lokuslar (A24, A113, A7, A43, A28) ı ı ı ı tablo 2-6'da
ş
Her bir populasyon için ortalama heterozigotluk düzeyleri ve her bir lokus için gen
ş ğ (HT) ı ı tablo 5 ve 6'da ş En yüksek heterozigotluk düzeyi 0.739
ile Hakkari ı en ş heterozigotluk ğ 0.586 ile ı
örneklerinde ş Mikrosatelit lokuslan tek tek heterozigotluk düzeyleri yönünden
incelendiklerinde ise A 7 lokusunun 0.945 HT ğ ile en yüksek ş gösteren, A28
lokusunun ise 0.522 HT ğ ile en ş ş gösteren lokus ğ ortaya
ı ı ş ı
20
Alel Lokus Frekans
· Populasyon
98 A24 0.07 ! Hatay
i
212 Al13 0.20 i Hatay
99 A7 0.03 · Hatay
151 A7 0.03 : Hatay
161 A7 0.03 Hatay
169 A7 0,03 : Hatay
119 A43 , 0,18 j Hatay
141 A43 • 0,03 l Hatay
108 A24 0.04 ' Artvin
218 Al13 0.07 Artvin
146 A7 0.03 • Artvin
0.03
i
Artvin
173 A7
177 A7 0.05 Artvin
142 A7 : 0.03 : ı
i
i
i ı 144 A7 ! 0.03
!
127 A43 • 0,04 : Hakkari
:
139 A43
• 0,02
i Hakkari
146 A43 0,02 · Hakkari
104 A7 , 0.02 Hakkari
i
143 A7 ' 0.02 ' Hakkari
155 A7 0.04
! Hakkari
138 A7 0.02 ş
153 A7 0.02 ş
Tablo 5. Populasyona özgü aleller ve ı
21
Alel frekanslan
Alel · ş ı Hatay Hakkari ı
96 0.10 0.12 0.20 0.26 0.00
98 · 0.00 0.00 0.07 0.00 0.00
102 · 0.05 0.10 0.00 0.02 0.12
104 0.38 0.42 0.19 0.34 0.50
106
: 0.47
0.32 0.54 0.38 0.38
108 0.00 0.04 0.00 0.00 0.00
Ho
0.72 0.92 0.87 0.88 0.86
He
· 0.64 0.71 0.66 0.70 0.63
Tablo 6.A24 lokusu için alel frekanslan ve heterozigotluk ğ
(Ho: gözlenen heterozigotluk He: beklenen heterozigotluk).
Alel frekanslan
Alel ş Artvin Hatay Hakkari ı
210 0.02 O 0.02 O O
212 O O 0.20 O O
214 O O 0.02 0.02 0.50
216 O 0.02 0.07 0.04 O
218 O 0.07 O O O
220 0.07 O O 0.04 O
222 0.07 0.26 0.11 0.10 0.03
224 0.19 0.02 0.52 0.31 0.05
226 0.22 0.10 0.02 0.16 0.20
228 0.09 0.21 O 0.16 0.05
230 0.17 0.24 O 0.14 0.10
232 0.07 0.08 O 0.04 O
234 0.07 O O O 0.03
236 0.04 0.02 O 0.02 O
238 O O 0.02 O 0.05
Ho 0.86 0.97 0.82 0.79 0.70
He 0.87 0.83 0.68 0.84 0.71
Tablo 7. Al 13 lokusu için alel ı ve heterozigotluk ğ
(Ho: gözlenen heterozigotluk He: beklenen heterozigotluk).
22
Alel ı
Alel ş İ Hatay Hakkari ı
99 O O 0.03 O O
102 0.02 O O O 0.03
104 O O O 0.02 O
105 0.04 O 0.03 O 0.05
108 O O 0.03 0.02 O
115 0.07 O O 0.04 0.06
117 0.02 0.18 O 0.13 O
119 0.09 O 0.06 0.02 0.08
121 O O 0.06 0.06 0.05
123 O O 0.11 0.02 0.03
125 0.02 0.03 0.03 0.04 O
127 0.09 0.18 0.14 0.04 0.05
129 0.04 0.08 O 0.11 0.03
131 0.06 O 0.08 0.07 O
I"" JJ O O 0.03 0.09 0.03
135 0.13 0.03 0.11 0.04 0.03
137 0.02 0.08 0.06 0.07 O
138 0.02 O O O O
139 0.04 0.03 0.11 0.04 O
140 0.07 O O 0.02 O
141 0.02 0.05 0.03 0.04 O
142 O O O O 0.03
143 O O O 0.02 O
144 O O O O 0.03
145 0.02 0.08 O 0.04 O
146 O 0.03 O O O
147 0.04 0.08 O O 0.03
149 0.04 0.03 0.03 O O
150 0.02 0.03 O O O
151 O O 0.03 O O
153 0.02 O O O O
155 O O O 0.04 O
157 0.06 O O 0.02 0.03
159 0.02 O O 0.02 O
160 O O O O O
161 O O 0.03 O O
169 O O 0.03 O O
171 O O O O O
173 O 0.03 O O O
177 O 0.05 O O O
179 0.02 0.03 O 0.02 O
Ho 0.96 0.84 0.83 0.89 0.65
He 0.95 0.92 0.95 0.95 0.72
..
Tablo 8. A 7 lokusu ı ı alel ı ve heterozigotluk ğ
(Ho: gözlenen heterozigotluk He beklenen heterozigotluk).
23
Alel ı
Alel ş ı Hatay Hakkari ı
119 O O 0.18 O O
126 O 0.02 O O 0.08
127 O O O 0.04 O
139 O O O 0.02 O
140 0.87 0.70 0.28 0.46 0.86
141 O O 0.03 O O
142 0.12 0.18 0.08 0.19 0.07
144 0.02 0.10 0.45 0.28 O
146 O O O 0.02 O
Ho 0.27 0.44 0.70 0.67 0.29
He 0.27 0.48 0.74 0.70 0.26
Tablo 9. A43 lokusu için alel ı ve heterozigotluk ğ
(Ho: gözlenen heterozigotluk He: beklenen heterozigotluk).
Alel ı
Alel ş • Artvin Hatay Hakkari ı
127 0.10 O O 0.09
129 0.15 0.30 0.08 0.24 0.13
133 0.15 0.08 0.04 0.04 0.20
138 0.60 0.62 0.88 0.63 0.13
0.54
Ho 0.70 0.75 0.25 0.72 0.93
He 0.62 0.53 0.31 0.54 0.66
Tablo 10. A28 lokusu için alel ı ve heterozigotluk ğ
(Ho: gözlenen heterozigotluk He beklenen heterozigotluk).
24
Populasyon ı heterozigotluk ğ ve standart hata
ş 0.664 ± 0.124
Artvin
0.691 ± 0.085
İ
0.739 ± 0.071
Hatay
0.641±0.115
ı
0.586 ± 0.084
Tablo 1 ı ş lokus için ortalama heterozigotluk düzeyleri
Lokus HT ğ
A24 0.669
Al13 0.876
. A7
0.945
A43 0.554
A28 0.522
Toplam 0.713
Tablo 12. Lokuslara göre gen ş ğ
(gene diversity, HT) ğ
2.2.7.2. Hardy-Weinberg dengesinin ı ı
Gametlerin rasgele ş öngören nul hipotezi Haldane (1954), Weir (1990), Guo ve
Thompson (1992)'un Hardy-Weinberg testlerine göre populasyon içi düzeyde her bir lokus
için ı ı ş Hardy-Weinberg dengesinden ı inceleyen f
1s
ğ (Weir ve
Coekerham 1984) ş Bunlar ı ı orijinal Genepop ı ı (Raymond
ve Rousset 1994) internet versiyonu olan "Genepop on the Web" ı ı ş ı Pozitiff
1s
ğ heterozigot ı ğ ı negatif ğ heterozigot ı ğ ı ş etmektedir.
25
Her populasyon ve mikrosatelit lokusu için P ğ tablo 13 'te ş ş
durumdan sadece bir tanesinde (Hakkari populasyonu A 7 lokusunda) 0.05 düzeyinde bir
Hardy-Weinberg dengesinden sapma Ş
Populasyon Lokus P ğ
ş A24 0.2983
ş Al13 . 0.7725
ş A7 0.7288
ş . A43
ş A28 0.8628
. Artvin
A24 0.1564
Artvin Al13 0.3402
Artvin A7 0.3812
Artvin A43 0.1204
Artvin A28 0.0902
Hakkari . A24 0.1358
Hakkari Al13 0.3739
Hakkari A7 0.0291
Hakkari A43 0.6266
Hakkari A28 0.1308
Hatay A24 0.0513
Hatay Al13 0.2854
Hatay A7 0.0573
Hatay A43 0.6261
Hatay A28
ı A24 0.0542
ı AI13 0.1078
ı A7 0.1354
ı A43 1
ı A28 0.0839
Tablo 13. Hardy-Weinberg testi ı
26
2.2.7.3. ğ ı ğ ı ı ı
Herhangi bir lokus çifti ve populasyon için ğ ı ğ (linkage disequilibrium)
durumunun söz konusu olup ı ğ ı Arlequin ver. 2.00 ı ve ark., 2000)
ı ı bir permutasyon yöntemi ile (Slatkin ve Excoffier ı 996) belirlenen
ğ ı ı içeren bir olabilirlik-oran (likelihood-ratio) testi ı ş ı Test ı her
bir populasyon İ ı ğ ı ğ ı ş
Her populasyonda incelenen her bir lokus çifti için 16002 permutasyon sonucunda bulunan
kesin P ğ ve ı bulunan ğ ı dengesizlikleri ı ı tablo 14 ve 18' de
ş Tüm lokuslar ş populasyondan ikisinde ı ğ ı ğ
ş Tablolarda O, A24 lokusunu; I, AI13'ü; 2 ATyi, 3, A43'ü ve 4 de A28
lokusunu göstermektedir.
(O, ı : Kesin p= 0.0876592 + 0.000859001
(O, 2 ) : Kesin
p= 0.379597 + 0.00149185
( 1, 2 ) : Kesin
p=
0.189274 + 0.00122638
(O, 3 ) : Kesin
p=
0.00969331 + 0.000301178
( 1, 3 ) : Kesin
p=
0.00753702 + 0.000271095
( 2, 3) : Kesin
p=
0.0142654 + 0.000384246
(O, 4 ) : Kesin
p= 0.373088 + 0.00150884
( 1, 4 ) : Kesin
p=
0.921905 + 0.000849018
(2, 4 ) : Kesin
p= 0.962524 + 0.000609133
(3, 4 ) : Kesin
p=
0.934752 + 0.000804525
Tablo 14. ş populasyonu ğ ı ğ ı kesin P ğ ı
(O, 1 ) : Kesin
p=
0.002885 + 0.0001762
(O, 2 ) : Kesin
p=
0.5308 + 0.00149
( 1, 2 ) : Kesin
p=
0.2966 + 0.001487
(O, 3 ) : Kesin
p= 0.07118 + 0.0007698
(l, 3 ) : Kesin
p=
0.6395 + 0.001535
(2, 3 ) : Kesin
p=
0.5131 + 0.001517
(O, 4 ) : Kesin
p=
0.008815 + 0.0003152
( 1, 4 ) : Kesin
p= 0.7757 + 0.001305
(2, 4 ) : Kesin
p=
0.07264 + 0.0008269
( 3, 4 ) : Kesin
p=
0.293 + 0.001489
Tablo i 5. ı populasyonu ğ ı ğ kesin P ğ
27
(O, 1 ) : Kesin
p=
9.983e-06 + 9.983e-06
(O, 2 ) : Kesin p=
O + O
(1, 2 ) : Kesin p=
O + O
(O, 3) : Kesin
p=
9.983e-06 + 9.983e-06
(1, 3 ) : Kesin
p=
O + O
(2, 3) : Kesin p=
9.983e-06 + 9.983e-06
(O, 4 ) : Kesin
p=
0.002246 + 0.0001492
(1, 4 ) : Kesin p= 0.6534 + 0.001487
(2, 4 ) : Kesin p= 0.2097 + 0.001269
(3, 4 ) : Kesin p= 0.3999 + 0.001562
Tablo 16. Hakkari populasyonu ğ ı ğ kesin P ğ
(O, 1 ) : Kesin p= 0.0001398 + 3.657e-05
(O, 2 ) : Kesin p= 0.4671 + 0.00157
(1, 2 ) : Kesin
p= 0.05736 + 0.0007511
(O, 3 ) : Kesin
p= 2.995e-05 + 1.724e-05
(1, 3) : Kesin
p=
O + O
(2, 3) : Kesin
p= 0.4948 + 0.001657
(O, 4 ) : Kesin
p= 0.3154 + 0.001449
(1, 4 ) : Kesin
p= 0.3455 + 0.00146
(2, 4 ) : Kesin p= 0.6392 + 0.001557
(3, 4 ) : Kesin p= 0.1675 + 0.001109
Tablo 17. Hatay populasyonu ğ ı ğ kesin P ğ
(O, 1 ) : Kesin p= 0.1398 + 0.001074
(O, 2 ) : Kesin p= 0.4492 + 0.001571
(1, 2 ) : Kesin
p=
0.001887 + 0.0001483
(O, 3) : Kesin p= 0.6705 + 0.001376
(1, 3) : Kesin
p=
0.02998 + 0.0005286
(2, 3) : Kesin p=
0.5518 + 0.001555
(O, 4 ) : Kesin p=
0.5072 + 0.001591
(1, 4 ) : Kesin
p=
0.8144 + 0.001203
(2, 4 ) : Kesin
p= 0.7524
+ 0.001367
(3, 4 ) : Kesin
p=
0.08603 + 0.000911
Tablo 18. ı populasyonu ğ ı ğ kesin P ğ
Tablo 19 ve 20' de ğ ı dengesizliklerinin 0.05 düzeyindeki ı ı ı
ş "+" ş ğ ı ğ ğ "-" ş ise ğ ı
ğ ğ göstermektedir.
28
Populasyon
Lokus
ş Artvin Hakkari
O 1 2 3 4 O 2 3 4 O 1 2 3 4
O
+ + + + +. + +
+ + + + + -
2
+ + + + -
3
+ + + + + +
4
+ +
Tablo 19. ğ ı dengesizliklerinin 0.05 düzeyindeki ı ı ı
Populasyon
Lokus
Hatay ı
O
O ı 23401234
+ +
1
+ + + +
2
+
3
+ + +
4
Tablo 20. ğ ı dengesizliklerinin 0.05 düzeyindeki ı ı ı
2.2.7.4. Populasyon ı ı analizleri
Ömek1enen ı ı ı ı ı ı ı anlamak ı ı tüm populasyonlar ve
populasyon çiftleri İ F ı ı ı ş ı
29
2.2.7.4.1. F ı ı ile populasyon ş ı ş ı ı ve genetik ı incelemeleri
İ F ST ğ ı dönem genetik ı olarak ı (Reynolds ve ark.
1983; Slatkin 1995). İ F ST ğ (populasyonlar ı ı ı ı ğ ı nul
hipotezi ı F
ST
ğ ğ ı ı ı haplotiplerin populasyonlar ı
permutasyonu ile elde edilir) ve bunlara ait P ğ (Bu P ğ gözlenenle ı ya
da daha büyük F
ST
ğ veren ı ı ı Arlequin ver. 2.000
ı (Schneider ve ark. 2000) ile elde ş
ş ı ı poplasyonunu ş Artvin, Hakkari, Hatay ve ı içeren toplam
populasyonun FST,
ı
ve FIT ğ ş mikrosatelit lokusu (A24, A113, A7, A43, A28)
için Weir ve Cockerham 'a (1984) göre "Genepop on the Web" ı ı (Raymond and
Rousset 1994) 6. ğ ile ş
Her bir populasyon çifti için bulunan F ST ğ ve ı P ğ ı ı Tablo
21 ve 22'de ş Tablo 23'de ise bulunan P ğ 0.05 düzeyindeki
ı ı ı belirtilmektedir. Yirmi ş ı ş ı ı ı istatistikselolarak ı
bir genetik ı ş ş etmektedir. ı populasyonu Anadolu
ı ı bir ş ı ş Anadolu ı
Hatay populasyonu ise F ST ğ göre ğ genetik olarak ı
ş ş populasyonu Artvin ve Hakkari' den F ST ğ göre genetik
olarak ı ı ı göstermemekte ancak Artvin ve Hakkari ı ı ı
göstermektedirler. Tablo 24' de ş populasyonda her ş mikrosatelit lokusu için ı ı
ve tüm lokuslar için F ST, F LS ve F IT ğ ş Populasyonlar ı
ı ş ı ölçen F ST ğ ı mikrosatelit ı ı en yüksek ğ
(0.1685) A43 lokusunda en ş ğ (0.0282) ise A28 lokusunda ş ı ş ı
Populasyonlar içerisinde Hardy-Weinberg dengesinden ı ölçen ı ğ A24,
A113, A28 ve toplam lokuslar ı ı bir genel heterozigot ı ğ ı ı A7 ve A43
ı için ise genel bir heterozigot ı ğ ı ı ş Toplam populasyonda Hardy-
Weinberg dengesinden sapmaya ş eden FIT ğ ise A24, A28 ve toplamda
heterozigotluklar lehine bir sapma, ğ lokuslar için ise heterozigot ı ğ ı ı
göstermektedir.
30
1 2 3 4 5
1 0.00000
2 0.00486 0.00000
3 0.00513 0.01765 0.00000
4 0.11501 0.12501 0.02123 0.00000
5 0.06549 0.10563 0.13394 0.21451 0.00000
Tablo 21. ş milaosatelit lokusu için bulunan ikili populasyon F
ST
ğ
(1: ş 2: Artvin, 3:Hakkari, 4: Hatay, 5: ı
1 2 3 4 5
1
2 0.08886±0.0022
3 ı 0.00400±0.0004
4 O.OOOOO±O.OOOO O. OOOOO±O. 0000 0.00281±0.0004
5 O. OOOOO±O. 0000 O.OOOOO±O.OOOO O. OOOOO±O. 0000 O.OOOOO±O.OOOO
Tablo 22. ş milaosatelit için bulunan FST P ğ
(1 ş 2: Artvin, 3:Hakkari, 4: Hatay, 5: ı
2 3 4 5
+ +
2
+ + +
3 + + +
4
+ + + +
5 + + + +
Tablo 23. 0.05 düzeyinde F
ST
P ğ ı ı ı
ı ş 2:Artvin, 3:Hakkari, 4: Hatay, 5: ı
31
Lokus F
ST
F
1s FIT
• A24 0.0331
-0.2962
-0.2532
A1l3 0.1186
-0.0566
0.0687
A7 0.0648 0.0606 0.1215
A43 0.1685 0.0044 0.1722
A28 0.0282 -0.3472 -0.3092
Toplam 0.0796 -0.1082 -0.0200
Tablo 24. Toplam populasyon ş Artvin, Hakkari, Hatay ve ı
için her bir lokus ve toplam lokuslar için bulunan F ı ı
2.2.7.5. Fenogram ş ı
Fenogramlar mikrosatelit verileri ı ş ı matrisleri ı ı
ş
2.2.7.5. ı Genetik ı ı
Populasyonlar ı Nei'nin (1972) standart genetik ı ğ ı Ds, standart genetik
ı ğ ı standart ı (Nei 1978) bir girdi matrisi üretmek ı ı AN ı
(Ota 1993) ı ı ş ı
Nei'nin standart ı ğ ı ı formülü ş ğ ı ı
D 1

s= - n ı ı ı
burada,
"Ç'"" "Ç'"' ..... j x'
Jx::= L; L, .)
r
32
ve
""
J
Lj ı ll"
v-
Z - r
ğ populasyon X ve Y için ortalama ı ve ş ğ ı ı
Xij ve Yij X ve Y ı i. alelinj lokusundaki ı ı mjj lokusundaki
alel ı ı r ise incelenen lokus ı ı ı göstermektedir.
ş Türkiye ı ı populasyonu ı genetik ı Nei'nin standart genetik
ı ı göre (1972) ş ı mikrosatelit lokusu verileri ı ş ve
ı matrisleri standart ı ş (Tablo 25 ve 26).
2 3 4
2 0.0508
3 0.0800 0.0685
4 0.2866 0.3399 0.1008
5 0.1234 0.2175 0.2780 0.5579
Tablo 25. Türkiye'deki ş ı ı populasyonu için Nei'nin standart genetik ı
matrisi (l: ş 2: Artvin, 3: Hakkari, 4: Hatay, 5: ı
2
" .)
4
5
0.0420
0.0513
0.1796
0.1156
2 3 4
0.0481
0.1 934 0.0447
0.1806 0.1405 0.2473
Table 26. Tablo 25"deki ı ı standart ı
2.2.7.5.2. Fenogram çizimi
Fenogram ı ve ı UPGMA yöntemi (Sneath ve Sokal 1973) temel ı
daha önce elde dilen Ds ı İ verilerek D ISP AN ı (Ota 1993) ile
ş Çizilen fenogram Ş Tde ş Fenogram Türkiye'deki ş ı
populasyonu için ş mikrosatelit lokusu verileri ı ş ş
ş fenogram Hatay populasyonunun ğ ı bir yerde ş ı ğ ı
görülmektedir. Daha alt düzeydeki ı ise ı populasyonu Anadolu
ı ı ı ş ı ş ve Artvin populasyonlan birlikte ı ş
Hakkari populasyonu ise bunlardan ı ı ş ı
,----- Eskisehil'
'------ Al'tvin
'------------- Hakkal'i
'------------------------------------ Kil'klal'eli
L-_______________________________________________________ Hatay
Ş 7. ş mikrosatelit lokusu (A24, Al13, A7, A43, A28) verileri ı elde
edilen Türkiye'nin ş ı yöresine ş - A. m. anatofiaca, Artvin - A. m.
caucasica, Hakkari - A. m. meda, Hatay - A. m. syriaca, ı - A. m. cm<nica) ait
ı ı UPGMA ı
2.2.7.6. Köken belirleme
Mikrosatelitlerin, kökeni belirsiz bir grup bireyin hangi populasyondan ğ dair
bilgilendirme kapasitesini ölçmek için "Arlequin ver. 2.000" ı ı genotip belirleme
(genotype assignment) ğ Türkiye'deki ı ı için ı ı ş ı Program her
ı bireyin belirli bir populasyona ait ğ öngörusü ile her genotipin log
olabilirliklerini hesaplamakta ve bireylerin populasyon çiftleri için log olabilirlik
ğ ğ tablolar vermektedir. Bu tablolardaki ğ koordinat düzlemine
34
ı Yöntem Paetkau ve ark. (1995, 1997) ve Waser ve Strobeck'in (1998)
makalelerini temel ı ş ı
ş mikrosatelit lokusu ı (A24, All3, A7, A43, A28) her populasyon çifti için
bireylerin herbir populasyona ait olma ı ı ı ı logaritmik grafikleri ş Ş
8-17). ı ı göstermek için grafiklerde X=Y ğ ş ı ve Hatay
populasyon çifti tam bir ı ş göstermektedir. Artvin-Hatay ş ı ş ı ı ise
Artvin yerine Hatay populasyonuna ait ı beklenen bir birey ı ş ı bireyler ı
ı ı ş ı ı ğ ı yerine Artvin' e ait olsa daha iyi
ı iki birey ı ş ı tam bir ı ş ş Hakkari - ı
ş ı ş ı ı da Hakkari yerine ı populasyonuna ait ı daha iyi
ı bir birey ı ş ı ı ş oldukça iyi ş Hatay-Hakkari
ğ bir beklenmeyen Hakkari ğ mükemmel ı ş ı önlemektedir. ş
Hatay ve ş ı grafiklerinde de sadece birkaç birey ğ populasyondan
ş ı daha iyi ı Artvin, ş ve Hakkari ı
ı ı ğ populasyon çiftleri ı ı kadar iyi ı ş ı
35
ı
-40 -30
i
i
i
i
i
o o
o
o

ş
-20 -10
o
ı
o

ı o o o
o o
$,0 %
• •
oc(}
• o


ı

••
• • •

....
.
• •

-10
• ş

-20 .
o Artvin
-30
Ş 8. ş ve Artvin populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
36
ş
-35 -30 -25 -20 -15 -10 -5
-5
-10
o o
o ° Q:P
°0

o o
o o o
o
o
••

't ••
o

o
o • o

o

° •
..
o
...
-15
-20
o
ı
-25


-30
Ş 9. ş ve Hakkari populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
37
ş
r
-50 -40 -30 -20 -10
o
o
-10
o 0 8 000
000
o
o
o o
+
00
o
°0
+ +
+
.. + + ..
-20
o

.... -------
...
•••
••
••
+
-30


-40
-50
Ş ş ve Hatay populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
38
• ş
o Hatay

ş ı
,
-50 -40 -30 -20 -10
ro o o
o o
ı

o -10
o
o o
+
o o +
o
fi
o

ı
-20
++
+ +
r-
+
,
. + ş
i
: o ı ı
+
-30
+
-40
+
+
Ş ı ı ş ve ı populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
39
-50
i
ı
o
-40 -30
Artvin-Hakkari
-20 -10
o o 8 /9::;0 6l
o ..
° ...
o 000 , ....
° .....
°

• 1 .. .

-10
-20
-30 .
-40
Ş ı 2. ı ve Hakkari populasyon çifti için İ
İ olabilirlik ğ
40
;-;-Art"An-
i .
! ° Hakkari·
L .. ___ ...
Artvin-Hatay
-50 -40 -30 -20 -10
o
o
-10
rF
o
0
0
o
o
cb
00
o o
&0

Ö


\
• -20
o •
.:

•••

• • •
..
-30


••



-40
Ş 13. Artvin ve Hatay populasyon çifti İ İ
İ olabilirlik ğ
41
ı
-50 -40 -30 -20 -10
i
i
o 00 o
o
si>
<0
0
i
o
i
i
o S
!
-10
o o

o o
o
..
• o
.t
....
-20

.:
• •



-30


..


• •
-40-
.t
Ş ı 4. ı ve ı populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
42
i ,
, • Artvin '
i :
, o ı i
i ,,,,,,.J
Hakkari-Hatay
,
-50 -40 -30 -20 -10
°
°
-10
0&
°
o
0'8
o
o

°
o

o
ı
o o


o
• t.
• •
-20
...
ı .

••
.. :
-30
• •
• -40
----------------------5
Ş 15. Hakkari ve Hatay populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
43
Hakkari ı
\ ° Hatay ii
i
i
ı
-40 -30 -20 -10

. ··-60·
Ş 16. Hakkari ve ı populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
44
i
-50 -40
i
i
o
o
-30
o
ı
ocz,
<Po
o o
o
o o
o
o
-20
o
'6 o
o
+
-10
• •
• + •
...
• •


+ •




•••
-10
-20 .
-30
-40

Ş 17. Hatay ve ı populasyon çifti için genotiplerin
logaritmik olabilirlik ğ
45
i. Hatay L
ı i
SONUÇ
Bu ı ş ı amaçlanndan biri Türkiye' deki ı populasyonlannda mikrosatelit
ı genetik ş ğ belirlenmesidir. ı ş ı ğ ı ı ş mikrosatelit lokusu bu
örneklerde daha önce incelenen izozim ı nazaran çok daha büyük bir ş
ş Anadolu ı lokus ş ı ş ortalama alel ı ı 14.6
olarak ş bu ı M soy ı için 6.4, C soy ı için 9.0 ve A soy ı için
13.4'tür. ı ş ı mikrosatelit ı A24'te 6, Al13'te 15, A7'de 41, A43'te 9 ve
A28 lokusunda 4 ı alel ı ş Türkiye'deki ı ı ş mikrosatelit
lokusu kullamlarak bulunan polimorfizm Estoup ve ş ı (1995) A, M ve C soy
ı dokuz populasyonda ğ ı Estoup ve ş ı (1995)
mikrosatelit ı için alel ı ı A24'te 7 ile A 7' de 30 ı ğ ş ğ
ş Bizim ı ş ı ise alel ı ı A28' de 4 ile A 7' de 41 ı ı
Franck ve ş ı (1998) 4 A ve 7 M populasyonunda A7 lokusu için 32 alel, Garnery
ve ş ı (1998) ise 15 M, 1 A ve 1 C populasyonu ı ı ı ş ı
toplam 33 A7 aleli ş ı Bu ş mikrosatelit lokusu ı ı Anadolu ve Avrupa
ı ı ı ı ortalama heterozigotluk düzeylerindeki ı ı dikkat çekicidir.
Öyle ki Estoup ve ş ı ı ı ş ı (1995) M soy ı için bizim ı ğ ı ı
ş lokus ele ı ı ğ ı ortalama heterozigotluk düzeyi 0.234 (Umea) ile 0.400 CA vignon)
ı C soy ı için ise 0.410 (Chalkidiki) ile 0.564 (Berlin) ı ğ ş iken
bizim ı ş ı bu ğ 0.641 (Hatay) ile 0.739 (Hakkari) ı ı ı ı
Anadolu'daki heterozigotluk düzeyi her iki Avrupa soy ı da yüksek ancak Estoup
ve ş ı ı (1995) ı ş mikrosatelit lokusu ile ı Afrika A soy ı ı
heterozigotluk düzeyinden (Tiznit için 0.764, Johannesburg için 0.869) ş
ı ş mikrosatelit lokusu için Türkiye 'nin Avrupa ı bulunan ı
yöresi örneklerinde toplam 32 alel bulunurken Anadolu ı toplam 73
mikrosatelit aleli ş Polimorfizmdeki bu fark ı populasyonunun ortalama
heterozigotluk düzeyi (0.586) ile Anadolu ı ı ı ı (Hatay
için 0.641- Hakkari için 0.739) ş ı ş ı ı ı da ı görülmektedir. ı deki
bu ortalama heterozigotluk düzeyi Estoup ve ş ı ı (1995) 0.410 ve 0.564
ı ğ ı ğ belrttikleri C soyu ortalama heterozigotluk düzeylerine
Anadolu'nunkilere oranla daha ı ı ı ş ı ı yöresine özgü 2 alel (142 ve 144
46
A 7 alelleri) bulunurken her dört Anadolu populasyonunda bulunup ı örneklerinde
bulunmayan 6 mikrosatelit aleli (A24 için 96 aleli, A7 için 125,137,139 ve 141 alelleri,
A43 İ 144 aleli) ı İ olan nokta Anadolu' da bulul1l1p ı
populasyonunda bulunmayan bu 6 mikrosatelit alelinin ı zamanda iki Avrupa soy ı
olan M ve C ı da Estoup ve ş ı (1995), Franck ve ş ı (1998) ve
Garnery ve ş ı (1998) ı ı ı ş görülmemesidir.
ı 'ye özgü ğ A 7 lokusunun 142 aleli Estoup ve ş ı (1995)
ı C soyuna ait olan Chalkidiki populasyonunda da ş Bununla birlikte
ale! ı ı bu ı ı ı bir ı ı ı ş bir mikrosatelit olan ve içinde hem
ikili hem de tekli tekrarlar ı ı A 7 lokusunun ı ı ı ğ ş
ğ de göz ı edilmemelidir.
Bu ı ş ı İ 10 mikrosatelit lokusunun ı ş ı ı ş Ancak
projeye olan mali destek yeterli ı ğ ı için 5 lokus ı ş ı İ ş Fakat ı ş ı ş
lokus ile Türkiye ı ı ı büyük bir ş ş İ
daha ş destekle ı ş ı ı ı İ ş ve ı bölge ve ekotipleri
ı ş mümkün olabilecektir.
Kandemir ve ş ı ı (2000) ı ğ ı morfometrirk analizlerde ğ Anadolu
örneklerinin A. m. syriaea alttürünü temsil ettikleri ş Bu bulguyu göz önüne
ı ı alttüre ait ı ı ğ Hatay örneklerinde bizim ı ş ı 8 tane
sadece bu populasyona özgü ale! ş İ ğ populasyonlar içinde Hatay
populasyonu populasyona özgü en fazla alel gösterenidir. Bunlardan A 113 lokusuna ait 212
(0.20) aleli ile A43 lokusuna ait 119 alelinin (0.18) ı ı ğ dikkat
çekicidir. Populasyona özgü alel ı ı Hatay populasyonunu 6 özgü alel ile Hakkari
ve 5 alel ile Artvin ı ı ı izlemektedir. ş ve ı
ı ise populasyona özgü ş alel ş
Türkiye'de biri Avrupa ı olan Trakya'da dördü ise Anadolu ı olmak üzere ş
ı ı alttürü ğ ş Trakya örneklerinin C soy ı ğ ı bir alttür
olan A. m. earnica ile benzer morfometrik karakter ş ğ ı ı ğ ı ş
(Kandemir ve ark. 2000). Ruttner (1992) orta Anadolu, Akdeniz, Ege bölgeleri ile
Karadeniz bölgesinin ı ı ı ı A. m. anatoliaea alttürü; ğ Anadolu'nun ise
47
A. 171. meda; ğ Anadolu'nun ise A. n1. caucasica alttürleri ı ş ı
olarak ı ı ğ ı öne ş Kandemir ve ark. (2000) ı morfometrik
analizlerde ğ Anadolu örneklerinin A. m. Meda, Hatay örneklerininse A. m. İ
alttürlerinden ı ş
ş populasyon-Iokus ş ı ş ı ı birinde Hardy-Weinberg dengesinden 0.05
düzeyinde ı sapma ş ı ğ ı ı mikrosatelit lokuslan ı
birçok ğ ı dengesi sapmalan ş ama hiçbir ğ ı ğ tüm
populasyonlarda ş Hakkari populasyonunda toplam 14, Hatay ve ş de
6, Artvin ve ı de ise 4' er ğ ı ğ ş ı lokuslar
ı gözlenen ğ ı ğ populasyonun gen havuzuna ı gen
ı ş ı sonucu Oliaya ı Hakkari populasyonunun büyük ölçüde
ğ ı ğ göstermesi bu bölgeye gezginci ı gelen ı gen
havuzuna etkisi ğ ş edebilir. Bu hipotezin ı populasyonlarda ve ı
lokuslar ı ı ı gerekir. Artvin ve ı ı örneklerinin
ı ğ ı yöreler ı ı ı ı ğ bölgeler ğ ğ ı
ğ ğ populasyonlara göre çok ş ı beklenir.
Oldukça yüksek genel F ST ğ 0.0796 olarak ı ş olup lOtane ikili populasyon
ş ı ş ı ı F
ST
ğ 8'inin 0.05 düzeyinde ı ı ı göstermesi Anadolu'da
ı ı ş gösterdiklerini ortaya ş Gezginci ı ı ğ ı ı
ı ğ Türkiye'deki ı ş ğ ğ görülmektedir. Hatay ve
ı populasyonlan ı ş ı ğ tüm populasyonlardan ı (P<0.05) ı ı
göstermektedirler. Genel FS
T
ğ ğ Türkiye ı ı ı
ı en fazla ı A43 lokusunun en az ı ı ı ise A28 lokusunun ş ğ
görülmektedir.
Türkiye ı ı için çizilen fenogramda ı örnekleri Anadolu
örneklerinden ı bir ş yer ı Bu sonuç daha önceki morfometri ve allozim
ı ş ı (Kandemir ve ark. 2000) desteklemektedir.
Mitokondri ı incelemesinde özgü bir restriksiyon bölgesi ı ı ve
kodlamayan DNA ı ı bulunan Hatay ı Anadolu balanlanndan ı olduklan
48
ve Hatay örneklerinin O soy ı ait olduklan öne ş (Palmer ve ark. 2000;
Kandemir ve ark. 2000). Bizim ı ş ı FS
T
ğ göz önüne ı ı ğ ı Hatay
ı C soy ı ait ğ bilinen ı örneklerinden ve Anadolu
ı tümünden ı ğ sonucu ı ı ş ı Bu sonuçlar Hatay
ı ğ Anadolu ı ı ı soy ı ğ ı ı
desteklememektedir. Bu sonuçlar Hatay ı ı ı Anadolu balanlanndan ı olarak
O soy ı ğ ş desteklemektedirler. Palmer ve ş ı ı (2000)
mtDNA ı ş ı göre C soy ı ait ğ öne sürülen Anadolu balanlan ise
mikrosatelit ı ı ş göre ı bir soy ı ı
ı ı ı ı Nitekim Franck ve ş ı (2001) mtDNA verilerinin ı ı ı
taksonomik ve genetik ı ı sonuca ı için tek ş ı yetersiz
ğ ı ş
Nei' in standart genetik ı ğ ı (1972) sonsuz alel mutasyon modeli (Inifinite alele
mutation model) için uygundur; bütün lokuslar için nötral bir mutasyon ı ı öngönnekte ve
her ş ğ ş ş form daha önce populasyonda bulunmayan bir al el olarak
ş ve etkin populasyon ğ sabit olmak üzere populasyondaki genetik
ş ğ genetik kayma (drift) ve mutasyon ı bir denge durumunda ğ
öngörülmektedir. Mikrosatelit ı ı incelenmesinde sonsuz alel mutasyon ve ı
ı mutasyon (Stepwise mutation model) modelleri ı ı Sonsuz alel mutasyon
modeline göre mikrosatelit lokusunda bir mutasyon, ı ı önemli ı ı bir ya da
birden çok tekrar biriminin ı ya da silinmesi ile ş ve populasyonda daha
önce olmayan yeni bir alelin ortaya ı ı yol ı ı ı mutasyon
modeli ise yeni bir mikrosatelit alelinin sadece bir tekrar biriminin eklenmesi ya da
silinmesiyle ş ğ ve yeni alelin populasyonda daha önceden ğ
öngörür. Bu ı ş incelemeler sonsuz alel mutasyon modeline göre ı ı ş ı Bunun
nedeni A 7 lokusunun tek bir tekrar birimi içermemesidir.
Mikrosatelit ı yüksek ı ı ı ı ı nedenenin DNA ı ı DNA
ş ı ı kayma ı ğ ş ı nokta mutasyonlan
ı ğ bu lokuslardaki ı büyük ğ ğ tekrar ı ı
ğ ş (Freeman and HelTon 1998). Evrimsel ı ğ mikrosatelit alelinin nötr
ı yüksek mutasyon ı ı ve ş ı (codominant) ı ı göstermeleri ı türler
49
ve populasyonlar ı genetik ı ş mikrosatelitleri, seçilim ı ı tabi olan
morfometri ve allozim belirleyicilerden (Freeman and Herron 1998) daha üstün
ı ı ı ı ı ı ı ş ı ı ğ görülen (Ruttner 1988)
morfometrik karakterlerin en büyük ğ çok genle ı Mitokondri
ı populasyon ğ ı ş ı ı bir ş ı ı ş moleküler
belirleyicidir ancak dölden döle sadece anadan geçmesi ve ı ı rekombinasyona
ğ ı bir eksikliktir.
Bundan önce Anadolu ı ı soy ı belirlenmesi için ğ bir ş
ı ş ı ı ş ı Smith ve ark. (1997) ve Palmer ve ş ı ı (2000) Türkiye
ı ı soy ı belirlenmesi için ı ı mtDNA ı ş ı göre Türkiye
ı ı genelolarak ğ Akdeniz soyu C'ye ait ğ öne ş Palmer ve
ş ı (2000) Hatay ı ı yeni bir mitokondriyel DNA haplotipi ş ı
Kandemir ve ark. ı ı ş da Hatay yöresi ı ı ğ Türkiye
ı ı ı ş ve Palmer ve ş ı ı (2000) ğ da ı
bir mtDNA haplotipini ş Palmer ve ark. (2000) ı yeni haplotipin
Ruttner'in (1988) sözünü ğ dördüncü soy ı O'ya ait ğ sonucuna
ı ş ı Bizim ı ı göre ı populasyonu ğ bütün Anadolu
ı ikili FST ğ gösterdikleri gibi ı bir ş ı ı ve
bu sonuç Anadolu ı ı ı ğ Akdeniz soyu C'ye ait ı ş
desteklememektedir.
Türkiye ı bitki örtüsü, iklim ş ğ ve çok ş ş ı ı ı
ş ğ son derece ş Dört milyonun üzerinde koloni ı ğ ı ile ı ı
ş ğ ı önde gelen ülkelerinden biri olan Türkiye bal üretiminde FAO
istatistiklerine göre dünyada dördüncü ı yer ı Bal üretimini ş için
kalitesi ve genetik ı ı bilinen ana ı ı ş ı Bu ı ş ı
ı bir tanesi de mikrosatelitlerin ğ ş populasyon ya da ekotiplerin
ı ı ş ı ı ı ölçmektir. Bunun uygulamadaki ı ana ı ş ğ
kökeni n ğ olarak belir1enebilmesidir. Bireylerin genotiplerinin geldikleri
populasyonlara atfedilebilmesi bizim ğ ş ı ı ı ı ı ı yapabilmemize
olanak ş Ş 8-17). ğ Hatay ı ğ kolayca ve kesin
ş ı ş ı Artvin balanlan da köken belirleme testi ile oldukça ş ı ı
50
bir ş ı edilebilmektedir. Bu uygulama ş ana ı ı kalite kontrolunun
ğ ı ı bir ş ı ı olanak ğ ı Mikrosatelitlerin ı ı ı ı ya
da ekotiplerinin belirlenmesinde oldukça ümit verici ı ı büyütülürse daha
kesin sonuçlara ş ı ğ görülmektedir.
Sonuç olarak bu ı ş Hatay ı ı ı Anadolu ı ı ı bir soy ı
ait ğ ı görülmektedir. Öte yandan Anadolu ı ı C soyuna ait ğ
bilinen ı ı ı bir soy ı ait ğ sonucuna ı ı ş ı
Bunun ileriki ı ş ı ı ı gerekmektedir. Gezginci ı ı ğ ş ı Anadolu
ı ı ı ı genetik ı ı ı ı büyük ölçüde ı ş
Genetik köken belirleme ı ş ı ümit verici sonuçlar ı ş Bu uygulama ana ı
ş ğ ş ana ı genetik kalite denetimlerinde ş ı
ı Bunun ı ı Türkiye ı ı genetik ş ı ı
ş ve mikrosatelit lokusu ı ı ı ı ı ı yarar ğ ı
51
REFERANSLAR
Arias MC, Sheppard WS, Molecular phylogenetics of honeybee subspecies (Apis mellifera
L) inferred from mitochondrial DNA sequence, Mol. Phylogen. EvoI. 5, 557-566, (1996).
Asal ş ş C, ı C, ı ı MA, Enzyme polymorphism in honeybee (Apis
mellifera L) from ı Turk. 1. Zoo1. 19, ı 53- ı 56, (1995).
BerIocher SH, Insect molecular systematics. Annu. Rev. Entomol. 29,403-433, (1984).
Bowcock AM, Ruiz-Linares A, Tomfohrde J, Minch E, Kidd JR, Cavalli-Sforza LL, High
resolution of human evolutionary trees with polymorphic microsatellites. Nature 368, 455-
457, (1994).
Braaten DC, Thomas JR, Little RD, Dickson KR, Goldberg I, Schlessinger D, Ciccodicola
A, d'Urso M, Locations and contexts of sequences that hybridize to poly(dG-dT).(dC-dA)
in mammalian ribosomal DNAs and two X-linked genes. Nuc. Ac. Res. 16, 865-881,
(1988).
Comuet JM, The MDH polymorphism in some West Mediterranean honeybee populations.
In M. D. Breed, C. D. Michener and H. E. Evans (eds.), The Biology of Social Insects.
Proceedings, 9th Congress of the ı ı Westview Press, Boulder, CO, (1982).
ğ Y,Kence A, Morphometric study on population structure on honeybee, Apis
mellifera L. (Hymenoptera: Apidae). Türkiye 2. Entomoloji Kongresi Bildirileri, 387-396,
(1992).
Estoup A, Solignac M, Harry M, Comuet JM, Characterization of (GT)n and (CT)n
microsatellites in two inseet species: Apis mellifera and Bombus terrestris. Nuc. Ac. Res.
21,1427-1431, (1993).
Estoup A, Gamery L, Solignac M, Comuet JM, Mierosatellite variation in (Apis mellifera
L) populations: hierarehical genetic strueture and test of the infinite allele and stepwise
mutation models. Genetics 140, 679-695, (1995).
Franck P, Gamery L, Solignac M, Comuet JM, The origin ofwest European subspecies of
honey bees (Apis mellifera): new insights from mierosatellite and mitochondrial data.
Evolution 52, 1119-1134, (1998).
Franck P, Gamery L, Solignac M, Cornuet JM, Molecular confirmation of a fourth lineage
in honeybees from the Near East. Apidologie 3 ı 167-180, (2000).
Franck P, Garnery L, Loiseau A ve ark., Genetic diversity of the honeybee İ Africa:
microsatellite and mitochondrial data, Heredity, 86, 420-430, Part 4, (2001).
Freeman S, Herron JC, Evolutionary Analysis. Prentice-Hall, Ine., Simon & Schuster! A
Viacom Company, New Jersey, (1998), 786 p.
52
Garnery L, Comuet JM, Solignac M, Evolutionary history of the honeybee A p İ s mellifera
inferred from mitochondrial DNA analysis. Mol. EcoL. 1,145-154, (1992).
Gamery L, Solignac M, Celebrano G, Comuet JM, A simple test using restricted PCR-
amplified mitochondrial DNA to study the genetic stmcture of Apis mellifera L.
Experientia 49,1016-1021, (1993).
Garnery L, Mosshine EH, Cornuet JM, Mitochondrial DNA variation in Moraccan and
Spanish honey bee populations. Mol. EcoI. 4, 465-471, (1995).
Garnery L, Franck P, Baudry E, Vautrin D, Comuet JM, Solignac M, Genetic diversity of
the west European honey bee (Apis mellifera mellifera and A.m. iberica). II. Microsatellite
loci. Genet. SeL. EvoI. 30 (SuppL. 1), S49-S74., (1998).
Goudet J, Raymond M, De Meeüs T, Rousset F, Testing differentiation 111 diploid
populations. Genetics 144, 1933- ı 940, (1996).
Guo SW and Thompson EA, Performing the kesin test of Hardy-Weinberg proportions for
multiple alleles. Biometrics 48, 361-372, (1992).
Haldane JBS, An kesin test for randonmess ofmating. J. Genet. 52,631-635, (1954).
Hall HG, Parental analysis of introgressive hyridization between African and European
honeybees using nuclear DNA RFLPs . Genetics 125, 611 -62 1, (1990).
Henderson ST, Petes TD, Instability of simple sequence DNA 111 Saeeharomyees
cerevisiae. Mol. Cell BioL. 12,2749-2757, (1992).
Kandemir İ , Kence A Allozyme variability in a central Anatolian honeybee (Apis mellifera
L) population. Apidologie 26, 503-510, (1995).
Kandemir İ , Genetic and morphometric variation in honeybee (Apis mellifera L)
populations in Turkey. Ph.D. dissertation, Middle East Technical University, Ankara,
Turkey, (1999).
Kandemir İ , Kence M, Kence A, Genetic and morphometric variation in honeybee CA.
mellifeta L.) populations of Turkey. Apidologie 31, 343-356, (2000).
Levinson G and Gutman GA, High frequencies of short frameshifts in poly-CA/TG tandem
repeats bome by bacteriophage M13 in Eseheriehia eaZi K-12. Nuc. Ac. Res. 15, 5323-
5338, (1987).
Litt M, Luty JA, A hyper\'ariable microsatellite revealed by in vitro amplification of a
dinucleolide repeat within the cardiac muscle actin gene. Am. 1. Hu. Gen. 44, 397-401,
( 1989).
Morrison A, Johnson AL, Jo1111son LH, Sugino A, Pathway correcting DNA replication
errors in Saeeharamyees eerevisiae. EMBO 1. 12,1467-1473, (1993).
53
İ M, Genetic distances between populations. Am. Nat. 106,283-292, (1972).
Nei M, Analysis of gene diversity in subdivided populations. Proc. Natl.
Acad. Sci., USA 70:3321-3323, (1973).
Nei M, Estimation of average heterozygosity and genetic distance from a
small number of individuals. Genetics 89,583-590, (1978).
Nunamaker RA, Wilson WT and Haley BE, Electrophoretic detection of Africanized
honeybees (Apis mellifera scutellata) in Guatemala and Mexico based on malete
dehydrogenase allozyme patterns. 1. Kans. Entomol. Soc. 57,622-631, (1984).
Ota T, DISPAN (Genetic Distance and Phylogenetic Analysis) software. Pem1sylvania
State University, (1993).
Packer GJ, and Owen RJ, ı dislocation of the patella, Arc. Emer. Med. 9, 244-
245, (1992).
Paetkau D, Calvert W, Stirling I, Strobeck C, Microsatel1ite analysis of population structure
in Canadian polar bears. Mol. Ecol. 4, 347-354, (1995).
Paetkau D, Waits LP, Clarkson PL, Craighead L, Strobeck C, An empirical evaluation of
genetic distance statistics us ing microsatel1ite data from bear (Ursidae) populations.
Genetics 147, 1943-1957, (1997).
Palmer MR, Smith DR, ğ 0, Turkish honeybees: genetic variation and evidence
for a fourth lineage of Ap is mellifera mtDNA. The Journal of Heredity 91, 42-46, (2000).
Pamilo P, Varvio-Aho SL, Pekkarinen A, Low levels of heterozygosity in Hymenoptera as
a consequence of haplodiploidy. Hereditas 88, 93-99, (1978).
Raymond M and Rousset F, GenePop ver. 3.0. Institut des Sciences de l'Evolution.
Universite de Montpel1ier, France, (1994).
Raymond M and Rousset F, An kesin test for population differentiation. Evolution 49,
1280-1283, (1995).
Reynolds J, Weir BS, Cockerham CC, Estimation for the coancestry coefficient: basis for a
short term genetic distance. Genetics 105, 767-779, (1983).
Richardson BJ, Baverstock PR, Adams M, Al10zyme electrophoresis. Academic, New
York, (J 986).
Roderick GK, Geographic structure of insect populations: gene flow, phylogeography, and
their uses. Annu. Rev. Entomol. 41, 325-352, (1996).
Ruttner F, Biogeography and Taxonomy of Honeybees. Springer-Verlag, Berlin
Heidelberg, (1988), 284 p.
54
Ruttner F, Naturgeschichte der honigbienen. München: Ehrenwirth, (1992), 357 p.
İ P, ı G, Faure C, Chebloune Y, Gouy M, Verdier G, Nigon VM,
Evolution of the primate beta-globin gene region. High rate of variation in CpG
dinucleotides and in short repeated sequences between man and chimpanzee. 1. Mol. Biol.
182. 21-29, (1985).
Schneider S, Roessli D, Excoffier L, Arlequin ver. 2.000: A software for population
genetics data analysis. Genetics and Biometry Laboratory, University of Geneva,
Switzerland, (2000).
Sheppard ı and Berlocher SH, Enzyme polymorphisms in Apis mellifera melfifera from
Norway. J. Apic. Res. 23, 64-69, (1984).
Sheppard WS, Genetic variation and differentiation in honeybees (Apis) Ph. D.
Dissertation. University of Illinois at Urbana-Champaigni Illinois, (1986).
Sheppard WS, Arias MC, Meixner MD, Grech A, Apis mellifera ı a new honeybee
subspecies from Malta. Apidologie 28, 287-293, (1997).
Sheppard WS and Smith DR, Identification of African-derived bees in the Americas: a
survey ofmethods. Ann. Entomol. Soc. Am. 93,159-176, (2000).
Slatkin M, A measure of population subdivision based on microsatellite allele frequencies.
Genetics 139,457-467, (1995).
Slatkin M and Excoffier L, Testing for linkage disequilibrium in genotypic data using the
Expectation-Maximization algorithm. Heredity 76,376-383, (1996).
Smith DR, Taylor OR, Brown WM, Neotropical Africanized honey bees have African
mitochondrial DNA. Nature 339, 213-215, (1989).
Smith DR, Mitochondrial DNA and honeybee biogeography, 131 - 1 76. In DR Smith (eds.),
Diversity in the genusApis. Westview, Boulder, CO, (1991).
Smith DR, Slaymaker A, Palmer M, ğ 0, Turkish honeybees belong to the east
Mediterranean lineage. Apidologie 28, 269-274, (1997).
Sneath, PHA ve SokaL. RR, Numerical Taxonomy, Freeman, San Francisco, (1973).
Strand M, Prolla TA, Liskay RM, Petes TD, DestabiliLation of tracts of simple repetitive
DNA in yeast by mutations affecting DNA mismatch repair. Nature 365, 274-276, (1993).
Suazo A. McTiernan R, Hall HG, Differences ı African and European honey be es
(Apis mellifera) in random amplified polymorphic DNA (RAPD). J. Hered. 89, 32-36,
(1998).
Suazo A and Hall HG, Modification of the AFLP protocol applied to honey bee (Apis
l71cllifera) DNA. Biotechniques 26, 704-705, 708-709, (1999).
55
Tautz D, Hypervariability of simple sequences as a general source for polymorphic DNA
markers. Nuc. Ac. Res. 17,6463-6471, (1989).
Tautz D, Notes on the definition and nomenelature of tandemly repetitive DNA sequences.
EXS 67,21-28, (1993).
Vos P, Hogers R, Bleeker M, Reijans M, Van de Lee T, Homes M, Frijters A, Pot J,
Peleman J, Kuiper M, Zabeau M, AFLP: a new technique for DNA fingerprinting. Nuc.
Ac. Res. 23, 4407-4414, (1995).
Waser PM and Strobeck C, Genetic signatures of interpopulation dispersal. TREE 43-44,
(1998).
Weber JL, May PE, A b u n d a n ~ class of human DNA polymorphisms which can be typed
us ing the polymerase chain reaetion. Am. J. Hu. Gen. 44, 388-396, (1989).
Weir BS and Cockerham CC, Estimatinf F-statistics for the analysis of populatian
strueture. Evolution 38,1358-1370, (1984).
Weir BS, Genetic data analysis. Sinauer Pub!., Sunderland, MA, (1990).
56
EKI
Örnek Toplanan Yerler
Bölge Lokasyon Örnek ı ı
ş Çifteler/Osmaniye 6
ş Çifteler/Orhaniye 4
ş ı 6
ş Merkez 15
Artvin Kayalar 6
Artvin Efeler 6
Artvin Düzenli 6
Artvin Camili 14
Hakkari Çengel 13
Hakkari Merkez 17
Hatay ğ 16
Hatay ı 4
Hatay ğ 4
ı ğ ı 21
57
EK2
ı ÇözeltHerin İ ğ
Tablo 1. Wilson tamponunun ı ı ş ı
ş ğ ı ekle:
10 ml ı M Tris.CI pH 8
200)l1 0.5 M Etilendiamintetraasetik asit (EDTA)
1 ml 10% (a/h) LamiI sülfat (SDS)
0.771 g Dithiothreitol (DTT)
0.584 g Sodyumklorid (NaCl)
100 ml 'e ı ı ı ş su ile tamamla.
Tablo 2. Yüzde ı ı ı akrilamid / üre çözeltisi
75 ml 40% akrilamidl çözeltisi
50 ml 10x TBE
240 güre
ı ı ı ş su ile 500 ml 'ye tamamla.
Tablo 3. Poliakrilamid jel elektroforezi için yükleme tamponu
Formamid
Xylene cyanol FF
Bromofenol İ
0.5 M EDTA (pH=8)
10 ml
10 mg
10mg
200 )LL
58
1- Proje No: TBAG-1934 (100TOS3)
2- İ ş ı Grubu: Temel Bilimler ş ı Grubu
3- Projenin ş ı ve ş Tarihleri: Eylül 2000- ı 2002
Projenin ı DNA'da SSR (Basit Dizilim ı Analizi Yöntemiyle ı ı (Apis
mellifera) ı ı Genetik ı ı ı ş ı ı ı
5- Proje Yürütücüsü ve ı ı ş ı ı ı
Doç. Dr. Meral Kence, Prof. Dr. Mahinur Akaya, Prof. Dr. Aykut Kence, ğ ı Bodur, Necva
ğ ı
6- Projenin ğ ş ve Adresi:
ODTÜ Biyoloji Bölümü Ankara
7- Destekleyen ş ı ı ve Adresi:
ODTÜ, ı ı ğ ı
8- Özet (Abstract) :
Bu çal mada Türkiye'deki balar s populasyonlar n n gösterdi i kal tsal çe itIili in mikrosatelitIer kullan larak
incelenmesi ı t r. Be ı alttüre ait balar s (Apis mellifera L) örnekleri kuzeydo u Anadolu (Artvin-
A.m.caucasica), güneydo u Anadolu (Hatay-A.m.syriaca), do u Anadolu (Hakkari-A.m.meda), orta Anadolu
(Eski ehir-A.m.anatoliaca) ve Türkiye'nin Avrupa yakas ndan (K rklareIi-A.m.carnica) toplan p be mikrosatelit
lokusu yönünden ara t r Im t r. Çal lan 4 Anadolu populasyonunda, ayn mikrosatelitler kullan larak A soy hatt
(0.234-0.400) ve C soy hatt (0.410-0.564) için bulunan ortalama heterozigotluk düzeylerinden daha yüksek ı
0.641-0.739 aras de i en ortalama heterozitluk de erleri bulunmu tur. Bulunan F
ST
de erler i Türkiye'deki balar s
populasyonlar ndaki ı la man n ı oldu unu ortaya koymu tur. Hatay populasyonu di er tüm
populasyonlardan ı bulunmu tur (P<0.05). Bu yüzden Hatay populasyonunun O soy hatt na ait oldu u
dü ünülebilir. Türkiye'nin Avrupa yakas ndaki K rklareli populasyonu bütün Anadolu populasyonlar nda farU
bulunmu (P < 0.05) ve C soy hatt ile benzer alelsel içerik ve heterozigot1uk düzeyi göstermi tir. Ortalama alel
say s n n (Lokus ba na: 14.6) M (Lakus ba na: 6.4), C (Lakus ba na: 9) ve A soy hatlar n nkinden (Lakus
ba na: 13.4) yüksek olmas ve nadir görülen alellerin varl Anadolu'nun Ruttner'in belirtti i gibi (1988) Yak n
Do u balar s populasyonlar için bir gen merkezi oldu unu desteklemektedir.
MikrosatelitIer ana ar üretimi kalite kontrolünde de i ik rk ve ekotiplerin tan ı ve ayr t r lmas nda ümit
verici görünmektedir.
Genetic variation in honeybee populations of Turkey were aimed to be analysed us ing microsatellites, in this study.
Five honeybee (Apis mellifera L) populations belonging to five different subspecies sampled from northeastem
Anatolia (Artvin-A.m.caucasica), southeastern Anatolia (Hatay-A.m.syriaca), eastern Anatolia (Hakkari-
A.m.meda), central AnatoIia (Eski ehir-A.m.anatoliaca) and European part of Turkey (K rklareli-A.m.carnica)
were studied using 5 microsateIIite loci. A high level of average heterozygosity changing between 0.641 and 0.739
is detected in four Anatolian populations which is higher than the average heterozygosity levels reported for
populations of A (0.234-0.400) and C lineages (0.410-0.564) for the same İ loci. Differentiation
among the populations in Turkey was found to be highly significant as measured by F ST values. Hatay population
was significantly (P< 0.05) different from the rest of the populations. Therefore Hatay population can be
considered belonging to O lineage. ı population which is located in the European part of Turkey, is found
to be significantly (P< 0.05) different from all Anatolian populations and showing similar allelic composition and
heterozygosity levels with C lineage. Higher value of average alele number (14.6 per locus) than the average allele
nwnber found in M (6.4 per locus), C (9 per locus), and A lineages (13.4 per locus) and presence of rare alleles
support the idea that Anatolia is a genetic center for honeybee populations of Near East as suggested by Ruttner
(1988).
Microsatellites seem to be promising in discriminating and identifying different races and ecotypes in quality
control of honeybees in queen bee rearing.
9- Anahtar Kelimeler:
4-1 O adet anahtar kelime verilmelidir.
Mikrosatelit, balans!, Apis mellifera, Türkiye, Anadolu, C soy ı O soy ı
Microsatellite, honeybee, Apis mellifera, Turkey, Anatolia, C lineage, O lineage
10- Projede ı ı ş ı ı ile İ ı (makale, ğ :
Bodur Ç, Microsatellite analysis in honeybees (Apis mellifera L) of Turkey. MS Thesis. Middle
East Tech. Un., Ankara, Turkey, (2001).
Bodur Ç, Kence M, Akkaya M &Kence A 2002. Türkiye' deki ı populasyonlan ı
mikrosatelit ı ı ı ı ş XVI. Türkiye Ulusal Biyoloji Kongresi, İ
Thiv., Malatya-Türkiye, 76. s., 4-7 EylüL.
Bodur Ç, Kence M, Akaya M &Kence A 2003. Microsatellite ı ı in honeybee (Apis
mellifera L) populations of Turkey. ı International Genetics Congress, Melbourne,
Australia, 6-11 July.
ğ N, Kence M, Kence A., 2003. Seasonal variation in PGM heterozygosity ı
honeybees. International Genetics Congress, Melbourne, Australia, 6-11 July.
11- Proje ı ı Gizlilik Durumu:
Gizli x Gizli Dejil

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->