Las ilustraciones originales en este libro son por Neil Hague

!
# $
#

% & '
' #

#

"
$)

(#
$ #

#
!

#

!
*

!

%
&

$
!

#

'
)
!

$
#

# #
, -

!

.

$
#/$

$

+)

0

%

#
$)
0 .%

"El trabajo de Neil Hague es único - el lenguaje de una mente
muy creativa y abierta. Usted mira con sus ojos, pero él habla a
su corazón." (David Icke)
"A Través de Ojos Antiguos debería inspirar hasta al alma más
dimensionalmente resistente para abrirse hasta realidades más
benignas y suntuosas que actualmente se reúnen con, o
integran, nuestro planeta en peligro." (Jaye Beldo)
Para más información sobre el trabajo de Neil y como comprar
sus cuadros visite www.neilhague.com

Contenido
1
1
1
1
1
1
1
1
1
1

#2
#2
#2
#2
#2
#2
#2
#2
#2
#2
#
#

3 4
4
4
1
4
1
4
, 4
, 4
+ '4
4
.4
4
4

/ 1 #

0
9
0

+
,
1

,
5 #
$ %%%%%%%%6
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% 7
5
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% 8
!:
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%8;
1
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%<<
9
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%76
)
=* 0
>
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%?@
0
A
,
A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%@<
B
C1 ) D%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% ;@
,
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
>
B
1 2
5
% E;
"
1 ( 5#
*
F
2
G% %%%%%%%%%%%%%%%%% EE

Verdades Eternas...
Cada hombre toma los límites de su propio campo visual por los límites del mundo. (Arthur
Schopenhauer)
Los medios violentos darán libertad violenta. (Gandhi)
El disidente es cada ser humano en aquellos momentos de su vida cuando él renuncia
momentáneamente a la manada y piensa por sí mismo. (Archibald Macleish)
Pienso que todos tenemos una pequeña voz dentro de nosotros que nos guiará... si excluimos todo el
ruido y desorden de nuestras vidas y escuchamos esa voz, ella nos dirá lo correcto a hacer.
(Christopher Reeve)
No vale el tiempo de un hombre inteligente el estar en la mayoría. Por definición, hay ya bastantes
personas que hacen eso. (G. H. Hardy)
Cualquier tonto puede hacer las cosas más grandes, más complejas, y más violentas. Se necesita un
poco de genialidad - y mucho coraje - para moverse en dirección contraria. (Albert Einstein)
Un cobarde es incapaz de mostrar amor; es el derecho del valiente. (Gandhi)
Aprecia para siempre lo que te hace único, porque tú eres realmente un bostezo si se va. (Bette
Midler)

Siempre Considera el Lado Brillante de la Vida...
Algunas cosas en la vida son malas
Ellas realmente pueden volverte loco
Otras cosas sólo te hacen jurar y blasfemar.
Cuando masticas el cartílago de la vida
No te quejes, da un silbido
Y esto ayudará a que las cosas resulten mejor...
Si la vida parece muy putrefacta
Hay algo que has olvidado
Y eso es reír, sonreír, bailar y cantar.
Cuando te sientes en los vertederos
no seas un tonto zoquete
Sólo aprieta tus labios y silba - esa es la cosa...
La vida es un pedazo de mierda
Cuando la miras
La vida es una risa y la muerte una broma, es verdad.
Verás que es todo un espectáculo
Mantenlos riendo mientras vas
Sólo recuerda que la última risa está en tí.
Y siempre considera el lado brillante de la vida...
Siempre considera el lado luminoso de la vida...
Siempre considera el lado brillante de la vida.
Palabras por Eric Idle, La Vida de Brian de Monty Python

Quién mira afuera, sueña; quién mira adentro, despierta. (Carl Gustav Jung)
Los grandes espíritus siempre han encontrado oposición violenta de los mediocres. Éstos últimos no
pueden entender cuando un hombre no se rinde sin pensar a prejuicios hereditarios, sino que franca
y valientemente usa su inteligencia. (Albert Einstein)
Todas las verdades son fáciles de entender una vez que son descubiertas; el punto es descubrirlas.
(Galileo)

E

= $ A " # $) ! # ) 2$ % H ' $2 " (# = = # " " % H $ & # # ' " # " # &# # ' # ( " " %1 $ 2$ # % . 2 " $ $ # # " = # %9 $ # " $ $ " # # # # # $ # % # 6 J # % # ' (# ! " $ % ! 2 # # " # 2 $ # ' ' " ' ' " . (Oscar Wilde) @@. # ! $ # ! 2 # 2 G% B F ! G% FI " ' !" ' ! 2 $ # $ J $ A A % $ " . sus pasiones una cita. . Sus pensamientos son opiniones de alguien más.% " $ % " J $ ! # " 2 ' " " 2 ! $ J " " # ' $ % ) # # " %* " ' ' " - $ % $ " ! " 2 ' $ K ! ! % " $ A " A ' # %9 ! # A" $ ! # # " ! ) # A % .# $ ! $ " # 2 !" # - 2 $ % # $ ! # # %1 # ! 2 %* % ' ! # $ " # - ! # # ' # # # F1 . # $ " # %." A A 3 " # ' ' ' %F " A ! %3 $ $ ) " # # ' $ % ) $ # %H # 2 G% FI # # # " " $ ! G% 9 # # " # 2 . . 2 $ $ G% FI ' G% . # % FH # %* ) # ' ' $2 # " ) # # " % # " # " ' !) A % # " ) A %3 F $ # 2 # % % ! $ %H G% . sus vidas una imitación.CAPÍTULO UNO Ningún Copo de Nieve en un Alud Nunca se Sintió Responsable La mayoría de las personas son otra gente. $ " # $ 3 ' # ! # # " $ . " # J! " ! % G% # %* ! 2 # . 2 # 24 " # " " ' ! $ ) $) # A A % > ! ( # ! " ' ! .

.* " ! ' F G% F1 # .% FH ! # # % $ 2 # " " 2N% '$ $ " ! # $ ( # # % . # ! % ( ! ' 2 # $ - " - # A# $ 8 " .# ) " $ # . # " " ' ! A A # # 4A JF ' GA %B " " G% 1 A A G% * ! 2 (# !# ' .) " ' " $ 2$ " ' ' A # % $ # 8 # # 2 A# '$ $ $ ) . / .% M+! ' $ D% * % A A( A % $ # $ # A -% # ! " # A ( A % $ 2 '$ % 2" A # $! ( K % + ' ' ! 0 # - " % " $ . ! 9 # ' ! " ! $ # # # # ) # # - ' # 2 " " ) G% " % 4 * 1 5 3 + $ . ! # .! ) % M+' A A # $ F" G% FI " ) ! # " G% * A A # # " ! A # AA # A# " (# ) $ ) % * " # % 1 $ )4 A / " A %& $ )" A " " # # A % $ # ' .% M0 $ $ 2$ ! 2" ! $2 K B % 4 2!9 " 2 ! # 8 .N% . $ )AA $ ' ' ! 2" ' ! " 2 A # A " ' $2 B - ) ! . $ ) " # A G% F ) $ - " 2 " ' G% FI ') ! G% F A $ # # % F9 " $ # ' %F # ! ' # G% F1 ' " ( " 2 " # 2 # 2G% " # 9 ' $2 C ! $ .# $) " " A$ $ ' " ! # " A $ A # . / 7.# . $ " " " $ # . # G% 9 A! AA $ A# ' " " # # # L. . + F9 " " $ ' ! C # # # # . ' ' ' N% F1 5 # 4 $ " - # ( ( # A % B " .6 " ') $ $) ' # " " %3 # ) )" # # ! ! ( D 2 ! # ( # " G% 9 .

verdad?. (Él lee "Dosis Diaria de Ilusión") < " " A! '$ " ' ) %* A 2 $ $ $ . " % ( $ ' # # ( % ¿' Te gustaría salir hoy.2 # " $ ! " $ # " ! # $ ( $ 2# " $ !# % M& 2 # $ $ " J 2 G% '! * 2 ! L ! # # # " 2 2 ' $ " ' %A # " # $ +O ' 2 $ " # % ) # " # $ A % # ! $ 2 $ (# # ) J! ! " # 2$ !# %* 2# ' $ # ! # $ % !# # / # ! 2 / 2 # # # % # # " # .! % " ' ' " = # " " " 2 " $ ' / " # # " D% . ! $ % # " '! .' " % FI ' /# =# ' " 4 A A 2" # 2 @@. ' # " " $ %* ' 2# # ! # # # # % # $ " A $% # 2 # ' " ' $2 ' ! ' %0 ' ) # # " ' # # )4 A / $ - # " % 0 # ' % ! $ " ' # # ' # ' A %3 B > # %9 " " $ A ' ! 2 # # " ) ! . $ " = $ " D% " %9 C: C %H $ / ! " = . Bill?. " " $ # Figura 1: ¿'Pero podríamos salir si quisiéramos. estoy feliz sentado aquí'.' 'No gracias. compañero." A # N% # $ ' 2 2% %& 2 ' ' %A> # " ' " # " # A % $ A 2 .

" ' ( # # 2 A C 0 0 ! 1 0 D% 9 . 2 !' " ! % # ! ' # / # " # 2C # # D 2 $ % . A 2 A ! " # # # A 1 # # $ $ !A # " $ A $ # .¿no es grandioso ser libre?. banco central y ejército mundiales. - @@. $. $) . " # A %9 # (# . " %& # ! . # $ $ ! ) " . entonces . 'Está bien. ! ' ." 2" # # ! ' 2 ' %* # A K > A+ O # 2 2 $ . # $ '# ! # $ C: D% * # . # ! ' ' ' $ . # # A2 A! ' " # # % # #2 ! # $ " !" ' " 2% # 2" 2 ! # # 2" 2 % A %> ! # # % = # GOBIERNO MUNDIAL Banco Moneda Ejército Centrales Población con Microchips Unión Europea Unión Americana Unión del Pacífico Unión Africana (Evolucionada desde la CEE) (Evolucionada desde el NAFTA) (Evolucionada desde el APEC) (Evolucionada desde la OAU) Estados Nacionales y Regiones Figura 2: El estado fascista global Iluminati." P ' 2 % * # # # % # 2 ! ' # # $ " # (# ( ' % # 2 /# = 3 # 7 ! # ) 4 3 .' (# )" 2 ' 2 ' $ # # ! ! # % ' > A 2 # A " " 2 " . El plan es para una dictadura del gobierno mundial que incluye un segundo nivel de súper-estados como la Unión Europea. !A $ ! (# # 6.'Seguro podríamos'. # !# # " . % # ! P . Lo que ahora llamamos 'países' serían simplemente filiales administrativas controladas por el gobierno. # A# " $ % 2# ! # ) # 2" % 3 A ' $ # $ ) " $ A ) % 0 ' % > $2 # = =!! $ %3 )4 A $/ " %.# 2 $ # " . Esta estructura permitiría que unos cuantos impongan su voluntad a la población global. ) 1 B # # A" .# $ % # " " " .

= $ " " " $ # %. $ ! 3 # # 2# 2 2 # % $) ' % / $ # # # : . p. La sociedad global está estructurada como pirámides dentro de pirámides más grandes con una abarcando a todas ellas. %1 '4A % " # 0 ! ' .1 # C: D% & # = ' %* $ =9 2 # # 1 C 9 1D ! # .% ! # # $ " # ) ) ! ' ' " 1 $ # " " # " 9 1 =!1 # 2 ) . # # A $ A 9 # # ) + .% 1 # $ # '. ' # 2 # ) % * )D # 2 ! C $ 9 1 5 3 ' A A" # # . Encima están las familias Iluminati que manipulan su orden del día para el control global a través de organizaciones e instituciones aparentemente inconexas. La gente en los compartimentos inferiores no tendrá ni idea de lo que Religión ellos son parte. ! # # % # # ) # ' ' # 1 . Linajes Iluminati Élite Global Banca Empresas Educación Política Fuerzas armadas Medios de comunicación Servicios de inteligencia Medicina/industria farmacéutica Drogas ilegales/crimen organizado Figura 3: La dictadura de muñecas rusas. ' " ! 0 A # ! 1 ' # 2 % $ " 1 ! 0 $ 9 1 . # - " ! ' # 2 A$ # # 3 * # 2 /# $ # 2 . Las ‘sociedades libres’ son un mito porque la Mano Oculta impone su orden del día detrás de este velo del engaño. % .%* # 2 # # # $ % La Pirámide de Manipulación Niveles de conocimiento y jerarquía dentro de las instituciones. quienes deciden la política coordinada a través de toda la pirámide.ej. ! # # ) .# $ %+ # $ # ' 2 # A %%% $ A % # 2 $ # %1 # " 2 0 . de cajero del banco a presidente de la junta Todas las instituciones y grupos principales que afectan nuestras vidas diarias se conectan con los Iluminati. 9 # ! % # # ! # % $ # A % # " Q A *$ 1 ' ' $ # # " # . A! ) A $ " . # % 2 # % * $ " $ # $ # " ) . $ # = = ! # # 5 ' ' # 2$ ! 2 B 1 C ? # # 0 D' ! # .

$ . %9 # % ! # %1 # . $ ! $ " ( ! '" J % # % * # $ 4 # " F # 1 $ " # $ $ !' $ A A %* " A 2A A " % =! ' A # A D A! # " A # " A % # # % # G% # %M ! # A $ A # " " A ( ' A # N% . # !' # - # ED% $ 2 2 " # # $ 2 # % " " ' ! # # " % Figura 4: El Dinero es simplemente deuda. 2 A % * . $ ' " $ G% .R# # $ " # A A # # $ # > #' # ' # ' # 2 ' $2 / " $ % 2 $2 A K %F 2 # 9 1 G% & @ ' $2 # '. $ 2 " $ # 2$ # $ %* $ $ $ A # # # # A " " " $ C: 6D% F1 # G% F. y hasta el 'dinero en efectivo' es sólo un pagaré que promete pagar en algún tiempo en el 'futuro'. $ " %9 % " # # # = %1 # . $ ! ! . $ # ! . ' # # # =# # %* # A A ! $! ' # $ A $ ( " ' A # A # # $ # . " # $ %. Está allí para que todos lo vean en los billetes de banco británicos.2 $ . # ' # ! $ %. $ % F1 # # '! G% 0 # A " ( A " # " ' A # A! # # " %* " = '" C 2# ' " !A ! # 9 #' # 2 ! '% > # 2 " $ # 2 ! 2 <.! # # # " # # 2 # ) " $ ' ! A %* ! # # ! # # # # # " $ # # $ # 2! $ # C: # " # ! %* .

! # $ " # 2 # %9 K $ ! " 2 G% % % %9 # 2 %1 # # '! % # -2 1 % * = # " 2 # # $ $ $) !B # # # # ( ) ! ! # %* 1 : 1 $. $ " %0 ' # # " # # A A $ $ '" ! % . o tan dependientes de sus favores.. " # % %1 .E 1 1 ." # $ $ # ..' $ # # $ % % $ $ % $ '! . aguantará su carga sin queja. mentalmente incapaz de entender las ventajas enormes. A A # # # " $ # %* # $ %* # S ! ) # % * $) # " # # # $ $ M9 # = =# $ # ! ( $ ! # -2 = # " ." ! " # " # ' $ # # % 1 " .. # ') 1 9O 0 ' ( # # ) 2 % # ) ! $ ! !# %* " % ( $ @?6% 3 # 1 1 " B ' ) # %> # / A A % # ! . el gran cuerpo de la gente. !' % 3 # 4 # 5 ' ' H ?<E Los pocos que entienden el sistema o estarán tan interesados en sus ganancias.!' F9 " " $ # ' # # # ! # 4 # # $ " ! # " '! A A / " " ! # S# C D # 5 3 % 2 # ) $ K A # A # # ( !# # % A # '# A % F9 " '# G% / N% MH $ C # # $ 2 ! D % " $ % # $ ! N% # ! T 2 " # J ' @7. mientras por otra parte. ' # " T $ 2 # ." ! " $ # $ # # # # ! $ ! 2 # % $ # # $ # ' " # 2 !' # " " $ # 2 " # $ ! $ %9 $ " # # $ # # .# # # 2' > #' % # % # 2" A ! # A # A L A $ 2 # # " 2 # ) # $ # # " ' $ # # N% $ %M # ' $2 L # 2 / ( # # $ . ' ' ' " ! # $ 3 " # 2 # " " ' C:11D # " # " K ! +O # ( : ! # # $ % # C . que no habrá ninguna oposición de esa clase. y quizás sin sospechar que el sistema es hostil a sus mejores intereses.

% K ! 2 A A % K # B1 1 B1 0 .1 0 V 0 > U . . : V 5W : ( V . .. U 3 S0 V>55 ! UV I 9 5 % $ # 3 . ! % '! # ! % ' ! % ! . . 3 B1 ! $ 3 B1% # " # # % H = 5 U .%* # $ 5 0 ! %* 2 ! # " % $ 2 '$ A ) % 2 Figura 5: Los ataques del 11 de septiembre fueron un ejemplo clásico de la técnica de Problema-ReacciónSolución y las 'soluciones' fueron todas planeadas mucho " . . A# # ) A B * $ :B ! = %* 5 ' ! % # A (# A %0 # # # A A! $ # $ A # A % ! '# % # ! 2 ! " " ! $ 2 $ $2 $ ' / D" #/$ # # 1 $ A A ' 6' # 2% * # A A' " " 2 # # " A# A # # # " 2% 5 # 2" 2%9 # . " A @@ # A " " )" # $ " ' $2 %1 # " ' $2 # # # # ) BB1 " A 5 0 AC # D * # # A# A $ % A $ 2 '$ ' .) # # ! # ) 3 # BB1 # " # $ 5 0 .+ : V0 . =: U B1 = V B1 * Q U 0 I 1' U1 3: V . L S. U > U 1 ' U 10 > 1 $ U 0 B ' UL 5 9 V SVU >H * Q L3 H U . ! % ' $ ! ' $. # % # ! ' " = # 2 #/$ ! ' . % # 0 ! (# C '$ ( ' ' =! ! ! %: K > A A % #/$ C D '. # # 2% A " ! " " # " . L S. 1' VW W S: U ' V V. S: U ' U 51 U ' U L0 V . . B1 B 0 . (Vea $ Alice en el Mundo Maravilloso y el Desastre del Centro # Mundial de Comercio y Cuentos del Bucle del Tiempo # # ! # para el trasfondo detallado).$) D # ! * # # # # # ' .# " antes de que las torres gemelas fueran golpeadas. # -2 " ) ! D# O ' #'% 3 A A # # K $ / ! ! 2 %3 # ! # ! ( ' % ! ! +*= =U # A ! " $ ! ' # %. : VW . B * 5# ! 1 0 ! :( ':( 1 # > !O # # 2 !# $ O # 0 # > # 1 :( O C " ' ' 0 ' / %3 .

que aumentan la ansiedad y así la sugestionabilidad individual y masiva.. .# $ D ' $ " A $ ' A 8D% 1 ' . # # ! ' # GA % # 2 # '# # # # $ G% 3 $ " . durante epidemias severas. C # D 2% ') # $ " ' $ ) %A F # $) # ! ' # 2# # # " .# ( # % M ' ) # .! ' 2 ' '#% 1 2 # %A 3 ' A ) %F 2 # '# ' $ ' " # ! ) # ! # # = %1 # . # ! $) # ) '# " 2 # . accidental o deliberadamente inducidos.' * . ' 2 2 % # U $ $ @87 'Varios tipos de creencia pueden ser implantados en la gente después de que la función cerebral ha sido deliberadamente interrumpida por miedo..# $ A % * # ! " # # # " K B # 0 4 1 # ! # # % - ! / # .# # '# ! ) N% # $ ! # $ A $ ' - $ ! % 3 2 C ! " . cólera o entusiasmo. Sus varias manifestaciones grupales son a veces clasificadas bajo el título de 'instinto de manada'. Nos aconsejarían no subestimar el efecto en la psique colectiva en términos de miedo y un deseo de que las autoridades "protejan a la gente" de ese miedo. J! D " $ # # ( %. !D ) " ! ' $2 ' $2 # " ! # $ #/$ ' $2 / # * " # ) # . '# ! ! ! # " 2 $ ! % 2 " '# 2 # G% 9 " # " %> 9 # '# % 1 . '. %%% # " 2 # # 2N% # ! # 2 " " $2 # %3 ' $ # " # ! % $ (# # K # ! # # ' / . " ' 9 $ =5 =.# ' $ %1 # ! (# ' # %. y todos los períodos similares de peligro común. y aparecen más espectacularmente en tiempos de guerra.. * $ $ " C: +O # . # $ > ! # # = ' # $ 5 0 # # 2 B ) # $ %9 # " $ J# # # ' A A % * '# ! 2 2 ' . De los resultados causados por tales perturbaciones el más común es el juicio temporalmente dañado y la sugestionabilidad aumentada. $ %F ' ) %. B ! % H ! # . ' # AC $ 2 ' # # A # # $ $ $ " 2$ ( # # # # ) " # % ' ' .# # 2 $ % * # %M # ! 2 %* # .# # # ' C.

U $ # . ! . 1'# # # A # # E ! # # '# .el mundo con microchip simbolizado por Neil Hague.% 3 # C# ! # 9 3 . protector. Será su guardián.D ' # # $ " 2 ' $2 ' $ ..C: < ! 7D% > " ) '# # ' # A # A' .# $ 4 . D! . 1'# ' '# - # # ! : K A J! $ . A ! A # 39 D" C >>. '# $ X' 9 >) 2 'El Ángel Digital será una conexión desde usted hacia el mundo electrónico. > D# A ! # $ A A 2 " '# ! # 2# 5: " ' # +O # # $) $= # " # .# # # # '# 1'# A # . '# Q % # # 2 ) .' ! '# ! . # " A 3 $ 1'# V A A A " # # 2 % Figura 7: Campos de concentración digitales . # C ## .6 ) ! A % % 1 # # 2 5 $ C5: D " # %A * # 2 ' $ ! ) ' # $) $ # # ! A 2 %1 $ # C D4 A 0 # ! # #/$ ! $ # A % ) # # C " '# ' Figura 6: El microchip con el tamaño de un grano de arroz diseñado para convertir a la gente en robots. +5B1+0 0 # -2 $ . 3 2 # -2 # # . Es vital para la libertad humana que la gente rechace ser implantada con un microchip.# $ ) # $ $ $ / # # % # %I # $ % " # -2 " 0 .. " # # $ '# # # > # # # % ' %3 $ ! " # # # # # % 9 # '$ # # 0 ( # # -2 ( # # = A % '# $ %* ! $ . Seremos un híbrido de inteligencia electrónica y nuestra propia alma.. A A # " A V %. $ .6 " ' $2 1 # ## . D : " # A !A . Traerá cosas buenas para usted.C . > $) T.

2 # $ $ # $ ! # # ) $ $ " # ! 9 3 ( $ # > *$ '# ' 2 # $ # ! ) %. 2 " H # " $) ! - # K B0 # # ) " . A( A ' .% # " C 1 D! @<@% " # # 2 %%% * > # " $2% " ' # * $ D! % # " 4 La experiencia ha demostrado que el método más simple de asegurarse un arma silenciosa y ganar el control del público es mantenerlo indisciplinado e ignorante de los principios básicos del sistema por una parte. @?< $ $ . Esto es conseguido por: 1. 2. violencia. mientras por otra parte se lo mantiene confundido. # # ) " ! %1 # %* 1 '# $) .6 = # -2 # # 1'# C # .% @86A % 3 . y distraído con asuntos de ninguna verdadera importancia..sobre todo la TV y los periódicos. diseño de sistemas y economía. desacople de sus mentes (de la planificación). $ ! L' * # A %. > 3Y. saboteando sus actividades mentales. comprometiendo sus emociones. # . !. # $ # " # $ %* # $ % '# # 2 ( K # B D " # # ! " % . proporcionando un programa de baja calidad de educación pública en matemáticas. # % # $ ' ' # ! ! ! C5: D # $ 1'# # # C: ' 2 $2 @@6 " ' $ C # '#% # # '# # '# !# ( # $ ) # ' @@7 " '# & ) " ' H * # / ( C ( # %3 # 1 C 2 '# ' # # ' ! ' $ # 3 " A A % : ' # " '# " # 2 !' % # % # @8. aumentando su auto indulgencia y su indulgencia en actividades emocionales y físicas por: a) endureciéndolos a afrentas y ataques emocionales (violación mental y emocional) mediante un bombardeo constante de sexo. y guerras en los medios . A # 9 B 'A# ' '#D %* $)# # # ! %> ' 2 $ $ # # # ' ' A ' # A '# $ $ ! $ % F1 " # " $ G% D! # B $ # D E@ %%%A %L ! 9 3 # ! A . desorganizado. y desalentando creatividad técnica.+5B1+0 0 # # )" ! %. 6 . @86 C " # " $ $ $ ' # $ # 2 # D ) ) " % # '# # # # " % 2' '# # $ 4 A $. # % $ .

a más confusión. F5 G% 9 # $ % F> !! " # #$ 0 > # $ # $ ! S # $ # " ! ! 3 ' ' ' # " " !/ ( Z " ' A ) " " # ! 2 # ' - $ # " " " . y cautivada por asuntos de ninguna verdadera importancia. es decir. operado por un programador de ordenador. uno que sabe qué buscar. el arma silenciosa es un tipo de guerra biológica. en vez de balas. el público se ajusta / adapta a su presencia y aprende a tolerar su invasión en sus vidas hasta que la presión (psicológica vía lo económico) se hace demasiado grande y ellos colapsan mentalmente. pero debido a la naturaleza técnica del arma silenciosa. ocupado. en vez de un arma de fuego. propulsadas por procesamiento de datos. o manejar el problema con inteligencia. sin tiempo para pensar. de regreso en la granja con los otros animales. mentales. y no saben asociarse con otros para defenderse contra ella. La regla general consiste en que hay ganancia en la confusión. Escuelas: Mantenga al público joven ignorante de verdaderas matemáticas. El público no puede entender el arma.b) darles lo que ellos desean .' A A 4 Dispara situaciones. en vez de un general militar. y el descubrimiento de. y no interfiere obviamente con la vida social diaria de alguien. más ganancia. Ataca la vitalidad. Cuando un arma silenciosa es aplicada gradualmente. Éstos impiden su interés en. entendiendo. ellos no pueden expresar su sentimiento de un modo racional. las armas silenciosas de la tecnología de automatización social. manipulando. siendo así capaces de cambiar su pensamiento de las necesidades personales hacia muy fabricadas prioridades exteriores. Por lo tanto. no causa ningún daño físico obvio. ocupado. y sus fuerzas y debilidades físicas.y privarlos de lo que ellos realmente necesitan. en vez de granos de pólvora. bajo las órdenes de un magnate bancario. En resumen: Medios: Mantenga la atención pública adulta distraída lejos de las verdaderas cuestiones sociales. Aún así hace un 'ruido' inequívoco. Por lo tanto. inequívoco a un observador entrenado. ellos no saben cómo pedir ayuda. el mejor acercamiento es crear problemas y luego ofrecer soluciones. El público podría sentir por instinto que algo está mal. y verdadera historia. y emocionales. c) rescribir la historia y la ley y someter al público a la creación anormal. Trabajo: Mantenga al público ocupado. verdadera ley. desde un ordenador. opciones. Esto no hace ningún ruido obvio.en exceso . y atacando sus fuentes de energía natural y social. causa daño físico y mental inequívoco. en vez de un tirador. verdadera economía. Por lo tanto. y de modo inconfundible interfiere con la vida social diaria. # !/ 1V G% ! " % # S $ S# $ C 2D %1 .'comida basura para el pensamiento' . Entretenimiento: Mantenga el entretenimiento público por debajo de un nivel de sexto grado." S $ !/ % ' # " ! ! ! % * ! # # ! ' $ ! ) $ # !/ ! / / % ' $ C! )D $ " ! # ) ' ! # $ % $ $ % * = % 2 = # # 8 A# " % # ! ! ! 9 ! # ) 1 %* " " ) $ $ ! . y movilidad de los individuos de una sociedad conociendo. y por lo tanto no pueden creer que ellos estén siendo atacados y sometidos por un arma.

" '# " # # 2 # # # # J $ $ 0 ! " # ! . " ! # $ % 9 2! ) % D $$ ! ! $ # # 2! .# " $ " ( % 3 ) # % ) B # * ) ! 3 1 $ ! K B .2 # " A A % # " ! # # ! $ $ !/ # " $ # % $2 # # 2 > #' # " / . # $ ! . # $ 9 / % # ' $2 / # $ # " $2 " %& %9 # " '. % )2! '$ # $ / # 2 ' $2 $ !/ % " # # ! " # ! # A A" ( % $ # % ! H* ! # $ # * > " ' *$ # $ J 2 # # ' !1 .J " ' # $ $ !/ ' $2 # " % > '$ ). % # # . los medios principales destruyen la información y las religiones destruyen la espiritualidad. # %9 C # % ! # % $) # # ' ! ! # 2 $ ! $ " 2% % (# ' ' " B " J' $ '! $ 2# ' 2 # # 0 ' % ' %* ) # ) # # '4 'Sólo mírenos. Todo está hacia atrás.' F9 " G% 9 " # " ' % < . / " 2 # # # # # # # " $) ' ) # 2 311% * 1 # ! / $ % 9 2 '$ $ ) # $ ! 2 > #' ' ' # % # $ # # % # % $ $2 ! # $ % 9 " 1V A= " # $ B *! 0 2 $ ! $ 3 1 =A ) ! ' $2 $ $ ! # 2# ) $ # 2 ! " " % % # !/ # ) " $ # $ %+ # ( )" " ' $2 . " $ A ) $ % .% # )# ' # $ $ " ! (# # " ' % # )" ' $2 . todo es al revés. Los doctores destruyen la salud. las universidades destruyen el conocimiento. los abogados destruyen la justicia." $ $ ! %* # -2 " # # $ $ 'J " - 2 " J! " A A $ " # $ ! " # # 2% 3 .! $ ' " 3 ! 1 # " $ # " ! " 9 $ !/ 2# " ' $2 ! # ' ! " $ % ! . $ !/ # 2 # . $ ! ! ) " 2 # " # 2 " $ !/ %A . los gobiernos destruyen la libertad." .

.. S # A2 $ # $ # ! # (# 2 # # ) " 2" " $ %. (Oscar Wilde) " # 2 # " '.. . ! ' % %3 $ " ' " ( ' 2 " %0 # # " # " 2 " % * 2 " ( " $ $ # . 5 5 # 5 # ! 7 # $ " %0 # B # ! A % ! # " 5 2 A ! %. " ) # $ 2 # ! A ( # # %5 ' # " 1 % . % $ # / - ( ' " 1 # ! A # * A' $ 2 ! @. =" . ' %1 # # = " B # = ( ( $ A ' 'A % # # # @@./ . ! . " @@. / # $ " " # " !# " ( " 2 # ' $ 2# # " * # $ ! " " ) $ # " ! 2 % ! ' 2 2 %9 ( ' $ A .org/tools/owners/ 1 CAPÍTULO DOS Más Allá del Velo Cada vez que la gente está de acuerdo conmigo siempre siento que debo estar equivocado. A # " A ! # %.: Columbia Journalism Review: http://www. 2 A " = % = # # ' # ! " / # 2 ! ! % 2 . ! $ 2 A % A ) ! ! 5 ! ! # = ' %3 " $." $ # ' # # ! %1 2 % # # # % A 2 ! / $ A .8 # ' # A % 2 " ' 2 .%.%+ " $ ! $ %* " ! # 2" C 2 " # $ # % $ . / # # " " ' 1 # # # DJ # $ # # % %1 # T ..cjr. . # ( A ' '$ ! # . A2 # " '$ # 2" ! A " ! ! # %* % # " % .

D" 2 # # " $ # #/$ ! % 1 " $ # # ' " # ! (# $ % # $ ( A # " ! " # 6. J# A 0 ' " 0 2A 2 % * (# ! % ' $ ' 3 # ! # ! # ' %3 " # A# 2A %A FI GA# A A % " # %3 $ '$ 2 ' # ! " 2 " 2" $ $ ) %* # # ' # " $ " ' % 1 # # " # . # # J 2 . # 2 $ A = " % # # ) # A ' ! # $ # " ' # $ # # # '$ % A ' ) # # A # %3 # 2# 2% A ' # # ! ? % ' .# # " # " % * '" # 2" " # $ A! % $ A # 2" A % * # 2" 2 # 2$ ! # A # ! # # A / $$ # ! % 2 $ ' A A= # " ! A # # % $$ " # # =" # A % = % * # " ! " # $ # # ! %* A 2% * " " A A " # # # % ' !A $ " ! # # " " " " $ .6 $ # $ # % >% % 5 ! # : .# # # # " 1 % # A2 . $ # " ' " ! ' # %3 # $ % $ $ ' % " A ! A J # " " $% # %3 $ / !# %1 $ # # %> # " # # # # % 3 $ ' ! ' $ . A A # 2" %> ! # 2 ! '" " # $ " # # .. ( $ " .2 ' # # # % # # @@.! # ' # '# A! A A A A # 2 " # $ %1 %1 = A " %* . # . . * )4 A / " ) %9 " # % ( % $ A % . C# # D! C $ # .% > $ # ! ! # .

5% Materia luminosa ordinaria 0. 1' 25 # " A >) 9 = S D% C' 5 # .8 # # # ! 2 % = " # ' " # A = .. A CB Figura 8: La vista humana Energía / materia oscura 95% Materia no luminosa ordinaria 4. Histérico. # # ." 0 O 9 A! # ' '$ + .005% %& ' !% 1 A >) * ! " # A ' % ' ' : = # # $ @ ' %9 ! . # ! ' ())* fracción casi inmensurable de la materia / energía que se estima que existe en el +universo ¡y todavía la gente ridiculiza la suposición que " $ AC ' # " .'luz visible' .# % # 3 A $ # " # ' # $ $ # # $ 2" # ) # $ % % # ' ! .8 # A(# % C0 2 ) A $ A %* % # $ ' ' % ! 2 %M # $ ' N% # $ J# A % 2 68 [ 2 ' 2 # . 400nm * 5# 10 " $ 750nm ' -3 1mm 10 1cm 10 1m 10 -2 # $ % # ! # # 5 " # $ ' # ' A! A # A# ' ' # %1 B ' # # % 1 & 0 # # ' ! ' -6 ! # ! Figura 9: Incluso dentro del -13 Longitud de onda (metros) 1 m % " ! @8 # # # . S # # ) # $ A= A. # # nunca han visto a un 'extraterrestre'!.puede ser accesible -9 a la visión humana.5% Espectro electromagnético 0. # # # ) ! ) %D1 ) # ' ' C A 2 S A D # 2 ! ..! # no estamos solos porque " ! # ! D# ! A D sólo puede percibir una # A.. / . A # A ' # A A # # % # # A A ' ! # J $ # A A # ' $ % " # A A C: ? ! @D% A" # " A A # ) A # # # ( .. ' # " A 2 2 # # 10 1nm 10 2 2 # " " 2 ( # $ % M1 N% 9 # " ! 2 # #/$ % # $ " # espectro electromagnético sólo una fracción .

$ # %* # # - $ " # % " . # # # %1 '$ A2 A ! '! # ) # . # # ' '$ # )5 ! # # J . el ganador toma todo. constituyendo así un aspecto del control de la Matriz. un deseo de controlar. pero ellos son 'poseídos' por reptilianos y otras entidades que operan en los reinos más allá de la vista humana y dictan sus acciones en 'nuestro' mundo. # $ # ' C: # D% # 2 JA ! 2 '! A! J " . Éstos son los mismos rasgos de los linajes Iluminati.! # ! # $ D% Figuras 10 y 11: Vemos la forma 'humana' de los linajes Iluminati vibrando dentro de la frecuencia de la 'luz visible'. es la parte más antigua del cerebro humano.# # A # 2 A# " ' ! A ' # " # . !# " # # ! # " # # # $ " 5# C ' # $ ) % # % # ! A # ' D % # 2 = A= Figura 12: El cerebro reptiliano. o 'Complejo-R'. C: A % 9 # #/$ . (dibujos de Neil Hague) (# # # # " ' . una obsesión con estructuras jerárquicas de poder y la idea que la fuerza es derecho. 1 !' # $ '$ % ( '$ %* # " ) . $ ) 1 / 2 2 ) " % & % # " % # # 5# ' $ A # A # # % " . . ( %1 $ ' ! # $ $ # 2 # $$ " 2 # ! # ! . Representa el instinto de supervivencia y produce los rasgos de carácter del comportamiento de sangre fría.

más primitivas en nuestra evolución mental. " $ $ " # " # ' # ' = =' .A2 2 A % . (ilustración por Neil Hague) '. El deseo de exceso viene del "cerebro reptiliano. 4 A . ! $ A # # # .6 # C# # # " # " 2 '..# # / # A % B ' # # ! # # $ B '% M # # ( " ' $ " ' $2 # ) # # N% P' $ ! ! $ # B ' " G% $ # .. # # 2 A # % F K (# J1 K% 1 P 2 # A % $ 2 $ $ $ ( 5# # K D " = . El reptiliano quiere agarrar tanta comida como sea posible. $ 0 " 4 Figura 13: Los hipócritas (y luego unos) Iluminati manipulando la sociedad humana bajo el control de los Reptilianos." las estructuras más tempranas. Cuando llega a una . " # # " # # # $ $ # # ! %* ! # . ser tan grande y poderoso como sea posible. $ ! # " " # # 2 $ %3 2 * ( % : $.. A % # ! $ . # 1 . porque está concentrado en la supervivencia.

'2$ # ') %1 C6%.' ! # # $ # 2 $ # ' %* A K " ! # $ # ' $ .D% * : $ Figura 14: Carlos el Grande. el Rey de los Francos y Emperador del Sacro Imperio Romano Germánico. Adolf Hitler y los nazis también estuvieron obsesionados con él. A" $ 5! # # ) 0 ' # 0 $ . o Carlomagno.. Bush descienden del monarca nacido alemán.3 ' ) # J # ) / # " * : # 2 (# B ' " . ' % A ' A 2 ') ' # $ $ ' $ % * ( # # " $ ) .$ ' % 5 2 2 .. el reptiliano siempre gana. 1 ) 5# # ' # 2 # % # " # " # # AC: $ # ! ) %> C76 =? 6D $ 1 # 5 K C: 6D% 6E # U ' B ' " > ! . Nuestros apetitos insaciables han dejado a los norteamericanos 9 libras (4 Kg) más pesados. de lo que estábamos hace dos décadas. y más vulnerables que nunca a la enfermedad cardíaca y diabetes. 1D " . $ B ' B $ ' 1 ' " # ! # B 77<% # # = # % = # %5 " .. Su linaje es muy significativo para los Iluminati y 35 de los 43 presidentes desde George Washington hasta George W. # # ' 5 # ( !* >) # 0 ! # C 0 ! . %& ' 2 # ) ' 5 .opción entre el intelecto y el reptiliano. en lo más profundo. B ... ( % > A 5 A ) " . %. por término medio. . 1 # . Acumulamos montañas de deuda (los cargos por mora que pagamos en tarjetas de crédito se han más que triplicado desde 1996. %* # 3 1 . * (# . B ' %* % > $ > # $ A ' # ' ! $ C: 5 # ED% W 8D% ! # # # 2 ! $ " $ ) # $ % # ! " ( ! " 2" . Exigimos cosas que.# =1 # % * 2" .. %* K ') # ! ' # # ! # B$ >) " " . realmente no queremos o ni siquiera usamos. " E8 J > 2 #2 : ! # ( .% * . ) . # " % 0 % # # # # $ ) % ! # $ # " . $ . 'Satisfacer ese lagarto interior tiene sus desventajas. a u$s 7. que vivió de 742 a 814.300 millones por año) y quemando combustibles fósiles como locos.

: ! # # # $ * B $* = % " $ # 5 2 # B . incluso los Bush y Windsors. Dracul fue la inspiración para el Drácula de Bram Stoker y muchas familias Iluminati descienden de esta línea.ahora Rumania. Mary de Teck. . ! # 2 " # " ' # %0 $ ! # # ! " $ " 2% 1 ' (# $ # $$ ! ' " ' . * 1 !D" # 2 . . . Q ' . el regente del siglo XV de Valaquia en la región una vez llamada Transilvania . ( 2 ' ' $ A ' 2 ' ) ' C ( %H ! % - E A 2 " . % * ) '2$ (# B $ .'2$ " A >) . o Vlad el Empalador. 2 = = ' . La reina Elizabeth II está relacionada con Vlad el Empalador por su abuela. = $ B $ % ! ! # : 5 B 5 ' ' 5 B '! " $ % # # B '! U ) # $ $$ ! % # ) " # # " $ $ 2 A 1 A $ " ) 5# ' # . % ! # # # ) '2$ # # " 3 % 1 # # # ) # % ) ) ! " # ) ' # ! ' " # 2 % * / " # ' # " $) $ $2 " %> ! # " # # # 2 ' ' . # ! ! ! '2$ $ % * ) '2$ 2 # # '! 2 # 2 ! " " $ # % '2 A A 2 # 3 U ' ' B '% B $ 2 # ' ! ) # " . # ! # # $ 5 C# # 5 D # % ! # ! K B . ( ! # # ! $ % * $ 2 $) # - # $ ! " " # 5# %0 ' ' ) " # .' %. ) '2$ ' = # A A ! A ' K $ A % A 'A # " 2 A A! $ '2$ A A %: " ! ! # % 1' # ' $ A # A! ' # # 2$ # 5# % * ! 0 " '! A 2 0 A A A! > ) 0 . # A % 2 ' # % $ # $ )% # " . ' ! $ # $ ' $ " 2 " 1' $ # 2 % Figura 15: Vlad Dracul. ! A ' A % %.

. Éstos son los reinos de los manipuladores Reptilianos y otras entidades que procuran poseer a los linajes Iluminati y cualesquiera otros que caen vibratoriamente en sus garras. ! # ( 2 $ " ! ( # ( .# =#/$ # $ ! ) . # A # $ %1 0 O # 2 # A %3 % ' ' $ # " " ' # ' A" K <D% & # % * 5 " 2 ! $ 5# # " # 2 ' ! % = # # # # % ' $ $ # # %& # # # ! ! " # )" A ) % # . $ ' ) $ . # %D 1 > " # 9 % ( # A ' 0 2# % FI # ! ' . (dibujo de Neil Hague) * $ ' . # # $ $$ % $ # $ %0 ' # " 5# # # A ' ' $ # - # ! $ - " $2 .5# ' $ 2 G= #2 '! $ # " . . # # 2 # # 2 % # @<? A # 2 # # $ A AC: A # # " # %C # # # $ . % $ % ' ' J " # % A ) A " ! 2 . / 2 $ # % ! 2 B $ 2# 2 % . . " ! " " # 2 ' ! # ' ! $ 6 # A % " # - ( 2 ! " ' ' ) $ # $$ # $ $ " %1 ! ! A ' " ' ' ' ) % 5# % $ " 2 !# 2 2 # # %* 2 . % Figura 16: Más allá de la frecuencia de la visión humana están los planos de intervalo entre esta dimensión y la siguiente. 2" ! # 5# # 2 " " 5 # ( A! A 2 # %* # !' ." # % C0 $ $ . # ! 5# ! 2 " $ + .

2 ' $ % # ! .. 2% * # $ 2 # 2 # ! 2 # 2" # .E % ' 5# # $ ' # ' . # A A $ % ( ' % $ " A A" / " " # ! ' $J % ) $ # # # S 2 A .# # ( # ! $2 $ # 1 ! $) # % # ' # . %D% " ' $2 5# " # " $ # % ! 2 # (# " $ ! # % # % 3 ! 2% CAPÍTULO TRES Descargando Realidad La verdadera vida de uno es tan a menudo la vida que uno no conduce.. (Oscar Wilde) F1 A # ) G% A " '. " 2 # " " 8 " $ " $ A # " - A . # $ %* " )G% 0 2 ! ! / ! # " " # " " ) ! K (# % + ! ' # " # " ' $ %. # " 1 2 " # # . A.A A2 % # % " $ " 2 - % A % * . ! " # # # # # " # # # 4F " # # ( . " " %* # F1 # $ ' % 0 %9 %. 2 $ A . ' ' " % 2 ' ) # 2 " ' ' " # # # # ." . 5# 2 % * # # # 2 ! ' '# . ! # " $ " ' D% # # !' " C $ D ' ) $ % " $ # !# ! # -2 # A A' # " ( " ) $.8 # " / ) ) %. % # ! ..# " G% ' # $ " ) # " ' # ' ! ' %* # $ $ " ' " # ' $ # # 2$ ! ' $ %0 $ " ! $ $ % # ! ' # ! # $ " " . # ! # # ( ! ! # ! # 2% * A ' A ' # = C # / (# 9 ' %9 $ # % (# 5# - ! # %* ' ! @@.

(

C:

7D%

'!
$

/

A

A

#

$

J

%
Figura 17: El cerebro crea la realidad 'física' descifrando
señales eléctricas en una ilusión tridimensional holográfica.
Esto es hecho por la corteza visual en un nivel, pero el
cerebro entero está implicado porque es un holograma,
como explicaré dentro de poco.

0
#
# A2 AM
!
$ !

Corteza
visual
primaria

2
$

'!
=

/
% ,

"

"
A "
"

A
#

"
#

#

'

"

%*
A
(#
# "

!
AA
C:
?D%
2
(#

#
#

%
$
$ .%

#
.A
$

"
'!

%

$

"
%
#

$
#

! '

#

$
$

$
#

#

( #

#
$. = !
"

-

-

#
"

$
(
$ N%

/

#
'
'!
!

"

%
Figura 18: El único lugar donde el mundo 'físico'
existe está en su cerebro. No hay 'ahí fuera', como
lo percibimos; sólo un 'aquí dentro'. Los ojos sólo
transforman el diminuto rango de frecuencias
conocido como 'luz visible' en señales eléctricas
que son descifradas por la red de cerebro/ADN en
una realidad holográfica 'tridimensional'. ¡El
mundo 'físico' que pensamos que está 'alrededor
de nosotros' sólo existe en nuestras cabezas!.

#
'

$

=

% 9

#

.
#
A
% ,

$
#

'
#
2

"

AA
%

#
#
#

#

$

!#

"
C

=

=

*

#
D
# 2
' 2

#
#

$
9

#
G% , = =

/

(

# (
#
'
$

$ !
%* "

C

=

#
#
% *
=
D%

# !
"
"
% F1
= =

$
J

#

'

!
."

%
CD
#

J! CD
"

A
L' U !
#

!

#
#

#
."
)% +
) #
%
!

"
%
"

$
#
% &
'

#

#
$ 2

"

B 'A
" '$

"
<

#
"
# "

A!
#
)
! "
$

"

#
"

# 2
!
'
$
;;6
" K
U% B '
# #
JC$D
" 2 !
$
2
#
'
$
#
%
$
# "
#
$
$
.

#

$ !
" #

1

#

)
"

"

$

#

% >

%

'

1

B
#
$
'#
.
"
#
%* " #
# 0 '
$
$
( #
3
>
C> # 9
H
@@ D% 3 #
#
'#
!
#
#
"
#
"
. %9
2 ! $2
. # "
#
#
'#
.
2
$
$
% *
'#
#
#
#
. %
#
%> !
!
#
#
%
$
' $
L
U
$
%&
2
$
#
# $ %1
."
2
$ A
A
$2
2 J!
$
$
$
$
# )
CFF
$2 "
$
2 GGD% H
2
"
#
%+
A
A
!
# $ %3
'! * '
) #
"
! # $
$
2
#
#
%1
!
/
$
%
! " #
#
#
#
%
1
#

!
"
%

'

'#
-

$

#

.

#
A
%*

"
$

1
#

%
' A
# 2"

!
A ) $
!
'#
%
A
L /

$
A
D
$ .% 0

A
#

A

"
'

'
"

A !
. A
%

;;#

(

#

#
% 1
#
"

"
2

,

"
.

(
#

#
$

)"
AA
%
$

%

$
'
,
. / 1
0 O
# "
.
# "
K'
)"
! #
A
A
%1
#
%

F 2" "
G%
) #
#
#
#
'$
.
$
.
#
#
% *
2
# 2 '$
! '$
%* . '
#
C
D

!

# "

0 '
$
)
"
')%
"
' "
#
$
A
#
# 2
')
.
2 #
# 2 2 % '#
.
$ %& )"
2
! F# 2
#
# "
#
$ #
% A
3
# 2
#
)!
2 '. % M
!
)N% F # $ G% F:
G%
$
%*
')
$ 2 "
"
$
!
$ #
% 1
= # 2 =
' $2
#
#
"
$

"

=

A
#
L / C!
' '
)$

)

'#
.
2 # .

#
#

D'
)
'
%
)
A

#

!
)

#
A

C!

!'

!
A
#
A
#

"

"

"

'#

#
')

.

%1
) % , ')

%P P
') ! #
"
G%
#
)A ) %
'#
.
#
')
$
#
#
'#
$2 !
A
A
') "
%

#
#

"

"

#
'

#

"
!

'

#

#

7

A
"

!
.
# 2
.
'#

%
(#

$
$

!

%
A

' '
"

%
A

A

#

.
G% ,
(
" # 2
' "
'!
#
'#
. J
'#
.

'
A
#

!

"

$

(
"
# "

% 9
% F9
) "
#
A( #
)
$
# %

$
#

!#

$

"

"

! #
" '!
2

#
!

#
#

'

"

%

+
$

"

$
J
J!

"
$

#

"

9

# "

5%

#
A

/
$

%9
"

"
'!
%

*

/
#

)!
#
'

"
#
% :
O

/ '

-

1
) #

!
#
J

"

A
%+
"
0

"

!
'
.% 3

# "
# )

A
%
#
#

%

' '
"

#

%,#

"

(#
#
% ,
'
#
# !
# # 2
2
% > !
0 (%
!

#
"

!
.

# 2
# % , #
$ #
#
"

#

# "
A

$

"

/

2$

#

"
!

!
#

2

#

#

"
$

%
2 #

= $
!D
A

#

"

"

!

.
%1

#
J
! #
'$ C
!
' #
( .%
4

#

'!

-

$
"
% 9

'

"

)

)
"
) !
(#
'

$
$ !"
'
#
# !
/

,#

=,

. '
$
%
"
#
%*
)4 A
,
"
'
4A
+
"
#
A
K #
A"
"
!
%

%,

A

=5

#
2% *
"

$

)

$ *
"
'$ % &
'. !
#
"
)% 1
#
#
"
2
"

!9 $

"
(
!

"

)

%

*

%1

!#

%1

"

2

"
(

'#
$ !

! #
F
#
$ G% A
1
1

%1
%9

A

$

#
'

A

L

A

'Somos perceptores. Somos la conciencia; no somos
objetos; no tenemos ninguna solidez. Somos ilimitados...
Nosotros, o mejor dicho nuestra razón, olvidamos [esto] y
así entrampamos a la totalidad de nosotros en un círculo
vicioso del cual raramente surgimos en nuestra vida.'

'

Figura 19: Un átomo es 'vacío' para la realidad de los
cinco sentidos y así ¿cómo pueden ellos ser los
componentes básicos de nuestro mundo 'sólido'?. No
pueden - la 'solidez' es una ilusión. Los electrones y el
núcleo (también 'vacío') están mucho más separados de lo
que puede ser retratado un este gráfico. Como dijo un
escritor: 'Si un átomo fuera del tamaño de una catedral, el
núcleo sería aproximadamente del tamaño de una
moneda de diez centavos'.

* 2
#
A2 A

(#

2
!A

A
%
D

#

!

$ %

"
#

!

"

2
?

$
!# 2
"
A! A
2
2

#
#
2
%

C"
'
$

"

" # " ! # 2 # 2 " A AF G% M ' ' $ C " 2% F1 A / # $ A 2 $ # # 2A % 1 # ( # " A2 A ! ' $ % . DA 2# AC# D # # $ " A" ' G% # $ ' %1 # ' " % . ! $ . %. # " - ' % # # ( ' # # ) ! ' " ! # . $) '$ .# # # A # A! A 2 A # # # " $ ! % $ ' $2 / " # # $ # %* - # # $ % % 0 % H ' $2 % / ! ' # ." '. * # $ # # # J # ! # %1 . " A .AC: . 2 # (# @ % ! % ! ! # ! ' ! # # $ % $ " !! $ 2% !# $ % # ' .! # !# J # !' $ % # X %1 ! ' '.%3 ! / " F 2 G% = " % A O # ' " # # $$ " % # A # # # ! ! A # $ ." / C' ' # ! D" # % * " # A2 A A! ' # " '!$ # # ( # # # 2 A# )4 A . A! A! A! ! A %1 2" 2 . ! " # ! # (# (# 2$ ' ' # %9 ! # # A . .$ # # 2' # # A' A # $ . $ S C D ' # (# $ ! ' (# ' ' - " % 1 " # " $ # # 0 @D% J " ' # % " B B N% C: C # 1 . D# # " %9 ' " $ A # ' " = " ' # # ! # ' # %9 # . / 2 . ' # % !# A# " $ ! .$ " # " . % ' . '! .% " ' ' # % 2 # # ." $ $ # 2 # # 2 # .E ! # ! ' % " !A A %1 '$ # # # ' * ' # .D% ' . " M N% .. A % A 2A# # # 2" $ " " # 2 2 # # $ # ! # " .

A 1 % ' $2 # # / $ % (# # %H " ( " (# % 2 2 A H $ " 2! ! $ 2%H $ !! A $ A %9 # $ # # 3 ! $ P )" ! # 2 % # # # $ 2 . A $ % A 2 $ % ! J A A # % $ ! # . # " ' B ! ' $ ! '$ / $ # % # # $ 2! ' $ 2 A ( 1 ' $2 .! . / $ '$ . # 3 $ # " $ 2 . = 4A F5 . (ilustración por Neil Hague) # 2 " % 9 2 # . A % " G%A9 # % = J / . # # " ! # # 2 # $ ! ! 2 # $ " % A % ' / " " ' $2 % " " 9 $ %9 ! $ % ! %H A ) $ / $ ! # !! # " .! 3 % ! A HA % 3 ! " $ # $ 3 2 ! 3 " ' $2 " ! '$ 3 " 2 3 2 # %* % 2 ' / .4 A # $ # %H / ] ) " $ ' $2 ) %* % .% A $ . que unen el cuerpo / holograma humano con otros niveles de la realidad. " # " # # ( ! ) ' # " ( " # '# % H $ ! 2 " $ % Figura 20: Los siete principales puntos de vórtice. # $ $ 1 A AA 3 A! A 3 A % 1 ) # $ %* ! # $ " ! 0 . # " / 1 = %H S F" ( " % 1 %* ! # ! '$ # " A A ) . # # # %0 # # ' $2 ' # ' $2 %9 % ! # 2" .' )4 A $ \1 0 ! \ ]% '! A % ' 2! . o chakras. (# '$ 1 " " 2% # / 2 ! # $ # 2 ! # # " $% ) $ ! 2 " # ' ' $. # 2 # ' # ( # %A* J $ 2 GAC ( D A " " % 2 E..$ * I # # # $ ! # ! ! # ! # J! %H 3 A # # # ! 2 # # %A P%A $ .

! A % 1 ! # ! )% 9 A A (# % Figuras 21 a 23: La  creación de la Matriz. ubicuo y eterno.) a la manifestación del miedo (la entidad  alada) que tomó una vida propia. como es simbolizada por Neil Hague. * 2 3 ' " ! > C: C D <D% 9 # DJ # # % E $ . esto llevó Figura 21 (arr.% 1 " 9 $ " # " $ 3 % ! # # $ # ! $ ( % Figura 23 (abajo) % ! ) % $ ! 2 %1 ! JH B 2 . ! A # 2 (# " ' # " ! % '% > # # $ ! '% # ! # :2 1 %9 ' ( # / $ $ " $ 2 J 0 " 2 4 " ! $ ! % .! % * A . A % A 5# A A ' ' # " % " # D ' ' 2 # .) Figura 22 (ab. Como dice un mito hindú. Primero vino la imaginación en la 'forma'.! ' " ' # ! 2 ' " A $ A # " " $ $ ! $ ) * 3 9 $ # A2 A ) # %1 '.lo atemporal. # A " AC . y la conciencia fue atrapada en una ilusión que creyó que era 'real'. ! ' A $ 0 9 $ '$ # % ' ! # ) " " ) " # $ # ( ' C 2# . la conciencia humana comenzó como una ondulación que decidió dejar el océano de conciencia . olvidó que era la parte del océano infinito y se sintió aislada y separada. # (# ' /% 2 " ' ' $2 " ) = A # $ # A A 2 " # ! # % " . ) % # $ # " $ ' # " $ $ 3 9 $ % A A . Cuando se despertó en este estado 'desconectado'. " 3 " . con esto vino la ilusión de separación.A . # 5# " $ ! =' # " " # $ A A % '! 9 #2 P # )P ! 2 # " ' ' " 1 4A 3 2 2# " # " A % .

# ) # 2 ' # # ! # 2 A A# # % '2 .# # 2# " - # !# # % F1 ! G% 0 ' # 0 A * ' %U ' C* $ B! V ! !$ * %33% @?@D4 0 ' $ $ %* # $ % 9 # $ ' # # # # # # * 0 # %%% %A # . > ' # $ # # $) / 2 % ' ' $ " '$ .%D% " " 1 (# E # ! # # %9 # # .* 0 0 0 . ! (# %* %1 # ! ! $2 ' ' ! $ $ $ % 3 A A' " '! . $ ! %. % A2 # A # 0 . # # # $ " '2 $ = ." . %* A 0 . %* # ! 2% * 0 .A % B ! # $ ' $2 # 0 . # 3 $ 1 # ! # $ # 2 # " CH $ 2 (# # '! 0 # .= # # !# 0 . # $ . # 2 % .% # $ ! # " 2 " % . % 2 " # ! " # # % * - %1 # # # % # 2 . # # " B " # ! " Figuras 24. 2 %0 ' ' ' # C: 7D% ! " " % * ' # 2' : # . " # * ) " . 25 y 26 (# (# '! 3 # 2 # ! % # 2# # 0 .

(por Neil Hague) $ ! $ # ! 1 # ' % ' L! . en un estado de amnesia colectiva." ' $2 " %9 %5 $ % 1 # ' # " =A %9 # %+ # $ " - A " A (# L! ! $ A N% ! -% $ # ! 9 # # 2 %* ' ' C: ?D% ' # 2 ! $ $) " " # # 2 C ! ! $ )D% ! $) $ $ # 2 EE @6.: ' $) # # 2 % . # . ! " K $ $ )% & $ " D! %1 # ) % # # . $) C $ $) ' /# =' ' $ # ' ' A A %M 2 $ # $ C" * 0 $ .# # %H $ $ ') L ! ' U '% 1 % ' $) $ " " 8 ) # Figura 27: El juego de realidad virtual: la conciencia entrampada." # =# L # $ # $ ! # = = . # ! # " $ .% 9 A $) ! .% 3 ! . se volvió controlada por su propio miedo en un laberinto de autoengaño e ilusión manipulada que yo llamo la Matriz. A " $ / ' 9 2 $ # % # " ! 2 2 ' ! % ) $ # # # % ' $2 %1 ! ' $2 $ " CA # " # $ ! ' $2 # (# " A A D # ' 2 0 . # . / ' ' $2 A D # " . .

' (# $ ! ' @D% 9 # # # ! " ' 2% : % % # # $) # # . ' ! % Figura 28: Los Hologramas se hacen usando dos partes de la misma luz láser. Una mitad (rayo de Sujeto referencia) va casi directamente a la placa fotográfica y la otra (rayo de trabajo) es desviada sobre el sujeto. ' 3 ) 2 % # ' . $ # # ! . # " # " -% . Parece aleatorio y sin sentido hasta que el patrón sea iluminado con una luz de láser y se forma un holograma.su 'solidez' es una ilusión (Cuadros 'Pequeña y Abedul' y 'Viejo Soldado' cortesía de Estudio de Holografía. E %. %1 " /# =' # ' $ # # " ! ' " # 2 # 2 E6 $ C: E8D% # " - # . Centro de Exposición de Toda-Rusia. A! # ! ! # . # # # # " A. Un patrón de interferencia se forma sobre la placa fotográfica Laser Divisor del rayo (espejo semi-transparente) Figura 29 (izq. Moscú.): La onda o patrón de 'interferencia' sobre una impresión holográfica. ! # EE ! E6D% * E J " # ' ! " 2 A " # " # %* . ' # ) $ A= ! C: E.ru). pero usted está viendo hologramas por los cuales usted podría pasar su mano. Cuando este rayo de trabajo es desviado otra vez sobre la impresión esto forma "un patrón de interferencia" con el rayo de referencia. Si se ilumina con un láser este patrón crea una imagen tridimensional holográfica del sujeto. . Es lo mismo con el cuerpo humano . * 0 . # # " - % .holograph y. Figuras 30 y 31 (abajo): Esta muchacha y soldado parecen 'reales' y 'sólidos'.# 2 # # # A' A ! = % 3 ' # # # " # 2 # # # $ C: ' # # # . Por más vea www. ' $ ! " # ! .

3Dhologrammen.este es otro holograma.): Lo que puede parecer ser tan sólido no lo es . $ ' ! D! # ! $ $ A $ A 0 .# ' # " ' # 2 " # ' 0 " AC $ A % 2 # " ' .= # " 0 . Figura 33 (der.com. '. Ámsterdam. Alemania.):.# 0 A 0 $ ! " # 2 " (# # # ) # # " . " $ - # C: E<D% Figura 32 (izq. $ 2 . $ '! " %1 0 # # # ' # % $ # " ' # $ %. ( % # . Cuadro 'Canilla Abierta' cortesía de 3-D Hologrammen.G% * 0 . (# ! # A ' F# ! # # $ " # C: # 2 '! ! # $ . A ' $ A # # % $ " 2 0 . Lo mismo es esto. # ' " ' # .' $ A2 A ' A " # ! # 2 $ ' # " '! (# $ $ # $ S . una canilla metálica 'sólida'. Correo electrónico: lasertrend@aol. $ ! ' # % %* # " # " $ # 2 !$ ' ! ' # % # # " % 9 # ' 2 # ! 2 % # # " ." E7D% " A A $. " $ . % + ( 9 )4 A ' % O % + $ 0 ( " ' # # %H # 2 " ! 2 2 $ % ) ( $ .. Cuadro 'Medina' cortesía de Laser Trend Holographie.com.! # # J# . Por más vea www.% # " " " # $ '2 A" 2 $ " ! ' # %3 " %9 O ) " ' - . ! # # " # ! %. % # # % # # A! $ $ % # # $ ! " # ! O # " # 2' 0 $ # " " ! .. 1 # # # # " # # " .' " # # " $ # # " ' # " " % (# A 2 $ " # " # # " ! ' ' A % * # 2 # " - ' # !# E8 - A= %1 -A %%% . # # " $ ! # 0 .

): El ordenador central o 'cerebro' de la Matriz comunica una realidad colectiva a los terminales de ordenador / cerebros humanos (y todos los otros). ¿no?. Este es un holograma de la columna vertebral humana que es sólo una proyección ilusoria. los que descifran las señales en una realidad tridimensional holográfica ilusoria. los cerebros humanos dan retroalimentació n a la Matriz y este bucle de doble sentido lleva a cambios que llamamos 'Evolución'. E< . Nueva York (vea detalles detrás del libro). Figura 35 (der. Es como rescribir un programa de ordenador y así es como la conciencia puede recobrar el control de la Matriz. Centro de Exposición de Toda-Rusia... Por más vea www. Cuadro 'Espina' cortesía de Jason Sapan.): Juego de manos. Figura 36 (izq. Moscú. en todas partes del súperholograma.holography.ru.Figura 34 (izq. A su vez. manos holográficas que usted no podría estrechar ¡a menos que su cerebro le dijera lo contrario!. Estudios Holográficos. Cuadro 'Padre' cortesía de Estudio de Holografía.): Nuestros huesos parecen tan 'sólidos' y seguramente nuestros cuerpos deben ser 'físicos' y 'reales'.

el cristalino receptor. A A! " %A % # $ ! ( # 2 2 # " # # ! @8 @7 # # %^ " ' $2 (# # # $ . C y T..6 U ' ! %0 %1 " # " # % 2 " # ) " 2 %A 1 # @?. G. # ' " D% % 1 " # # % * # ( # ' 2 0 - ! # # D # . 0 ( $ .%... Cómo se ordenan éstas decide la naturaleza de la forma 'física'. que nos conecta con la Matriz..% M " # # .' $2 : ' # " @.[% / $ % E7 . ¿Le recuerdan los códigos en las películas de Matrix?. Usted podría verlo como televisión holográfica en la cual los cuadros transmitidos como formas de onda desde el transmisor son descifrados en imágenes móviles por la TV. ' * " $ $ % # / J ' ' =) " 2 0 * $ # ) 2 ' ' ' # # ) " 2 # " ' # $) $ $ $$ # C @E%.' $/ " # " '! # " % * " ) " 2 # # % . AGTAAGAGCCTTACGGGAATTCCGGCGAAGCGTTTCACAGAGATCACGCTCATACCATCAACCTGGTGAAT CGACAGTACAACCCACGTCACGAGACGAATCGCCGGTATTTGTATCAACTAACACGAGACCACTTTTCTCT GGCATGTAGGGAGGGATCCTCGCTCGAACGAATTGCAACGGACATCGGGTCGTGTTGGAGAAGGCCAACA GGACGTCCGCGTGCTTGCGACAAGAGATGTCCCCCTTGATGCATCACCAGACTAACACTGCCACACCTTGA GGACTTGGTGCCATTACAACAAGAGGTCATAGATAGCTACCGTAGATGTCGTCCTGCGTCCTATCTACGGTT GATACGATGGTTCGGGGGGGTGGACCGGGTATCGGACTACCGAATGTTCCTCGGCTTAAACATTTCGCTTA CACCTAGCCGAAAGCATCAAGAATTAATCATTACCAACTATGTGTTGTCGAGACCGTTCAGAGCCTTCATTG GCCGTACCCGCCCATGTGATTTAATCTAGGGGGGGACCTCGACACCTTAAAAGTGCGATTATACAGTAACG CGCTCTTGGAGACGTCGGAACAGTAGTCCGCTAAACGGTCGCACGGAAGCCGCTTATGATACGGTAGTTAT GACAGTCGAAGGGGCAGGTTAGAACTCTACAGTCCCGAGTCCCTTCTAACCATCCATGTCGACTGGTGTTG 0 # %M N% 2 ' = " N% 1 C: ' ^ * ! 2 $ 0 $ ' %* 2 E?D $ # / ! " $ " " .. K 1 ! ! C D% D ! ! ' # # # A .A % Figura 37: Recibimos constantemente una realidad colectiva en forma de onda desde la Matriz y desciframos estas frecuencias en una realidad tridimensional holográfica ilusoria. Figura 38 (izq.): La hélice de doble espiral del ADN. El ADN es el programa de software que contiene nuestros datos genéticos y lo que llamamos mente y emociones.4 " ! ) " 2 = " " 12 # ' # $ # . transmisor y amplificador de frecuencias o 'luz'.. Figura 39 (abajo): El ADN puede ser expresado como una serie de códigos de letras en secuencias de A.

la profesión médica de hoy. 2 # % " %3 A C# D! % 1 2 8.): La antigua imagen de serpiente de doble hélice conocida hoy como el caduceo. .el programa o conciencia. O $ " # # %9 # " C: 5 3 " " $ $ J 5 # $ 6 D% ) ADN Ácido Ácido Ribonucleico Desoxirribonucleico % % # 0 # ! )A ! '2 5 = = 2 ) %9 " 2' ! 5 # .' %* # ! 2$ # K 1! C: # %* ' O ! %1 % )A %H 2 ) " # . 2 # E? 5 $ A ! % ! # ADN ' ! ! # # % 5 # % $ $) ! . apropiadamente. ! .D! % # " # C: # # # # # C: $ 1 2 A # A # A % ' $$ " / % Figura 42: El 'láser' ARN lee el 'software' ADN y pasa la información a las células.): El ADN tiene una sensación reptiliana acerca de él cuando es masivamente amplificado. según nuestro estado de conciencia y conexión. $ " O # ! # ' ($ # ! # # $ 5# $$ " 2 6. Qué parte del 'disco' ADN decide leer y comunicar es controlado por la fuerza que controla el ARN .% Figura 40 (izq. Figura 41 (der. % # ' : ! 4A %% %% $ # . un símbolo para el ADN y. # # 2$ # # '! A2 A 1 # )=5 #2 ' $ ! 1 6 D% # # $ # %* %* " # % % # # $ = " (# ! ' # 2$ ! # # ! $$% A2 $ ' ) A ' # 2 # A # %9 A O A A # 2 . E@D ! ' ! ' ! '! 2 1 ' ' ) ) 2 $ 0 # " ) ..

% H ' ! $ .' Figura 43: Nuestros cerebros y el ADN/ARN son como terminales de ordenador recibiendo y transmitiendo datos." ' % # E@ # . 2 ( ' # ! $ AC " 24 'A partir de la forma característica de esta molécula gigantesca . que puede tomar muy bien pulsos eléctricos. (Ilustración por Neil Hague) # S " 0 .el ADN representa una antena electromagnética ideal.# ! C D! ! $$ % & !" 2 5 ! # ! # ! 2 5 ! '# # " A # A ' O %1 # %9 " $ ! C " D # # !# = " '$ " ! # A A # % * " # ' S # 5 D% * # " $ % ' $2 " # " ! " (# # 2 " %9 ! ')% $ 5 = ! %1 5 % ! $) % ' %1 A # A! $ A! # " '$ # ! " A# * A % # " 2 A . tiene la forma de un anillo y así es una antena magnética muy buena. # 2 " $ $ # / ') L ! # " # # $ # " 0 # A %1 2) ' " " $) # ) A / $ 4A # S # 2 S% 3 # # " % " " " ! # 5 # " . Operamos en una versión holográfica de la Internet. Esta información es intercambiada con el cerebro de la Matriz y con otra gente y formas de vida. Por una parte es alargada y así una antena de lámina.una doble hélice enrollada . '$ $ ! # # ! % # 2 $ " 2 $ . % 5 # % 5 ) # # " # ! 2 ! " ! . visto desde arriba. Por otra parte.

2" A$ " (# ' 2 " # # # . 0 ! %5 B # %* . # A 1 A % D= 0 $ # O ! AC " % # " ' # 2" # A ' $ # ! ) = # $ # % H ' $2 = O # ! # . (# # ! A ) ' # ! ! 2 # # # # AC # A ! # # C 5 S 5 .! # 2 % ' ' # " # $ ' A$ $% ) # % " # # 0 % $ ! % 3 . GA % * $ ! ! 2 ! ) " A 0 . # ! 2 $ " %* 0 . )" ) " 2 A A # $ " ' 2 " - # # # $ # # 2 # ! $. . # 6. ' A 0 ! ' ' # " # ! 2 .% # # %9 # C $ # )C U O$ U C 2D% ' $ # D# D # ( # ! ( % # U $ 2 $ %1 ! # # . ) $ " ' " )" # 1 # $ )4 A * 5 # " " " " $ A % . # ! # % " ( ' ! % $ # " A %M U =! 0 .U U U $ C: 6ED% # ) # $ U $ # $ # 2 " 2 # ! " $) ) ! " % % # * ' # 2 C ' $ $ ! # ' $) # D ) " A2 A % $ # " 2 $ .! (# # " ! $ ! ! ' A L # 2 ' ' ' $ ' ! . 2 # ! % * ' . % A $ % S5 $ $ ! # = " # = 0 0 % & . % %* D% $% # % # # $ A %* # = ' # " .= " $ S ! ! # $ ^ 9 $ A CU ! ! - # ' " 193 # # 4 $ A N% 9 ) # " 9 # # $ # # ! # $ ' ! ' / / $ '$ $ !) % . ! # D% # # O ^ D " # )4 A F # $ # 0 . " $ # = # " /# =' # ! " A %* # .

La energía que fluye por los meridianos. ' $2 ! # % 9 2 . consiste en fotones que llevan información por todo el cuerpo.. # $) $ % ' ! ' $2 #2 2 . ) ) = # # *$ " # " $ # 2 1 # # > # 2 % 0 $ # : A # % .(# 193 193 " # # $ % % # # # $ $ : " A! 2 66 $ ' 2" ! # . Somos sus profesores externos mientras aprende'.' * # " 2 ) ! ! # $ $ " $ # ( # ! (# $ ! # 2 " # 2 # # 2 % 0 (# A$ A # 6 % # # A # A # 0 ( % C ' ' F' ) . pero. # A A $ A %: 2 )4 $ % " ) # # A # 0 > # " ' 3 A %M A $ # ! A # ! $ A # A % # $ # %* # 2 # # " 2 ) ! 2 .. conocida como chi en la acupuntura.% 2 ' # # # ! ( % . Al rato. ' % ! # # ) <. La red recibe la información sobre el cabeceo y la rodadura del avión en forma de pulsos de estímulo y su respuesta cambia con el tiempo.! ) # # 1 % ' ' # # " 2 # " % * ! # $) $ " # $ # ! # # # # " ! 0 G%D* . produce una agradable trayectoria recta y nivelada. ' 'Cuando primero las conectamos el avión 'se estrellaba' todo el tiempo. " A # A! 2 - % # / / % # 0 . # # " .. El sistema de chakras también se conecta con esta red y cuando el flujo de energía (información) es bloqueado o suprimido se manifiesta como enfermedad o des-alivio (juego de palabras en inglés: enfermedad).# %B ) # . A # 8%.y así el cuerpo sano.. la red de neuronas se adapta lentamente a medida que el cerebro aprende a controlar el cabeceo y la rodadura del avión. ( 2 := N% # A A" # " O 2" # . Esta es la placa de circuitos del ordenador del cuerpo. Figura 44: Una imagen realzada por ordenador del sistema de meridianos tomado por una cámara gamma después que trazadores radiactivos habían sido inyectados en puntos de acupuntura. Las agujas de acupuntura se usan para mantener la energía fluyendo y equilibrada .

# ! 9 %* 2 ! # C) ' $ ' % S5 " C " ! ! S5 =# A . . $ ! $ ! $ %9 A % 2 # # % # # .) ! $ ! 2 A . # $ % H 0 . " # # $ % ! " N% 3 $ . " ) " 2 D # # 2 $ CA# = 2 . ' C# # " A % A AA = $ )" # " = ' # . % " " ' ' " $ # # ' # " # # ! ' # A ! # " % ' ' # $ S 5 2 % " " $ # # % # # " %* / # S5 ' ' ' '$ : = L B% L% : %& # ' # 2 # !" $ ' % M( # # # / # # B 2 ' W # ! " # $ " AC # A $ " 2 " ! # # # ' . ! $ - ' # ! %* 2 ' : = # 5 !V $ # ' D% * ! / @7. # # " $ # - % L A % # # " = . ' % * 0 # ' . 1 A # # * # 2 # $ = %A +! # ' .# D # ' 2 %3 $ $ C= = $ # " D = $ # > A % " # $ ( ! . " # " % $ : # # " # $ A D! U $# " # # # # $ . B # . " %* 0 " 1 " ' % 2$ ! # 2 % ! A " A % 1 # A # # 2" # " 2 !# $ % ' ! ! . # ! $ # 2" " # !# )% 2% 3 A AC 2 # 2 6 $ 5 D 2 " . = # # . % A2 ' ' ' ' % (# # " $ # # K # B $ ! ) # 5 D A # " ' # (# $ " ! ( $A % " " ' !# .

(Dibujo de Tomassi) * # . Pero si pudiésemos deshacernos de nuestras lentes. ' 4 > $ ' " # A$ A= " = # ! 2 # 2 C $ # ! # ' ' C# 2 D ( % " # %* # $ J # 2 3 . # # - %* ( " / # # " # # ."' . A % " 2% .! # " $ # # '! ! J ' $ 2 # # ' % S5 %. '. Lo que está 'ahí fuera' es un océano enorme de ondas y frecuencias y la realidad luce concreta para nosotros sólo porque nuestros cerebros son capaces de tomar este aspecto borroso holográfico y convertirlo en palos y piedras y otros objetos familiares que forman nuestro mundo. ! # $ % / ! # 2 2 % Figura 45: '¿Elefante?.. 'Me entrené en Harvard y Oxford y si hubiera un elefante en este cuarto yo sería el primero en verlo'. la suavidad de una pieza de porcelana fina y la sensación de arena de playa bajo nuestros pies son realmente sólo versiones elaboradas del síndrome del miembro fantasma [cuando las personas amputadas "sienten" un miembro mucho después de que ha sido amputado]. En otras palabras." dice Pribram. ! # S5 # # A # A %. ¿Cuál es real y cuál es ilusión?. 2' # . ' . "o. $ % S5 S % ' A2 A %V (# $ D( # 3 # 9$ . Esto simplemente significa que una taza de porcelana tiene dos aspectos muy diferentes a su realidad. la experimentaríamos como un patrón de interferencia.%* " # ! ' A ' 1 # ' " S5 S % ! A # 2 # # . Cuando es filtrada por la lente de nuestros cerebros se manifiesta como una taza. " $ 2 # # $ # " $ " ' ^ # % " # . ¿Qué elefante?'.. si lo prefiere. esto no significa que no hay tazas de porcelana y granos de arena de playa ahí fuera.' 'Según Pribram. " # ! # # # * # # ( % 41 # 2 6E $ " $ ! ^ # 2 " 2 A 3 ) ' % . "Ambos son reales para mí.. al menos no en el modo en que estamos acostumbrados a creer. ' 2 % 0 ' $ $ % '.. ninguno de ellos es real.. [Karl] Pribram [se dio cuenta] que el mundo objetivo no existe.'..

$ = A 2 A $ ' ) # # % FF9 A # # / • " • * " ' $ G= ' 2$ # GC # # 68D% # " A A ' # 2 # # 2 # $ G% FH " # A' ' 2 2 ! @8 # ( A! @8 # # # @8 # A ) @8 # A @7 # F# # $ D 2 2 # " " C % 9 GG% # A D% * $ # $ 2 % $ # ' ' $ ! @8 # ' % 2 5 % % 0 2 2 ! ( % $ 2 C: # # $ " ! ' A # . (Ilustración por Neil Hague) ) # " )% # " " %9 A $ 2 ! !# ' # A '.# % F9 " A '.# F % # # $ " @7 # ' ) # # @8 @7 # . $ $ ./ ! G% FA A % • # $ # A 2 " 2S " A % $ @8 # # " . realmente nos conectan (o debería ser) con el 95 por ciento de la energía / materia en el universo que no podemos ver y también a reinos más allá de eso. = F G% Figura 46: El 95 por ciento del ADN 'chatarra'. : 6<G% +! $ . y al menos la mayor parte de la enorme capacidad cerebral que la ciencia dice que no usamos. A A " " 66 ' " # . el 95 por ciento de la actividad cerebral no implicada con el estado despierto.

# " - * # 4 # ! % 2 = % 3 %+ (# % * ." ! C %. " # % " ( # ' $ ' $ " A " # ' / # ( # %> ! " ' % $) # # 2 # $ .%: C D $ # # M! ' $ $ 6. así como el hambre. # $ ! ! A ! $ ' # # . es el blanco de productos químicos ( ( usados en comidas y bebidas de consumo masivo. # '! ! # # O ! # # $ %3 " 2 # '# $ $ # " # 2 # %1 A ' A" 0 ! # A 3 % 1 # A % * " ) '! .. ." S C: '# A " " ! %* / % ' # # $ A # 2 A # A! = $) # ! ' A A %* # A2 $ ! # " ! ! # " # $ . y todo lo que tiene que ver con el concepto del placer y la actividad creativa.% * " (# $ $ $ " " " 2G% " " ! # 2 ' ' D% @7 # # ' " . sentimientos y humores. El Hipotálamo organiza y controla muchas emociones complejas." ' # A $ " A2 $ # ! % % $ J # A % C # # # ) # # A ! ' = / # = % 2 $ Figura 47: El hipotálamo en el cerebro es un regulador clave de nuestro estado emocional y organiza y controla los sentimientos y el humor. ! " . mente y emociones y. así como todos los estados motivacionales incluso el hambre. como veremos más tarde. El Hipotálamo es vital para el equilibrio de cuerpo.# " " A $ A! . apetito y consumo de comida. $) # C" # # A " '! D # $ # " $ .. > ! $ # # " ! ' % ) $ $ # ' " $ J $ " %1 ! 0 .. 24 '." # ! A # 2" ! " " " $ +)A# ' $ % * " 2 A'2 # " 67D% $ A # / # " ) ! $ % # A 2 %1 ! # ' " $ # # / " # " # $ ! ... %." . # ( % FI 2 A % . apetito y consumo de comida. y todo lo 68 . A A' A J $ N% # A # # A D A # / " - .

O * " - A # A A # " %* 2 .que tiene que ver con el concepto del placer incluyendo satisfacción. está íntimamente implicado en la integración de todo estímulo fisiológico. comodidad y actividades creativas. que luego traduce. .. $ ) # .6 # # " 2 # " ' ! $) % % ! ! # !' A! % ! A # A' 0 .. . destila y ensambla en un "paquete" discernible./ " C!S ! " $) 2 '$ . # $) " ! ! ' 2 " . todos los 5 sentidos. relacionando todos los atributos de una experiencia.... ' A ! " ' A ' " ) %& # # (# ' $2 $ # " # V " # " $ %* A # $ % ' " $ )" " # 0 # " $ ' 6< % .' '# (# ) # A D ( # 2 # = S $ # " A 3 A $ ( ! $ %H (# % * 3 " =! " 3 % * 3 # # A L..% V ! %> # # ' A2 A % #2 $ A A" 8.. ' # % # $ # 2 # ! '! A $) % # ( D! # C (# " * ' ! % % * # ' ! 3 % C % $ " " $ # J 2 # ! '$ ) $ . " $ " # $ 3 = A % " # ....A % " % . .2 2 D! > 9 % ! 2 # A $ D ) $ $ $ 2 C $ " # $) 2% ! % ! % % # > " # A > % 1 # # 5 " # $ " ! $ # " # $ 2 .. El Hipotálamo. 0 $ " # 2 D $ # % 1 2%%% # " (# 3 A %> 2 # ! 2! ! 3 " " 2! % B $ " 3 # CA $ 2 ' $2 # ( " $ ! .. A 3 3 %& # % A +' # ' # $ " . 3 2 " 2 " # . $ (# A 9 $ % * " ! $ $ " # " ) . Las neuronas en el Hipotálamo producen varios neurotransmisores Hipotalámicos que transmiten información e instrucciones a todas las partes del cuerpo.' ! " A % / $ ! A# . %. " # !# $ " " A " A ' # %9 A O $ " ' ' / % .

componentes son afectados por pensamientos y emociones entonces los pensamientos y las emociones también deben afectar nuestro ADN.. los pensamientos y emociones para afectar el mundo. El cristal en la Figura 48 se formó después de que el agua fue expuesta a palabras de amor y apreciación.' Figuras 48 y 49: El efecto impactante del pensamiento y las palabras en cristales de hielo. sobre todo el cuerpo humano.# # N%D # # %. por Masaru Emoto) M.. '# S # ) # # $ " # # # # # A . en esta realidad. es en su mayor parte agua. las palabras eran 'Me enfermas . que estudia el efecto de pensamientos y emociones en nuestra bioquímica. Mensajes del Agua.te mataré'.# %& 4 'Hay una rama entera de la medicina llamada psiconeuroinmunología. ) A A " " ) # !$ $ / # !# ) / # $ % $ # # $ % # !# # # $ " 2 A AC # # " # # ' / $ # ! 67 ) $ ( # '# $ ! " 2 A ' % # # 5$ 9 # '$ ' # " " ' 2 " $ # / 2 ! / % H D A # M! " $ $ % %* ! $ " # # # " 2 % A %1 2 %9 %* # ' $ ' 6? ! 6@ D # / ! $ ' # > % ! # ) # " %1 : C$ # ! ! # " 2 " 2 ' A! ! ! ! / # A " # ( % 1 # $ $ # # ! = # $ " ! # A A % 3 . así que si estos. La diferencia deja claro el poder de las palabras. en la Figura 49. # C # DJ! ! $ ' %C " 2 " " = = # 7. (Para más ejemplos vea los libros. que. volúmenes uno y dos.2 # " N% $) $ 2 )# 0 %>%0 % ' # = %& ! " # (# # $ ! (# ! # # ( $) # # $ # " # # $ !# A ! # A! A 0 = A % # $ ! # ( 7. La bioquímica está íntimamente relacionada con el ADN.

$ @@@D )4 A " ! # A % # " = (# % * " A # # !' # " $ " $ G% 9 ' % # A # # # - " 1 1 > # 2 # A " # # / ! % ! # % %> / # .." " > # 0 $ % . %9 %* # ! = " $ (# # = # '! '! ! / ' $ % F1 # G% 2 J # # A ' ' A" # ' # 9 $ G% # # # # ! " %1 # $ $ !# # " ! # . . %1 # / # $ # " # " # " " # " 9 $ " 2# $ 3 S5 % 0 # " # " # # # " . 1 # ( !B " # ' # : = $ ! $ $ # # # $ ! $ " A" 3 ^. *$ . .% # $ ! 2" ) . 1 L " # ' ! 2 " % & ) " " ! ' ' ! " " # ! ' # % L " 2# !# 2 ' ' ! " )$ A ! A " 2# %& " A 3 A $ %* 2 # # ! $ # 2 3 2L %* " $ 2 !# $ / %H 2" 2 . = % $ = # O % * 3 # 2# ! AC $ # . # % ..# # # % # # A % . # " " 2# 0 . : $ X 6? A2 A %B ) # " $ %.$ ! = # A % . # $ # # $ ! $ % * 0 . % " " # $ . 3 L = 2S " # " / @8 # $ # ! @8 # 2 A ' A %^ # " " ) # ' ! ' # % = %& " ' A ' A % # O ' % 1 A ' A ! " %* # " ! # $) A ' A # ! '# ." C# D ) " %./ " %3 " " $ % # " .% . / = # ! % # " ! 2 %1 O $ # % F." " =# ! 9 $ S5 # ( A A . " ! # " 0 ..S # " 2 # " 9 1 2 3& ! 41 C1 # -2 *$ . A % * = ! D F1 ! " # S # . 2 S $ %* 0 . # " 3 ! # %0 .

' ! $ ! ! # ! $ $ / 0 . $ 0 ." . # $ !# # # .# " K # # # " # # 2A # . # / / # # ( # " / # 9 2! # # ! 2 %+ 9 # ' C # Q %& D / A ! $) % ! (# 2$ ! # " ' 0 & # (# U ' ' A %1 A# ! ! %1% # / # # # " # ! 0 .. $ $ 3 $ %* C . $ # " ' ' # " %* # = " 2 " ! # ( # % # % # ! ! $) $ / $2 ' #2 # 2 % ! 1 U ' A 9 2" $ ' # $ % $ " S5 # $ 9 # 2 A! # # A # # > !O ! A ' # # 2A! # ! ) $ # 2% # # % ' # 2% 2 $ (# %F =5 =. tal cuerpo es sólo "un traje" que nos deja participar en la "película" misma por un rato.# # . no es nuestra identidad verdadera o "yo". Lo que vemos con nuestros ojos es todavía menos. con la que nuestro cuerpo o robot biológico puede relacionarse.% . #' 0 " :$ ' 2% 2 " 2 % " 2 '$ " 2! * S5 9 # A$ 2 A# .% %%%% * E8? E ' # ! 1' ' # ! 2 # ! :$ .5 por ciento de toda la masa calculada. $ ! 2 # " " 9 $ 9 ) 0 # # $ . "La realidad" es una "película" delgada de luz [electromagnética]. una matriz visible.G% ! # " ' # 2 2 ! / 0 .! # % ' # # $ ! ." 2# # # $ . G% ! K' )" % # # ! # # S5 # 2 # $ K 1 . # 0 0 .% %0 ' " ! 0 2 # % ! ' $ # ! # ." ( ! ' # # # ' " 2 # # '$ $ # $.$ .# .' 2" F" 0 .." % " / ! . + .6D4 'Tenemos que recordar que la materia luminosa que observamos con nuestros instrumentos es sólo el 0. . " % % % * " .% * # $ # %* 2 # ' # (# " ' $ 2% $ 2 \]A %& # 2 2 # % ! 4A % 2 % ' )" % 6@ ! # 0 # 2 2 $ ! " ' ) A .

%3 # B 1 # # # %9 # # 2 # " $ ' ) ( % 2 2 " ' # %.% K # ' # $ '# ! 0 " . # 2 # '2 ' 3 %%% % # # A2A G% ! $ %F # # # A.= " % " " 9 # " # # # # # . # # . - # " X " # # # G% +! $) %%% 1 # 2= ! ! " '.% % CAPÍTULO CUATRO Pasado y Futuro en DVD El público es maravillosamente tolerante. # # ! # $ ' = " ' $ # $ = # % ' " 2 ' ' # $ % " # 2 " %3 # $ ! # 2 .A! ' A )A # # ) " # " = F1 " ) # " G% 9 ) # " # F1 # ) '! / # G% # %9 # ) O 0 . " 2% %9 # % . (Oscar Wilde) # * 0 . % A # A . Perdona todo excepto la genialidad. # A #A! $ $ " ( " ' 2 2% # 2 # " ' / A A %9 # A # A! " ! 2 " A A %1 # 2 " ' ! ' (# 2 2# " (# # " . # 0 . " .% # # $ # 2! $ % ! # ! # 2 # O %3 A # A $ # # # $ % # " ' " A # A! # A # A %1 # # # # ! # # # % ' ' " # $ " '! / # % # # ! A A % A # A $ ! $ 2 ' A # A % # ' ! ' ! *2 1 $ : ' 2 % # % 2 $) B 8.C '# ! D! %3 ' # ) ! 2 # = # # # $ ) ) %* # # ) ! %* '$ # # $ O ) " # $ # % $ > $ ! % F1 # # ' %* 3 A # A # 2 " # ! ' 2 % % (# .

S5 8 . ' % ' $ ' $2 $ (# ! ( 2% " # # " '$ %. F A # " " # # " %* " # # ' # $ % % # 2 % " S5 S ! # # # # $ # ! ! % O " # # $ # 0 . # ! %* # 2 " )% ) # A A $ 4 ' # = $ ' " # %* " . $ ) " # 2 (# # # # $ J A # =! $ ' .# # %3 2 " # % =) # . A A " % . / # # %9 # G% S5 ! %5 # 2 # 2% > # A # A !O G% F " $ # # ) # ' ' /# =' $ % ) # %3 0 ." $ ' $ ! # $ $% * " $ %* 0 . 3 $ C # $ D # " . $ (# " ' $2 $ # # # ' $2 # # % M. ( # ! # # ) # B % A # A # 2# # % A D% " =# • • ' ' '! # 2 0 ! 2 # / # ' / ! # 0 .$ # A# A # %. S5 " $ # )" (# # 2 # 2 A # A # # % # ) " $ $ S5 " ' " # )# . CA • * # " ! ) ' # .% ' ' . $$ # " S5 ' %5 # ' $ " $) ) # # : 5 B .$ " ! $ ' # N% . A# ! # 0 " A G% F . 0 . " # $ 2 " . $ # %K # # ! A A # ! A # A A # A % F9 # # ! # O # 2 G% '! / # = # >+5 % 2 # 2" # .% 2 $ $ # $ % %A * $ ! ! A % F5 A A " # J # # % % # " % 3 %. (# ' # B " # 2 O # ' # %* " 2 A # A( ' A ) )4 A * $ # 2 0 ( $ ) % ! # % ) ) " %A $ A ) % A ' A G% # % > ! ! $ $ ) 0 .1 B $ $ # # 0 $ .

" 0 . # $ A' A A' ! A A %0 $ 2 2# ' # ! C(# D " 2' " $ %* " # " / # % $ # % . 'presente' y 'futuro' en DVD. " . 5 8. ' # ) # # S# 2 0 . > ! . % # 9 %.# # # A A # 2 % " % Figura 50: 'Pasado'. el 'pasado' puede cambiar el 'futuro' y 'el futuro' puede cambiar el 'pasado'.% ! ) # # " ' A # A ' ) ' # " # # " # '! # # . 0 . ! % - # .% # % . 2 # %9 % ' $2 " 2 ( $2 # ' ' 5 9 # G% ! .% 1 $$ . K $ # 0 / 8 A %H # O ! # # %3 # # $ . ' # # %* # A ' !A # # # # 2" # 0 . # 2 # !# ! ' $2 ! # S5 " # # C 2 $ " $ # ( A # !AF' 0 . ! /% " (# # # 2 ! # 1 # 2 # ' A ' . Así. (ilustración por Neil Hague) > 2 ! ' ' (# ' ! ' $ ' %5 # $ " # $ - " '$ '$ %1 $ " ' ) D (# % # 1 ! " # ! : !A A A %3 $ # ! # # A K # A . ' # 2 " # $ %* % $ # ' ! " (# = > # # 2 " # # ! % .% . # " # O %& # " " '.SB # % M9 ' ! " N% # . Todos ocurren al mismo 'tiempo' en partes diferentes del mismo 'disco' y lo que pasa en una 'escena' puede afectar todo el resto.

% # ! % # % 2 S ' # " # # ! A B # 2 " # $ # " " . Por esta razón ellos perciben la vida y el mundo muy diferentemente al resto y pueden ser vistos como 'locos' o 'peligrosos'.C % A ) > ! $ # A # A 8 D4 : Figura 51: Los tres tipos de 'humano': a la izquierda está el programa de software puro. el caballo sin jinete. y a la derecha es simbolizado el mucho más pequeño . # . # # %* # # A A2 0 " % A $ ! 2 A$ # 2 ) D% 9 " 2 A # " " O .pero rápidamente creciente .número de personas que están conectados conscientemente con la conciencia más allá de la Matriz. que incluye los linajes Iluminati 'puros'. pero atrapada en la ilusión y dominada por el programa. la imagen del centro representa la mayoría de los 'humanos' que son conciencia consciente de sí misma.! ' %9 (# A ' A $ $ 2 $ " # # $ # ) %> ! 2 ) A" 2% 9 # % ' A K # # ! " # " . # # " # " A ) O # O ! (# C # ' D %.9 $ % A %. # $ % # O 0 . A # $ # # " # " # # )A ' AC $ % # %* ( # # 2 0 # O $ ) ( # A A = > A !O # # 0 % # . $ 8E $ % . 3 % * # # A A # $ '$ # ) # $ ! # # ! # # %3 # 2" # $ 2 A B * # # # A 5 )A O % * 2 ! .) B * 2 .% . (Por Neil Hague) D9 # 0 O ! / S5 ." # # # ) % $ .

" ) $ ! 5) % 86 " '$ # O " $ # % " )! # ! J # ' .# " # A# O ." $ %9 0 % ) 0 % A # (# A $ # # # ! $ - 2 2# ! ! " ! $ " # ! (# . 0 # # $ # $ ! $ ' ' # !# " " $ # . ) # # " ' %& A A A %. # %* 0 # # # 2 ! ' ' # % # . # # 2 ' ! ! # ) " / # $ ' # # " 2 " % " # - # ' # %> # # # G% " $ $ ! # % N% # =M # " # ! # % * %* # " ! # # 2 1 ! ! %M 2 " # $) . ! 2 # " # 2 ' # # " # # # " # 2 N% # . ! 0 . # # = ED ! # ' !' O % # " . 0 %3 A2 . # . ' # 2 !A ' (% 0 ' 0 A $ % D+ # # '# . . ! # 2 " " % # " O % * # # % $ O # # 2 % . $ $ " $ 2 # % 3 = % # " % # ." %3 # F9 0 # 3 # ! " # ! # $ ! # $ # # " E? # # . # / $ # O # % # # ! ! ! $ # " $ ' * ' %* # = # # 5)A A %* " =" $ $) 0 . # . % $ " 2 5) ' . # % . # # " = # # " ' ' # A %3 " ' $ ! %1 ' ! " # # O C# ! D = ')% # O ! O # C 5)D 1 (# # $ # . .# O # = # ) # " . # # # 2 # # % # " 0 ." " $ %* 0 . 2 ' % . ' " .

% $ ' # # # # O 5 ' ' B ' '! $ $ C: 8 D% * : A $! A# $ % +$ ( # ! ! # # 2 $ " ! 2 K # O # $ 2% * D $ $ # . / 2 . CA # ! A D# % # " " 5) . " ' A# )% 5 $ A # % 88 ! 1 0 O # A %1 # ! !# . C C # $ " # # ! D " 5) ! U 5 ! # %* # " $ $ $ ! ) # # . banca. # . . # % 0 ( ) O 0 % 3 # C# ) D # ' > $ # 2 $ $ 1 " # ( % $ # ! 0 )0 " " # 2 $ ' : " ! $ # % >$ ' " A # . negocios y medios. Ellos se cruzan de una forma obsesiva para impedir que el programa de software sea reescrito por la infusión de conciencia consciente de sí misma. % Figura 52: Los linajes 'Vestido Rojo' de los Iluminati que dominan la realeza. (ilustración por Neil Hague) * 0 . O # # # ! # # " 5) ' % * " ! 0 # 2 # # # . política." $ " # ' # . .

! ' # ." # $ ' ' " /# =' ) # A A ' .F 2 $ J 2 2 ' # ! O ! / # $ # " ) 0 (% A# ! ! 5# " . sino como una categoría sola 8< . .. Luz. rayos X . Hoy los físicos creen que los fenómenos subatómicos no deberían ser clasificados únicamente como ondas o como partículas. 2 9 ' # ! ." # %> # # 2 C# # $ # 2 C # " ( # 2# D! O : 2 # # " '! ) " # $ ' 2 2 $ $% * # % 9 D! # # 5 # $ 2$ $ $ ' ! . Esta capacidad parecida a la de un camaleón es común a todas las partículas subatómicas. ' ' ) # # ! * $ # # # O 5# # # # ! % .% # # " 2 # # ' " # $ % # ! . # " - %* 5# 2 C# $2 " # 5# # " . ondas de radio.% * 5 # # " 0 % 2 A 0 0 $ A) . '2 # # D $ % $ " 3 0 $ ! " # 2 '! 5 # 2S . B %* # " # 2 0 # 5# # # . # # ) 0 ' .% * % # 2 $ # ! O % # # # GA# # 2" ' # # 0 ' # %A .todos pueden cambiar desde ondas (a partículas) y viceversa.. puede manifestarse o bien como una partícula o bien como una onda. " A % ! (# . ! ) $ % 3 B % " # $ " 2 " ( # ! 5# ) " $ / ) ) # $ = ! % * * # B # A ' # A $ A" # ' ' 5# # $ " # 2 % # " # 5# 9 2 # . % $ %* . A # $ # 0 (% A ) . como algún cambiador de forma del folklore. % * $ 3 > 2 %* A # % ! # $ # # # ! ' $ # " A2 A " ! $ # # 2 A $ 5# $ CA # 2 %1 '$ # ! # # %. A! A 3 ! # " # A %9 2 " # % CA ' A D " 2 ! # 0 ' $ 2 $ 4 'El electrón. También es común a todas las cosas que una vez se pensó que se manifestaban exclusivamente como ondas. rayos gama. ' % # # " ' $ # # A D% . " $ $ # %1 )" % # # " # .

Los Iluminati usan a sus clones de software humanos para dirigir su sistema de control. Esto incluye la utilización de técnicas como Problema-Reacción-Solución y manipulación de Mano Oculta para avanzar su orden del día para una dictadura global Orwelliana." # " " . La conciencia consciente de sí misma también puede comportarse del mismo modo cuando está profundamente atrapada en la ilusión.de 'algos' que son siempre de alguna manera ambos. % * 5) # # ! ' $ ! % ' # O ' O L' U ! % +2" 2 BB14 A * $ $ F $ G% # 2# " (# ! # (# ! " " # # " " B # A % 0 # .% Figura 53: Los programas de software puros no están limitados a las familias Iluminati. # % # ' . Estos 'algos' son llamados quántums.U O @8 " . y los físicos creen que ellos son la materia básica de la cual el universo entero está formado.D " # C( D # % # $ # .' $ # " # " # - " A# " $ ! A( %%% !# # " 2! # # A 4A $ A % # $ % 2 2 # # " ) $ . " $ $ $ L # O % 2 # ) # ! 2 # # ! # % 87 . A A# " ' % H # " # 2 " # K . Usted los encuentra en todos los niveles de la sociedad y ellos a menudo son recaderos parecidos a un clon que sirven al sistema sin dudar. (Ilustración por Neil Hague) H $ ! 2 # # ( " 5# ! 5) # %3 # ! $ !# # " 0 . # # C: 8ED% $ !# " $ C ' 0 .

Los Animales.# # # % > # . # $ # # - 3 2 8? % # % * . ) " B ' $2 # " A! . 1 " ! # " % " # " # ! ' # - ! 2 " .A O . $ $ $ % # " # # ! - = $ D! %* " # ! " C'# D # = $ (# # # # " . el Mundo Natural y la 'ley de la naturaleza' son todas ilusiones holográficas proyectadas por el software de ADN . # # # # # # ! " (# " ' " ' %* %* C $ # # Q ! # - # A Q # # 2 A " " ) ( " $ # $ " %* " ! # O %9 %& ! .el programa de la Matriz." 5) O % ! # # " # ) # # # ' ! 2 " ' # (# 5 # ! # # # # (# # ! $ $ " # S $ ' # $ # % * " # A 2 # A %* $ 2 # $ % $ " $ O # $ % Figura 54: Todo en nuestra realidad 'física' es un holograma descifrado desde formas de onda por el cerebro/ADN/ARN.

Por más vea www." . 2 ' 2 0 . Él hizo sus alas diminutas. ! B 1 # ' 2 !> ! % G% 4 Todas las cosas brillantes y hermosas. )" 0 . A ' A D% 1 # A 8@ # " # 2 " # A' 2 '% ) $ ! !# " " # $ . El gato y la rosa 'sólidos' aquí son hologramas. $ $ 2! " # . El Señor Dios las hizo a todas ellas. Él hizo las alas arrancadas. # # # # # (# 0 2 2# BB1 # ' / # # .0 F1 . Él hizo sus pétalos brillantes. Todas las cosas sabias y maravillosas. %%% A! 2 " # ) " # # . Cada pequeña ave que canta. % * 0 . Cada pequeña flor que se abre. Todas las criaturas grandes y pequeñas. . ' ( # A A# " ! ' AA # % 88 ! 8<D% Figuras 55 y 56: Todo en nuestra realidad 'física' es un holograma descifrado a partir de formas de onda por nuestro cerebro/ADN/ARN. C: . Todas las cosas destrozadas vivas. Todos los asesinos grandes y pequeños. . Moscú.holography. Cuadros 'Siam' y 'Rose2' cortesía de Estudio de Holografía. # " A! A )$ # ! ' ! = (# # A # " # # $ %D> $2 A! $2 # # '# . Centro de Exposición de Toda-Rusia.! ! . El Señor Dios los hizo a todos ellos. $ # # # $ $ 2 $ %.ru).% # % C+$ $ # # (# " '# . " $ " ) .# # ) # # " A 9 % 9 2 " 2 = " # ) " " # # C: . B # 4A F9 " ' 2 GA %* " # # ! ' 86D% * . Él hizo el veneno letal. Cada gran tiburón que te come. .0 # % 3 ! ! . * . % C ' # $ " %9 . B 4 $ 1 # # " - " 2%> ! Todas las cosas de mierda y horribles. Cada pequeña serpiente que te pica.

! " ) # ' % * ! . % FI # A A . D .% D ' $ D% K CU L $ CL # ) # $ " # 2 # " <.2 = # 0 . G% # # . # . ' 2 ' ' '% $ ( B ! $ $ B '$ # # # L $ ! # ) ) C # D .% ( # # % # A # # # + " $ ' $2 + # ' ' $ ! # $ # # ! + # ! 2 ' $2 %F # K # $ G% # ' 2 A # # ! 0 $ C ! # A # O ! - " .! K <@. # # ' # $ %1 '$ $ O # ' $ D ! ! ! %* $ # ) # ' O 0 # # ! ) # ! $ # ! 2 !# $ " ' " $ %. ' ' " # % $ (# # ! % 2 % . " = # .$ $ ' $ Q )# # # . !' $ # " 2 2 $ % 2 # ' ) # # " %* $ # F! " G% " ! # # % # $) .' ' G% . G% FI . ! # # " % * . # 2$ $ $ G% F3 # ' K # # # B # $ ! # 2 ) A! ! - %1 B 2 # # $ # ' ! # # 2 " $ ! %+ $ # A # $ # . " ! $ % ' .% F1 # ! .3 # # $ $ _ " # - # # BB1% 1 ' $ " $ ! 2 $ " 2 % A # O # 2 $ # # . # %3 $) # %1 # D % # 3 # " 0 . # = C9 $ # # ! 52 B ! %* " ! $ %I # # # " # $ $ # C # $ + # $ . 2 $) # ! O ! 2 %* ! # =! = ' / # .# ! $ # 2 - # $ " # # # % * $ $) # " ' %* ! ! # # $ D% # ! 2$ % . " # A A # % 2 ' %3 # " # # ( $ $ C# # # O # .

G% # ' %* ! # 0 .holograms. $ P ' PA %+ # 4A )4 P> ! # A A! ' $ .P ! 87D% * / ' A A % F9 # $. Respuesta: porque ellos identifican quiénes son y su sentido de posibilidad con ser una "personalidad" física subordinada a "leyes" ilusorias y no con ser lo que realmente son .el Infinito Uno. A2 A # ! ' % " ' A ) .' Figura 57: El universo es una ilusión holográfica similar a alzar la vista al "cielo" proyectado en el techo de un planetario. " A A A A %1 " G% M3 # N% ) . " # " # # 4 P> ! . > $ " ' ) # # " # $ $ A A # ! %* A A # # # $ GA # . # # A A# " O A . cortesía de Galería de Arte Holográfica Real. B )4 '¿Piensas que el Infinito se sienta a cenar?. $ ! # . por qué lo hacen esos en el Bucle del Tiempo?. " $ ' $ # " " $ C # D" # A A # %* # =A ' $ M# NA %1 .A % . N% H ' $. ¿Entonces. )4 A F9 B # ! # A H $ ' # " # " " # $ . ¿Piensas que el Infinito tiene que respirar o morirá?.% " .# " # ! $ %. ¡Un programa de ordenador!.S %A F9 $ # B # 2 # " # " ! # ' K $ % .% A F G%A1 / " " (# ! ' %* ." ' # ! % F5 # ! %..! # $ ' # " " # ! %A 0 # !# ' %A # (# $ ! ' G% 0 %%% M N% A 1 0 . ¿Pero qué es?.# # # % ! ' ! 2= A # A %1 ' $ . # ! # ! )" # # A # " A # " ' 3 C: # " 2$ 2 2 # " % $2 2 " . 'El Planeta Saturno' aquí es un holograma.% M1 2 " ! ! 2 $ 2 2! $ " ! A ! 2A ( 2 %A 5 # A ) . # $ 2 % " # ) # ! # 2 % . " ' # " # # 2 0 ( # ) !0 ' O G% 0 " # # 4A F9 " " # ' G%A9 # # 2 '$ # " $ # # %9 2 # $ # " # # ' 2%F* 2# # " # # G% F # " ' # $ G% .P ! . Cuando usted mira al cielo nocturno ilusorio en un planetario puede parecer increíblemente 'real'. Por más vea www. # " " ' ! " A " # A $ % ' ! A'2 A ! # # % % F* 2 .P 2P! # 4A) " ' # # (# .bc. A < . " ! # # # %9 % $ # % 0 . # A % " ' ' # " # # = " ! # = # % # . )" " 0 .ca). # # . 1 . (Cuadro 'Saturno'.

(Cuadro 'Usheptis' cortesía de 3-D Hologrammen. 2% F9 ! # ' N% 1 # $$ A # A A $ ' ( # # $ ! M! $ 0 . ¿Y si los hallazgos arqueológicos. los monolitos y otras 'pruebas históricas' son simplemente escritos en el programa en este punto?. $ # O # # 2 " # 2 " '! ' $ A A G% " ' ' ' " (# ' ' # " ' $ $ # $ # 2 SB # 2 # " / # $ " % F9 " # # # # C A # < 0 # . entonces la 'historia' en cualquier etapa sólo es lo que la Matriz decide comunicar al ADN. C $ Vea un Mundo en un Grano de Arena Y un Cielo en una Flor Salvaje Sostenga la Infinidad en la palma de su mano Y la Eternidad en una hora.# " " ! ) # # B )4 A F9 " " G% # ! D% F9 " " # 2 $ 4 " # $ %* # '$ # ! # A# A %9 %9 - % " 2 ! %* / # 2 2 $ # # A %* ' ! 1 # " # # %F 3 %* * %A . Ámsterdam. ' G% . # " ) # G% + . ¿Realmente existió 'ayer' como usted pensaba que lo hizo o es sólo una señal que su ADN está recibiendo ahora?. Por más vea www. ' A %3 ( ! 0 . > ! S ! ./ = # ! ! # % A# # A 2 ( %1 # # A % # $ # # " # " # 2 # ! # $ " # " '! A / # ! '$ '! / # S5 # # # B! G%AU B / A= # " ! 2 # $ % '! A # '$ # ' ' J A D % # # % S # # $.com). # 0 . " ! A A # # (# # $ A A % FH # $ # G% 3 # 2$ " $ " # # 2 ! # " " A # A# A # A % 0 ! # $ # A ' A G% 1 A D " CA A D ' . las reliquias.3-Dhologrammen. $ # ' # " # ' ! # " ! ) % 2 /# =' % Figura 58: Este es un holograma de artefactos egipcios. CA $ .2 # " $ 2 # %9 " . $ # '! # 2 # %9 '! 2 # / ( # 3 % A! / % # # # $ A 3 #2A # ! # % /# =' # # # %9 ' ! # % F. El ADN recibe constantemente la información de la Matriz.% FI $ A ' A G% +V H # % .

cada una con su propio horizonte de eventos o frecuencias peculiares. hay un universo paralelo en el que Napoleón ganó la Batalla de Waterloo. También existen en otros universos..' 3 . De hecho. Podríamos participar en otras películas. # / # G% * # " ` # " - " C: " ( # # T " 8?D% # A! A A % F1 # A # # - % " 2% > '$ $ B # ! 0 . # A A ' % F5 ' G% 9 " 2' ! 5 $ . No tenían una única ubicación. tal vez en todas ellas. Decían que estaban llenos de fantasmas y espíritus. Cuando quisieron determinar la ubicación exacta de partículas atómicas como los electrones. sino también en más de una. %A 0 " # # " 0 # ! %9 # $ " # # ' A ' .. en otro el Imperio Británico conservó su colonia americana.' * " $ 0 . en otro ustedes jamás nacieron.' 'Esta idea era tan inquietante que durante décadas los científicos la descartaron. # 24 'Durante casi cien años la ciencia ha estado obsesionada por un oscuro secreto: que podría haber mundos ocultos y misteriosos más allá de nuestros sentidos humanos.... 3 % . Pero con el tiempo los universos paralelos tendrían una espectacular reaparición. y hay un número infinito de estos universos paralelos.% $ '! # 0 . K U% B '% 1 # " 2 # 2" $ '$ % # # # # # A $ A 0 ." ! %A '! ' % * " $ %* / # # + # !" # . '.% # ' J J 0 . Los místicos hace tiempo aseguraban que dichos lugares existían. todos ellos ligeramente diferentes. / !# # %0 # # A A # ) # # $ ! # # # % 1 # A A % # # # ! ! ' # % 0 # ) # # # $ $.$ % # ) % % # " !A $ '$ A 2 A ' A 9 0 " 2 '! ! . . descubrieron que era totalmente imposible. Pero desde los años 1920 los físicos han intentado explicar un inquietante descubrimiento. . 0 . Lo último con lo que la ciencia quería estar asociada era la superstición. Las matrices son como canales de TV. también." 2 # $ # ! % 1 2 ! K 1 ) 5 6 4 'No estamos sólo "dentro" de una matriz visible. 1 # A ' ! A " $ F / # J # ') # " = /# =' J! $ / G% FI % " G% <E ( " %* 9 $ ! 2 % ( # " 2 ) " % .' 'La única explicación que a alguien se le puede ocurrir es que las partículas no existen solamente en nuestro universo. Esta vez serían diferentes y todavía más extraños que la idea de que Elvis aún viva. # % 9 '! " # . # BB1 > # %* .

La separación llevó a la manifestación del miedo (la entidad alada) que tomó una vida propia.. Cuando despertó a sí misma en este estado 'desconectado'. olvidó que era parte del océano infinito y se sintió aislada y separada.Galería en Colores de Neil Hague C $) " # # $ D La creación de la Matriz: primero la imaginación devino en la 'forma' y con esto vino la ilusión de separación. . la conciencia fue atrapada en una ilusión que creyó que era 'real'.. <6 . la conciencia humana comenzó como una ondulación que decidió dejar el océano de conciencia . Como un mito hindú dice. ubicuo y eterno.lo atemporal.

'tiempo'. y un sentido de separación. <8 . El hipócrita (y luego unos) Iluminati manipulando la sociedad humana bajo el control del programa de la Matriz.El miedo consciente de sí mismo se volvió el Frankenstein que controló a su creador manipulando la realidad a través de la ilusión de forma.

Mientras la energía de la Unidad penetra la Matriz, la vibración del miedo
se disuelve y la realidad de su conciencia cautiva es transformada en la
Unidad Infinita (vea el capítulo diez).

CAPÍTULO CINCO

Médico, Cura Tu Virus Informático
En una ocasión de esta clase se hace más que un deber moral el decir la opinión de alguien. Se hace
un placer. (Oscar Wilde)

# '

!

#

# #
!
" #
A 2 A '
'
#

"
'

"
A
(#
#
# "

%*
#

#

(

$
2!

#

#

!
#

#

#

G% F1

)!

(#
#

'
'

#

!
#

5 %

#
% F1
)

$ "

#
# A
%
!

%5

"
<<

'2
#
# #

#
#

)
. G% 9

#
$

'

"

#

#
3

# " )

#
#
!

% *)
"
# "
%

#

"
#

$

#
'

%
# " -

Figura 59: Este es el gráfico del colon que vi
durante mi limpieza. Cada sección está
relacionada con un área diferente del cuerpo
porque en un holograma cada parte contiene el
todo. (Gráfico cortesía del dueño del copyright,
Bernard Jensen Internacional de California.
Para comprar este y otros gráficos vea
www.bernardjensen.org. Detalles adicionales en
la contratapa del libro)

#
# " - C#

D
!

$

A
#
'
# !
"
#
#

$ A
#
#

#
! 2 '
$) '
'
%
#

# "
%1
#
#

!
!
#

"
'
#
0

#

"

# " 0 .%
0 .% *
# " # !
)
$
#
#
% H
#
/# ='
"
(
A
#
A
% 2
%

#

.!

%
! (#
"
$

/# ='
$ '
#

$

Figura 60: La columna, también, representa al cuerpo entero. Por ejemplo,
T7 en el centro afecta al páncreas, duodeno, estómago, hígado, bazo,
vesícula biliar y peritoneo. (Gráfico cortesía del dueño del copyright,
Publicaciones Koren, Surrey, Inglaterra. Para comprar este gráfico (que
incluye la información sobre cuales áreas del cuerpo representan las
vértebras), envíe un correo electrónico a Richard@familychiropractic.co.uk.
Detalles en la contratapa detrás del libro)

;;6
2"
2
#
$ '

' $2
'
2

#

#
#
"
#

#
#
*

"

"

#

#

!

"

2'

#

%&

$
#

#
'

# "
"

!

"
2% 3

'
%&

# .
)"

#

.

! !
#

#
#

!

#
$

#
' $2

( - ! ' $2
>O ! 2
#
%3
"
>O %:
#

#

#

#

# .

>O
$

!

# .
%
' '
9 !
2#
"
#
! 2

2

'

!
#
$

!

2%
' 2
%9
# #
$
! %
'
"
2" !
2
%H
' # $
0
$
"
2"
K
9
# $
K
"
%

$

'$
>O %B
' $2
# $ %H
#
$
# " -

)
$

$ %1
!

"
"

'

(#
F 'G%

2
O' =$ =
<7

' $2 ' $
%
.'
= -

# "
$$

# .
# %
'

$ C(

#

D%

0

#

$

'#

M#

2
%

!
"

!

N

#
$
#
#

#

% *

)

/ (#
)
$
)
"
%* '
$
% 3 # $
/ #
$
#
"
#
# $ $
%3
#
"
#
#
!#
%
#
2
# 2
2 ' $2
#
!#
# = '
C:
8@D% 1
# (
'
#
#
#
.
0
.
)
#
#
2 !
!
# .
.
"
$
#
>
2
' $2
)
- !
!
#
$
%
# !
2
"
#
% &
# 2
.
! )"
#
" ' $2
%9
'.
$)
# . '
$
$
!
' $2
.
#
# C:
<;D%
"
"
'
) C:
< D%

'
. "
$
$

%
)
# %
$
# .
%

Figura 61: Cada parte del ojo en este nivel de la
ilusión representa una parte del cuerpo - esto es un
gráfico del ojo izquierdo. (Gráfico cortesía del dueño
del copyright, Bernard Jensen Internacional de
California. Para comprar este y otros gráficos vea
www.bernardjensen.org. Detalles adicionales en la
contratapa del libro)

"

#

)

#

" ! # 2
#
# "
#
#
$
%
B
'.
$
" !
2
"
' $2 #
% *
# .
$
(#
!
='
#
%
'
#
%,
!
A
A
'
AC
D%
#
2
"
'
"
'
#
%* 2
#
)
=
"
#
"
#
'2
2
#
!
2
!
%0
)
% 9
) #
#
#
$
%
'2
#
=
%

# "
!

#
# #
$
# "

!

A
# "
(#
# .

'

%> !
#
'2
!
$
$ $) "
$$
# "
'2
#
(

#
'
!

%
#

"
#

"

#
(

*

2
(#
$

#

'2

#

$
$ %
%

"
!

$

"

#
"
D' '
#
#
)

#

(
% 3
(
(

!

#

2 %1
' $
."
'

$

'2

$ "
% '2
# $ "

$
!

'
. #
# " - #

(

#

'

AC
"

(

!
"

$ !
.
!

#
'!

(
A
#

$

.

(
#

#

# " #
#
#

2
)

#
#

'2
!

# %
<?

#

9

!

! # # ' $ 2! $ 2 ! 2 % " # $$ = %+ # 0 $) # 2 % # % % % % # # # " % # # " / ! # ! S5 # # . $ 2 ( $ # " 2 2 F# ' # $ " # ( $ " A A %9 '2 % . ! ( '2 ( " # ! # ! $ # ) ! S ( # ! G% ! ! # # 2 ! # %* " ' # # # % % # . # ( % # $ ! ! # * 2 ' ! . = 2 % " '$ # # ! S5 " ! ( ! % # ' ! $ " <@ $ %3 # / ! S5 %0 # " S # # $) # $ # . # S5 # S' $ $ ( # ! $ ' # ' % # % # # ! " # " ( # # $ ! ! $ # " # ! " $ % ! '2 " '$ ! ' ' # $ ! # %9 $ % # 5 ! # ( " # = # S5 % * # # %> ! 4 ( " " 2 2 ! % K B # %* ' # # ' " ." " # . .. # ! $ " # ( ( % 3 % * %9 . # 2 # = = % .2% * $ # 2 %0 9 ' $2 $ ! # ) ( .% . $ ! ! 2! % $) # " # ! '. %1 % . ! $) $." ' % %* ! %0 ' # 5 $ # ( # '2 % * ! '2 6? ' ! $ # . '2 # " # %. " " # # # . ! # $ # ' # # # ' ! ! " # " $ ' 1 $ " ! # # '2 A # A '2 % " % $ " # # # # " ' # ! $ $ $) $ % $.

% ' # ( # $ ! (# %+ . # % # = " (# % . . G% $ " ' " # " A ' # # % A $ % . " % F# " G% 1 %3 # !A A % %9 ' # ! (# $ . ." '. # ! " # ' %H 2 # 2 " " % 2 # A ! # " % FH " # # / .# # * $ $ " 7. # ' # ) $ $ % " $ $ # %> ! # 2 " # # # ! L' % . %& " $ # ! " ' $2 " $ %3 . # ! " % A % 2 " $ ! $ " ! ! ( % 3 # (# # # # " 2 ' (# % * # % 0 # $ # # " # %* . L' 3 >O % 9 H 1 4* 1 0 ! 0 1 # 0 ( 3 C* $ U S $ %. .2 =# # . # # ( A $ A " # # # ! $ # % " # ) ' $2 # " 2' " ! $ . ( # # ' ( ' # 2 " 2" $ % . ! # H ' ! ) $ " ! ) # # % 0 . $ 1 # @@ D ! $ . # $ # $ " $ ) / $. $ " % 1 # # $ '! # )! " # ) # '$ / %. . % $ ! .# . A # $ ! ! $ # 2 % . ( ! # ! # 2 %* ' . % # $ A # # A # # " . # ' " ) %3 2 %0 " $ %. $ ' D! # " " ' $2 # " # A2 A (# % 1 # )# % 2 " ! " %1 # $ ! # ' $2 ( # # # # # 2' % * # # ! % ' $2 / ( 4A . ! " ' $2 # ! $ C # ! " $ " '! # # " # ' $2 $ 5 '$ 12 0 > O %5 0 5 '$ H %.

0 C # # % ! " ! # # % ' $ EE $ ! # ( % . % * # # " # 2 % ' $ ' . " " 2 / ! # # # 2 0 . " " ! # / " J % ( '2 ! D! ! $ ) ! ' 4 7 % %1 S % ' ' $ # ! " # . '2 " $ $ # $ '2 . ! # ! ! ! A ) % %A 0 2 %A $ =! " 2 %3 # 2 # % % # # O ( 2 # " # $ % $ % 9 # '2 # ! $ " % # % " ' " S5 C . C $ " # ! # ! $ $ . # # # ' A ) $$ $ " 2 2 # $.# )" # # " 2 %& $ 9 2 $ * # ! > # # # $ " # % 2# $ %0 * $ " ) % 1 # # A % * # 2 ! ) !' " ' $ 3 1 * Q 2' ! ' " % " # 2" $ C D% " ' CFF A 1 2 > $ A GG%D% A # $ $ # 2 '$ $ V D% * # # . ' 9 / " A % O " # " # .# .# .! (# # ! ' # ) A .# # " ( $ D! '2 2 C " # # =! %> $ %* $ %9 # = $ 2 ( # # " " # ' 2# = = ' % 1 ! # . A# ) # 2 # ' A # " 2 " 2 # $ D / # ' 2 ! " # $) " 1 %1 " # $ # # ! % > 9 ' 2# # C # 2 # # ) ! # . # .# ' # ! )" ' !! 2 # # " # %A $ " '! " # ! $ " .. S5 % * D 0 % # $ ! ! % A . ! # $ %* " 2 ! $$ ! A A # # # 0 . C ' # " '2 % * ! ! D ' # $ " .2 " =# 2 $ " # # " = " % " .

%+ $ # # # 2 " " # 3 # ! ( # 2 ! # % M& " A # ! >% 9 $..%. > '2 • 4 ' • : % # ! $ % # # % # ) ' ! $ % % 4 $ / $ $.com/dailynews/may2001/whatsinvax. %A 2 %A 2 " % " A A " " # $ " ! B ! # # .! # ( %* ' # # 3 . 2 - # 3 B #/$ $ 2'$ # # $ ! S5 %3 # # # $ # " 2# %3 " # %* " %* A " '! ! # " N% 0 # ! % ' A # $ % # " " # # % F 'G% A +! ' # FA +' 1' A 1 2 A 1 9 " # $ / G%A ! 1' ' $ .% ' # # # " # $ # 2 # $ F %* ' # ! ! / # " # 2 G% .. / ' %9 $ % # % # ! " .. % # $ % ! 1 $) 2. $ 1 - ( # # " # ! ( C % '2 D! # # ' 2 " 2 % ' ' ! ( !# ) - % 4 ( # ! 2! ) ! % (Por más detalles vea www. # 2 ' " ' . %A ! %%% $ . # ." % ' ' # " # $ " / # " # ' ( % * ' # " # # $ % . " # ! ' " # ! " A .% # $ ! $ $ ! $ # # $$ S5 .• > ( ) !# • : .vaccinationnews. 4 ! ! '2 : 4 # # • Q # %. # ! # ! - / # " ' 7 .htm) $ " # # $ %9 . # - ! # # " # % '.! % 4 ( ' ' ! • # # $.

* # " " !' (# ! # " 7E ! # %0 S5 .! # A A' $ 1 " ! !" # # ! # $ " # . " %H' ! % # # ' C % $ 9 ) " # ) $ > % ! . # # = ! ' # ) %& # # ' / / 1 (# G% F # % $ " $ % " # .$ - " " 1 B # % * # % * " A ' # # $ $ $ A 2 # ! ( # ! %* # $$ # # # 0 " # % 9 " " 2 " ' " $ ) J# # " (# $) % # # $$ ! $ 1 * C ! " 3 - # $ / " # 2! ' $ %. " 0 . " % # " S 0 ! ( $ # . " $ # " DJ! 2 % 1 Q G% $) ! 2 / " " $ ! % F* )# ') ! ! # $ # %* # # # # # $$ ' % 9 # # ) % . ! ) G% ' 1 '! ! # # % F1 / A B # " 2 ' 2 # ' %A % . # # A A % . (# # # .! %9 # # $ $) # # % % F C= 0 # # ' ! % ( $ 2" ! % $) " D # ' $ # S 5 DJ DJ # C " / $ ' # " # # S S # !# . 0 J % " '! 2 $ # # $ * O ) $ # C $) # = # # %3 % '# !# $ D% $ # " # # " $ " 2 # DJ ( 2C ' # # # %9 ' $ ! ! $ 0 . % ) " # " %A ( # " # " S5 '! A % " # % G% J J# $ # # A K $ " A .

# 2 A %1 " A( A ' ' " " ' %1 # " " = = " % % # " A # . (Oscar Wilde) 3 (# 5 # # # ! % $ " ! ! " ' ' # $ # # " ! # # ! ! $ # ) # # ) 2 # # A %* 0 ' $/ " " 2# # # " ) $ # K ) ) ! # % # " .% # $ " ! '! A ) # / / % 1 A" F 'G% # ! / % Nota: Cuando yo había completado este libro y entró en la etapa de producción. que detalla los descubrimientos de científicos e investigadores rusos respecto al ADN. y usted encontrará un resumen de su trabajo en el Apéndice I. # ) ! # # # %* A . $ # / )# $ G% 0 # )! # ) # " # $ ) ) # )% * " (# A A A( = # A $ 2# 2 2 $) # ! # " % F. Él se ahorra la vista del horror de su cosecha.A '! ! '! " ) # ) S5 # $ O # 0 $ ' " !# # # # " ' # H # A F $ " ! % .# # ) %9 ' ' ! % > ' " $ ! " 2' ! # " # % '! / )% F.A G% " % * ! # J# A .J $ 0 $ ) 2" # %1 . ! L 2 " $ * 0 0 24 A 0 . A %> ! 1 # / A % # " A % I # . # A" ' # " %9 ! $ = % '! $ " A ' % $ # ." 2 76 # %* 2 # # $) # # %* ' %* # # %* % # # # # % # ! . Sus descubrimientos apoyan el tema del ADN como 'Internet biológica'. CAPÍTULO SEIS El Programa de Dios Está bien para su paz que el santo vaya a su martirio. Vale la pena leer el Apéndice I en la página 130 antes de seguir porque está estrechamente relacionado con mucho de lo que usted ha leído hasta ahora. vi revisiones en Internet sobre un libro llamado Vernetzte Intelligenz. $ . ) ' $ " # G% 9 " % ! " 2' " ! # # # " A ) " A % F9 # ) " # G% " .

..! $ A % * $ $ # ' $ $ 2 9 B ' *$ 7 / 7? 4 A 5 $ ! ) $ $ \ ]A % B " / # # ' ' $ $ 2" F" # G% ( . mientras otros rizan el pelo. Pero. '1 X.2 $ # N% * # " # %0 % F.. Unos arropan el pelo bajo su kipá/solideo.El Señor es Mi Pastor'. hasta justo detrás de la oreja.. hay una costumbre de no afeitarse (y con frecuencia ni siquiera recortar) la barba.! ' # " C: < D% Figura 62: 'Cantaremos ahora el himno 364 .% FH G% ! $ # ) # ! # # O 9 ! ) 2 " %* $ $ $ ! 1 " # ' ! $ = ) ) 2 ! % # # A F9 " $ $ GA K ! " ' # $ %9 # 0 . $2 # 2 $. Luego deben usarse empujados hacia adelante de la oreja para que sean visibles.. (Dibujo de Neil Hague)) 3 " ) # # # $ # ' # F. Una vez que la barba crece. Una de las opiniones en la Cábala es que los peyos tienen que usarse largos sólo hasta que salga la barba. las patillas simplemente tienen que ser lo bastante largas para que uno pueda tirar del pelo.. Muchos Ortodoxos dicen que los peyos (alias cabellos de las orejas / costados) comienzan directamente en la sien... y no deben crecer más cortos que la parte superior del pómulo. '! # # 2 $ %* ! " $ $ ) A ') ! " M # N% 9 # '$ # # $ % $ " # ' C $ A 0 D# '2$ ) 2 " # G% $ # % 9 F# " " G% B ' * 2 @4 7 4A # $ $ $A % F # " J! # % M0 $ $ $ # " ! # ! " # # $ " " " ! %* ! % ! " # % A ! G% . Muchos quienes se dejan crecer peyos largos lo hacen así por motivos Cabalísticos.." # $ A 0 A A 3 " AC A A D% 78 . # % .. "$ =# 1 # ! 1 1 (# $ % " $ 2 # # 9 ! A # # ( A $ " # ' .... no debería permitirse a los peyos del costado de la cabeza crecer más abajo de donde los lados de la barba comienzan a aparecer. y el área de la barba puede ser afeitada con algo que no sea una hoja afilada (muchas personas aceptan el uso de afeitadoras). y permitir al área de las patillas (en todo hasta la parte superior de la oreja) crecer largas también (las patillas largas son llamadas peyos). específicamente dentro de la comunidad Jasídica. # $ '$ # ! A ' # 9 $ " # . ! " 2G% 9 '$ $ $ $ $% * ' $ # 2% # A # # AC# # # # ! A % M !N% > ! $ $ =M %F # " # # % !! + ( # # $ %& # 2 2" " 2' ! # "% 4 ) ) 2 " # $ " ) G% # " # D ') $ N% $ 'Realmente..

Si usted decide no cortar sus uñas.! '! # " %3 U $.) G% # " .C: # * # ! " # " 2 $ % & (# 2 7 C $ ! . # C D% * ) $ # 2$ = ! % # ) # ! ) $ $. Las uñas nos han sido dadas de modo que podamos trabajar y caminar. # " # " .) ! ' ' " ' $ . (Ilustración por Neil Hague) # 2 # % ' F 1 # * % $ " $ # 4 0 # $) $ % $ 2 " # $ # " " % F ) G% FI ' ' ' # " $ " G% 9 # # # # 9 $ % / # $ # % * $ $. Las uñas también nos ayudan a caminar. G% * / .' 4 % % # 'El Sijismo cree en tener una vida sincera. si usted levanta cualquier objeto con sus dedos usted verá la presión en sus uñas. ' . # % * . honesta y progreso en la vida.) $ % ) 2 ! 2 . ) (# $ ) F# " # G% 9 '.6 $ # # !# 9 $ # ! > # $ %* " $! # # 2% % %.... ! D )$ " 9 D! # / ' # . ! # G% ' 2# % # T T# # # 0 ! <ED% . # A ! ' # # . Por ejemplo." $. )# C# " %%%D% 9 $ # 9 ) # " " 2" # # 4 F# " .) $ % $ # ! 9 B $ * # # F# " '. 2 2%* . ¡Adoradme a MÍÍÍÍÍ!.' Figura 63: El Programa de Dios de la Matriz. )C $ . Así por lo tanto el Sijismo permite que sean cortadas.. cuando usted trabaja eventualmente se romperán. # 7 ) # " 3 8 $ % 9 " # $ ' " # " 2 $ # $ % # " $ ! # # % * *!L 2 ) # " 7< " 1 " 6 .) # C / $ . ) " CK U% B ' D! # " ( # # # # $.. $ " $ ! # A %H ..6D% # # " $ O ! ! 2 % $ " > " O / ' $ . )% $ $ " # ! $ ) $) % 3 5.2" ' % * # 1 ) 2 # ' # $ $ ! # .

# $% ( 2 # % $ V! $) # %& $ '$ # ! 2' $2 # % # # " ' $ 2% ' .# $ $ # # " ' # . 2" $2 ' %& 2" ' " # 2 % 2# " # 2 # . CF # # # .D ) " ' " '$ $ ' . # $ D " ' ! # # A# ! " # # # # E. lo que pasa si usted llega un poco tarde para los rezos. lo que usted no puede decir.O ! C9 2 1' 2 ' 1 $ % ) 2 " # # # %A >$ 9 ) 5$ 2% 1 . lo que usted puede decir antes de que usted rece. !0 !# ' $ " # ! # ( -% # B 2 ' ' $ # " !# !# ' 2 " " " ' 0 ! # 2 (# " '! - !" %9 ' " : $ B ' 0 4 ! %A # " ! $ '$ 2" # 2 % $ " " !" ' $2 # $ .% . cómo uno actúa . ! 2= GD% ' # " .' $ $ # ' # K " $ %5 # # " 2$ ! $ %9 " ! '$ ' % 3 %A $ L #' ' # (# # . " " ) 2 # # # B ' $ ( " # ! # 0 # $ ' $ " % & )4 'Este libro aquí realmente nos dice lo que usted hace cuando usted se despierta por la mañana.cómo usted puede saludar a alguien por la mañana. " " % 0 ! ' 0 # ' " % * 5$ V ! $ $.' 3 %* .' %1 0 # # 2 $ . * # # " # 77 $ # L $ ! % $ )" $ ) # # $ # 1 " ' $ . B ' # ! $$ ' " = # $ # $$ $ $ ! ' . qué partes usted se pierde. lo que usted hace en la sinagoga. cómo uno se viste.% 9 " " %9 ' ' $ . # ) ! A ' $ '$ # ' % ' $ : % 5$ ! V $ # " . A ) " $ ) %A # # $ # ! . . ' ' ' ' ! 2 . cómo usted va a la sinagoga. todas estas cosas están allí. # # = $ 2" .antes de rezar por la mañana no comemos .% * % H " # $ ) 2 ( % # # ! !L " ' % $ # ( $2$ # 9 2 9 5$ V! # ' # %& $ $$ $ 2 ! $ 2 $ ! $ ' 5 $2 % . ! 2 " " )=! # ' % > $2 ' 5$ V ! ! %& %3 $ * " $ # # ( . %9 '.A # ' C# .0 .% & $ " B ' # # $ % ! # ( %9 F # G% 2$ % # $ $ B (# " # ! # " # .

el mismo hecho que estemos aquí comprobando. Realmente sabemos que no hay ningún otro animal en la manada. ' C !D ' \ $ ]A % 3 $ $ " # ' $ $ ! .. 5$ # 2 %1 ' # ' $2 # A )A # % ! % % # ) # $ # # " # # " 2 % & . %9 % * # 2" # " . aunque no haya ninguna verdadera diferencia en la leche.# " " '$ # ' G% ' # ) %3 / / * ' ' 2 ) # ' # $ # # " ' 2" # # )" " '! ! " " " # ! 2" . " # % %3 $ 2 # ) " 2" # 2 ' $2 '" %* # ' $ 'Yo estaría aquí bastante durante el ordeñe para asegurar que no hay ningún otro animal en la manada además de vacas. > % A' # # G% 0 '2 ' : $ # 2 . es muy extraño tener una manada mezclada de todos modos. pero a pesar de todo las exigencias son que estemos aquí.' # # $ # ( $ " # 4 '. ' ) " $ " # %9 2" # $ $ ' 2 " # % # V ! ! )" '$ $ ! $ # ' " # # # " # 2 ' / /# " # " ... $ % 2" ! ! ! # = ) )" %1 # ' $ %1 ' 5$ V ! 0 2 %F $ % # 2 # " # .# 2 # '%& )" $ % # ! %9 $ " - %* . $ 2( # %I ." A % 1 # " " # ! / # A $ $.' F9 2 ' A # # %& )" $ . Es lo que hace kosher a la leche.# ! ' ' ! ' % 3 # # " ) ' ) B ' ! 4 # # ) 2 ( ! $ a7<< ?8@ 6@6% . $$ A > A % ) U $) 2 A $ b # # A %H # % $ : )" # $ ' $2 ' ' # ! " ' # $ A % 7? A % $ .) 2 A # )A ) % " # # # # / %1 ( ! # % & $ $ # # # $ B $ " $ ' (# A % $ %M N # $ # # $ % # $ %* ) " ' # ) ) 2 " $ $ # # ( # ' " $ '! ! $ 2 * ' 2 " ' ' # $ # " $ " # # # $ %* '" " / ( # $ %.' F+ G% 'Un búfalo. ' ' # 2 / E< ' ! # # # 0 % " # $ # 2 ! # $ %& ) # $ '$ $ . ! " ' $2 # .

" # # " % ) 2 ) # 9 ) ) 2 # " # # " ) 2 ' # " " # '$ . y le daría una calidad de leche.F ' G% ." " 2 %3 %F $ : / # $ # # " # G% 2 $ 2 2 (# " # $ ' # 2 % # # " " ' 2! $ )" ! # % $ # 2 # # (# ' $ $/ ! %& )" ' $ #2 " # ) 2 $ 2 % B # # # ' # % $ # " # ' $2 ' ! " 2 " # # % 9 " ) 2 ( # $ # # # # ' # % & ! # " # " ' # " # # $ 2 # $ 2 ' # ' % $ : )" # $ ' # A F! GA % FH # ! # G% 2 / # $ %* ) '$ # $ # " I 4 'Ahora ellos hacen un pequeño danés y ellos ponen una porción de queso en el medio. # '$ # $ ! " " ! % $ ' ! (# '# ! ) 2 " # '2$ $$ " ' ' # ) 2% 0 % " ' ' A ) # ) 2 " $ %%%A % 0 # F# " 2 ' G% 9 # # " $ ! $$ 2 # ! P# ' # # P" # % 9 '# 2% $ ! B C# 2 '$ ' D (# " ! $ # A # $ ! A# %I ' $2 $ ' ' ' # ) 2 ' ' # ) 2 ! # $ ! # $ '% / A # A ! =A 9 " " " %%% A %F $ )" / ) 2 $ ' # 2 CF" ' . y si luego ponen una hogaza de pan allí dentro enseguida el pan tendría una calidad de leche. ) " # 2 # # C$ )" # # 4A * " . me he tomado muchas molestias para convencer a los panaderos de hornear su Danés de Queso en bandejas que tienen bordes en los cuatro lados de modo que no tendrán esta posibilidad de "¿y si el queso se desborda?". ) # 2 2 . % $ : ) " ' # 2 ' # # ) 2 ! 2 ' # ) # ) 2% A ' # # # A ) %. 2 # ' % $ (# 2 %K # # %A ' ' " ' # ' A ) % $ )" # " ( # # 2 $ A # . ) 2 A .' # $ " ) 2 " # % ! " ' ' ! ' $2 .# B A % F1 G% + $ # 9 *!L 2 ) 2 2 9 ) 2 # % ' $ D ! ! . $$ # $ " 7@ $ ! 9 ) ( # % # " L $ " ' $2 ' ' $ % # %5 . A veces el queso desbordará los bordes. # A % FI ) G% * $ ' $2 ' # $ # )" ! ) 2 2G ' " ! % # 2 ) 2 . Si aquel danés resultara estar al final de la lámina y el queso se extiende y sobrepasa el borde de la bandeja se caería en el suelo del horno. GD! A $ $ %%%A % 5 . F# " 2 # " ! # " # $ % B # 2 $ 2 % $ $ # # # # %. 'Así que.

pero si un fuego arde. $$ ' . "John. # " 4 A# ! # 5$ A %3 ?. $$ . # ! ' ' $ ' # ! ' ' .% % A * \ # 2 .J # O' ! " " " %A " A ! A * !A # 9 )A ' 2 -% $ " $ # # . % $ V! # %H ' $2 ' % & ) " '! A ' . D# )" # # # # # # ' # %A ! $ %9 .' $$ % ) ! . digo.! ) A ) ) ' $2 $ $ " . hazme un favor no la apagues".! ' %%% # . $$ A # %A E48E . % L % A . Si usted viniera a mi casa un sábado y me viera sentado en la oscuridad y pensara.\ ] . "Ah. no me gusta verlo sentado en la oscuridad". " A # A %1 ) ' " " % ) # ! 2 # # # # " ' ) # 5$ " 9 )% " A % ] " A '! A . puedo dejarlo seguir ardiendo.J . . yo tendría que dejar el cuarto porque me estoy beneficiando de algo hecho para mí en el Sabbat.% 9 # ) ) # # " I ' 4A " $) # # " ! ' 2% ' 2 # # ' $ !! %A ) % ' $2 # $ # # '$ ) 2# ) 2# ! # %> ! $ " " " # 9 # " # ' $ % ) A $ A! % J # # % ) 2 " 9 )# '2$ # ) 2 # # % # # 2 1 ! )" ' $2 ' E. $$ 2 # # C " '! " A A" D% 5 ' L )" 2" ' # # " # .. $$ $ %%% . el único problema es que el cuarto está un poco oscuro. " =# # " )! %.' . ! $ ! % " # " ) \ # %* 2 # 2'$ ] # # 2 A ! ! % 2 " - # 2 2% A . encenderé la luz". $$ % FI G% I " " $ ( ' . y usted se sienta. . Y cuando usted deja el cuarto. " ! # # # # # # %. la luz ha sido encendida para usted. enciende la luz y se va. $$ # / 2 ! ! $ " " # $A ) . las luces están apagadas aquí.# " $ C $ ." ." y usted dice "Ah. "John. $$ . $$ # %%% \ 2" ]%%% # ' # " " $ $ A %1 # 2 5$ V! $ # 4 'Usted no debería encender un fuego. $$ 64E %%% E ! 7 E? E? $ 2 $ %A # " 2 " $ " ' %F 2 # G% M1 N% # . eso está bien.% & ) 9 )4 A 9 # ! A %9 " # $ $ 2# $ # ' 2 # " A # ' A %I 2 !" %F $ " & " 2G% F9 " A &A /# G% 9 ) # $ ' $ L )" $ # .! $% A 3 ." . 'Pero si digo. % $ B ) " . # '$ .. bebamos un trago. bien. V! ' $ %1 " # $ . .

y si esto puede pasar... # D! # L L '$ 2 $ % # ) 5$ $ $ A # $ $ 2 " ' $2 % 2 9 = C .. # " # '2$ =A ! " ! ' # ' ' " # ' # ! " # ' % D # " %A 2 # ' ' ' '. # # # 2 ) ! ' % # " ' $2 ) ! " # ' # % # # O 9 . # # " # ! 2 3 # A# A.%* 0 % G% F " . .. ' '% : / # $ $ # L (# L ' 5$ ! ' %9 B " " $ ' $ C # D% 3 '" ' $ $) # # $ L )! A % . .P P ( $ ) 2 ( 2 # 9 . # " # % $ # # % ) ' # # $ 2 " " # # " # ! # $ A A $ % / " # 2 = D # 2" % ) 2 " ' $ $ $ ' % " .' (Mi énfasis) & )" ' ' # 2 2 ' ' ' " ' A % 3 4A .A ) %1 $ # ! $ (# % # 2 # $ A %F " I ' A: $ #2 = A FH GA 4 'Aplicamos esta clase de pensamiento a todo lo que hacemos . # ' " ' % ! 2 !A A 9 ) ! $ . # # %3 ) 2 ( )" 2 " $ !# # # " 2 ') . y si eso puede pasar porque tenemos miedo. ' # ) ' %1 # % C ' # # %.% ) " # # %1 2 # A # # % # F # $ : # I " # *!L 2! " ' $ $ ! # " # G% * A " ! # " # $ " 2 ' ! " % 9 $ ? # " ! %0 $ G% * 2 2 . Tenemos miedo del daño espiritual que puede venir sobre nosotros. Sin embargo.' F1 # 0 . si arreglamos los errores que cometimos en este mundo entonces no tenemos que tratar con eso en el mundo por venir. %3 ) 2 # C# ( ( $ . # J $ ! # # " %1 # $ % % # ' $2 $ 9 # %%% # # ' # ! 5$ %1 $ : )4 'Tenemos que entender que en el mundo por venir vamos a tener que tratar con esta tarjeta de resultados que hemos desarrollado a través de nuestra vida y. ." / $ # % )" $ # # C 2 " 2 $ D# " 2 ') ' $ %9 / 2 ' 2 ) 2% A A ) %F G% 9 2 $ # ' ' " ') ') " / # $ !S ! % # ! %* )" " ! $ # % 2 " A ' ! . de los errores que cometimos recibimos el castigo por ellos.

# 2 # # #2 # 2 . ' ' " $ ' / " $ $ # " $ " # % # # A A ! ' # A % # %* # ' # ! / ! .C 9 $ $ D" " ) # # 1 2 = ' # / # # $ $ %9 # ' " 5 ( = ' $ A # 2 . )% # # * (# 2 ' ( F $ ! $ 2 $ G% B ' ) 2 G% F3 ! $ . # 2 $ !# 0 2 %9 J# 0 ' ' / V ' % F0 # ' 2 . 0 " # .) $ ' ' %+ ' 9 L / J# ) 2 $ ' 0 K / J# $ B J! # > ! V ' CV ' 9 DG% % 9 /4 A %9 # 0 " .A % . # # $ % ! 5 ' # A " # " 3 # %1 2 " # ! $2 $ ) $ $ A $ ( # # / A % ) ) # " # " B $ $ 4 # ! 0 0 .# 2 ' # ( !# # % # " # # . % 2 $ " . B 2 # 1 %1 # % . %> " ! J# / %. %. !A # O ! % 2 ( %& ' ' %I ." ' # # " '. $ # % 9 !# 3 ! $ ! # " " ) # ! # " 2 " # # " $ $ # # ! A B ! %3 " %* # $ $% " ( . $ $ $ . " # ' " $ " " # 2 %0 2 # " # $ # " " # $ ! ' # # ) ( 2# 2 ? $2$ # % 9 $ # # B$ % . B '$ D! # 2 $ $ " ' ' ' # # .) " ! .A %* ' ' $ % '! ! O $ 3 ! # " ' ' " %.# # # # " " ( L' ' . C %9 2 ! # $ " %* " . $ 2 ' * B A % 3 # . $ $ % $) $ B 0 ! 9! ' % C2 $ L /D # $ ! A % * " '.

.' $2 " 9# " $ % " . " L / $ '$ ( !" $ ' $ % # " # (# % # $ ! ." # $ ' # $ # C D 2 %* # # 2 " # # # # $ %* ' ! " A A " # 2 " '% * # # # " @@%@ # C D % * B$ * # # # % " ! L / # ! # . %* 2 ' ' 2 # !# # . A A ! # # # ' ' '! C: ! * ' # - # # ! % ?E # !L A <6D% * # ' A ) 0 . # G% 3 2 # ' $2 2 " # $ %A +! 2 # ) %AH ) ! ! # # $! . # '! # $ ) # / " 2 % FI " " L / # ) ! # $ %* " $ %* % $ % % # " * # $ . Toda la humanidad no salvada realmente busca ser libre de lo que ellos ven como su "tiranía".# $ ! 2 # # " ' $ $ ! # " # %* # " %1 . Estamos en un umbral en la historia. Y la presentación es tal que evita toda la terminología "religiosa"'. Nunca antes las técnicas para "liberarse" . # # A % % & ' $2 (# " ! A A % '# '! # % " " " ) %1 4A %%% P # # P ( " " " ! " # # ' ' 2A % (# 2 # '$ B$ ! . han estado tan cerca de ser presentadas al gran público. $ 2 # $ # %: " # # 2 # . .las técnicas de hechicería. -% ! # . # ." " A # $ A ) " ' $2 %3 )" A #2 A $ '$ $) " " $ ! $ B$ " ' C . # $ % 2 9 $ # " # # # " 2 " $) ( # # ' ) % * 0 .A A $ D% * . 5) # # 2 ' . $ " ! L / " ) # % $! # # $ $ $ " !# . % F9 G% F3 " " " ' $ G% # 2 ! $ # # # ' 2C D %A # $ $ " ' $ 2 # # # ! ( # $ ! %A& ) " B$ $ " " " # " # " ' '% 9 ! ' $2 " # 5$ : $ # " % ) # 4 9 A 2# ! " # % *2 2 'Cada uno REALMENTE sabe que Dios existe y que Él está al mando. 2 2 = # " % $ '.

Figura 64: Las religiones humanas adoran al mismo 'Dios' de la Matriz a través de versiones diferentes del programa. $ > ) ! #2 .+ ! : S ) 9# 0 2 A 0 L / A! ' 2 . A .D C" 9 % # << FF 1 A 5 C: $ # ) . y el Papa con la mitra en la cabeza de la Iglesia Católica. # . $ B % <8 ! $ . GG% A " # )" 1 A! <7 <? ! <@D% . ' D ! A 5 2 C # D $$ ' % 2$ ! " 9. ¿¿Piensa usted por casualidad que ellos podrían estar relacionados??. B $ + $$ ' . son todos aspectos del mismo Programa de Dios de la Matriz. " $ . 2 2 A % ') # C . . # B $ $ % $) 3 " A A B $ A $$ 2 ! . 2 A 0 A 0 > A! A 5 ' A $ A# A A= .A! 1 A ! Figuras 65 y 66: El dios pez Oannes (Nimrod) como era simbolizado en Babilonia.% A 5 . (por Neil Hague) ! ' ' $ $ # B $ ! 5 # " 5 $ " % " 1 '. * A ') 2 AL / ! > $ ?6 2$ # .

= # " # " % $ = Figuras 67. 72 y 73: La reina Semíramis como es representada en una moneda antigua y las Estatuas de la Libertad en Nueva York y París. N% $ " ( % L / # ! ' # # 2 # # $ ' $ ( " # 2 # 2 * )" ) " ' ' # % # # # # # $ # C 9 0 D% 2 . . '$ ! 0 K$ * 9 !' 1 ' " %9 $ * = D )" *" C *# " # # A 2 A# " '! !# ) 2% # 2 9 9 # L / $ 2 " $ '$ %* # 2 # # ) 2 L /! 9 # " $ '$ % " 2 4M '$ / L /= $ ! . A ') . 68 y 69: Tres de una clase: la Madre cristiana María y Jesús. 2 # " # SB ! ' *$ : = $ # 52 . 7 ! 7 D% * C: 7ED% 1 ?8 2 .% * A % ( ' ! . y la Reina babilónica Semíramis y Tammuz. A D% * ' $ A L / A! S S$ $ # ' 0 ! $ A 8 5 ! ' ' $ . También note como la Semíramis babilónica sostiene la cruz 'cristiana' miles de años antes del cristianismo. 71. B 2$ # 5 . 2 . 2 . 2 9 2 C: 7. Son la misma deidad. !* # # C0 ' D! B $ C # # $ .$ % * ' $ $ # ! >) ' 0 . " 2% Figuras 70. L / ' # 2 . que es la Britannia británica. la Isis egipcia y Horus. B $ 5 . Es el mismo mito bajo disfraces (apenas) diferentes. H # # ) $ .

# ! 0= = . 8 $ % 2 . ! * A= !. 2 )" ' '. A 1 A D 2 ! %." # " A $ ) ! ! # A % ! $$ " # $ - # ! 2 ) ! ) 2 $$ $ A 0 B $ ! # $ % ' # $ $ . ! ! # %* * ! ' $ ' $ % $ ) # ) !. A! 2 C ) # # $ " % #2 B$ 2 # ! " ?< ) . A # L /A # N% ) 2 ) 1 $2$ 5! B $ ! $$ # 2 ' 0 # ! # # B $ %: ! '! $ $ %& L %* $ # ' $ . )" . . . 2 " # $ % $ 9 $ 7. 2 . 2 " * # * ! # # 9 # # .%& # % ' $2 ' C D A A $ $ ' K '% 1 2 $$ A ) 2 A %* * ' ! $$ ! %* # ' ' ' ' # ) " 2% 3 # $$ / # ) 2 ! L 2 ! 1 % $ .$ # )!# . = %L / $ 2$ ! ' $ ! " L / " A A= '. # $ # " " % $$ 2 " ) 2 ( ) # # -% 1 = / # # . ! # # $ * ! C !D= - ! A ! ) ! # % # -2 # ! AA # # B $ " $2 ! $$ ! # )%3 5 !0 # $$ # 52 # A ) # V '% * ' " '. ) 2!# A ' $2 I ' " 2 " %.D! $ $ ') .) " ' $2 A # A B ! $ 2 A A 9 % * 9 # ' C. 2 # # $ . . = % ' " $ .. ' ' %.) # # . ! " # 2 # $) # $ % 9 2 %* $ %& # ' 2 # $ ' " 2 " # 2 ' 1 .$ ) 2 " 8 2 " ' $2 A A ' $2 % A ' $ A .% * AA 2$ : 2 # $ B $ ! . ' . 0 # 0 ." A / ') . . . 2 %* ' A 9 AC ' D! A $ B $ %* . ! ) 9 % $ 2 A # A # = # .% * = = ' # # % M* " # $ . .! B $ %* K S$ $ 2 # " # !' ) 2 # % ! ) ! A A ! B$ ' ' 2$ $ 8?7 ' $2 $ $ .

y hasta en China. es directamente designado por Dios." 664 ? # A % # '2 %* # # . ) 2D > # $ # $ * B $ 'Por todo el mundo. no debe haber ningún otro profeta. " $ ' V $ * 0 %* ! # ' $ $ ' 1 ! '! ' # 0 % * $ " $ ' .# ' % . ! ' # # # # " 2 # ! # " ) . siempre es encontrada junto con ellos. pero. Los sacerdotes de Osiris. 9# $ $. # " $ 4 " !' " ( $ 9 2 A A %* ) 2 # $ J " ! L / J! " " " A A $% 9 = O 0 . En la Roma Pagana. y luego se puso a trabajar para conseguir que otros imiten su ejemplo.$ # # $$ ! L 2 ! # ( L / ! A # ) 2 $ ' " $ ' %* " $ ' S$ ' # ) " # 0 ' %." ! ! 9 2% * " " 2! ! # 0 . 2 ! % $ Q ! C # # '# B $ ! 1 % ( # @@?D4 B $ C9 $ ! %* " %L 2 2 ) $ $ # 1 ! # %* # " $.% 2 " $ ' . primero afeitó su propia cabeza. el Baco egipcio. La diferencia básica en las dos sectas es la de la fe chiíta del sistema de "Imamah". La designación del primer "imán" fue hecha ?7 . en India. esta tonsura o afeitado de la cabeza. el único líder verdadero de los musulmanes. . siempre eran distinguidos por el afeitado de sus cabezas. " E4 8 $. la señal distintiva del clero babilónico era la cabeza afeitada. Así Gautama Buda. La fe chiíta de "Imamah" implica que después del Profeta (pbuh). ! # J 2" ( " " B - B $ ! 1'2 0 ' % " 2 ' # 1 # # 9 # ! 1 %* # ) 2 % $ (# % 9 4 'Hay varias diferencias en las opiniones de juristas Shi'ah (chiítas) y Sunitas.!" 78 . en cualquier momento dado. en obediencia. es "un Imán" que. Sin embargo. al establecer la secta del budismo en India que se extiende hasta las regiones más remotas del Este. # # ! B $ % * ) " # # # $ # ( $ " # % * " # ' # L 2 0 . # # 1 # ! ! %3 # " A %%% ! # 2 ) 1 B$ $ . ' $ A $ $ " L 2 ! $ " # 0 0 # .# " > $ 9 $ '! . como los profetas de Dios. 9 ! ! % # # # # $. donde se encuentran los rastros del sistema Caldeo." 1 ! A % . no todas estas diferencias pueden ser llamadas como las " diferencias básicas" en estas dos sectas principales del Islam.' $ . % . . $ 9# 1 # B $ % = 1' $ J J! ' %. como él fingió. que vivió al menos 540 años antes de Cristo. a una orden Divina.) ' /# 2% .

por Dios a través del último Profeta (pbuh). DF ! " 2 ' $ $ # # % ) ! 2 $ 2% % $ ! ! $ # J# ) 2 & & 2 $ '2# =# $ $) 4 ' % # # # # # # % . H ' J# $ $ ! ! A # / $ $ ' / 2 ! %* # # )% A# " !' ' )G% + . como los profetas de Dios." que lo precede.!" D C # %9 J# & J! # (# % 9 ! % . por otra parte. $ % ! $) $ # ' $ % FI A JA ! 2# ! A 1 $ $ .% $) # 0 9 " 2 U U' # ) ! 2 %& " $ ! 2 " $ ( ) # # # % 0 . # ! %I $ 2 # G% %.' $ " ) . no adhiere a ninguna de tales creencias. %. Los "Imanes. por lo tanto. mientras cada "imán" subsiguiente es designado a través del "imán. ' # ! ' # % . La escuela Sunita. ' '. '3 FB # 2" ' ' .A JA $ ' $ ! " " G% H !# A $ ! & " $ '!# ) G% F $ % . son "ma'soom" (libre de pecado. # ! ! # # # 0 A! # $ ' ! $ " ) " " ! 2# " " ! ' 2 ' # $ = " # $) A # $ A # O # )D% F1 G% F* # " * ! ! F $ !B 9 0 A" 2 C ' 2 ' $ # G% F ! $ )D" # $ $ " > ! ) !' D G% * # . $ " G% # / G% % FI A " ! A $) " ' # $ A % " . La creencia chiíta sostiene que los "Imanes". Otro requisito del "imán. ! # ) 2 1 2 B $ D 9 " %* # 0 " $ # ! . B '! B $ & ! ! 2C " ! G% ! ' ! $ T $ $ ! )% & $ ! " A # # A# ! $ % #C '! ! $ C " ! B $ : 5 A ! $ ! $ # # . ?? = ( $2 " $ $ ' " %. son así no sólo los líderes políticos de los musulmanes sino también sus líderes religiosos y clero. $ " # " ' ' '. $ # %3 # $) %A $ 9 0 F# . deberían ser obedecidos en todos los asuntos y en todas las circunstancias." según la fe chiíta." según la creencia chiíta es que él debe pertenecer a la familia del último Profeta (pbuh). inocente) y. # - ! 9 # 2" # # C' # " H " $ %& # % . 1 " # # " 0 # # .

(Oscar Wilde) .% % " / # A2 A ' 9 2 A " 2 2 A $ $ # 0 .org/faqs/judaism/FAQ/05-Worship/section-42. % " #2 ! (# # ! %3 2 " " # ! %9 " ' ' " # A A %* 0 . ! # 0 " '$ %+ ?@ % % # 0 % # # ) # " ' # A A % " $ ' % # A # # # ! % A ) ! " # " " $ # 2 ! # " # $ $) %* A A * . A % . .html http://www. $ 2 $) .% % " 2 # % $) O % ) # A ! ' / # " # # ! # # . Nueva Era .com/related/text.La Misma Historia Discrepar con tres cuartos del público británico es uno de los primeros requisitos de la cordura. % $2 ! $ # 0 # 2 # # # .: http://www.% * $ # " / # $ . # O S " ' # %. # ! ' 2 $/ " # 0 %. $ -% B . %9 " # " $ # # " A # $ ! #2 # 2 $ A# " '! ! 2 $ .# 0 . # " 5# '$ 2 # A! " 0 .ecademy./# .com/node.understanding-islam.faqs.! ! ' . A # 2 % ! $ " $ # ' ' A ( % 9 $ O # # ( 3 ! $ ! '! ' $ ' A2 ! 2 ' (# 0 " $ $ . # " A # " (# # . . A $ ! ! ( " # / ! ( ) # # ' % " %> $ $ ' # % " # ! . # % 0 0 1 1 " 0 .php?id=26320 3 http://www.# $ 2 % 9 ! A .aspx?type=question&qid=417 1 2 CAPÍTULO SIETE Vieja Era.# " ' A # * 0 .

CA 3 A D " % '! # # 2 # " ' # " G% . ) # $ % 1 " % .% 9 (# # $ " # * 2 ) 2 . # % 2$ ! " 2 ! 0 ' " %> ) % A # 0 9 $ %9 " # $ # # A A % ' $ $ S % 2 # ! ! % # # .' 'No. % .# # F G% * O " # A! A ' $2 (# GA# # " 1 # " $ A % * " 0 .% ' $2 ! 2 # A! A %A F9 " % # " . no tendrás que hacerlo.% * A !A " # 2 2 % P ! P# O " # # # # ! % 2 ! # % 2 2 % 9 ! $ 2 # A A 0 " F ! # # # 0 . Hombres han vaciado cargadores enteros sobre ellos y no han acertado a nada salvo al aire.' * 0 . '! ) # . Trato de decirte que cuando estés listo. $) ' ! $ % * " # # 0 # = # $ ! : # ! %* ' % . $ " '! 2 J % ' ' 0 . $ $% $ ! ' $2 % # $ % # 0 # (# # . # $ % M # $ " %* '$ '$ $ # # ! A! A $ % #2 # # # G% ! # ! ! " ! % / O 2 # % F9 " ! 2 J 2 K B ! # % " " # % 2 ! !/ 0 . nunca serán tan fuertes o tan rápidos como tú puedes ser. 3 " 2! 0 " B )4 A . A ' B (# % )" @. ' # " A A" " # 3 # " / " 2 # (# " " " . Y todavía su fuerza y su velocidad aún se basan en un mundo que está hecho de reglas. % . que puedo esquivar balas?. " .' '¿Qué tratas de decirme.% 0 (4 'He visto a un agente [programa de software] atravesar una pared de concreto.# . Por eso. % $ # J 2 # # " # $ # $ ! " # ! # % 9 # $ # B # " % ! ( # ! # # ' ! # ! " # ! %* ! # " ! ! A 3 A ) A *! A * " $ O %5 2 " '! %* .% * 3 %* . ! (# " " ( N% * # $. Neo.

$ ! 9 $ # G% " " # 3 # " A F* # 2 A (# ! %9 $ 2 2 *$ D% 0 # # # A % # # A# ! $ (# * > # " $ . # # % @ ! " # ! 2 % " $ # " / # .' $ B 0 . ' 2 .$ . GA ) # # $ A) 2 ' GA ) G%A+ " " B $ ( C " " 0 ..% %* " ! " # % . # %* B # C $ B # $ # # $ ' .! " P A F9 $ $ $ # * 1 # ' 2 ' P . # ' " # 2 %A F M / # $ # 2 ( $ ! # ! $ % # " # % ." A C ! A # # " # A # ! " # GA# G%A0 B A O . ' # ' - # 2" # # %* # $ . A # $ (# A $ ' " /! A # # ! # # / # $ $ % 2 . $ = . # ' 2 $ . ! .# % 1 $ A2 # $ " %9 ! % # .% S # / # %* . ! A # A A " A A . )" $ # A2 A= # % ! 2 J D $ % ' %& " " $ D% $ % ' $2 2 ' # " # 2 ! " # " # 2" ! ! # # 2 # ! # B $ A$ . 2 A % .% A F9 2 # $ ) # 2 ! )4 A +' # 2" ( # # # # H % " " " . A A J %. $ B ' $ 0 ! # " 2 ' %1 # # " # ! $ %. O # # " ! ' " $ % # $ 0 # 1' J " # (# # ! # " ' % F9 " 0 =A2 " H % ! $ " # ! 2 " " " % " " (# # - # A O A' $ # 0 .! " .N% * A % # # A # " # . %1 $ # 1 0 .# " ! # # # ) ! 2 * 0 (# 3 %9 " ! # B # %A F9 % ! ' " '! # O # 2 " A" / " # ( .

B %A F9 '! " $ G%A ." ' ' # 2" $ 1 " # ). # " L / " 2% > " ' # A # # 9 " L / # A %* " # " . # # " " A# " 0 .# 2 G%A* A # A! $ = " 4 . # 2 2% * A A ) # # AA $ 'A A % % 9 % Figura 74: La Matriz de la Nueva Era: la conciencia atrapada en la ilusión de evolucionar a través de la experiencia reencarnada juega a una especie de juego de escaleras y serpientes.. A '$ 1 A " # A . # . )A # . Cree que progresa 'subiendo las dimensiones'. 3 # ! " # $) # " A F9 " (# $ 2 (# 0 . ! @ $ A # . )% $ A 0 . 5$ : # " % " " # 2" * % ! .% " I ! A$ " A A % ) $ ' ' ' (# ' ' ' (# " " % A . # " ' (# % # # A %.% 0 % 2# " ).# # ! $ ( A ) . 2 A ' % ' (# / 2 " . " # # ! $ 1 % . ' %0 A# " % " # # # # 2 " # 4 " A " A! A 0 . pero la Matriz está diseñada para asegurarse que no se escape.

0 . $ . K # 2 G% F # " # G% 9 ! ' # % .) ! # A % $ *! 1 # $ > ]A % " 2 % . A! A > $ A *!1 " # ' ! # G% F # 0 .% FH # " # . Incluso aunque esta imagen clásica de Jesús se derive sólo de artistas occidentales. . 0 " $ $ # / # .# " ) " 2 '! 3 G% # % C B * . % 1 # A " # ! 2 A K ! A $. " K > B $) B ! A + " 2 # A . '! 3 % F1 # Figuras 75 y 76: La representación cristiana de Jesús y su alias de la Nueva Era. A# " # 2# * * # A % # !' # ) $. % . . Sananda. A 0 K > B A % A . ' %1 $. tanto el cristianismo como la Nueva Era se las arreglan para retratarlo del mismo modo. @E L . A' A # " # 2 " # $ A A A 2# A ' !% . $ ) " 2 0 .. " ! # $ 1 ) ' ! A A C: 76D% * 0 # % $ '. A # " L / C: 78 ! 7<D! / $ % M '! B$ " 2L / $ # " 2 # N% 9 / 2 ! A L /A %* K > B $ ! A 0 $ A L " 2 # 0 $ 1 # " $ 2 ' A % FI G% F1 2 ' G% F1 # G% FI ' G% # % K # K %9 " ' # 2# ' % ' $2 # % # # # A' A! # $ . $ $ B ' A" %* # > > # A 1 ) B 2 '$ A# S $ ' A# A % # $ '$ . " ' \ 0 " 2 $ ( ! $ % $ $ " K # # # " 2% > ! A / ! + # A # ! # K (# ) # ' 2 A % . 0 ' $ (# # %%% # %%% A L /1 K 0 0 % ' ' L / # # %9 .D . " K * > S* > B A 0 A" ' A A 1 $ ) " A " 2 ! ! !' $ 5 # A # $ " 2 # " # $ $ $ 2' ! " $) # ' .

. ¡Queridos Amados. 0 # D% K ! G% " # % O # ! %> " " ! $ > ! A ' # . $ )$ 2 ! # $ 2 !# 2 # N% # " ! " $ % M* $ # $ # " A '$ / " " ! %D* 1 $ ! %A MMM $ ! $) #2 ! # # ) 24 Figuras 77 y 78: Dos de muchas representaciones de la Nueva Era de 'Ashtar'. # % c% " % # A A A# A" 2 # = %+ 7%. Estén en @6 .. L / A A # A %3 U $# # $ ' A %M# " $ # A # # ' = " ' # %9 $/ " " ! ' A= A . # # % M* 1 # $) # $ ) ! # N%AC )" ' . les envío vibraciones de AMOR de la Más Dorada Rosa a todos y cada uno de USTEDES!.NNN%A . A % B $ =# ! A A ) ' # ) " '! " O " $ " E. A % B $ $ # " 9 B ' + # C 2 % F9 " # 2 " 2" 0 5 S( # # ! 1 ' A " 0 " ' 1 # ! . .' A # $ # ! # # " . =# ! + ( ( S+ ' A AA ' A! A # " -A $ # 2 # " 0 . ¡Estamos tan contentos de que escuchen y se conecten con nosotros!.< # . Starene. ' A # 9 NA % +! ) %M ' 2 # ! $) 5! " N%A ' % C$ = # # 5! % A )A # 2$ $ = " ' .. $ A # D $ 2 ) . *.# # (# % # # 2 " ) 2 # 1 ' ' ' 77 ! 7?D% * " # $ A # # + 9 1 A AC: # " A # '! " # 2 # 2 A ' # ! .# 2 ( # ! 2% ) 2% > ' # 7 : 0 2 ' ' " A! ) A 1 . yo.

. Ellos saben que son uno con todos. '3 3 . ¡¡Kadoish. $ % " # 0 " ) $ ! ! . C 0 5 D 0 " L / 1 A % 3 # $ .. Kadoish. a la larga conectándose con nuestro más Alto Ser. y que ellos son Cristo (fundamental para cualquier discusión de la Cristología de la Nueva Era es el reconocimiento que los seguidores de la Nueva Era distinguen entre Jesús. ! 3 % '! " % %* A % F.! P P $) # $ ' A $) A # .A! A ( $ '! 66%. ..!# $2 D! . ¡ShaLaeLa!. El trabajo de luz incorpora el mensaje de Jesús de Amor y Luz en nuestras vidas diarias. Firmado Cte. ¡Adonai!. %3 '$ $ A . D! F # 3 $ # ' C # # # GA D ) # = # %.. pero siempre divina. Starene.000 trabajadores de luz llamados Águilas conectados con el Comando y ese es el mínimo de almas requeridas para el proceso de ascensión. " ' $2 ' $2 ' $ $) # 66%.% * # $) $ 2" L / C A( ! A# # % 3 $% ' $2 . # # A ) > # $ # . %1 " # ! . el parto de la humanidad desde lo denso y físico hacia cuerpos físicos-etéricos de Luz. Tsebayoth!!!!. ¡¡¡¡¡¡LOS AMAMOS!!!!!!. ¡Amor & Luz!. " " # ! " 2 $) ! A A # 2 $ ! ' # $ %H % %1 A# B # A # ! # " ! ) " 2% # ) - b " . # " " % " # # B $ 5 A *$ A.. Adonai. Estas Águilas son un grupo de almas que no se identifican con un planeta especial. K % A F1 # .% " ' / G% > $ " ! ' " " ! # %* # # " ' " ' % # # 9 @8 2 % . 9 ! # " # " 1 ' # '! . ! % 0 . y la conciencia de Cristo diversamente definida.. # " .paz interior como exterior.0 ' ! $ %3 U $ ' $ 0 0 2 9 % ' ! # # 1 )3 1 9 # % ! % 4 'Hay 144. ¡¡¡Estén en AMOR. " $ 0 $) # A %9 G% * 0 .. y a menudo una entidad cósmica. impersonal). Ellos sirven como comadronas cósmicas en el proceso de ascensión. % .. ! $ ' $2 $ !C 3 * " )" K %* . 2 $ ' %%% ' % 9 " " 2% # C$ D% 3 # 2" L / # / ! # # % 1 ' # A A ( ! . capaces de ascender con la tierra a la quinta dimensión. un mero recipiente humano.% * .!!!. 7ma Flota Comando Ashtar =0 2 $ ) . Kadoish.

theosociety. # ) # = $ (# %%%GA. " 2 # # # " ' 2# # # .! (# # # !! ) 2 ' ! 2# %* # .to/ 1 CAPÍTULO OCHO Otra Mirada a la 'Sociedad' La educación es una cosa maravillosa.) ! ' ' (# 9 H ' ! # ' # 2 # 2 # $ % # # 0 % # " % * ) % .# / # !! # # # " # " # .galactic.org/pasadena/gdpmanu/mahat_ch/m_c-5. $4 % $ 2 ! !' A % A " = ' ' " ' " # # " # A # O 2 " ! ) " # D! " 0 ! # # A % G% * # ! 2 # . (Oscar Wilde) . A# " )" L / ( %B # !! " L / !. $ " $ # " % ' ' " '$ / A . " ' " ! $ # # ) % # # ! 0 " % ' ' ! # # " # ' " # # % 9 % # # # : http://www.' @< % F9 " # C ! % # # # ! 2 2 " / # $ '# . " A A " " ) # # 2 ' * # % . 2 ' % .ascension-research. - # # # 2" # 9 %A F9 " '2 # . a condición de que usted siempre recuerde que nada digno de saberse puede ser nunca enseñado.html 2 http://www.htm 3 http://ashtar. $ / # $ % *$ % $ " %. . (# % %. # (# # " ! .# # % * ' ' % A " % 1 ! A A % * 0 " 2 2% / " 2" 0 D # 3 % S5 D0 # " # # %* 0 .! # # % .org/gwb.++++ A ) 0 # # # / % $ " 2 . .# $ " # # " 0 . " > ! ' L 2 " 3 ! # # " # .

= $ $2 % ' 9 # 5) $ ) " @7 # # # % . # $ 9 " ! ! " ! # # # . " # # ! ' ! 9 3 2% 1 C # D! " 6D1 C = $ 9 $ # # # # .$ % 0 =* K &( % # : 3 0 9 # $- $$ ! # .A # A# . trabajan juntos para imponer el estado centralizado global.$ ! $ # > . # # 0 # # # ! #2 . ' # # # " 2 ' " = 0 .# # % ED . ' . # . 0 $ # " # " % # # $ 1 # ' ! ' % " ! # " / # # ! # # # # C # " # 9 A= # A 3 % # # D " ! $ ! # $ -% O ) # " $ " # ! % " ! A# ( # " # # $ ' C: $ # 7@D% % > ! Figura 79: Tras bambalinas los > ) ) 0 2' operarios y las marionetas de los Iluminati. C " $ % 2 %* <D ' D% $ " 2 '. que a menudo parecen estar F GD en 'lados' opuestos.$ ! 9 ! ) ' 7D9 # # / ! # . # # # # # 8D1 ! X $ # " % " $ 2 # / " # # = # ' !% 9 A .!3 D! %%% O > A )A # # # % O !# ! ! ! 2 " 0 92 . % O $ ! ! 2 $ % C % ' O D %1 # 9 9 0 0 # 5) # A . A" # . Unos hacen esto a sabiendas mientras algunos tienen sus acciones manipuladas sin entender las implicaciones completas de lo que hacen. ( = 9 A - B A A A %* # " .

! # ' D% 9 ! '! # ! # # # ' # ! % " C ( .# # ! ' %* 0 ." % - 1 C 2 $ " 9 ! X C # " %3 D" D # # ' % 3 # AC ' $ ' '. # %A* ! 2 " ' ' . % " ) O' ' # . - # # 9 % ! 3 # % %% * # ! %A > ( 4A FI - 2 A D" ! ( " # % * $ $ D% ' ! # %* $ # ' A A # 9 A % # " " # # # U # $ " # . % # # C.% 2 " # 2 # " # 2% 2# 0 .D " ! 2. " # . $ $ $ .$ ) # B K %1 " $ $ # 0 .% # %3 " - " " " A " ! ' ' " # % # # " ' ' G%A3 $ # " ( % * # ) % F> " '! $ " ' " " ) # # ) 2 # $ # $ % E. $ $ ) '# # # ) A # A # # = 3 2 % 9 0 " . ' ' # '# % # A A $) # # 4 # 0 $ ' ! % 3 ' # ! ! ' " " )4 A * ! 2 # 2 # " # # C# % D! ' 2 # # . # '$ % # # " # # @? # # # / ! # ! # % $ # " " . * # $ $) # C.# " $ # # $ %> 2 # " # " % # ! ( .$ # # # ! 2 ' ! 2 9 0 0 .G% " %1 " % '$ # " 0 .! %1 + # # 0 * $ A# ' %.# " # # % %. A A %* " (# O # # # # ! $ # $ % 9 0 .# # $ !' ' " A A # " # # % " 2 # # " % ! " !# ' " # " 2" O # 0 % .

/ ' # # # N% * .E $ % # -2 $ # # # -2 $ % .#/$ # -2 # ! A/# % (# . # # # %* A # # ' # # # $ # * ' $ %1 ! ' $ ! # # " " 2 ! 0 $ # ! $ ) " B # 2 % 2% * # $ $ ' $ " $ A " $ ! / %0 ' ' " ! $ " # # A C D " " # # Q # " " ." 5 3 ! # " # .$ B ... " # # !# # # " 2% # % * # # # ! C # ! " ' ( " # %1 2 % $ )A %3 $ % 2 ' ' 1 # $ O # (# . # # J# S0 # % # $ ! " $ # " " " 2 2 # # # % 0 # F $ # # $ $ G% . # 2 % # # % $ # S5 ! # $ # / 2! # % . B $ # %* # ! # %5= $ @@ " # # %4 5 = $ " 0 ( ' # ' # ( ( % # . ! 2 ' # '$ $ % 2# A # % * ) A A C # ! ! $ . A ! # ) 2 " # # $ )A % ' $ $ # # # # # ) # A $ )A %* # $ # D .% H " # # # # ! 2 $ . (# %> %+ 4 F# " $ 2 # $ $ )A G% L / 0 .E ' % & " . A ( ) ' # % 1 ' ! ! # .% * / $ 0 " # . # %3 # $ $ O ! # ! 2 ( ' " " ! % M3 ' # 2 % ' . : 4A %%% # $ ' # ) # ) D% # " # # $ # = ! % 2 . ) 2 # # ! # # " 5 % ! 9 ! # B 3 3 . # -2 $ # " ! = $ ' # " " ! # 0 ' 0 ' . " 2 " $$ ! %1 .'$ # ' / ' % * 3 '! # ! # 3 # A " $ ' 5 ' K B .

# # # $ # $) # - ! K L $ ' # # / # ' $ % A ! * 0 # ! ' 0 % .. A # .# . . ! 3 ( $ A ) # %I # B . él mencionó sus síntomas a las secretarias en su oficina. # " D # " - # # # 2 $ # $ .# " # $ " # # # # C # # " ( = $ !! %H ! $) # # $ ! % @. A salvo en tierra. $ !9 " # 4 'Después de sólo dos tazas de chocolate caliente artificialmente endulzado. # " . ) # 5 9 # ' 0 # -2 # . ! 4 $. % * # ' ! ! * " " # $ ! # # % # ! . en el vuelo. %3 2 ' # 2 # " ) ' " $ # ' $ ! " ) $$ $ %.O % # ./ ! " =0 # # # 2 .' # C % ' # D# # # ! $ " - $ # !# " ' " $ $ # " $ %. [Él contó] de experimentar síntomas similares después de ingerir productos con aspartamo. $ $ = . ! # # - # $ . # A .. A ' A # " " 2 ) # " # # C: D# B ' ! # 5 =B ' %. # " ! . % ! # " # $ " " # ' $. " " ' # # .! # ' '! $ % " ! $ $ 2% . $ # " 2 -%* # $ % " 2 " 2 $$ - $ $ ! # # $ - " $ . . 3 $ ! ! # % 0 2 # : " " . . # ! ' ) # % # # # . $$ ! # $ % 3 . / ! # / $ %+ # # # ! # $ ! % C # # . # %* $ ) " .O ' % * : $$ . # # 2 " ./ $$ # ! . . S # # # D # $ # " %* . # $ 2 # . de leer los instrumentos y por muy poco evitó un aterrizaje trágico. un piloto experimentó visión borrosa tan que severa fue incapaz. % & .O % 1 2 ' %9 # !9 @@ ' @@.

<.K A! ( # # " # = $ " $ " # ! $ # .K $ " 1 ' # # 0 .# 2 $ %* # " " # ! $$ % 1 " 2 $ $ # ! % %A $ A # A $ $ " " 2 " 2 1 # ) C 8 # / " '.K %+ # ' %* $ %3 #2 % $ " $ . / " /$ .K ! # $ 2 .K " " ' # # 0 . # ! 0 . - " " % # # G%P ' 2 " 2 ! !# # # %A 1 # ' ) . - !# ) # " % * # # $ % * 0 : # . .K # % 0 . = # ! # $ ! # " # % $ $ % ( ( ! $ " - # 0 ! . % * % . #' # % D! # 2 # # # 2 F # 2 # ( # $ # # $ P+' .K # # A 0 . - . 'O .( ( " ( '! ! 2 $ A ) $ % A $ A ' ' D ! ( $ .' $ %3 ' # # 6.# $ # % $ '. - $ %1 $ ( % 0 . # .K (# # $ ' " ) '# $ ! # A A .K %1 = - # # ! ! %* % 0 : $ A$ S % 0 .K ! # # ' " ( " ! % '2" . ! 0 .! 2 $ % K " ' 0 . ( '# $ A ) # # % * " $ 2 @@8 " ' E " 6" " " ' # $ # " $ # ! $ %9 ' $ " '$ % & # 2 $ " # " $ ! $ %1 2 ' $ )$ 1 C1 D% # 2 " 2 ! @# 1 # # " 2 %3 2 % ! # % ! " % . " ! # $ =# A # !# $ # % ' $ ! # %5 '# $ 0 . # ! # * / # 3 2 @ .K% 3 %* $ C7E .' 9 $ !%%% $ % 0 .K " " # ( ( 0 . ! .

)% 2 $ A ) # >! 2 " )" # ( * K ! 2 )" # ! * $ '. B 2 .% * # ! ! " # # $ # $ # .# . # 2 $ # # ! % ! # # A %& $ . # % 8 ..K ! # ' % $ $ ' ' % A # !# " !# ) # ." $ # 0 @88 $ ! 2 # # 2 # " " $ # ' # # # " % '! # " ! % " " !' . 2 2 7 ! 4 =0 $ + > H % " 2 # $ # " $ # # ! # -2 %* # " 2 ) . ! ? % M ' N% M* # / 0 . " % " % $ $ % * # # ! 6.# ' %3 ! # " A $ $ A# ( 2 " 0 . )" # ) $ $ )" $ $ - ' $2 # # " " ' # ' 2 # ) # # 2 # $ $ A % . )A 2 # .6 6.# " ' $2 # " % A ' ! # $ " !$ # ! % $ G%A % ' %M' $ C # ! # (# D! N% * " # $ H * > *$ ! $ # $ ! > !* $ $.. % (# # % $ " ' ' " 4A FI A # 2 # # >! * * ! ) # # # 2 %3 # # " # . # # $ $ # # # # > # $ $ % # # $ 3 ! ! ! # " . : * # $ ! 1 ?.%. % * " # )" 5 )# # ! # 0 # # $$ : ! ' # BB1 2 %3 $ ! * #/$ 1 2 8 $ '.. ! .. ' $2 ' # $ . ' % EK # # $ # % " $ - 2 # # # ) $ .. $ # " 2 # $. # + 29 3 # 1 # # # 2% * # ' ' " ' $2 !" # ' # B ! : $ (# # ! %A # # ( ' A ) %3 3 $ A $ " $ ' ' A %* $ 1 $ " %& ' $2 # $ # ( 6. !> ' # ' ' # 2 N% K .

.E 1 ! % K 1 " " / - $ # 2 ! ' 2 # ! # # " ( # ) % 2 %%% A %& <.. volúmenes uno y dos. - ) " # A$ $ % A(# . O # # # 2 # # # $ " . A ) % 2 $ " ' ! . E. / # ! . # $ A ) % +' # %A .# ) A # A 9 * # # $ AC ) ( # 5 # $ A . . # " # ' $2 )" A - # # " $ % > ! 6%7. # L # $ % Figuras 80 y 81: ¡El efecto de un teléfono móvil en cristales de hielo . U # $ A # " 9 $ $ 1 $2 3 5 # K B % F0 # # . ) # ' 2 # %A 9 . %0 (# ' $ A %K # X ! # $ ! * $ ' ' $ # $ % # # . % - A % " ! - $! ' $2 ' ' $ ' # # . ) # " " $ ! $ $ '$ " " U% B ' $ $ %. # A' ' " %* . ( $.8 0 $ ! A )" !. A la izquierda el agua fue expuesta a palabras de amor y gratitud.. lo que pasó cuando fue sometida a frecuencias de teléfono celular. (Por más ejemplos vea los libros. Mensajes del Agua. a la derecha.y el cuerpo humano en esta realidad es sobre todo agua!. $ .' % * S5 ! ! % ) % I " # $ $$ ! # " # # $ ! # ) " # ! %* # # % # - B " 2 2 $ # = ! # $ .= # " G% F 'G% 1' ! $ 2 3 * 1' # $ " # $ 2 # # A/ " 2 ' 2 ' (# (# " E. O # $ # 2 68 [ . por Masaru Emoto) 1 1 $ $ ) 9 - ' % # # # 5 . %* # A A L # " " # C# # A# " # A $2 * *O ) $ D% " # 1 #/$ D ) ..

$ J $ J $ ( ' ! ! # $ - " % %9 2 %* D' $2 % $ . ' # ' $2 2 8 # $ % $ 8 T @7@% @?. A # $ ! A %1 # # " ) N% - # . =# # J J # ) .'! ! $ @@6 % " A # F .. 1 $ # .%* . # # * ! B ' # # % * $ 2" $ 2 (# " 4 : $ J # " # J 2 ! J J J ! J# # . %* " " # *$ # " J # %9 # # # " # A+O A# " # % " # ! . J J 2J J J $ # J 2 J J 9 . ) J# # # $ A J ( 29 .K ! # - * # A %* 0 2 ! ' A % 0 " # " 2 @@6 5 )2 ! " $ #' $ A# .S5 # * " # 2 (# # # # # # %3 A (# 4A ! G% * # - ! # ! 2 # 2 4 .$ % $ $ ' . # J J -J % # " # ! ) # # ' - ( # . $ %9 3 ' " 5 % EE $ " # # # 5% B L' - # '. ! !9 . J J$ J # J $ . ' (# $ % # 2% > ' 2 " ! B ' $ A " ' $ 2 # A . " 1 2! 9 2 > # " 5 ! $ ! " # % 1 )4 A 5 " $ " 2 = A % M+ 5 ! # $ 2 # $ # ' " # # ! $ # C$ D # 2 ) # # ! # '# ! = 2 " # " U $ # # 9 .% 0 . - $ = ' 3 ( # # $ %: 2 # # .! 3 " # - ' % * " # .% % # " ! # 2 0 # $) # . # ) " 2 %3 / $ '# $ - C 9 " ' !% # $ " # @?.J J # J$ .6 ! 9 .%3 $ # J J J $ J J J J J # J # J J 2 J $ J .

' # " " %& %1 $) # # " % $ # ) ! # .2 2 % " 2 # $ $ ! $ 2 % " .# ! ! ' . ' $ S # # # '# " ' % 1 $ " # " ! " ' $ 2 " # $ # # ) '# # S % '# / " # ( ' # ." # '$ ' # # % * ' $ # ! ! 2 '$ " $ # # " $ # %3 ) # 0 # " " . = % .A $ ! ' = A % FI # $ ! $ ! A % " # $ ' # " $ # $ ' A# # A $) $ # " $ $ . # # = ! I !' % ) $ #2 ) ) # ! ! # # # # %9 $ +$ % # . ! ' # # # # % F9 " # ' $ # 2 # $ G% # 2 2 %B F# " ' 2# 2 # " 2' ! # $ " $ " ." # (# # " 2 ' # # % # # ! # 3 " 2 # # # # 2 S5 % * " " " ! " ) % * ! @@7 " =# 1 ! # ( # ! " $ ' 2 2 A ! # % ( # " A # % $ # # # # " ) )! '# # ! # % ." A # " %1 # ! # 2 # ) % & ) " # ! 2 % $ " # % C0 ." = B '# # # !# # " '# ' G% $ " $ " % % ! # 2 ! ' $ # # " .# %9 % . # . ' ' ' " " 2 ! .D# " '# # A2 A! 5 # # # " # '# " " $2% I ' # .% # % * # 2 # # # 2 " # # # # # -2 ! ' $ ! # # # ' ! # ' .8 # # # # ! # 2 " $ " ! # 2 " ! ! 2 # " " ( ! # G% ! # . ) # # " ! %.

%9 ! ( " # # # . # % # 2# 9 ! 9 .! # 9 BB1 " $ 2 - # A # ' # ! # '% % . $ ! # # # $ %H " 2 # % %9 2# . ! ! %9 $ ( $ " # # # %9 # ! ( % $ 2 ! % # ' $ " ! # !# $ %* ! # # # % - # 2 % " $ .J 2 . 2 % !B " # ! $ A ) .6 !A # 2 # = 0 3 # $ . A *! # " A! $ . ! ' 8 %...6 - ! # # R@.% B O " " 2 # ! # " ' $2 %9 " !" % '! # ! # . " 0 # J # . % # # ! %. $ " ! $) # *! . $ 2 " " R7 .8 ' $2 ( 3Y.< .A # ! # * ! $ 0 .= S5 # %3 " $ # " .D # # % * # 5) ! " % # ) ! # $ " 2 " ( * Q ( $ # " A $ ." % # " * # 0 .1 ..! # 5) " " 2% # ' ! . # O $ # # J # " %0 ! ' 9 " # ! " # $ $ ! # 2 $ ! 2 2 " # # # C O % # .E 2 " ! # ! %* % # $ " # 2% # .J # " ! . $ # $ . # %> $ " A! % ' # $ $ $ " # ! - $ C # ! ..# 2 " !# # $ .! # ! ! # # $ D% * ! # ! % ! " " # # " ! ) 2 ! $ " ' % * ! $ ! $) ! # " C! # .. %9 # . D% " % - # B '# " 2 " # $ # ! # # '! # % ! # # C$ 5 9/$ F GD% A > ! / ! " " # ! A %.% I " # # 2# # # 2 $ " 7. . # . # # 0 # # " $ # ' # # = ( " $ / ! . 3 # # " " # 9 '! b..

" # ! ) % ! $ $ O $ # % 0 0 # ! /# # # 5) ! ) % $2 A J . . % $ # # # # 2 %3 # $ # ' # ' # # # B % : ' 2 % $ A " $ $ 0 ) 2D # # " " ! # $ R<.. = $ # ( A 2 ) " ' % ! # # % ! .# # %9 # " # ) ! $ $ # " 2 # $ # $ # / # A" $ # $ $) # ! $) # 4 # C# # # %* # # %+ . 0 $ %* ' # # # -2 # # ' $2 ( (# # $ $ # % $ ' # !$ = 2 # ! # ' # % + # =! 3 # % # # " ! % ! ' $2 2 ) # 2N% . # ' '% * 2 " '#% * " + # # $ # ' " 2 2 A # ! A # ! " ' .! 5) D' ! # " # %3 " 2G% B % FI # " # = $) # # %M .% M1 A " " ! 2 $ 2 # $) ' # ' # P ! # % ' # 2 # # P " " $ 2 A A % ! # # $ . ! . %* # ! $ # ! ! # J ! $ = # %* # # 3 1 # # $ # ! ) ) # '$ -% * ! # " . 3Y. ! P' # A A # " # # P% # ) ' % 2 S ! 2 # # $ # # / .% " !# / # " " # A C # .! '! # / # $ # # 0 $ # * 0 . " # " " # # 2 # . $ A# # 1 # # # $ ) # 2 " ' = " ' # # # # # ) # # # # # # .7 ' %* $ $ # 2 '# 1 / A( A N% % F+ # # G% 0 # " $. # 2 # . " 2 # # 0 . ! $ )% * # $ " # # # $ '." # %* # # $ A # # .# .

) 4 'El nacimiento de un hombre es el nacimiento de su pena.! . # ! / S $ S ' " ! # ! $ # % * " # ! 0 ." 2 . ! # " . porque su ansiedad por evitar la muerte inevitable se hace cada vez más aguda.' 2 $ I / B %1 L : 5$ : # " # F# # " ! " % . Todo está hacia atrás.$ # 0 # # # ( $ / ' ' G% % %. A ! # . Su sed por la supervivencia en el futuro lo hace incapaz de vivir en el presente. los gobiernos destruyen la libertad.? ! ' %. . todo está al revés.' # " $ ' • * " # • * # 4 ! $ # # " = ! ! • * # #2 ) % # # " ! # • * # # = $ % # ! # # " # # # # # $ B # # # # $ % F1 # 9 # # # # ! # " # #2 = # # # $ #2 % ! ) # # $ " # $ % ! - # " # " # • * $ % ! • * A !A ) # " " $ # % # 0 # ! $ 2 2' " 0 # ! ' % ) 4 % * 0 . más estúpido se hace. Los doctores destruyen la salud. $ . # # ! %9 %0 2 # % $) # " $ # " # # $ ! # $ ! ! !' C %* " " $ # # # " " # " 2 $ ! S5 # D% * 0 . " '! = " 0 % " 2 0 . # $ # " $% 'Sólo mírenos. los abogados destruyen la justicia. 0 ' & )4 # ! # " # ( # # ! ! # # -2 ! " ' # ' " " " ! # . ¡Él vive por lo que siempre está fuera de alcance!. ¡Qué amargura!.% * " $ $ %* " ! # ! / D ! " C " ! # # # # % ' %. 2 " # !' G% . las universidades destruyen el conocimiento. Cuanto más vive.A %1 % $ % " # $/ " # $ % ' " 1' . los medios principales destruyen la información y las religiones destruyen la espiritualidad.

" # ) .@ " 2$ O '% 2 $ # $ . ) '# % $ %4 3 (# . # !$ $ # ! " # '# ! $ ' 2 " # $ # % ) $- $$ # # " ! ' # ) ! . % & ' $2 # # '$ ' ' ' 2 ! % $ ) ) .! H # # 2 # $ % . (Oscar Wilde) . % ! 2 " # F # % # ! 2 % $ . ! ' ' # ! # %* '! " ) ) ! $ %3 ' ' " !# D # # " '# $$ ) # ) " %9 ) " " % '# ) # C# # ! %4 > ! % %1 % 2 " $ $ % = ! ' # 2 # " ) # # " % $ % CAPÍTULO NUEVE Es todo Bollocks (Cojones) La representación fue un gran éxito. " 0 # # . $ O '# " $ # # 1 9 '! # $ " '$ O '# ' A !# O 'A %> ! ' ' ' # !# / # ' " ! 1 ' 2 %1 % 2" G% + . # 2 %9 # " # " # " # ! * # ! ) ! # " " . $ / " . # $ 2# # ( 7< # " # ) . %* -% %9 2 " ' # %3 # $ %9 . ( # " $ # F $ ! '! ( # % 9 ) # ) G% A ' # G% 1 +V H # ^^^^ F" # " ' # 0 $ # $ # # $ # # # # " # # . pero el público fue un desastre. # ( # ( % 2 / # $ # O '# ' $2 O '% I 2 # # O ' % 2$ # ! # ) 2 # . ! " ) $ 0 ) # ' # # ( ) $ $ # . 2 # %1 ) # $/! ' % ' # ' # $ ! ' ' ' ' = " # $ % +' %A0 ^^^^% F " ( % 2" # " $ " " $ . #. ! *$ $ # $ # $ # $ # # G% 1 % MI $ N% $ # # #2 " .0 .

.P# ( " . # % ( G% B %H # ! ( $ " S5 % * 1 A(A !' ( ' ' =' $ % " 2 ( ' ! A 'A # % # 9 $ . G% ! # $ $ 2 # # '2 ' # " % Respuesta: programación. # ) F" $ ! $ # %%% 1 # " % # G% # $/ # ? D% Figura 82: Soy Yo. 3Y. # )P (# 2 # # # ! # 2 # # " ' . ahí vas de nuevo.. # # '! $ !# .' .%.% (# $ /# = # ! A ' A A!A # # % ¿'Pene al cerebro. " F" ( creación?. la gran cosa sobre la 2 ! ! # ' # $ F GF - $ % # # " ( !" $ # # " 2" ' $ # B ' # ' # # ' ( .. ' ! ! ( A2 A ( G% # O " ' ! G% mostrar su ' # $ ! # # avergonzados de %H # % ML / N% * Q $ # ' %%% %3 # # $ # " ¿por qué están tan # F" 2" $ # . Es una # ilusión holográfica de todos modos.. oh.! $2 # " # )" ! % # " A A % $ 2 (# ( # " # # # # % # " 2 # %* ! A $ # # A % A %I ' ! A $ A $ %. ' ) ' # ' ( '$ ' # . ¿Cuál es # " $ # 2 8.. Pene.' 'Fuerte y claro. # '$ # # . " ' ! ! ! $ 2 A # $ .% " $ % 9 2 # $ %9 % F" # $ " # # # 2 ! ! # # $ %9 # # ' % . . me recibes?.% 3 ( ! desnudez?.! % % ( . # ! pero si las religiones % creen que su 'Dios' # ' % ! $ " % creó el cuerpo. sólo preocupado de la eyaculación preco. ! $ $ 2 ) # ' ! ) # ( # # # $ # % % " " # $ # ) 0 . ! # ( . " ' ' F& 4 # ' G% ! % % FI ! F" G% . y que Dios es perfecto.C: * '$ 2 # # %5 # # G% F G% = 9 $ 1 Soy Libre.%9 9 '! $ ! " # $ 2$ ' # .

% %5$ +A %A (# A # $ :% V !L 1 . ( ( $ # ( !' ) %F " % '# . # ! " # " 2 " 2 O ' A # " 2 # L /J # $ ' J! " $ ) ' %. ( I # $" 2 ' %> ! # " " A A I ' A 9 " ) A F5 G% FI $ I $ ' # # 2 # # % I # " ( A $ ! ! # " " A" # # % ' ' ' G%A # ( 0 $ ' .6D ) 4 A ' " # . ( %>$ ! ' # # # ' 2 (% ( ( %9 # # # ! % # $ # " A2 A # " # # # " % 9 . 9 %* # # " ! $ $ $ A! # ' # ' . C> # 1 H " $ ! ' # ! $ # ( ! $ # $ % A(# $ J ) 2 .# # % " " ! 1 O % 0 . 5 ! " 5# ' 5# ." " " $ (%. # $ # ( ! ' A %+ . $ A " % 9 A! ' # ( # " # ! . " # . # " # .%A # 2 A # # " # ' 5! ) ( ..! ' " ( # " (# ( # $ ) ! $ % # ( " # # ' # " 2 %* 2 ( ' ( # (# %. %> ! # # (% " # 0 . !' ' ) ! 2 ! # # S5 % * # ' 2 " ! $ ( ! # (%3 # " # $ % " $ 2 ! / # ' " # " ( ' # '$ ' ' # # # ' ' ! $ 2 # # # ' %+ $ 2 # +V H F>+* G% F " 2 # ! ( %F 2 $ ' ( " G% &( 2G% " 2 '$ 2 # # $ G%AB # % * # $ %3 # # $) ( $ ( % * # $ $ # ! $ # % %5 2 % ( # = = ( # 1 # ) ! " " %* $ " 2 ! # " + " U )4 A ! " # % * $ A L # '$ %.

. Mencken (1880-1956) * # ) B # B 9 2 # 2 # # K U% B '% $ %33% C! K B -D # # ! # .%3 )2 0 ' ' B ' " # # # # 2 " 2 ' $ ! ) ) # ! ) * C: ?ED% 9 # 2 $ %A F " # $ 2 G% FI # $ B ' 2!V ! G% FH 2 ) # G% F9 " V ! 2 ) G% FH G F# " 2 G F! B ' G% $ GN% " % Figura 83: George W Bush. . ' ' ' 2$ # # # 2! A # A# A A " % ! " / 4 K # 1 ! ' ! > $ # $. $ 2$ " $ 1 # 2 - # ' $ # % .' H. 'En algún día grandioso y glorioso. L' U ! 2 = # " A - A / % " ) " 2% 9 # " 9" ..# " # # " .. cada vez más estrechamente.H = K # # $ % +$ # ! $ % ! ) # 2 ' # % # $ ! $ 3 % ' $ # * # 2 # 2 $ 2 ! 2 " " # ' MFI 1 '! A % * 0 A! . el alma interior de la gente. la profecía de su llegada: 'A medida que la democracia se perfecciona.% * # 2 # C: ?6D% =$ '! V ! ..L. la oficina del presidente representa. # 1' ' # # ! . %* = * I % FI ' H G% * 0 . # 2 2 $ # " # # # $ # # ! $ ( # /# # % " # " $ 2 " .# # 2 % ' ' " ' A# . 0 2 # % ' ' A # # " A ! - # # ) " 2 $ 9 # " ! 0 # " A # $ % * $ % % 5 / 3 9 # 2 " ! # $ # # 1 " $ ' $2 # " % ! ' ) $ # $ " A ' " # " 1 # ! # # # .5 >#> # ! % " " ' # A '2# =# $ $ * ' ' - # ' " $ # # " % $ $ # ' ) # $ ' $ # # 2 $ $ % # # # AA ! .6 = ! $ # # " / # B ' . la gente sencilla de la tierra alcanzará por fin el deseo de su corazón y la Casa Blanca será adornada por un completo idiota.. ! # # 2 " A U '#A 2% M.

%.... !> " ! @8 J# # 1 B # > B ' )" '$ # . '$ A % FI # $ " 2 $ 9/$ C9B.. 1 D # ! $ ! > C.6 B ' ! V .% # 2 # 2 # J 2" 5 # # " # # " # . A " ! $ ! # 5# $ ! .la Matriz . # # # B '" $ A # ! +' C D# %%A % # " +' @. # % ' $2 ! B '! V - # A # $ 3 !# " $ A $ !1 " 2 K " ) - # 2# $ ! % $ 2 $ " # 2 2 G% 9 A # *$ $ ' $2 %9 $ 2 1 '... / N% $ '$ A # U $4 % %9 # ' ' ' # A ' A %M $ 2 A ! A +' # V B O 0 ( = +' # K B 'N% : ( V ' > 2 B ' # $ : L$B ' ' % " $ # 2 ! 2 % E .." # 2 # !N% * # 2 # # $ A .# $ 0 $ # " # 2 # # ! # 0 A # # $ # 1 . ' $ " A AC D" # $ $ % %9 ! 2 B '" U +A " $ M $ '$ " A # A# A # 0 . ! A # " $ " ' ) 5 9 ' $2 2 # 1 # # " # ! # %* # 2 # # C! A %* " $ ' " % " " ' ' D! # A A % Figura 84: La representación de Neil Hague del juego de naipes de 'Lucifer ' .en el cual a la gente constantemente se le reparte de un mazo marcado. # %>! ) # 1 # ( .D! ) A % # 2 # A$ A % * # ' ! # % $ U% B '# " 2 # B ' $ " # # # " # ' $2 %. F G% M* " # # # # " # ! $ N% $ $ '1 +' % . B .

. " ! % # # $ " A . " # % O ' A ! " ' % ' # ! $ %* # $ . ! # # " # # # # $ " # # ! # # ) # $ $. A # # ! $ + ! ! ! # # ' " 2 " ' ! !$ " # 2G% F .%.2 # F# $ !$ " (# # $ ) O %. # " ! ! # / # 6 # A # %..6 ! # % B '' $2 # # $ %.6 # # 3 # # /$ 1 # $ % F9 ! " # 2 . ) # $ ! ! ' MM * / A # = # 2 " # B '# # " /# =# # ) % * " # ! # " $ # ! ) ' $ # # $ ! ! A2 $ A %& # L' U ! # ! %9 % * # $ " 2 # " ' # # ).# # # # B ' .. B ' ! # . ! # ( $ # " $ # C # " 2D% + # " " 9 % # " V % * " ! - '! =. 2# /# =# $) " V !G% F: . A# % . ' .# # ) $ A # # ! $ $ A' $ # 2 " # ' $ # # V B 9 O " ' % > $ !B 0 ' ' # ! # # G% 9 %1 " ! + 9 # ! 9 + ! + " A A %1 $ . ' $ . / # %V A A %H " 3 ! % # * A ' ) O O # ' # " B ' $/ " ! B$ ! ' !K % # ) $ ' $ ." # ' !' # . ! " # # ) # B ' # A H' A % " H' # # # ) $ $ 3 " $ # %& %& ! " %%%G%A $ " " ' " 2 ! D% & # ! 1' # AC # $ # # " 2 ''''NN% .. ' . /$ # ' % M9 " ) # N% & 9 3 $ # $ # # % ' ! # $$ 2 $ ) # %* # + % # % / $ * " A.. % .. A K K # # A # # ) " V # B ! ! 2 # $ ) # $ % .. V B !G% F9 " # ) ! " 2 " .

'2 %1 ' '. # # (# %.# # # % % 0 " ! % # " # $ A %+ ') # " $ $ A %1 ! ! (# # $ # # ! " $ # . $ > ! $ # " - # # =A . (# %B %0 $ $ 2 L' U ! )4 A 1 # " .' # # %* # $ $ # ' ' $ # $ %& )" ' $2 # !A A $ # " %& ! ' / # 2 3 $ % 4 ' % F $ # # # $ G% F $ . %9 " ' ! 2 U O @8 . % * / S# 2 % * " $) %. $ %3 1 " (# $ $ 9 # ! # %9 " # ! % 2 ' $2 # $ " " ! + " # # # $ # ( # # " " $ . % =V " ! ( (# % ! # # # A # 2! # % . # O # # ( = ' # ' % B ! # 2 - G%AB % '! $ %. # $ . # ! $ " " ) C # %0 $ 2 " D " " # # % 0 ' # $ 2 ! ( # *! L 2 # " %* ' ') ) # $ # % # - ' 8 " " ! % . # ' # " # " A 2 " ' # !' # " 2 " ( $ # " # # (# ( ! # # " $ # " ! " # # A O " = D 5 # A' " # 2 ' # 3 # %.B " %A % " " ) # S ) # A # 2A 0 ' 9 ' " A + A # 2A J! # # # % 3 2# 9 ) % > $2 . ( ! % * # / $ 2 # 2 O B # = ! " $ %3 C % . $ ! # (# # . ( $ %3 / " # $ " . !' $ " " # G% F $ 2 $/ # # # $ !' # G% F $ $ # # G% F $ # ! # $ # " ! # G% '$ 3 $ $ ! '$ ' " # $ *$ % FA 1 # / # 2% .# " . '$ # .

.# " A ') A! !A # # (# # " A # # " ) # " ') ! # 2 # # 2 ! # ! % 1 " # " . # = # $ $ 4 # % % " ( ! $ # # ! %.! ' ' # $ $ ( # ' )" 2 # 2 ) $) 2 ! ! # % $ - 2 $) $ ! ) # " ' " A % .) < .) $ '$ % 2 # " " # A $ '. ! " # # # # # $ # # " # 2 " 2% $ % ' ' '! A A % " " # # A " F # # !) 2 ( ! E # % # " " ' $ $ $ # 2 ) E . # C .$ $ '.# # 2 # " # 2 ! ) 2% . # # O A ( A " =! ! ( % $ ! % O " # ! 2 " ' A( A # # $ ) . # 3 %." ) 2 # ) ) 2% & . # # $ $ % # % " " '$ ! " ! # 2 # # . ' ' # # # " $ ') $ % > ! ! ' ') # # " # # %9 (# # %9 # % ' $ " # $ 2 ' # # # '2% * %9 A # % # 3 # (# # % * ') ) # %A +' ! ' b .) 2 # " ( $ ' # $ " (# # L '$ $ + $ $ - # % ) " J # 2 # # G% # # ' % %3 % F9 ! " % FI # ) 2 $ ' 2 ) 2 ! " G% % . ." %* " # ' $ L $ # # " # $% - G% F9 $ 2 # # $ # # . % # $ # " $$ ! ' " L " /%3 " # ! 2 % D # $ " # $ ' ' $2 -% # .G% : . " " # " . # " $ ' % * ' # " ) ) ' # " % . $ " # $ O $ # # " # ! % # ! # # $ . # * # " # # # ! %AB $ J # # # A! # $ $ > .B 0 .! $$ ) 2 " $ ' A! # A # # # ' . ' .# ') ' % # % A % ! ! . # " . " # 9 % 2% .

# 1 2 2 %& ' " 2 % F9 " = / %9 " # K # $ G% * $ # # / ! # U% B ' ! A %9 0 $ $ . # ' G% ( G% 7 ( G% # ' $ J # # ' " " 2 # # # / ! " # J! $ " . ). " # " # ! # A 9 # $ C %* A! # # T" # # # D) %1 % F ( G% . " # # " ' 3 # # ( # " # 2 ). A( A # # # " A( A 4 ! A( A . 2 %. " # A % A ) A # . # ! # $ ! '$ # A # # )% F ( G% 3 $ " # !# # ! 2 $ !# $ # A A ! %* # $ $ # $ # 2 " $! %* # # $ # # $! " ! # # " A ! A" % $ % F ( G% * # $ ' $ # " # ( # / L .% & ! " # # 2 ! " # # " # ' # . " 2 # %9 # $) ' ' $ # # % FH ' # F F! !' # ( " " # '$ # " ! # ! " .' (# " # # $ F A ! ! $ # # A %0 ' # 2 " % ( G% 3 " %& # .= !# " " " ( ' # # . A # % ( G% F * # # ' # F 2 # - %* # $ % $ " # # ' % # # 2 " # ! # ' # ! $ # ! ( # ) . 2 % ( G% * ' # 2 2 ! ' # 2 .

* $ ) # ' A A A" # $ # A %9 F" * ) $ ) # A # $ . $) ' # # " 2 # .. $ )% K '2% A A $ # # # -2 A# #2 8 A A % " ! " # # " $ " # ! $ 2 ! # -2 % # ? % " " . !' $ # # # D A AC# " # * # " ' F $) # 0 K0 K %* A A # ( G% * " 9 $ A A % $ # ! %* " # ! # # - ! 2= # # # " " # $ %* / " # A %3 $ " $ " ( % U ." % ! # $ " . G% " % ! =5 * =' # " %+ A # # " " # ! A '# # " . # # ' # ' = 8# ! % # " ' " # # # % # # # ! $2 # A! # " # ! % # # # # A 0 .. ! 1 $ # 2 ) ) # # . % F ( G% $ %> ! " # # # " # # $ )% # $ % . # " %1 # - # : # A( A %* # ) ! %3 $ = # # ' # # A ! ! 2: 2 " / $ # " '! / F # ' ' " " ' ' ' ! # " # A # %9 ! !# ' ! $% B " " %. =.%. % '! / $ G% 3 % F9 " G% " " '. A % * $/ " % > ( ' # ' 2 ) ( # $ # ! # # $ # 2' " ' ' ' ' ..# " ! K B # $ .R%A A K ( A JF" ' G%A %A FA H%%%G%A A %A $ % " ' ' ' $ = = # " " $) / % 0 $ ' $ A # " ' $ ) 6.

$ 4 'Los niños pueden pensar que ellos hacen elecciones cuando realmente han sido capturados por una opción.A# " A A! '" ' 4A . '! # # # " .6 $ AO A # " # # % # -2 ' # # $ " (# $ # 2 # $ ! # + # # # 2% A$ A # % * ! $ " ' # # . 5 3 '. Así hay una variedad de identidades ofrecidas a ellos y tienen que insertarse en una. . Han sido capturados por una identidad en vez de ser capaces de descubrir su propia identidad.' ( ' " %H " % ' ! # = '! ' ' ' " ' # # " 4A .% A A ) " # # !# # % # 2 # $ . # $ % * " # " A A %." # %* A = = $ A % 3 ) " # A '. 2 # !%%% " 2 #) A % " $ A . # ) # # ' %%% 1 \# # '] # " " A %3 .$ ! " # / # " 2 )! # 2 % M9 # $ # " N% 0 ! 0 : !1 ..# ' # # 2 $ 2% . $ " # 2A $ A %9 # $ ! % " 2 " %1 $ ' # # " # - %3 # # # # $ " ! N% A ( (# ! $ # # # " # " # - % M9 ! $ $ A % ! " ( ( # # 2 2 # # ! % ( ( * AO " # " # # * # # # % 2%9 " " / $ " # % $) # # # # # AO A A ' ! % A 1 2 ) ! # A %3 9 BB1 $ . ! * ( % ' " - # # " # # %1 % % 1 # 2 " ' # # !' " " $ = " # " % ! # ' ' / 2# # 2 A %3 # 2! %3 A .# # # # @ $ 9 # ) # = # % # )4 A H # # $ - ! ! ' %* $ / %9 2 2 A %3 # " # .# % F9 2 # # ! # " # 2 = # " # = ' 2 .

! %. 1 O ! # . 2 # # % ' # # 5 #' * !' # 2 . %." " # " $ # " = # # # ' # ( " ' %9 ! % F9 " " ) # ! # " " G% FB G% = 3. La palabra original vino de un hierro largo con un logotipo al extremo que quemaba el costado de una vaca y mostraba que el granjero la poseía.2 # $ # " $ ( # " ! %9 2 $ ) !S " ! ' % $) # 2 # % 2 ' %> # " 0 . Entonces sólo tener el nombre de la compañía a lo largo de la parte superior muestra que ellos te poseen o algo.%. $ ( P P 2" ' $ % % MA 0 % ) ! $ ' ( # = ! # " ) ' / $ " # # # O O '" # # - ' # N% * $ = ! %A * 2$ / ( %1 . % " ' ' ! # # ( # 4 G% * 1 O . . $ 4 'Es como si alguien te posee. A ' ( ! # " " " ' A %& # " # %3 2 # # ! ! " 2# ! 2 % # = # # !' ( 0 .# " % A )" # ! # # # # # ! ' $2 " A % $ # " !# # % " " ! # $ # . # ! # # # 3 ! " 1 O " %3 . J ! # ! $ A # # " % /%* # ! $ ! . " % .' * / # # # $ ! . # = % " # A ' * I ! ' ( .9 . ! A # %A 1 O $) # # " ( ! # # " ! '! ( # " # " ! % # A A# " # .# B ( " " # # # " O '# # B ' % O # % . " # # " ! ' # $ 0 . 1 O (# %A +' # # # A %* " # ' ( # 3 . .# $ G%A> .A $ " # ' ' 2# ! % G% B # $/ " 0/ $ # " # d # A A %I !" ! . A ' # " " 9## ' # / ) .'! " # $ . 1 O ) $ % " %. % F5 1 O $ ) . ! # " . / # # %3 # " " # #/$ $ $ '$ ) 9 % " 2 $) # . . : ! % F9 " # G% F1 ( .

2 ! ' # # # %. 0 . ! % # " $ 2 # " 2 2 ! . %9 ! # " " ' 0 . $ ! ! % # # ' # # % # # %%% * 0 A ! !% 0 " $ ! # A ! $ % ' ! # " " ! 2 # # ) # %%% 0 $ % ' # ! # . (Oscar Wilde) Siempre perdone a sus enemigos.% 3 $ " F" # ' G% " . nada los enoja tanto.$ # G% F # A 2" $) # # # " G% F # " $ 2 ( $ " 2% % * ! 2 # $/ " ! " '! $ % # # # 2 $ . (Oscar Wilde) " # # %* " $ $ $ . # ! # / # ." # ! $ 2 $ # " # " # " F - # ! " G% F $ # . # # 2 # $ ! $ " # # " " # ' # " ' ' # 4 $ ! ' " # 0/ 9 #% = $ # % ! # ) # ' 1 %1 ! A " A ! ' % ( # ! 2 # ' %9 = % 4 % # 2 ( # 2 ) % # d A " # ) # G% F # # ( " # $ ) # " %B /$ " ! D # ' 0 . / # ( # # % # # # " # " ' #2 ( % . # $ # %%% 0 A # A# " 2' . # . # # ! # # # A A ( G% F # ) # 2 ' $ # G% F # 2# $ !# 2 " G% &( ! ! " 2 # ) . # % " ' $ # ! ! ' (# " ! # ! % " % . G% F # . $ % CAPÍTULO DIEZ Salir del Sistema Amarse a uno mismo es el principio de un romance para toda la vida. G% F * 0 %. - . C '.

# # # .# # $ $ %0 # # # ! O % # ! ! ) D% ! # # ! # ) $ # % ' 2" '$ # % " # % $ ! ) # $ $ ! # %> " # ) # " " A2 A " ' %1 )$ C ! " " " % 2 '! (# # / ! ! # ' " O " " . '! ! # " 3 " # " % # ! # ! " ! ! " ' ' # A= % . # = ' " # A # " AA # %* . # # # # $. 2 # 5 / # " 2 '! # # " # =! A ' A A % . %* (# A # ! " $ ! ' $ AA # A! A F! % % ." 2 ! # .* A A # # ) .% 3 .# " # # " $ 0 4 # # # # # # $ ' ! ! % $ 2$ # ! # 2% 9 " (# # ' ! 1 ! ! # . / '!# !% $ = # # / A %* " $ " # # 3 ! / / " =9 $ ! A (# # # # # 1 # % " %A " " $ 3 '! 2 # 2 3 %* . # ' # % . $ % A " %* (# A # %A = ' # %* " $ A! A " # " A # 3 ! %* A = / % " # $ # '! # 2J # 1 # % # 2% # $ " %5 .# # A 4 = " O !# ! %. A # A $ $ . ! " # ( GA %* # % 9 $ C # ! % * # %0 ' %+ / # $ 2G% 1 # # % # # 2' # ) % $ / # # %%% % F1 ) # # ' # . ). ' % . " # J ' # $ ! $ # # # # % $ % # ! # # % ) A J # # A " ! 0 ' 5 " 0 . D ! ' ! % F9 ' ! # 0 ." # ) # . # # G% . ! " " # % # (# % .

# !# '! + $% 1 $% 1 ' $ G% 1 # # # C: $ " # %A E % $) " " # ) ) # A " " " # " ' " 0 # # # '! =# ) % A $ ' ( ! . # G% 1 ' A K A '2 A $ ! +* A % / " ! A A # # " (# = ! '. $ # " ' $2 # ' # # " ! " $% . (# # # # # $ # .% 3 .% A ' + A 0 ) . # % $ ' " ) # ) > ! # # ' # F> .# $ # $) " # " 2! # # ! % 9 " $ 2 % $ # . $) % $ # ! ! # ' $ %H A %%% A %1 $ ! 0 %1 # % + % . ' $2 ' ' # # . ) # A %3 $ % 9 $ A ! ' A # % " # # # $ # ! # %* # G% # # ' ' # )# " A! % " ' ' ) # $ !'! ' # $ " / " % # 2 4 " 2# A %%% A # !# O $ %. 3 $ ! $ 2 $ # " $ # # " ' " ' - # # # # ! " # # # > $ %9 ' # " A2 % $% . ! %3 " ! 9 $ " # $ # " # %3 " ( ' # U O @8% * %1 $ % 2 % # ! + $ ) " " 0 # 0 %.R% ) " 2" )" # 2 '$ ( # # %1 $ # 2 ! 5 # A A % % " # $ ' A A A A$ # .%& " ! )" 9 $ ! # 2 2 # 2 $ 2 ' E. A %3 A # % F1 ) # % 9 # ( # " % $ 0 ! (# A # $ " # 2 % # 2 ! $. # 2 $ # # # # # # " ) # " %> ! # )0 4 A $ " A % 2 # $ % # # # % # 2 ! ! # ) # %* " $ ' " ' $ # . # A %% %% $ / # # " ?8D% 1 " # # 3 '! " % # = . '! $ # " # # ! F # ! # % 2 $ # ( % # .

G% . % Figura 85: Cuando nos abrimos a la Conciencia Infinita que somos. Esos todavía atrapados en la ilusión ven a tal gente como loca.' A A $ %* % * " '.! GG% * " # " 6 # '! ' ' '! ' ' '! # " % = % FH # " # . $) $ ' A J '! # . $ % % # ! 4 A 3 ' " " " # " 3 % $ " ! 2 # ' ' ' # # ( # 2 2% 9 A A # # %3 . # # # ! # # # $ " # ' $ ' ! # # " $ # # F1 # % 3 %. + # # ' " " ! A( A A A # " ' ! # " . peligrosa o extrema. % 3 " % % FF1 $ ' ) $ # # C # ! # " " A %H D% # = $ #2 %5 $ $) ' ' ' " A 9" . comenzamos a ver a través de la ilusión y la Matriz pierde su control de nuestro sentido de la realidad.! A # % # # .$ $ # %A ' $ # %* = ! '# $ % " " $ . A! %1 A # # $ " %1 # # " ) # ! # .A * - # " # " # ! ' " J " % ' . # A %9 " # # $ " A # " . A $ # ! 0 # AA $ %. % = $ # # ) AA $ % AA $ # 0 . ! ' % .H A $ # # A # .

A + # ( ! A # ! ) $ # A ) A . $ " # . ) $ ( %9 %* " # ! # % # ) " " L! # (# " # " % " # ( ! " J ' # # # ( ! ' /# =' ) " 9 0 . " " 2" # . # " . " $ # = $ ' ! ( ! 0 ." # # # ) A# ! $ G% # # $ ' # " # A " # # ! * ' ) # " /$ $ " % = # $) . ! '$ # A % * " # # ! ! $ " # ' ! " ! ! # ! ! 2 # = 0 $ = . ) # " %." % 3 . # # # " ! " %1 %9 ! % %1 $ ) $ " /$ ! .A ' # 2 2" %3 A * . $ %." # # ! $ % ' %* 0 3 $ '! # %. # $ $ % . # # # " * 1 # " (# " ' # # % * . %1 ' ' . J ." # # % ! %. ( %9 " # ! # O %0 ' ." ( # " " .2 3 # $ " ' ' 2 # ! # %3 8 2 0 ." % $ ' ! # A %. $ ! # . ! # ! # " # # ! 2% # $ " # %* # % % 2 # # " ( # ." ' # ! - %3 !' # % # ) # $ ) $ # ) * # # # # # %* " 0 " $ 2 %1 J # # $ " ! ! # % . .4 # % ( # A " # A " A " # A %1 " ) # $ # $ # # # # / # " # # # %0 ) ') L ! " # ' F" G% . # " ." 1 $ " # # 2% '$ ' ! ' # /$ ! $ $ # ! ' 3 %. % %.A %. # # 2 %3 %+ # . $ " " ' # # A % )% 1 " ' # 2 % # # 2 %> ! ' $ 3 3 ) $ .! " $ " 2 $ ! $ " B $ 2 %.!> . $ ! %3 # ! (# %9 $ " # ' # A * .A # " $% O " # 3 .

" ' $ # " 9 $ % # $ ( 3 # " U 4A * $ %0 # A % # # # # % 3 = * I = %3 $ " %. observó: 'Sin propósito no existiríamos. " % (# # ! 2 # # ! 2 " # $% H ' 2 / # # " ' ! # # % $2 $ $ %. Y el personaje del Agente Smith." %> " $ ' ' # " " ) % " A A! 2 # # %. " . '! # $ # $ ( %9 ) ' ) * # ) % # . lo que nos conduce. lo que nos guía. ! " " (# A A! $ # # # # " ! " 9 $ ' " % %H # # 0 ' ' ' # 2 $ J ) %* " ! % # # # ) # )# " " %H " 9 $ .# " 1 " $ %1 # # # ' !! ) " 1 $ # # 4A # # # 4# " % # A % " %1 ! % # # %+ A %* A + $ .' & # 2 '$ # " 9 $ 3 # # # $ 3 / " # # ( 0 . un programa de ordenador. $2% * # $ ! =# # =3 %1 ' % 2 $ $ % '$ / # < %H " ' # # $ ' . ! $ % F9 " " A + $ 2%* ! " # ! % # 3 # %* A !A # =5 ' 9 $ ) 0 $ 2 . el propósito lo que nos une. Si no lo tiene es suprimido'. ' ' # # ' / " # A ! 5 " " # %9 . # " " ) . # # % " # A# A ! # A * !A ! " " % A !A # %1 0 . el propósito lo que nos jala. # # # " ' ! " $ 2 # 2 0 (" # " " ! # %. ! # " % # " " ' % " " ! 2 . el propósito lo que nos liga. %* .% I $ . $ ! 2 " A) 3 # # / ) % " % FI G% # (# %3 ' # $ $ A # # A %3 # '$ A " # # ! # . Es el propósito lo que nos creó. Es el propósito lo que nos define." A * .! O " $ " # = = ! # # 2% = $ %* # " " # ! # # 0 .A# " " # G% + ! A2 $ A % # " %* # $ A A " ( # # ! # %.'! ! / ! '! " %0 / $ # " %1 ' . ' # %* ' # $ # ' # # J! ' " $ $ )% ' # # . # " # $ %> ! # $ 4 'Cada programa que es creado debe tener un propósito.

" # C$ " ! # # # ' % $ = 3 %* ! " $ # # % # A! % . ! G% B 2! % # # ! $/ " # # ! ' 2 " $ # %. $ %1 .4 A .% 3 # 9 $ # 0 # # # % A ! " $ ! J % 1 # # ! $ F G% '$ ! # 2 ! 2 # ! # " " ' % F '! # " ' !# A " A # $ %. $ = # " %1 $ # $ %* " %1 # # " A # A 9 B " # $ # # 9 # ! ! ! # ' " $ %* # <%.% 3 'No hay ninguna razón para no tomar un salto de fe en imaginar lo que puede esperarse. $ A " A # 0 ..." '$ % H # - $ % * ! # ! $ " 1 . " ! # . Podemos confiar que es tiempo de que la humanidad despierte a una asociación verdadera de unos con otros. # % 9 A ! ' $ 4 # # 2 " '! % . 3 G% # 2 %1 # K D 2 ' ' ' # # 2 $ ! !! ! # !# J J ' $ " ' $ %. # 1 0 ! " ' # " E 6 1 ! A K K A " ! 2 ! " '$ 1 2 1 A % ! . $ . - ) % 9 1 " 0 ! 2 2 # # # " ) # # !J ! ! 2 A# A G% .. $ = ( 2 A % = $ 0 . 7 . # # %* # # = # $ " # ! $ # ! # % # # % # # 2 % 3 $ # ! # # # ! F " ' . % % # # %> # = " ( J# # # $ 3 %H # # # 3 ) $ %3 # ! # J ' ! ' J $ ! " " 3 # # % # # ) . 3 4 $ ! # # $ % F1 # $ " % $ 2 J ! # # $ !" . ' . U $ $ ! # " ! ! %1 ! $ %. $ $ 3 ! " # ' # $ $ % 9 ' # # # # $ # (# % # # '! % %+ " 2 ( %9 " " ' % # # " '! / $ " B # %1 # 1 # # ! # ' # # 2 '$ !' # # % # 2 % * 2 % * # !# A " A # $ ! %3 ! J J # ! # J ! %.# .

con la tierra, y el Cosmos. Aceptando esta asociación podemos reclamar nuestros derechos de
nacimiento y hacernos Ciudadanos Galácticos que cuidan al planeta y lo mantienen, así
manteniéndonos. Este es claramente el desafío de nuestros tiempos. Todavía, llegando justo a tiempo
y según lo programado está el alba de Solsticio de Invierno en el día que podemos recordar que
somos verdaderamente Hijos del Mundo.'

'
"

/ # $
!

"

' '
"
2
# %,
#
'

!"

;

B
$

"

1

2
'
%

2

-

"

"

#

%

/
A
A

# !
>)

"

A
) #

0 !

'
) "

"
A' $2

.
/ !
#

2

"

3

$
-

0
"

%
"

#

A
0 .%

A
1
#

'

$

# (
!
$ %
' $2 #
#
% *
!
2 "
"
A
9 '
A
#
$A
%
#
C
' ' !
%9
'
"

A

A
%0
! 1

*

"
0

A
A
'

1

!

#

'!

2

"

#
"

'

3

%

#

2
%

'

%

K
0

#
$ %

A!
.
$

*

9 /
!

#
'

8;;
' $2
$2 $ )
- !
%9 '
A
A A # A! 1
.
!
"
!
#
D
#
0 .#
;
$
#
2
%& /
%
Figuras 86 y 87: A
medida que la
energía de la
Unidad penetra la
Matriz, la vibración
del miedo se
disuelve y la
realidad de su
conciencia cautiva
es transformada.

> !
"

#
# %

%
9
A

2
A

3
#

'
!

#
#

(

=
%

$
!
% * A
FL

%

,
(

#
'
)
A
0 .!
% F3
$
)
G% F
/
$
) J
C:
?< ! ?7D%

'

%9
"
$ =
$
3

%
0

#
3

* I

(

$
"
!
3
G% F "
$ G% *

3
?

J!
%

2

"

G% F

.J#
!
!
#
3
!

)
$

"
"

)

$ G%
0 .
'

*

2

!
3 %
%
" $
'
" $
#

9 $
# 2
$
%
!
!
%1
0 .!
/# ='
$
3
$
%
2

! (
$

'
"
#
#

$ "
"
"

3
#
'

'
#

$

#

#
"

#
"

)

# A

#
.! #

$
!

#
#
'

%

>

#

! "
# %* 3
#

$

)
(

'
!

A
!

$
# 2

#

"

)

%
#

/
$ #
#

!

$ A

"
#

%

%1

'

2#
%

2 "
0 .A
#
'
A #
A A
%
$ "
#
%

%

'

!

"
$

2
2

"
2

$
(#
'

!

- "
$ "

"

$

2

A.

#

%

"
'!

$
!

# A
.

"

!
'
"

$

2

%

A

! (#

$

#
A

3
#

!
#

A
%
(#
'

'
$

)
3

!

Figura 88: La
transformación de la
división a la Unidad
está abierta para
cada uno. No hay
ningún 'pueblo
elegido', sólo Amor
Infinito.

,
$

"
3

#

#
C:
#

??D% * "
#

2
$
#

'

%

1
# #
3
"
)
#

!

"
#

%

#

4 F
3

A

2

#

G% F
2

A
G%

F

3
#
)
3

2
#
F
@

3

( G%
)2

# "
" #
#
# 2 G% F 3
2
F 3
2" #
"
3
' 2#
A
A
G% F 3
2
%
F# " '
3
2
#

G% F

3
2
$
# ! 2
#
# 2
#
#
I
G%
A
+
A
G% F 3
#
# 2
2
G% F 3
2
(
A A
G% F 2
# .G% F 3
#
# 2
2 A
#
A
2
A
A
( G%
# "
3 G% * /
! 3
" '
"
%

# " - # "
2% 9

"

# " - J!

"

)

!

>

"
# )

!

"

"

#

.

#

"

%

F

"
%
$)
%

#
#

"

#
$ "
%9

#

%
* I

#
$

%

#
%

(

G%

,

%

F1

G%

, # %
'!

%

Apéndice I

El ADN Humano es una Internet Biológica, Dicen Científicos Rusos
#

"

! ' $2
#
$
' .
# ! $
U $%

2
"
$)

$
$

#
#

$ ! ' $2
2
#
#

!
$

!

#

'

!

'

A

=#
#2

2

#

A
D

#
# $
$

#
!

$

)

!

#

"
(#

@; [
N% , /
$
"

#
#

#

#

"
#
%

#
#
b

'

#

! $

%
/
@; [ #

%9

#
!

$

D
%

D

!
)%
'

(

E

!
!

$) #
%
(#

) '
#

$
)D!

'

#

#

"

)

\

%

#
(
.

#

( C
C$

A
%*
b
' .
#
$

A
% M,

"

C
"

2

!

A

$)

# .

]%

!
"

$ 2

!

#
#

"
@;[
.
A
'

%

#

!

.#

#

*
/

% * /
.

'!
!

\

$

%

#

#

#

!
C

$
#
#

24

(#
#

8 []%
(

#
%H
$
! " 2' !

C\]D

2

[

$

'

'

,

#

'
\ ! 9)

#

]%
K ))

E;

!

$

(#

% " $ $) \ . ! =% 3 ! 2 # ! ' %3 ) # # # ! (# A\M $ N]% 9 . # " ! % " ) $ $ " 2 # # $ ' " ' ! " # $) 2 # ]% ! # $ ! :! $ # %9 # ( ! # .% > $2 '% * ! 2 $ # $ " ' ' $ $ $2 $ $ E ' " $ # .4 1 ' ! / % ' ) 2 % \* > 5 A 2 $ $) 2 ) A # A " ' ] $ # % \ $ ]% # A '2# = K 2% ( 1 J # . 6 % # .# # " * # (# " K )) ( # $ # % # # $ =# 2 # ) # $ $ N% \M # $ S' = " N%] ! ) !' 2 ! # # # 0 # 0 %] # # ' )% \ % M3 ) ' # # ! / * (# ! %\ ' 2 # " . %3 %M ' $ $ # # # % ." # ! A P ) ! # (# # 2 ]% ) $ $ )%] 2 $ " # $ # $ N% \ # # $ ! ! # # N% M $ # ' ! # % " ! '# # " # # % # ! ! # ]% ' $) # ! # # # ! W# ( # $ N% M N% %M # - # # # (# ! \ ' ' ! ) # $ ! # $ ' % M # $ # # ! # # $ ! ! " 2$ . ! - .! > $ # ) $ .# $ % # 4A * ) A % \* " # " =' # # # ) # . $ $ % # 1 =5+0 " # 2" # $ # %\ " %] # $ # .%] " A (# - ## - . # " # ' $ $ % ! # ' . # ! A\ . $ " ' % # # /$ A " A $ $ # % 0 # . # # # $ ]% * # # " % <.

# " (# 2 # " # # # 2 1 # # # . $ " ' .?C ( ( ! ' $ # ! $ " # ]% ' " " 1 %* . E # \ B ! ! 9# ? ' '2# = '2# = % * ' # ! # ! " " . # $ # " ! .) # %9 # $ # $ # 2 5 .! $ : !: " . '# '2# = ( / % \ # .1 '2# = %* ' 2# # " %0 ! # 2 %1 ' # $ # . $ # # ! $ # ! 2%9 ! '2# = # ]% * $ $ " # $ (# ' $2 # " ' $! 5 . # " " $ $ # % > $ 2% 5 2 # $ 2 2 % 5 D K . ! A \ " ]D # % A! A . ! # %I . ! ' $ %] # # $ ) " =5 ) C ) D% / # # ! # '2# = %* ) % ( ! # 2! # " ) # ( # ' ! B $ 2 # # # % (# # ! # ) ) ' '2# = ' # $ )% 1 $ ]% - # # ! # \' (# " . D% A= . ) # " # . ) 2 # (# . " $ 2 % '2# = %* ) $ # # 2# % (# 1 ! % 2 # # # A C # 2 # # A\ " .% 0 ' 2 ! # 2" " " # # ' J \5 # $ ' M* 2 2 # # & / # " " # N% * . 5 A $ /# =# " - = 2% > ! # A % ) 2 " # ) ! % B ) # " " # $ ! " ! $ " 2% 0 ' A # # A $ $) .B " \! 2" ! ! (# '2# = $ ." " S " (# # % $ A! A A ! 2 %] A 2 > ! ) ! ! $ # $ # % * $ " 2 $ # .

4 Hola David. 2% \F1 %] 9 " . ' # ' - ) # # # # " ' $ ! # ! - ]% # .' \ # C A # 2 # % \* $ 2 # # # # # 2 $ ! A# ) # D '$ $ ! D% $ 2 # ! / - % ! - / # 2 2 # # . 6E E7% * 2V \ $ # $ ( # : # 2 " : !: OOO% ! 2 " " " K . # / % M3 9 . . . mi nombre es Barry Newton. ' . % '! $ ! (# A ) # A\ " 0]% " # # # 2 # '2# = 1 J! # $ ]% 1 # # C % 9 $ " # ' # # # # .% ' $ " # J# \( # $ % 2 (# % # $ $ \ # \ . Soy un practicante de medicina homeopática e EE . 2 ! # # %] * # ' ' 2 " $ . ! ! .. # ! % 9 $ # # .' ' !]% * '2# = % M* # " # 2 # # ' '! . # # % " %9 . ' ]% MH # 2 / . # .8 '# # ! # " $ 2 $ # $2 % ! ' " ' # - @@. ' ]% 9 . \ N% 3 ( ' %.?# $ ? b ' # ' ' ' # " $ ' 2 # %.B %3 # =$ % .! 1 2 # " .B % # A$ A % ! " 2# " " ! %] APÉNDICE II Conque la Conexión Reptiliana es una Locura. $ # 2 # # % 3 # $ 2 # 2 $2 2 . G% ' ! # .$ . # # ! . ¿eh? $) (# .A # $ A # ( ) %9 # # ] . $ N% H ' # % ! % " \B '. # " # '2 /$ # N% $ E@E.

y estar en la presencia de. El cambio es a veces profundo y a veces discreto. Copyright Healing Health & Harmony Presenciar un cambio es una experiencia completamente notable y extraña. y comportamiento facial (incluso corporal) totalmente diferente de lo que era el anterior.cuando los pacientes con el Desorden Disociativo de Identidad cambian de una personalidad a otra. después de leer su libro. Esta paciente me proveyó de dibujos que ella había hecho que para mí no tenían ningún significado especial hasta ahora en 2005. una persona totalmente diferente. El cambio de personalidad no es diferente de hablar a. y burbujea con protuberancias y hundimientos y es muy difícil de enfocar. La piel del cuerpo anfitrión aparentemente se hace fluida. fláccida. Hijos de la Matriz. traté a una paciente que sufría la condición psiquiátrica monstruosa conocida como Desorden Disociativo de Identidad o DID (una vez conocido como 'personalidad múltiple') el resultado de nacer en un Culto Satánico y ser posteriormente ritualmente abusada por más de tres décadas. Desde 1994 hasta 2001. La finalización del cambio revela una presencia. Lo que al principio me golpeó fue que su idea del 'cambio de forma' era muchísimo similar a un proceso conocido como 'cambio' . como los Annunaki también llamados los Observadores por los antiguos Mesopotámicos y otros. y esto E6 . estructura. así como a unir ideas.hipnoterapia clínica residente en Australia. La lectura de su trabajo me incitó a recordar tales acontecimientos.

que ahora expido a usted.conectó mi memoria con los dibujos de ojos que fueron hechos por mi paciente .com. 1 #! '> > 'e > ! Note que los ojos del mal son dibujados con pupilas verticales. Revisé las notas del caso para localizar los dibujos de ojos mirando.au/ 1 # ' ' $ / E8 # # %9 $ # % . Saludos cordiales.cdsubliminal. Barry. En efecto parece que la presencia y el uso de serpientes es integral en todos los casos de Abuso Ritual Satánico. y que los dos perpetradores principales son representados como reptiliano y serpiente. y para mi muy grande sorpresa encontré varios dibujos más que también parecen confirmar sus exposiciones en cuanto a Satanismo y reptiles.ojos que le dijeron que estaban 'siempre mirando'. http://www.

Sign up to vote on this title
UsefulNot useful