You are on page 1of 50

EXERCCIOS DE VESTIBULAR www.planetabio.

com

Assunto: Citologia
1- (UNIFESP-SP) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vrus influenza A (H1N1), causando perdas econmicas, sociais e de vidas. O referido vrus possui, alm de seus receptores proticos, uma bicamada lipdica e um genoma constitudo de 8 genes de RNA. Considerando: 1. a sequncia inicial de RNA mensageiro referente a um dos genes deste vrus: 5 AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3

gabarito
responda: a) Qual ser a sequncia de aminocidos que resultar da traduo da sequncia inicial de RNA mensageiro, referente a um dos genes deste vrus indicada em 1? b) Considerando os mecanismos de replicao do genoma viral, qual a principal diferena entre o vrus da gripe e o vrus que causa a AIDS?

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
2- (UNIFESP-SP) A sonda Phoenix, lanada pela NASA, explorou em 2008 o solo do planeta Marte, onde se detectou a presena de gua, magnsio, sdio, potssio e cloretos. Ainda no foi detectada a presena de fsforo naquele planeta. Caso esse elemento qumico no esteja presente, a vida, tal como a conhecemos na Terra, s seria possvel se em Marte surgissem formas diferentes de a) DNA e protenas.

gabarito

b) cidos graxos e trifosfato de adenosina. c) trifosfato de adenosina e DNA. d) RNA e acares. e) cidos graxos e DNA 3- (UFRS) Assinale com V (verdadeiro) ou F (falso) as seguintes consideraes sobre o colesterol, um lipdio do grupo dos esterides. ( ( ( ( ( ) ) ) ) ) Ele participa da composio da membrana plasmtica das clulas animais. Ele sintetizado no pncreas, degradado no fgado e excretado na forma de sais biliares. Ele precursor dos hormnios sexuais masculino e feminino. Ele precursor da vitamina B. As formas de colesterol HDL e LDL so determinadas pelo tipo de lipoprotena que transporta o colesterol.

A seqncia correta de preenchimento dos parnteses, de cima para baixo, a) V - F - V - F - V. b) F - V - F - F - V. c) V - V - F - V - F. d) F - F - V - V - F. e) V - V - F - V - V.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
4- (UNIFESP-SP) Considere as trs afirmaes: I. Somos constitudos por clulas mais semelhantes s amebas do que s algas unicelulares. II. Meiose um processo de diviso celular que s ocorre em clulas diplides. III. Procariontes possuem todas as organelas citoplasmticas de um eucarionte, porm no apresentam ncleo. Est correto o que se afirma em:

gabarito

a) I, apenas. b) II, apenas. c) III, apenas. d) I e II, apenas. e) I, II e III. 5- (UEG-GO) A ingesto diria de leite pode causar perturbaes digestivas em milhes de brasileiros que apresentam intolerncia a esse alimento, a qual provocada pela deficincia de lactase no adulto, uma condio determinada geneticamente e de prevalncia significativa no Brasil. "CINCIA HOJE", v. 26, n. 152, ago. 1999, p. 49. [Adaptado]. Tendo em vista o tema apresentado acima, INCORRETO afirmar: a) A lactose, presente no leite, bem como outros carboidratos de origem animal representam uma importante fonte de energia na dieta humana. b) A lactase, assim como outras enzimas, tem sua atividade influenciada por diversos fatores, tais como a temperatura e o pH. c) A lactase uma enzima que age sobre a lactose, quebrando-a em duas molculas, sendo uma de maltose e outra de galactose. d) O efeito simultneo da desnutrio e das infeces intestinais pode resultar em deficincia secundria de lactase, aumentando ainda mais o nmero de pessoas com intolerncia lactose.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
6- (UNIFESP-SP) Analise o diagrama.

gabarito

Indique a alternativa que identifica corretamente os conceitos correspondentes a 1, 2, 3 e 4. a) 1 = em clulas diplides; 2 = na mitose; 3 = na meiose; 4 = em clulas haplides. b) 1 = em clulas haplides; 2 = na meiose; 3 = na mitose; 4 = em clulas diplides. c) 1 = na meiose; 2 = em clulas haplides; 3 = na mitose; 4 = em clulas diplides.

d) 1 = na meiose; 2 = na mitose; 3 = em clulas diplides; 4 = em clulas haplides.


e) 1 = na mitose; 2 = em clulas diplides; 3 = em clulas haplides; 4 = na meiose.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
7- (UECE) Sabe-se que o carboidrato o principal fator a contribuir para a obesidade, por entrar mais diretamente na via glicoltica, desviando-se para a produo de gordura, se ingerido em excesso. Uma refeio composta de bolacha (amido processado industrialmente) e vitamina de sapoti (sapoti, rico em frutose), leite (rico em lactose) e acar (sacarose processada industrialmente) pode contribuir para o incremento da obesidade, por ser, conforme a descrio acima, visivelmente rica em a) lipdios.

gabarito

b) protenas. c) glicdios. d) vitaminas.

8- (UFC-CE) Sobre as substncias que compem os seres vivos, correto afirmar que: (01) os carboidratos, os lipdios e as vitaminas so fontes de energia para os seres vivos; (02) a gua a substncia encontrada em maior quantidade nos seres vivos; (04) alm de sua funo energtica, os carboidratos esto presentes na formao de algumas estruturas dos seres vivos; (08) as gorduras constituem o principal componente estrutural dos seres vivos; (16) os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdios, os carboidratos, as vitaminas e os cidos nuclicos. Soma ( )

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
9- (UFABC-SP) O Saccharomyces fermento biolgico, usado pelas donas de casa na produo de po. Normalmente, aps manusear a massa, e tendo feito os pes, antes de ass-los, ela pega um pedao da massa e faz uma bolinha que colocada num copo com gua. Quando a bolinha sobe, ela coloca os pes para assar. Considere a figura a seguir que representa a clula do Saccharomyces e algumas regies indicadas por nmeros.

gabarito
a) Considerando o Saccharomyces que se encontra no interior da massa, escreva a reao responsvel pela diminuio da densidade da bolinha e indique a regio numerada onde ela ocorre. b) Sendo o Saccharomyces um organismo anaerbico facultativo, qual deles consome mais glicose: os que esto no interior da massa ou os que ficam na superfcie? Explique.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
10- (UFABC-SP) O local onde ocorrem os principais eventos da digesto humana o intestino delgado. Nele so encontradas as microvilosidades e uma mistura de sucos digestivos. No esquema simplificado a seguir, est representada por setas a trajetria de algumas substncias para os capilares sangneos e destes para as clulas intestinais.

gabarito
a) Mencione uma substncia orgnica, resultante da digesto de protenas, que pode seguir a trajetria da

seta pontilhada e uma substncia inorgnica que pode seguir a trajetria da seta contnua.
b) Suponha que uma pessoa tivesse perdido a capacidade de gerar clulas com microvilosidades. Que conseqncia ela teria no aproveitamento dos nutrientes? E se as clulas intestinais deixassem de receber a substncia inorgnica do sangue, que problema ocorreria? Explique cada situao.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
11- (UFSC) A gua a substncia mais abundante na constituio dos mamferos. encontrada nos compartimentos extracelulares (lquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de rgos como a bexiga e o estmago). Sobre a gua e sua presena nos mamferos CORRETO afirmar que: (01) a quantidade em que encontrada nos organismos invarivel de espcie para espcie. (02) com o passar dos anos, existe uma tendncia de aumentar seu percentual em um determinado tecido.

gabarito

(04) importante fator de regulao trmica dos organismos. (08) em tecidos metabolicamente ativos inexistente. (16) participa da constituio dos fluidos orgnicos que transportam substncias dissolvidas por todo o corpo. (32) constitui meio dispersante para facilitar a realizao das reaes qumicas. Soma ( )

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
12- (UFBA) A figura ilustra mecanismos moleculares de resistncia bacteriana a antibiticos, a saber: a) o recrutamento de uma enzima que destri ou incapacita a droga; b) o uso de uma bomba no envoltrio celular que expulsa a droga antes que ela aja; c) a substituio da protena-alvo da droga por uma verso que a droga no reconhece.

gabarito
A partir da anlise das informaes, explique a resistncia bacteriana a antibiticos, relacionando-a estratgia reprodutiva do grupo.

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
13- (PUC-PR) As enzimas so catalisadores orgnicos e atuam na ativao das reaes biolgicas. Em relao s enzimas, podemos afirmar que: a) seu poder cataltico resulta da capacidade de aumentar a energia de ativao das reaes. b) so catalisadores eficientes a qualquer substrato. c) atuam em qualquer temperatura, pois sua ao cataltica independe de sua estrutura espacial. d) sendo protenas, por mudanas de pH, podem perder seu poder cataltico ao se desnaturarem.

gabarito

e) no podem ser reutilizadas, pois reagem como substrato, tornando-se parte do produto.

14- (UFSC) Protenas so molculas essenciais vida, atuando como enzimas, hormnios, anticorpos, antibiticos e agentes anti-tumorais, alm de estar presentes nos cabelos, na l, na seda, em unhas, carapaas, chifres e penas dos seres vivos. Em relao s protenas CORRETO afirmar que: (01) so biopolmeros constitudos de aminocidos, os quais so unidos entre si por meio de ligaes peptdicas. (02) a produo destas molculas se d sem gasto de energia pelos organismos, j que os aminocidos provm da alimentao. (04) todas as protenas possuem peso molecular idntico, caracterstica especial dessas molculas. (08) a insulina, que foi o primeiro hormnio a ter sua seqncia de aminocidos conhecida, produzida por clulas especializadas do pncreas. (16) apesar da diversidade na constituio e estruturao de seus aminocidos, essas molculas apresentam, no seu conjunto, a mesma velocidade de degradao no meio ambiente. (32) a grande variabilidade biolgica dessas molculas permite sua utilizao para fins de identificao pessoal, da mesma forma e com a mesma preciso que os exames de DNA.

10

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
15-(UFBA) A viso das cores nos vertebrados depende de clulas cnicas (cones) na retina. Aves, bem como lagartos, tartarugas e muitos peixes, tm quatro tipos de clulas cnicas, enquanto a maioria dos mamferos possui apenas dois. [...] Cada cone contm um pigmento que consiste em certa variante da protena opsina, ligada a uma molcula pequena de retinal. (GOLDSMITH, 2006, p. 72). O diagrama, construdo a partir de anlises do DNA, reconstitui a provvel evoluo da capacidade de Enxergar as cores em diferentes grupos de vertebrados.

gabarito
Interprete o diagrama apresentado e justifique o uso de seqUncias especficas de DNA na identificao de tipos de cones em um organismo e a conseqente capacidade de ver as cores.

11

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
16- (UFMG) O DNa participa de importantes processos na sntese molecular. a) Durante a realizao de um desses processos, nos indivduos com xeroderma pigmentoso, a protena anmala no capaz de reparar erros, o que resulta em mutaes. processo b) Indivduos portadores de xeroderma pigmentoso podem apresentar algumas clulas em que o DNA normal , com uma frequncia muito alta, substitudo pelo DNA mutante. Analise estas duas representaes IDENTIFIQUE esse

gabarito

de fragmentos de DNA:

Considerando as informaes contidas nas duas sequncias iniciais DNA normal e DNA mutante e outros conhecimentos sobre o assunto, IDENTIFIQUE a sequncia I, II ou III que apresenta um RNA em que o DNA mutante foi usado como molde. JUSTIFIQUE sua resposta.

12

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
17- (UFMG) Observe estas figuras:

gabarito
Considerando-se as informaes contidas nessas figuras e outros conhecimentos sobre o assunto, CORRETO afirmar que, a) em II, ocorre fixao de dixido de carbono. b) em III, a obteno de energia depende de mitocndrias. c) em I e II, a transcrio e a traduo ocorrem no mesmo compartimento. d) em I e III, os tipos de bases nitrogenadas so diferentes.

13

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
18- (UFF-RJ) Os sais minerais so de importncia vital para o bom funcionamento de diversos processos fisiolgicos, sendo necessria a reposio da concentrao de cada on para que seja mantida a homeostasia do organismo. O grfico e a tabela abaixo mostram a concentrao e algumas atividades biolgicas de trs ons em seres Humanos:

gabarito
Analisando o grfico e a tabela acima, pode-se afirmar que os ons representados por I, II e III so respectivamente: a) Ca+2, Na+ e K+ b) Na+, K+ e Ca+2 c) K+, Ca+2 e Na+ d) K+, Na+ e Ca+2 e) Na+, Ca+2 e K+

14

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
19- (UNIFESP-SP) O uso de vinagre e sal de cozinha em uma salada de alface, alm de conferir mais sabor, serve tambm para eliminar microorganismos causadores de doenas, como as amebas, por exemplo. O inconveniente do uso desse tempero que, depois de algum tempo, as folhas murcham e perdem parte de sua textura. Esses fenmenos ocorrem porque a) as amebas morrem ao perderem gua rapidamente por osmose. J as clulas da alface possuem um envoltrio que mantm sua forma mesmo quando perdem gua por osmose e, por isso, murcham mais

gabarito

lentamente. b) tanto as amebas quanto as clulas da alface no possuem barreiras para a perda de gua por difuso simples. Ocorre que, no caso da alface, trata-se de um tecido e no de um nico organismo e, portanto, a desidratao notada mais tardiamente. c) as amebas morrem ao perderem gua por osmose, um processo mais rpido. Em contrapartida, as clulas da alface perdem gua por difuso facilitada, um processo mais lento e, por isso, percebido mais tardiamente. d) o vinagre, por ser cido, destri a membrana plasmtica das amebas, provocando sua morte. No caso da

alface, o envoltrio das clulas no afetado pelo vinagre, mas perde gua por difuso simples, provocada
pela presena do sal. e) nas amebas, a bomba de sdio atua fortemente capturando esse on presente no sal, provocando a entrada excessiva de gua e causando a morte desses organismos. As clulas da alface no possuem tal bomba e murcham por perda de gua por osmose.

15

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
20- (UFF-RJ) Os estudos de evoluo humana utilizam freqentemente como alvo para anlise molecular o DNA-mitocondrial, devido a sua herana exclusivamente materna. Assinale a alternativa que descreve o papel do DNA mitocondrial na fisiologia da clula. a) Conter informaes para a sntese de enzimas mitocondriais. b) Fornecer informaes para protenas envolvidas na contrao mitocondrial, durante a respirao celular. c) Fornecer energia clula pelo ciclo de Krebs.

gabarito

d) Conter informaes para a sntese de enzimas da via glicoltica. e) Fornecer informaes para a duplicao do DNA nuclear.

16

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
21- (UFF-RJ) Aps um determinado tempo de cultivo celular, trs garrafas de cultura, identificadas pelos nmeros I, II e III, contendo o mesmo tipo de clula, foram incubadas com uma substncia citotxica nas concentraes de 25mg/mL, 50mg/mL e 100mg/mL, respectivamente. Durante este estudo, foi possvel acompanhar, por um perodo de 14 dias, a variao da rea da superfcie do retculo endoplasmtico destas clulas, resultante do efeito citotxico da droga. Entretanto, na hora de colocar os resultados na tabela, o pesquisador no conseguiu ler a identificao das garrafas, e por isso, ele as denominou, aleatoriamente, de X, Y e Z. Os resultados deste estudo esto representados na tabela abaixo.

gabarito

Com base nesta tabela e tendo em vista que: i) o efeito citotxico do composto se inicia imediatamente aps a sua adio cultura de clulas; ii) a metabolizao da droga no produz outros compostos txicos e iii) que no dia da adio da droga, a medio da rea do retculo foi realizada uma hora depois desse procedimento, responda: a) Que concentrao da substncia foi colocada nas garrafas representadas nas colunas X, Y e Z, respectivamente? Justifique. b) Qual o dia do cultivo celular em que a substncia foi colocada nas garrafas? Justifique. c) Em que tipo de retculo endoplasmtico ocorreu a variao de rea observada neste experimento? Justifique. d) Qual a principal funo deste retculo nas clulas da musculatura esqueltica?

17

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
22- (UFPR) A Citologia se fundamenta em estudos morfolgicos, funcionais e moleculares. De acordo com os estudos citolgicos, correto afirmar que: (01) As mitocndrias so responsveis pela respirao celular tanto em clulas animais como em clulas vegetais. (02) O centrolo orienta a formao do fuso mittico nas clulas dos vegetais superiores. (04) possvel diferenciar o DNA do RNA pela base pirimdica e pela pentose. (08) O principal componente do ncleo a cromatina que constituda por DNA e protenas. (16) O nuclolo uma estrutura caracterstica das clulas eucariontes, visvel na intrfase. (32) O complexo de Golgi est relacionado a vrias funes celulares, sendo a secreo celular uma delas.

gabarito

Soma (

23- (UFRS) Em um experimento em que foram injetados aminocidos radioativos em um animal, a observao de uma de suas clulas mostrou os seguintes resultados: aps 3 minutos, a radioatividade estava localizada na organela X (demonstrando que a sntese de protenas ocorria naquele local); aps 20 minutos, a radioatividade passou a ser observada na organela Y; 90 minutos depois, verificou-se a presena de grnulos de secreo de radioativos, uma evidncia de que as protenas estavam prximas de serem exportadas. As organelas X e Y referidas no texto so, respectivamente, a) o complexo golgiense e o lisossomo. b) o retculo endoplasmtico liso e o retculo endoplasmtico rugoso. c) a mitocndria e o ribossomo. d) o retculo endoplasmtico rugoso e o complexo golgiense. e) o centrolo e o retculo endoplasmtico liso.

18

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
24-(UFF-RJ) Biodiversidade o conjunto de diferentes formas de vida no planeta. De todos os seres vivos que constituem atualmente a biosfera, j foram identificadas cerca de 1.413.000 espcies. Essas incluem: 1.032.000 espcies de animais, 248.500 espcies de plantas, 69.000 de fungos e 26.000 de algas. Apesar desses nmeros serem bastante elevados, supe-se que o nmero real de espcies seja ainda muito maior (30 a 150 milhes), pois, grande parte da biodiversidade ainda no conhecida. (adaptado de http://www.naturlink.pt/canais/Artigo.asp?iArtigo=4521&iLingua=1) As figuras abaixo representam trs tipos de clulas de organismos de diferentes reinos.

gabarito

a) Identifique os reinos de cada clula representada. b) c) Cite uma estrutura exclusiva de cada clula representada na figura. D a principal funo de cada uma das estruturas citadas no item anterior.

19

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
25- (UERJ) Em um experimento, culturas de Escherichia coli foram tratadas com dois agentes mutagnicos que lesam o terceiro nucleotdeo do gene que codifica uma protena da cadeia respiratria. O primeiro agente induz a troca da base adenina por guanina; o segundo promove a supresso da base adenina. Foram selecionadas amostras de clulas tratadas com cada um dos agentes e isolados os genes modificados. Em seguida, as bases nitrogenadas desses genes foram seqenciadas, sendo identificadas as estruturas primrias das protenas que eles codificam. O quadro a seguir resume os resultados encontrados:

gabarito

Explique por que nas clulas tratadas com o agente 1 no houve alterao na seqncia de aminocidos, enquanto nas tratadas com o agente 2 ocorreram grandes modificaes.

20

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
26- (UERJ) Algumas clulas so capazes de enviar para o meio externo quantidades apreciveis de produtos de secreo. O esquema abaixo representa a clula epitelial de uma glndula que secreta um hormnio de natureza protica.

gabarito
Nomeie as organelas que participam diretamente do transporte do hormnio a ser secretado e descreva a atuao delas.

21

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
27- (UFF-RJ) Quando se coloca gua oxigenada em um ferimento na pele, uma enzima localizada no interior de uma determinada organela das clulas do tecido ferido cliva essa gua, provocando um borbulhamento sobre o ferimento. a) Em que organela a enzima em questo se localiza? b) Explique por que ocorre o borbulhamento sobre o ferimento, descrevendo a reao e a enzima envolvida. c) Um animal geneticamente modificado apresenta uma reduo significativa da sntese das enzimas da organela identificada na resposta do item a. Nesse caso, o processo de detoxificao do etanol seria afetado? Justifique. d) Cite o nome e a funo especfica da organela identificada no item a, nas clulas vegetais. 28- (UECE) Sabe-se que no transporte de substncias atravs da membrana plasmtica: 1) Certos ons so conservados com determinadas concentraes dentro e fora da clula, com gasto de energia. 2) Caso cesse a produo de energia, a tendncia de distriburem-se homogeneamente as concentraes destes ons. As frases 1 e 2 referem-se, respectivamente, aos seguintes tipos de transporte: a) difuso facilitada e osmose b) transporte ativo e difuso simples c) transporte ativo e osmose d) difuso facilitada e difuso simples

gabarito

22

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
29- (UFF-RJ) At a metade do sculo passado, s era possvel observar clulas ao microscpio ptico. Com a evoluo da tecnologia, novos aparelhos passaram a ser empregados no estudo da clula. Hoje em dia so utilizados microscpios informatizados e com programas que permitem o processamento de imagens obtidas como as representadas nas figuras abaixo:

gabarito
Na figura I, vrias organelas foram identificadas e evidenciadas por diferentes cores. Aps a remoo de todas as organelas delimitadas por membranas da figura I, restou a regio de cor azul (figura II). Assinale a alternativa que identifica a regio azul e duas estruturas celulares encontradas nessa regio. a) hialoplasma - microtbulo e cariomembrana b) citoplasma - centrolo e desmossomo c) citosol - ribossomo e microtbulo d) citoplasma - corpsculo basal e endossomo e) citosol - microtbulo e vacolo

23

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
30- (UFF-RJ) Em apenas doze meses foi derrubado 1,3 bilho de rvores da Amaznia, o equivalente a 0,7% da floresta.
(Adaptado da revista VEJA, junho de 2005). Apesar de chamada de o pulmo do mundo, noite a Amaznia respira e consome oxignio, como os animais que moram ali. Experimentos clssicos demonstraram que as plantas so capazes de fazer fotossntese (representada pela

frmula 6CO2 + 12H2O luz> C6H12O6 + 6H2O + 6O2) e produzir oxignio. Um experimento, em que foram utilizados ratos e/ou
plantas na presena ou na ausncia de luz, foi realizado em um ambiente hermeticamente fechado para mostrar a relao entre a produo e o consumo de O2. Assinale a alternativa cujo grfico melhor representa a concentrao final de O 2 nas diferentes condies Experimentais. Dado: A linha tracejada nos grficos representa a concentrao inicial de O 2 nas diferentes condies experimentais.

gabarito

24

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
31- (UFPEL-RS) A meiose um processo de diviso celular em que so formadas quatro clulas com o nmero de cromossomos reduzido metade (n cromossomos). Esse processo dividido em duas etapas (Meiose I e Meiose II), e cada etapa subdividida em vrias fases. Nessas fases, ocorrem vrios eventos: I. clivagem (quebra) das cromtides homlogas e troca de trechos entre elas. II. deslocamento das cromtides irms para plos opostos da clula. III. ocorrncia da citocinese e formao das duas clulas, as quais possuiro n cromossomos cada uma. IV. deslocamento dos cromossomos homlogos para plos opostos da clula. V. emparelhamento dos cromossomos homlogos na placa metafsica (equatorial) da clula.

gabarito

Os eventos I, II, III, IV e V correspondem, respectivamente, s seguintes fases:


a) Interfase, Anfase I, Telfase II, Anfase II, Metfase I. b) Prfase I, Anfase II, Telfase I, Anfase I e Metfase I. c) Telfase I, Anfase II, Citocinese I, Telfase II e Prfase I. d) Anfase I, Telfase II, intercinese, Prfase I, Intercinese. e) Intercinese, Telfase II, Anfase I, Metfase I, Anfase II.

25

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
32- (UFRS) Considere as afirmaes a seguir, referentes aos cromossomos homlogos. I. Durante a mitose e a meiose, quando os cromossomos so visveis como entidades distintas, os membros de um par de homlogos so de mesmo tamanho e exibem localizao centromrica idntica. II. Durante os estgios iniciais da meiose, os cromossomos homlogos pareiam. III. Cromossomos homlogos so os que contm os mesmos alelos para cada loco gnico.

gabarito

Quais esto corretas? a) Apenas I. b) Apenas II.

c) Apenas III.
d) Apenas I e II. e) I, II e III.

26

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
33- (UFF-RJ) De acordo com o tipo de nutrio, os seres vivos podem ser classificados em autotrficos e heterotrficos. Entretanto, ambos sintetizam ATP, principal moeda energtica, a partir de diferentes molculas para manter suas vias metablicas.

gabarito

Aps a anlise das vias metablicas (I e II) representadas no esquema, correto afirmar que: a) I ocorre nos cloroplastos de clulas vegetais e II ocorre nas mitocndrias das clulas animais e vegetais; b) I ocorre em cloroplastos de clulas vegetais e II ocorre somente nas mitocndrias das clulas animais; c) I ocorre somente nas mitocndrias das clulas animais e II ocorre em cloroplastos de clulas vegetais; d) I ocorre nas mitocndrias das clulas animais e vegetais e II ocorre somente nos cloroplastos de clulas vegetais; e) I e II ocorrem tanto em mitocndrias e cloroplastos de clulas animais e vegetais.

27

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
34- (UFRN) Uma protena X codificada pelo gene Xp sintetizada nos ribossomos, a partir de um RNAm. Para que a sntese acontea, necessrio que ocorram, no ncleo e no citoplasma, respectivamente, as etapas de a) iniciao e transcrio. b) iniciao e terminao. c) traduo e terminao. d) transcrio e traduo.

gabarito

35- (PUC-SP) Vacinas contm antgenos de agentes infecciosos e esses antgenos levam o indivduo vacinado a apresentar uma resposta imunitria primria. Se, aps algum tempo, o indivduo contrair o agente infeccioso contra o qual foi imunizado, dever apresentar uma resposta imunitria a) mais lenta que a primria, pois seu organismo ainda no tem clulas de memria imunitria. b) mais lenta que a primria, pois seu organismo ainda no tem anticorpos em quantidade satisfatria. c) mais rpida e intensa que a primria, devido ao reconhecimento do agente infeccioso pelas clulas de memria imunitria presentes em seu organismo. d) mais rpida e intensa que a primria, devido diminuio da quantidade de anticorpos em seu organismo. e) to rpida e intensa quanto a primria, devido baixa atividade dos linfcitos em seu organismo.

28

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
36- (UNIFESP-SP) Analise a figura

A figura representa um cromossomo em metfase mittica. Portanto, os nmeros I e II correspondem a: a) cromossomos emparelhados na meiose, cada um com uma molcula diferente de DNA. b) cromtides no-irms, cada uma com uma molcula idntica de DNA. c) cromtides-irms, cada uma com duas molculas diferentes de DNA. d) cromtides-irms, com duas molculas idnticas de DNA. e) cromossomos duplicados, com duas molculas diferentes de DNA.

29

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
37- (UNIFESP-SP) A hidroponia consiste no cultivo de plantas com as razes mergulhadas em uma soluo nutritiva que circula continuamente por um sistema hidrulico. Nessa soluo, alm da gua, existem alguns elementos qumicos que so necessrios para as plantas em quantidades relativamente grandes e outros que so necessrios em quantidades relativamente pequenas. a) Considerando que a planta obtm energia a partir dos produtos da fotossntese que realiza, por que, ento, preciso uma soluo nutritiva em suas razes? b) Cite um dos elementos, alm da gua, que obrigatoriamente deve estar presente nessa soluo nutritiva e que as plantas necessitam em quantidade relativamente grande. Explique qual sua participao na fisiologia da planta

gabarito

38- (UFPR) Para se descobrir a funo das estruturas celulares, uma via experimental usada pelos cientistas a remoo da estrutura celular que se quer estudar e a posterior verificao do que acontece clula na ausncia da estrutura. O uso de organismos mutantes uma alternativa para a obteno dessas clulas modificadas. Embries de sapos compostos de clulas sem nuclolos (anucleoladas) foram comparados a embries normais. O desenvolvimento a partir do zigoto acontece de forma semelhante nos dois casos, mas no momento da ecloso do girino os mutantes anucleolados morrem. Paralelamente a isso, a principal alterao observada nas clulas de indivduos normais foi um aumento significativo na concentrao de ribossomos no citoplasma, o que no ocorreu nos mutantes anucleolados. Com base nessas informaes e nos conhecimentos de Biologia Celular, considere as seguintes afirmativas: 1. Nos indivduos mutantes anucleolados, a ecloso do girino no acontece, por falta de alimentao adequada do embrio, o que leva sua morte. 2. O nuclolo o responsvel pela produo dos ribossomos, por sua vez responsveis pela sntese das protenas necessrias ao processo de ecloso dos girinos. 3. A ecloso do girino s acontece na presena de uma grande quantidade de energia, na forma de ATP, que obtida por meio dos ribossomos. 4. Os indivduos mutantes anucleolados sobreviveram fase embrionria por j contarem com ribossomos prontos, presentes no vulo. Assinale a alternativa correta. a) Somente a afirmativa 1 verdadeira. b) Somente as afirmativas 1 e 2 so verdadeiras. c) Somente as afirmativas 2 e 4 so verdadeiras. d) Somente as afirmativas 2, 3 e 4 so verdadeiras. e) Somente a afirmativa 3 verdadeira.

30

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
39- (PUC-SP) Encontra-se abaixo esquematizado o cromossomo 21 humano. O desenho foi feito com base na observao ao microscpio de um linfcito ( glbulo branco ) em diviso.

gabarito

A partir da anlise do desenho, assinale a alternativa INCORRETA. a) O cromossomo encontra-se duplicado e bem condensado. b) Ele pode ser observado durante a metfase da diviso celular. c) As cromtides, indicadas por A e A', so constitudas por molculas de DNA diferentes. d) O centrmero localiza-se prximo a uma das extremidades desse cromossomo e este apresenta um de seus braos bem maior que o outro. e) A trissomia desse cromossomo responsvel pela sndrome de Down

31

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
40- (UFJF-MG) Todas as clulas so envolvidas por uma membrana plasmtica que controla a entrada e a sada de substncias. A organizao estrutural e funcional da camada fosfolipdica e a presena de protenas de transporte conferem membrana plasmtica a capacidade de ser permevel apenas a algumas substncias. Analise e responda as questes abaixo sobre os processos de troca de substncias entre as clulas e o meio externo. a) O salgamento dos alimentos um recurso que evita a sua putrefao, sendo, por isso, utilizado na preservao de diversos tipos de carnes. Explique porque o sal ajuda na preservao desse alimento. b) A clula vegetal no sofre plasmoptise, ou seja, ela no se rompe ao ser colocada numa soluo hipotnica. Voc concorda com essa afirmativa? Justifique sua resposta. c) A figura que se segue apresenta vrios tipos de transporte, que permitem a passagem da glicose, atravs da clula intestinal, da luz do intestino at o sangue. Com base nesta figura, explique a participao da bomba de sdio e potssio no mecanismo de transporte da glicose, da luz do intestino at os vasos sangneos.

gabarito

32

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
41-(UEL-PR) Considere as seguintes fases da mitose: I. telfase II. metfase III. anfase Considere tambm os seguintes eventos:

gabarito

a. As cromtides-irms movem-se para os plos opostos da clula. b. Os cromossomos alinham-se no plano equatorial da clula. c. A carioteca e o nuclolo reaparecem. Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza. a) I - a; II - b; III - c b) I - a; II - c; III - b c) I - b; II - a; III - c d) I - c; II - a; III - b e) I - c; II - b; III - a

33

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
42-(PUC-PR) Mergulhadas no citoplasma celular encontram-se estruturas com formas e funes definidas, denominadas ORGANELAS CITOPLASMTICAS, indispensveis ao funcionamento do organismo vivo. Associe as organelas com suas respectivas funes: 1) 2) 3) 4) 5) Complexo de Golgi Lisossoma Peroxissoma Ribossoma Centrolo

gabarito

( ) - responsvel pela desintoxicao de lcool e decomposio de perxido de hidrognio. ( ) - local de sntese protica. ( ) - modifica, concentra, empacota e elimina os produtos sintetizados no Retculo Endoplasmtico Rugoso. ( ) - vescula que contm enzima fortemente hidrolticas formadas pelo Complexo de Golgi. ( ) - responsvel pela formao de clios e flagelos. Assinale a seqncia correta: a) 3; 4; 1; 2; 5 b) 2; 3; 1; 5; 4 c) 2; 1; 3; 4; 5 d) 1; 3; 2; 4; 5 e) 3; 4; 2; 5; 1

34

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
43- (UFJF-MG) A distribuio adequada de ons nos espaos intra e extracelular fundamental para o funcionamento das clulas. Por exemplo, a transmisso de impulsos nervosos, a contrao muscular e a secreo de hormnios so totalmente dependentes dessa distribuio e dos fluxos inicos. Dois importantes ons envolvidos nos processos celulares so o sdio e o potssio que tm concentraes diferente nos meios intra e extracelular. Sobre essas diferenas, CORRETO afirmar que: a) a concentrao de sdio maior fora da clula, e um importante componente na determinao dessa diferena a bomba de sdio-potssio que o transporta com gasto de ATP. b) a concentrao de sdio e potssio maior fora da clula, e um importante componente na determinao dessa diferena a bomba de sdio-potssio que os transporta com gasto de ATP. c) a concentrao de sdio maior dentro da clula, e um importante componente na determinao dessa diferena a bomba de sdio-potssio que o transporta sem gasto de ATP. d) a concentrao de potssio maior fora da clula, e um importante componente na determinao dessa diferena a bomba de sdio-potssio que o transporta com gasto de ATP. e) a concentrao de sdio maior fora da clula, e um importante componente na determinao dessa diferena a bomba de sdio-potssio que o transporta sem gasto de ATP. 44- (UFRS) Os hepatcitos so clulas que sofrem constante renovao. Uma de suas organelas tem a capacidade de reciclar macromolculas, que podero ser reaproveitadas pela clula. A organela referida a) a mitocndria. b) o nuclolo. c) o lisossomo. d) o centrolo. e) o ribossomo.

gabarito

35

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
45- (MACKENZIE) Entre os seres vivos ocorrem os tipos gamtica, esprica e zigtica, de meiose, segundo o esquema:

As a) b) c) d) e)

meioses esprica, gamtica e zigtica ocorrem, respectivamente, em algas, vegetais e fungos. vegetais, algas e fungos. vegetais, fungos e algas. fungos, algas e vegetais. fungos, vegetais e algas.

36

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
46- (UFT-TO) A origem da vida parece ter ocorrido h cerca de 3.400 M.a., quando o planeta Terra teria j 1.000 a 1.500 M.a., e os seres vivos conservam em si marcas do seu passado. Atualmente, h reconhecidamente duas formas de organizao celular entre os seres vivos: a clula procaritica e a clula eucaritica, que provavelmente originaram-se de organismos ancestrais, a partir de eventos evolutivos e interaes com os ecossistemas em que habitavam. Qual seria a origem da diferena entre clulas procariticas e eucariticas? At h pouco tempo, considerava-se que as clulas eucariticas teriam derivado da invaginao e especializao da membrana plasmtica da clula procaritica. A cientista Lynn Margulis sugeriu que a origem da clula eucaritica se deve ao desenvolvimento de associaes simbiticas obrigatrias entre diferentes seres, que ocorreram em trs etapas: (1) Uma clula proto-eucarionte hospedou uma bactria aerbia, obtendo assim a mitocndria; (2) Esta clula proto-eucarionte hospedou uma espiroqueta obtendo assim clios, flagelos e citoesqueleto; (3) Finalmente, esta clula proto-eucarionte hospedou uma cianobactria e obteve assim os plastos. verdadeiro que: I. Esta hiptese chamada Teoria Endossimbiontica muito improvvel porque a simbiose raramente ocorre na Natureza. II. A sntese protica em mitocndrias e cloroplastos no ocorre na presena de substncias inibidoras de procariontes, como estreptomicina e cloranfenicol. III. A membrana que envolve as mitocndrias e plastos dupla, o que sugere que a bactria ndossimbionte foi fagocitada pela clula proto-eucarionte. IV. Houve a aquisio de complexidade na estrutura e funo da clula eucaritica em relao clula procaritica, inclusive permitindo a maturao de protenas. V. As organelas de eucariontes, mitocndrias e plastos, no tm DNA prprio e, portanto no podem fazer diviso autnoma. Indique a alternativa em que todas as afirmativas so verdadeiras. a) II, III e IV b) I, II e IV c) I, II, IV e V d) IV e V

gabarito

37

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
47- (PUC-RIO) Uma dieta alimentar pobre em carboidratos e rica em protenas deve conter respectivamente: a) Pouca carne e muitos farinceos. b) Pouco leite e muitas verduras. c) Pouca carne e muitas verduras. d) Pouco leite e muito acar. e) Poucos farinceos e muita carne.

gabarito

48- (UNB)-Desde o incio da teoria celular at hoje, muito se tem descoberto acerca da clula, de suas organelas e caractersticas, e a respeito dos processos bioqumicos que nelas ocorrem. Com relao a esse tema, julgue os itens seguintes. (1) O movimento citoplasmtico, conhecido como ciclose, visvel ao microscpio ptico e tem intensidade inversamente proporcional temperatura. (2) Alteraes na concentrao dos ons provocam, nas clulas, modificaes profundas na permeabilidade, na viscosidade e na capacidade de resposta a estmulos. (3) Mitocndrias, retculo endoplasmtico e lisossomos so comuns s clulas procariticas e s eucariticas. (4) O nmero de cloroplastos de uma clula determinado geneticamente, mantendo-se estvel ao longo da vida celular. (5) O acar das frutas produzido durante o processo de fotossntese. (6) O fumo e a atividade fsica regular tm papis antagnicos na destruio do excesso de colesterol.

38

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
49- (UFT-TO) As atividades celulares so orientadas pelas informaes contidas no DNA, que so decodificadas em protenas atravs dos mecanismos de transcrio e traduo. O que faz uma baleia parecer uma baleia so suas protenas. Assim, as protenas determinam as funes vitais da baleia, como de todos os seres vivos. Para ditar o desenvolvimento de um organismo, a informao do DNA deve, de algum modo, ser convertida em protenas. Esta converso ocorre porque o DNA contm um cdigo gentico para os aminocidos que compem as protenas. Neste cdigo, cada aminocido representado por uma seqncia de pares de bases, e esta seqncia refletida na seqncia de aminocidos reunidos em uma cadeia protica. Assim, traduzir o cdigo gentico significa passar o cdigo de seqncia de bases para uma seqncia de aminocidos. Deste modo, o DNA decodificado na forma de uma protena estrutural ou enzimtica que, por sua vez, responsvel por uma caracterstica do organismo. Podemos afirmar que: I. Esta decodificao se faz atravs da leitura de seqncias de trs nucleotdeos, chamados cdons, que especificam aminocidos. II. Os cdons diferem entre diferentes txons de seres vivos; h cdons que no codificam aminocidos. III. A decodificao ocorre no citoplasma celular, em estruturas chamadas ribossomos, a partir de uma fita simples de DNA que deixa momentaneamente o ncleo somente para tal funo. IV. Cada cdon traduz apenas um aminocido. V. Alguns aminocidos so codificados por mais de um cdon. A isto chamamos degenerao do cdigo, o que possivelmente traz maior estabilidade contra mutaes no DNA.

gabarito

Indique a alternativa em que todas as afirmativas so falsas. a) I e III b) II, III e IV c) II e III d) II, III e V

39

EXERCCIOS DE VESTIBULAR www.planetabio.com

Assunto: Citologia
50- (UFOP-MG) A anlise laboratorial de uma amostra de gua revelou a presena de dois patgenos (A e B) com as seguintes caractersticas: Patgeno A organismo filtrvel, parasita intracelular, constitudo por uma capa protica que envolve a molcula de cido nuclico. Patgeno B organismo no filtrvel, que tem uma membrana lipoprotica revestida por uma parede rica em polissacardeos, que envolve um citoplasma onde se encontra seu material gentico constitudo por uma molcula circular de DNA.

gabarito

Esses organismos so, respectivamente: a) uma bactria e um fungo. b) um protozorio e um fungo. c) um vrus e uma bactria. d) uma bactria e um vrus.

40

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

1- a) No esquea que h o cdon de iniciao (AUG) e o cdon de parada (UGA). Logo, o peptdeo traduzido tem a sequncia:
Metionina Arginina Tirosina cido glutmico Triptofano Tirosina Alanina Tirosina.

b) A replicao do vrus influenza A H1N1 envolve a enzima RNA-polimerase, que realiza a replicao atravs dos RNAs virais. J o HIV, por ser um retrovrus, utiliza a enzima transcriptase reversa para gerar uma fita de DNA-viral, que se integra ao DNA da clula hospedeira, e num dado momento passa a formar cpias do RNA-viral. 2-c 3-a 4-d 5-c 6- d 7-c 8- Itens corretos: 02 + 04 + 16 = 22

41

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

9- a) A equao da fermentao alcolica : C6H12O6 2C2H5OH + 2 CO2 A liberao de dixido de carbono durante o processo fermentativo reduz a densidade da massa. A Fermentao alcolica ocorre no hialoplasma, indicado pelo nmero I. b) Os fungos que esto na superfcie consomem menos glicose, uma vez que realizam a respirao celular, processo que tem maior rendimento energtico. Os fungos que se encontram no interior da massa consomem mais glicose, pois realizam a fermentao alcolica processo que apresenta menor rendimento energtico. 10- a) A digesto de protenas libera aminocidos. Uma substncia inorgnica que poderia passar da corrente sangunea para os tecidos poderia ser o oxignio. b) As microvilosidades aumentam a rea de absoro da clula, assim se o indivduo perdesse a capacidade de gerar microvilosidades, teria prejuzo na absoro de nutrientes. Sem aporte de oxignio as clulas no conseguiriam produzir energia de modo adequado.
42

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

11- 04 + 16 + 32 = 52 12- Todos os mecanismos de resistncia citados envolvem a sntese de certas protenas, provavelmente os genes relacionados produo de tais protenas se encontram nos plasmdeos bacterianos, que podem ser passados a outras bactrias atravs do processo de conjugao.

13-d 14- Itens corretos: 01 + 08 = 09 15- Os diferentes cones apresentam opsinas distintas, cuja sntese depende de informaes contidas nos genes, dessa forma uma anlise do DNA, permite discriminar os tipos de cones existentes na retina do animal e elaborar um diagrama como o representado na questo.

43

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

16-a) As enzimas de reparo fazem uma verificao e correo de eventuais erros cometidos durante a replicao. Quem apresenta xeroderma pigmentoso possui enzimas de reparo defeituosas e dessa forma est sujeito a sofrer um maior nmero de mutaes. b) Fita II, pois apresenta complementaridade com a fita inferior do DNAmutante, portanto, utilizou essa hlice como molde.

17-a 18-b 19-a 20-a

44

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

21- a) As clulas da garrafa Y foram expostas a 25mg/mL da toxina, pois as clulas apresentaram menor desenvolvimento do retculo endoplasmtico. As clulas da garrafa Z foram exposta a 50mg/mL da toxina, uma vez que o desenvolvimento do retculo foi intermedirio. J as clulas da garrafa X foram expostas a 100mg/mL da toxina, visto que o desenvolvimento do retculo foi maior. b) A substncia foi adicionada cultura no quarto dia, pois a partir dessa data verifica-se aumento da rea do retculo. c) O reticulo o liso, pois uma de suas funes a detoxificao de substncias potencialmente agressivas. d) Controlar a concentrao intracelular de clcio no sarcmero.

22- Itens corretos: 01 + 04 + 08 + 16 + 32 = 61 23-d

45

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

24- a) 1- Reino Plantae; 2- Reino Monera; 3- Reino Protista b) 1- Cloroplasto, vaclo central e parede celulsica. 2 DNA circular e mesossomo. 3- centrolo. c) 1- O cloroplasto est relacionado fotossntese, o vacolo central participa da osmorregulao e do armazenamento de substncias, a parede celular fornece sustentao e proteo. 2- O DNA circular armazena informaes genticas, o mesossomo participa da produo de energia. 3- os centrolos originam clios e flagelos. 25- Como o cdigo gentico degenerado, em alguns casos, a troca de uma base nitrogenada gera um novo cdon, que especifica o mesmo aminocido determinado pelo cdon anterior. J a supresso de uma base nitrogenada alterar todo o processo de produo de RNA-m, mudando drasticamente a sequncia de bases dos cdons formados.

46

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

26- O hormnio proteico ser sintetizado no retculo granuloso, a seguir encaminhado ao complexo golgiense, que armazena e secreta o hormnio em vesculas de secreo. Tais vesculas sofrem fuso com a membrana plasmtica da clula para eliminar o seu contedo. 27- a) A enzima se localiza no peroxissomo. b) O borbulhamento resultante da liberao de oxignio da reao esquematizada a seguir: 2H2O2 2H2O + O2 A enzima que catalisa o processo a catalase. c) Sim, pois os peroxissomos apresentam enzimas relacionadas degradao do etanol. d) Glioxissomos, produzem carboidratos a partir de lipdios. 28-b 29-c 30-a
47

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

31-b 32-d 33-a 34-d 35-c 36-d

37-a) A soluo nutritiva responsvel pelo fornecimento de sais minerais essenciais ao desenvolvimento do vegetal. b) Magnsio, componente da molcula de clorofila, essencial para o processo de fotossntese. 38-c 39-c

48

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

40- a) O sal adicionado ao alimento cria um meio hipertnico, que causa desidratao dos microrganismos responsveis pela putrefao do alimento. b) A clula vegetal no sofre ruptura ao ser colocada em meio hipotnico graas a presena da parede celular. c) A bomba de sdio e potssio gera a diferena de concentrao de sdio, que permite o co-transporte de sdio e glicose. 41-e 42-a 43-a 44-c 45-b 46-a 47-e 48- F V F F F V 49-c
49

EXERCCIOS DE VESTIBULAR www.planetabio.com

Gabarito

50-c

50