fragile histidine triad protein [Rattus norvegicus


Rattus norvegicus fragile histidine triad protein (FHIT) mRNA, complete cds

fragile histidine triad [Homo sapiens]
GenBank: AAT37530.1 >gi|47716670|gb|AAT37530.1| fragile histidine triad [Homo sapiens] HVHVHVLPRKAGDFHRNDSIYEE

Homo sapiens fragile histidine triad (FHIT) gene, exon 8 and partial cds
GenBank: AY625256.1 >gb|AY625256.1|:68-136 Homo sapiens fragile histidine triad (FHIT) gene, exon 8 and partial cds CACGTTCACGTCCACGTTCTTCCCAGGAAGGCTGGAGACTTTCACAGGAATGACAGCATCTATGAGGAG