Eae gene.

TTGATCTTCTGGATACCTTCCTGATTTAACTCACCCACCCCTAACCAGGAAAGCAGAGCCAGCTCCCAAT CATCTTCGCCTAATAAATCTAATAATAACCTGGCATATTTCTTTTTTAATTCAATCTTAACAAACTTAGA TTGCAATAAAGAAGATATTAGCGCAACAATTTCCCCCTTTGGCATGTTGCCAAACATCGCCAAAGTAGGA TCGTGTTGTTCCAGCAGCCCGCTGTTTTTTAATGATAGTTCTTTTATTTTATCACTATCGGTAAGAGTAA GCAGCTCTTGCATATCATTGAGCAGCTTCTCGATTGTCGAGCCTTCCTCTTCTTTCCTTGCGCTACCTTT GCGATATCCCAGGCTTAGCCCTTCAATCGTTTCAGAAAGCGATGAACTAGTAATCATTGCTAATTCATTT TGCAAATTTATTAATGGCGAAGAAATATTAGAAGAATTTTTTTGCGTTAATTGCTGAGATTCTAATTCAA AATCTAATGAATTAGAATTAAAAACAGATGCGGGGTTTTGATTAAATTCAATACCATTAGCCATTGGAAA CTCACGTAATCATTAATTATGAATATTCCATTAAATAGTACTGTACAACAGCTTCCTTTCTACTCTATTC TTAGACGATGTAAGTTCACCATATTTTTTCTCATTGTTCAACCACCAGGATGAATAAAATTTAAAAATGT TATCCTCATATAAAATAAAACTTCTCAATGGTGCGATGCGTAATCGGGAATTACAACTTCCGATGGGAAA CCTAACGCTAGGTACGGAAGATAACGATATTGTTTACTTTCCCCTTGAACAAGGCCTCAATCAGTTTTTA CTTGATATACGTGAGGAAGGTGTTTTCCTTTTATCTCCGGTTGAATTTTGGATTGATGGGCAACCCACGC CCTATGAAGCAGATAAACCATTACCTGTCGGAAAGGTTATTGATATAGCGGGATGTTGCTTCATCATTGG TGATATTGACCATTCCTTGCCATTGTCTGATGTGCCAGAAAGGTTCTCTGCCAAAAGTCGACGCAAAAAA CGCCTTATCCTGGCGAGCGTGATTGGTGCTACTTTTGCGTTGTCTGGTGCCATCGGCAGTTACGTTTTGC TTTCCCCAAAAGCTGAACCCCCAACGTTTACCAGAGCTGATGTATATCAGCAGCTAAAAGAAAACAAACT TCATGCAATCACTCTGGTATGGCATGGGAAAAATATCGCGCTTTATGGGCGTTGCGAATCAACCACGGAT TTAACTCCATTTTTTAATTACCTAAAAGAAAAAAATATTTTTTATTACAATAATATCATTTGCAATAACC AAATCATATCCGCAATTAATGATGTCTTAACGGAATACGGTTACAAAGATATCATTATTACAAAAGGTAA TAAGCCTGGATTCTTTCTGTTATCGGGATACATTCCCCCTTCACCCAAATGGAGCGAGGTTGAAAATCTG TTACTGAATACGCCAGGAGTTGCAGGATGGGAAATACACAACAACAGTAACAATAAAATCAATGAACTGG CATCAGAGTTTAAAAAGAATAAACTAATAAACTATGTCAATATTTTCAAAAAGAATGATGTCATCATTGT TGCGGGGGAAGTTTCTCAACAGAATGAGAGTAAGATCCTTGCCATTATAAATGCAATGAACAAAAATAGT AACGCCAAGATACTCTTTCAGAACATTCAGCCGTACATTTCAGCAGATATTTTCCCCGGAAAAATACTCA GAATCAGCGGTACGATGAAGAATCCAACAATTGCTCTTGATAATGGCACCAGCCTGGGGATTGGTAGCAT TCTGAAAGGAGGCTATGTCATAGACGCGATTGATCCTAAAGATGGTATCAACATCTCCCGCCCAGACGAA TATATACATATTCCACTGTCGTATTAATTTCTTATCCTCTTCCCCCTCTTCGGAGGGTTTTTTATTGTGT GGATGTTGTGAGCATAGTTGTTGCTTGATGTGATTCAGCTTTGGTATCAGCGTGGTTGGATCAACCTACA

TGAGAAAACGTGAATGTGTCTCTTTGAAAGAGACCTATTAAGCAGATAAAAAGACCAGTAGTAGATTTGA TTATAAGAGGTTATTTCTTAAGAAGAAATAATTATGCCCCGACTAAAACAATACATATTTTAGCCGGGGT GGTTATGGAATTATTCTACACAAACCGCATAGACATTTGGAGTATTAACATTAACCCCAGGAAGAGGGTT TTGTGTTATTAGGTTATAAGTGCTTGATACTCCAGAACGCTGCTCACTAGATGTCTGTTTAATCCAAGCA GTTATTGAGTTCATAGAACTATAATGGCTATATTTATTTGCAGCCCCCCATGAGTCATAAATATCTGACA ATACCGTCTGTGTGGATGGTAATAAATTTTTGCAAATGGACATAGCATCAGCATAATAGGCTTGCTTATC CACTTTTATCATATACGACGGTGCTTTTATAGTGTAACTTACTGTTTGCTTATCACCAGATGTGGCTTTA ATTACGACACTGCCTTTACCATTCAAAGTGACTTTCCCTGATGCATCGACAGTCGCGATACTGGTATTTT CTGAATACCATGAATATGTACCATCACCACCGCTTGCTTTCAGTTTAAACTGACCATATTGCAGCCAAAT ATTAGGCAACTCGCCTCTGACATTGTTACCAATAATATCAACCTTGTTGTCAATTTTCAGTTCATCAAAA AAAGTGACCTCAGTCGCTTTAACCTCAGCCCCATCACTGACTGTCGCACTAACAGTCGCTTTACCGGCGG AACTGGAAGTTAGTGTTATCGTCGCACGACCATCATTTCCCGTGGTTGCTTGCGTTTGAGACTTACCGTT GAACATCCCAAAGTTTGTTGAGAATGTAACGGATTGATTATTAACTGGCTGACCGTTTTTCATAACTTTT ACAGTATATTTAATAGCATCCTTACCATTTGCTACTGCAGTTGTCTTATCAGCCTTAATCTCAGTAATGC TGGCCTTGGTTTGATCAAAAAATATAACCGCACTGGCATTAAGTGCTGAAGTCATCTCCGCGGTTTTAGC AGACACGACGACCTGTCCTGGCGTACTCGACTTCAACGTTACGGTTGCCTTACCGTTAGCATCCGTTTTG GCACTATTTGCCCCAAGAGTTGCAGTTCCTGAAACAATATTAAATGAAACAGGGACATTAGCCTGAGCTA CCCCATTCTTTTTCACCGTCGCGGTATAAGTAATGGTATCGGCGTTATCCGCTTTAGCCGAAGTCTTATC CGCCGTAAAGTCCGTTACCCCAACCTGGTCGACAACTTGACCATTCGACAGAACGGTAATAGTAAGCTGT ACATTGTTAGAGCTATTGCCATTACGGTCATAGGCGCGAGCCGTCACTTTATAAATATTGCTGCCACCTT GCACATAAGCAGGCAAAATAGCCTGGTAGTCTTGTGCGCTTTGGCTTCCGCTATGCTGAATCTGACCGCC CTGACTGCGTAATGCACTATCATCCCAGACGATACGATCCAGACCGTATTTGCTCTTAACGATCAACTGA ATCTTCTGCGTACTGTGTTCAGTACCATTAATATCATGCGGAATATTCAGAGAAAGAATATCCTGCTTCT TGTACTCCAGAATAATATTGTTATTACGCTGAACCAGATCGTAACGGCTGCCTGATAATGTTCTTAACTC GTTAACATACTGTGGTTCAATTTGCTGAGACCACGATTTATCAAACTGATAACGGAACTGCATTGAGTAA AGGAGATCATTTTCATTACCCGTACCATGACGGTAATCGATCCCCATCGTCACCAGAGGAATCGGAGTAT AGTTTACACCAACGGTCGCCGCACCAGGATTCGACTGCAGCTTATCAGAATTAAACAAAGCAACATTATC ACCATAATACTGCTCATATATCAGCTTGGCGCCTAATGCCGGATATGACGGTAGATAGCCATTAAAACGG ATATCGAAGCCATTTGCTGGGCGCTCATCATAGTCTTTCTTATTGTATGACTCATGCCAGCCGCTCATGC GGAAATAGCCGTTAACGCTACTTTTGAAATAGTCTCGCCAGTATTCGCCACCAATACCTAAACGGGTATT ATCACCAGAAAAATCCTGATCAATGAAGACGTTATAGCCCAACATGTTTGCAGGAAGGAAAAAACGCTGA CCCGCACCTAAATTTGCCGTAAAGCGGGAGTCAATGTAACGCGCTCCGACCTGACCAAATGCCAGCATTT TTTCGGAATCATAGAACGGTAATAAGAAGTCCAGTGAACTACCGTCAAAGTTATTACCACTCTGCAGATT AACCTCTGCCGTTCCATAATGTTGTAACCAGGCCTGCAACTGTGACGAAGCCTGGTTACCAGCGATACCA AGAGCGGTATCTTTCGCGTAATCGCCGTTCAGAGATCGCGACTGAAGCTGGCTACCGAGACTCGCCGCCT GTTGTGCCGCATAATTTAATGCCTTGTCATCGGTCATGTTGCTTTTGGTCACGTCCGGGGACATTTTAGT CAGTTTATTCGTGTGACCAGCAACACCACCTGCAGCAACAAGAGGTGCCGAACCTAAAAGTGGTAGTGCA CTGTATTCAAAGGGAAGTTTTTTGAGTGGCAAAATGATCTGCTGACCAGGCGCGGCCTTCATCATTTCGC TTTCAGAACTGTATAAATGCTTATTCAACGACCAAATCGTCGATAAATTAATATCTTGCGATTTAGAAAG ATCGGCAACAGTTTCACCAGTTTTCAACGTATAAAAAAGGCGATTCTGATAGCTATCATGAGTTAACAGT TTTGAATCCGAACCCAATTTAAAATAATTTTCACCATTTGCAAATGAATTCTGATTAACATAAAAAAACA ATCCTAAACCAGCACTAAGCATAATCAATGTTTTTTTTAGCTTATGCTTGTGCCGGGTCCGGGTATAACA ACCATGAGTAATCATGTTATGGCTCCACCACAATGAGTTAGAATGAGAAATAAATTATATTAATAGATCG GATTTTATCTTCCGGCGTAATAATGTTTATTGTCGCTTGAACTGATTTCCTCTATTTTCATATGTTCGTT TTCTAATGTTATTCCCTGATTATGTAATACCAAATACAGGTTTTCCATTGACTTAACAACGACTTCTATT TCATTCTCGAGTTTTTCAGGGGTAGCATCATCGAGAGGGAAACGTAACGCTAACAACAGCGATTGTGCTC CAGCCTCATAGCACAGATATGGCCCACCATTCTCTGCAAACCATAAGTTTGCATTCAAAATCTCAAGAGC GAAGTTAGAGTTATCTGTCGGGAATTTCCCACAGACACCATAAATCATCATATATTCGTCATTGGCATCA GATAACGAAATATAATAAATTTCATCAATAGCAAAAGAACACAATCTGTTTTCATTAAATGAAATAGATC CAATACCAATTTTTTCTGCAAATTTTTCTAATAAAAGTTCAGATCTTGATGACATTGTATTTTCTCTTAA TTAAATTTATATTTACAGAAGCTCAAGAGTTGCCCATCCTGCAGCAATGTTATTCCCTGAAAAATTGACG TTAGTTAGACTTCCCCCCTCCCTCCCTCTAAATAAAATGATTATGGATATATTTAGACGAAACGATGGGA TCCCGGCGCTGGTGGGTTATTCGAAGTATTCACAGCGCTATTACTCCCCCCCGTTAATCCTCCCATGTCA TGGCGTAATCCACCACTTAGCGCCAGACGCGCATAAGTGCTTTGAATCCCCGCACTTGGATTTCCTAATA ACCGTGCGCCGTTATCAGTAGTATCCCGGGGAGGATGTTGAATGGTGCTATATACAACAGAATCTGTATT CCCCATATTCTGAACAGACGTATTAGAATTAGAAGTCGGCACCTGCGAATCATGCAGCGATGTTTTAACA TCAGCATACGGATTCTGCACGGTCCCTATGCTGGAAGTGTCAAAGAAAGTCGACGAGGTGCTAGCCATCG .

AGCTACGTCTGCTCTCCATGGTATCTTCTGACCCAGGGGTATCTACATTGCCCTGTGCAGGTGTATTATT TGCAGGCTTATTCTCTACCGTACGTGCGCTTGTAGTTGTAGTTGTAGTAGTTGTTGTTGTTGTTTGTTCT ACCGGCTGATTTTTTCGATGAAGCGCAGCGGTGACGGCAACACCAATTCCCCCACCAAGAATCAATGCGC CACTAAGACCGTAGCCAGCCCCCGATGAAACTTTCAGCTCCTCCTGGCGTTTAGCTTGTTGTTCATCATA TTTTTTTTGCGCCTGAGCATTATTTTCAATGGCTTGCTGTTTGGCCTCTTCGCCTGCTGCTTTAGCCTGC TCTTCTATATTCGCAACAACATCATCTTTCAATACCCCTGACGGAATCGCATTTCCGAGCTCATCGATAT TAACTTTTTGATTATCTGGGTTCTGGAACGCTTCTTTCGTTAACTGATCTCTTGTCGCAGTTTCAGTTGC ACTTGCAGCTGCATCAGGGTCGGTCGTGGTTGGGCTATCCGGCTCCGGCGTCAATGCAAGCGCCTGTACA ATACCCGTCGCCGCCAACCCTATCAGACCTGTAGCAACAGTCCCCAACGCCAACCAAAGTTTAGGATCTG AACGAAGGCTGGAAGTTGAGGTTGAGGTCTGAGTTTCTGTGGTGTTTTCCGCACCGCTATTTGACTCCCT CAACTCCCCAACGCCTTTTGACTCCCCAGCACCTTTGGACTCCCCGGTCCCTTTGGGCTCTAACAGCTCC AGTATCCTTTGGCGGGCTTCCGTGATATCTGAAGCAACGGTGACCATAGCATGCCCAGCACCACCACGGC CTCCAGTAAATACAAATTTGTCTTTACCTTCAGGATCAATGGACTGCAAGCGAGCGTACTCTTGATCACT TAAAACAACAGAGGTCTCAACACCATTCCTCTGACCGACAGCAATATGTTTACCATCTTCCTGAGTTTCA ACTCGAAATACCGAAGAGCCAATCTGCCTGTTAAGAGTATCGAGCGGACCATGATCATGAAGAACTTCAA ATCCATCATTCAGTGTTATCTCAGACGCCGCCAGGCGCATCGGATTTACAGGAAGTCCAGGAACATCACT GGCACGATTGTCGCCAGAATCAGCCATAGAATTCCTTACAGGCGTAAATAGCGCACGAGATCCCAACGGC CCCGTAGAGTTAATGAGCTGACCACGCCCCCCTGCACCGTCGGTTTGTGAAGGTAATGGAGGTGCAGGAG GAATTGAATTATTCACATTGGGATTATGACCAAGATTACCAATAGGCATAAATATCTCCTTTTTATTTTA TGTAAATAGATAACAATCCTTTATTTTGCTATTACATAATAATGTATGGTATACAGCACGTAGTCGATAA ACGGCTGAACATGACATCGACCAAATAAATCACAATCTGATTTTTGATGCAAGAAAATAATGTGCTAAAA ACACACATCGGGTAACAAAATAAAAATAATTATATTATATAAAAGTAAACACCACGTGAAATCTTAATAA AACATTTCATAAATAAAATTGCAGCAAACATTCATTTATATTAAAAAACACAGCCAAAGAAAACCAATTA AGCAAACTATAAATCTTAATTAATAATAAAGTTTATTAAGTTTCTTTATCGCGTTTTTTCTTACATCAAC AAAGGCCATGCTATACACCAGGAAGCTTAATTTATACCTGACAAGGTTATCCCTACAATCGGGTATCCTG TACATGCTCTAAAATCGCATTCTGAGTAATCGCTTTTATCTCACTGACTTTGAAGCCGCTAAAGTTGCGT TCAAATATTTCTTGTGAGACTTGTTCTATCATCTTCGTCTGGGTGTTAAAACGTGTTATTGGATCCACTC TTTTGCCGCACTGCTCATCAACTTTCTGATTAAAGTATTTATTGGACTGCAAGAAGTGACCAATTGATGA TTGTGCCCCGTTCATATCAAGAGGTTGCTGTAACGCATTTTCAACAGCTCTAAAAATGTGACCTTTAGTC TCCTTACTAATGACCGAATTATTACTCCTGCAATAGTCATCCAGAGTTCTATTTACTGTTCTGGATATAT AAGTCGTCTGCTCCTGCTGGAACCATTGTTGGGTATCGCCATTACGAGTTTGTTTGGCTACAGCCTGCAG GAGTTGGTTAGTCAGTTTGCCATGATTAATCACAAAGTTCGACTGCACGGGCATGAACCTCATACCCGTG Primers .

Sign up to vote on this title
UsefulNot useful