Los genes son DNA

ESQUEMA DEL CAPITULO r
-----------------------_/
-
..
-
...
Introduccion
El acido desoxirribonucleico (DNA,
deoxyribonucleic acid) es el material genetico de
las bacterias
• La transformacion bacteriana proporciono la primera prueba
de que el DNA es el material genetico de las bacterias. Las
propiedades genHicas pueden ser transferidas de una cepa
bacteriana a otra extrayendo el DNA de la primera cepa y
afiadiendolo a La segunda.
El DNA es el material genetico de los virus
• La infeccion por fagos demostro que el DNA es el
material genetico de los virus. Cuando el DNA y los
componentes proteinicos de los bacteri6fagos son
marcados con is6topos radioactivos diferentes, solo el DNA
es transmitido a la progenie de fagos producida por las
bacterias infecciosas.
El DNA es el material genetico de las cHulas
animales
• El DNA puede ser utilizado para introducir nuevas
caracteristicas geneticas en celulas ani males 0 en animales
completos.
• En algunos virus, el material genetico es el RNA.
Los polinucleotidos tienen bases nitrogenadas
ligadas a un esqueleto de azucar-fosfato
• Un nucleosido esta formado por una base purica 0
pirimidica ligada a una pentosa (azucar de cinco carbonos)
en la posici6n 1.
• Las posiciones en eL anillo de ribosa se describen con el
simbolo matematico de primo ('), para distinguirlas.
• La diferencia entre el DNA y el RNA radica en el grupo
localizado en la posici6n 2' del azucar. El DNA tiene un azucar
desoxirriboso (2'-H); el RNA tiene un azucar riboso (2'-OH).
• Un nucle6tido consiste en un nucleosido ligado a un grupo
fosfato en la posicion 5' 0 3' de la (desoxi)ribosa.
• Los residuos sucesivos de (desoxi)ribosa de una cadena de
polinucleotidos estan unidos por un grupo fosfato entre La
posicion 3' de un azucar y la 5' del siguiente.
• Un extremo de La cadena (convencionalmente el izquierdo)
tiene una punta 5' libre y, en el otro, la punta libre es 3'.
• El DNA contiene las cuatro bases, adenina, guanina,
citosina y timina; el RNA posee uracilo en vez de timina.
El DNA es una helice dupLex
• La forma Bdel DNA es una helice dupLex formada por dos
cadenas polinucleotidicas que corren de forma antiparalela.
• Las bases nitrogenadas de cada cadena son anillos planos
de purina 0 de pirimidina orientados hacia el interior que
se aparean uno a otro a traves de puentes de hidrogeno
para formar unicamente pares de A-To G-c.
• El diametro de la helice duplex es de 20 A, ademas de una
vuelta completa cada 34 A, con diez pares de bases por vuelta.
• La helice dupLex forma un surco profundo (ancho) y un
surco superficial (angosto).
_ La duplicacion del DNA es semiconservadora
• En el experimento de Meselson-Stahl se utiliz6 marcaje de
densidad para demostrar que la cadena polinucleotidica
individual es la unidad del DNA que se conserva durante la
duplicaci6n.
• Cada cadena de un DNA duplex actua como molde para
sintetizar a una cadena hija.
• Las secuencias de las cadenas hijas estan determinadas por
apareamiento complementario de bases con las cadenas
progenitoras separadas.
lID Las cadenas de DNA se separan en la horquilla de
duplicaci6n
• La duplicacion de DNA es emprendida por un complejo
de enzimas que separan a las cadenas progenitoras y que
sintetizan a las cadenas hijas.
• La horquilla de duplicacion es el punto en el cuallas
cadenas progenitoras se separan.
• La enzimas que sintetizan DNA se denominan DNA
polimerasas; las enzimas que sintetizan RNA son conocidas
como RNA polimerasas.
• Las nucleasas son enzimas que degradan a los acidos
nucleicos; entre otras, DNAsas y RNAsas, que pueden
dividirse en endonucleasas y en exonucleasas.
.. La informacion genetica puede ser proporcionada
por el DNA 0 eL RNA
• Los genes celulares son DNA, pero los virus y los viroides
pueden tener genomas de RNA.
• El DNA se convierte en RNA por transcripcion, y el RNA
puede convertirse en DNA por transcripci6n inversa.
• La traducci6n del RNA a proteinas es unidireccional.
aD Los acidos nucleicos se hibridan por apareamiento
de bases
• El calentamiento provoca que las dos cadenas de un DNA
dLlplex se separen.
• La T
ro
es el punto medio del rango de tem peratura para la
desnaturalizaci 6n.
• Las cadenas complementarias Lmicas pueden renaturalizarse
cuando se reduce la temperatura.
Continua en la siguiente pagina
1
• La desnaturalizaci6n y La renaturaLizacion/hibridacion
pueden ocurrir con combinaciones de DNA-DNA, de
DNA-RNA 0 de RNA-RNA y pueden ser intermoLeculares
o intramoleculares.
• La capacidad de dos preparaciones de acidos nucleicos
de una soLa cadena para hibridarse es indicio de su
complementariedad.
1m Las mutaciones cambian la secuencia del DNA
• Todas las mutaciones consisten en cambios de la
secuencia del DNA.
• Las mutaciones pueden ser espontaneas 0 inducidas
por mutagenos.
... Las rnutaciones pueden afectar a pares de
bases individuales 0 a secuencias mas largas
• Una mutaci6n puntual cambia a un solo par de bases.
• Las mutaciones puntuales pueden ser provocadas
par la conversion qui mica de una base en otra a par
errores durante la duplicacion.
• Una transici6n remplaza a un par de bases G-C par un
par de bases A-To viceversa.
• Una transversion rempLaza a una purina par una
pirimidina, par ejemplo, cambiando A-T aT-A.
• Las inserciones son el tipo mas comun de mutacion,
y son resultado del movimiento de elementos
transponibles.
IIID Los efectos de las mutaciones pueden
ser revertidos
• Las mutaciones primarias desactivan a un gen,
mientras que las inversas (0 retromutaciones) revierten
sus efectos.
III Introducci6n
La naturalez3. hereditaria de todo organismo viviente
es definida por su genoma, el cual consiste en una
secuencia larga de acido nucleico que proporciona
la informaci6n necesaria para construir el organismo.
Se utiliza el termino "informacion" debido a que el
genoma por si mismo no desempefia ninguna fun-
cion activa en la construccion del organismo, mas
bien es la secuencia de las subunidades individuales
(bases) del acido nucleico la que determina las ca-
racteristicas hereditarias. Por una compleja serie de
interacciones, esta secuencia se utiliza para producir
todas las proteinas del organismo en el momenta y
ellugar apropiados. Las protefnas forman parte de
la estructura del organismo 0 tienen la capacidad
de construir estructuras 0 llevar a ca bo las reaccio-
nes metabolicas necesarias para la vida.
El genoma contiene el conjunto completo de
informacion hereditaria para cualquier organismo.
Fisicamente, el genoma puede ser dividido en va-
rias moleculas diferentes de acido nucleico y fun-
cionalmente, en genes. Cada gen es una secuencia
que dentro del acido nucleico representa a una sola
protefna. Cada una de las moleculas de acido nu-
cleico que componen el genoma puede contener
2 CAPITULO 1 Los genes son DNA
• Las inserciones pueden revertirse par deleci6n del
material insertado, pero las deleciones no pueden
revertirse.
• La supresion ocurre cuando una mutacion de un
segundo gen anula el efecto de la mutaci6n del primer
gen.
IIDI Las mutaciones se concentran en puntos
calientes
• La frecuencia de la mutaci6n en cualquier par de bases
en particular depende de fluctuaciones estadisticas,
excepto en los puntos calientes, en Los cuales la
frecuencia se incrementa cuando menos en un orden
de magnitud.
_ Numerosos puntos calientes son resultado
de bases modificadas
• Una causa comun de los puntas calientes es La base
rnodificada 5-metilcitosina, la cual experimenta
desarninacion espontanea y se convierte en tirnina.
1m Algunos agentes hereditarios
son extremadamente pequenos
• Algunos agentes hereditarios rnuy pequeiios no
codifican proteinas, sino que constan de RNA a
proteinas que poseen propiedades hereditarias.
1m Resumen
gran numero de genes. Los genomas de los orga-
nismos vivos pueden contener incluso <500 genes
(como un micoplasma, que es un tipo de bacteria)
0>25 000 en el ser humano.
En este capitulo se analizan las propiedades del
gen en cuanto a su construccion molecular basica.
En la iUkJ' se resumen las etapas de transicion
del concepto historico del gen a la definicion mo-
derna del genoma.
Un genoma consiste en el conjunto completo
de cromosomas de cualquier organismo espedfico, de
modo que comprende una serie de moleculas de aci-
do desoxirribonucleico (DNA, deoxyribonucleic acid)
(una para cada cromosoma), cada una de las cuales
contiene numerosos genes. La principal definicion
de un genoma es deterrninar la secuencia del DNA de
cada cromosoma.
La primera definicion del gen como unidad fun-
cional se derivo del descubrimiento de que cada gen
es responsable de la produccion de proteinas espe-
dficas. La diferencia en las caracteristicas qufmicas
del DNA del gen y su producto protefnico condujo
al concepto de que un gen codifica a una protefna.
A su vez, esto llevo al descubrimiento del aparato
complejo que permite que la secuencia de DNA de
un gen genere la secuencia de aminoacidos de una
protefna.
•.. • .••• J!.
1865 Los genes son lactores particulados
1871 Descubrimiento de los acidos nucleicos
1903 Los cromosomas son las unidades hereditarias
1910 Los genes residen en los cromosomas
1913 Los cromosomas son secuencias lineales
de genes
1927 Las mutaciones son cambios ffsicos en
los genes
1931 La recombinaci6n ocurre por entrecruzamiento
1944 EI DNA es el material genetico
1945 Un gen codilica a una protefna
1951 La primera secuencia protefnica
1953 EI DNA es una helice duplex
1958 EI DNA se replica de forma semiconservadora
1961 EI c6digo genetico esta determinado por tripletes
1977 Los genes de las eucariotas son interrumpidos
1977 Posible secuenciaci6n del DNA
1995 Secuenciaci6n de los genomas bacterianos
2001 Secuenciaci6n del genoma humano
Breve historia de la genHica.
un gen es una secuencia de DNA que codifica a un RNA;
en los genes codificadores de proteinas, el RNA a su vez
codifica a una proteina.
A partir de la demostracion de que un gen con-
siste en DNA y de que un cromosoma consiste en
un tramo largo de DNA que representa a numerosos
genes, se llega a la arganizacion global del genoma
en funcion de su secuencia de DNA. En el Capitulo 3,
El gen interrumpido, se retoma en mas detalle
la organizacion del gen y su representacion en pro-
teinas. En el Capitulo 4, El contenido del genoma, se
analiza el numero total de genes, y en el Capitulo 6,
Agrupamientos y repeticiones, se describen otros
componentes del genoma y el mantenimiento de
su organizacion.
.. El DNA es el material genetico
de las bacterias
Concepto principal
• La transformaci6n bacteriana proporcion6 la primera
prueba de que el DNA es el material genetico de
las bacterias. Las propiedades genHicas pueden ser
transferidas de una cepa bacteriana a otra extrayendo
el DNA de la primera cepa y sumandolo a la segunda.
La idea de que el material genetico es acido nucleico
tiene sus rakes en el descubrimiento de la transfor-
macion, en 1928. La bacteria Pneumococcus mata de
neumonia a los ratones. La virulencia de la bacteria
depende de su polisacarido capsular, componente de
la superficie que permite que la bacteria escape de la
destruccion provocada par su hospedador. Diversos
tipos de Pneumococcus (1, II Yill) tienen polisacaridos
capsulares diferentes; su aspecto es lisa (5, smooth).
Todos los tipos de Pneumococcus lisos puede dar
lugar a variantes incapaces de producir el polisaca-
rido capsular, en cuyo caso, la superficie de la bac-
teria es rugosa (R, rough) ([armada por el material
que estaba debajo del polisacarido capsular). Estas
bacterias son avirulentas, no matan a los ratones
porque la ausencia del polisacarido permite que el
animal destruya a la bacteria.
Cuando par medio de tratamiento calorico se
matan bacterias lisas, pierden la capacidad de danar
al animal, sin embargo, la combinacion de bacte-
rias 5 desactivadas con calor y la variante ineficaz R
produce un efecto considerablemente diferente del
de cada bacteria por separado. En la • se
muestra que cuando se inyectan conjuntamente en
un animal, el raton muere como resultado de una
infeccion por Pneumococcus. Las bacterias 5 virulen-
tas pueden ser recuperadas del raton muerto.
Secuencia de aminoacidos Proteina
RNA Secuencia de nucle6tidos
'IGUR 1" Un gen codifica una molecula de RNA, la cual
codifica una proteina.
Entendiendo el proceso par media del cual un
gen se expresa, permite una definicion mas rigu-
rosa de su naturaleza. En la FT U A 1. se ilustra el
tema basico de esta obra. Un gen es una secuencia
de DNA que produce otro acido nuclei co, el acido
ribonucleico (RNA, ribonucleic acid), que cuenta con
dos cadenas de acido nucleico, mientras que el RNA
tiene una sola. La secuencia del RNA es determina-
da par la secuencia del DNA. (De hecho, es identica
a una de las cadenas de DNA.) En muchos casos,
pero no en todos, el RNA se utiliza a su vez para
dirigir la produccion de una proteina. Por 10 tanto,
DNA Secuencia de nucle6tidos
l
Gen Naturaleza quimica
1.2 El DNA es el material genetico de las bacterias 3
Tipos de Pneumococcus
Inyeccion
de celulas Resultado
formante, se demostr6 que este es acido desoxirri-
bonucleico (DNA, deoxyribonucleic acid).
Ni las bacterias tipo S asesinadas con calor ni las
bacterias tipo Rvivas pueden matar a los ratones, pero la inyec-
cion simultanea de ambos tipos de bacterias puede matar a los
ratones de forma tan efectiva como la bacteria tipo S viva.
/
Sin capsula, ~ Bacteria S muerta
de aspecto ~ y bacteria Rviva
rugosa (R)
M u e r e ~
• La infeccion por fagos demostro que el DNA es el
material genetico de los virus. Cuando el DNA y los
componentes proteinicos de los bacteri6fagos son
marcados con diferentes is6topos radioactivos, s6lo el
DNA es transmitido a la progenie de fagos producida
por las bacterias infecciosas.
Concepto principal
.. El DNA es el material genetico
de los virus
a
a
Vive
Vive
M u e r e ~
Bacteria S viva
Bacteria S muerta
Bacteria R viva
Can capsula,
de aspecto
lisa (S)
\
Bacterias S vivas
recuperadas del
\
raton muerto
Se extrae
el DNA
Wl\VJW/
.......... )
Bacteria R Transformacion Bacteria S
El DNA de la bacteria de tipo S puede transformar
a la bacteria de tipo Ren el mismo tipo S.
En este experimento, las bacterias 5 muertas
fueron de tipo III y las R vivas, de tipo II. La cu-
bierta de las bacterias virulentas recuperadas de la
infeccion mixta era lisa, de tipo III, por 10 tanto,
alguna propiedad de las bacterias 5 tipo III, muertas,
puede transformar a las bacterias R, induciendo la
formacion del polisacarido capsular tipo III, que las
torna virulentas.
En la se muestra la identificacion del
componente de las bacterias muertas responsable de
la transformacion, el cual se denomin6 principio
transformante, que se purific6 desarrollando un
sistema libre de celulas, en donde los extractos de
las bacterias 5 muertas podfan agregarse a las bac-
terias R vivas antes de ser inyectadas al animal. En
1994, mediante la purificacion del principio trans-
Una vez que se comprob6 que el DNA es e) mate-
rial genetico de las bacterias, el siguiente paso fue
demostrar que el DNA proporciona el material ge-
netico en un sistema bastante diferente. El fago T2
es un virus que infecta a la bacteria Escherichia coli.
Cuando las partfculas del fago (virus) se agregan
a las bacterias, estas se adsorben en la superficie
exterior, parte del material entra en la bacteria y, al
cabo de -20 min, cada bacteria explota (se lisa) para
liberar una numerosa progenie de fagos.
En la se ilustran los resultados de un
experimento realizado en 1952 en el cual se infec-
taron bacterias con fagos T2, los cuales habfan sido
marcados radioactivamente en su componente de
DNA (con 32P) 0 en su componente protefnico (con
35
5). Las bacterias infectadas se mezclaron en una
licuadora y dos fracciones se separaron por centrifu-
gaci6n. Una de estas contenfa las cubiertas de fagos
vadas liberadas de la superficial de la bacteria, en
tanto que la otra estaba formada por las bacterias
infectadas. *
Gran parte del marcador 32p se encontro en las
bacterias infectadas. Las partfculas de la progenie de
fagos producidas por la infeccion contenfan - 30%
del marcador 32p original. La progenie recibio una
cantidad muy pequena, menos dell %, de la protef-
na contenida en la poblaci6n original de fagos. Las
cubiertas de fago estaban formadas por protefnas, y
por 10 tanto portaban el marcador radioactivo
35
5.
Asf pues, con este experimento se demostr6 direc-
tamente que s610 el DNA de los fagos progenitores
entra en las bacterias y que despues formara parte
de los fagos de la progenie, exactamente el patron de
herencia que se espera del material genetico.
* N del T: este parrafo implica que los virus fueron marcados en
un componente a en Olro (pero no en los dos). mientras que la
descripci6n de los resultados sugiere que tanto un componente
como el Olro fueron marcados.
4 CAPiTULO 1 Los genes son DNA
. I •
DNA marcado
con
32
p _

• marcada con 35S
Adici6n de DNA TK+
Las celulas que carecen del gen TK no pueden
producir timidina cinasa y mueren sin timidina
Colonia
de celulas TK+
Algunas celulas incorporan al gen TK; los descendientes
de una celula sometida a transfecci6n se agrupan en una colonia
Las bacterias
inlectadas
contienen
70% del
marcador 32p
Los fagos de la
progenie
tienen 30% del
marcador 32p
y <1% del
\. marcador 35S
I
Se separan las cubiertas de los
lagos de la bacteria infectada
J\J'l-
A

1
Las cubiertas de
los lagos contienen I
80% del marcador Se afslan las partlculas
35S de la progenie de lagos

Se inlecta a la bacteria con
lagos marcados.
t Lt
lGURA 1 5 El material genetico del fago T2 es el DNA. 1 f Las celulas eucariotas pueden adquirir un fenotipo
nuevo como resultada de la transfecci6n par adici6n de DNA.
Un fago se reproduce ordenando ala maquina-
ria de una celula hospedadora infectada que pro-
duzca mas copias de sf misma. El fago posee ma-
terial genetico cuyo comportamiento es analogo al
de los genomas celulares: sus rasgos son fielmente
reproducidos y estan sujetos a las mismas reglas que
gobiernan la herencia. El caso de los T2 refuerza la
conclusion general de que el material genetico es
el DNA, ya sea que forme parte del genoma de una
celula 0 de un virus.
III El DNA es el material genetico
de las celulas animales
Conceptos principales
• El DNA puede ser utilizado para introducir nuevas
caracteristicas genHicas en celulas ani males 0 en
ani males completos.
• En algunos virus, el material genetico es RNA.
Cuando se agrega DNA a poblaciones de celulas eu-
cariotas individuales en cultivo, el acido nucleico
entra a las celulas, 10 cua!, en algunas, resulta en la
produccion de protefnas nuevas. Cuando se utiliza
DNA purificado, su incorporacion da lugar a la pro-
duccion de una protefna en particular. En la
se representa uno de los sistemas estandar.
Aunque por razones historicas estos experi-
memos se describen como transfeccion cuando
son realizados con celulas eucariotas, constituyen
una contraparte directa de la transformacion baete-
riana. El DNA introducido en la celula receptora se
incorpora a su material genetico y es heredado en la
misma forma que cualquier otra parte. Su expresion
confiere un nuevo rasgo a las celulas (sfntesis de
timidina-cinasa en el ejemplo de la Figura 1.6). En
un principio, estos experimentos solo tuvieron exito
con celulas individuales adaptadas para crecer en un
media de cultivo, pero desde entonces, el DNA ha
sido introducido en ovulos de raton por microin-
yeccion, y puede llegar a ser una parte estable del
material genetico del animal.
Dichos experimemos muestran directamente
no solo que el DNA es el material genetico de las
eucariotas, sino tambien, que puede ser transferido
entre especies dlferentes y seguir siendo funcional.
El material genetico de todos los organismos
conocidos y de numerosos virus es el DNA. No
obstante, algunos virus usan un tipo alternativo de
acido nucleico, el ribonucleico (RNA, ribonucleic acid),
como material genetico. El principia general de la
naturaleza del material genetico, par 10 tanto, es
que siempre es acido nucleico; de hecho, es DNA,
excepto en los virus de RNA.
1.4 El DNA es el material genHico de las celulas ani males 5
III Los polinucle6tidos tienen
bases nitrogenadas ligadas a
un esqueleto de azucar-fosfato
Conceptos principales
• Un nucle6sido esta formado por una base purica 0
pirimidica ligada a un azucar pentosa en la posici6n 1.
• las posiciones en el anillo de ribosa se describen con
el simbolo (') para distinguirlas.
• la diferencia entre el DNA y el RNA radica en el grupo
localizado en la posici6n 2' del azucar. El DNA tiene un
azucar desoxirribosa (2' -H) Yel RNA, un azucar ribosa
(2'-OH).
• Un nucle6tido consta de un nucle6sido ligado
a un grupo fosfato en la posici6n 5' 0 3' de la
(desoxi)ribosa.
• los residuos sucesivos de (desoxi)ribosa de un
polinucle6tido estan unidos por un grupo fosfato
entre la posici6n 3' de un azucar y la posici6n 5' de la
siguiente.
• Un extremo de la cadena (convencionalmente el
Izquierdo) tiene una punta 5' libre y en el otro, una
punta 3' libre.
• El DNA contiene las cuatro bases, adenina, guanina,
citosina y timina; el RNA posee uracHo en vez de
timina.
El componente basico de los acidos nucleicos es el
nucle6tido, que tiene tres componentes:
• una base nitrogenada,
• un azucar y
• un fosfa to.
La base nitrogenada es un anillo de purina 0 de
pirimidina. La base esta ligada a la posici6n 1 en una
pentosa por medio de un enlace glucosfdico del N
J
de las pirimidinas 0 el N
g
de la purinas. Para evitar
ambiguedades entre los sistemas de numeraci6n de
los anillos heterocfclicos y del azucar, a las posicio-
nes de la pentosa se agrega un sfmbolo (').
Los acidos nucleicos son nombrados segun el
tipo de azucar que eontienen; el DNA posee 2' -des-
oxirribosa, mientras que el RNA tiene ribosa.La di-
ferencia radica en que el azucar del RNA tiene un
grupo OR en la posiei6n 2' del anillo de pentosa. El
azuear puede ligarse en las posiciones 5' 0 3' a un
grupo fosfato.
Un aeido nucleico consiste en una cadena larga
de nucle6tidos. En la 'IGlJF: ~ se muestra que el
esqueleto de la cadena polinucleotfdiea consta de
series alternas de residuos de fosfato y de pentosa
(azuear) a traves de la uni6n de la posici6n 5' de
un anillo de pentosa con la posici6n 3' del siguiente
anillo de pentosa mediante un grupo fosfato. Por
6 CAPITULO 1 Los genes son DNA
eso se dice que el esqueleto de azucar-fosfato con-
siste en enlaces 5'- 3' fosfodiester. Las bases nitro-
genadas "sobresalen" del esqueleto.
Cada acido nucleico contiene cuatro tipos de ba-
ses. Las mismas dos purinas, adenina y guanina, estan
presentes tanto en el DNA como en el RNA. Las dos
piriruidinas del DNA son dtosina y timina; en el RNA
se encuentra uracilo, en vez de timina. La unica dife-
rencia entre el uracHo y la timina es un grupo metilo
suplantador en la posicion C
5
. Las bases suelen nom-
brarse par sus iniciales. El DNA contiene A, G, CYT;
el RNA contiene A, G, C YU.
El nucleotido terminal de un extrema de la ca-
dena tiene un grupo 5' libre; el nucleotido terminal
del otro extrema tiene un grupo 3' libre. Se ha con-
venido en escribir las secuencias de acido nucleico
en direccion 5' a 3', es decir, del extremo 5' de la
izquierda al extrema 3' de la derecha.
III El DNA es una helice duplex
Conceptos principales
• la forma Bdel DNA es una helice duplex formada por
dos cadenas polinucleotidicas antiparalelas.
• las bases nitrogenadas de cada una son anillos planos
de purina 0 pirimidina orientados hacia el interior y
que se aparean mediante puentes de hidr6geno para
formar unicamente pares de A-TYG-c.
• El diametro de la helice duplex es de 20 A, y cada 34 A
hay una vuelta completa, con diez pares de bases por
vuelta.
• La helice duplex forma un surco principal profundo
(ancho) y uno menor (angosto).
La observacion de que las cantidades de bases pre-
sentes en los DNA varfa segun la especie, condujo
al concepto de que la secuencia de bases es la forma en
que se porta la informacion genetica. Hacia la decada de
1950, el concepto de informacion genetica era co-
mun: el par de problemas que planteaba era determi-
nar la estructura del acido nucleico y explicar como
una secuencia de bases del DNA podia representar la
secuencia de aminoacidos de una proteina.
Tres nociones convergieron en la construccion
de un modelo de helice duplex del DNA, desarro-
llado por Watson y Crick en 1953:
• Los datos de la difraccion de los rayos X de-
mostraron que el DNA tiene la forma de una
helice regular que da un giro completo cada
34 A(3.4 nm), can un diametro de -20 A
(2 nm). Como la distancia entre nucleotidos
adyacentes es de 3.4 A, debe haber 10 nu-
cleotidos par vuelta.
Los !ostatos
tienen cargas
negativas
Base pirimfdica
Base puriea
DNA,

Enlaces
fosfodiester 5'-3'
Puentes de hidr6geno 3'
. H I
/ 0
5' H3C 0-- H-N NyH'rl

N-{ )=N 0
o H
HJ-H"O N H d"
o o'
N-{, rN
o-·H-N
\
H
H 0
N=<, }-N
.
_a_ZD_ca_r'_fO_Sf_at_or . H'" N - '0:-q C
3
.
N-H--'O
0-:
N=< }-N
o N-\.G C)-H 0
K 5'
o H N O--·H-N H
\ "H
3' EI interior es hidr6fobo
La helice duplex mantiene un grosor constante porque las
purinas siempre enfrentan a la pirimidinas en los pares de bases com-
plementarios A-TYG-c. La secuencia que se ilustra en la figura es T-A,
CoG, A-T, G-C.
Una cadena polinucleotidica esta formada por una
serie de enlaces azucar-fosfato 5'-3' que forman un esqueleto
con las bases prominentes.
• La densidad del DNA sugiere que la helice
debe contener dos cadenas de polinuc1eo-
tidos. EI diametro constante de la helice
puede explicarse si las bases de cada cadena
apuntan hacia adentro y son restringidas de
manera que una purina siempre se oponga
a una pirimidina, evitando asociaciones pu-
rina-purina (demasiado ancha) 0 pirimidi-
na-pirimidina (demasiado angosta).
• Independientemente de las cantidades ab-
solutas de cada base, la proporcion de G es
siempre igual a la de C en el DNA, y la pro-
porcion de A siempre es la misma que la de
T, de manera que la composicion de cual-
quier DNA puede describirse par la propor-
cion de sus bases, es decir, G+ C, que fluctua
entre 26 y 74% en diferentes especies.
Watson y Crick propusieron que las dos cadenas
polinucleotfdicas de la helice duplex se relacionan
mediante puentes de hidr6geno entre las bases nitroge-
nadas. La G puede formar puentes de hidrogeno
especfficamente solo con la C, y la A, solo can la T.
Estas reacciones se describen como apareantiento
de bases, y se dice que las bases apareadas (G con
C a A can T) 'son complementarias.
EI modelo proponfa que las dos cadenas polinu-
cleotfdicas corren en direcciones opuestas (antipa-
ralelas), como se ilustra en la . Observan-
do a 10 largo de la helice, una cadena va en direccion
5' a 3', mientras que su pareja carre de 3' a 5'.
EI esqueleto de aZllcar-fosfato esta en la parte
exterior y porta cargas negativas en los grupos fos-
fato. En solucion in vitro, las cargas del DNA se neu-
tralizan por la union de iones metalicos, tfpicamente
Na+. En la celula, las protefnas con carga positiva
proporcionan parte de la fuerza neutralizante. Estas
protefnas desempefian una funcion importante en
la determinacion de la organizacion del DNA en la
cetula.
Las bases se encuentran en el interior; son es-
tructuras planas, en pares perpendiculares al eje de
la helice. Considerese la helice dllplex como una
escalera espiral: los pares de bases forman los es-
calones, como se ilustra esquematicamente en la
J:IGUR 1 J. Al ir avanzando por la helice, las bases
estan una sobre otra, como una pila de platos.
Cada par de bases gira - 36° en tomo al eje de la
helice, respecto del siguiente par de bases, de modo
que -10 pares de bases forman una vuelta completa
de 360°. La torsion de las cadenas sabre sf mismas
forma una helice duplex can un surco menor (-12
Ade ancho) y un surco mayor (-22 Ade ancho),
como puede observarse en el modelo a escala de
la FICURA 1.10. La helice duplex es dextrogira, es
decir, que gira en la direccion de las manecillas del
1.6 El DNA es una helice duplex 7
Azucar Base Fosfato
reloj observada a 10 largo del eje helicoidal. Estas
caracterfsticas representan el modelo aceptado para
10 que se conoce como forma B del DNA.
Es importante percatarse de que la forma B re-
presenta un promedio, no una estructura especifica-
da con toda precision, pues la estructura del DNA
puede cambiar localmente. Si tiene mas pares de
bases por vuelta se dice que esta sobregirada, de 10
contrario, sera laxa. La torcion local puede ser afec-
tada pOI la conformacion global de la helice duplex
del DNA en el espacio 0 por la union de proteinas
en sitios especificos.
III La duplicaci6n del DNA
es semiconservadora
, Los pares de bases planos yacen perpendicular-
mente al esqueleto de azucar-fosfato.
Las dos cadenas del DNA forman una helice du-
plex. Fotografia © Photodisc.
8 CAPITULO 1 Los genes son DNA
Conceptos principales
• En el experimento de Meselson-Stahl se utiliz6
marcaje de densidad para demostrar que la cadena
polinucleotidica individual es la unidad del DNA que se
conserva durante la duplicaci6n.
• Cada cadena de un DNA duplex (0 DNA duplohelicoidal,
DNA de doble cadena a DNA de doble banda) hace las
veces de molde para sintetizar una cadena hija.
• Las secuencias de las cadenas hijas dependen del
apareamiento complementario de las bases con las
cadenas progenitoras separadas.
Es crucial que el material genetico se reproduzca
con exactitud. Las dos cadenas polinucleotidicas es-
tan unidas solo por puentes de hidrogeno, de mo.do
que pueden separarse sin necesidad de romper en-
laces covalentes. La especificidad del apareamien-
to de bases sugiere que cada una de las cadenas
progenitoras separadas puede hacer las veces de
cadena molde para la sfntesis de una cadena hija
complementaria. En la A se representa el
principio de que una nueva cadena hija es ensam-
blada en cada cadena progenitora. La secuencia de
la cadena hija es dictada por la cadena progenitora;
una A en la cadena progenitora ocasiona la coloca-
cion de una Ten la cadena hija, en tanto que una G
progenitora provoca la incorporacion de una Chija,
y asf sucesivamente.
En la parte superior de la Figura 1.11 se mues-
tra un duplex progenitor (no replicado) formado
por las dos cadenas progenitoras originales. La parte
inferior muestra las dos duplex hijas que estan sien-
do producidas por el apareamiento complementario
de bases. Cada una de las duplex hijas es identica
en secuencia original y contiene una cadena proge-
nitora y una cadena recientemente sintetizada. La
- • to
La duplicaci6n del DNA es semiconservadora. IRA 1.
.1' I I
..
I . .... . ...
DNA progenitor Generaci6n 1 Generaci6n 2
Duplicaci6n
en media ----<: HIBRIDO
de densidad .
Ii''''=<HIBRIDO \.'O'iDiU
\/j\f,V/ L1GERO
PESADO
'W't'O\Y/----<: L1GERO
HIBRIDO
Analisis de densidad
HIBRIDO
.
- - - - .Ligero
••••. Ligero --_. Ligero
- - - -. Hfbrido ._. Hfbrido • -_. H[brido
--··Pesado - - - -. Pesado - - - -. Pesado
....


.... (C). I

Lascadenas
- progenltoras _...- ('f)T,-{
se desenrollan

v----©. C -If.. .
'i' _.:.. y y .
.nn...

...
1 1 El apareamiento de bases proporciona el meca-
necesario para la duplicaci6n del DNA.
del DNA porta fa informacion necesaria para
su secuencia.
Las consecuencias de este modo de duplicacion
5-e ilustran en la . El duplex progenitor
replica para formar dos duplex hijos, cada uno de
. ') cuales esta formado por una cadena progenitora
.. una cadena hija (de sfntesis reciente). La unidad
..;:.e se conserva de una generacion a fa siguiente es una de
dos cadenas individuafes que forman ef duplex proge-
':':"7. Este comportamiento se conoce como dupli-
;::adon semiconservadora.
En la Figura 1.12 se Hustra una prediccion de
=-:e modelo. Si el DNA progenitor porta un mar-
de densidad "pesada" porque el organismo ha
_io cultivado en un medio que contiene un isotopo
(como 15N) (N del T: en otras bibliogra-
.:::.=.- aparece como N
15
, el resto de los marcadores
=z:lCionados en este capitulo tambien aparecen con
= lllimero despues de la letra p. ej., p32 y S35), sus
2denas pueden ser distinguidas de las sintetizadas
cando el organismo es transferido a un medio que
- isotopos "ligeros" normales.
£1 DNA progenitor consiste en un duplex de dos
2':::enas pesadas (rojas). Despues de una generacion
_z crecimiento en medio ligero, el DNA duplex es
'JUijrido" en cuanto densidad. 0 sea que esta forma-
_ ' par una cadena progenitora pesada (roja) y por
cadena hija ligera (azul). Despues de la segunda
==-;::.eracion, las dos cadenas de cada duplex hfbrido
;: separado. Cada una adquiere a una pareja
de tal forma que la mitad de los DNA d{lplex
Cadena hija /
\ Cadena hija
siguen siendo hfbridos y la otra mitad es completa-
mente ligera (ambas cadenas son azules).
Las cadenas individuales de estos duplex son comple-
tamente pesadas a compfetamente ligeras. Este patron se
confirmo experimentalmente en la prueba de Me-
selson-Stahl en 1958, que siguio a la duplicacion
semiconservadora del DNA a traves de tres genera-
ciones de crecimiento de E. coli. Cuando el DNA fue
extrafdo de las bacterias y su densidad se midio por
centrifugacion, el DNA forma bandas correspon'
dientes a su densidad, pesada en las progenitoras,
hfbrida en la primera generacion, y mitad hlbrida y
mitad ligera en la segunda generacion.
III Las cadenas del DNA se separan
en la horquilla de duplicaci6n
Conceptos principaLes
• La duplicaci6n del es llevada a cabo par un
complejo de enzimas que separan las cadenas
progenitoras y sintetizan las cadenas hijas.
• La horquilla de duplicaci6n es el punta en que se
separan las cadenas progenitoras.
• Las enzimas que sintetizan el DNA se llaman DNA
pol.i merasas; las enzi mas que si ntetizan el RNA se
conacen como RNA polimerasas.
• Las nucleasas son enzimas que degradan a los acidos
nucleicos; incluyen DNAsas y RNAsas, y pueden
dividirse en endonucleasas y en exonucleasas.
La duplicacion exige la separacion de las dos cade-
nas de un d{lplex progenitor; sin embargo, el rom-
pimiento de la estructura es transitorio, y se revierte
conforme se forma el duplex hijo. En algun mo-
1.8 Las cadenas del DNA se separan en la horquilla de duplicaci6n 9
do sintetizada. Las enzimas se nombran segun el
tipo de cadena que sintetizan: las DNA polimera-
sas sintetizan DNA, las RNA polimerasas, RNA.
La degradacion de los acidos nucleicos tambien re-
quiere de enzimas especfficas: las desoxirribo-
nucleasas (DNAsas) degradan alDNAy las ribonu-
cleasas (RNAsas) degradan al RNA. Las nucleasas
se incluyen en las clases generales de exonuclea-
sas y endonucleasas:
• Las endonucleasas cortan enlaces individua-
les en el interior de las moleculas de DNA y
de RNA y generan fragmentos discretos. Al-
gunas DNAsas dividen ambas cadenas de un
DNA duplex en el sitio diana, mientras que
otras dividen solo una de ellas. Las endo-
nucleasas participan en reacciones de corte,
como se observa en la FIGURA 1 14.
• Las exonucleasas eliminan los residuos, uno
a uno, a partir del extrema de la molecula, y
generan mononucleotidos. Siempre actuan
en una sola cadena de acido nucleico, y cada
exonucleasa avanza en una direccion especf-
fica, es decir, empieza en un extrema 5' 0 3'
para dirigirse hacia el otro. Estan involucra-
das en reacciones de ajuste, como se muestra
en la v
w
-.• l.-.fo:lli:.r••• r:..1.l li,r,
-. ",""__ L...-.II __ .,.....:.1 III r.
Enlace roto

I. Una endonucleasa divide a un enlace en un acido
nucleico. En este ejemplo se muestra una enzima que ataca a
una cadena de un DNA duplex.
--+-
:.):Ct
La horquilla de duplicaci6n es la regi6n del DNA
en la cual hay una transici6n del duplex progenitor desenrolla-
do a los duplex hijos recientemente replicados.
..-...
Una exonucleasa elimina bases, una a la vez,
dividiendo el ultimo enlace de una cadena polinucleotidica.
III
La informacion genetica puede
ser proporcionada por el DNA
o el RNA
Conceptos principales
mento, solo un tramo pequeno del DNA duplex se
separa en cadenas individuales.
La estructura helicoidal de una de
DNA dedicada a la duplicacion se ilustra en la
.\ . La region no replicada es el duplex proge-
nitor que se abre hacia la region replicada, donde
se han formado los dos duplex hijos. La estructura
helicoidal doble se rompe en la union entre las dos
regiones, llamada horquilla de duplicacion. La
duplicacion implica el movimiento de la horqui-
lla de duplicacion a 10 largo del DNA progenitor, de
modo que hay un desenrollamiento continuo de las
cadenas progenitoras y un enrollamiento de los du-
plex hijos.
La sfntesis de acidos nucleicos es catalizada por
enzimas especfficas, las cuales reconocen el molde
y emprenden la tarea de catalizar la adicion de sub-
unidades a la cadena polinucleotidica que esta sien-
• Los genes celulares son DNA, pero los virus y los
viroides pueden tener genomas de RNA.
• El DNA se convierte en RNA por transcripci6n, y el RNA
puede convertirse en DNA por transcripci6n inversa.
• La traducci6n del RNA a proteina es unidireccional.
El dogma central define el paradigma de la biologfa
molecular. Los genes se perpetllan como seCl1encias
de acido nucleico, si bien actuan al ser expresados
en forma de proteinas. La duplicacion es respon-
sable de la herencia de la informacion genetica. La
transcripcion y la traduccion son responsables de la
conversion de una forma a otra.
En la 1\, 1 16 se ilustran las funciones de la
duplicacion, la transcripcion y la traduccion desde
la perspectiva del dogma central:
• La perpetuaci6n del dcido nucleico suele implicar
al DNA 0 el RNA como el material genhico. Las
celulas utilizan unicamente DNA, en tanto
que algunos virus usan RNA, y la duplica-
10 CAPITULO 1 Los genes son DNA
/
Proteina
Molde de doble
cadena --< J.(j Cadena antigua
J- Cadenasnuevas
'YJy} Cadena antigua
La duplicaci6n genera dos duplex hijos, cada uno de los
cuales contiene una cadena progenitora y una cadena
fabricada recientemente
Molde de cadena
individual
VV\---+ YRfR{
'IVV --.VV\
Transcripci6n
inversa
·
·
·
..........
-<- ••••••• ".
@ RNA
Duplicaci6n
at
Duplicaci6n
1 7 Los acidos nucleicos, tanto los de dobLe cadena
como los de cadena individuaL, se replican por la sintesis de
cadenas compLementarias regida par las reg las del apareamien-
to de bases.
GURA 1.16 El dogma centraL manifiesta que La informa-
:ion deL acido nucleico puede ser perpetuada 0 transferida,
-in embargo La transferencia de la informacion a proteinas es
'rreversibLe.
La cadena progenitora individual
es utilizada para sintetizar una
cadena complementaria
La cadena complementaria es
utilizada para sintetizar una copia
de la cadena progenitora
cion del RNA vfrico ocurre en la celula in-
fectada.
• La expresion de la informacion genetiea eelular
suele ser unidireeeionai. La transcripcion del
DNA genera moleculas de RNA que uniea-
mente pueden ser utilizadas otra vez para
generar secuencias de protefnas; en general
no pueden recuperarse para usarlas como
fuente de informacion genetica. La traduc-
cion del RNA a protefna siempre es irrever-
sible.
Estos mecanismos son igualmente efectivos
. ara la informacion genetica celular de procario-
:35 0 eucariotas y para la informacion transportada
;Jor los virus. Los genomas de todos los organismos
-ivos estan formados por DNA duplex. Los virus
. seen genomas de DNA 0 RNA, Yde cada tipo hay
de doble cadena (ds, double stranded) 0 de
.::adena unica (ss, single stranded). Los detalles del
=:Iecanismo de replicacion del acido nucleico varian
=:::nre los diferentes sistemas vfricos, pero el princi-
;-:0 de duplicacion por slntesis de cadenas comple-
:::lentarias sigue siendo el mismo, seglll1 se ilustra
la FIGURA 1.1 .
Los genomas celulares reproducen el DNA por
0:. mecanismo de duplicacion semiconservadora. Los
vfricos de doble cadena, sean de DNA 0
::t: A, tambien se replican utilizando como molde
-.as cadenas individuales del duplex para sintetizar
.31 las cadenas complementarias.
Los virus con genomas de una sola cadena la
_:ilizan como molde para sintetizar una cadena
.:amplementaria, la cua!, a su vez, es utilizada para
sintetizar a su complemento, que, por supuesto, es
identico a la cadena original inicial. La duplicacion
puede implicar la formacion de intennediarios es-
tables de doble cadena 0 uti}izar acido nucleico de
doble cadena solo como una fase transitoria.
La restriccion de la transferencia unidireccional
de DNA a RNA no es absoluta, ha sido superada por
los retrovirus, cuyos genomas estan formados por
moleculas de RNA de una sola cadena. Durante el
ciclo infeccioso, el RNA se convierte en una cadena
{ll1ica de DNA por el proceso de transcripcion in-
versa; dicha cadena, a su vez, es convertida en un
DNA de doble banda. Este DNA duplex se convier-
te en parte del genoma de la celula y es heredado
como cualquier otro gen, de manera que la transerip-
cion inversa permite que una seeueneia de RNA sea reeu-
perada y utilizada como informacion genetiea.
La existenciC! de la duplicacion del RNA y de la
transcripcion inversa establece el principia general
de que la informacion en eualquier tipo de seeuencia de
dcido nucleieo puede eonvertirse en el otro tipo. Sin em-
bargo, en el curso normal de los hechos, la celula
depende de los procesos de duplicacion, transcrip-
cion y traduccion del DNA. No obstante, alguna
vez la informacion de un RNA celular se convierte
en DNA y se inserta en el genoma (evento posi-
blemente mediado par un virus RNA). Aunque la
transcripcion inversa no participa en las operaciones
regulares de la celula, llega a ser un mecanismo po-
tencialmente importante cuando se analiza la evo-
lucion del genoma.
1.9 La informacion genetica puede ser proporcionada por el DNA 0 eL RNA 11
'li'IJ...,,{.lIr:.r.I •••
La horquilla de duplicaci6n es la regi6n del DNA
en la cual hay una transici6n del duplex progenitor desenrolla-
do a los duplex hijos recientemente replicados.
do sintetizada. Las enzimas se nombran segun el
tipo de cadena que sintetizan: las DNA polimera-
sas sintetizan DNA, las RNA polimerasas, RNA.
La degradacion de los acidos nucleicos tambien re-
quiere de enzimas especificas: las desoxirribo-
nucleasas (DNAsas) degradan al DNAy las ribonu-
cleasas (RNAsas) degradan al RNA. Las nucleasas
se incluyen en las clases generales de exonuclea-
sas y endonucleasas:
• Las endonudeasas cortan enlaces individua-
les en el interior de las moleculas de DNA y
de RNA y generan fragmentos discretos. Al-
gunas DNAsas dividen ambas cadenas de un
DNA duplex en el sitio diana, mientras que
otras dividen solo una de ellas. Las endo-
nudeasas participan en reacciones de corte,
como se observa en la FIGURA 1 14.
• Las exonucleasas eliminan los residuos, uno
a uno, a partir del extrema de la molecula, y
generan mononucleotidos. Siempre actuan
en una sola cadena de acido nucleico, y cada
exonucleasa avanza en una djreccion especi-
fica, es decir, empieza en un extrema 5' 0 3'
para dirigirse hacia el otro. Estan involucra-
das en reacciones de ajuste, como se muestra
en la ".1" n 1
w
••l''J'
--...
"l .. l'
.r-."-.. .. Ul' -.r-.-.;.lilItr.
-••IL.li.
Una endonucleasa divide a un enlace en un acido
nuclei co. En este ejemplo se muestra una enzima que ataca a
una cadena de un DNA duplex.
'1
Moleculas de DNA repllcadas ,
Horquilla de duplicaci6n
Enlace rota

....-.
Una exonucleasa elimina bases, una a la vez,
dividiendo el ultimo enlace de una cadena polinucleotidica.
III
La informacion genetica puede
ser proporcionada por el DNA
o el RNA
Conceptos principales
mento, solo un tramo pequeno del DNA duplex se
separa en cadenas individuales.
La estructura helicoidal de una molecula de
DNA dedicada a la duplicacion se ilustra en la
. La region no replicada es el duplex proge-
nitor que se abre hacia la region replicada, donde
se han formado los dos duplex hijos. La estructura
helicoidal doble se rompe en la union en tre las dos
regiones, Hamada horquilla de duplicacion. La
duplicacion implica el movimiento de la horqui-
lla de duplicacion a 10 largo del DNA progenitor, de
modo que hay un desenrollamiento continuo de las
cadenas progenitoras y un enrollamiento de los du-
plex hUos.
La sintesis de acidos nucleicos es catalizada por
enzimas especificas, las cuales reconocen el molde
y emprenden la tarea de catalizar la adicion de sub-
unidades a la cadena polinucleotidica que esta sien-
• Los genes celulares son DNA, pero los virus y los
viroides pueden tener genomas de RNA.
• El DNA se convierte en RNA por transcripci6n, y el RNA
puede convertirse en DNA por transcripci6n inversa.
• La traducci6n del RNA a proteina es unidireccional.
El dogma central define el paradigma de la biologia
molecular. Los genes se perpetuan como secliencias
de acido nucleico, si bien actuan al ser expresados
en forma de protefnas. La duplicacion es respon-
sable de la herencia de la informacion genetica. La
transcripcion y la traduccion son responsables de la
conversion de una forma a otra.
En la GI 1 se ilustran las funciones de la
duplicacion, la transcripcion y la traduccion desde
la perspectiva del dogma central:
• La perpetuaci6n del dcido nucleico suele implicar
al DNA 0 el RNA como el material genitico. Las
celulas utilizan unicamente DNA, en tanto
que algunos virus usan RNA, y la duplica-
10 CAPITULO 1 Los genes son DNA
---
Proteina
Cadena antigua
} Cadenas nuevas
r Cadena antigua
Molde de doble --:"Il
YJ\YAy
Molde de cadena
individual
VV\---. YJWR{
'IVV -+VV\
La duplicaci6n genera dos duplex hijos, cada uno de los
cuales contiene una cadena progenitora y una cadena
fabricada recientemente
Transcripci6n
inversa
..
.
..........
.............
.
RNA
@' Wl\l{/ DNA
Duplicaci6n
@
Duplicaci6n
• 1 Los acidos nucleicos, tanto los de doble cadena
como los de cadena individual, se replican por la sintesis de
cadenas complementarias regida por las reg las del apareamien-
to de bases.
URA 1.16 El dogma central manifiesta que la informa-
:" n del acido nucleico puede ser perpetuada 0 transferida,
:'a embargo la transferencia de la informacion a proteinas es

La cadena progenitora individual
es utilizada para sintetizar una
cadena complementaria
La cadena complementaria es
utilizada para sintetizar una copia
de la cadena progenitora
cion del RNA virico ocurre en la c€lula in-
fectada.
• La expresion de la informacion genetiea eelular
suele ser unidireecional. La transcripcion del
DNA genera moleculas de RNA que {tniea-
mente pueden ser utilizadas otra vez para
generar secuencias de proteinas; en general
no pueden recuperarse para usarlas como
fuente de informacion genetica. La traduc-
cion del RNA a protelna siempre es irrever-
sible.
Estos mecanismos son igualmente efectivos
- a la informacion genetica celular de procario-
.0.5 0 eucariotas y para la informacion nansportada
r los virus. Los genomas de todos los organismos
:"os estan formados por DNA dllplex. Los virus
een genomas de DNA 0 RNA, Yde cada tipo hay
mplos de doble cadena (ds, double stranded) 0 de
unica (ss, single stranded). Los detalles del
-ecanismo de replicacion del acido nucleico varian
::::me los diferentes sistemas viricos, pero el princi-
.0 de duplicacion por sintesis de cadenas comple-
.entarias sigue siendo el mismo, segun se Hustra
:: , la FIGURA 1.17.
Los genomas celulares reproducen el DNA por
mecanismo de duplicacion semiconservadora. Los
vfricos de doble cadena, sean de DNA 0
- -A, tambien se replican utilizando como molde
= cadenas individuales del d{lplex para sintetizar
las cadenas complementarias.
Los virus con genomas de una sola cadena la
__ como molde para sintetizar una cadena
::cmplementaria, la cual, a su vez, es utilizada para
sintetizar a su complemento. que, por supuesto, es
identico a la cadena original inicia1. La duplicacion
puede implicar la formacion de intermediarios es-
tables de doble cadena 0 utilizar acido nueleico de
doble cadena solo como una fase transitoria.
La restriccion de la transferencia unidireccional
de DNA a RNA no es absoluta. ha sido superada por
los retrovirus, cuyos genomas estan formados por
moleculas de RNA de una sola cadena. Durante el
cielo infeccioso, el RNA se convierte en una cadena
{mica de DNA por el proceso de transcripci6n in-
versa; dicha cadena, a su vez, es convertida en un
DNA de doble banda. Este DNA d{lplex se convier-
te en parte del genoma de la celula y es heredado
como cualquier otro gen, de manera que la transerip-
cion inversa permite que una seeueneia de RNA sea reeu-
perada y utilizada como informacion genetiea.
La de la duplicacion del RNA y de la
transcripcion inversa establece el principio general
de que la informacion en eualquier tipo de seeueneia de
Cicido nucleieo puede eonvertirse en el otro tipo. Sin em-
bargo, en el curso normal de los hechos, la celula
depende de los procesos de duplicacion, transcrip-
cion y traduccion del DNA. No obstante, alguna
vez la informacion de un RNA celular se convierte
en DNA y se inserta en el genoma (evento posi-
blemente mediado por un virus RNA). Aunque la
transcripcion inversa no participa en las operaciones
regulares de la celula, llega a ser un mecanismo po-
tencialmente importante cuando se analiza la evo-
lucion del genoma.
1.9 La informacion genetica puede ser proporcionada por el DNA 0 el RNA 11
" f'. W
U
u t r a ~ 4 ' C"R"'au·II"Ui"Ui'J(S'z"j'ruu·'i'f;''-'VJu,-
Genoma Numero de genes Pares de bases
Organismos
Plantas <50 000 <10
11
Mamiferos 30 000 -3 X 10
9
Gusanos 14 000
_10
8
Moscas 12 000 1.6 x 10
8
Hongos 6 000 1.3 x 10
7
Bacterias 2-4 000 <10
7
Micoplasma 500 <10
6
Virus DNAds
Vaccinia <300 187 000
Papova (SV40) -6 5226
Fago T4 -200 165 000
Virus DNAss
Parvovirus 5 5 000
FagofX174 11 5387
Virus RNAds
Reovirus 22 23 000
.
Virus RNAss
Coronavirus 7 20 000
Influenza 12 13500
TMV 4 6400
Fago MS2 4 3569
STNV 1 1300
Viroides
PSTV RNA a 359
La cantidad de acido nucleico del genoma varia
en un range enorme. ds, doble cadena; 55, cadena unica.
Los mismos principios se aplican a la perpetua-
cion de la informacion genetica tanto en los geno-
mas enormes de plantas 0 anfibios como en los ge-
nomas diminutos del micoplasma y en la informa-
cion genetica aun mas pequefia de los virus de DNA
o RNA. En la se resumen algunos ejem-
plos de la gama de tipos y tamanos de los genomas.
En toda la gama de organismos, cuyo comeni-
do total de genomas varia en un rango superior a
las 100 000 veces, prevalece un principio comun:
el DNA codifica a todas las proteinas que la(s) dlula(s)
del organismo debe(n) sintetizar, y las proteinas, a su vez
(directa 0 indirectamente), proporcionan las funciones
necesarias para la supervivencia. Mediante un princi-
pio similar se describe la funcion de la informacion
genetica de los virus, ya sea de DNA 0 RNA: el dcido
nucleico codifica a la(s) protefna(s) necesaria(s) para em-
paquetar al genoma y tambien para cualquier funci6n
adicional a las proporcionadas por la dlula hospedadora
necesaria para la reproducci6n del virus durante su ciclo
infeccioso. (El virus mas pequeno, el virus satelite de
la necrosis del tabaco [STNV, satellite tobacco necrosis
virus], no puede replicarse de forma independiente,
requiere de la presencia simultanea de un virus "co-
operador", el virus de la necrosis del tabaco [TNV,
tobacco necrosis virus], que por si mismo es un virus
normalmente infeccioso.)
12 CAPITULO 1 Los genes son DNA
III Los acidos nudeicos
se hibridan por apareamiento
de bases
Conceptos principales
• El calentamiento provoca que las dos cadenas de un
DNA duplex se separen.
• La T
m
es el punto medio del rango de temperatura de
desnaturalizaci6n.
• Las cadenas complementarias unicas pueden
renaturalizarse cuando 5e reduce la temperatura.
• Puede haber desnaturalizaci6n y renaturalizaci6nj
hibridaci6n con combinaciones de DNA-DNA, DNA-
RNA a RNA-RNA, y pueden ser intermoleculares a
intramoleculares.
• La capacidad de dos preparaciones de acido nucleico
de una sola cadena para hibridarse demuestra su
complementariedad.
Una propiedad clave de la helice duplex es su ca-
pacidad para separar las dos cadenas sin afectar los
enlaces covalentes; esto hace posible dicha separa-
cion, y que se reformen en condiciones fisiologicas a
la velocidad necesaria (muy rapida) para mamener
las funciones geneticas. La especificidad del proceso
depende del apareamiento complementario de las
bases.
El concepto de apareamiento de las bases es fundamen-
tal para todos los procesos relacionados con los dcidos nuclei-
cos. La separaci6n de los pares de bases es un aspecto crucial
de la funci6n de una mol&ufa de doble cadena, mientras
que la capacidad para formar pares de bases 10 es para
la actividad de un dcido nucleico de cadena (mica. En la
se muestra que el apareamiento de bases
perrnite que los acidos nucleicos complementarios de
cadena unica formen una estructura duplex.
• Una region duplex intramolecular puede
formarse por apareamiento de las bases
entre dos secuencias complementarias que
forman parte de una molecula de cadena
unica.
• Una molecula de cadena unica puede apa-
rearse a traves de las bases con una molecula
de cadena unica, complementaria e inde-
pendiente, para formar un duplex intermo-
lecular.
La formacion de dominios duplex a partir de
acidos nucleicos de cadena unica es mas importante
para el RNA, pero tambien existe un DNA de cade-
na unica (en forma de genomas viricos). El aparea-
miento de las bases entre cadenas complementarias
unicas e independientes no esta restringido a com-
binaciones DNA-DNA 0 RNA-RNA, tambien puede
ocunir entre una molecula de DNA y una de RNA.
./
• • • 1 • •• • ~
I •
19 El apareamiento de bases ocurre en los DNA
~ _ : 3 1 ( e incluso en las interacciones intermoleculares e intra-
-: -=:ulares del RNA (0 del DNA) de cadena individual.
DNA
renaturalizado
DNA de doble
cadena
l(Desnaturalizaci6n )
VVVV DNA de cadena
/V individual
-:: areamiento
-. amolecular
:el RNA
areamiento RNA largo
- ermolecular entre VV' RNA corto
oleculas cortas
. largas de RNA ,
La carencia de enlaces covalentes entre cadenas
plementarias pennite manipular al DNA in vitro.
- ;- fuerzas no covalentes que estabilizan a la helice
plex se intern.unpen por calentarniento 0 exposi-
a concentraciones bajas de sales. Las dos cade-
;- de la helice duplex se separan completamente
__ando se rompen lOdos los puentes de hidrogeno
::..:e las unen.
EI proceso de separacion de cadenas se llama
esnaturalizacion 0 (coloquiatmente) fusion. (EI
-;;:rmino "desnaturalizacion" tambien se utiliza para
_5cribir la perdida de la estructura autentica de una
-:- efna; es un termino general que implica que la
~ nformacion natural de una macromolecula se ha
::-- sformado.)
La desnaturalizacion del DNA se presenta en un
:; go lirnitado de temperatura y da lugar a cambios
: rprendentes en muchas de sus propiedades flsicas.
:=: punto medio del rango de temperatura en que las
-- enas del DNA se separan se conoce como tempe-
r.::ura de fusion (T
m
, melting temperature), la cual de-
~ nde de la proporcion de pares de bases G-c. Como
:::.i a uno de estos pares tiene tres puentes de hidro-
5eno, es mas estable que un par de bases formado
~ r A-T, el cual solo cuenta con dos de dichos puen-
: . Entre mas pares de G-C contenga el DNA, mayor
: ra la cantidad de energfa necesaria para separar las
- denas. En solucion y en condiciones fisiologicas,
::n DNA con 40% de puentes G-C, valor tfpico de los
senomas de los marnfferos, se desnaturaliza a una T
m
aproximada de 87°C, de modo que el DNA duplex
es estable a la temperatura de la celula.
La desnaturalizacion del DNA es reversible en
·ondiciones apropiadas. La capacidad de las dos
-adenas complementarias separadas para volver a
:ormar una helice duplex se llama renaturaliza-
don, la cual depende del apareamiento especffico
'e las bases entre las cadenas complementarias. En
.a "2 se observa que la reaccion tiene lugar
Las cadenas individuales de DNA desnaturaliza-
das pueden renaturalizarse para formar una estructura duplex.
en dos etapas. Primero, las cadenas individuales de
DNA que estan en la solucion se encuentran por
casualidad; si sus secuencias son complementarias,
aparearan sus bases para generar una region corta
de helice duplex. Posteriormente, dicha region se
extiende a 10 largo de la molecula como una cre-
mallera para formar una molecula duplex larga.
La renaturalizacion de la helice duplex restaura las
propiedades originales perdidas con la desnaturali-
zacion del DNA.
La renaturalizacion describe la reaccion entre dos
secuencias complementarias separadas por desnatu-
ralizacion. Sin embargo, la tecnica puede ampliarse
para permitir que cualesquiera dos secuencias com-
plementarias de acidos nucleicos reaccionen entre sf
para formar una estructura duplex. A este proceso
se le llama asociacion, si bien la reaccion se descri-
be de forma mas general como hibridacion cuando
participan acidos nucleicos de diferentes orfgenes,
como sucede cuando una preparacion es DNA y la
otra, RNA. La capacidad de dos preparaciones de !lcidos
nucleicos para hibridarse demuestra con precision su com-
plementariedad, pues solo las secuencz'as complementarias
pueden formar una estructura duplex.
El principio de la reaccion de la hibridacion es
poner frente a frente dos preparaciones de acidos
nucleicos de cadena individual y despues calcular la
cantidad de materia de doble cadena que se forma.
En la se Hustra un procedimiento por
el cual se desnaturaliza una preparacion de DNA y
se adsorben en un filtro las cadenas unitarias. Pos-
teriormente se aiiade una segunda preparacion de
DNA (0 de RNA) desnaturalizado. EI filtro es tratado
de tal forma que la segunda preparacion se adsor-
ba solo si puede formar pares de bases con el DNA
adsorbido en un principio. Usua]mente la segunda
1.10 Los acidos nucleicos se hibridan por apareamiento de bases 13
YJ\:i
~
Conceptos principales
mas, un cambio en el fenotipo del organismo puede
permitir que se identifique la funcion de la protefna.
La existencia de numerosas mutaciones en un gen
permite que se comparen numerosas variantes de
una protefna, y mediante un anatisis detallado se
identificaran las regiones de la protefna responsables
de una funcion enzimatica 0 de otras funciones.
Todos los organismos experimentan cierto nu-
mero de mutaciones como resultado de las ope-
raciones celulares normales 0 de las interacciones
aleatorias con el ambiente a las cuales se les llama
mutaciones espontaneas; la velocidad a la que se
producen es caracterfstica del organismo especffico,
yen ocasiones se Ie llama nivel de Condo. Las mu-
taciones son eventos raros y, por supuesto, las que
dafian a un gen son descartadas con la evolucion,
de modo que es dificil obtener grandes cantidades
de mutantes espontaneos para estudiarJos en las po-
blaciones naturales.
La incidencia de las mutaciones suele incremen-
tarse mediante tratamientos can ciertos compuestos;
se les llama mutagenos, y los cambios que provo-
can se conocen como mutaciones inducidas. La
mayorfa de los mutagenos actuan directamente en
virtud de su capacidad para modificar una base es-
pecffica del DNA 0 para incorporarse en el acido nu-
cleico. La efectividad de un mutageno se juzga por
la medida en que incrementa la tasa de mutaciones
respecto del nivel de fondo. Utilizando mutagenas se
pueden inducir numerosos cambios en un gen.
Las mutaciones espontaneas que desactivan
el funcionamiento de un gen tienen lugar en los
bacteriofagos y en las bacterias a una tasa relativa-
mente constante de 3 a 4 x 10-
3
por genoma, por
generacion. Dada la gran variacion en el tamalio
de los genomas entre bacteriofagos y bacterias, esta
tasa corresponde a amplias diferencias en el ritmo
de las mutaciones par par de bases, 10 cual sugiere
que la tasa global de mutacioh ha estado sujeta a
fuerzas selectivas, que han equilibrado los efectos
nocivos de la mayorfa de las mutaciones respecto
de los favorables de algunas mutaciones. Esta con-
clusion se refuerza por la observacion de que una
arqueobacteria que vive en condiciones adversas
de altas temperaturas y acidez (que supuestamen-
te dafian el DNA) no muestra una tasa elevada de
mutaciones, de hecho la tasa de mutacion global
apenas es menor al rango promedio.
En la FIGURA 1 22 se muestra que en las bacterias,
la tasa de mutaciones corresponde a -10--6 eventos
por locus par generacion, 0 a una tasa promedia de
cambio por par de bases de 10-
9
a 10-
10
por genera-
cion. La tasa en pares de bases individuales varfa
considerablemente, en un rango de 10 000 veces. No
hay un dlculo preciso de la tasa de mutaciones en
5e desnaturaliza
el DNA en soluci6n
~
"WA.YAlU
5e desnaturaliza el DNA
y se adsorbe en un fHlro
~
( ~ ...
~ )
5e sumerge el filtro en la soluci6n
l
~
5e determina el DNA unido al filtro
l
~ ~
.\
( ~ ~ \
~
T." , La hibridaci6n en filtro establece si la soluci6n
de DNA (0 RNA) desnaturalizado contiene secuencias comple-
mentarias a las cadenas inmovilizadas en el filtro.
'''' ElexpirTmentodelfiitroevalua la complemenlariedad
Las mutaciones proporcionan evidencias determi-
nantes de que el DNA es el material genetico. Cuando
un cambia en la secuencia del DNA provoca una mo-
dificacion en la secuencia de una protefna, se puede
concluir que el DNA codifica a dicha protefna. Ade-
• Todas las mutaciones consisten en cambios en la
secuencia del DNA.
• Las mutaciones pueden ser espontaneas 0 inducidas
por mutagenos.
preparacion se marca radioactivamente, de manera
que se pueda medir la reaccion como la cantidad de
marcador radioactivo retenido par el filtro.
La extension de la hibridacion entre dos acidos
nucleicos de cadena individual depende de su com-
plementariedad. No es necesario que dos secuencias
sean perfectamente complementarias para hibridar-
se. Si estan estrechamente relacionadas, pero no
son identicas, se farma un dllplex imperfecto en el
cual el apareamiento de bases se interrumpe en las
posiciones en que las cadenas individuales no co-
rresponden.
• Las mutaciones cambian
la secuencia del DNA
14 CAPITULO 1 Los genes son DNA
tipo silvestre
. .
H
CITOSINA
r7'Y 'H
)
URAGlLa a a

....NvN,
. II H
o
U

A
C
C
....
G
Acido
nitroso
. ..
EI genoma,
1 en 300
generaciones
Cualquier gen,
1 en 10
5
-10
6
generaciones
Cualquier par de
bases, 1 en 10
9
-10
10
generaciones
Tasa de mutaci6n
..
.
-AGCCTGAATGGCCAAT ..
G
. Un par de bases muta a una tasa de 10-
9
a 10-
10
::- ;eneraci6n, un gen de 1 000 pares de bases muta a una tasa
:" -:0-6 por generaci6n, en tanto que un genoma bacteriano
- .3 a una tasa de 3 x 10-
3
por generaci6n.
Las mutaciones pueden ser inducidas por modi-
ficacion quimica de una base.
1.12 Las mutaciones pueden afectar a pares de bases individuales 0 a secuencias mas largas 15
=...:cariotas, aunque en general se piensa que hasta
-eno punta es similar a la de las bacterias, calculada
_ !" locus y por generacion.
Las mutaciones pueden afectar
a pares de bases individuales
o a secuencias mas largas
(onceptos principales
• Una mutaci6n puntual modifica a un solo par de bases.
• Las mutaciones puntuales pueden ser provocadas por la
conversi6n quimica de una base en otra 0 por errores
durante la duplicacion.
• Una transicion remplaza un par de bases G-C con un
par de bases A-T, 0 viceversa.
• Una transversion remplaza una purina con una
pirimidina, por ejemplo, A-TaT-A.
• Las inserciones son el tipo mas comun de mutaci6n,
son resultado del movimiento de elementos
transponibles.
-:wlquier par de bases del DNA puede mutar. Una
mutacion puntual cambia solo un par de bases, y
ede ser provocada por dos tipos de eventos:
• La modificacion qufmica del DNA convierte
directamente una base en otra diferente.
• Un mal funcionamiento durante la duplica-
cion del DNA provoca la insercion de una
base equivocada en una cadena polinueleo-
tfdica durante la sfntesis del DNA.
Las mutaciones puntuales pueden ser de dos ti-
pos, dependiendo de la naturaleza del cambio cuan-
do una base es sustituida por otra:
• La elase mas comun es la transicion, que
consiste en la sustitucion de una pirimidina
por la otra, 0 de una purina por la otra, en
cuyo caso, un par G-C es remplazado par un
par A-T, 0 viceversa.
• La elase menos comun es la transversion,
en la cual una purina es remplazada por una
pirimidina 0 viceversa, de tal forma que un
par A-T se convierte en T-A 0 en CoG.
Los efeetos del acido nitroso constituyen un
ejemplo elasico de transicion porIa conversion
qufmica de una base en otra. En la se
muestra que el acido nitroso lleva a cabo una des-
aminacion oxidativa que convierte a la citosina en
uracilo. En eJ cielo de duplicaci6n que sigue a la
transici6n, el U se aparea can una A, y no con la G,
con la cualla C original se habrfa apareado. De esta
manera, el par CoG es remplazado por un par T-A
cuando la A se aparea con la T en el siguiente cielo
de duplicacion. (EI acido nitroso tambien desamina
a la adenina, provocando la transicion inversa de
A-T a G-C.)
Las transiciones tambien son provocadas por
apareamiento erroneo de bases, cuando pare-
jas inusuales se aparean desafiando la restricci6n
usual de los pares de Watson y Crick. En generaL el
apareamiento erroneo de bases es una aberraci6n,
resultado de la incorporacion en el DNA de una base
anormal que tiene propiedades ambiguas de aparea-
miento. En la se muestra el ejemplo del
bromouracilo (BrdU), molecula analoga a la timina
.. -..
l ... '.J -.:rc.- . ;II - L.,.. ._.......,. -....
... .'.
-, ,.. .;'.- '." -.
. , ...
CH
3
HC""'C'Q;<'O, ,
N N 'H.... W'H
/ Y'H, 1
., " "N""C....C;;-N
Azucar 0 I II
Par A.T HC""N"'C.....J
EI SrdU se aparea can I )ucar
la A en la duplicacion t
Sr

N N '·H.......H
./ ..... ./ 'H
., '·,N"'"C.... C-N
Azucar 0 I II
HC"" "'C..... N'
N
Par SrdU-A Azucar
EI cambia ceto-enol permite que el SrdU se aparee can la G
Sr Sr
I I
Cambia ceto-enol HC""C....C...
OH
I • I II
./N.....CN,H /N....C"'N
., II ., 11
Azucar 0 Azucar 0
I EI SrdU se aparea
t can la G en la duplicacion
Sr
I
HC"'CC"'0"H. Par SrdU-G
I II '"
./N....C...N,. .?
., II
Azucar 0" I II
, 'H'N...G""-"C..... N'
H N
Azucar
Se pueden inducir mutaciones al incorporar ana-
logos de bases en el DNA.
que contiene un aromo de bromina en lugar del gru-
po metilo de la timina. EI BrdU se incorpora al DNA
en lugar de la timina. No obstante, sus propiedades
de apareamiento son ambiguas porque el atomo de
bromina permite que se realice un cambio en el cual
la base modifica su estructura, de una forma ceto
(=0) a una forma enol (-OR). Esta tlltima puede
aparearse con la guanina, to cual conduce a la sus-
Jitucion del par original A-T pOl' un par G-c.
EI apareamiento erroneo puede ocurrir durante
la incorporacion original de la base 0 en un cicio
subsigulente de duplicacion. La transicion es indu-
cida con cierta probabilidad en cada cicio de dupli-
cacion, de modo que la incorporacion de BrdU tiene
efectos continuos en la secuencia del DNA.
Durante mucho tiempo se penso que las mu-
taciones puntuales eran la via principal de cambio
16 CAPITULO 1 los genes son DNA
en genes individuales, pero ahora sabemos que las
inserciones de fragmentos de material adicional
son muy frecuentes. La fuente del material inser-
tado yace en los elementos transponibles, que
son secuencias de DNA susceptibles de cambial' de
lugar (vease Capitulo 21, Transposones, y Capitulo
22, Retrovirus y retroposones). Normalmente, una
insercion suprime la actividad de un gen, y donde
han ocurrido dichas inserciones, despues pueden
producirse deleciones de una parte 0 todo el mate-
rial insertado, y hasta de los dominios adyacentes.
Una diferencia significativa entre las mutacio-
nes puntuales y las inserciones/deleciones es que
la frecuencia de las primeras puede incrementarse
pOl' los mutagenos, mientras que la incidencia de
los cambios provocados pOl' elementos transponi-
bles no se ve afectada. Sin embargo, las insercio-
nes y deleciones tambien pueden ser producto de
mecanismos, pOl' ejemplo, los que implican errores
cometidos durante la duplicacion 0 la recombina-
cion, aunque probablemente sean menos comunes.
Por otra parte, una clase de mutagenos, las acri-
dinas, dan lugar a inserciones y deleciones (muy
pequeii.as) .
lID Los efectos de las mutaciones
pueden ser revertidos
Conceptos principales
• las mutaciones directas desactivan a un gen, en tanto
que inversas (0 revertientes) revierten sus efectos.
• las inserciones pueden revertir por deleci6n del
material insertado, pero las deleciones no pueden
reverti rse.
• la supresi6n ocurre cuando una mutaci6n de un segundo
gen anula el efecto de la mutaci6n del primero.
En la 2 se muestra que el aislamiento de
los revertientes es una caracterfstica importante
que distingue las mutaciones puntuales y las inser-
ciones de las deleciones:
• Una mutacion puntual puede revertirse al
restaurar la secuencia original 0 al adquirir
una mutacion compensadora en alguna otra
parte del gen.
• Una insercion de material adicional puede
ser revertida por delecion del material inser-
tado.
• Una delecion de una parte de un gen no
puede revertirse.
Las mutaciones que desactivan a un gen son lla-
madas mutaciones directas, y sus efectos son re-
vertidos por mutaciones inversas, las cuales son
de dos tipos, reversion verdadera y reversion supre-
sora intragenica.
ATCGGACTTACCGGTTA
TAGCCTGAATGGCCAAT
Mutaci6n I
puntual t
ATCGGACOACCGGTTA
TAGCCTGAGTGGCCAAT
Reversi6n ~
ATCGGACTTACCGGTTA
TAGCCTGAATGGCCAAT
ATCGGACTTACCGGTTA
TAGCCTGAATGGCCAAT
Inserci6n
ATCGGACTTXXXXXACCGGTTA
TAGCCTGAAYYYYYTGGCCAAT
Reversi6n I
par deleci6n t
ATCGGACTTACCGGTTA
TAGCCTGAATGGCCAAT
ATCGGACTTACCGGTTA
TAGCCTGAATGGCCAAT
ATCGGACGGTTA
TAGCCTGCCAAT
Reversi6n imposible
FlGl. Las mutaciones puntuales y las insercianes pue-
den ser revertidas, pero las deleciones son irreversibles.
Una reversion exacta de la mutacion original
se llama reversion verdadera, de tal manera que
si un par A-I ha sido remplazado pOI un par G-C,
otra mutacion que restituya el par A-I regenerani
exactamente la secuencia de tipo silvestre.
El segundo tipo de mutacion inversa, la rever-
sion supresora intragenica, puede tener lugar
en otro sitio del gen, y sus efectos compensan a
la primera mutacion. Por ejemplo, un cambio de
aminoacido en una protefna puede aboUr la fun-
cion del gen, pero una segunda alteracion puede
compensar por la primera y restaurar la actividad
de la protefna.
Una mutacion directa resulta de cualquier cam-
bio que desactive un gen, mientras que una muta-
cion inversa debe restaurar la [uncion de una protef-
na danada por una mutacion directa en particular,
de modo que las demandas de una mutacion inversa
son mucho mas especfficas que las de una mutacion
directa. En proporcion, la tasa de retromutacion es
menor que la de mutacion directa, normalmente por
un factor de -10 veces.
Las mutaciones tambi61 pueden ocunir en
otros genes para contrarrestar los efectos de una
mutacion en el gen original, deeto que se conoce
como supresion. Se llama supresor al locus en
que una mutacion suprime el efecto de una muta-
cion en otro.
lID Las mutacianes se cancentran
en puntas calientes
(oncepto principal
• La frecuencia de las mutacianes en cualquier par
de bases en particular depende de una fluctuaci6n
estadistica, excepto en los puntas calientes, en los
cuales la frecuencia se incrementa cuando menos en un
orden de magnitud.
Basta ahora se han descrito las mutaciones en fun-
cion de los cambios individuales en la secuencia
del DNA que influyen en la actividad de la unidad
genetica en la cual ocurren. Cuando se analizan
las mutaciones desde la perspectiva de la desac-
tivacion del gen, la mayorfa de los genes de una
especie muestran tasas mas 0 menos similares de
mutacion respecto de su tamano, 10 cual sugiere
que el gen puede ser considerado como un objetivo
de la mutacion, y que un dana en cualquiera de sus
partes puede abolir su funcion, pOI consiguiente, la
susceptibilidad a la mutacion es aproximadamente
proporcional al tamano del gen. Pero consideran-
do los sitios de mutacion de la secuencia del DNA,
,)odos los pares de bases de un gen son igualmente
susceptibles 0 algunos son mas propensos que otros
a sufrir mutaciones?
(,Que sucede cuando se afsla un numero im-
portante de mutaciones independientes del mismo
gen? Se obtienen numerosos mutantes, cada uno
de los cuales es resultado de un evento mutacional
individual. Posteriormente se determina el sitio de
cada mutacion. La mayorfa de las mutaciones ra-
dicaran en sitios diferentes, si bien algunas estaran
en la misma posicion. Dos mutaciones aisladas de
manera independiente en el mismo sitio pueden
constituir exactamente el mismo cambio en el DNA
(en cuyo caso el mismo evento mutacional ha su-
cedido en mas de una ocasion), 0 pueden constituir
cambios diferentes (en cada par de bases son posi-
bles tres mutaciones puntuales diferentes).
En el histograma de la se muestra
la frecuencia con la cual se encuentran mutacio-
nes en cada par de bases del gen lac! de E. coli. La
probabilidad estadistica de que ocuna mas de una
mutacion en un sitio particular se determina por
cinetiea de impactos aleatorios (como se observa en
1.14 Las mutacianes se cancentran en puntas calientes 17
50 100 150 200 250 300 bp
Distancia a 10 largo del gen
Las mutaciones espontaneas ocurren a lo largo
del gen lacI de la bacteria E. coli, perc estan concentradas en
un punto caliente.
La desaminaci6n de la citosina produce uracilo,
y la de 5-metilcitosina, timina.
Citosina 5-metilcitosina CH
3
H
I Y ~ ' H
/'Nf(N )
o
CH
3
Timina 1 ~ O
f'1f'
N N
/' II 'H
o
H
I
~ N ' H
t\J N
" f(
"'"0;'0
0
)
~ o
"N N
f( 'H
o
__ ___ 1__ 1
en
(!)
g 40
'(3
5 30
E
(1) 20
D
0
ID 10
E
'OJ
z
la distribucion de Poisson). Por 10 tanto, algunos
sitios adquiriran una, dos 0 tres mutaciones, mien-
tras que otros no obtendran ninguna. Algunos sitios
adquieren muchas mas mutaciones de las esperadas
en una distribucion aleatoria; pueden presentar 10 e
incluso 100 veces mas mutaciones que las predichas
por los impactos aleatorios. Estos sitios se Haman
puntos calientes. En los puntos calientes pueden
ocurrir mutaciones espontaneas, y mutagenos dife-
rentes pueden tener diferentes puntos calientes.
III Numerosos puntos calientes son
resultado de bases modificadas
Concepto principal
• Una causa comLin de puntos calientes es la base
modificada 5-metilcitosina, la cual sufre desaminaci6n
espontanea y se convierte en timina.
Una causa importante de mutacion espontanea re-
sulta de la presencia de una base inusual en el DNA.
Ademas de las cuatro bases que se insertan en este
cuando es sintetizado, en ocasiones se pueden ob-
servar bases modificadas cuyo nombre refleja su
origen; son producidas al modificarse quimicamente
una de las cuatro bases ya presentes en el DNA. La
base modificada mas comun es la 5-metilcitosina,
generada par una enzima metilasa que agrega un
grupo metilo a ciertos residuos de citosina en sitios
especfficos del DNA.
Los sitios que contienen 5-metilcitosina propar-
cionan puntos calientes para que se desarrollen mu-
taciones puntuales espontaneas en E, coli. En cada
caso, la mutacion adquiere la forma de una transi-
cion de G-C a A-T. Las cepas de E. coli incapaces de
metilar la citosina carecen de puntos calientes.
La razon de la existencia de los puntos calientes
es que las bases de citosina sufren desaminacion
espontanea con frecuencia considerable. En esta re-
accion, el grupo amino es remplazado por un grupo
ceto. Recuerdese que la desaminacion de la citosina
genera uracilo (vease Figura 1.23). En la • U
se compara esta reaccion con la desaminacion de
5-metilcitosina, en donde la desaminacion genera
timina. El efecto en el DNA es la generacion de pa-
res de bases G-U YG- T, respectivamente, donde hay
un apareamiento erroneo entre parejas.
Todos los arganismos cuentan con sistemas de
reparacion que corrigen pares de base apareados
erroneamente eliminando y remplazando una de
las bases. La operacion de estos sistemas determina
si los pares apareados erroneamente, como G-U Y
G-T, resultan en mutaciones.
En la se muestra que las conse-
cuencias de la desaminacion son diferentes para la
5-metilcitosina y para la citosina. La desaminacion
(poco frecuente) de la 5-metilcitosina provoca una
mutacion, en tanto que la desaminacion de la cito-
sina mas comun no tiene este efeeto porque los sis-
temas de reparacion son mucho mas efectivos para
reconocer G-U que G-T.
La E. coli contiene una enzima, uracilo-DNA-
glucosidasa, que elimina los residuos de uracilo del
DNA (vease la seccion 20.5, La inversion de bases
es utilizada por las metilasas y las glucosilasas). Esta
accion deja sin aparear un residuo de G, y posterior-
mente "un sistema de reparacion" inserta una base C
para aparearlo. El resultado final de estas reacciones
es la restauracion de la secuencia original del DNA.
Este sistema protege al DNA de las consecuencias
de la desaminacion espontanea de la citosina (pero
no es 10 suficientemente activo como para prevenir
los efectos del alto nivel de desaminacion provocado
por el acido nitroso; vease la Figura 1.23).
Notese que la desaminacion de la 5-metilcitosi-
na produce tirnina, 10 cual da lugar a un par de bases
apareadas erroneamente, G-T. Si el apareamiento
18 CAPITULO 1 Los genes son DNA
La remocion del uracilo evita las mutaciones - ;::;
c
Me
C

G G
Desaminaci6n oxidativa
La T remplaza a la Me-C I EI U remplaza a la C
T .. u

GIG
T .. Eliminaci6n del uracilo

G G
I Insercion de citosina
T .. C

G G
Duplicaci6n
C C

G G
T Y c
W'WAYAYAJU
A G
la T se aparea cin la A I
Mutaci6n Sin mutaci6n
FIGURA 1 2 La desaminaci6n de la 5-metilcitosina produce
timina (por transiciones de C-G a T-A), en tanto que la desami-
naci6n de la citosina produce uracilo (que suele ser eliminado
y posteriormente remplazado por citosina).
erroneo no se corrige antes del siguiente cido de
duplicacion, resulta una mutacion. En la siguien-
te duplicacion, las bases del apareamiento erroneo
entre G y T se separan y posteriormente se aparean
con nuevas parejas para producir un par G-C de tipo
silvestre y un par A-T mutante.
La desaminacion de la 5-metilcitosina es la cau-
sa mas comun de la produccion de pares erroneos
de G-T en el DNA. Los sistemas de reparacion que
actuan en dichos pares tienden a remplazar T por C
(en vez de la alternativa de remplazar G por A), 10
cual ayuda a reducir la tasa de mutacion (vease la
seccion 20.7, Control de la direccion de la repara-
cion del apareamiento erroneo) . No obstante, estos
sistemas no son tan efectivos como la remocion de
V de los pares erroneos G-V, de modo que la des-
aminacion de la 5-metilcitosina provoca mutaciones
con mucha mayor frecuencia que la desaminacion
de la citosina.
La 5-metilcitosina tambien crea puntos calien-
tes en el DNA de eucariotas, fenomeno comlm en
dinudeotidos CpG concentrados en regiones de-
nominadas islas CpG (vease la seccion 24.19, Los
islotes CpG son dianas reguladoras). Si bien la 5-
metilcitosina representa -1 % de las bases del DNA
humano, los sitios que contienen la base modifica-
da representan -30% de las mutaciones puntuales;
esto hace del estado de la 5-metilcitosina un factor
determinante de mutacion muy importante en las
celulas animales.
Los efectos de la eliminacion de la enzima del
raton MBD4, glucosilasa susceptible de eliminar T
(0 V) de pares erroneos con G, subrayan la impor-
tancia de los sistemas de reparacion para reducir
la tasa de mutaciones; el resultado es una tasa de
mutacion tres veces mayor en los sitios CpG. (La
razon de que eJ efecto no sea mayor es que la MBD4
constituye solo uno de los numerosos sistemas que
inciden en los pares erroneos G-T; es de imaginar
que la eliminacion de wdos los sistemas incremen-
tara mucho mas la tasa de mutacion.)
La operacion de estos sistemas proyecta una luz
interesante en el uso de la T en el DNA respecto de
la V en el RNA que quiza se relacione con la nece-
sidad de estabilidad de la secuencia del DNA; el usa
de T significa que cualquier desaminacion de C se
detecta de inmediato debido a que genera una base
(V) que suele estar ausente del DNA 10 cual incre-
menta en gran medida la eficiencia con que pueden
funcionar los sistemas de reparacion (comparados
con la situacion en que tienen que detectar aparea-
mientos erroneos G-T, los cuales tambien pueden
ser producidos por situaciones en que la eliminacion
de la T no serla la respuesta apropiada). Asimis-
mo, el enlace fosfodiester del esqueleto es mas labil
cuando la base es V.
lID Algunos agentes hereditarios
son extremadamente pequefios
Concepto pri nci pal
• Algunos agentes hereditarios muy pequeiios no
codifican proteinas, pero constan de RNA 0 de
proteinas que tienen propiedades hereditarias.
Los viroides son agentes infecciosos que producen
enfermedades en plantas superiores; son molecu-
las circulares de RNA muy pequeiias. A diferencia
de los virus, en los cuales el agente infeccioso es
un virion, genoma encapsulado en una cubierta
de protefna, el RNA viroide es el agente infeccioso. EI
viroide esta formado unicamente por RNA cuyas
bases estan extensamente apareadas pero de forma
imperfecta, de modo que forman una barra carac-
teristica, como la ilustrada en la ! II . J. Las
mutaciones que interfieren con la estructura de esta
barra reducen su capacidad infecciosa.
Un RNA viroide consiste en una especie mole-
cular individual que se replica de forma autonoma
en cHulas infectadas y cuya secuencia se perpetlla
1.16 Algunos agentes hereditarios son extremadamente pequeiios 19

.. ....

, PSTV grave ., 00 'M
j
j {
I
I j ,',
'" C UOu C o"'c U /,:>. A"'A AO GC oGA GAA/fl /flC ","II AC A e" C e u u cc C
°O"ACU AACU ouoouuec GGUU CACCU CUCC OAoeAO AAGA OAAOGCGG CUCGG Gil. GCUUCAO uec eCGGO CC\OAOCOA UGGC A"'AGG GGUGOGG GUO CC BCGG co AOOAO ccca GAAA AOGGUUU
11111111111111111 1111 111111 11111111111111 11IlllIIIIIlll II 1111111 11111111 1111111111111 IIIII llllll! III II 1111111 II1II 11111111 1111
'teCUUGG UUGA CGCC",,,OG CCG" UGUGGG GoGO UUCGUU UUCU UUUUUCGCC G"'Gce cu cO......GUC AOO GOCCC GG CuuCGCU OUCG uuucc CCGCuec CAe GG eGce Ge uceuu GaGC CUUU UUUUA
C
U
I
UU
C
UU I AaC C CA A e\ loA A A\ U ... e e1 C C CA'" C GC C U uu ceu
. ueu Aell veAu I euG
3:.ro :lOCI 210 200 AA..... U 210 IfIO
, PSTV leve '" '" 90 '''' / ''''
l
AC uGu c1 GAc U AAA I NJ GC GGJ - GAAA U AG Jjt'" AG A G ACt UAAUU cc C
AACU GuOOUUOC GGUU CACCU COCC GN3CN3AAANJA CUCGG GA GCUUCA.G vee CCGGG CC GGAGCGA UGGC UAAGG GGUGGGG GUG CG GCGG CO AOOAG cere GAAA AGOGU
U
,
U 11I1I II [I 11111111 II t I 111111 1111 1[1111111111 111111111 1111' [I 1111111 III 11111 II 1111111 'Ill 11II1 1111111 \11 II 1111 11 1I11I 1111 1111 1111 ,
I
eCuuoo UUGA CGCCAAOO CCOA UGUOOG GGOO uUCGUUuuuucu uuuuutGCc GAGCC co OOAAGUc AOO GGCCC GoG cuUCGCU GUCG GUuuc CtGCUCC CAC GG CGCC GC UCCUU GGGC CUUU UUUUA
C
Uu
C
UU I "G
C
C tC, A C AA A A U A C C ceCA A C GC C U UU CdJ I
Vcu \ ACA\ VCA
U
I I CuG
359 330 300 210 240 210 180
+U A-.U
El RNA del PSTV es una molecula circular que forma una estructura extensa de doble cadena inte-
rrumpida por numerosos lazos interiores. La forma leve difiere de la grave en tres sitios.
fielmente en sus descendientes. Los viroides pue-
den clasificarse en numerosos grupos. Un viroide
dado se identifica con un grupo porIa similitud de
su secuencia con la de otros miembros del grupo.
POl' ejemplo, cuatro viroides relacionados con el del
tuberculo ahusado de la papa (PSTV, potato spindle
tuber viroid), muestran similitudes de secuencia del
70 al 83 pOl' ciento. Los diferentes aislamientos de
una cepa de un viroide en particular pueden va rial'
entre ellos, y el cambio puede afectar al fenotipo
de celulas infectadas. POl' ejemplo, las cepas leves
y severas de PSTV difieren par tres sustituciones de
nucleotidos.
Los viroides se asemejan a los virus en que sus
genomas de acido nuclei co son heredables porque
cumplen con todos los requisitos de la informacion
genetica, aunque los viroides, lIamados en ocasio-
nes patogenos subviricos, difieren de los virus en
estructura y funcion. EI RNA viroide no parece ser
traducido a protefnas, pOl' 10 tanto no puede codifi-
car pOl' sf mismo las funciones necesarias para su su-
pervivencia, fenomeno que genera dos interrogan-
tes: cComo se replica el RNA viroide? cComo afecta
al fenotipo de la celula de la planta infectada?
La duplicacion debe ser realizada pOl' enzimas
de la celula hospedadora, subvertidas de su funcion
normal. La heredabilidad de la secuencia del viroide
indica que el RNA viroide proporciona el molde.
Presumiblemente, los viroides son patogenicos
porque interfieren con los procesos celulares nor-
males, quiza de forma relativamente aleatoria, pOl'
ejemplo, secuestrando una enzima esencial para su
propia duplicacion 0 interfiriendo con la produc-
cion de moleculas necesarias de RNA celular, 0 bien,
pueden comportarse como moleculas reguladaras
anormales con efectos particulares en la expresion
de genes individuales.
Un agente aun menos comun es la encefalo-
patfa espongiforme de ovejas y cabras (scra-
20 CAPITULO 1 Los genes son DNA
pie), enfermedad neurologica degenerativa de ove-
jas y cabras que se relaciona con kuru y sfndrome
de Creutzfeldt-Jakob, enfermedades humanas que
afectan la funcion cerebral.
El agente infeccioso del scrapie no contiene dcido
nudeico. Este agente extraordinario lIamado prion
(agente infeccioso proteinaceo) es una glicoprotef-
na hidrofoba de 28 kD, 0 PrP, codificada pOl' un
gen celular (conservado entre los mamfferos) que
se expresa en el cerebro normal. La protefna existe
en dos formas, el producto que se encuentra en el
cerebra normal conocido como Prpc, que es comple-
tamente degradado por proteasas. La protefna en-
contrada en los cerebros infectados se conoce como
Prpsc y es extremadamente resistente a la degrada-
cion por proteasas. La PrPC se convierte en PrPSC por
una modificacion 0 cambio conformacional que
confiere resistencia a las proteasas y que aun no ha
sido descrita por completo.
Como agente infeccioso del scrapie, el PrPSC debe
modificar de alguna manera la sfntesis de su contra-
parte celular normal, de tal forma que, de ser inocuo
se tome en infeccioso (vease la seccion 31.12, Los
priones provocan enfermedades en los mamfferos).
Los ratones que carecen del gen PrP no pueden ser
infectados para que en ellos se desarrolle scrapie, 10
cual demuestra que el PrP es esencial para el desa-
rrollo de la enfermedad.
III Resumen
Mediante dos experimentos clasicos se demostro
que el DNA es elmaterial genetico. El DNA aisla-
do de una cepa de la bacteria Pneumococcus puede
conferir propiedades de dicha cepa a otra. Ademas,
el DNA es el unico componente heredado porIa
progenie de los fagos progenitores. EI DNA puede
utilizarse para transferir nuevas propiedades a ce-
lulas eucariotas.
El DNA es una helice duplex formada par cade-
"as antiparalelas en las cuales los nucleotidos estan
idos pOl' enlaces fosfocliester 5'a -3'. El esqueleto
:orma la parte exterior; las bases de purina y de piri-
::niclina estan apiladas en el interior formando pares,
::ll los cuales la A es complementaria de la T, y la G,
":'e la C. Las cadenas se separan y recurren al apa-
::-eamiento complementario de bases para ensamblar
-- enas hijas siguiendo un patron de duplicacion
= miconservadora. El apareamiento complementa-
_:0 de bases tambien se utiliza para transcribir un
que representa una sola cadena de un DNA
iiiplex.
Un fragmento de DNA puede codificar a una
El codigo genetico describe la relacion en-
=e la secuencia del DNA y la secuencia de la protei-
-. Solo una de las dos cadenas del DNA codifica a
'..:na proterna. Un codon esta farmado pOl' tres nu-
que representan un solo aminoacido. Una
=e enda codificadora de DNA consiste en una serie
.:: codones, los cuales son leidos desde un punto de
:.aicio predeterminado. En general, uno de los tres
_arcos de lectura posibles puede ser traducido en
_,oteinas.
Una mutacion es un cambio en la secuencia de
_Q pares de bases A-T y G-C del DNA que, en una
=:.'cuencia codificadora, puede cambiar la secuencia
ie aminoacidos de la proteina correspondiente. Una
:2utacion por desplazarniento del marco de lectura
::J.odifica el marco de lectura subsiguiente insertando
eliminando una base, de modo que se produce una
=erie completamente nueva de aminoacidos a partir
'el sitio de la mutacion. Una mutacion puntual cam-
.=":a solo al arninoacido representado par el condon en
cual sucede la mutacion. Las mutaciones puntua-
,::5 pueden ser revertidas por mutacion inversa de la
:::mtacion original. Las inserciones pueden revertirse
:- r la perdida del material insertado, pero las de-
.::ciones son irreversibles. Las mutaciones tambien
." ;Jeden ser suprimidas de manera inclirecta cuando
mutacion de un gen diferente antagoniza al de-
'::GO original.
La incidencia natural de las mutaciones se in-
=ementa pOl' medio de mutagenos. Las mutacio-
:::es pueden concentrarse en puntos calientes. Una
':rri.edad de punto caliente responsable de algunas
=·.naciones puntuales es provocada por la desami-
de la base modificada 5-metilcitosina.
Las mutaciones directas ocurren a una tasa de
- 0-6 pOl' locus por generacion; las retromutaciones
mutaciones inversas) son menDs comunes. No
as las mutaciones inciden en el fenotipo.
Aunque toda la informacion genetica de las ce-
___as es transportada por el DNA, los virus tienen
=:=::lOmas de doble cadena 0 de una sola cadena de
o de RNA. Los viroides son patogenos subviri-
cos formados unicamente por moleculas circulares
pequeiias de RNA, sin cubierta protectora. El RNA
no codifica proteinas; se desconoce su forma de per-
petuacion y de patogenesis. El scrapie es un agente
proteinico infeccioso.
Referencias
III Introducci6n
Revisiones
Cairns, J .. Stem, G.. and Watson, J.D. (1996). Phage and
the Origins of Molecular Biology. Cold Spring Harbor
Symp. Quant. Bioi.
Judson, H. (1978). The Eighth Day of Creation. Knopf, New
York.
Olby, R. (1974). The Path to the Double Helix. MacIvl..illan,
London.
III El DNA es el matelial genetico de las bacterias
Articulos de investigaci6n
Avery. O. T., MacLeod. C. M., and McCarty. M. (1944).
Studies on the chemical nature of the substance in,
ducing transformation of pneumococcal types. J. Exp.
Med. 98, 451-460.
Griffith, F. (1928). The significance of pneumococcal types.
1. Hyg. 27, 113-159.
.. El DNA es el material genetico de los virus
Articulos de investigaci6n
Hershey, A. D. and Chase, M. (1952). Independent func-
tions of viral protein and nucleic acid in growth of
bacteriophage J. Gen. Physiol. 36, 39-56.
III El DNA es el material genetico de las celulas
animales
Articulos de investigaci6n
Pellicer. A.. Wigler, M., Axel, R., and Silverstein. S. (1978) .
The transfer and stable integration of the HSV thymi-
dine kinase gene into mouse cells. Cell 14. 133-141.
III El DNA es una helice dOplex
Articulos de investigaci6n
Watson, J. D., and Crick, F. H. C. (1953). A structure for
DNA. Nature 171, 737-738.
Watson, J.D.. and Crick, F. H. C. (1953). Genetic implica-
tions of the structure of DNA. Nature 171. 964-967.
Wilkins, M. F. H.. Stokes, A. R.. and Wilson, H. R. (1953).
Molecular structure of DNA. Nature 171, 738-740.
III La duplicaci6n del DNA es semiconservadora
Revisiones
Holmes, F. (2001). Meselson. Stahl, and the Replication of
DNA: A History of the Most Beautiful Experiment in Biology.
Yale University Press, New Haven, CT.
Referencias 21
Articulos de investigaci6n
Meselson, M. and Stahl, F. W. (1958). The replication of
DNA in E. coli. ?roc. Nat!. Acad. Sci. USA 44,671-682.
l1li Las mutaciones cambian la secuencia del DNA
Revisiones
Drake, J. W.. Charlesworth. B., Charlesworth, D.. and
Crow, J. F. (1998). Rates of spontaneous mutation.
Genetics 148, 1667-1686.
Drake, J. W. and Balz, R. H. (1976). The biochemistry of
mutagenesis. Annu. Rev. Biochem. 45, 11-37.
Articulos de investigaci6n
Drake, J. W. (1991). A constant rate of spontaneous muta-
tion in DNA-based microbes. Proc. Nat!. Acad. Sci USA
88,7160-7164.
Grogan, D. W.. Carver, G. T., and Drake, J. W. (2001).
Genetic fidelity under harsh conditions: analysis
of spontaneous mutation in the thermoacidophilic
archaeon Sul/olobus acidocaldarius. ?roc. Nat!. Acad. Sci.
USA 98, 7928-7933.
lID Las mutaciones pueden afectar a pares de bases
individuales 0 a secuencias mas largas
Revisiones
Maid, H. (2002). Origins of spontaneous mutations: specifi-
city and directionality of base-substitution, frameshift,
and sequence-substitucion mutageneses. Annu. Rev.
Genet. 36, 279-303.
22 CAPITULO 1 Los genes son DNA
l1li Numerosos puntos calientes son resultado de bases
modificadas
Articulos de investigaci6n
Coulondre, C. et a1. (1978). Molecular basis of base subti-
tution hotspots in E. coli. Nature 274, 775-780.
Millar, C. B., Guy, J., Sansom, O. J., Selfridge, J., MacDo-
ugall, E., Hendrich, B., Keightley, P. D., Bishop, S.
M., Clarke, A. R., and Bird, A. (2002). Enhanced CpG
mutability and tumorigenesis in MBD4-deficient mice.
Science 297,403-405.
lID Algunos agentes hereditarios son extremadamente
pequefios
Revisiones
Diener, T. O. (1986). Viroid processing: a model involving
the central conserved region and hairpin. Proc. Natl.
Acad. Sci. USA 83, 58-62.
Diener, T. O. (1999). Viroids and the nature of viroid disea-
ses. Arch. Virol. Supp!. 15, 203-220.
Prusiner. S. B. (1998). Prions. Proc. Nat!. Acad. Sci. USA 95,
13363-13383.
Articulos de i nvestigaci6n
Bueler, H. et a1. (1993). Mice devoid ofPrP are resistant to
scrapie. Cell 73, 1339-1347.
McKinley, M. P., Bolton, D.C., and Prusiner, S. B. (1983).
A protease-resistant protein is a structural component
of the scrapie prion. Cell 35, 57-62.
Los genes codifican proteinas
-
-
..
....
...
ESQUEMA DEL CAPITULO J
Introducci6n
Un gen codifica a un solo polipeptido
• La hip6tesis de un gen : una enzima resume Las bases de la
genHica moderna: que un gen es un fragmento de DNA que
codifica a una sola cadena polipeptidica.
• La mayoria de las mutaciones deterioran La funci6n del gen
en el cual se producen.
Las mutaciones que se presentan en el mismo gen
no se pueden complementar
• Una mutaci6n en un gen afecta s6Lo a La proteina
codificada por la copia mutante del gen y no a las
proteinas codificadas por algun otro alelo.
• La incapacidad de dos mutaciones para complementarse
(producir un fenotipo silvestre cuando se presentan en
configuraci6n trans en un heterocigoto) significa que
forman parte del mismo gen.
Las mutaciones pueden provocar perdida
o ganancia de funci6n
• Las mutaciones recesivas son provocadas por perdida de
funci6n del producto proteinico.
• Las mutaciones dominantes son resultado de una ganancia
de funci6n.
• La evaluaci6n de la esencialidad de un gen requiere de una
mutaci6n nula (que elimine por completo su funci6n).
• Las mutaciones silenciosas no tienen ningun efecto porque
el cambio de base no altera la secuencia ni la cantidad de
proteina, 0 porque el cambio de la secuencia de la proteina
no tiene ningun efecto.
• Las mutaciones rezumantes (0 hipomorfas) inciden en la
funci6n del producto del gen, pero no se observan en el
fenotipo debido a que prevaLece la actividad suficiente.
Un locus puede tener numerosos alelos mutantes
diferentes
• La existencia de varios alelos permite ocurrencia de
heterocigotos con cualquier combinacion en pares de alelos.
Un locus puede tener mas de un alelo de tipo
silvestre
• Un locus puede tener una distribucion polim6rfica de alelos
sin un aLeLo individual que pueda ser considerado como el
unico de tipo silvestre.
La recombinaci6n ocurre por el intercambio fisico
de DNA
• La recombinaci6n es resultado del entrecruzamiento que
ocurre en los quiasmas e involucra a dos de las cuatro
cromatidas.
• La recombinacion se debe a un rompimiento y una reuni6n
que tienen Lugar a traves de un intermediario de DNA hibrido.
El c6digo genetico se lee en tri pletes
• EL c6digo genHico se lee en tripletes de nucleotidos
denominados codones.
• Los tripletes no estan superpuestos y se leen a partir de un
punta fijo de inicio.
• Las mutaciones que insertan 0 eliminan bases individuales
provocan un cambio en Los grupos de tripletes despues del
sitio de la mutaci6n.
• Las combinaciones de mutaciones que insertan 0 eliminan
tres bases (0 multiplos de tres), insertan 0 eliminan
aminoacidos, pero no cambian La lectura de Los tripletes
mas aLla del ultimo sitio de mutacion.
(ada secuencia tiene tres marcos de lectura posibles
• Usualmente solo un marco de lectura es traducido y
los otros dos son bloqueados por senales frecuentes de
terminaci6n.
Los genes procari6ticos son coli neales
con sus proteinas
• Un gen procari6tico es un fragmento constante de 3N
nucleotidos que codifica a N aminoacidos.
• El gen, el RNAm y la proteina son todos colineales.
Numerosos procesos son necesarios para expresar
el producto protelnico de un gen
• Un gen procari6tico se expresa por transcripci6n en RNAm
y posteriormente por traducci6n del RNAm en una proteina.
• En Las eucariotas, un gen puede contener regiones internas
no representadas en la proteina.
• Las regiones internas son eliminadas del transcrito de RNA
por el corte y empaLme de este para dar origen a un RNAm
colineal respecto del producto proteinico.
• (ada RNAm esta formado por una regi6n lider 5' no
traducida, una regi6n codificadora y una regi6n posterior 3'
no traducida.
Las proteinas actuan en trans, pero los sitios del
DNA, en cis
• Todos los productos de los genes (RNA 0 protejnas) actuan
en trans; pueden actuar en cualquier copia de un gen en la
celula.
• Las mutaciones de actuacion en cis identifican a las
secuencias de DNA que son el objetivo de reconocimiento
de los productos de actuaci6n en trans. No se expresan
como RNA ni como proteinas, y afectan s6lo al fragmento
contiguo de DNA.
Resumen
23
gen son las diferentes formas que se encuentran en
su locus.
La clave para comprender la organizacion de los
genes en los cromosomas fue el descubrimiento del
ligamiento genetico, 0 tendencia de los genes de un
mismo cromosoma a mantenerse juntos en la pro-
genie, en Lugar de ordenarse de manera indepen-
diente, como pronostican las leyes de Mendel. Una
vez que se introdujo la unidad de recombinacion
(reordenamiento) como medida de vinculacion, fue
posible construir mapas geneticos.
La resolucion del mapa de recombinacion de
una eucariota superior esta restringida por 10 re-
ducido de la progenie que puede obtenerse de cada
cruza. La recombinaci6n es tan poco frecuente en-
tre puntos cercanos, que se observa rara vez entre
mutaciones diferentes del mismo gen. Por ello, en
los mapas de ligamiento clasico de las eucariotas se
puede colocar a los genes en orden, perc no es posi-
ble determinar las relaciones en un gen. Al cambiar
a un sistema microbiano en el cual se puede obtener
una progenie muy numerosa de cada cruza gene-
tica, los investigadores pudieron demostrar que la
recombinacion ocurre dentro de los genes y que si-
gue las mismas reglas que se dedujeron previamente
para la recombinacion entre genes.
En un gen, las mutaciones pueden estar organi-
zadas de forma lineaL con 10 cual se demuestra que
el gen mismo posee la misma construccion lineal
que el ordenamiento de genes en un cromosoma, de
modo que el mapa genetico es lineal en los loci y en-
tre estos: esta formado por una secuencia continua
dentro de la cual residen los genes. Esta conclusion
condujo naturalmente a la perspectiva moderna
que se resume en la I U A 2. , en la cual se consi-
dera que el material genetico de un cromosoma esta
farmado por una molecula ininterrumpida de DNA
que representa a numerosos genes.
- ..... ... . . • • • ••• AA
EI cromosoma contiene
numerosos genes
EI gen es la unidad funcional de la herencia que
constituye una secuencia del genoma cuya funcion
es dar origen a un producto discreto (ya sea una
protefna 0 un RNA); su comportamiento basico fue
definido por Mendel hace mas de un siglo. Resumi-
do en sus dos Leyes, el gen fue reconocido como un
"factor de partfculas" que se transmite sin cambios
del progenitor a su progenie. Un gen puede existir
en formas alternas que se conocen como alelos.
En los organismos diploides, los cuales tienen
dos conjuntos de cromosomas, una copia de cada
uno de ellos se hereda de cada progenitor, mismo
comportamiento exhibido por los genes. Una de las
dos copias de cada gen es el alelo paterno (heredado
del padre), el otro es el materna (heredado de la ma-
dre). La equivalencia condujo al descubrimiento de
que, de hecho, los cromosomas portan a los genes.
Cada cromosoma consiste en una estructura li-
neal de genes. Cada gen reside en una localizacion
particular del cromosoma. La localizacion se conoce
de manera mas formal como locus. Los alelos de un
III Introducci6n
Un cromosoma es una molecula de DNA muy larga . 00=;;;;;;;;;;;;;;;;;::""
Cada gen es parte de
una secuencia
continua de DNA
11
Inicio del gen Final del gen
III Un gen codifica a un solo
polipeptido
Conceptos principaLes
• La hip6tesis de un gen : una enzima resume las bases
de La geneiica moderna: que un gen es un fragmento
de DNA que codifica a una soLa cadena poLipeptidica.
• La mayorla de las mutaciones deterioran La funci6n deL
gen en el cual se producen.
CATATAAGGTGAGGTAGGATCAGTTGCTCCTCACAATGC
GTATATTCCAcrCCATCCTAGTCAAOGAGGAGTGTTACG
GU f Cada cromosoma tiene una sola molecula larga de
DNA dentro de La cual se encuentran las secuencias de genes
individuaLes.
Mediante el primer intento sistematico de relacionar
a los genes con las enzimas se demostr6 que cada
etapa de la ruta metabolica es catalizada par una sola
enzima y que puede ser bloqueada por mutaciones en
un gen diferente. Esto condujo ala hipotesis de un gen:
24 CAPITULO 2 Los genes codifican proteinas
una enzima. Cada paso metabolico es catalizado por
una enzima especffica cuya produccion es responsabi-
lidad de un solo gen. Una mutacion en el gen altera la
actividad de la proteina de la cual es responsable.
Para incluir a las proteinas formadas por mas de
lilla subunidad, es necesario modificar la hipotesis. Si
las subunidades son todas iguales, la proteina es un ho-
momultimero, y esta representada par un solo gen.
Si las subunidades son diferentes, la proteina es un he-
teromultimero. Expresada como una regIa mas ge-
neral aplicable a cualquier proteina homomultimerica,
la hipotesis de un gen : una enzima se manifiesta con
mayor precision como un gen : una cadena polipeptfdica.
Identificar que proteina representa a un gen en
particular puede ser tardado jLa mutacion que dio
lugar a los chfcharos rugosos murantes de Mendel
no se identifico sino hasta 1990, como una altera-
cion que inactiva al gen que codifica a una enzima
ramificadora del almidon!
Es importante recordar que un gen no produce
directamente una proteina. Como se mostro previa-
mente en la Figura 1.2, un gen codifica a un RNA,
que a su vez puede codificar a una proteina. La ma-
yor parte de los genes codifica a las proteinas, pero
algunos codifican moleculas de RNA que no produ-
cen proteinas. Dichas moleculas de RNA pueden ser
componentes estructurales del aparato responsable
de la sintesis de proteinas, 0 bien, regular la expre-
sian genetica. El principio basico consiste en que
el gen es una secuencia de DNA que especifica la
secuencia de un producto independiente. El proceso
. . . . ...
Homocigoto ~ Heterocigoto de Homocigoto
de tipo silvestre tipo silvestre/mutante mutante
Ambos aiel os Un alelo (dominante) Ninguno de los
producen produce una proteina alelos produce
protefnas activas activa proteinas
flOflO"''''r:J
n.n.fllflOe>.
-""""""
____ VI
t t
tipo silvestre tipo silvestre mutante
tipo silvestre mutante mutante
!
no. no. n. r> r:J
----
Fenotipo Fenotipo Fenotipo
silvestre silvestre mutante
FIGURA 2 2 Los genes codifican proteinas; la dominancia se
explica por las propiedades de las proteinas mutantes. Un alelo
recesivo no contribuye al fenotipo debido a que no produce nin-
guna proteina (0 produce una proteina que no es funcional).
de la expresion de los genes puede terminar en un
producto que sera RNA 0 proteina.
Una mutacion es un evento aleatorio respeCto de
la estructura del gen en el cual es muy probable que
se dane, 0 incluso que se suprima, la funcion del gen.
Casi todas las mutaciones que afectan el funciona-
miento de un gen son recesivas: representan ausencia
de funci6n, pues al gen mutante se Ie ha impedido producir
su protefna usual. En la I R 2 se ilustra 1a relacion
entre alelos de tipo recesivo y alelos de tipo silvestre.
Cuando un heterocigoto contiene un alelo de tipo
silvestre y un alelo de tipo mutante, este ultimo es
susceptible de regir la produccion de la enzima, y por
10 tanto, es dominante. (Esto implica que elunico
alelo de tipo silvestre produce una cantidad adecuada
de proteina. Cuando esto es falso, 1a menor cantidad
producida por un alelo, comparada con la de dos
alelos, resulta en el fenotipo intermedio de un alelo
parcialmente dominante en un heterocigoto.)
III Las mutaciones que
se presentan en el mismo gen
no se pueden complementar
Conceptos principales
• Una mutaci6n en un gen afecta s6lo a la proteina
codificada por la copia mutante del gen y no a las
proteinas codificadas por algOn otro alelo.
• La incapacidad de dos mutaciones para complementarse
(producir un fenotipo silvestre cuando se presentan en
configuraci6n trans en un heterocigoto) significa que
forman parte del mismo gen .
LComo determinamos si dos muraciones que provo-
can un fenotipo similar se encuentran en el mismo
gen? Si en e1 mapa estan muy cerca, pueden ser ale-
los. Pero tambien podrian representar mutaciones
de dos genes diferentes cuyas proteinas estan impli-
cadas en la misma funcion. La prueba de comple-
mentacion permite determinar si dos muraciones
yacen en el mismo gen 0 en genes diferentes. La
prueba consiste en hacer un heterocigoto para las dos
mutaciones (apareando a progenitores homocigoti-
cos para cada muracion).
Si las mutaciones se encuentran en el mismo
gen, los genotipos progenitores pueden represen-
tarse como:
m] m
2
-y-
In] m
2
El primer progenitor proporciona un alelo mu-
tante m] y el segundo, un alelo m
2
, por 10 tanto, el
heterocigoto tendra 1a constitucion:
2.3 Las mutaciones que se presenta n en el mismo gen no se pueden complementar 2S
MUTACIONES EN EL MISMO GEN
. . .
No se observa ningun gen de tipo silvestre, por 10
tanto, el heterocigoto tiene un fenotipo mutante.
Si la mutacion yace en genes diferentes, los ge-
notipos progenitores pueden representarse como:
m
l
+ +m
2
-y-
m
1
+ +m
2
Cada cromosoma tiene una copia tipo silvestre
de un gen (representada por el signa mas) y una
copia mutante del otro, de modo que la constitucion
del heterocigoto sera:
m
1
+
+m
2
en la cuallas dos progenitores han proporcionado
una copia de tipo silvestre de cada gen. El heteroci-
goto tiene el fenotipo silvestre, de modo que se dice
que los dos genes se complementan.
La prueba de la complementacion se describe
mas ampliamente en la FI ? ". La basica consiste
en la comparacion que se muestra en la parte supe-
rior de la figura. Si dos mutaciones se encuentran
en el mismo gen, se observa una diferencia en los
fenotipos de la configuracion trans y de la configura-
cion cis. La configuracion trans es mutante, pues cada
alelo tiene una mutacion (difereme). Sin embargo,
la configuracion cis es de tipo silvestre, debido a que
un alelo tiene dos mutaciones y el otro, ninguna.
En la parte inferior de la figura se muestra que si las
dos mutaciones se encuentran en genes diferentes,
siempre se observara un fenotipo silvestre. Siempre
hay un alelo de tipo silvestre y un alelo mutante de
cada gen, y la configuracion no tiene importancia.
La incapacidad para complementar significa que dos
mutaciones son parte de la misma unidad genetica.
Se dice que las mutaciones que no se complementan
forman parte del mismo grupo de complementa-
cion. Otro termino utilizado para describir a la uni-
dad definida porIa prueba de complememacion es
cistron, que significa 10 mismo que gen. Basicamen-
te estos tres terminos describen a un fragmento de
DNA que funciona como una unidad que dara lugar
a un RNA 0 un producto protefnico. Las propiedades
del gen respecto de la complementacion se explican
por el hecho de que este producto es una molecula
(mica que se comporta como una unidad funcional.
• Las mutaciones recesivas son provocadas por perdida
de funci6n del producto proteinico.
• Las mutaciones dominantes son resultado de una
ganancia de funci6n.
• La evaluaci6n de la esencialidad de un gen requiere de una
mutaci6n nula (que elimine por completo su funci6n).
• Las mutaciones silenciosas no tienen ningun efecto
porque el cambio de base no altera la secuencia ni
la cantidad de proteina, 0 porque el cambio de la
secuencia de la proteina no tiene ningun efecto.
• Las rnutaciones rezumantes (0 hipomorfas) afectan a la
funci6n del producto del gen, pero no se observan en
el fenotipo porque queda actividad suficiente.
Conceptos principales
lit Las mutaciones pueden
provocar perdida 0 ganancia
de funci6n
configuraci6n cis configuraci6n trans
R oJ El cistr6n se define mediante la prueba de complemen-
taci6n. Los genes estan representados por espirales; los asteriscos
rojos identifican a los sitios de mutaci6n.
Los diversos efectos posibles de las mutaciones
en un gen se resumen en la r
Cuando un gen ha side identificado, en principio
se puede !legar a conacer su funcion produciendo
un organismo mutante que carezca completamente
del gen. Una mutacion que elimina por completo la
funcion de un gen,normalmente porque el gen ha
sido eliminado, se llama mutacion nula, y si el gen
es esencial, la mutacion nula es letal.
Para determinar el efecto del gen en el fenoti-
po, es fundamental caracterizar a un mutante nulo.
Cuando una mutacion no afecta al fenotipo, siem-
pre cabe la posibilidad de que se trate de una muta-
cion rezumante, es decir, se produce una cantidad
suficiente de producto activo para que cumpla con
su funcion, aunque la actividad se reduce cuantita-
tivamente 0 es cualitativamente diferente del tipo
silvestre. Sin embargo, si una mutacion nula no
afecta al fenotipo, se puede conduir con toda segu-
ridad que la funcion del gen no es necesaria.
tipo silvestre
mutante 2
~ ~ mutantedoble
t t
VVVV VVifV Un gen es de
\1' I'",/V VVVV tipo silvestre
~ ~ Fenotipo silvestre
~ ~ tiposilvestre mutante 2
tipo silvestre
mutante 1
mutante 1
MUTACIONES EN GENES DIFERENTES (configuraci6n trans)
~
VVVV
VVVV
~
Sin complementaci6n
Fenotipo mutante
Complementaci6n
(fenotipo silvestre)
Una copia de cada
gen es de tipo silvestre
26 CAPITULO 2 Los genes codifican proteinas
Concepto principal
• La existencia de aLeLos muLtiples permite que los heterocigotos
representen cuaLquier combinaci6n en pares de aLeLos.
Un locus puede tener numerosos
alelos mutantes diferentes
Si se produce una mutacion recesiva por cada cambio
que impide la produccion de una protefna activa en
un gen, debe haber gran numero de dichas mutacio-
nes en cualquier gen. Numerosos remplazos de ami-
noacidos pueden cambiar la estructura de la proteina
10 suficiente como para impedir su funcion.
Las diferentes variantes del mismo gen se lla-
man alelos multiples, y su existencia permite la
creacion de un heterocigoto entre alelos mutantes.
La relacion entre estos alelos multiples asume di-
versas farmas.
En el caso mas sencillo, un gen de tipo silvestre
codifica a un producto proteinico funciona!. EI alelo
mutante, 0 los alelos mutantes, codifica(n) protei-
nas que no son funcionales.
Sin embargo, con frecuencia se presentan casos
en que una serie de alelos mutantes tiene fenotipos
diferentes. Por ejemplo, la funcion de tipo silvestre del
locus blanco de la Drosophila melanogaster es necesaria
para el desarrollo del color rojo normal de los ojos. EI
locus recibe su nombre segun el efecto de mutaciones
(nulas) extremas, las cuales provocan que la mosca
tenga ojos blancos en homocigotos mutantes.
Para describir a los alelos mutantes y a los de tipo
silvestre, el genotipo silvestre se indica mediante un
superindice "mas" (+) despues del nombre del locus
(w es el alelo silvestre para los ojos [rojos] de la D.
melanogaster). En algunos casos se utiliza el simbolo
+ para describir el alelo de tipo silvestre, y solo los
alelos mutantes se indican con el nombre del locus.
Una forma completamente defectuosa del gen (0
ausencia de fenotipo) suele indicarse mediante un su-
perindice "menos" (-). Para poder distinguir entre una
variedad de alelos mutantes con efeetos diferentes,
pueden utilizarse on'os superindices, como Wi 0 w
a
.
El alelo w es dominante respecto de cualquiera
otro en los heterocigotos. Hay muchos aIelos mutan-
tes diferentes; una muestra (pequefia) se ilustra enla
GURA 2 5. Si bien algunos alelos carecen de color de
ojos, muchos otros producen algllD color, de modo
que cada uno de estos alelos mutantes representara
una mutacion diferente del gen, la cual no elimina
por completo su funcian, sino que deja una actividad
residual que produce un fenotipo caracteristico. En
un homocigoto, estos aielos son denominados por el
color de los ojos. (La mayoria de los alelos wafectan
la cantidad de pigmento del ojo. Los ejemplos de la
figura estan organizados [mas 0 menos] en orden
descendente de cantidad de color, pero otros, como
el w
SP
, afectan el patron en el cual es depositado.)
Cuando existen muchos alelos, un animal pue-
de ser un heterocigoto que porte dos alelos mutantes
diferentes, y su fenotipo dependera de la naturaleza
de la actividad residual de cada alelo. En principio,
la relacion entre dos alelos mutantes no difiere de la
que se observa entre los alelos mutantes y los de
Una mutaci6n puntual
puede dafiar la funci6n
~ Y /
!

Una mutaci6n puntual puede
crear una nueva funci6n
WJW\.YAU
~
.,
Una mutaci6n nula no
produce protefnas
WJW\.'YAU
!
Una mutaci6n silenciosa
no afecta a la proteina
WJ\U\1lJ\U
!
~
EI gen de tipo silvestre codifica a una protefna
'WA.YM7\JU
~
~
FIGURA 2.' Las mutaciones que no afectan a la secuencia 0
a La funci6n de La proteina son siLenciosas, en tanto que las
mutaciones que eLiminan toda La actividad de la proteina son
nulas. Las mutaciones puntuales que provocan perdida de la
funcion son recesivas, a diferencia de las que provocan ganan-
cia de la funcion, que son dominantes.
Las mutaciones nulas, u otras mutaciones que
impiden la funcion del gen (pero que no necesa-
riamente la eliminan por completo) se denominan
mutaciones de perdida de funcion (0 amorfas).
Una mutacion de perdida de funcion es recesiva
(como en el ejemplo de la Figura 2.2). En ocasiones,
una mutacion tiene el efeeto opuesto y provoca que
una proteina adquiera una nueva funcion; dicho
cambio es conocido como mutacion de ganancia
de funcion, la cual es dominante.
No todas las mutaciones del DNA provocan
cambios detectables en el fenotipo; aquellas sin un
efecto aparente se conocen como mutaciones si-
lenciosas, las cuales pueden ser de dos tipos; uno
de eUos implica cambios de bases en el DNA que
no provocan ningllD cambio en el aminoacido de la
proteina correspondiente, en tanto que el segundo,
cambia al aminoacido, perc el remplazo en la pro-
teina no afecta a su actividad; a estas sustituciones
se les llama neutrales.
2.5 Un locus puede tener numerosos alelos mutantes diferentes 27
transferasa A
'-Yi\.W\."VJ\:.Y/
gen A

2 Delecion 2J. cambios de aminoacidos
F
J.1 antigeno 0
uca. gen B
'-'YA.YA.YlVU
transferasa B
Gala.1
.
: antigeno B 1-R
i
Fuca.1
Alelo Fenotipo del homocigoto
w+ ojos rojos (fenotipo silvestre)
W
bl
sangre
cereza
w
bf
gamuza
w
h
miel
we albaricoque
we eosina
wi marfil
W
Z
cascara de limon (amarillo limon)
If'fP moteado, el color varia
w
1
blanco (sin color)
Ellocus wtiene una serie extensa de alelos cuyos
fenotipos van del color de tipo silvestre (rojo) a la ausencia
total de pigmento.
tipo silvestre: un alelo puede ser dominante, puede
haber dominancia parcial, 0 codominancia.
..................
GaiNAca1
J,.
antfgenoA
2
i
Fuca.1
t
III Un locus puede tener mas
de un alelo de tipo silvestre
Fenotipo
o
A
B
AB
Genotipo
00
AOoAA
BOo BB
AB
Actividad
Ninguna
N-Ac-gal transferasa
Gal transferasa
GaIN-Ac-Gal-transferasa
Concepto principal
• Un locus puede tener una distribuci6n polim6rfica de
alelos sin un alelo individual que pueda ser considerado
como el unico de tipo silvestre.
No necesariamente hay un solo tipo de alelo silves-
tre en un locus especffico, por ejemplo, el control
del sistema del grupo sangufneo. La falta de fun-
cion es representada por el tipo nulo, 0 grupo O. No
obstante, los alelos funcionales A y B proporcionan
actividades codominantes entre sf y dominantes
respecto del grupo O. Las bases de esta relacion se
ilustran en la FG A 2 6.
El antfgeno 0 (0 H) se genera en todos los indivi-
duos. y consiste de un grupo carbohidrato particular
que se agrega a las protefnas. Ellocus ABO codifica
a una enzima galactosil-transferasa que agrega otro
grupo de azucar al antfgeno O. La especificidad de
esta enzima determina el grupo sangufneo. EI alelo A
da lugar a una enzima que utiliza el cofactor UDP-N-
acetilgalactosa y crea el antfgeno A. EI alelo B produ-
ce una enzima que utiliza el cofactor UDP-galactosa
y crea el antfgeno B. Las versiones A y B de la pro-
tefna transferasa difieren en matro aminoacidos que
presumiblemente afectan su reconocimiento del tipo
de cofactor. El alelo 0 tiene una mutacion (delecion
pequefia) que elimina la actividad, de modo que en
el antfgeno 0 no hay modificaciones.
Esto explica porque los alelos A y B son domi-
nantes en los heterocigotos AO y BO: la actividad
28 CAPITULO 2 Los genes codifican proteinas
FIGURA 2.6 El locus del grupo sanguineo ABO codifica a la
galactosiltransferasa cuya especificidad determina el grupo
sanguineo.
transferasa correspondiente crea el antfgeno A 0 el
B. Los alelos A y B son codominantes en los hete-
rocigotos AB debido a que ambas actividades trans-
ferasa estan expresadas. EI homocigoto 00 es nulo
y no tiene ninguna actividad, por 10 tanto, carece
de ambos antfgenos.
Ni A ni B pueden ser considerados unicamente
como de tipo siJvestre porque representan actividades
alternativas, mas que perdida 0 ganancia de funcion.
Una situacion como esta, en la que hay multiples ale-
los funcionales en una poblacion, se describe como
polimorfismo (vease la seccion 4.3, Los genomas
ill.dividuales muestran una variacion extensa).
III La recombinaci6n ocurre
por intercambio fisico de DNA
Conceptos principales
• La recombinaci6n es resultado del entrecruzamiento
en los quiasmas e involucra a dos de las cuatro
cromatidas.
• La recombinaci6n ocurre por rompimiento y reuni6n,
que tienen lugar a traves de un intermediario de DNA
hibrido.
Recombinaci6n intermedia
Moleculas de DNA progenitor
. ...
A B
A B
a b
a b
~
A
A
a
a
::1 quiasma
~ s provocado por
antrecruzamiento entre dos
.e las cromatidas
Dos cromosomas siguen siendo
os progenitores (AB y ab).
-os cromosomas recombinantes ~ ~ ~ ~ ~ ~ ~ ~
contienen material de cada
orogenitor y tienen nuevas ~ ~ ~ ~ ~ ~ ~ ~
ombinaciones geneticas (Ab yaB).
_ bivalente
:ontiene 4 cromatidas,
2: de cada progenitor
r J A 2" La formaci6n del quiasma es responsable de la
-roducci6n de recombinantes.
=-a recombinacion genetica describe la generacion
de combinaciones nuevas de alelos en cada gene-
::-acion de organismos diploides. Las dos copias de
(ada cromosoma pueden tener diferentes alelos en
algunos loci. Intercambiando las partes correspon-
dientes entre los cromosomas. se pueden generar
cromosomas recombinantes diferentes de los cro-
mosomas progenitores.
La recombinacion resulta de un intercambio fi-
ico de material cromosomico. fenomeno visible en
el entrecruzarniento que ocurre durante la meiosis
division especializada por la que se producen las ce-
luJas gerrninales haploides). La meiosis empieza con
una celula que ha duplicado sus cromosomas, de tal
forma que posee cuatro copias de cada uno. En las
primeras etapas de la meiosis, esas cuatro copias estan
fntimamente relacionadas (en sinapsis) en una estruc-
tura llamada bivalente. En esta etapa. cada unidad
cromosornica se denomina cromatida. Los intercam-
bios en pares de material ocurren entre cromaridas.
EI resultado visible de un evento de entrecruza-
rniento se denomina quiasma, y se Hustra a manera
de diagrama en la u . Un quiasma es un sitio
en el que dos de las cromatidas de un bivalente se
han rota en los puntos correspondientes. Los extre-
mos rotos se han reunido de forma entrecruzada, ge-
nerando nuevas cromatidas. Cada cromatida nueva
esta formada por material proveniente de una cro-
matida de un lado del punto de union y por material
proveniente de la otra cromatida en ellado opuesto.
Las dos cromaridas recombinantes poseen estructuras
recfprocas. El evento se define como rotura y re-
union. Su naturaleza explica porque un solo evento
de recombinacion puede producir solo el 50% de re-
combinantes: cada evento de recombinacion involu-
cra solo dos de las cuatro cromaridas asociadas.
Recombinantes
La recombinaci6n implica el apareamiento entre las
cadenas complementarias de dos dOplex de DNA progenitores.
La complementariedad de las dos cadenas de
DNA es esencial para el proceso de recombinacion.
Cada una de las cromaridas que se muestran en
la Figura 2.7 consiste en un larguisimo duplex de
DNA. Para que estas se rompan y reconecten sin
perdida de material. se requiere de un mecanismo
que reconozca exactamente las posiciones corres-
pondientes, 10 cual sucede gracias al apareamiento
complementario de bases.
La recombinacion implica un proceso en el cual
las cadenas individuales de la region de entrecru-
zamiento intercambian parejas. En la se
muestra que este evento da lugar a un fragmento
de DNA hibrido, en el cualla cadena individual
de un duplex se aparea con su complemento prove-
niente del otro duplex. Por supuesto. el mecanismo
involucra otras etapas (las cadenas deben romperse
y resellarse) que se analizaran en detalle en el Capi-
tulo 20. Sistemas de reparacion. pero la caracteristica
crucial que hace posible ]a recombinacion exacta es
la complementariedad de las cadenas de DNA. La
figura muestra solo algunas etapas de la reaccion.
pero podemos observar que en ]a recombinacion
intermedia se forma un fragmento de DNA hfbrido
cuando una sola cadena cruza de un duplex a otro.
Cada recombinante esta formado por un duplex de
DNA progenitor dellado izquierdo, el cual esta co-
nectado por un fragmento de DNA hfbrido a] otro
duplex progenitor dellado derecho. Cada duplex de
2.7 La recombinaci6n ocurre por intercambio fisico de DNA 29
DNA corresponde a una de las cromatidas implicadas
en el proceso de recombinacion de la Figura 2.7.
La formacion del DNA hfbrido exige que las se-
cuencias de los duplex recombinantes se encuentren
10 suficientemente cerca como para lograr el aparea-
miento entre las cadenas complementarias. Si no hay
diferencias entre los dos genomas progenitores en
esta region, la formacion de DNA hfbrido sera perfec-
ta. Sin embargo, la reaccion puede ser tolerada aun
cuando haya diferencias diminutas, en cuyo caso, el
DNA hfbrido tiene puntos de apareamiento erroneo,
en los cuales una base de una cadena confronta a una
base de la otra cadena que no es complementaria.
La correccion de dichos errores de apareamiento es
otra caracteristica de la recombinacion genetica (vea-
se Capitulo 20, Sistemas de reparacion).
III El c6digo genetico se lee
en tripletes
Conceptos principales
• El c6digo genetico se lee en tripletes de nucle6tidos
denominados codones.
• Los tripletes no estan superpuestos y se leen a partir
de un punta fijo de inicio.
• Las mutaciones que insertan 0 eliminan bases
individuales provocan un cambio en los grupas de
tripletes despues del sitio de la mutaci6n.
• Las combinaciones de mutaciones que insertan 0
eliminan a tres bases en conjunto (0 en multiplos
de tres) insertan 0 eliminan aminoacidos, pero no
cambian la lectura de los tripletes mas alla del ultimo
sitio de mutaci6n.
Cada gen representa una cadena proteinica especf-
fica. El concepto de que cada protefna esta formada
par una serie de aminoacidos en particular, data de la
caracterizacion de Sanger de la insulina, de la decada
de 1950. El descubrimiento de que un gen esta for-
mado par DNA dio lugar a la interrogante de como
una secuencia de nucleotidos del DNA represen-
ta una secuencia de aminoacidos en las protefnas.
Una caracteristica clave de la estructura general
del DNA es que es independiente de la secuencia parti-
cular de los nucleatidos que la componen. La secuencia
de nucleotidos del DNA es importante no por su
estructura per se, sino porque codifica a la secuencia
de aminoacidos que constituye al polipeptido co-
rrespondiente. La relacion entre una secuencia de
DNA y la secuencia de la protefna correspondiente
se denomina codigo genetico.
La estructura y la actividad enzimatica de las
proteinas se deben a su secuencia primaria de ami-
noacidos, que al ser determinada en cada una, el
gen puede transportar toda la informacion necesa-
ria para especificar una cadena polipeptidica aeti-
30 CAPITULO 2 Los genes cadifican proteinas
va. De esta manera, un solo tipo de estructura -el
gen- es susceptible de representarse a sf mismo en
innumerables formas de polipeptidos.
En conjunto, los diversos productos proteinicos
de una celula asumen las actividades catalfticas y
estructurales responsables de establecer su fenoti-
po. Obviamente, ademas de las secuencias que co-
difican a las protefnas, el DNA tambien contiene
ciertas secuencias cuya funcion es ser reconocidas
por moleculas reguladoras, usualmente proteinas.
En este caso, la funcion del DNA es determinada
directamente por su secuencia, no a traves de un
codigo intermediario. Ambos tipos de region, los
genes expresados como protefnas y las secuencias
reconocidas como tales, constituyen la informacion
genetica.
El codigo genetico es descifrado por un meca-
nismo complejo que interpreta las secuencias de los
acidos nucleicos, el cual es esencial si la informacion
transportada en el DNA tiene que tener algun signi-
ficado. En una region dada, solo una de las dos ca-
denas de DNA codifica a una protefna, por 10 tanto,
el codigo genetico se representa como una secuen-
cia de bases (mas que como pares de bases).
El codigo genetico se lee en grupos de tres nu-
cleotidos, cada uno de los cuales representa a un
aminoacido; cada secuencia de tres nucleotidos se
denomina codon. Un gen incluye una serie de co-
dones que se lee de forma secuencial desde un pun-
to de partida de un extremo hasta un punto final, en
el otro extremo. Escrita en la direccion convencio-
nal 5' a 3', la secuencia de nucleotidos de la cadena
de DNA que codifica a la proteina corresponde a la
secuencia de aminoacidos de la proteina escrita de
terminal N hasta terminal C.
El codigo genetico se lee en tripletes no superpues-
tos a partir de un punto fijo de inicio:
• No superpuestos implica que cada codon
esta formado par tres nucleotidos y que los
codones sucesivos estan representados por
trinucleotidos sucesivos.
• El uso de un punta fijo de iniciacian significa
que el ensamblaje de una proteina debe co-
menzar en un extremo y avanzar hacia el
otro, de manera que las diferentes partes
de la secuencia codificadora no puedan ser
lefdas de manera independiente.
La naturaleza del codigo pronostica que dos tipos de
mutaciones tendran efeetos cliJerentes. Si una secuen-
cia en particular se lee de forma secuencial como:
UUU AAA GGG CCC (codones)
aa1 aa2 aa3 aa4 (aminoacidos)
entonces una mutacion puntual afectara. solo a un
aminoacido. Por ejemplo, la sustitucion de una A
por cualquier otra base (X) provoca que aa2 sea
remplazado por aa5:
Mutante doble C- ~
:=:J GCU GCU AGC UGC UGC UCU GCU GCUrz:
A a la Ser Cys Cys Ser Ala Ala
Mutante triple C- C- C-
:=:J GCU GCA UGC UGC AUG CAU GCU GCUC
Ala Ala Cys Cys Met His Ala Ala
UUU AAX GGG CCC
aal aa5 aa3 aa4
porque solo el segundo codon ha sufrido cambios.
Sin embargo, una mutaci6n que inserta 0 elimina
una sola base cambiara a los grupos de tripletes de toda la
secuencia subsiguiente. Un cambio de este tipo se lla-
ma desplazantiento del marco de lectura. Una
insercion puede asumir la siguiente forma:
UUU AAX AGG GCC C
aal aa5 aa6 aa7
Debido a que la nueva secuencia de tripletes
es completamente diferente a la antigua, la secuencia
completa de aminoclcidos de la protefna se modifica
a partir del sitio de la mutacion, de modo que es
probable que la funcion de la protefna se pierda por
completo. Las mutaciones de cambio del marco de
lectura son inducidas por las acridinas, compuestos
que se unen al DNA y que distorsionan la estructu-
ra de la doble helice, provocando la incorporacion
de bases adicionales 0 la omision de bases durante
el proceso de replicacion. Cada evento mutagenico
provocado por una acridina resuIta en la adicion 0
eliminacion de un solo par de bases.
Si se produce un mutante de acridina por, diga-
mos, la adici6n de un nucleotido, este debe regresar
al tipo silvestre por la delecion de dicho nucleotido.
Sin embargo, la reversion tambien puede ser provo-
cada por delecion de una base diferente en un sitio
cercano al primero. Las combinaciones de dichas
Concepto principal
• En general, solo un marco de lectura es traducido, los OtTOS
dos son bloqueados por senales frecuentes de terminacion.
mutaciones proporcionan evidencias reveladoras
referentes a la naturaleza del codigo genetico.
En la se ilustran las propiedades de
las mutaciones de cambio del marco de lectura. Una
insercion 0 una delecion cambia la secuencia com-
pleta de la protefna despues del sitio de la mutacion,
pero la combinacion de una insercion y una delecion
hace que el codigo se lea de forma incorrecta solo
entre los dos sitios de mutacion; la lectura correcta
se restablece despues del segundo sitio.
En 1961, mediante el analisis genetico de las mu-
taciones por acridina en la region rII del fago T6 se
demostro que todas las mutaciones podrian ser cla-
sificadas en uno de dos grupos descritos como (+) 0
(-). Cada tipo de mutacion provoca por sf misma un
cambio en el marco de lectura: el tipo (+) por adicion
de una base y el tipo (-) por delecion de una base. Las
combinaciones de mutantes dobles de los tipos (++) Y
(- -) siguen mostrando un comportamiento mutan-
te, pero las combinaciones de los tipos (+ -) 0 (- +)
se suprimen una a la otra. En este caso, la segunda
mutacion se describe como supresora del cambio
en el marco de lectura de la primera mutacion.
(En el contexto de este trabajo, la palabra "supresOI"
se utiliza en un sentido inusual porque la segunda
mutacion esta en el mismo gen que la primera.)
Estos resultados muestran que el codigo genetico
debe ser lefdo como una secuencia establecida pOI el
punto de iniciacion, de modo que las adiciones 0 las
deleciones se compensan mutuamente, mientras que
las adiciones 0 las deleciones dobles siguen siendo
mutantes. De cualquier forma, estos hallazgos no re-
velan cuantos nucleotidos constituyen cada codon.
Cuando se construyen mutantes triples, solo las
combinaciones (+++) y (- - -) muestran el fenoti-
po silvestre, mientras que las otras siguen siendo
mutantes. Si se considera que tres adiciones 0 tres
deleciones corresponden respectivamente a la adi-
cion 0 la omision global de un solo aminoacido, esto
implica que el codigo se lee en tripletes. Entre los
dos sitios de mutacion hay una secuencia incorrecta
de aminoacidos, mientras que a cada lado de los
sitios de mutacion las secuencias siguen siendo de
tipo silvestre, como se indica en la Figura 2.9.
III (ada secuencia tiene tres
marcos de lectura posibles
Secuencia mutante Secuencia de tipo silvestre
Las mutaciones de cambia del marco de lectura
muestran que el codigo genetico se lee en tripletes desde un
punta fijo de inicio.
Si el codigo genetico se lee en tripletes no superpues-
tos, son tres las formas posibles de traducir cualquier
2.9 (ada secuencia tiene tres marcos de lectura posibles 31
secuencia de nucleotidos en protefnas, dependiendo
del punto de iniciacion; a dichas secuencias se les
llama marcos de lectura. Para la secuencia
ACGACGACGACGACGACG
los tres marcos de lectura posibles son
ACG ACG ACG ACG ACG ACG ACG
CGACGACGACGACGACGACGA
GAC GAC GAC GAC GAC GAC GAC
Los genes procari6ticos son
coLineales can sus protelnas
Conceptos principales
• Un gen procari6tico es un fragmento constante de 3N
nucle6tidos que codifica a Naminoacidos.
• El gen, el RNAm y la protelna son todos colineales.
J Un marco de lectura abierto empieza con AUG y continua
en tripletes hasta un cod6n de terminaci6n. Los marcos de lectura
bloqueados pueden ser interrumpidos con frecuencia por codones de
terminaci6n.
Un marco de lectura que consta exclusivamente
de tripletes que representan a aminoacidos, se llama
marco de lectura abierto u 0 RF (open reading fra-
me). Una secuencia que se traduce en una protefna
tiene un marco de lectura que empieza con un co-
don de iniciacion especial (AUG) y que posterior-
mente se extiende a traves de una serie de tripletes
que represeman a aminoacidos, hasta terminar en
uno de los tres tipos de codones de terminacion
(vease el Capftulo 7, El RNA mensajero).
Cuando un marco de lectura no puede ser tra-
ducido en protefna porque con frecuencia se pre-
seman codones de terminacion, se dice que esta
bloqueado. Si una secuencia esta bloqueada en los
tres marcos de lectura, no puede tener la funcion de
codificar a una protefna.
Cuando se obtiene la secuencia de una region de
DNA de funcion desconocida, se analiza cada marco
de leetura posible para determinar si esta abierto 0
bloqueado. Normalmente, no mas de uno de los tres
marcos de lectura posibles esta abierto en un solo
fragmento de DNA. En la r se muestra el
ejemplo de una secuencia que puede leerse en solo
un marco de lectura debido a que los marcos de lec-
tura alternativos estan bloqueados por codones de
terminacion frecuentes. Es poco probable que por
casualidad exista un marco de lectura largo y abier-
to; si no se tradujera en una protefna, no habrfa pre-
sion selectiva para evitar la acumulacion de codones
de terminacion, de modo que la identificacion de un
marco de lectura largo y abierto se considera como
evidencia en primera instancia de que la secuencia se
traduce en proteina en dicho marco. Un ORF para
el cual no se ha identificado un producto protefnico
suele denominarse marco de lectura no identificado
(URF, unidentified reading frame).
EI segundo marco de lectura
esta bloqueado
EI tercer marco de lectura
esta bloqueado
Comparando la secuencia de nucleotidos de un gen
con la secuencia de aminoacidos de una protefna,
podemos determinar directamente si el gen y la
protefna son colineales; esto es, si la secuencia de
nucleotidos del gen corresponde exactamente a la
secuencia de aminoacidos de la protefna. En las bac-
terias y sus virus hay una equivalencia exacta, cada
gen contiene un fragmento continuo de DNA cuya
longitud es directamente proporcional al numero de
aminoacidos de la protefna que representa. Es ne-
cesario un gen de 3N pares de bases (bp, base pairs)
para codificar una protefna de N aminoacidos, de
acuerdo con el codigo genetico.
La equivalencia del gen bacteriano y su produc-
to significa que un mapa ffsico de DNA correspon-
ded exactamente a un mapa de aminoacidos de la
protefna. (,Que tan bien se acoplan estos mapas con
el mapa de recombinacion?
El paralelismo del gen y la protefna se investigo
originalmente en el gen de la triptofano sintetasa
de E. coli. La distancia genetica se valoro a traves del
porcentaje de recombinacion entre mutaciones, en
tanto que la distancia de la protefna se midio por
medio del numero de aminoacidos que separaban a
los sitios de remplazo. En la l se comparan
ambos mapas. El orden de siete sitios de mutacion es
el mismo que el orden de los sitios correspondien-
teS a los remplazos de aminoacidos, y las distancias
de recombinacion son relativamente similares a las
distancias reales de la proteina. El mapa de recom-
binacion amplfa las distancias entre algunas muta-
ciones, pero por 10 demas, la distorsion del mapa de
recombinacion es escasa, respecto del mapa fisico.
El mapa de recombinacion hace ver dos puntos
generales acerca de la organizacion del gen. Muta-
ciones diferentes pueden provocar que un amino-
acido de tipo silvestre sea remplazado por sustitutos
diferentes. Si dos de estas mutaciones no pueden
recombinarse, deben involucrar mutaciones pun-
tuales diferentes en la misma posicion del DNA. Si
las mutaciones pueden separarse en el mapa gene-
tico, pero afectan al mismo aminoacido en el mapa
superior (las lineas comunicantes convergen en la
figura) , deben implicar a mutaciones puntuales en
posiciones diferentes que afectan al mismo amino-
acido debido a que la unidad de recombinacion ge-
32 CAPiTULO 2 Los genes codifican protelnas
.. .. . . . ... . .. ... . .. - . .-.
Conceptos principales
netica (en realidad 1 bp) es mas pequena que la uni-
dad que codifica al aminoacido (en realidad 3 bp).
IGUR El mapa de recombinacion del gen de la tripto-
fano sintetasa corresponde a la secuencia de aminoacidos de
la protei na.
EI DNA esta formado par dos cadenas apareadas por medio de bases
cadena superior
5' ATGCCGTIAGACCGTIAGCGGACCTGAC
3' TACGGCAATCTGGCAATCGCCTGGACTG
t
cadena inferior
Sfntesis
de RNA
5'AUGCCGUUAGACCGUUAGCGGACCUGAC3
EI RNA tiene la misma secuencia que la cadena superior de DNA;
es complementaria a la cadena inferior de DNA
El RNA se sintetiza utilizando una cadena de DNA
como molde para el apareamiento complementario de las bases.
mente, para sintetizar protefna (como se 0 bserva
en detalle en el Capftulo 7, El RNA mensajero).
El RNA mensajero se sintetiza por el mismo
proceso de apareamiento complementario de bases
utilizado para replicar el DNA, con la importante
diferencia de que corresponde solo a una cadena del
DNA de doble helice. En la se muestra
que la secuencia del RNAm es complementaria de
la secuencia de una cadena de DNA y que es icten-
tica (excepto por el remplazo de T por U) ala otra
cadena de DNA. La forma convencional de escribir
las secuencias del DNA implica que la cadena de
arriba vaya en direccion 3', con la secuencia
igual a la del R A.
El proceso por el cual un gen da lugar a una
protefna se llama expresion genica, que en las
bacterias consta de dos etapas. La primera etapa
es la transcripcion, durante la cual se produce
una copia de RNAm de una cadena del DNA, en
tanto que la segunda es la traduccion del RNAm
en una protefna. Mediante este proceso se lee en
tripletes la secuencia de un RNAm para originar
la serie de aminoacidos que crea a la protefna co-
rrespondiente.
Un RNAm incluye a una secuencia de nucleo-
tidos que corresponde ala secuencia de aminoaci-
dos de la protefna; esta parte del acido nucleico se
conoce como region codificadora. Sin embargo,
el RNAm incluye secuencias adicionales en ambos
extremos, las cuales no representan directamente
a una protefna. La region 5' no traducida se llama
lider, en tanto que a 1a region 3' no traducida se 1e
conoce como remolque.
El gen incluye la secuencia completa represen-
tada en el RNA mensajero. Ocasionalmente, las
mutaciones que impiden la funcion del gen se en-
cuentran en las regiones adicionales no codificado-
ras, con 10 cual se confirma la perspectiva de que
dichas regiones comprenden una parte legftima de
la unidad genetica.
Las mutaciones pueden
estar separadas, perc afectan
a la misma posicion
Glu Proteina
@
@! @)
I II I
Ty.: r :: :Q
II II
: de tipo silvestre :: : :: ::
I 111 I' II
t Mapa de a.miriOacido " 'e la 'rotina
1 : i I : I
: ,': : \
:-Distancia entre ---i\\
I II' 'II 1\\
"iO' de": '"
I II I III
'@111111
V Proteina mutante Cis: II :: v
I I II
, "
GI Ar :
,
Mutaciones diferentes
en la misma posicion
• Un gen procariotico se expresa por transcripcion en
RNAm y posteriormente por traduccion del RNAm en
una proteina.
• En las eucariotas, un gen puede contener regiones
internas no representadas en la proteina.
• Las regiones internas son eliminadas del transcrito de
RNA por el corte y empalme de este para dar origen a
un RNAm colineal respecto del producto proteinico.
• Cada RNAm esta formado par una region lider 5'
no traducida, una region codificadora y una region
posterior 3' no traducida.
Al comparar un gen y una protefna se trata solo
con la secuencia de DNA ubicada entre los puntos
correspondientes a los extremos de la protefna. Sin
embargo, un gen no se traduce directamente a una
protefna, se expresa mediante la produccion de un
RNA mensajero (RNAm, messenger RNA), que es
un acido nuclei co intermedio utilizado, efectiva-
fill Numerosos procesos son
necesarios para expresar el
producto proteinico de un gen
2.11 Numerosos procesos son necesarios para expresar el producto proteinico de un gen 33
RNAm
.. ..
Ex6N 1 Ex6N 2
¥/
!
RNAl
5' V. /\. 3'
f Ribosoma
\ (TradUCCion )

. ... .
DNA
CITOPLASMA
La expresi6n de un gen es un proceso que sucede
en multiples etapas.
NUCLEO
5'
VV3'
pre-RNAm
l1NTR6N r (--c-or-te-y-e-m-p-al--':'m-e)

Protefna
.. -:. .
Transcripcion
Traduccion
RNA
-- EI ribosoma traduce al RNAm
DNA
Region Ifder Remolque
5'V V
3
' RNA
I I I
La longitud del RNA define a la region del gen

Proteina
I I I
La proteina define a la region codlficadora
El gen puede ser mas largo que la secuencia que
codifica a la proteina.
En las bacterias, la transcripci6n y la traducci6n ocurren
en el mismo compartimiento.
En la se ilustra esta situacion, en la
cual se considera que el gen comprende un frag-
mento continuo de DNA necesario para producir
una proteina en particular; incluye la secuencia
codificadora para dicha proteina, pero tambien se-
cuencias a ambos lados de la region codificadora.
Una bacteria esta formada por un solo compar-
timiento, de modo que la transcripcion y la traduc-
cion ocurren en el mismo lugar, como se Hustra en
la . En las eucariotas, la transcripci6n
tiene lugar en el nucleo, no obstante, el producto
de RNA debe ser transportado al citoplasma para ser
traducido. En los genes mas simples de las eucario-
tas (igual que en las bacterias), el RNA transcrito
es de hecho el RNAm. Sin embargo, para los genes
mas complej os, el transcrito inmediato del gen es
el pre-RNAm, que requiere de cierto procesa-
miento para generar al RNArn maduro. Las etapas
basicas de la expresion genica de una eucariota se
bosquejan en la Este proceso resulta en
una separaci6n espacial entre la transcripci6n (en el
nucleo) y la traduccion (en el citoplasma).
La etapa mas importante del procesarniento es el
corte y empalme del RNA. Numerasos genes de las
eucariotas (y casi todos los de las eucariotas superio-
res) contienen regiones internas que no codifican pro-
teinas. En el proceso de corte y empalme se eliminan
estas regiones del pre-RNArn para generar un RNA
con un marco de lectura abierto y continuo (vease la
Figura 3.1). Otras eventos procesadores que ocurren
en esta etapa implican la modificaci6n de los extremos
5' y 3' del pre-RNAm (vease la Figura 7.16).
La traducci6n tiene lugar mediante un complejo
mecanismo que incluye tanto protefnas como com-
ponentes de RNA. La "maquina" que se encarga del
proceso es el ribosoma, un gran complejo que incluye
algunas moleculas extensas de RNA (RNA ribos6mico,
o RNAr) y numerosas proteinas pequefias. El proceso
por el cual se reconoce que arninoacido corresponde
a un triplete de nucle6tidos en particular implica un
RNA de transferencia intermedio (0 RNAt); hay cuan-
do menos una especie de RNAt para cada aminoaci-
do. Numerosas proteinas accesorias estan implicadas.
La traducci6n se describe en el Capitulo 7, El RNA
34 CAPITULO 2 Los genes codifican proteinas
mensajero, pero considerese por ahora que los ribo-
somas son las grandes estructuras que se mueven a
10 largo del RNAm en la Figura 2.14.
El punto impartante de esta etapa es que el pro-
ceso de la expresion genica implica al RNA no solo
como sustrato esencial, tambien como proveedor
de componentes para el mecanismo. Los compo-
nentes RNAr y RNAt son codificados por genes y
generados par el proceso de transcripcion (como el
RNAm, excepto que no hay una etapa de traduccion
subsiguiente) .
fill Las protelnas actCtan en trans,
pero los sitios deL DNA, en cis
Conceptos principales
• Todos los productos de los genes (RNA 0 proteinas)
actuan en trans; pueden actuar en cualquier copia de
un gen de la celula.
• Las mutaciones de actuacion en cis identifican
a las secuencias de DNA que son el objetivo de
reconocimiento de los productos de actuacion en trans.
No se expresan como RNA ni como proteinas, y afectan
solo al fragmento contiguo de DNA.
Una etapa clave para la definicion del gen hle el
descubrimiento de que todas sus partes deben estar
presentes en un fragmento contiguo de DNA. En la
terminologfa genetica, se dice que la configuracion
de los sitios localizados en el mismo DNA esta en cis,
mientras que de la configuracion de los localizados
en dos moleculas diferentes de DNA, se dice que
esta en trans, de modo que dos mutaciones pueden
presentarse en cis (en el mismo DNA) 0 en trans (en
moleeulas diferentes de DNA). La prueba de com-
plementacion recune a este concepto para determi-
nar si dos mutaeiones estan en el mismo gen (vease
la Figura 2.3 de la Seccion 2.3. Las mutaciones que
se presentan en el mismo gen no se pueden comple-
mentar), y ahora podemos ampliar el concepto de
la diferencia entre los efectos eis y trans de la de-
finicion de la region codificadora de un gen a la
descripcion de la interaccion entre los elementos
reguladores y un gen.
Supongamos que la capacidad de un gen para
ser expresado depende de una protefna que se une
al DNA eerca de la region codificadora. En el ejem-
plo representado en la 1 u , 2 1 , el RNAm puede
ser sintetizado solo cuando la protefna esta unida al
DNA, pero sup6ngase que en la secuencia del DNA
enla cual se une esta protefna ocune una mutacion
y la protefna ya no reconoce al DNA: el DNA ya no
podrfa expresarse.
Par 10 tanto, un gen puede ser desaetivado tanto par
una mutaci6n en un sitio de control, como par una mutaci6n
en una region codijicadora. Las mutaciones no pueden
proteinas se unen a los sitios
'" de control de actuacion en cis
"J Sifo:ae control Regi6n codificadora UNA

Dos tipos de ! EI RNA
secuencias de DNA se sintetiza
RNA
Los sitos de control del DNA proporcionan sitios
de union para proteinas; las regiones codificadoras se expresan
a traves de la sintesis de RNA.
Ambos alelos sintetizan RNA en el tipo silvestre
La mutaci6n en el sitio de control afecta s610 al DNA contiguo
Mutaci6n
I
NO HAY SINTESIS DE RNA MEDIADA POR EL ALELO 1
La sintesis de RNA I
continua a partir del alelo 2
I Un sitio de actuacion en cis controla al DNA
adyacente, perc no influye en el otro alelo.
distinguirse geneticamente parque ambos tienen la
propiedad de actuar solo en la secuencia del DNA del
alelo individual en el cual oeunen, sus propiedades
son identicas en la prueba de complementacion, de
modo que una mutacion en una region de control
se define como parte integrante del gen, de la misma
forma que una mutacion en la region codificadara.
La muestra que una deficiencia en
el sitio de control afecta solo a la region codificadora a
la eual estd eometada; no afecta la capacidad del afro alelo
2.12 Las proteinas actuan en trans, pero los sitios del DNA, en cis 35
NO HAY SiNTESIS DE RNA A PARTIR DEL ALELO 1
La protefna activa actua en ambos alelos
gen (0 cistron) se transcribe en un producto de
RNA, el cual a su vez es traducido en una secuen-
cia polipeptfdica si el gen codifica a una proteina.
Se dice que un RNA 0 un producto protefnico de
un gen son de actuacion en trans. Un gen se define
mediante la prueba de complementacion como una
unidad de un fragmento individual de DNA. Se dice
que un sitio del DNA que regula la actividad de un
gen adyacente es de actuacion en cis.
Cuando un gen codifica a una proteina, la re-
lacion entre la secuencia de DNA y la secuencia de
la protefna depende del codigo genetico: Solo una
de las dos cadenas de DNA codifica a una proteina.
Un codon esta formado por tres nucleotidos que
representan un solo aminoacido. Una secuencia
codificadora de DNA consiste en una serie de co-
dones, los cuales son leidos desde un punta fijo
de inicio. En general, solo uno de los tres marcos
de lectura posibles puede ser traducido en pro-
teinas.
Un gen puede tener multiples alelos; los rece-
sivos son provocados por mutaciones de perdida de
funcion que interfieren con la funcion de la protei-
na. Un alelo nulo tiene perdida total de la funcion.
Los alelos dominantes son provocados por mutacio-
nes de ganancia de funcion que crean una nueva
propiedad en la protefna,
!
t
(fU
!
NO HAY SfNTESIS DE RNA A PARTIR DEL ALELO 2
Q-protefna mutante
La protefna mutante no puede unirse a ninguno de los alelos
Una mutaci6n de actuaci6n en trans de una proteina
afecta a Los dos aLeLos del gen que controla.
para expresarse. Una mutacion que actua exclusiva-
mente afectando las propiedades de la secuencia con-
tigua del DNA se denomina de actuacion en cis.
El comportamiento de la mutacion de actua-
cion en cis que se muestra en la Figura 2.17 se pue-
de comparar con el resultado de una mutacion en
el gen que codifica a la protefna reguladora. En la
se muestra que la ausencia de protefna
reguladora evitara que ambos alelos se expresen; se
dice que una mutacion de este tipo es de actuacion
en trans.
Revirtiendo el argumento, se sabe que si una
mutacion es de actuacion en trans, su efecto debe-
ra ser ejercido a traves de algun producto difusible
(tipicamente una proteina) que actue en multiples
dianas en una celula. Sin embargo, si una mutacion
es de actuacion en cis, su funcion afectara directa-
mente a las propiedades del DNA contiguo, 10 cual
significa que no se expresa en laforma de RNA 0 de una
proteina.
l1li Resumen
Un cromosoma es un fragmento ininterrumpido de
DNA duplex que contiene numerosos genes. Cada
Referencias
III EL c6digo genHico se Lee en tripLetes
Revisiones
Roth. J. R. (1974). Frameshift mutations. Annu. Rev. Genet.
8,319-346.
ArticuLos de investigaci6n
Benzer, S. and Champe, S.P. (1961). Ambivalent ril
mutants of phage T4. Proc. Natl. Acad. Sci. USA 47,
403--416.
Crick, F.R,C" Barnett, 1., Brenner, S., and Watts -Tobin,
R, J. (1961). General nature of the genetic code for
proteins. Nature 192, 1227-1232.
Los genes procari6ticos son coLineaLes
con sus proteinas
ArticuLos de investigaci6n
Yanofsky, c., Drapeau, G.R., Guest, J.R., and Carlton, B.C.
(1967). The complete amino acid sequence of the
tryptophan synthetase A protein (subunit) and its coli-
near relationship with the genetic map of the A gene.
Proc. Nat!. Acad. Sci. USA 57, 2966-2968.
Yanofsky, C. et al. (1964). On the colinearity of gene struc-
ture and protein structure. Proc. Nat!. Acad. Sci. USA,
51, 266-272.
36 CAPITU LO 2 Los genes codifica n protei nas
El replic6n
ESQUEMA DEL CAPITULO J
Introducci6n
Los replicones pueden ser lineales 0 circulares
• Una regi6n repLicada aparece como un ojo dentro deL DNA
no replicado
• En el origen inicia una horquiLLa de replicaci6n y despues
se desplaza de forma secuenciaL por eL DNA.
• La repLicaci6n es unidireccional cuando se crea una sola
horquilla de replicaci6n en un origen.
• La replicaci6n es bidireccional cuando un origen crea dos
horquillas de repLicaci6n que se despLazan en direcciones
opuestas.
Es posible elaborar el mapa de los origenes con
autorradiografia y electroforesis
• El desplazamiento de la horquilla de replicaci6n puede
detectarse por medio de autorradiograna utiLizando pulsos
radioactivos.
• Las horquillas de replicaci6n crean estructuras en forma de
Yque aLteran La migraci6n electroforetica de los fragmentos
de DNA.
(Regula la metilaci6n del origen a la iniciaci6n?
• ode contiene 11 repeticiones que estan metiladas en
la adenina en ambas cadenas A
• La repLicaci6n produce DNA hemimetilado, eL cuaL es
incapaz de iniciar la replicaci6n.
• Hay un retraso de 13 min antes de que las repeticiones
GATe sean metiladas de nuevo.
CTAG,
Los ongenes pueden ser secuestrados despues de
la replicaci6n
• SeqAse une al DNA hemimetilado y es necesaria para el
retraso de la replicaci6n.
• SeqA puede interactuar con DnaA.
• Puesto que Los origenes estan hemimetilados, se unen a la
membrana celuLar y en ocasiones no estan a disposici6n de
las metiLasas.
• La naturaLeza de la conexi6n entre el origen y La membrana
aun no es clara.
(ada cromosoma eucari6tico contiene numerosos
replicones
• Los repLicones eucari6ticos tienen una longitud de 40 a
100 kb.
• Un cromosoma se divide en numerosos replicones.
• Los replicones individuaLes se activan en momentos
caracteristicos durante la fase S.
• Los patrones de activaci6n regional sugieren que los
replicones cercanos entre Sl son activados al mismo
tiempo.
376
En las levaduras pueden aislarse los origenes :=
replicaci6n
• Los origenes de S. cerevisiae son secuencias cortas ri ,-
A-Tque tienen una secuencia esencial de 11 bp.
• El ORC es un complejo de seis proteinas que se une a _
ARS.
El factor de competencia controla la replicaci:
eucari6tica
• El factor de competencia es indispensable para La in·:-.=-
de La replicaci6n en cada origen.
• Esta presente en elnucleo antes de la replicaci6n,
desactivado 0 destruido por la replicaci6n.
• La iniciaci6n de otro ciclo de replicaci6n es
despues de que eL factor de competencia entra de nL:'
nucleo despues de la mitosis.
El factor de competencia esta formado por
prote1oas MCM
• El ORC es un complejo de proteinas que esta asociac: -
origenes de las levaduras durante todo eL ciclo celu!.=.-
• Cdc6 es una proteina inestable que se sintetiza s6Lo ,,-
• Cdc6 se une al ORC y permite la uni6n de las proteir,o.:
MCM.
• Cuando la repLicaci6n se inicia, las proteinas Cdc6 y
MCM son desplazadas. La degradaci6n de Cdc6
reiniciaci6n.
• Algunas proteinas MCM se encuentran en eL nucleo e-
eL ciclo, pero otras pueden entrar s6Lo despues de lc
mitosis.
Los lazos 0 mantienen a los origenes
mitocondriales
• Las mitocondrias utilizan diferentes secuencias de c--
para iniciar la replicaci6n de cada cadena del DNA. -
• La replicaci6n de La cadena Hinicia en un Lazo D.
• La repLicaci6n de la cadena Linicia cuando su orige-
expuesto por el movimiento de La primera horquilLa :"
replicaci6n.
Resumen
Introducci6n
- ~ c€lula tiene un solo cromosoma (como en las
=:iotas) 0 varios (como en las eucariotas), el ge-
~ completo debe ser replicado precisamente una
...:::. cada clivision celular LDe que manera se vincu-
::pisoclio de la replicacion con el cido celular?
== utilizan dos conceptos generales para com-
- el estado de replicacion con la condicion del
:elular:
• La iniciaci6n de la replicaci6n del DNA obliga a
la cilula (procari6tica 0 eucari6tica) a experimen-
tar una divisi6n posterior. Desde este punto de
vista, el numero de descenclientes que genera
una celula esta determinado por una serie de
decisiones en cuanto a iniciar 0 no la repli-
cacion del DNA. Esta se controla en la etapa
de la iniciacion. Una vez que la replicaci6n ha
comenzado, continua hasta que se haya duplicado
elgenoma completo.
• Si la replicacion prosigue, no se puede per-
mitir que ocuna la division consiguiente
hasta que la replicacion haya sido comple-
tada. De hecho, la conclusion de la repli-
cacion puede desencadenar la division ce-
lular. Despues, los genomas duplicados son
segregados en cada celula hija. La unidad de
segregacion es el cromosoma.
:::n las procariotas, la iniciacion de la replicacion
episodio inclividual que involucra a un sitio uni-
== el cromosoma bacteriano. El proceso de la clivi-
~ logra mediante el desarrollo de un tabique que
~ : : e la pared celular y que divide a la celula en
=:n las celulas eucarioticas, la iniciacion de la re-
...2:ion se identifica pOI el cornienzo de la fase S, un
_do prolongado durante el cual ocurre la smtesis
=_ 'A Yque comprende numerosos episodios indi-
es de iniciacion. La division se logra por la reor-
:....::acion de la celula en la mitosis. En este capitulo
~ rdara la regulacion de la replicacion del DNA.
_ =:10 inicia un cido de replicacion? LQUe controla
:-ogreso y como se se11aliza su terminacion?
:::"<1 unidad de DNA en la que tiene lugar un solo
de replicacion se denomina replicon. Cada re-
II "se activa" una sola vez, solo una, en cada cido
ar. El replicon se define por poseer los elementos
_ ntrol necesarios para la replicacion. Tiene un
~ e n en el cual se inicia la replicacion. Asimismo,
_'e tener un termino en el cual se detiene la re-
.:3.cion.
Cualquier secuencia adherida a un origen 0,
=' rminos mas precisos, no separada de un ori-
== por un termino, se replica como parte de ese
·con. El origen es un sitio de actuacion en cis,
- az de afectar solo a la molecula de DNA en la
" reside.
(La concepcion original del replicon [en las pro-
cariotas] 10 visualizaba como una unidad que poseia
el origen y el gen que codifica la protefna regula-
dora. Sin embargo, en la actualidad, en los eromo-
somas eucarioticos, el termino "replicon" se aplica
en general para describir una unidad de replicacion
que contiene un origen; las protemas reguladoras de
actuacion en trans pueden ser codificadas en cual-
quier otra parte.)
El genoma de una celula procariotica constituye
un solo repJicon; por 10 tanto, las unidades de repJi-
cacion y de segregacion coinciden. La iniciacion en
un solo origen promueve la repJicacion del genoma
completo, una vez en cada division celular. Cada
bacteria haploide contiene un solo eromosoma, par
10 que este tipo de control de repJicacion se deno-
mina de una sola copia.
Las bacterias pueden contener mas informacion
genetica en la forma de plasmidos. Un plasmido es
un genoma aut6nomo de DNA circular que constituye un
replic6n independiente (vease la Figura 14.2). El repli-
can de un pl<ismido puede ser controlado por una
sola copia, 10 que significa que se replica una sola
vez cada vez que se replica el cromosoma bacteria-
no, 0 puede estar bajo control de copias multi-
ples, cuando esta presente en un numero de copias
mayor que el cromosoma bacteriano. Cada fago 0
DNA de los virus tambien constituye un replicon
y, por 10 tanto, es capaz de iniciar numerosas veces
durante un ciclo infeccioso. Quiza una mejor ma-
nera de considerar un replicon procariotico, por 10
tanto, sea invertir la definicion: cualquier molecula de
DNA que contiene un origen puede ser replicada de forma
aut6noma en la dlula.
En la replicacion se observa una diferencia fun-
damental en la organizacion de los genomas bacte-
rianos y eucarioticos. Cada cromosoma eucariotico
contiene un gran numero de replicones; pOI 10 tan-
to, la unidad de segregacion induye muchas uni-
dades de replicacion. Esto agrega otra dimension al
problema del control: todos los replicones que se
encuentran en un cromosoma deben ser activados
durante un cido celular. Sin embargo, no se activan
de manera simultanea. Cada replicon debe ser acti-
vado en un periodo bastante prolongado y cada uno
debe ser activado no mas de una vez en cada ciclo celular.
Alguna serral debe distinguir entre los replicones
replicados y los no replicados para garantizar que
los replicones no se activen una segunda ocasion.
Numerosos replicones son activados de manera in-
dependiente, por 10 que debe existir otra serral que
indique el momenta en el cual se ha completado el
proceso de la replicacion de todos los replicones.
Ahora se ha comenzado a reunir informacion
sobre la construccion de los replicones individuales,
perc todavia se tiene poca informacion sobre la re-
15.1 Introducci6n 377
- . . -,-
ORIGEN
Horquilla de
replicacicin
----.
Horquilla de replicaci6n
----.

DNA replicado

Horquilla de
replicaci6n
+--
DNA
progenitor
REPLICACION UNIDIRECCIONAL
FIGURA 1<; 2 Los replicones pueden ser
bidireccionales, segun La formaci6n de una 0 de dos horql2:"
de replicaci6n en el origen.
Una molecula de DNA comprometida en la
cacion tiene dos tipos de regiones. La FIGURA 1
muestra que cuando se observa el DNA en rep·
cacion mediante microscopia electronica, la regi
replicada aparece como un ojo de replicaci'
dentro del DNA no replica do. La region no re .
cada consiste en el duplex progenitor; este se
en la region replicada en donde se han formado 1
dos duplex hijos.
El sitio donde tiene lugar la replicacion se d-
nomina horquilla de replicacion (en ocasior::
tambien se Ie conoce como punto de crecimie
to). Una horquilla de replicaci6n se desplaza de f017
secuencial pOl' el DNA desde su punta de inicia en el --
gen. EI origen puede aprovecharse para
la replicacion unidireccional 0 la replicaci
bidireccional. El tipo de episodio esta determina-
por la formacion de una 0 de dos horquillas de rer_
cacion en el origen. En la replicacion unidireccio -
una horquilla de replicacion abandona el origer;
continua por el DNA. En la replicacion bidirecc
nal, se forman dos horquillas de replicacion; esta..
alejan del origen en direcciones opuestas.
La aparicion del ojo de replicacion no disc-
gue entre replicacion unidireccional y bidirec
nal. Como se ilustra en la FIGURA 15 2, el ojo pue-
representar cualquiera de las dos estructuras. Si
genera por medio de replicacion unidireccional
REPLICACION BIDIRECCIONAL
DNA no
replicado
Ojo de
replicaci6n
Aspecto
Estructura molecular
DNA no
replicado
• Una regi6n repLicada aparece como un ojo dentro deL DNA
no repLicado.
• En eL origen inicia una horquilla de replicaci6n y despues
se des plaza de forma secuencial por el DNA.
• La replicaci6n es unidireccional cuando se crea una sola
horquilla de replicaci6n en un origen .
• La repLicaci6n es bidireccional cuando un origen crea dos
horquillas de replicaci6n que se desplazan en direcciones
opuestas.
Conceptos principaLes
FIGURA El DNA replicado se observa como un ojo de
replicaci6n flanqueado por DNA no replicado.
lacion que existe entre eUos. No se sabe si el patron
de replicacion es el mismo en cada cido celular LSe
utilizan siempre todos los origenes 0 algunos son
silentes en algunas ocasiones? LLos origenes siem-
pre se activan en el mismo orden? Si hay diferentes
tipos de origenes, Lque los distingue?
En contraste con los cromosomas nudeares, los
cuales son controlados por una sola copia, el DNA
de las mitocondrias y de los doroplastos puede ser
regulado mas como plasmidos que existen en copias
multiples por bacteria. Hay numerosas copias de cada
DNA de los organelos por celula y el control de su
replicacion debe relacionarse con el cido celular.
En todos estos sistemas, la cuestion fundamen-
tal es definir las secuencias que funcionan como
orfgenes y determinar como son reconocidas por
las protefnas adecuadas del mecanisme de replica-
cion. Se comienza por considerar la construccion
basica de los replicones y las diversas formas que
adquieren; despues de la consideracion del origen,
se plantea la pregunta de como la replicacion del ge-
noma se coordina con la division bacteriana y que se
encarga de segregar los genomas a la bacteria hija.
1111 Los replicones pueden ser lineales
o circulares
378 CAPITULO 15 El replic6n
A 15..J Un ojo de replicaci6n forma una estructura El en
- Acircular.
RA 1 El ojo de replicaci6n se agranda a medida que
.:.: norquillas de replicaci6n prosiguen por el replic6n. N6tese
_= el "ojo" se hace mas grande que el segmento no replicado.
-:: dos lados del ojo pueden definirse porque ambos tienen
isma longitud. Fotografia cortesja de Bernard Hirt, Swiss
for Experimental Cancer Research (ISREC).
. ... .
REPLICACI6N UNIDIRECCIONAL
1-
-<---.-to---->-
REPLICACI6N BIDIRECCIONAL
-<------->-
La cantidad de horquillas de replicacion que hay en
un ojo de replicacion puede determinarse de dos
formas. La eleccion del metodo depende de que el
DNA sea una molecula definida 0 una region no
identificada de un genoma celular.
Con una molecula lineal definida se puede uti-
lizar microscopia electronica para medir la distancia
entre cada extremo del ojo y el extrema del D A
Yluego comparar las posiciones de los extremos de
los ojos en las moleculas que tienen ojos de diferen-
tes tamaiios. Si la replicacion es unidireccionaL solo
uno de los extremos se movera; el otro es el origen
fijo. Si la replicacion es bidireccionaL ambos se des-
plazaran; el origen es el punto medio entre ellos.
Con regiones no definidas de genomas exten-
50S se pueden utilizar dos puIsos de radioactividad
sucesivos para etiquetar el desplazamiento de las
horquillas de replicacion. Si un pulso tiene una eti-
queta mas intensa que el otIO, pueden distinguirse
por las intensidades relativas del etiquetamiento.
Conceptos principales
r Pueden utilizarse diferentes densidades de eti-
quetamiento radioactivo para distinguir entre la replicaci6n
unidireccional y la replicaci6n bidireccional.
_ Eliquela de densidad pesada (incorporada
primero)
- Eliqueta de densidad ligera (incorporada en
segundo lugar)
-- Sin etiqueta (invisible en la autorradiografia)
• El desplazamiento de la horquilla de replicaci6n puede
detectarse por medio de autorradiografia utilizando
pulsos radioactivos.
• Las horquillas de replicaci6n crean estructuras en forma
de Yque alteran la migraci6n electroforetica de los
fragmentos de DNA.
1111 Es posible elaborar el mapa
de los orlgenes con
autorradiografia y
electroforesis
Apariencia de la
estructura epor
medio de microscopia
eleclr6nica
Estruclura de
replicaci6n e
:epresenta un origen fijo y una horquilla de
'cacion movible. Si se genera por replicacion bi-
-;: donal, el ojo representa un par de horquillas
:eplicacion. En cualquier caso, el avance de la
jcacion expande el ojo hasta que termina por
-:car todo el replicon.
Cuando un replicon es circular, la presencia de
jo forma la estructura e, la cual se muestra en
JRA 1 oJ. Las etapas sucesivas de la replicacion
circular del virus del polioma se yen a tra-
- e microscopia electronica en la
15.3 Es posible elaborar el mapa de los origenes con autorradiografia yelectroforesis 379
La primera dimensi6n separada por masa ----..
Antes de la replicacion, el sitio diana palind:-
mico es metilado en las adeninas de ambas
La replicacion inserta las bases normales (no m -
primera dimension que los separa por masa y e
una segunda dimension en donde el
es determinado sobre todo por la morfologfa. L
diferentes tipos de moIeculas en replicacion sigu -
rutas caracterfsticas, medidas por su desviacion ':
la linea que seguirfa una molecula lineal de DK.-
del doble de tamano.
Una simple estructura Y, en la cual una horqu'"
se desplaza por un fragmento lineal, sigue una ru-
continua. Cuando las tres ramas tienen una misI
longitud ocurre un punto de inflexion y la estru-
tura se desvfa mas del DNA lineal. Consideracion-
analogas determinan las rutas de las estructuras _
bles en forma de Y 0 de las burbujas. Una burb_
ja asimetrica sigue una ruta interrumpida con -
rotura en el sitio donde la burbuja se convierte e-
estructura en forma de Ya medida que una horq .-
abandona el extremo.
Juntas, las diferentes tecnicas para describir
DNA en replicacion muestran que los orfgenes "
utilizan con mayor frecuencia para iniciar episodi-
de replicacion bidireccional. A partir de este nivel
resolucion, se debe avanzar ahora al nivel
para identificar las secuencias de actuacion en
que forman el origen y los factores de actuacion
trans que 10 reconocen.
(Que caracterfstica de un origen bacteriano (0 p1=.
mido) garantiza que sea utilizado para iniciar 1a :--
plicacion solo una vez en cada cielo? (La inieiac:,
se asocia a a1gun cambio que marca el origen de -
manera que un origen replieado pueda distingui:
de un origen no replieado?
Algunas secuencias que se utilizan para e"
proposito estan ineluidas en el origen. oriC con::
ne 11 copias de la secuencia la eual es --
diana de metilacion en la posicion N6 de la adeni;-
par la metilasa Dam. La reaccion se ilustra er:
lilt (Regula la metHaci6n
del origen la iniciaci6n?
Conceptos principales
• orie cantiene 11 repeticiones que estim metiladas
en la adenina en ambas cadenas.
• La replicaci6n produce DNA hemimetilado, el cual es
incapaz de iniciar la replicaci6n.
• Hay un retraso de 13 min antes de que las repeticione.:
sean metiladas de nuevo.
Burbuja
asimetrica
--0-
--0
-<
---L-
['J
1 kb 1 kb
Burbuja Y doble
>--< ---0--
>--< --0-
>-< -0-
>< c::>
Y simple
. . ... .:
,
; .; .
I-
DNA DNA
metilado hemimetilado
Me
GATC-
CTAG
Gf'.JtTC
Replicaci6n j Nletilasa Dam
CTAG
"\
Me
GATC
CTAG-
Me
Estas pueden visualizarse por medio de autorra-
diograffa. La muestra que la replicacion
unidireccional hace que a una etiqueta Ie siga la otra
en un extrema del ojo. La replicacion bidireccional
produce un patron (simetrico) en ambos extremos
del ojo. Este patron se observa por 10 general en los
replicones de los cromosomas eucarioticos.
Un metodo mas reciente para elaborar el mapa
de los orfgenes con mayor resolucion se vale de
los efectos que tienen los cambios de la forma del
DNA sobre la migracion electroforetica. La
ilustra la tecnica de mapeo bidimensional,
en la cuallos fragmentos de restriccion del DNA en
replicacion son sometidos a electroforesis en una
La replicaci6n del DNA metilado origina DNA
hemimetilado, el cual mantiene su estado en los sitios GATC
hasta que la metilasa Dam restaura la condici6n metilada por
completo.
1C\
la contribuci6n de
la forma de tres 2 kb ... kb
dlmenslones 2
1 kb 1 kb
EI tamano del
fragmento se
duplica durante
la replicaci6n
La posici6n del origen y el numero de horquillas en replica-
ci6n determinan la forma de un fragmenta de restricci6n en replicaci6n,
la cual puede deducirse par su ruta electroforetica (linea continua). La
linea punteada muestra la ruta del DNA lineal.
380 CAPITU LO 15 El replic6n
15.5 Los origenes pueden ser secuestrados despues de la replicaci6n 381
- as) en las cadenas hijas. Esto genera DNA he-
etilado, en el cual una cadena esta metilada
- tra no. Par 10 tanta, la replicacion convierte
sitios diana Dam de metilados par completo a
-:::imetilados.
.:. Cual es la consecuencia de la replicacion? La
idad que tiene un plasmido con base en oriC
:-eplicarse en E. coli dam- depende de su esta-
e metilacion. 5i el plasmido esta meti]ado se
te a una sola ronda de replicacion y despues
roductos hemimetilados se acumulan, como se
.:ribe en ]a . Par 10 tanto, un arigen
- 'metilado no puede usarse para iniciar un cielo
::-eplicacion.
£:sto sugiere dos explicaciones: la iniciacion
=je requerir la metilacion completa de los sitios
7 _3 Dam en el origen a puede ser inhibida par la
-_ irnetilacion de estos sitios. La ultima posibilidad
e ser la correcta parque un origen de DNA no
= ado puede funcionar de manera eficiente.
Asi, los orfgenes hemimetiJados no pueden ini-
- e nuevo hasta que la metilasa Dam los haya
en orfgenes metilados par completo.
:itios GATC localizados en el origen permanecen
- imetilados -13 min despues de la replicacion.
c largo periodo no es habitual porque en los sitios
-_-=-C tipicos en cualquier otro lugar del genoma,
-.>metilacion comienza de inmediata «1.5 min)
es de la replicacion. Otra region actua como
-:. el promotor del gen dnaA tambien muestra re-
antes de que comience la remetilacion.
;::1 promotor del gen dnaA estara reprimido
=:J.tras este hemimetilado, 10 cual reduce el nivel
c a proteina DnaA. Par 10 tanto, eJ origen esta
=:Le y la produccion de la proteina iniciadora cru-
es reprimida durante este periodo.
Los orlgenes pueden
ser secuestrados despues
de la replicaci6n
I i:onceptos principales
SeqA se une al DNA hemimetilado y es necesaria para
=1 retraso de la replicaci6n.
SeqA puede interactuar con DnaA.
Juesto que los origenes estan hemimetilados, se
nen a la membrana celular yen ocasiones no estan a
isposici6n de las metilasas.
_a naturaleza de la conexi6n entre el origen y la
membrana aun no es clara.
-- que se debe el retraso de la remetilacion en oriC
-n dnaA? La explicacion mas probable es que estas
- .ones son secuestradas en una forma en la cual
"' inaccesibles a la metilasa Dam.
..

Origen activo
Replicaci6n !

Origenes
/ inactivos

Metilasa Dam !

Origen activo
S6lo los origenes metilados por completo pueden
iniciar la replicaci6n; los origenes hijos hemimetilados no pue-
den utilizarse de nuevo hasta que hayan recuperado su estado
de metilaci6n completa.
Un circuito encargado de controlar la reutiliza-
cion de los orfgenes es identificado par mutaciones
en el gen seqA. Los mutantes reducen el retraso de la
remetilacion en oriCy en dnaA. Como resultado, ini-
cian la replicacion del DNA demasiado pronto, can
10 que se acumula un numero excesivo de origenes.
Esto sugiere que seqA forma parte de un circuito re-
gulador negativo que impide que los arfgenes sean
metilados de nuevo. La proteina SeqA se une can
mayor fuerza al DNA hemimctilado que al DNA me-
tilado par completo. Puede iniciar la union cuando
el DNA es hemimetilado, momenta en que su pre-
sencia continua impide la formacion de un complejo
abierto en el origen. SeqA no tiene especificidad
par la secuencia oriC y parece probable que esta sea
conferida par la protefna DnaA. Esto explicaria las
interacciones geneticas entre seqA y dnaA.
La hemimetilacion de las secuencias GATC del
origen es indispensable para su asociacion can la
membrana celular in vitro. El DNA oriC hemimeti-
lado se une a las membranas, pero el DNA que esta
metilado par completo, no. Una posibilidad es que la
asociacion a la membrana tenga que ver en el con-
trol de la actividad del origen. Esta funcion podrfa
ser independiente de cualquier funcion que tenga la
membrana en la segregacion (vease la Figura 17.4).
La asociacion a la membrana podrfa impedir que
ocurriera la reiniciacion de manera prematura, de
forma inctirecta par el secuestro de los origenes, a
directa par la inhibicion de la reaccion par parte de
algun componente en la membrana.
Las propiedades de la fraccion de la membrana
sugieren que ineluye componentes que regulan la
replicacion. Un inhibidor observado en esta fracci6n
compite can la proteina DnaA. Este inhibidor pue-
de impectir la iniciacion de la replicacion solo si es
Un inhibidor unido a la membrana se adhiere al
DNA hemimetilado en el origen y puede funcionar al impedir
la union de DnaA. Es liberado cuando el DNA es metHado de
nuevo.
ciacion, perc que cuando se combinen logren =
resultado esperado. Algunas mutaciones en el ge
dnaA provocan replicacion asincronica. 10 cual su-
giere que DnaA podrfa ser el "titulador" 0 el "rei
que mide el nllmero de orfgenes en relacion con :.:
masa celulay. La sobreproduccion de DnaA da luga-
a resultados conflictivos, los cuales pueden vari-
desde no tener ningun efecto hasta causar que ..::
iniciacion suceda en una masa reducida.
Ha sido diffcil identificar los componentes pr--
tefnicos que median la adhesion a la membrana. "L:
indicio de que esta es una funcion de la prote' -
DnaA 10 constituye su respuesta a los fosfolfpid :
Estos facilitan el intercambio de ATP con el
unido a la protefna DnaA. Se desconoce la funci'
que tiene esto en el control de la actividad de Dn- -
(la cual requiere ATP). perc la reaccion implica ql:.:
es probable que DnaA interactue con la membran=..
Esto significarfa que mas de un episodio tiene q...::
ver en la asociacion a la membrana. Quiza un or:-
gen hemimetilado este unido al inhibidor asocia '
a la membrana, pero cuando el origen se metila
completo, el inhibidor es desplazado por la
DnaA asociada a la membrana.
Si DnaA es el iniciador que desencadena un c-
cIo de replicacion, el suceso principal serfa su a '-
mulacion en el origen en un nivel crftico. No he.-
variaciones cfclicas en la expresion 0 en la conce::-
tracion global de la protefna DnaA, 10 cual sugie-
que los sucesos locales deben ser los responsablc:
Para que sea activa en la iniciacion de la replicaci6=.
DnaA debe encontrarse en su forma unida a ATP.::"':
protefna DnaA tiene una actividad intrfnseca
que transforma el ATP en ADP. Esta actividad "-
intensifica la subunidad de la polimerasa de Di -,-
III. Cuando la replicasa es incorporada al comple:
de replicacion, esta interaccion ocasiona la hidrolis_
del ATP unido a DnaA, 10 que desactiva la prote'
DnaA e impide que comience otro ciclo de replicc-
cion. Esta reaccion ha sido denominada RlDA (re-- -
latory inactivation of DnaA, desactivacion regulad ::
de DnaA). Es potenciada por una protefna llama""'-
Hda. Todavfa no se sabe que controla la cranolocr--
de la reactivacion de la protefna DnaA.
Otro factor que controla la disponibilidad '.
DnaA en el origen es la competencia por unirla :
otros sitios del DNA. En particular, un locus den
minado dat tiene una gran concentracion de siti
de union a la protefna DnaA. Se Ie une unas oc
veces mas DnaA que al origen. La delecion de .
hace que la iniciacion ocurra con mayor frecuen '=
Esto reduce de manera significativa la cantidad c:-
DnaA disponible para el origen, perc no se sabe co-
exactitud que funcion pueda tener en el control (:,-
la cronologfa de la iniciacion.
EI DNA es metilado
de nuevo y Iibera al
inhibidor
DnaA se une a oriC
EI inhibidor unido a la
membrana se adhiere
al DNA hemimetilado
C
c
Me
Me
"GATC NNNNNNN
'CTAG NNNNNNN
Me
Me
iGATC

agregado antes que la protefna DnaA a un sistema
in vitro. Esto sugiere el modelo que se muestra en la
, en el cual el inhibidor reconoce de ma-
nera especffica el DNA hemimetilado e impide que
se una la protefna DnaA. Cuando el DNA es meti-
lado de nuevo, el inhibidor es liberado y la pratefna
DnaA es libre de iniciar la replicacion. Si el inhibi-
dor esta asociado a la membrana, es posible que la
asociacion y la disociacion del DNA a la membrana
tengan que ver con el control de la replicacion.
La extension completa del sistema utilizado
para controlar la reiniciacion no es clara, pero es
posible que participen numerosos mecanismos: el
secuestro ffsico del origen, el retraso de la remetila-
cion, la inhibicion de la union de la pratefna DnaA
y la represion de la transcripcion del gen dnaA. No
es evidente cual de estos episodios ocasiona los de-
mas, y si sus efectos en la iniciacion son directos 0
indirectos.
Alm se debe resolver el tema central de cual
caracterfstica tiene el encargo fundamental de sin-
cronizar los sucesos. Una posibilidad es que la adhe-
sion a la membrana ocurre en la iniciacion y que sea
necesario el ensamble de alguna estructura extensa
para liberar el DNA. El periodo de secuestro parece
aumentar con la longitud del ciclo celular, 10 cual
sugiere que refleja de manera indirecta el reloj que
controla la reiniciacion.
Como unico integrante del mecanismo de repli-
cacion indispensable solo en el origen, la protefna
DnaA ha atrafdo mucha atencion. Esta protefna es
la diana de numerosos sistemas reguladores. Es po-
sible que ninguno de estos sistemas sea suficiente
por sf solo para controlar la frecuencia de la ini-
382 CAPITULO 15 El replicon
(ada cromosoma eucari6tico
contiene numerosos replicones
Origen 1

.. . .. _. . .
Origen 2
=':-,:=pios principales
-:5 replicones eucari6ticos tienen una longitud de 40 a
_= kb.
_- cromosoma se divide en numerosos replicones.
_:- replicones individuales se activan en momentos
:;acteristicos durante la fase S.
_=s patrones de activaci6n regional sugieren que los
-=Jlicones cercanos entre 51 son activados al mismo
=-:mpo.
-" celulas eucarioticas la replicaci6n del DNA
..:. confinada a una parte del cido celular. La fase
ele durar unas cuantas horas en una celula eu-
rica superior. La replicaci6n de la gran cantidad
=:>NA contenido en un cromosoma eucari6tico
_QIa al dividirlo en numerosos replicones indivi-
=·es. Solo algunos de estos replicones participan
.3 replicacion en un momento dado de la fase S,
arecer cada replicon es activado en un momen-
:= ecffico durante la fase S, aunque los datos que
-- -obre el tema no son decisivos.
El inicio de la fase S 10 seiiala la activaci6n de
_rimeros replicones, En las pocas horas siguien-
!os episodios de iniciacion tienen lugar en otros
- Jcones de manera ordenada. Mucho de 10 que
: be sobre las propiedades de los replicones in-
: uales proviene de estudios autorradiogrMicos
recurren en general a los tipos de protocolos
_-trados en la Figura 15.5 yen la Figura 15,6. Los
-_ :.icones cromosomicos suelen mostrar replicacion
2ireccional.
LQue tan grande es el replic6n promedio y
antos hay en el genoma7 Una dificultad para
=:cribir la unidad individual es que los replicones
pueden fusionarse y formar ojos repli-
- os extensos, como se ilustra en la II
-=. metodologfa utilizada en general para distinguir
los replicones individuales y los ojos fusio-
=.dos consiste en utilizar fragmentos de DNA en
- cuales puedan observarse numerosos replicones
capturados al parecer en una etapa en la
todos han iniciado casi al mismo tiempo, perc
,,-res de que se reunan las horquillas de las unida-
_=s adyacentes.
En grupos de replicones activos, el tamaiio pro-
-=.edio de la unidad se mide por la distancia que
y entre los orfgenes (es decir, entre los puntos
edios de los replicones adyacentes). La velocidad
: n la cual se desplaza la horquilla de replicacion
uede estimarse a partir de la distancia maxima que
=-_corren los rastros autorradiograficos durante un
determinado.
Longitud medida del repiic6n
...-----., I
Replicones fusionados
Para medir el tamaiio del replic6n se necesita un frag-
mento de DNA en el cuallos replicones adyacentes esten activos.
Los replicones individuales de los genomas eu-
cari6ticos son relativamente pequefios, por 10 ge-
neral de -40 kb en las levaduras 0 en las moscas y
de -100 kb en las celulas animales. Sin embargo,
pueden variar mas de 10 veces en longitud dentro
de un genoma. La velocidad de replicacion es de
-2 000 bp/min, la cual es mucho menor que la del
desplazamiento de la horquilla de replicacion bac-
teriana (50 000 bp/min).
Por la velocidad de replicacion, es evidente que
el genoma de un mamffero podrfa replicarse en cerca
de 1 h si todos los replicones funcionaran de manera
simultanea. Sin embargo, la fase S dura mas de 6 h
en una celula somatica tfpica, 10 cual implica que no
mas del 15% de los replicones tienden a estar acti-
vos en un momenta dado, Hay casos excepcionales,
como las divisiones embrionarias tempranas de los
embriones de Drosophila, en donde la duracion de la
fase S se comprime por el funcionamiento simulta-
neo de un gran numero de replicones,
LComo se seleccionan los orfgenes para la ini-
ciacion en momentos distintos durante la fase S7 En
Saccharomyces cerevisiae, parece ser que esta prede-
terminado que los orfgenes se repliquen temprano,
pero que las secuencias de actuacion en cis puedan
hacer que los origenes ligados a ellas se repliquen
despues.
Los datos disponibles sugieren que los repli-
cones cromos6micos no tienen terminalesen las
cuales las horquillas de replicacion interrumpan el
desplazamiento y (al parecer) se disocien del DNA.
Parece mas probable que la horquilla de replicacion
continue desde su origen hasta que encuentre una
15.6 (ada cromosoma eucari6tico contiene numerosos replicones 383
Las horquillas de replicaci6n se organizan en
focos dentro del nucleo. Las celulas fueron etiquetadas con
BrdU. El segmento izquierdo de la figura se tifi6 con yoduro de
propidio para identificar la masa de DNA. El derecho se tifi6 con
Ull anticuerpo contra BrdU para identificar el DNA en replica-
ci6n. Fotografia cortesia de Anthony D. Mills and Ron Laskey,
Hutchinson/MRC Research Center, University of Cambridge.
horquilla que avance hacia ella desde el replicon ad-
yacente. Ya se ha mencionado el posible problema
topologico de unir el DNA que acaba de sintetizarse
en la union de las harquillas de replicacion.
La predisposicion de los replicones vecinos a
estar activos de manera simultanea podria expli-
carse por la presencia de controles "regionales", en
los cuales los grupos de replicones son iniciados de
modo mas 0 menos coordinado, al contrario de un
mecanismo en el cual los replicones individuales
son activados uno par uno en areas dispersas del
genoma. Dos caracteristicas estructurales sugieren
la posibilidad de una organizacion a gran escala.
Regiones bastante extensas del cromosoma pueden
de£lnirse como "de replicacion temprana" 0 "de re-
plicacion tardia", 10 cual implica que hay poca dise-
minacion de replicones que se activan en momentos
tempranos 0 tardfos. La visualizacion de las horqui-
llas de replicacion par medio de etiquetamiento con
precursores de DNA identi£lca de 100 a 300 "focos"
en vez de una tincion uniforme; es probable que
cada foco que se muestra en la conten-
ga >300 horquillas de replicacion. Los focos podrian
representar estructuras fijas a traves de las cuales
debe moverse el DNA en replicacion.
l1li En las levaduras pueden
aislarse los origenes
de replicaci6n
Conceptos principales
• Los origenes de S. cerevisiae son secuencias cortas ricas
en A-Tque tienen ulla secuencia esencial de 11 bp.
• El ORC es L11l complejo de seis proteinas que se une a
una ARS.
384 CAPITULO 15 El replic6n
Cualquier segmento de DNA que tenga un origer:
debe estar en condiciones de replicarse; par 10 tan-
to, aunque los plasmidos son muy poco
en las eucariotas, puede ser posible construirlos p :-
medio de una manipulacion apropiada in vitro. EST_
se ha logrado en las levaduras, aunque no en la
eucariotas superiores.
Los mutantes de S. cerevisiae pueden ser "tran:-
formados" en su fenotipo silvestre con la adicion c.:
DNA que transporte una copia silvestre del gen. ::.
descubrimiento de los origenes de las levaduras tu -
lugar cuando se observo que algunos fragmentos G:
DNA de las levaduras (cuando forman un circul-
son capaces de transformar las celulas defectuo
con mucha e£lciencia. Estos fragmentos pueden
brevivir en la celula en estado no integrado
nomo), es decir, como plasmidos autorreplicamc-
Un fragmento transformante de alta frecuenc...
posee una secuencia que Ie da la capacidad de rep
carse e£lcientemente en las levaduras. Este
se denomina ARS (autonomousZy replicating seque·:.
secuencia de replicacion autonoma). Los
ARS se derivan de origenes de replicacion.
En los casos en los que los elementos ARS
han mapeado de manera sistematica en regio.c
cromosomicas extensas, parece que solo algl!-
de ellos en realidad se aprovechan para inicia':-
replicacion. Los otros son silenciosos 0 quiza se
licen con poca frecuencia. Si es verdad que al -.
origenes tienen probabilidades variables de ser _
lizados, tampoco podria haber terminales £ljas e::::
los replicones. En este caso, una region dada de
cromosoma podria ser replicada desde arigenes .:-
tintos en ciclos celulares diferentes.
Un elemento ARS esta formado por una re.:
rica en A-T que contiene sitios discretos en 10 ;:-
les las mutaciones afectan el funcionamiem
origen. La composicion de bases, mas que la
cia, puede ser importante en el resto de la re.
La muestra un analisis sistematic-
mutaciones a todo 10 largo de un origen. EI :
cionamiento del origen es inhibido por com._
por mutaciones en una region "nuclear" de 1."
denominada dominio A, la cual contiene
cuencia de consenso de 11 bp formada por per-:-
bases A·T. Esta secuencia de consenso (en ocas_
denominada ACS, ARS consensus sequence, se
de consenso de la ARS) es la (mica homologia
los elementos ARS conocidos.
Las mutaciones en tres elementos adya e-
numerados B1 a B3, disminuyenla funcion de
gen. Un arigen puede funcionar de manera =-
con dos elementos B cualesquiera, siempre y c =
haya un elemento A funcional. (Las copias :_-
fectas del consenso nuclear, que suelen conf r=
en las posiciones 9111, se ubican cerca de, 0 =-
..
Complejo de
posreplicaci6n
VR.
ORC
ORC
ORC
Fase S
Fase G1 MCM
tardfa

Fase G2
/AYA.YA.VAYJ: ,
Fase G1 temprana
fA-YAYA"VA.YJ., t
Cdc6
..0IIII(. -.
·
·
·
·
Despues de la replicaci6n, el factor de competencia:
que se encuentra en el nLicleo es inactivo; el factor
de competencia del citoplasma no puede entrar al
nLicleo
DYAYlt')./A

.
- .
La disoluci6n de la membrana nuclear durante la
mitosis permite que el factor de competencia se
asocie al material nuclear
:"ntes de la replicaci6n, el nLicleo contiene factor de
competencia activo
La divisi6n celular genera nLicleos hijos competentes
para respal dar la replicaci6n
15.14 El factor de competencia que se encuentra en
- - Jcleo es desactivado despues de la replicaci6n. Un nuevo
de factor de competencia puede entrar s6lo
- .:oldo se rompe la membrana nuclear en la mitosis.
__erdese que el aRC es un complejo de 400 kD
__e se une a la ARS de S. cerevisiae (vease la seccion
';.. En las levaduras pueden aislarse los orfgenes
replicacion). El origen (ARS) esta formado por
- secuencia de consenso A y por t-res elementos
::- vease la Figura 15.12). El aRC de seis protei-
:::25 (de las cuales todas son codificadas por genes
-:.::nciales) se une a la secuencia A y al elemento
:::.yacente B1. Se necesita ATP para la union. pero
no es hidrolizado hasta alguna etapa posterior.
2.-- :actor de transcripcion ABFl se une al elemento
3; esto ayuda a la iniciacion. pero son los sucesos
__e tienen lugar en los elementos A y B1 los que en
provocan la iniciacion. La mayor parte de
::. orfgenes estan ubicados en las regiones que se
o:::.cuentran entre los genes. 10 cual indica que quiza
eo. importante para que la estructura de la cromati-
- =local este en una conclicion no transcrita.
La caracterfstica sobresaliente es que el aRC
-=rmanece unido al origen en todo el cido celu-
=-. No obstante. los cambios ocurren en el patron
-= proteccion del DNA como resultado de la union
1 Las protei nas del origen controlan la suscep-
tibilidad a la iniciaci6n.
de otras protefnas al complejo ORC-origen. La
i resume el cido de los sucesos que tienen
lugar en el origen.
Al final del cido celular. el aRC esta unido a A-
B1 Ygenera un patron de proteccion in vivo similar
al que se observa cuando se une al DNA libre in
vitro. En terminos basicos. la region que atraviesa
A-B 1 esta protegida contra la DNAasa. pero hay un
sitio hipersensible en el centro de B1.
Durante G1 este patron cambia. mas notable-
mente por la perclida del sitio hipersensible. Esto se
debe a la union de la protefna Cdc6 al aRc. En las
levaduras. Cdc6 es una protefna muy inestable. con
una vida media de menos de 5 min. Se sintetiza du-
rante G1 Ysuele unirse al aRC entre la salida de la
mitosis y la etapa G1 tardfa. Su rapida degradacion
significa que no hay protefna disponible despues en
el cido. En las celulas de los mamlferos. se controla
de manera distinta; esta fosforilada durante la fase
S y como resultado es exportada desde el nudeo.
La protefna Cdc6 proporciona la conexion entre el
aRC y un complejo de protefnas que participa en
la competencia y en la iniciacion. Cdc6 tiene ac-
tividad ATPasa indispensable para que respalde la
iniciacion.
15.9 El factor de competencia esta formado por proteinas MCM 387
Ciertos mutantes de levaduras nos permiten co-
nocer el sistema que controla la disponibilidad del
factor de competencia. Las mutaciones que se pre-
sentan en el factor de competencia pueden impedir
la iniciacion de la replicacion. Asf es como las mu-
taciones actuan en las protefnas de mantenimiento
del minicromosoma (minichromosome maintenance.
MCM) 2, 3 Y 5. Las mutaciones que ocunen en el
sistema que desactiva el factor de competencia des-
pues del inicio de la replicacion deben permitir la
acumulacion de cantidades excesivas de DNA. por-
que la presencia continua de factor de competencia
permite que suceda la replicacion. Dichas mutacio-
nes se observan en los genes que codifican los com-
ponentes del sistema de ubiquitinacion encargado
de la degradacion de ciertas protefnas. Esto sugiere
que el factor de competencia puede ser destruido
despues del inicio del cicio de replicacion.
Las protefnas MCM2, 3 Y5 son necesarias para
la replicacion y entran al nu.cleo solo durante la mi-
tosis. En las celulas animales se encuentran homo-
logos, en donde MCM3 esta unida al material ero-
mosomico antes de la replicacion, pero es liberada
despues de la replicacion. El complejo MCM2, 3, 5
de la celula animal permanece en elnucleo durante
el ciclo celular, 10 cual sugiere que puede ser un
componente del factor de competencia. Otro com-
ponente, capaz de entrar solo en la mitosis, puede
requerirse para que el complejo MCM2, 3, 5 se aso-
cie al material cromosomico.
En las levaduras, la presencia de Cdc6 en el
arigen permite que las protefnas MCM se unan al
complejo. Su presencia es indispensable para que
ocuna la iniciacion en el origen. En consecuencia,
el origen entra a la fase S como un complejo de
prerreplicaci6n, el cual contiene el aRC y las pro-
tefnas Cdc6 y MCM. Cuando ocurre la iniciacion,
Cdc6 y MCM son desplazadas y el origen regresa
al estado de complejo de posreplicaci6n, el cual
contiene solo el aRc. La protefna Cdc6 es degra-
dada con rapidez durante la fase S; pOl' 10 tanto,
no esta disponible para respaldar la recarga de las
protefnas MCM y, en consecuencia, el origen no
puede ser utilizado para un segundo cido de inicia-
cion durante la fase S.
Si Cdc6 esta disponible para unirse al origen
durante la fase G2 (par expresion ectopica), las pro-
tefnas MCM no se unen hasta la siguiente fase G1,
10 cual sugiere que hay un mecanismo secundario
que garantiza que se asocien a los orfgenes solo en
el momenta adecuado. Esta podrfa ser otra parte del
control de la competencia. Al menos en S. cerevisiae,
este control no parece ejercerse en el nivel de la
entrada al nucleo, pero esta puede ser una diferen-
cia entre las levaduras y las celulas animales. Las
protefnas MCM2-7 constituyen un complejo de seis
388 CAPITULO 15 El replic6n
miembros en forma de anillo alrededor del D -.-
Algunas de las protefnas del aRC tienen similiL
des con las protefnas de replicacion que cargan ;:
DNA con la polimerasa de DNA. Es posible q;"
el aRC utilice la hidrolisis de ATP para cargar -
DNA con el anillo MCM. En los extractos de XeI:
pus, la replicacion puede iniciarse si el aRC es el'
nado despues de que ha cargado las protefnas Cd
y MCM. Esto muestra que la funcion principal ;:
aRC es identificar el origen a las protefnas Cdc6
MCM que controlan la iniciacion y la competenc::.=
Las protefnas MCM son indispensables par
elongacion y para la iniciacion, y continuan func' -
nando en la horquilla de replicacion. Su particip=
cion exacta en la elongacion no es clara, pero ~
posibilidad es que contribuyan a la actividad de
helicasa que desenrolla el DNA. Otra posibilidad :-
que actuen como una defensa avanzada que a
en la cromatina para permitir que una helicasa --
tue en el DNA.
lED Los lazos Dmantienen
los orlgenes mitocondriales
Conceptos principales
• las mitocondrias utilizan diferentes secuencias de ori-
gen para iniciar la replicaci6n de cada cadena del DNA.
• la replicaci6n de la cadena Hinicia en un laza D.
• la replicaci6n de la cadena l inicia cuanda su arigen
queda expuesto par el mavimiento de la primera
harquilla de replicaci6n.
Los arfgenes de los replicones en los cromosoIE..
eucarioticos y procari6ticos son estructuras estcL-
cas: estan formadas por secuencias de DNA que ('
reconocidas en su forma duplex y son utilizad=.
para iniciar la replicacion en el momenta adecuad-
La iniciacion requiere la separacion de las caden=
del DNA y el comienzo de la sfntesis bidirecc: -
nal del DNA. En las mitocondrias se observa ~
organizacion diferente.
La replicacion comienza en un origen especmc
localizado en el DNA duplex circular. Sin embarg-
en un inicio solo una de las dos cadenas proge -
toras (la cadena H en el DNA mitocondrial de :
mamfferos) sirve como molde para ]a sfntesis de r
cadena nueva. La sfntesis continua solo una distil::-
cia corta y desplaza a la cadena compafiera o r i g ~
(L), la cual permanece como cadena individw
como se i]ustra en la - r. ~ ! > 6. La condicion -:
esta region da origen a su nombre, laza de despla: -
miento, 0 lazo D.
Las polimerasas de DNA no pueden iniciar
sfntesis, sino que requieren un extremo 3' con a
Conceptos principales
El episodio fundamental en el control de la r r
cacion es la actuacion del ORC en el origen. -:
• El ORC es un complejo de proteinas que esta asociado
a los origenes de las levaduras durante todo el ciclo
celular.
• Cdc6 es una proteina inestable que se sintetiza s6lo e-
G1.
• Cdc6 se une al ORC y permite la uni6n de las proteina5
MCM.
• Cuando la replicaci6n se inicia, las proteinas Cdc6 y
MCM son desplazadas. La degradaci6n de Cdc6 impide
la reiniciaci6n.
• Algunas proteinas MCM se encuentran en el nOcleo
durante el ciclo, pero otras pueden entrar s6lo despuEc:
de la mitosis.
Figura 1.12). Si en el ovocito se bloquea la slntesis
de protefnas, la membrana alrededor del material
inyectado permanece intacta y el DNA no puede
replicarse de nuevo. No obstante, en presencia de
sfntesis protefnica, la membrana nuclear se romp
del mismo modo como 10 harfa en una division ce-
lular normaL y en este caso pueden ocurrir ciclOS
subsiguientes de replicacion. El mismo resultad
puede lograrse con agentes que permeabilicen 1-
membrana nuclear. Esto sugiere que el nucleo con-
tiene una protefna (0 protefnas) indispensable pare:.
la replica cion que se consume de alguna maner-
por un. ciclo de replicacion, por 10 que aunque haye:.
mas proteina en el citoplasma del ovocito, esta sale
puede entrar al nucleo si la membrana nuclear e
rompe. En principio el sistema puede ser lievade
aLll1 mas lejos si se desarrolla in vitro un extract
que respalde la replicacion nuclear y permita asf eO
aislamiento de los componentes del extracto y
identificacion de los factores relevantes.
La F GU 'I) 14 explica el control de la reinicic.-
cion al proponer que esta protefna es un factor de
competencia. Esta presente en elnucleo antes de Ii.
replicacion. Un ciclo de replicacion desactiva 0 de -
truye el factor, y no puede ocurrir otro ciclO has-=.
que se proporcione mas factor. El factor 10calizaG
en el citoplasma puede acceder al material nucleiC
solo en la mitosis subsiguieme cuando se rompa :=.
envoltura nuclear. Este sistema regulador cumpl-
dos propositos. AI eliminar un componente necesar:
despues de la replicacion, impide que ocuna mas c::
un ciclo de replicacion. Tambien constituye un laz
de retroalimentacion que hace que la iniciacion de:=.
replicacion dependa del paso por la division celuk
lED El factor de competencia est::
formado por protelnas MCM
HL
HH HL
densidad
.....
LL
EI DNA en el nucleo
liene una densidad
ligera
EI segundo cicio de
replicaci6n genera
DNA pesado y DNA
hibrido
La replicaci6n
semiconservadora
genera DNA de
densidad hibrida
EI DNA se replica en
presencia de precursores
pesados
Permeabilizaci6n de la
envollura nuclear
Inyecci6n del nucleo al ovocito
>1 cicio de replicaci6n requiere factores
por la presencia de un represor que impida la replica-
cion repetida en los orfgenes que han sido utilizados.
Las preguntas cruciales con respecto a la naturaleza
de este sistema regulador son: ccomo determina el
sistema si un origen particular ha sido replicado? y
cque componentes protefnicos intervienen?
Se ha conocido un poco la naturaleza de los
componentes protelnicos al utilizar un sistema en
el cual un DNA sustrato experimenta un solo ciclo
de replicacion. Los ovocitos de Xenopus tienen todos
los componentes necesarios para replicar el DNA
(en las primera s horas posteriores a la fertilizacion
realizan 11 ciclos de division sin la expresion de ge-
nes nuevos) y pueden replicar el DNA en un nucleo
que es inyectado al ovocito. La r resume
las caracterfsticas de este sistema.
Cuando un espermatozoide 0 nucleo en inter-
fase es inyectado a un ovocito, su DNA se replica
solo una vez (este episodio puede rastrearse con
una etiqueta de densidad, del mismo modo que en
el experimento original en el que se definio la re-
plicacion semiconservadora, mostrado antes en la
Un nucleo inyectado en un ovocito de Xeno-
pus puede replicarse s6lo una vez a menos que la membrana
nuclear sea permeabilizada para permitir ciclos subsiguientes
de replicaci6n.
386 CAPITULO 15 El replic6n
IIIIJ Resumen
seccion 16.4, Los drculos rodantes producen multf-
meros de un replicon).
. - . . • I
Origen de la cadena L
Inicio de la sintesis de RNA
I
La conclusion 0
genera un circulo .
duplex
l
C
Se sellan las separaciones deo··· .
. las cadenas nuevas
. .
La conclusion de la cadena L nueva Iibera los genomas hijos
I \
C
- La conclusion EI genoma 0
genera un liberado es
circulo duplex parclalmente
- repllcado.
l
Cuando la cadena
desplazada pasa al
origen en la cadena L,
inicia la sintesis de la
nueva cadena H
o-E'DNA" ,'o\,\i,.,o
La sintesis de una cadena I
L nueva crea un lazo D al 't
desplazar a la cadena
progenltora
EI lazo 0 se expande

l
Cadena L
El cromosoma completo se replica una vez en cada
cielo de division celular. La iniciacion de la repli·
cacion obliga a la celula a experimentar un ci.elo
de division; la conclusion de la replicacion puede
desencadenar el proceso de division en sf. El ero-
mosoma bacteriano esta formado por un solo re-
plicon, perc un cromosoma eucariotico se divide
El Lazo Dmantiene una abertura en eL DNA mi-
tocondrial de los mamiferos, La cuaL separa los origenes para La
replicaci6n de cada cadena.
'ad cebadora (vease la seccion 18.8, La actividad
::' adora es necesaria para comenzar la sfntesis de
__ -A). La replicacion en el origen de la cadena H
- inicia cuando la polimerasa de R JA transcribe
::: cebador. Los extremos 3' son generados en el
_ ador por medio de una endonueleasa que di-
'e el hfbrido de DNA-R! A en numerosos sitios
'cretos. La endonueleasa es especffica para la es-
:.Ictura triple formada por el hfbrido de DNA-RNA
-as la cadena individual de DKA desplazada. Des-
'es, la polimerasa de DNA extiende el extremo 3'
interior del DNA.
En las mitocondrias de los mamfferos se encuen-
un solo lazo D en forma de una abertura de 500
600 bases. La cadena corta que mantiene ellazo
_ es inestable y se voltea; a menudo es degradada y
tetizada de nuevo para mantener la abertura del
:iplex en este sitio. Algunas moleculas de DNA mi-
condrial poseen numerosos lazos D, 10 cual refleja
.: uso de mllltipies orfgenes. El mismo mecanisme
emplea en el DNA de los eloroplastos, en donde
y dos lazos D (en las plantas superi.ores).
Para replicar el DNA mitocondrial de los ma·
Heros, la cadena corta localizada en el lazo D se
:-xtiende. La region desplazada de la cadena L ori-
se alarga y amplfa el lazo D. Esta expansion
: ntinua hasta llegar a unos dos tercios del trayecto
uededor del drculo. La replicacion de esta region
:,xpone un origen en la cadena L desplazada. La
_fmesis de una cadena H inicia en este sitio, el cual
_- utilizado por una primasa especial que sintetiza
. RNA corto. Despues, el RNA es extendido por la
limerasa de DNA y avanza alrededor del molde
ie la cadena individual L desplazada en la direccion
puesta a la sfntesis de la cadena L.
Como resultado del rezago en su inicio, la sfn-
:esis de la cadena H habra avanzado solo un tercio
el trayecto alrededor del drculo cuando la sfntesis
":e la cadena Lfinalice. Esto libera un cfrculo dllplex
: mpleto y un drculo hendido, el cual permanece
parcialmente en forma de cadena individual hasta
:;,ue la sfntesis de la cadena H coneluye. Por ultimo,
.as cadenas nuevas se sellan para formar estructuras
_'1tactas en terrninos covalentes.
La existencia de los lazos D da lugar a un princi-
io general: Un origen puede ser una secuencia de DNA
.ale sirve para iniciar la sintesis de DNA utilizando una
::1dena como molde. La abertura del duplex no siem-
re conduce a la iniciacion de la replicacion en la
tra cadena. En el caso de la replicacion del DNA
:nitocondrial, los orfgenes para replicar las cadenas
complementarias se encuentran en localizaciones
diferentes. Los orfgenes que facilitan la replica-
cion de solo una cadena tambien se encuentran en
la forma de replicacion del drculo rodante (vease la
15.11 Resumen 389
en numerosos replicones que funcionan durante el
prolongado periodo de la fase S. El problema de re-
plicar los extremos de un replicon lineal se resuelve
en una variedad de formas, con mayor frecuencia al
convertir el replicon en una forma circular. Algunos
virus tienen proteinas especiales que reconocen los
extremos. Los cromosomas eucarioticos confrontan
este problema en sus replicones terminales.
EI orlgen minimo de E. coli esta formado por
-245 bp e inicia la replicacion de forma bidireccio-
nal. Cualquier molecula de DNA con esta secuencia
puede replicarse en E. coli. Dos horquillas de replica-
cion abandonan el origen y se desplazan alrededor
del cromosoma, al parecer hasta que se encuentran,
aunque se han identificado las secuencias ter que ha-
rfan que las horquillas terminaran despues de encon-
trarse. Las unidades de transcripcion estan organiza-
das de tal manera que la transcripcion prosigue casi
siempre en la misma direccion que la replicacion.
La replicacion eucariotica es al menos un orden
de magnitud mas lenta que la replicacion bacteria-
na. Los orfgenes facilitan la replicacion bidireccional
y tal vez se utilicen en un orden predeterminado
durante la fase S. Los orfgenes de S. cerevisiae tienen
una secuencia nuclear de consenso formada por 11
pares de bases, en su mayor parte A-T.
Despues de la division celular, los nucleos de las
celulas eucarioticas tienen un factor de competencia
indispensable para iniciar la replicacion. Su destruc-
cion despues de la iniciacion de la replicacion impi-
de que ocurran cielos de replicacion posteriores en
las levaduras. El factor de competencia no puede ser
importado al interior del nueleo desde el citoplasma
y puede ser remplazado solo cuando la membrana
nuclear se rompe durante la mitosis.
En las levaduras, el origen es reconocido por las
protefnas del ORC, las cuales permanecen unidas
durante el ciclo celular en las levaduras. La protefna
Cdc6 esta disponible s610 en la fase S. En las leva-
duras es sintetizada durante la fase S y se degrada
can rapidez. En las celulas animales se sintetiza de
manera continua, pero es exportada desde el nucleo
durante la fase S. La presencia de Cdc6 permite que
las protefnas MCM se unan al origen. Las protefnas
MCM son indispensables para la iniciacion. La ac-
cion de las protefnas Cdc6 y MCM constituyen la
funcion de competencia.
Referencias
l1li Introduccion
Articulo de investigacion
Jacob, F., Brenner, S., and Cuzin, F. (1963). On the
regulation of DNA replication in bacteria. Cold Spring
Harbor Symp. Quant. Bioi. 28, 329-348.
390 CAPITULO 15 El replicon
IIIJ Los replicones pueden ser lineales 0 circulares
Articulo de revision
Brewer, B. J. (1988). When polymerases collide:
replication and transcriptional organization of the E.
coli chromosome. Cell 53, 679-686.
Articulos de investigacion
Cairns, J. (1963). The bacterial chromosome and its
manner of replication as seen by autoradiography. J
Mol. Bioi. 6, 208-213.
Iismaa, T. P. and Wake, R. G. (1987). The normal
replication terminus of the B. subtilis chromosome,
terC, is dispensable for vegetative growth and
sporulation. 1. Mol. Bioi. 195, 299-310.
Liu, B., Wong, M. L., and AlbertS, B. (1994). A transcribe.
RNA polymerase molecule survives DNA replicatio
without aborting its growing RNA chain. Proc. Natl.
Acad. Sci. USA 91, 10660-10664.
Steck, T. R. and Drlica, K. (1984). Bacterial chromosome
segregation: evidence for DNA gyrase involvement j-
decatenation. Cell 36, 1081-1088.
Zyskind, J. W. and Smith, D. W. (1980). Nucleotide
sequence of the S. typhimurium origin of DNA
replica.tion. Proc. Nat!. Acad. Sci. USA 77, 2460-2464.
IIiII Es posible elaborar el mapa de los origenes
con autorradiografia y electroforesis
Articulo de investigacion
Huberman, J. and Riggs, A. D. (1968). On the mechanisrr:
of DNA replication in mammalian chromosomes. J.
Mol. BioI. 32, 327-341.
III!II Cada cromosoma eucar;otico contiene numerosos
replicones
Articulo de revision
Fangman, W. L. and Brewer, B. J. (1991). Activation of
replication origins within yeast chromosomes. Annu.
Rev. Cell Bioi. 7, 375-402.
Articulo de investigaci6n
Blumenthal, A. B., Kriegstein, H. J., and Hogness, D. S.
(1974). The units of DNA replication in D. melanogas:_
chromosomes. Cold Spring Harbor Symp. Quant. BioI. 3'
205-223.
1m En las Levaduras pueden aisLarse Los origenes
de repLicacion
ArticuLos de revisi6n
Bell, S. P. and Dutta, A. (2002). DNA replication in
eukaryotic cells. Annu. Rev. Biochem. 71, 333-374.
DePamphlis, M. L. (1993). Eukaryotic DNA replication:
anatomy of an origin. Annu. Rev. Biochem. 62,
29-63.
Gilbert, D. M. (2001). Making sense of eukaryotic DNA
replication origins. Science 294, 96-100.
Kelly, T. J. and Brown, G. W. (2000). Regulation of
chromosome replication. Annu. Rev. Biochem. 69,
829-880.
-
-:iculos de investigaci6n
..:: lana, M., Apiou, F., Bensimon. A., and Debatisse, M.
(2003). Dynamics of DNA replication in mammalian
somatic cells: nucleotide pool modulates origin choice
and interorigin spadng. Cell 114, 385-394.
=- snokov, 1., Remus, D., and Botchan, M. (2001).
Functional analysis of mutant and wild-type
Drosophila origin recognition complex. Proc. Nat/.
Acad. Sci. USA 98, 11997-12002.
Y. and Stillman, B. (1992). A yeast
chromosomal origin of D A replication defined by
multiple functional elements. Science 255,817-823.
J. J., Aparicio, J. G., Chen, T.. Barnett, J. D.,
Jennings, E. G.. Young, R. A, BelL S. P., and Aparicio,
O. M. (2001). Genome-wide distribution of ORC and
MCM proteins in S. cerevisiae: high-resolution mapping
of replication origins. Science 294, 2357-2360.
m Los lazos 0 mantienen los origenes mitocondriales
Articulos de revisi6n
Clayton, D. (1982). Replication of animal mitochondrial
DNA. Cell 28, 693-705.
Clayton, D., A. (1991). Replication and transcription of
vertebrate mitochondrial DNA. Annu. Rev. Cell BioI. 7,
453-478.
ShadeL G. S. and Clayton, D. A. (1997). Mitochondrial
DNA maintenance in vertebrates. Annu. Rev. Biochem.
66,409-435.
Referencias 391
Retrovirus yretroposones
ESQUEMA DEL CAPITULO J
550
Introducci6n
El cielo vital de los retrovirus comprende sucesos
similares a la transposici6n
• Un retrovirus tiene dos copias de su genoma de RNA de
cadena unica.
• Un provirus integrado es una secuencia de DNA de cadena
doble.
• Un retrovirus genera un provirus mediante transcripci6n
inversa deL genoma retrovirico.
Los genes retroviricos codifican poliproteinas
• Un retrovirus caracteristico tiene tres genes: gag, pol y env.
• Las proteinas Gag y PoL se traducen a partir de un producto
de transcripci6n de longitud completa del genoma.
• La traducci6n de PoL requiere un cambio de marco por eL
ribosoma.
• Env se traduce a partir de un RNAm individual que se
genera por fragmentaci6n.
• Cada uno de los tres productos proteinicos es procesado
por proteasas para dar origen a multiples proteinas.
El DNA virieo se genera por transcripci6n inversa
• Se repite una secuencia corta (R) en cada extrema deL RNA
virico, de manera que los extremos 5' y 3' corresponden a
R-U5 y U3-R, respectivamente.
• La transcriptasa inversa inicia la sintesis cuando un RNAt
cebador se une a un sitio distante de 100 a 200 bases del
extremo 5'.
• Cuando La enzima alcanza eL extremo, Las bases 5'
terminaLes deL RNA se fragmentan, 10 que expone eL
extremo 3' del producto DNA.
• Los pares de bases expuestos del extremo 3' se aparean con
el extrema 3' de otro genoma de RNA.
• La sintesis continua y genera un producto donde las
regiones 5' y 3' se repiten, Lo que da a cada extremo La
estructura U3-R-U5.
• Ocurren episodios similares de cambio de cadenas cuando
la transcriptasa inversa utiliza el producto DNA para
generar una cadena complementaria.
• El cambio de cadenas es un ejemplo del mecanisme de
selecci6n de copias de la recombinaci6n.
El DNA virico se integra al cromosoma
• La organizaci6n del DNA provirico en un cromosoma
es la misma que en un transpos6n, donde el provirus
es flanqueado por repeticiones directas cortas de una
secuencia en el sitio diana.
• EL DNA lineal se inserta en forma directa en eL cromosoma
deL hospedador gracias a La acci6n de la enzima integrasa
retrovi ri ca.
• Se pierden dos pares de bases de DNA de cada extre
La secuencia retrovirica durante la reacci6n de integ
Los retrovirus pueden hacer transducci6n de
secuencias celulares
• Los retrovirus en proceso de transformaci6n se gene
un suceso de recombinaci6n donde una secuencia dl
celular sustituye a una parte del RNA retrovirico.
Los elementos Ty de las levaduras se asemej
los retrovirus
• Los transposones Ty tienen una organizaci6n similar
los retrovi rus end6genos.
• Los transposones Ty son retroposones con actividad
transcriptasa inversa que reaLizan transposici6n a tr
un intermediario de RNA.
Muchos elementos susceptibles de transposi
residen en Drosophila melanogaster
• Copia es un retropos6n abundante en D. melanogast
Los retroposones son de tres elases
• Los retroposones de La superfamilia virica son transl
que se desplazan a traves de un RNA que no constit
particula infecciosa.
• Algunos retroposones se asemejan de manera direct
retrovirus en su uso de LTR, en tanto otros no tiene
• Se pueden encontrar otros elementos que fueron gei
por un episodio de transposici6n mediada por RNA,
por si mismos no codifican enzimas que puedan cat,
transposici6n.
• Los transposones y retroposones constituyen casi La
del genoma humano.
La familia Alu tiene muchos miembros
muy dispersos
• Una parte importante deL DNA repetitivo en genoma
mamifero esta constituida por repeticiones de una s
familia, organizadas como transposones y derivadas
productos de transcripci6n de la polimerasa III de R
Los seudogenes procesados se originaron co
sustratos para la transposici6n
• Un seudogen procesado se deriva de una secuencia
RNAm por transcripci6n inversa.
Las LIN ES utilizan una endonueleasa para gE
un extremo con actividad cebadora
• Las LINES no tienen LTR y para cebar La transcripci6
inversa requieren que eL retropos6n codifique una
endonucleasa que genere una hendidura.
Resumen
RNA
RNA
·
·
·
·
·
·
·
..................•
·


" .
·
·
·
·
INTRACELULAR
EXTRACELULAR 't
ru " En Los cidos reproductivos de Los retrovirus y Los
retroposones se aLterna la transcripci6n inversa de RNA a DNA
con La transcripci6n de DNA a RNA. S6Lo Los retrovirus pueden
generar particulas infectantes. Los retroposones se confinan a
un cido intracelular.
..
• Un retrovirus tiene dos copias de su genoma de RNA de
cadena unica.
• Un provirus integrado es una secuencia de DNA de
cadena doble.
• Un retrovirus genera un provirus mediante transcripci6n
inversa deL genoma retrovirico.
••.......•............•
· .
·
I··················
'of
Conceptos principaLes
Los retrovirus tienen genomas de RNA de cadena
unica que se replican gracias a un intermediario de
DNA de doble cadena. El cicio vital de un virus com-
prende una etapa obligatoria en la que se inserta
DNA de doble cadena en el genoma del hospedador
por un episodio similar a la transposicion y que ge-
nera repeticiones directas cortas de DNA diana.
La importancia de esta reaccion rebasa la per-
petuacion del virus. Algunas de sus consecuencias
son que:
• Una secuencia retrovfrica integrada en la
lfnea germinativa se mantiene dentro del
genoma celular como provirus end6geno.
Al igual que un bacteriofago Iisogenico, un
provirus actua como parte del material ge-
netico del organismo.
ED El cida vital de los retrovirus
camprende sucesas similares
a la transpasici6n
La transposicion que comprende un intermediario
obligatorio de RNA es una propiedad exclusiva de
las eucariotas y proviene de la capacidad de los re-
trovirus de insertar copias de DNA (provirus) de
un genoma virico RNA en los cromosomas de una
elula hospedadora. Algunos transposones eucario-
ticos se relacionan con provirus retrovfricos en su
organizacion general y experimentan transposicion
a traves de intermediarios de RNA. Como clase, es-
lOS elementos se llaman retroposones (0 a veces
retrotransposones) .
Los retroposones mas sencillos no tienen acti-
vidad de transposicion, pero presentan secuencias
que los elementos activos reconocen como sustratos
para la transposicion. Por 10 tanto, los elementos
que usan una transposicion independiente de RNA
van desde los retrovirus mismos (que tienen capa-
cidad para infectar con libertad celulas hospedado-
ras), hasta secuencias con transposicion a traves de
RNA, y hasta aquellos que por sf mismos no tienen
la capacidad de transposicion. Comparten con todos
os transposones la caracterfstica diagnostica de ge-
erar repeticiones cortas directas de D A diana en
el sitio de una insercion.
Incluso en genomas donde no se han detecta-
o los transposones activos se encuentran vestigios
e episodios antiguos de transposicion en forma de
repeticiones diana directas que flanquean secuen-
cias repetitivas dispersas. Las caracterfsticas de estas
secuencias a veces comprenden una secuencia de
RNA como progenitora de la secuencia geonomica
DNA), 10 que sugiere que el RNA debe haberse
convertido en una copia de DNA duplex que se in-
serto en el genoma por un suceso similar a la trans-
osicion.
Como cualquier otro cicio de reproduccion, el
e un retrovirus 0 retroposon es continuo; es arbi-
rrario considerar como "inicio" el punto donde se
. terrumpe. No obstante, la manera de ver estos
elementos es parciaL por la forma en que suelen
observarse (FIGURA 2 2 . ~ ) .
Los retrovirus se consideraron primero partf-
culas vfricas infecciosas capaces de realizar trans-
mision entre celulas y por ello se cree que el cicio
intracelular (que comprende un DNA duplex) es
un medio de reproduccion de virus RNA. Los re-
troposones se descubrieron como componentes del
genoma, y las formas de RNA se han definido en su
mayor parte por sus funciones como RNAm. As!,
los autores consideran a los retroposones como se-
cuencias genomicas (de DNA duplex) que pueden
realizar transposicion dentro de un genoma; no mi-
gran entre celulas.
III Introducci6n
22.2 El cido vital de los retrovirus comprende sucesos similares a la transposici6n 55:
LTR LTR
DNA lineal
Integraci6n
I !ranscripci6n
tlnversa
ifili Los genes retrovlricos
codifican poliprotelnas
rentes, pero relacionados, es posible que genere pa:-
tfculas vfricas heterocigotas que portan un genoII::.-'.
de cada tipo. La diploidia puede ser importante pac
permitir al virus adquirir secuencias celulares. Lc-,
enzimas transcriptasa inversa e integrasa se tra .:>-
portan con el genoma dentro de la partfcula vfricc.
RNAVV'
FIGURA 22.2 El cido vital retrovirico procede por transcrip-
ci6n inversa del genoma del RNA en DNA duplex, que se inserta
en el genoma del hospedador para ser transcrito en RNA.
• En ocasiones se recombinan secuencias ce-
lulares con la secuencia retrovfrica y des-
pues se transportan juntas; estas secuencias
pueden insertarse en el genoma como se-
cuencias duplex en nuevas localizaciones.
• Las secuencias celulares que experimen-
tan transposicion por un retrovirus pueden
cambiar las propiedades de una celula cuan-
do se infecta can el virus.
Las particularidades del cido de vida de los re-
trovirus se ilustran en la FIGURA 22.2. Los pasos cru-
ciales son que el RNA vfrico se convierte en DNA,
el DNA se integra al genoma del hospedador, y des-
pues, el provirus de DNA de transcribe en RNA.
La enzima encargada de generar la copia inicial
de DNA a partir del RNA es la transcriptasa in-
versa. La enzima convierte el RNA en una cadena
duplex lineal de DNA en el citoplasma de la celula
infectada. El DNA tambien se convierte en formas
circulares, pero estas no parecen involucradas en
la replicacion.
El DNA lineal se abre camino hacia el nudeo.
Una 0 mas copias de DNA se integran al genoma del
hospedador. Una sola enzima, lJamada integrasa,
se encarga de la integracion. El proyjrus es transcri-
to por la maquinaria del hospedador para producir
RNA vfrico, que sirve como RNAm y como geno-
mas para empaquetamiento dentro de viriones. La
integracion es una parte normal del cido vital, in-
dispensable para la transcripcion.
Dos copias del genoma RNA se empaquetan en
cada virion, 10 que hace a la particula vfrica indi-
vidual eficazmente diploide. Cuando una celula es
infectada de manera simultanea por dos virus dife-
Conceptos principales
• Las proteinas Gag y Pol se traducen a partir de un
producto de transcripci6n de longitud completa del
genoma.
• La traducci6n de Pol requiere un cambio de marco por
el ribosoma.
• Env se traduce a partir de un RNAm individual que se
genera par fragmentaci6n.
• Cada uno de los tres productos proteinicos es
procesado par proteasas para dar origen a proteinas
multiples.
• Un retrovirus caracteristico tiene tres genes: gag, pol
env.
Una secuencia retrovfrica usual contiene tres 0 cua-
tro "genes". (En este cant exto el termino genes s'
usa para identificar regiones codificantes, cada u c.
de las cuales en realidad da origen a multiples pro-
tefnas por reacciones de procesamiento.) Un gen -
rna retrovfrico habitual con tres genes se organiu
en la secuencia gag-pol-env, como se indica en 1-
FIGURA 22.3.
El RNArn retrovfrico tiene una estructura co -
vencional; presenta una cubierta en el extrema
esta poliadenilado en el extrema 3'. Se represent.:.
en dos RNArn. Se traduce la longitud total de RN
para dar lugar a las poliprotefnas Gag y Pol. EI pr -
ducto Gag se traduce mediante la lectura desde e:
codon de iniciacion hasta el primer codon de ter·
minacion. Este ultimo debe ser pasado por alto pare
que Pol se exprese.
Diferentes virus utili zan mecanismos diverso,
para avanzar y dejar atras al codon de terminacio.
gag, conforme a la relacion entre los marcos de
lectura gag y pol. Cuando gag y pol se continuan, Ie
supresion por un glutamil-RNAt que reconoce e:
codon de terminacion permite La generacion de une.
sola protefna. Cuando gag y pol estan en
marcos de lectura, tiene lugar un cambio de marc
ribosomico que genera una sola protefna. Por 10 ge-
neral, la leetura completa es - 5% eficaz, de manera
que la protefna Gag supera por casi 20 tantos a la
protefna Gag-Pol.
vv
Transcripci6n
RNAV\r
552 CAPiTULO 22 Retrovirus y retroposones
· .. . ."...
Genoma virico
-1800 -2900
170-1260
I
-cpilio1/--F::;m:;::::r U3 .-/
10-80

'-·US' gag·
-2000
Cada gen genera varios productos proteinicos
Supresi6n 0 cambio ,I
de marco en el procesamiento...
extremo de gag
........._-==-==--=.,.,=== - ......
EI empalme produce Traducci6n I
RNA subgen6mico ...
Traducci6n

Procesamiento !
Gag
Pol
Q
Env
o
MA = matriz (entre la nucleocapside y la envoltura virica)
CA = capside (principal componente estructural)
NC = nucleocapside (que empaqueta el dfmero de RNA)
PR = proteasa (escinde Gag-Pol y Env)
RT =transcriptasa inversa (sintetiza DNA)
IN =integrasa (integra el provirus DNA al genoma)
SU = protefna de superficie (las espigas sobre el viri6n
interactuan con el hospedador)
TM =transmembrana (media la fusi6n virus-hospedador)
FIGURA 22.3 Los genes de los retrovirus se expresan como poliprotejnas, que son procesadas hacia
productos individuales.
La poliproteina Env se expresa par otros me-
dias: el empalme genera un mensajero subgen6mico,
mas carta, que se traduce en el producto Env.
El gen gag da origen a los componentes protei-
rucos del centro nucleoprotefnico del virion. El gen
pol codifica funciones encargadas de la sfntesis y re-
combinacion de acidos nucleicos. El gen env codifica
componentes de la envoltura de la partfcula, que
tambien secuestra componentes de la membrana
citoplasmica de la celula.
Los productos Gag, Gag-Pol y Env son polipro-
tefnas fragmentadas por una proteasa para liberar
las protefnas individuales que se encuentran en los
viriones maduros. La actividad de proteasa es co-
dificada por el virus en diversas formas: puede ser
parte de Gag 0 Pol y a veces adquiere la forma de un
marco de lectura independiente adicional.
La produccion de una partfcula retrovfrica com-
prende el empaquetamiento del RNA en el centro,
su rodeo por proteinas de la capside y la extraccion
por presion de un segmento de membrana de la
celula del hospedador. En la FIGURA 22.4 se muestra
la liberacion de partfculas infecciosas por ese me..
dio. El proceso se revierte durante la infeccion: un
virus infecta una nueva celula al fusionarse con su
membrana plasmatica y luego liberar el contenido
del virion.
FIGURA 22.<1 Los retrovirus (VIH) experimentan gemaci6n des-
de la membrana plasmatica de una celula infectada. Fotos por
cortesia de Matthew A. Gonda, Ph.D., Chief Executive Officer,
International Medical Innovations, Inc.
22.3 Los genes retroviricos codifican poliproteinas 553
Conceptos principales
F GI 2.. " El RNA retrovirico termina en repeticiones directas (R); el
DNA lineallibre termina en LTR y el provirus concluye en LTR, acortados
cada uno por un par de bases.
fill El DNA VlrlCa se genera
par transcripci6n inversa
duplex. Tiene una actividad de polimerasa que.-
permite sintetizar un DNA duplex a partir del pr-
ducto de transcripcion inversa de una sola cau:,-
na del RNA. La segunda cadena de DNA en es-
o
estructura duplex se denomina cadena de D1'_-
positiva. Como adyuvante indispensable de es:.:
actividad, la enzima tiene una actividad de
H, que puede degradar la porcion RNA del hili '.:
RNA-DNA. Todas las transcriptasas inversas rerr-·
vfricas comparten similitudes considerables de >
secuencias de aminoacidos y se pueden reconoc::-
secuencias homologas en algunos otros retrop05-·
nes.
En la FIGURA 22.5 se comparan las estructuras
las formas de DNA del virus con el RNA. El R:-.-
vfrico tiene repeticiones directas en sus extrem :
Esos segmentos R varfan de lOa 80 nucleotidos e-
diferentes cepas de virus. La secuencia del extrec.::
5' del virus es R-D5 y la secuencia en el extrem
es U3-R. Los segmentos Rse usan durante la
sian de la forma de RNA a la de DNA para gener=..:
las repeticiones directas mas extensas que se
van en el DNA lineal (FIGURA 22 6 YFIGURA 22.7). :::...
acortamiento de 2 bp en cada extrema de la forr:::: 0
integrada es consecuencia del mecanismo de integE-
cion (vease la Figura 22.9).
Al igual que con otras polimerasas de DNA. -0
transcriptasa inversa requiere un cebador. El cebc:.-
dar natural es el RNAt. Hay un RNAt del hospe ."-
dor, sin carga, en el virion. Se aparea una secueD '
de 18 bases en el extrema 3' del RNAt con las ( -
rrespondientes en un sitio que se encuentra a 10C :.
200 bases de distancia del extremo 5' de una de
moleculas de RNA vfrico. El RNAt puede tambi
aparear sus bases con un sitio cercano al extre -
5' del otro RNA vfrico, 10 que ayuda a la formaci'·
de un dfmero entre los RNA vfricos.
He aquf un dilema: la transcriptasa inversa iL.:.-
cia la sfntesis del DNA en un sitio apenas 100 a 2C =
bases en sentido descendente respecto del extre
5'. LComo puede generarse el DNA que represe
el genoma intacto de RNA? (Esta es una
extrema del problema general en la replicacion ""
los extremos de cualquier acido nucleico lineal; ve=.-
se la seccion 16.2, Los extremos del DNA lineal sc;:-
un problema para la replicacion.)
La sfntesis in vitro avanza hasta el final y ge-
nera una secuencia de DNA breve llamada DK_-.
de detencion fuerte-negativo. Esta molecula no :-
encuentra in vivo porque la sfntesis continua por:"::
reaccion ilustrada en la Figura 22.6. La transcripta.=-
inversa cambia de moldes y se lleva al DNA nade .'
con ella a un nuevo molde. Este es el primero '::
dos saltos entre moldes.
En esta reaccion, la region R en el extrema ::
del molde de RNA es degradada por la activid".::.
I
LTR
U3 RU5
-,
U5 ha perdido 2 bp
U3 R-1Q-80

-1800 I
170-1260
pol
pol
. ... . ..
-2900
eo
l
RNAvfrico
Forma lineal del DNA vfrico
-2000
gag
Forma de DNA vfrico integrado
U3 RU5 gag
- -,
I
LTR
250-1400 bp
Los retrovirus se denominan virus de cadena
positiva porque el propio RNA vfrico codifica los
produetos proteinicos. Como su nombre 10 indica,
la transcriptasa inversa se encarga de convertir el
genoma (cadena RNA positiva) en una cadena com-
plementaria de DNA que se denornina cadena de
DNA negativa. La transcriptasa inversa tambien
cataliza etapas posteriores de la produccion del DNA
• Se repite una secuencia corta (R) en cada extremo del
RNA virico, de manera que los extremos 5' y 3' sean
R-U5 y U3-R, respectivamente.
• La transcriptasa inversa inicia la sintesis cuando un
RNAt cebador se une a un sitio distante de 100 a 200
bases del extremo 5'.
• Cuando la enzima alcanza el extremo, las bases 5'
terminales del RNA se fragmentan, lo que expone el
extremo 3' del producto DNA.
• Los pares de bases expuestos del extremo 3' se aparean
con el extremo 3' de otro genoma de RNA.
• La sintesis continua y genera un producto donde las
regiones 5'y 3' se repiten, lo que da a cada extremo la
estructura U3-R-U5.
• Ocurren episodios simi lares de cambio de cadenas
cuando la transcriptasa inversa utiliza el producto DNA
para generar una cadena complementaria.
• El cambio de cadenas es un ejemplo del mecanisme de
selecci6n de copias de la recombinaci6n.
10-80 -':RU5
T
80-100
Repetici6n de 4-6 bp
del DNA diana
. . . .
U3 ha perdido 2 bp
_----.-.1
Hospedado U3 RU gag
554 CAPITULO 22 Retrovirus y retroposones
. .. .. .
EI retrovirus provee la cadena positiva de RNA
R U5 • U3 Fl.
5'· I - '3'
5'
5'
3'
5'
5'
3'
5'
3'
5'
3'
.... LTR.....
m:rmrrmrrm
1l············,U········
5'.LU
Concluye la sfntesis del DNA de
cadena negativa
3' I I I "'TtFlr"FrrFlr""tIFFr""rrFFu"'r""rRn

....
5e degrada el RNA y quedan fragmentos I
residuales para cebar la sfntesis de DNA .-
3'
Se retira el RNAI cebador
3'
5'
Concluye la sintesis de la cadena
positiva de DNA
3' 'rrrrrrrrrrrrrrrrr
Se sintetiza la cadena positiva de
detenci6n fuerte del DNA

EI DNA de cadena positiva se transfiere
al otro extrema de la cadena negativa
en el segundo saito
3' ",.""",'FFlF"""'C'F'FI__
rrtfrr.rrrmrrrn
3'
!
!
Se degrada la regi6n 5'
terminal de la cadena )?
de RNA
3'
5' 3'
EI RNAt cebador hibridiza al sitio
de uni6n sobre el RNA
retrovirico
R U5&. U3 R
5' . -, IiLIilLliUiULJ1l1.W 3'
La transcriptasa inversa inicia la sfntesis del DNA
de cadena negativa lr !
• Cadena negativa'
3' .
5' ruurn
IuL, I La slntesis de la cadena positiva de DNA requiere
un segunda salta.
FIGURA 22.6 Se genera la cadena DNA negativa por media del
cambia de molde durante la transcripcion inversa.
de RNAasa H de la transcriptasa inversa. Su retiro
permite que la region R en el extrema 3' realice
apareamiento de bases con el DNA recien sintetiza-
do. La transcripcion inversa continua despues por
la region U3 hacia el cuerpo del RNA.
El origen de la region R que se aparea con el
DNA de detencion fuerte-negativo puede estar en
el extrema 3' de la misma molecula de RNA (apa-
reamiento intramolecular), 0 el extrema 3' de una
molecula diferente de RNA (apareamiento intermo-
lecular). Se usa el cambio a un molde diferente de
RNA en la figura porque hay datos de que la se-
cuencia del RNAt cebador no se hereda en un cido
de vida del retroposon. (Si ocurriese apareamiento
intramolecular, se esperarfa que la secuencia se he-
redara porque ofrecerfa la {mica fuente para la se-
cuencia de union del cebador en el siguiente cido.
El apareamiento intermolecular permite que otro
RNA retrovfrico provea esta secuencia.)
El resultado del cambio y la extension es la adi-
cion de un segmento U3 al extrema 5'. El segmen-
to de secuencia U3-R-U5 se denomina repetici6n
terminallarga (LTR) porque una serie similar de
episodios afiade un segmento U5 al extrema 3' y da
lugar a la misma estructura de U5-R-U3. Su longi-
tud varfa de 250 a 1400 bp (vease la Figura 22.5).
Ahora se necesita generar la cadena de DNA
positiva y la LTR en el otro extremo. La reaccion se
muestra en la Figura 22.7. La transcriptasa inversa
ceba la sfntesis de la cadena positiva de DNA a par-
tir de un fragmento de RNA que queda despues de
degradar la molecula original de RNA. Se genera
una cadena de DNA de detencion fuerte-positivo
cuando la enzima alcanza el extrema del molde.
Este DNA se transfiere entonces al otro extremo de
una cadena negativa, donde tal vez se libere gracias
a una reaccion de desplazamiento cuando ocurra
una segunda ronda de sfntesis de DNA a partir de
un fragmento cebador en ubicacion mas alta (a su
izquierda en la figura). Se hace uso de la region
R para el apareamiento con el extrema 3' de una
cadena de DNA negativa. Este DNA de doble cade-
na requiere entonces conduir ambas cadenas para
generar una LTR duplex en cada extremo.
22.4 El DNA virica se genera par transcripci6n inversa 555
nismo para la recombinacion en general. Es p :::
probable que se emplee en sistemas celulares, pc
constituye una base COmlIn para la recombinac.::-
durante la infeccion por virus RNA, incluso aql.:.;:-
lIos que se replican de manera exclusiva a traves-;:
formas RNA, como los de la poliomielitis.
El cambio de cadenas ocune con cierta frecue::::-
cia durante cada ciclo de transcripcion inversa, :::
decir, ademas de la reaccion de transferencia q:..;:
es forzada en el final de la cadena del molde. :::.
principio se ilustra en la FIGURA 22.8, si bien no ::-
sabe mucho del mecanismo. Ocune transcripci6=
inversa in vivo en un complejo de ribonucleoprotc-·
nas, donde la cadena molde de RNA se une a co -
ponentes del virion, incluida la principal
de la capside. En el caso del VIR, la adicion de es-..=:
proteina (NCp7) a un sistema in vitro causa recomb:-
nacion. El decto es probablemente indirecto: NCp·
afecta la estructura del molde de RNA, 10 que a s-_
vez altera la posibilidad de que la transcriptasa ir:.-
versa cambie de una cadena molde a otra.
3'
, ..
La enzima se une a I
un nuevo molde t
5" -
5'.u..u..r..r '
. .. ".. "
La enzima se disocia I
del molde t

Se reinicia la I
transcripci6n t
inversa
La transcriptasa inversa
sintetiza la cadena de DNA
3'
FIGURA 22.8 La recombinaci6n con selecci6n de copias tiene
lugar cuando la transcriptasa inversa libera su molde y reinicia
la slntesis de DNA utilizando uno nuevo. Es probable que la
transferencia entre las cadenas del molde ocurran de manera
directa, pero aqui se muestra en pasos independientes para
ilustrar el proceso.
Ell El DNA virieo se integra
al eromosoma
Conceptos principales
Cada panlcula retrovirica pona dos genomas
de RNA. Esto hace posible que ocuna la recombi-
nacion durante un ciclo vital virico. En principia,
esto pudiese presentarse durante la sintesis de las
cadenas negativa, positiva, 0 de ambas.
• El apareamiento intermolecular que se
muestra en la Figura 22.6 permite que ocu-
rra una recombinacion entre secuencias de
los dos moldes sucesivos de RNA cuando
se sintetiza la cadena de DNA negativa. La
recombinacion retrovirica es en su mayor
parte debida a la transferencia de cadenas
en esa etapa, cuando se traslada la cadena
naciente de DNA de un molde de RNA a
otro durante la transcripcion inversa.
• Se puede sintetizar DNA de cadena positi-
va de manera discontinua en una reaccion
que comprende varias iniciaciones internas.
Puede haber tambien transferencia de ca-
denas durante esta reaccion, perc es menos
frecuente.
La caracteristica comLin de ambos episodios es
que la recombinacion es consecuencia de un cambio
de molde durante el acto de la sintesis de DNA. Iste
es un ejemplo general de un mecanismo de la re-
combinacion lIamado selecci6n de capia. Durante
muchos anos se considero como un posible meca-
• La organizaci6n del DNA provirico en un cromosoma es
la misma que en un transpos6n, donde el provirus es
flanqueado por repeticiones directas cortas de una
secuencia en el sitio diana.
• El DNA lineal se inserta en forma directa en el
cromosoma del hospedador gracias a la acci6n de la
enzima integrasa retrovirica.
• Se pierden dos pares de bases de DNA de cada extremo
de la secuencia retrovirica durante la reacci6n de
integraci6n.
La arganizacion del provirus integrado se asemeja
a la del DNA lineal. Las LTR en cada extremo del
provirus son identicas. EI extrema 3' de U5 cons-
ta de una repeticion corta invertida con relacion
al extrema 5' de U3, de manera que la LTR misma
termina en repeticiones cortas invertidas. El DNA
provfrico integrado es como un transposon: la se-
cuencia provirica termina en repeticiones inverti-
das y flanqueada par repeticiones cortas directas del
DNA diana.
Se genera el provirus cuando se inserta de ma-
nera directa un DNA lineal a un sitio diana. (Ade-
mas del DNA lineal hay formas circulares de las
secuencias vfricas.) Una tiene dos secuencias LTR
adyacentes generadas por la union de los extremos
lineales. La otra tiene solo una LTR, al parecer ge-
nerada por un episodio de recombinacion y que en
realidad constituye la mayor parte de los drculos.
556 CAPITULO 22 Retrovirus y retroposones
-
Durante mucho tiempo parecio que el cfrculo po-
drfa ser una integracion intermedia (por analogia
con la integraci6n del DNA A; hoy se sabe que se
usa la forma lineal para la integracion) .
La integracion del DNA lineal es catalizada par
un producto virico unico, la integrasa, que actua en
el DNA lineal retrovfrico y el DNA diana. La reac-
cion se ilustra en la FIGURA 22.9.
Los extremos del DNA virico son importantes.
Par ejemplo, las mutaciones en los extremos de los
transposones impiden la integracion. La caracteristi-
ca mas conservada es la presencia de una secuencia
del dinucleotido CA cerca del extremo de cada re-
peticion invertida. La integrasa une los extremos del
DNA lineal en un complejo ribonucleoproteinico y
despues convierte los extremos romos en otros en
recesion por el retiro de bases mas alIa del CA que
se conserva. En general esto implica la perdida de
dos bases.
Se eligen sitios diana en forma aleatoria con
respecto a la secuencia. La integrasa hace cortes es-
calonados en un sitio diana. En el ejemplo de la
Figura 22.9 los cartes estan separados por 4 bp. La
longitud de una repeticion diana depende del virus
particular; puede ser de 4, 5 0 6 bp. Al parecer se
etermina por la geometria de la reaccion de la in-
:egrasa con el DNA diana.
Los extremos 5' generados por la fragmenta-
cion del DNA diana presentan union covalente con
-os extremos 3' en recesion del DNA virico. En ese
ambos extremos del DNA vfrico se unen par
na cadena al DNA diana. La region de una sola ca-
ena es reparada par enzimas de la celula del hos-
pedador, y durante esta reaccion se retiran las dos
Jases que protruyen en cada extrema 5' del DNA
1rico. El resultado es que el DNA virico integrado
ha perdido 2 bp en cada LTR; esto corresponde a
_a perdida de 2 bp desde el extremo izquierdo del
U3 terminal y a la perdida de 2 pb desde el extre-
:no derecho del U5 3' terminal. Hay una repeticion
i:aracterlstica corta directa del DNA diana en cada
extrema de un genoma retrovfrico integrado.
El DNA virico se integra al genoma del hospeda-
or en sitios seleccionados en forma aleatoria. Una
-Bula infectada recibe de una a 10 copias del provi-
:us. (Un virus infeccioso entra al citoplasma, por su-
puesto, pero la forma de DNA se integra al genoma
::'n el nucleo.) Los retrovirus pueden replicarse solo en
.::elulas proliferantes porque el ingreso al nucleo re-
.:J.uiere que la celula pase por la mitosis, cuando el
virico logra el acceso al material nuclear.
La region U3 de cada LTR porta un promotor.
::::1 promotor en la LTR izquierda se encarga del ini-
jo de la transcripcion del provirus. Recuerdese que
requiere la generacion del DNA provfrico para
'lbicar una secuencia de U3 en la LTR izquierda;
A ,... • ......
1. La integrasa genera dos ex1remos 2. La integrasa genera extremos
3' con retraso de dos bases en LTR escalonados en el DNA diana
3. La integrasa vincula los extremos 3'
can retraso de LTA a los ex1remos 5'
escalonados de la diana
22 9 La integrasa es la (Jniea proteina viriea neeesaria
para la reaeei6n de integraei6n, donde eada LTR pierde 2 bp y
se inserta entre repetieiones de 4 bp del DNA diana.
por 10 tanto, se observa que el promotor es, de he-
cho, generado par la conversion del RNA en DNA
duplex.
A veces (tal vez con muy poca frecuencia), el
promotor en la LTR derecha facilita la transcripcion
de las secuencias del hospedador cercanas al ciclo
de integracion. La LTR tambien !leva un reforzadar
(una secuencia que activa a los promotores veci-
nos), que puede actuar sobre las secuencias celular
y vfrica. Tal vez a la integracion de un retrovirus se
deba que una celula hospedadora pase a un estado
tumorigenico cuando se activan ciertos tipos de ge-
nes en esta forma. i-Se pueden escindir del genoma
los provirus integrados? Podria ocurrir recombina-
cion homologa entre las LTR de un provirus; hay
LTR solitarias presentes en algunos genomas celu-
lares que podrian constituir vestigios de un episodio
de escision,
Hasta ahora se han analizado los retrovirus en
terminos del cicIo infectante, donde se necesita in-
tegracion para la produccion de mas copias de RNA.
No obstante, cuando un DNA virico se integra a
la linea germinativa se convierte en un "provirus
endogeno" originado en el organismo. Los virus en-
dogenos por 10 general no se expresan, pero en oca-
siones son activados por episodios externos, como
una infeccion con otro virus.
22.5 El DNA virieo se integra al eromosoma 557
cias celulares en la forma ilustrada en la FIGL
2 .1J. Parte de la secuencia virica ha sido sustitui
por el gen v-onc. La sintesis de proteinas genera - =
Gag-v-One en lugar de las proteinas usuales Gc.:-
Pol y Env. El virus resultante presenta un defet:-
to de la replicacion; no puede mantener un cic
infectante por si mismo. Sin embargo, puede pe:--
petuarse en compania de un virus auxiliar,
proporeiona las funeiones virieas faltantes.
Las siglas Onc constituyen una abreviatura
oncogenesis, la eapaeidad de transformar eelul::..
eultivadas de manera que se liberen de la regulaei -
habitual del crecimiento y sea posible su divisi'-:-
inestrieta. Los genes onc virico y celular pueden
causa de la aparicion de eelulas tumorigenieas.
Un gen v-onc confiere a un virus la eapaeidad'::
transformar un cierto tipo de celula hospedador::..
Los loci con secueneias homologas que se eneue-·
tran en el genoma del hospedadar corresponder:
genes c-onc. i.. Como adquieren los retrovirus gen::-
onc? Una caracteristiea reveladora es la discrepCL:'
cia en las estructuras de los genes c-onc y v-onc. L
genes c-onc por 10 general son interrumpidos por i--
trones, en tanto los v-onc no son interrumpidos. E5:.
sugiere que los genes v-onc se ariginan de capias .::.:
los genes c-onc empalmadas al RNA.
En la HGLP 2 11 se ilustra un modelo para :.=
formacion de los virus en transformacion. Un ct-
trovirus presenta integracion eerca de un gen c-c"
Tiene lugar una delecion que origina fusion del
virus al gen c-onc; la transeripcion genera
un RNA unido que eontiene secueneias virieas c
un extremo y secuencias eelulares onc en el
El empalme retira los intrones de las partes
y celular del RNA. El RNA tiene las senales ape-
piadas para el empaquetamiento dentro del viric=-
se generaran viriones si la celula tambien cantic:
otra copia intaeta del provirus. En este punto, 315'
de las partfculas vfricas diploides puede eontener =
RNA fusionado y un RNA vfrico.
Una reeombinacion entre estas secuencias '.
drfa generar el genoma de transformacion, don.::.:
hay repetieiones viricas en ambos extremos. (Gc-
ne eon freeuencia alta la reeombinacion par \::..-
rios medios durante el eielo infectante retroviric
No se sabe nada aeerca de sus requerimientos .::.:
homologia en los sustratos, pero se supone que -
reaccion no homologa entre un genoma viricc -
la parte eelular del RNA fusionado proeede
mismos meeanismos que se eneargan de la reco=.-
binaeion viriea.)
Las earacteristieas eomunes de todas las ela :::
de retrovirus sugieren que pueden derivarse de '_
ancestro unieo. Los elementos de las seeuencias '-
insereion (IS) primordiales podrian haber rodea.::.
a un gen de polimerasa de acido nueleico del he
I Transcripci6n de
t otro provirus
Empaquetado en el viri6n
/
l Empalme
Recombinaci6n del RNAl
Concepto principal
• Los retrovirus transformantes se generan par un
episodio de recombinaci6n donde una secuencia de
RNA celular sustituye parte del RNA retrovirico.
Transcripci6n a partir dell
provirus can deJeci6n t
Los virus en transformaci6n can replicaci6n
defectuosa presentan sustituci6n de una secuencia celular par
una parte de la secuencia virica. El virus defectuoso puede
replicarse can la ayuda de un virus auxiliar que realiza las
funciones naturales.
Virus auxiliar
--:.-:-=0"1=-=
I Las proternas del
" virus auxiliar
M lograr·····
la replicaci6n del
virus defectuoso
ED Los retrovirus pueden hacer
transducci6n de secuencias
celulares
Virus defectuoso
RU5 'gag
. . .....
Una informacion interesante acerca del cielo vital
virico surge de la aparicion de virus de transduc-
cion, que son variantes que han adquirido secuen-
..--- Provirus I ( gen e-one .......
LTR gag pol env LTR Ex6n Intr6n Ex6n

DELECION
Se pueden generar genes can replicaci6n defectuosa
mediante la integraci6n y deleci6n de un genoma virico para obtener
un producto de transcripci6n celular-virica unido, que se empaqueta
con un genoma normal de RNA. Se necesita recombinaci6n no hom6loga
para generar el genoma de transformaci6n can replicaci6n defectuosa.
558 CAPITULO 22 Retrovirus y retroposones
pedador; la unidad resultante tendrfa la forma de
LTR-pol-LTR, que pudiese evolucionar hacia un vi-
rus infectante por la adquisicion de habilidades mas
complejas para manipular sustratos tanto de DNA
como de RNA, incluida la incorporacion de genes
cuyos productos permitieran el empaquetamiento
del RNA. Otras funciones, como la transformacion
de genes, podrian incorporarse despues. (No hay
motivo para suponer que el mecanismo involucrado
en la adquisicion de funciones celulares sea exc1usi-
vo de los genes one; no obstante, es posible que los
virus que portan estos genes tengan una ventaja
selectiva debido a su efeeto estimulador del creci-
miento celular.)
III Los elementos Ty
de las levaduras se asemejan
a los retrovirus
Conceptos pr;nc;pales
• Los transposones Ty tienen una organizaci6n similar a
la de los retrovirus end6genos.
• Los transposones Ty son retroposones con act;v;dad
de transcriptasa inversa que realizan transposici6n a
traves de un intermediario de RNA.
Los elementos Ty constituyen una familia de se-
cuencias repetitivas dispersas de DNA que se en-
cuentran en sitios diversos de cepas disimiles de
levaduras. Las siglas Ty corresponden a una abre-
viatura de "transposones de levadura" (del ingles,
transposon yeast, Ty). Un episodio de transposicion
da origen a un vestigio caracterfstico: 5 bp del DNA
diana se repiten a cada lado del elemento Ty in-
sertado. Los elementos Ty son retroposones que
realizan la transposicion por el mismo mecanismo
que los retrovirus. La frecuencia de la transposicion
Ty es menor que la de gran parte de los transposones
bacterianos, -10-
7
-10-
8

Hay mucha divergencia entre los distintos ele-
mentos Ty. Casi todos entran en una de dos clases
principales llamadas Ty1 YTy917. Tienen la misma
organizacion general ilustrada en la T "lJ , ....
Cada elemento tiene 6.3 kb de longitud; los liltimos
330 bp en cada extrema constituyen repeticiones
directas llamadas 8. Cada uno de los elementos Ty
de cada tipo tiene muchos cambios respecto del pro-
totipo de su clase, como las sustituciones, insercio-
nes y deleciones de pares de bases. Hay - 30 copias
del tipo Ty1Y-6 del tipo Ty917 en un genoma carac-
teristico de levadura. Ademas, hay -100 elementos
delta independientes llamados 8 solo.
Las secuencias delta tambien muestran mucha
heterogeneidad, si bien es posible que las dos repe-
~ - - - - = ~ - - - : ~ = = ; ; . . . . .
I) lyA lyS
--- RNA de 5.7 kb - - - - l . ~
---RNAde 5.0 kb-.
Proteina TyA
Cambio de marco
2 12 Los elementos Ty terminan en repeticiones
directas cortas y se transcriben en dos RNA superpuestos. Tie-
nen dos marcos de lectura con secuencias relacionadas con los
genes retroviricos gag y pol.
ticiones de un elemento individual Ty sean identicas,
o al menDs con una relacion muy cercana. Las se-
cuencias delta vinculadas con elementos Ty muestran
mayor conservacion de secuencias de los elementos
delta solo, 10 que sugiere que el reconocimiento de las
repeticiones participa en la transposicion.
El elemento Ty se transcribe en dos especies de
RNA poli(Aj+, que constituyen >5% del RNAm total
de una celula haploide de levadura. Ambas especies
inician en el interior de un promotor en el elemento
8 en el extremo izquierdo. Uno termina despues de
5 kb; el otro 10 hace despues de 5.7 kb, dentro de la
secuencia 8 en el extrema derecho.
La secuencia del elemento Ty tiene dos marcos
de lectura abiertos que se expresan en la misma
direccion, pero se leen en fases diferentes y se su-
perponen por 13 aminoacidos. La secuencia de TyA
hace pensar que codifica una proteina de union al
DNA. La secuencia de TyB contiene regiones con
homologfas con las secuencias transcriptasa inversa,
proteasa e integrasa de los retrovirus.
La organizacion y las funciones de TyA y TyB
son analogas de la conducta de las funciones gag y
pol retrovfricas. Los marcos de lectura TyA y TyB se
expresan en dos formas. La protefna TyA representa
el marco de lectura TyA y termina en su extremo.
Sin embargo, el marco de lectura TyB se expresa solo
como parte de una proteina de union, donde la re-
gion TyA se fusiona con la region TyB gracias a un
episodio especifico de cambio de marco, que permite
pasar por alto el codon de terminacion. (Esto es ana-
logo a la traduccion de gag-pol en los retrovirus.)
La recombinacion entre elementos Ty parece
ocurrir en salvas; cuando se deteeta un episodio
hay una mayor probabilidad de encontrar otros.
22.7 Los elementos Ty de las levaduras se asemejan a los retrovirus 559
Se marca una unidad delta
Elemento Ty de inicio
EI promotor precede al elemento; se agrega
el intr6n
La transposicion da como resultado la aparicion --
multiples copias del transposon en el genoma de
levadura, pero todas las copias carecen del intr6,
Se conoce solo una forma de retirar intrones: e:
empalme de RNA 10 que hace pensar que la tra- .
posicion tiene lugar por el mismo mecanismo _-.-
en los retrovirus. EI elemento Ty se transcribe a:...::
RNA que es reconocido por el aparato de desdob:c::-
miento. Una transcriptasa inversa reconoce el R.: -_-
desdoblado y regenera una copia de DNA duplex:
La analogfa con los retrovirus continua toda- -
mas. EI elemento Ty original tiene una diferenc.::
de secuencia entre sus dos elementos delta. Sin e--
bargo, los elementos donde ocunio transposiciL-
poseen secuencias delta identicas, que se derivan
delta 5' del elemento original. Si se considera a .
secuencia delta exactamente como una LTR, CO--
sistente en las regiones U3-R-U5, el RNA de Tr
extiende de una region R a otra. Asf como se mue>
tra para los retrovirus en las Figuras 22.3 a 22.6.
regenera la LTR completa cuando se agrega un i.-=
al extremo 3' y un U3 al extremo 5'.
La transposici6n es controlada por genes de-·
no del elemento Ty. El promotor GAL utilizado PeL':'
controlar la transcripcion del elemento Ty marca C
es inducible: se activa con la adicion de galactosa. - =
induccion del promotor tiene dos efectos. Es necc-
sario activar la transposici6n del elemento marcac.
y esta tambien aumenta la frecuencia de
cion de los demas elementos Ty en el cromoso =
de la levadura, 10 que implica que los productos
elemento Ty pueden actuar en conformacion tTC.'
sobre otros elementos (en realidad sobre sus RN
El elemento Ty no da origen a partfculas infe.:.-
ciosas, pero se acumulan partfculas similares a virc:
(del ingles virus-like particles, VLP) en el interior c=
las celulas donde se ha inducido la transposici6-
Las partlculas, que se pueden observar en la FIGL
22.14, contienen RNA de longitud completa, D1\_-.
de doble cadena, actividad de transcriptasa
y un producto TyB con actividad de integrasa. :::..
producto TyA es fragmentado como un precurs :-
gag para producir las protefnas centrales madura.i
del VLP. Esto aumenta todavfa mas la analogfa entre:
el transpos6n Ty y los retrovirus. En resumen, t
elemento Ty actua como un retrovirus que perill-
su gen env y, por tanto, no puede empaquetar bie:::.
su genoma.
No todos los elementos Ty de cualquier
de levadura estan activos: la mayor parte de ellos h::
perdido la capacidad de transposicion (y son ani-
logos a provirus endogenos inertes). No obstante
estos elementos "muertos" conservan las repetici -
nes delta y, en consecuencia, proveen dianas par::
la transposicion en respuesta a las protefnas sinte·
tizadas por un elemento activo.
·.-
Intr6n

*
Promotor
Sustituci6n de bases
I
*

Los elementos con transposici6n tienen
deltas notorias, sin intr6n
Hay conversion genetica entre elementos Ty en di-
ferentes localizaciones, con el resultado de que uno
es "sustituido" por la secuencia del otro.
Los elementos Ty pueden escindirse mediante
recombinacion homologa entre las secuencias delta
de repeticion directa. Es posible que el gran numero
de elementos 8 solo constituya un vestigio de dichos
episodios. Una escision de esta naturaleza puede
asociarse a la reversion de una mutacion causada
por la insercion de Ty; el grado de reversion puede
depender de las secuencias delta exactas que que-
daron atras.
Es una paradoja que ambos elementos delta
tengan la misma secuencia y, no obstante, un pro-
motor esta activo en el delta de un extremo y un
terminador esta activo en el delta del otro extremo.
(Se encuentra una caracterfstica similar en otros
elementos susceptibles de transposicion, incluidos
los retrovirus.)
Los elementos Ty son retroposones caracterfs-
tieos, ya que realizan transposicion a traves de un
intermediario de RNA. En la FIGuRA 22 13 se incluye
un esquema ingenioso que permite detectar este
episodio. Se inserto un intron en un elemento para
generar una secuencia Ty exclusiva. Esta secuencia
se coloco bajo el control de un promotor GAL en un
plasmido y se introdujo en las celulas de levaduras.
f v A 2". 3 Un elemento Ty unico sometido a procesos de
ingenieria para contener un intr6n, experimenta transposici6n
para formar capias que carecen del intr6n. Las copias poseen
repeticianes terminales identicas, que se generan desde uno
de los extremos del elemento Ty original.
560 CAPITULO 22 Retrovirus y retroposones
FIGURA 22.14 Los elementos Ty generan particulas similares a
virus. Reproducida de J. Mol. BioI., vol. 292, AL-Khayat H. A.,
et al., Yeast Ty retrotransposons... , pp. 65-73. Copyright 1999,
con autorizaci6n de Elsevier. Foto por cortesia del Dr. Hind A.
AL-Khayat Imperial College London, United Kingdom.
III Muchos elementos susceptibles
de transposici6n residen
en Drosophila melanogaster
Concepto principal
• [apia es un retropos6n abundante en Drosophila
melanogaster.
La presencia de elementos susceptibles de transpo-
sicion en D. melanagaster se dedujo por primera vez
despues de observaciones analogas a aquellas con
que se identificaron las primeras secuencias de inser-
cion en E. cali. Se encuentran mutaciones inestables
que revierten al tipo silvestre por deleci6n, 0 que
generan deleciones del material de los flancos con
un punta terminal en el sitio de origen de la muta-
cion. Son causadas por varios tipos de secuencias
susceptibles de transposicion, que se ilustran en la
FIGURA 22 15. Estas secuencias incluyen al retropo-
son capia, la familia FB y los elementos P analizados
antes en la seccion 21.14, Participacion de los ele-
mentos susceptibles de transposicion en la disgenesia
de hfbridos.
La familia mejor descrita de retroposones es
capia. Su nombre refleja la presencia de un gran
numero de secuencias relacionadas muy de cerca
que codifican abundantes RNAm. La familia capia
se toma como paradigma para varios otros tipos de
elementos con secuencias que no tienen relacion,
pero cuya estructura y conducta general parecen
similares.
EI numero de reproducciones del elemento ca-
9ia depende de 1a cepa de 1a mosca; por 10 general es
de entre 20 y 60. Los integrantes de la familia estan
Repeticiones directas
~ ~
20-60 capias
Repeticianes invertidas
Repeticiones invertidas largas
- - - - - ~ _ .._..
FB
-30 capias
Repeticiones invertidas cortas
r - - - - ~ 2900 bp _
P ~
oa -50 capias
HGURA 22 lS Tres tipos de elementos de transposici6n en D.
melanogaster tienen diferentes estructuras.
bastante dispersos. Las localizaciones de los elemen-
tos capia muestran un espectro diferente (si bien con
superposicion) en cada cepa de D. melanagaster.
Estas diferencias han surgido durante periodos
evolutivos. Las comparaciones de cepas que han
tenido divergencia en fechas recientes (durante los
ultimos 40 afios) como resultado de su propagacion
en ellaboratorio revelan pocos cambios. No se pue-
de calcu1ar e1 ritmo del cambio, pero la naturaleza
de los sucesos subyacentes queda de manifiesto por
el resultado de las celulas que crecen en cultivo. EI
numero de elementos capia por genoma aumenta
de manera sustanciaL hasta el triple. Los elementos
adicionales representan inserciones de secuencias
capia en sitios nuevos. La adaptacion al cultivo en al-
guna forma desconocida aumenta de manera tran-
sitoria la tasa de transposicion dentro de los lfmites
de 10-
3
a 10-4 episodios por generacion.
EI elemento capia tiene -5 000 bp de longitud,
con repeticiones directas terminales identicas de 276
bp. Cada una de las repeticiones directas termina en
repeticiones invertidas relacionadas. Una repeticion
directa de 5 bp de DNA diana se genera en el sitio
de insercion. La divergencia entre cada uno de los
integrantes de la familia capia es pequefia, de <5%;
las variantes suelen contener pequefias deleciones.
Todas estas caracterfsticas son comunes a otras fa-
milias sirnilares a copia, si bien sus miembros indi-
viduales muestran mayor divergencia.
La identidad de las dos repeticiones directas de
cada elemento capia indica gue interactLlan para
permitir sucesos de correccion 0 que ambas son ge-
neradas a partir de una de las repeticiones directas
de un elemento progenitor durante la transposicion.
22.8 Muchos elementos susceptibles de transposici6n residen en Drosophila melanogaster 561
Como en el caso similar de los elementos Ty, esto
hace pensar en una relacion con los retrovirus.
Los elementos capia en el genoma siempre estan
intactos; no se han detectado copias individuales de
las repeticiones terminales (aunque seria de esperar
que se generasen si la recombinacion produjese de-
lecion del material interpuesto). En ocasiones se en-
cuentran elementos capia en forma de DNA circular
libre; al igual que los circulos de DNA retrovirico, su
forma mas prolongada tiene dos repeticiones termi-
nales y la mas corta tiene solo una. Se han comuni-
cado particulas que contienen RNA de capia.
La secuencia capia contiene un solo marco de
lectura largo de 4227 bp. Hay homologias entre
partes del marco de leetura abierta de capia y las
secuencias gag y pal de los retrovirus. Es notable
la ausencia de las homologias de alguna relacion
con secuencias retroviricas env indispensables para
la envoltura del virus, 10 que significa que es poco
probable que capia pueda generar particulas simi-
lares a virus.
Los productos de transcripcion capia se encuen-
tran como RNAm poli(A», que representa produc-
tos de transcripcion de longitud total y parcial. Los
RNAm tienen un extremo 5' COmLll1 derivado de
la iniciacion a la mitad de una de las repeticiones
terminales. Se producen varias proteinas, tal vez
gracias a episodios como el empalme de RNA y la
fragmentacion de poliprotefnas.
No se cuenta con pruebas directas del modo de
transposicion de copia; como resultado, hay tantas
similitudes can la organizacion retrovirica que pare-
ce inevitable que copia tenga un origen relacionado
con los retrovirus. Es dificil decir cuantas funciones
retroviricas posee capia. Se sabe, por supuesto, que
efectua transposicion, pero (como en el caso de los
elementos Ty) no hay pruebas de que tenga alguna
capacidad infecciosa.
.. .- . ~ -
ED Los retroposones
son de tres clases
Conceptos principales
• Los retroposones de la superfamilia virica son
transposones que se desplazan a traves de un RNA que
no constituye una particula infecciosa.
• Algunos retroposones se asemejan de manera directa a
retrovirus en su uso de LTR, en tanto otros no tienen
LTR.
• Se pueden encontrar otros elementos que fueron
generados por un episodio de transposici6n mediada
por RNA, perc por si mismos no codifican enzimas que
puedan catalizar la transposici6n.
• Los transposones y retroposones constituyen casi la
mitad del genoma humano.
Se define a los retroposones por su uso de mecan':.::-
mos de transposicion que comprenden la transcIi;-
cion inversa de RNA en DNA. Se conocen tres cla c..
de retroposones, incluidos en la FIr. I 2.16:
• Los rniembros de la superfanlilia virica G-
difican actividades de transcriptasa invers-.:.
integrasa, 0 ambas. Al igual que otros retr,-,
posones, se reproducen de la misma manE-
ra que los retrovirus, pero difieren de ell,:'_
porque no pasan por una forma infecci x
independiente. Se describen mejor en Ie_
elementos Ty y capia de levaduras y mosc:zs
• Las secuencias repetidas largas d i s p e r s ~ _
(LINES) tambien tienen actividad de tra.r.:s-
criptasa inversa (y pueden, por tanto, cor.-
siderarse como constitutivas de miembrc_
mas distantes de la superfamilia virica
pero carecen de LTR y usan un mecallis
diferente al de los retrovirus para cebar ~
reaccion de transcriptasa inversa. Proviene::.
.. .. ~ ... . ;. :
Superiamilia virica LINES Superiamilia no virica
Tipos frecuentes Ty (5. cerevisiae)
copia (0. melanogaster)
Terminaciones
Repeticiones en
dianas
Actividades
enzimaticas
Organizacion
Repeticiones terminales
largas
4-6 bp
Transcriptasa inversa,
integrasa, 0 ambas
Puede contener intrones
(retirados en el RNAm
subgenomico)
L1 (humano)
81,82 ID, 84
(raton)
Sin repeticiones
7-21 bp
Transcriptasa inversa
o endonucleasa
Uno 0 dos ORF
ininterrumpidos
SINES (mamiferos)
Seudogenes de
productos de transcripcion
de pol III
Sin repeticiones
7-21 bp
Ninguna (0 ninguna que
codifique productos de
transposones)
Sin intrones
I • Los retroposones pueden dividirse en las superfamilias viricas, que son similares
a retrovirus 0 LINES, y superfamilias no viricas, que no ejercen funciones de codificaci6n.
562 CAPITULO 22 Retrovirus y retroposones
int
LTR
ORF
pol
gag
gag
LTR
Ty • TyA
Copia
LTR
LINES - .... -_2--,
Homologfa con
Retrovirus
Los retroposones que se relacionan muy de cer-
ca con los retrovirus tienen una organizaci6n similar, pero las
LINES comparten s6lo la actividad de transcriptasa inversa.
secuencias relativamente cortas relacionadas entre
sf (constituidas por el DNA con repeticion moderada
descritas en la seccion 4.6, Genomas eucarioticos
que contienen secuencias de DNA repetitivas y no
repetitivas. Las LINES incluyen secuencias dispersas
largas y las SINES, secuencias dispersas cortas. (Se
describen como secuencias dispersas 0 repeticio-
nes dispersas, por su presencia comun y distribu-
cion generalizada).
Las plantas contienen otro tipo de elemento
movil pequeno llamado MITE (que corresponde
a un elemento invertido de transposicion repetida
en rniniatura). Tales elementos terminan en repe-
ticiones invertidas, tienen una secuencia diana de
2 0 3 bp, no presentan secuencias de codificacion y
tienen de 200 a 500 bp de longitud. Hay al menDs
nueve de tales familias (por ejemplo) en el genoma
del anoz. Amenudo se encuentran en regiones que
flanquean genes que codifican proteinas. No tienen
relacion con SINES 0 LINES.
Las LINES y SINES constituyen una parte signi-
ficativa del DNA repetitivo de los genomas animales.
En muchos genomas eucarioticos elevados ocupan
-50% del DNA total. En la se resume la
distribucion de los diferentes tipos de transposones,
que constituyen casi la mitad del genoma humano.
Excepto por las SINES, que casi siempre carecen de
funcion, los otros tipos de elementos estan consti-
tuidos por representantes funcionales y otros que
han sufrido deleciones que eliminaron parte de los
marcos de lectura que codifican las proteinas nece-
sarias para la transposicion. Los porcentajes relati-
vos de estes tipos de transposones son, en general,
similares en el genoma de raton.
Una LINES comun en genomas de mamiferos
se denomina Ll. EI miembro usual tiene - 6500
bp Ytermina en un segmento rico en A. Los dos
marcos de lectura abierta de un elemento de longi-
tud total se denominan ORFI y ORF2. El nlimero
de productos de transcripcion de la polime-
rasa II de RNA. Una muy escasa parte de los
elementos en el genoma tiene funcion com-
pleta y puede efectuar transposicion de ma-
nera autonoma; otras presentan mutaciones
y por ella solo pueden hacer transposicion
como resultado de un elemento autonomo
que actua en configuracion trans.
• Los miembros de la superfamilia no viri-
ca se identifican par caracteristicas externas
e internas que sugieren que provienen de
secuencias de RNA. Sin embargo, en estos
casos solo se puede especular acerca de como
se genera una copia de DNA. Se supone que
eran diana de un episodio de transposicion
por un sistema enzimatico codificado en otro
sitio, 0 sea, siempre carecieron de autonomia.
Se ariginaron en praductos de transcripcion
celular. No codifican proteinas con funcio-
nes de transposicion. El componente mas
prominente de esta familia recibe el nom-
bre de secuencias repetidas dispersas cortas
(SINES). Estos componentes se derivan de
productos de transcripcion de la polimerasa
III de RNA.
La muestra las relaciones de orga-
y secuencia de los elementos que codifican
.a transcriptasa inversa. Al igual que los retrovirus,
os retroposones que contienen LTR se pueden
lasificar por grupos de acuerdo con el numero de
marcos de lectura independiente para gag, pol e int y
el orden de los genes. A pesar de esas diferencias su-
de organizacion, la caracteristica comun
es la presencia de actividades de transcriptasa inver·
a e integrasa. Los elementos LINES de mamiferos
omunes tienen dos marcos de lectura; uno codifica
wa proteina de union de acido nucleico y la otra la
actividad de transcriptasa inversa y endonucleasa.
Los elementos que contienen LTR pueden va-
!iar de retrovirus integrados a retroposones que han
erdido la capacidad de generar partlculas infeccio-
-as. Los genomas de levadura y mosca tienen ele-
Ty y copia que no pueden generar particulas
:nfecciosas. Los genomas de mamifero contienen
:etrovirus endogenos que, cuando estan activos,
ueden generar particulas infecciosas. EI genoma
de raton tiene varios retrovirus endogenos activos
ue son capaces de generar particulas que propagan
infecciones horizontales. Por contraste, casi todos
.05 retrovirus endogenos perdieron su actividad
ace casi 50 millones de aiios en ellinaje humane
:' el genoma tiene hoy en su mayor parte restos
:nactivos de los retrovirus endogenos.
Las LINES y SINES constituyen una parte im-
ortante del genoma animal. En un principio se
definieron por la existencia de un gran numero de
22.9 Los retroposones son de tres clases 563
.. .
Elemento Organizaci6n Longilud (Kb) Genoma humano
Numero Fracci6n
<0,3 1 500 000
:. Transposasa 2-3 300 000
Retrovirus /retropos6n
LINES (aut6nomo). p, ej, L1
SINES (no aut6nomo), p, ej,. Alu
Transpos6n de DNA
• ,gag pol
ORF1 "7p'ol) - .
1-11 450 000
6-8 850 000
8%
17%
15%
3%
FTr.LJ A 27. 18 Cuatro tipos de elementos de transposici6n constituyen casi la mitad del genoma
humano.
de elementos de longitud total suele ser pequeno
(-50) y el resto de las copias son truncas. Se pue·
den encontrar productos de transcripcion. Como 10
indica su presencia en el DNA repetitivo, la familia
LINES muestra variacion de secuencias entre miem-
bros individuales. Sin embargo, los integrantes de
la familia dentro de una especie son relativamente
homogeneos en comparacion con la variacion ob·
servada entre dos especies. Ll es ellmico miembro
de la familia LI.I\TES que ha estado activo en los lina-
jes de raton 0 humano. Parece haber permanecido
muy activo en el raton, pero ha declinado en el
linaje humano.
Solo ha habido una SINES activa en el linaje
humano, el elemento comun Alu. El genoma de
raton tiene una contraparte de este elemento, B1, Y
tambien otros SINES (B2, ill, B4) que han presenta·
do actividad. El Alu humano y el SINES BIde raton
tal vez provengan del RNA 7SL (vease la seccion
22.10, La familia Alu tiene muchos miembros muy
dispersos). El otro SINES de raton parece haberse
originado de un producto de transcripcion inversa
de RNAt. Es probable que la transposicion de SThTES
se deba a que un elemento activo Ll las reconoce
como sustratos.
fDD La familia Alu tiene muchos
miembros muy dispersos
Concepto principal
• Una parte importante del DNA repetitivo en genomas
de mamiferos consta de repeticiones de una sola
familia, organizadas como transposones y derivadas de
productos de transcripci6n de la polimerasa III de RNA.
Las SINES mas notorias incluyen miembros de una
sola familia, Su breve longitud y alto grado de repe-
ticion las hacen comparables al DNA de secuencias
simples (satelitej, excepto que los miembros indi-
viduales de la familia estan dispersos en el genoma
en lugar de confinados a grupos seriados. De nuevo,
564 CAPITULO 22 Retrovirus y retroposones
hay similitud significativa entre los miembro;;
una especie en comparacion con la variacion e-
especies.
En el genoma humano, una gran parte
moderadamente repetitivo se encuentra corne
cuencias de - 300 bp que estan entremezcladas :
DNA no repetitivo. Al menos la mitad del marc
doble desnaturalizado es fragmentado por la e
de restriccion AluI en un solo sitio localizado 17:
adelante en la secuencia. Las secuencias fragn::=-
tadas pertenecen todas a una sola familia con ..=.
como familia Alu, de acuerdo con los medi :
identificacion. Hay - 300 000 miembros en e:
noma haploide (equivalentes a un miembro .:
kb de DNA). Las secuencias individuales Alu tie- _
dispersion amplia. Hay una familia de secuer:-
relacionadas presente en el raton (donde los 50:
miembros se denominan familia B1) en el cn ':.z
chino (donde se llama familia equivalente All;
en otros mamiferos.
Cada uno de los miembros de la familia .'_
tiene relacion mas que ser identicos. La familia :::._
mana parece haberse originado por una duplica . -
en serie de 130 bp con una secuencia no relacio
de 31 bp insertados en la mitad derecha del dime
Las dos repeticiones a veces se denominan "rn:--
izquierda" y "mitad derecha" de la secuencia
Cada integrante de la familia Alu tiene una ide:--
dad promedio de 87% con la secuencia de conse=.:
La unidad de repeticion BIde raton tiene 13C :0-
de longitud y corresponde a un monomero de
unidad humana. Tiene homologfa de 70 a 80% .
la secuencia humana.
La secuencia Alu tiene relacion con el RNA -; =-
un componente de la partkula de reconocimientC' -
senal (vease la seccion 10.9, La SRP interactua :
el receptor SRP). El RNA 7SL corresponde a la Ill:::':'
izquierda de una secuencia Alu con una inserc -
en medio. Asl, las 90 bases terminales 5' del ,
7SL son homologas con el extremo izquierd
Alu, las 160 bases centrales del RNA 7SL no tie;:
homologfa con Alu y las 40 bases terminales 3'
RNAm
RNA nuclear
RNA de 7SL son homologas con el extrema derecho
de Alu. EI RNA 7SL es codificado por genes que la
polimerasa III de RNA transcribe de manera activa.
Es posible que estos genes (u otros relacionados con
ellos) den origen a las secuencias inactivas Alu.
Los miembros de la familia Alu se asemejan a
transposones porque estan flanqueados por repe-
ticiones directas cortas. Muestran, no obstante, la
curiosa caracterfstica de que las longitudes de re-
peticion son diferentes para cada miembro de la
familia. Se derivan de productos de transcripcion
de la polimerasa III de RNA y, como resultado, es
posible que cada miembro porte promotores activos
internos.
Se ha encontrado una diversidad de propieda-
des de la familia Alu, y su ubicuidad ha originado
muchos indicios respecto de su funcion. No obstan-
te, aun no es posible discernir su fundon real.
Al menos algunos miembros de la familia Alu
pueden transcribirse en RNA independientes. En el
criceto chino algunos (aunque no todos) miembros
de la familia equivalente a Alu parecen tener trans-
cripcion in vivo. Se encuentran unidades de transcrip-
cion de ese tipo en la vecindad de otras unidades de
transcripcion.
Los miembros de la familia Alu pueden incluir-
se dentro de unidades de transcripcion de genes es-
tructurales, segun se observa por su presencia en el
RNA nuclear largo. La presencia de copias multiples
de la secuencia Alu en una sola molecula nuclear
puede generar la estruetura secundaria. De hecho,
la presencia de miembros de la familia Alu en forma
de repeticiones invertidas se encarga de la mayor
parte de la estructura secundaria que se encuentra
en el RNA nuclear de los mamfferos.
filii Los seudogenes procesados
se originaron como sustratos
para ta transposici6n
Concepto principal
• Un seudogen procesado proviene de una secuencia de
RNAm por transcripci6n inversa.
Cuando una secuencia generada por transcripcion
inversa de un RNAm se inserta en el genoma, se
puede reconocer su relacion con el gen a partir del
cual se transcribio el RNAm. Tal secuencia se deno-
mina seudogen procesado para reflejar el hecho
de que se proceso a partir del RNA y es inactivo.
En la FIGURA 22.19 se comparan las caracterfsticas
espedficas de un seudogen procesado con las del
gen original y el RNAm. La figura muestra todas las
..
Ex6n 1 Intr6n Ex6n 2 Intr6n Ex6n 3

l

EI extrema 5' corresponde EI extrema 3' tiene
con el RNAm un segmento A-T
Seudogen
procesado I - Tira continua de exones ...... I
Repetici6n corta directa Repetici6n carta directa
del DNA diana del DNA diana
FIGURA 22.19 Pueden surgir seudogenes por transcripci6n inversa a
partir del RNA para formar DNA duplex, que se integran al genoma.
caracterfsticas diagnosticas impartantes, de las que
solo algunas se encuentran en cualquier ejemplo
individual. Cualquier producto de transcripcion
de la polimerasa II de RNA pudiese, en principio,
dar origen a tal seudogen y hay muchos ejemplos
que incluyen los seudogenes procesados de globi-
na, que fueron los primeros en descubrirse (vease
la seecion 3.11, Los seudogenes son callejones sin
salida de la evolucion).
El seudogen puede inieiarse en el punto equi-
valente al extrema 5' del RNA, circunstancia que
serfa de esperar solo si el DNA se hubiese ariginado
del RNA. Varios seudogenes constan de secuencias
exanicas unidas de manera precisa; no se conocen
mecanismos para reconocer intrones en el DNA, por
10 que esta circunstancia constituye un argumen-
to a favor de una etapa mediada pOl' el RNA. EI
seudogen puede terminal' en un segmento corto de
pares de bases A-T al parecer derivadas de la cola
poli(A) del RNA. Acada lado del seudogen hay una
repeticion corta directa que parece haberse genera-
do por un episodio similar a la transposicion. Los
seudogenes procesados residen en localizaciones no
relacionadas con sus sitios de origen supuestos.
Los seudogenes procesados no portan ninguna
informacion que pudiera servir para respaldar un
suceso de transposicion (0 llevar a cabo la transcrip-
cion inversa precedente del RNA). Esto hace pensar
que el RNA era sustrato para otro sistema y codifi-
cado par un retroposon. De hecho, parece que los
elementos LINES activos proveen gran parte de la
actividad de transcriptasa inversa y que se encargan
no solo de su propia transposicion, sino tambien de
actuar sobre las SINES y generar seudogenes pro-
cesados.
22.11 Los seudogenes procesados se originaron como sustratos para la transposici6n 565
...
Inserci6n de
una copia
de un DNA
en un sitio
nuevo
CITOSOL
CI:::) ...
EI DNA",,,,, -
de 3'·OH

molde

/-"RlIN,nA

EI DNA sustituye I
al RNA t
Se crea un intr6n
por recombinacion ...
La hendidura proporciona
un extrema de cebaci6n
f • Se transcribe una LINES hacia un RNA que ;:
traduce en proteinas que se ensamblan en un complejo e-
el RNA. El complejo se transloca al nucleo, donde inserta
copia de DNA en el genoma.
:G 2 2' La retrotransposici6n de elementos diferente.=
a LTR ocurre por formaci6n de una hendidura en La diana c -
el fin de proveer un cebador para la sintesis de DNAc sobre -
molde de RNA. Las puntas de flecha indican extremos 3'.
Los elementos de LINES y algunos otros no terminan
en las LTR caracteristicas de los elementos retrovl-
ricas. Esto lleva a la interrogante: (. Como se ceba
la transcripcion inversa? No comprende la reaccion
comun donde el cebador de RNAm se aparea con
el LTR (vease la Figura 22.6). Los marcos de lectura
abierta en estos elementos carecen de muchas de las
funciones retroviricas, como domini os de proteasa
o integrasa, pero par 10 general tienen secuencias
similares a la transcriptasa inversa y codifican una
actividad de endonucleasa. En la LINES LI humana,
ORFI es una proteina unida a DNA y ORF2 tiene
actividades tanto de transcriptasa inversa como de
endonucleasa; ambos productos son indispensables
para la transposicion.
La Fl RA 22 2 muestra como estas actividades
sostienen la transposicion. Se hace una hendidura
en el sitio diana del DNA pOl' actividad de una endo-
nucleasa codificada pOl' el retroposon. El producto
RNA del elemento se vincula con la proteina unida
en la hendidura. La hendidura provee un extre-
mo 3'-OH que ceba la sintesis de DNAc sobre el
molde de RNA. Se requiere un segundo episodio
de escision para abrir la otra cadena de DNA, y el
hlbrido RNA/DNA se vincula con el otro extremo de
la hendidura en esta etapa, 0 despues de que se ha
convertido en una cadena doble de DNA. Algunos
intrones moviles utilizan un mecanismo semejante
(vease la Figura 27.12 ).
Cuando se originan elementos a partir de la
transcripcion de la polimerasa II de RNA, las se-
cuencias genomicas son necesariamente inactivas:
carecen del promotor que se encontraba en un sitio
ascendente respecto del punto de arigen inicial de
transcripcion. Estos suelen poseer las caracteristicas
de un producto de transcripcion maduro, par 10 que
se denominan seudogenes procesados.
Uno de los motivos pOl' 10 que los elementos de
LINES son tan eficaces radica en su metodo de pro-
pagacion. Cuando se traduce un RNAm de LINES,
los productos proteinicos muestran una preferencia
cis para unirse al RNAm a partir del cual se tradu-
jeron. La ) muestra que el complejo de
• Las LINES no tienen LTR y para cebar la transcripci6n
inversa requieren que el retropos6n codifique una
endonucleasa que genere una hendidura.
Concepto principal
ED Las LIN ES utilizan
una endanucleasa para generar
un extrema can actividad
cebadara
566 CAPITULO 22 Retrovirus y retroposones
NUCLEO

Transpos6n

CITOSOL

co
GURA 22 "" Un transpos6n se transcribe hacia un RNA que
,e traduce en proteinas que se desplazan de manera indepen-
-iente hacia el nucleo, donde actuan sobre cualquier par de
-epeticiones invertidas con la misma secuencia que en el trans-
::os6n original.
se traslada entonces al nueleo,
donde las protefnas insertan una copia del DNA en
el genoma. La transcripcion inversa a menudo no
avanza par completo hasta el finaL de modo que la
copia es inactiva. Sin embargo, hay posibilidades de
insercion de una copia activa parque las protefnas
actuan sobre un producto de transcripcion del ele-
mento activo original.
En contraste, las protefnas producidas por los
transposones de DNA deben importarse al nueleo
despues de su sfntesis en el citoplasma, pero no
cuentan con metodos para distinguir entre trans-
posones de longitud completa y transposones inac-
tivos con delecion. La :G' 2 muestra que en
lugar de distinguir estos dos tipos de transposones,
las protefnas reconoceran de manera indiscriminada
cualquier elemento par virtud de las repeticiones
que marcan sus extremos. Esto disminuye mucho
su posibilidad de actuar sobre un elemento de lon-
gitud completa en contraposicion a uno que ha te-
nido delecion. La consecuencia es que los elementos
inactivos se acumulan y, en un momenta dado, la
familia desaparece porque una transposasa tiene
pocas posibilidades de hallar una diana que sea un
transposon por completo funcional.
<'.Estan ocurriendo en la actualidad sucesos de
transposicion en estos genomas, 0 solo se observan
vestigios en sistemas antiguos? Esto varfa con la es-
pecie. Hay solo unos cuantos transposones activos
en la actualidad en el genoma humano pero, en
contraste, se conocen varios transposones activos
en el genoma de raton. Esto explica el hecho de
que las mutaciones espontaneas causadas par in-
serciones de LINES se presentan con una tasa de
-3% en el raton, pero de solo 0.1 % en el hom-
bre. Parece haber de -lOa 50 elementos activos de
LINES en el genoma humano. Se pueden sefialar
algunas enfermedades humanas como resultado de
la transposicion de LI a los genes y otras derivadas
de episodios no equivalentes de entrecruzamiento,
donde participan copias repetidas de LI. Un sistema
modelo en el que ocurre la transposicion de LINES
en celulas de cultivo hfstico hace pensar que un
suceso de transposicion puede introducir varios ti-
pos de dafio colateraL asf como la insercion en un
nuevo sitio; el dafio comprende reestructuraciones
y deleciones cromosomicas. Dichos sucesos podrfan
considerarse como agentes del cambio genetico. Ni
los transposones de DNA ni los retroposones cua-
si retrovfricos parecen haber tenido actividad en el
genoma humano durante 40 a 50 millones de afios,
pero se encuentran ejemplos activos de ambos en
el raton.
Notese que para que las transposiciones persis-
tan deben presentarse en la Unea germinativa. Al
parecer, episodios sirnilares tienen lugar en celulas
somaticas, pero estas no sobreviven mas de una ge-
neracion.
flII Resumen
La transcripcion inversa es el mecanismo unificador
de la reproduccion de retrovirus y perpetuacion de
retroposones. El cielo de cada tipo de elemento es
en principio similar, aunque los retrovirus suelen
considerarse desde la perspectiva de la forma vfrica
libre (RNAm), en tanto los retroposones se consi-
deran desde el punto de vista de la forma genomica
(DNA doble).
Los retrovirus tienen genomas de RNA de cade-
na unica que se replican mediante un intermediario
de DNA de doble cadena. Un retrovirus individual
contiene dos copias de su genoma. El genoma con-
tiene los genes gag, pol y env, que se traducen en po-
liprotefnas, cada una de ellas fragmentada en pro-
tefnas funcionales mas pequefias. Los componentes
Gag y Env se encargan del empaquetamiento del
RNA y la generacion del virion; los componentes
Pol participan en la sfntesis de acidos nueleicos.
La transcriptasa inversa es el principal compo-
nente de Pol y se encarga de la sfntesis de una copia
de DNA (cadena negativa) del RNA vfrico (cadena
positiva). El producto de DNA es mas largo que el
molde de RNA; mediante el cambio de moldes, la
transcriptasa inversa copia desde la secuencia de 3'
de RNA hasta el extrema 5' del DNA y desde la
secuencia 5' del RNA hasta el extremo 3' del DNA,
10 que genera las LTR caracterfsticas (repeticiones
terminales largas) del DNA. Ocurre un cambio simi-
22.13 Resumen 567
lar de moldes cuando se sintetiza la cadena positiva
del DNA utilizando la cadena negativa como molde.
EI DNA doble lineal se inserta en el genoma de un
hospedador gracias a la participacion de la enzima
integrasa. La transcripcion del DNA integrado desde
un promotor en la LTR izquierda genera mas copias
de la secuencia de RNA.
Los cambios de molde durante la sfntesis de
acidos nueleicos permiten que ocuna la recombi-
nacion por seleccion de copias. Durante un cielo
infeccioso, un retrovirus puede intercambiar parte
de su secuencia habitual por una secuencia celular.
EI virus resultante suele tener defectos de replica-
cion, pero puede perpetuarse durante la evolucion
de una infeccion conjunta con un virus auxiliar.
Muchos de los virus defectuosos han adquirido una
version RNA (v-onc) de un gen celular (c-onc). La se-
cuencia onc puede ser de cualquiera de varios genes
cuya expresion en la forma v-onc hace que la ( ( ~ l u l a
se transforme hacia un fenotipo tumorigenico.
EI episodio de integracion genera repeticiones
diana (como transposones que se desplazan a traves
del DNA). Por 10 tanto, un provirus insertado posee
terminaciones directas repetidas de LTR, flanquea-
das por repeticiones cortas de DNA diana. Los geno-
mas de mamfferos y aves tienen provirus endogenos
(inactivos) con dichas estructuras. Se han encon-
trado otros elementos con esa organizacion en una
diversidad de genomas, de manera mas notoria en
S. cerevisiae yD. melanogaster. Los elementos Ty de las
levaduras y los elementos de copia de las moscas tie-
nen secuencias de codificacion con homologfa con
la transcriptasa inversa y se desplazan a traves de
una forma de RNA. Pueden generar partfculas que
simulan virus pero no tienen capacidad infectante.
Las secuencias LINES de los genomas de mamiferos
se retiran aun mas de los retrovirus, pero conser-
van diferentes similitudes que sugieren un origen
comun. UtiLizan un tipo diferente de aetividad ceba-
dora para iniciar la accion de la transcriptasa inver-
sa, donde una actividad de endonueleasa vinculada
con la transcriptasa inversa forma una hendidura
que provee un extrema 3'-OH para la sfntesis de
cebacion sobre un molde de RNA. La frecuencia
de transposiciones de LINES aumenta porque sus
productos proteinicos tienen actividad en cis; se vin-
culan con el RNAm del que fueron traducidas para
formar un complejo ribonueleoprotefnico que se
transporta al nueleo.
Los miembros de otra elase de retroposones
cuentan con todos los puntos calientes de la trans-
posicion a traves de RNA, pero no tienen secuen-
cias de codificacion (0 al menos ninguna que simule
funciones retrovfricas). Pueden haberse originado
como pasajeros en un episodio de transposicion se-
568 CAPITULO 22 Retrovirus y retroposones
mejante a la retrovfrica, donde un RNA fue diana
de una transcriptasa inversa. Los seudogenes proce-
sados surgen POl' dichos episodios. Una familia par-
ticularmente notoria que parece haberse originado
pOl' un suceso de procesamiento es la familia Alu.
Algunos RNAsn, incluido el RNAsn 7SL (un compo-
nente de SRP) tienen relacion con esta familia.
Referencias
ED El cido vital de los retrovirus induye sucesos
simi lares a la trans posicion
Articulo de revision
Varmus, H. E. and Brown, P. O. (1989). Retroviruses.
In Howe, M. M. and Berg, D. E., eds., Mobile DNA.
Washington, DC: American Society for Microbiology,
pp. 53-108.
Articulos de investigacion
Baltimore, D. (1970). RNA-dependent DNA polymerase in
virions of RNA tumor viruses. Nature 226, 1209-121 L
Temin, H. M. and Mizutani, S. (1970). RNA-dependent
DNA polymerase in virions of Rous sarcoma virus.
Nature 226, 1211-1213.
Ell El DNA virico es generado por transcripcion inversa
Articulos de revision
Katz, R. A. and Skalka, A. M. (1994). The retroviral
enzymes. AI1I1U. Rev. Biochem. 63,133-173.
LaL M. M. C. (1992). RNA recombination in animal and
plant viruses. Microbial. Rev. 56, 61-79.
Negron\, M. and Bue. H. (2001). Mechanisms of retroviral
recombination. AI1I1U. Rev. Genet. 35, 275-302.
Articulos de investigacion
Hu, W. S. and Ternin, H. M. (1990). Retroviral
recombination and reverse transcription. Science 250,
1227-1233.
Negroni, M. and Buc, H. (2000). Copy-choice
recombination by reverse transcriptases: reshuffling 0:
genetic markers mediated by RNA chaperones. Proc.
Nat!. Acad. Sci. USA 97, 6385-6390.
1111 El DNA virico se integra al cromosoma
Articulo de revision
Goff, S. P. (1992). Genetics of retroviral integration. Annu.
Rev. Genet. 26, 527-544.
Articulo de investigacion
Craigie, R., Fujiwara, T., and Bushman, F. (1990). The IN
protein of Moloney murine leukemia virus processes
the viral DNA ends and accomplishes their integratior:
in vitro. Cell 62, 829-837.
lflii Los elementos Ty de las levaduras se asemejan a l05
retrovirus
Articulo de investigacion
Boeke, J. D. et a1. (1985). Ty elements transpose through
an RNA intermediate. Cell 40, 491-500.
Muchos elementos susceptibles de transposici6n
residen en D, melanogaster
- "ticulo de investigaci6n
taunt, S. M. and Rubin, G. M. (1985). Complete
nucleotide sequence of the Drosophila transposable
element copia: homology between copia and retroviral
proteins. Mol. Cell Bioi. 5, 1630-1638.
Los retroposones son de tres clases
- 'tfculos de revisi6n
Jeininger, P. 1. (1989). SINEs: short interspersed repeated
DNA elements in higher eukaryotes. In Howe, M. M.
and Berg, D. E.. eds., Mobile DNA. Washington, DC:
American Society for Microbiology. pp. 619-636.
3utchison, C. 1. A., Harclies, S. c.. Loec D. D., Shehee.
W. R., and Edgell, M. H. (1989). LINES and related
retroposons: Long interspersed repeated sequences
in the eukaryotic genome. In Howe, M. M. and Berg,
D. E.. eds., Mobile DNA. Washington. DC: American
Society for Microbiology, pp. 593-617.
stertag, E. M. and Kazazian, H. H. (2001). Biology of
mammalian Ll retrotransposons. Annu. Rev. Genet. 35.
501-538.
-,Veiner, A. M., Deininger, P. L.. and Efstratiadis, A.
(1986). Nonviral retroposons: genes, pseudogenes,
and transposable elements generated by the reverse
flow of genetic information. Annu. Rev. Biochem. 55,
631-661.
Artfculos de investigaci6n
Bureau, T. E., Ronald, P. c., and Wessler, S. R. (1996).
A computer-based systematic survey reveals the
predominance of small inverted-repeat elements in
wild-type rice genes. Proc. Natl. Acad. Sci. USA 93.
8524-8529.
Bureau, T. E. and Wessler, S. R. (1992). Tourist: a large
family of small inverted repeat elements frequently
associated with maize genes. Plant Cell 4, 1283-1294.
Loeb, D. D. et al. (1986). The sequence of a large LlMd
element reveals a tandemly repeated 5' end and
several features found in retrotransposons. Mol. Cell
Bioi. 6,168-182.
Sachidanandam, R. et al. (2001). A map of human genome
sequence variation containing 1.42 million single
nucleotide polymorphisms. The International SNP
Map Working Group. Nature 409, 928-933.
Waterston et al. (2002). Initial sequencing and comparative
analysis of the mouse genome. Nature 420, 520-562.
fD:E Las LINES utilizan una endonucleasa para generar un
extremo con actividad cebadora
Articulo de revisi6n
Ostertag, E. M. and Kazazian, H. H. (2001). Biology of
mammalian Ll retrotransposons. Annu. Rev. Genet. 35,
501-538.
Articulos de investigaci6n
Feng, Q., Moran, J. V.. Kazazian. H. H., and
Boeke. J. D. (1996). Human Ll retrotransposon
encodes a conserved endonuclease required for
retrotransposition. Cell 87. 905-916.
Gilbert, N., Lutz-Prigge, S., and Moran, J. V. (2002).
Genomic deletions created upon LINE-I
retrotransposition. Cell 11 0, 315-325.
Lauermann. V. and Boeke, J. D. (1994). The primer
tRL"!A sequence is not inherited during Tyl
retrotransposition. Proc. Nat!. Acad. Sci. USA 91,
9847-9851.
Luan, D. D. et al. (1993). Reverse transcription of R2Bm
RNA is primed by a nick at the chromosomal target
site: a mechanism for non-LTR retrotransposition. Cell
72, 595-605.
Moran, J. V., Holmes, S. E., Naas. T. P., DeBerardinis, R.
J .. Boeke, J. D.. and Kazazian. H. H. (1996). High
frequency retrotransposition in cultured mammalian
cells. CellS7, 917-927.
Symec D. E., Connelly, c.. Szak, S. T., Caputo, E. M.,
Cost, G. J., Parmigiani, G., and Boeke, J. D. (2002).
Human II retrotransposition is associated with genetic
instability in vitro. Cell 110, 327-338.
Referencias 569

Sign up to vote on this title
UsefulNot useful