You are on page 1of 10

KRİPTOSPORİDYUM SPP, GİARDİYA DUODENALİS VE ENTEMOBA HİSTOLİK ANTİJENLERİNİN İNSAN DIŞKI ÖRNEKLERİNDE EŞ ZAMANLI TESPİTİNDE KULLANILAN İMMÜNOKROMATOGRAFİK DALDIRMA

TESTİNİN DEĞERLENDİRİLMESİ Özet: İmmünokromatik (IC) testler, ilerde, kolay ve hızlı uygulanma özellikleri ile olası parazit hastalıklarının tanısında önemli bir rol oynayabilirler. Çalışmada, son zamanlarda kriptosporidyum spp, giardiya duodenalis ve entemoba histolika tanısı için geliştirilen immünokromiatik daldırma testi değerlendirilmiştir. Mikroskopi ve PCR "altın

standart"referans tekniği olarak kullanılmış ve bu IC testinin sonuçları, ELISA ve ve 3 parazit için ayrı ayrı uygulanan IC testleri ile elde edilen sonuçlarla karşılaştırılmıştır. Toplamda 160 dışkı örneği üzerinde ölçüm yapılmıştır. Mikroskopik yöntemler kullanılarak, 22 örneğe kriptosporidyum spp pozitif, 31 örneğe giardiya duodenalis pozitif ve 41 örneğe entemoba histolika pozitif tanısı konulmuştur. 68 örnekte ise bu üç parazit türünden herhangi birine rastlanmamıştır. IC testinin sonuçları, kriptosporidyum spp için % 70-72, giardiya duodenalis için % 90-97 ve entemoba histolik için % 62.5 duyarlılık düzeyi göstermişlerdir. Özgüllükler, sırasıyla % 93.6-94.9, > %99 ve %96.1 çıkmıştır. E. histolika dışındaki tüm tanılarda, PCR ve mikroskopi uyumu % 90'ın üzerinde çıkmıştır. Mikroskopinin E.histolika’yı, E.dispar ve E. moshkovski gibi patojenik olmayan türlerinden ayırmasındaki yetersizliklerden dolayı E. Histolika’da bu değer % 76.3 çıkmıştır. Üçlü dışkı immün testler, çok sayıda örneğin analiz edilmesi veya tamamlayıcı testlerin kullanılması gerekli hallerde endemik bölgelerde gerekli olan kitlesel tarama uygulamalarında yeterli duyarlılık sağlamaktadır. Giriş Kriptosporidyum spp, giardiya duodenalis ve entemoba histolika insanlarda ishal hastalığının temel sebebi olarak bilinmektedirler *1,2+. Tüm bu protozalar kirletilmiş su ve yiyeceklerin tüketimi ile taşınmakta ve insandan insana geçmektedir, bu durum aynı zamanda zoonotik iletimle de ilişkilidir *3+. Bu sebeple, bizim çalışmamızda ve diğer bazı çalışmalar gösterildiği gibi, salgınlar meydana gelmektedir, özellikle enfeksiyonların endemik olduğu gelişmekte olan ülkelerde yaşayan hastalarda bu protozaların bir kaç türüne eş zamanlı olarak rastlanması olasıdır. [4].

Kriptosporidyum. patojenik E. İyi bir aralıkta duyarlılık ve özgüllüğe sahip bir çok ürün ticari olarak temil edilebilmektedir. İmmünoflorosan mikroskopisi (IMF) gibi diğer teknikler duyarlılığı artırır (kriptosporidyum için % 97. . Bu testlerden bazıları E. histolikanın eş zamanlı tespiti için antikorlar içeren yeni IC testinin değerlendirilmesidir. histolika ve patojenik olmayan E. histolika tespiti için kullanılan moleküler teknikler. Mikroskopik olarak incelendiğinde E. hislikayı E.dispardan ayırabilirler. histolikanın düşük prevalansına rağmen. PCR teknikleri referans olarak kabul edilmiştir.histolika/dispar barındırdığı belirlenen hasta dışkı örneklerinde bulunan E. Bununla birlilkte duyarlılığın % 85 in üzerinde tutulması amacıyla 3 örneğin mikroskopik incelenmesinin farklı günlerde gerçekleştirilmesi gerekmektedir. Aynı zamanda Entomeba durumunda. ve aynı zamanda yüksek duyarlılık özelliği ve Entamoba türlerinin ayrıştırılmasındaki kabiliyeti nedeniyle. Kriptosporidyum. son yıllarda geliştirilmektedir [16-21]. histolika tespiti için kullanılan antijen belirleme testleri. Giardiya veya E. direkt mikroskopik incelemeler buna izin vermemektedir. Kriptosporidyum spp. PCR veya gerçek zaman PCR içermekte ve yüksek duyarlılık ve özgüllük sağlamaktadır.11] ve türlerin her ikiside morfolojik olarak ayırt edilemez olduğundan. Fakat bu yöntemler çok fazla zaman harcar ve rutin PCR tanısı için pahalı ve kaliteli ekipman gerektirir [11-15]. Direkt mikroskopik incelemeler parazit tanısı için "altın standart" olarak kabul edilmiştir. Giardiya veya E.Bu enfeksiyonların geleneksel tanısında dışkı örnekleri kullanılmaktadır ve parazitin uygun mikroskopik tespiti ve tanısı için özel boyama teknikleri ile birlikte kullanılması gerekmektedir. dispar ayrıştırılması gerekmektedir [10.4 civarında) fakat bunlar çok yorucu ve pahalı teknikleridir ve tüm laboratuarlarda gerçekleştirilmesi mümkün değildir *7-9]. enzim immünotestler (EIAs) ve İmmünokromatografi (IC) gibi. moleküler teknikler. izoenzim analizi veya ELISA testi kullanılarak gerçekleştirilebilmektedir ve Entamoba pozitif hastalarda bu tarz rutin araştırmalarda moleküler tekniklerin kullanılması önerilmektedir [11]. Bu yöntemler yorucudur. Giardiya veya E. ayrıştırma. çok fazla zaman alır ve alanında uzman personel gerektirir. Bu çalışmanın amacı. Üçlü IC testinin kullanışlılığı ile ELISA testi ve her üç parazit için ayrı ayrı uygulanan IC testi sonuçları karşılaştırılmıştır.

22x22 yayma ile tüm olası alanların araştırılmasına olanak veren 10X objektif ile sonraki gözlemlerde ise 40X ve 100X objektif ile çalışılmıştır. her bir konsantre örneğin bir kaç mikrolitrelik kısmı mikroskopik olarak direkt incelenmiştir. SG and SE) . R-Biopharm (Darmstadt. Almanya) tarafından temin edilmiştir. Numunelere. IC analizleri Takip eden immünotest tanı kitleri üreticinin talimatlarına göre kullanılmıştır: parazitlerin her birinin tespiti için Rida®Quick Cryptosporidium (N1202). Çalışmada bir adet Nikon Eclipse 80i mikroskobu kullanılmıştır. Tüm gözlemler. Her örneğin en az iki alikuotu hemen dondurulmuş ve PCR ve ELISA testleri için -20 C'de depolanmıştır. 30-50 mg kadar katı örnek veya 100 mikrolitre sıvı örnek. yetenekli ve tecrübeli mikroskopistler tarafından gerçekleştirilmiştir. Mikroskopik Analizler Bütün örnekler üzerinde formalin-etil asetat konsantrasyon yöntemi uygulanmıştır. Tıp Fakultesi. bağırsak rahatsızlığı ve ishal sorunu olan hastalardan 160 dışkı örneği toplanmıştır (Örnekler Lozana Blesa Hastanesi Mikrobiyoloji Servisi ve Zaragoza Universitesi. Taze numuneler 24 saat içerisinde işlenmiştir. 2008'den Aralık.Daha sonra 150 μl süpernatan başka bir tüpe aktarılmış ve reaksiyon . üretici tarafında temin edilen 1. Giardiya (N1102) and Entamoeba (N1702) tekli testleri (SC. Kullanılan tüm testler.Neelsen boyası damlatılarak elde edilen mikroskopik görüntüyle. Cryptosporidium ve Giardiya'nın eş zamanlı tespiti için ve Rida®Quick Cryptosporidium/Giardiya (N1122) ve her üç parazitin eş zamanlı tespiti için Cryptosporidium/Giardiya/Entamoeba (N1722) kombi testler (CG ve üçlü CGE) uygulanmıştır. Entamoba ve Giardiya trofozoitlerinin ve Kriptosporidyum oositlerinin ve ya kistlerinin tespiti amacıyla. 2008'e kadar farklı IC testleri ve mikroskopik incelemelerle analiz edilmiştir.Malzemeler ve Yöntemler Dışkı Örnekleri Parazitik enfeksiyonlar göz ardı edildiğinde. Parazitoloji Laboratuarından (İspanya) toplanmıştır).0 ml'lik bir ekstraksiyon karıştırılmıştır. Örnekler alınmış ve Haziran. Bir önceki gözlem. tamponu içerisine yerleştirilmiş ve daha sonra hızlı bir şekile 5 dakika süresince oda Süspansiyon katı parçacıklar çökene kadar sıcaklığında tutulmuştur. Trikrom ve modifiye edilmiş Ziehl.

%10'un altında olması durumunda negatif olarak görülmüştür. E.2 absorbans birimi olarak belirlenmiştir. CG testi için mavi bir band olarak tezahür etmiştir ve bu durum Kriptosporidyum spp için pozitif bir test olduğunu göstermektedir. G. önceden açıklanan protokoller izlenerek. Pembe-kırmızı band ise G. Farklı renkte bir band pozitif reaksiyon olarak görülmüştür.15 ekstinksiyon birimleri.şeridi tüp içerisine yerleştirilmiştir. hesaplanan eşiğin ± 10% 'u olması durumunda şüpheli. ELISA analizleri ELISA kaynakları şunlardır: ELISA R-Biopharm RidaScreen® Cryptosporidium (C1201). her bir antijenin saf konsantre standartları ile kalibrasyonu yer almaktadır.TPIAR:5’-GTCAAGAGCTTACAACACG-3’. Üreticinin talimatında gösterildiği gibi. çoklu testler için ise (CG ve CGE) 10 dakika sonra sonuçlar okunmuştur. trioz fosfat izomeraz geninin heminested polimeraz zincir reaksiyonu (PCR) [12] (primerler TPIAF: 5’CGAGACAAGTGTTGAGATGC3’. hesaplanan eşik değerinin % 10'u ve ya daha fazla yukarısında olması durumunda pozitif. DNA donmuş alikotlarından ekstrakte edilmiştir. SG ve SE için pozitif test kırmızı bir band olarak.6 sürümü kullanılmıştır. Kontrol hattı şerit üzerinde sürekli olarak görünür durumdadır ve test başarıyla tamamlanmıştır. G. duodenalis için pozitif bir test olduğunu göstermektedir . Test oda sıcaklığında inkübe edilmiştir ve her bir tekli test için (SC. SG and SE) 5 dakika sonra. CGE'nin pozitifliği için Kriptosporidyumun spp’nin bandları mavi. numunelerin eşik değerinin. duodenalisin bandları pembekırmızı. SC. TPIAIF: TPIBR: CCAAGAAGGCTAAGCGTGC. Renk yoğunluğu ne olursa olsun testteki herhangi bir reaksiyon pozitif bir sonuç olarak yorumlanmıştır. Eşiğin kurulumu amacıyla 0. Bütün testlerde. CTCTGCTCATTGGTCTCGC. Absorbans ölçümleri ve analizler için Labsystems IEMS mikroplaka absorbans okuyucu ve Ascent Software 2. ELISA RBiopharm RidaScreen® Entamoeba (C1701) ve ELISA R-Biopharm RidaScreen® Giardiya (C1101). . duodenalis ve Kriptosporidyum DNA'ları. negatif kontrol için ölçülen ekstinsiyona ilave edilmiştir ve ortalama ELISA eşiği 0. Ibıan DNA dışkı kitleri kullanılarak. histolikanın bandları yeşil çıkmıştır. TPIBF: GTTGCTCCCTCCTTTGTGC. Testteki hiç bir reaksiyon ve görünür kontrol hattı negatif bir sonuç olarak yorumlanmamıştır.

CAGATCTAGAAACAATGCTTCTCTACACCACTTACTATCCCTACC-3’).TPIBIF: GCACAGAACGTGTATCTGG) ve rDNA gen fragmanının küçük bir alt biriminin (SSU) kümelenmesi ile tespit edilmiştir *13+ (primerler SSU1: 5’-TTCTAGAGCTAATACATGCG. 3’. Burada 0. [14]'nın belirttiği primerler ve koşullar kullanılarak gerçekleştirilen PCR kümesiyle. özgüllük: 100·[d/(b + d)]. Entamoeba histolytica and E. b: yalnış pozitif örneği. SSU2: 5’-CCTAATCCTTCGAAACAGGA-3’.Ed-2: Eh-2: 5’SSU4: . Gutierrez-Cisneros ve ark. 41 tanesi ise E. Örneklerden 2 tanesi Giardiya ve E. Sonuçlar Kriptosporidyum. histolika/dispar pozitif olduğu belirlenmiştir. (primerler E1: 5’TGCTGTGATTAAAACGCT-3’. AGGAGTAAGGAACAACCTCCA). c: yalnış negatif örneği ve d: gerçek negatif örneği gösterir. Aynı zamanda örneklerden bir tanesi Hymenolepis nana yumurtaları barındırırken Eh-1:5’-ACATTTTGAAGACTTTATGTAAGTA-3’. dispar tespit edilmiş ve ayrıştırılmıştır. Kalan 68 örnek çalışılan her üç parazit türü için de negatif çıkmıştır. histolika /dispar eşzamanlı pozitif çıkmıştır. PVP: 100·[a/(a + b)] NPV: 100·*d/(c + d)+. PVP (pozitif tahmin edilebilir değer) ve NPV (negatif tahmin edilebilir değer) değerleri Openoffice (Sun Microsystem) elektronik çizelgesi ile hesaplanmıştır. 31 tanesi Giargia pozitif. 22 tanesi Kriptosporidyum pozitif. Direk ya da boyamalı mikroskopik analiz kullanılarak bu örneklerin. Uyum %95 güven aralığında hesaplanmış ve IC ve ELISA testlerinin sonuçları Yate'nin düzeltilmiş χ2 testi sonuçlarıyla karşılaştırılmıştır. Giardiya ve/veya E.SSU3:5’-GGAAGGGTTGTATTTATTAGATAAAG.05'den küçük eşit p değerleri istatistiksel olarak anlamlı bulunmuştur. histolika/ dispar bulunduran toplamda 160 dışkı örneği mikroskopik olarak araştırılmıştır. özgüllük. Burada a: gerçek pozitif örneği. E2:5’TTAACTATTTCAATCTCGG-3’.Ed-1:5’-GTTAGTTATCTAATTTCGATTAGAA-3’. Çizelge verileri analiz etmek için şu formülü kullanır: duyarlılık: 100·*a/(a + c)+. [22] ve Evangelopoulos ve ark. İstatistiksel Yöntemler Duyarlılık.

5 97.4 Tablo 3: Referans olarak mikroskopi ve polimeraz zincir reaksiyonu (PCR) yöntemi kullanılarak E. Ayrıca 3 örnek Blastosit hominis pozitif çıkmıştır.6 PPV (%) 38.4 95.8 96.7 77.4 97.6 25.5 75 (%) 94.6 PPV (%) 61.5 (%) >99.3 NPV (%) 83 82.7 87. histolika PCR Duyarlılık Özgüllük (%) 62.4 45.9 (%) 97.8 82.başka bir tanesi de Endolimax nana kistleri içerir.6 94.8 E.4 93.1 95. Histolika /disparın IC ile tanısında duyarlılık.2 99.7 95.6 97.2 99.5 Duyarlılık Özgüllük NPV (%) SC CG CGE ELISA 72.5 (%) 99.9 94.9 PPV (%) 96.3 .8 96.6 PCR Duyarlılık Özgüllük NPV (%) 90.2 99.5 62.9 (%) 95.6 98. özgüllük ve NPV verileri Test Referans Yöntem Mikroskopi PPV (%) 72.8 56.5 PCR Duyarlılık Özgüllük NPV (%) 70 65 70 65 (%) 94.7 40 (%) 97.2 60.6 92.7 97.9 PPV (%) 63.1 94.2 78.6 72. özgüllük ve NPV verileri Test Referans Yöntem Mikroskopi PPV (%) 100 100 100 90.9 E.6 77.5 (%) 77.7 72.7 (%) 95.4 35.7 97. Duodenalisin IC ile tanısında duyarlılık. dispar PCR Duyarlılık Özgüllük (%) 28.5 Duyarlılık Özgüllük NPV (%) SC CG CGE ELISA 96.6 Tablo 2: Referans olarak mikroskopi ve polimeraz zincir reaksiyonu (PCR) yöntemi kullanılarak G.3 96.7 96.7 97.1 92.2 96.8 96.6 95.5 17.2 99.7 94.6 87.9 NPV (%) 98 98 98.7 96.7 96.5 >99.5 69.6 85.7 63.7 69. Tablo 1: Referans olarak mikroskopi ve polimeraz zincir reaksiyonu (PCR) yöntemi kullanılarak Kriptosporidyum spp'nin IC ile tanısında duyarlılık.2 98.6 76.5 63.7 96.8 93.7 (%) 99.6 90.6 90. özgüllük ve NPV verileri Test Referans Yöntem Mikroskopi Duyarlılık Özgüllük NPV (%) SC CGE ELISA 19.4 (%) 95.3 PPV (%) 76.5 >99.7 (%) 95.6 72.1 24.9 81.

p<0. E. Kriptosporidyum tanısında. Bu sebeple yeni bir tanı testi geliştirildiğinde bu iki parametre analiz edilmelidir. Buna rağmen her iki teknikle elde edilen sonuçlar istatistiksel olarak anlamlı sayılabilecek bir uyumda çıkmıştır (%95. histolikanın spesifik PCR değeri (%93. üç örnek mikroskopi ile negatif. fakat üçlü ve SC IC testleri arasındaki uyum daha iyi çıkmıştır. tüm değerler istatistiksel olarak anlamlı bir uyum göstermektedir (p<0. Fakat spesifik PCR. PCR ile pozitif çıkmıştır ve yine 1 tanesi tüm IC testlerinde negatif çıkmıştır.4.3.Tablo 1. pozitif tahmin edilebilir değer (PPV) ve negatif tahmin edilebilir değerler (NPV) de tablolarda gösterilmektedir.7–93. E. Üçlü IC testi. Benzer sonuçlar üçlü IC testi ve mikroskopi (%76.5–97. p<0.5–97. mikroskopi ve PCR yönteminin referans yöntemler olarak kullanılmasıyla değerlendirilmiş.5. E. ELISA.2) ve %90.1–94. mikroskopi ve PCR arasındaki uyum %91 çıkmıştır.05).2).7–%99.4 olduğu görülmüştür (%95 CI %83. Buna ek olarak. G.8 uyum yakalanmıştır (%95 CI 94. histolika için ELISA ve PCR uyumu karşılaştırıldığında % 89. mikroskopi ve PCR arasında %91. 5 örnek mikroskopik olarak pozitif. SC ve CG testi ile elde edilen sonuçlarla kıyaslandığında. bu değer PCR ve ELISA için biraz daha düşüktür (%97. Üçlü IC testi mikroskopi. . %95 CI aralığı %90.6).3) karşılaştırıldığında da elde edilmiştir ve bu değer ELISA (%95.4 uyum yakalamıştır. Bu örneklerden yalnız bir tanesi tüm IC testlerinde negatif çıkmıştır. ELISA ve her bir parazit için tek tek uygulanan IC testi ile karşılaştırılmıştır. 2 ve 3 PCR tekniğini referans alarak hızlı ticari ve ELISA testleri için elde edilen duyarlılık ve özgüllük oranlarını göstermektedir. PCR ile %95 (%95 CI %90.9– 98. fakat PCR ile negatif çıkmıştır. ELISA testi mikroskopi ile %96.8) veya SE tekli IC testi (%97.5 çıkmıştır. Entamobanın mikroskopik tesbiti ve PCR arasındaki uyum % 92. Tam tersine. histolika tanısı için antikor içeren üçlü IC testleri.8'e düşmüştür. (%95 CI %86.6 (%95 CI %85. SG ve CG testi ile % 99. %95 CI %93.6–95.05).8–99).9 (%95 CI %92. Kriptosporidyum. histolika tespiti için dikkate alındığında bu değer %78. Tanı testinin seçimi duyarlılık ve özgüllük olmak üzere 2 ana prensibe dayandırılmalıdır.05).2).5) ile karşılaştırıldığında artış göstermiştir. Giardiya ve E. Örneklerden üç tanesi çok düşük sayıda oosit içermektedir. duodenalis varlığı analiz edildiğinde.4) uyum göstermektedir. Tartışma Hızlı ve görsel IC tanı yöntemleri sofistike ekipman veya deneyimli personel gerektirmeyen kolay uygulanabilir yöntemlerdir.6).

Çalışmada elde ettiğimiz sonuçlar. Diğer yazarlar. buna rağmen her iki yöntemin de çeşitli sınırlamaları vardır *2325]. G. 20.histolika antijenleri varlığından etkilenmediğini gösterir. IC testleri arasında belirgin bir farklılık bulunmamaktadır. Bütün IC testlerinde benzer duyarlılık. testlerin etkinliğinin anti-Giardiya ve anti E. Giardiya tanısı durumunda. PCR inhibitör maddelerin yokluğunda bu tekniğin daha yüksek duyarlılığı Kriptosporidyum tespitine olanak verir. bu yöntem başarısız olabilmektedir. %75-80 duyarlılık ile (PPV için bu değer %69-77 arasındadır) Weitzel ve ark.Bu çalışmada. bu durum testlerin bireysel tanı durumundaki epidomiyolojik çalışmalarda kullanılabildiğini göstermektedir. *26+ bulduğu duyarlılık değerine kıyasla daha düşük çıkmıştır. [29] veya Rida®Quick Crypto/Giardiya kombi ile Kriptosproidyum tanısı için % 100 duyarlılık ve özgüllük elde eden Regnath ve ark. Üçlü ve tekli SC testleri arasındaki yüksek uyum. IC testi ve ELISA testinde bulunan duyarlılık değeri. Bunun sebebi örneklerde bulunan az sayıda oosit ve/ veya PCR'de üretilen başlangıç maddesi inhibitasyonlarıdır. *27+ elde ettiği sonuçlar ile ve aynı zamanda Rida®Quick IC testleri ile uyumludur. Chalmer's ve ark. . parazitolojik tanılarda şüphesiz mikroskopi altın standarttır. [8] ve Llorente ve ark. duyarlılık (%93.5–97) ve özgüllük (%97–100) değerleri tüm IC testleri için çok yüksek çıkmıştır. NPV ve PPV değerlerinde çalışılmıştır. düşük oosit sayısı ile. Entomeba türlerinin ayrıştırılmasındaki etkinliğinden ve bilinen duyarlılığından dolayı PCR teknikleri referans olarak kullanılırken. Bu uyum. PCR ve mikroskopi arasındaki farklılıklar şöyle yorumlanabilir: mikroskopi ile pozitif ve PCR ile negatif olan örneklerde. 26–28]. Kriptosporidyum tanısında. enzim immünotestleri (EIA) için. Yüksek NPV ve PPV değerleri az sayıda yanlış pozitif ve yanlış negatif sonuçları yansıtmaktadır ve PCR ile mikroskopi arasındaki uyum iyi çıkmıştır. aynı testle Kriptosporidyum ve Giardiya tanısında % 92 ve %97 duyarlılık elde etmişlerdir *28+. mikroskopik olarak negatif olan numuneler. ayrıca tanı amacıyla uygulanan testlerde IC testinin ELISA kopro-antijen testi yerine kullanılabileceği ileri sürülmektedir. ve ELISA testi ile elde edilen değerlere kıyasla daha iyidir ve Regnanth (%100 duyarlılık ve %99 özgüllük) *26+ tarafından tanımlanan değerlerle uyum içerisindedir. yalnış pozitif sonuçların önlenmesi amacıyla pozitif örnekler mikroskopi ile onaylanmalıdır. CG ve SC IC testlerinin Giardiya tanısında ne kadar kullanışlı olduğunu göstermektedir. üçlü IC. Diğer taraftan. özgüllük. Farklı duyarlılık ve özgüllüğe sahip çeşitli hızlı testler ticari olarak temin edilebilir [19.

histolika. Giardiya ve Entomeba histolika /dispar tanısını kombine eder. PCR'nin altın standart olarak alınmasıyla daha yüksek çıkmıştır. NPV ve PPV değerleri. dispar'ı ayıramamaktadır. histolika tanısında kullanılan testlerde duyarlılık. klinik maliyet etkinliği ile. 2 türün tanısında PCR'nin. Diğer bir Enzimatik hızlı immünotest (EIA). tarama önerisi için ve çok sayıda örneğin analiz edilmesi gerekli olan endemik bölgelerdeki büyük çaplı analizler için. PCR uygulamaları pahalıdır ve tecrübeli teknisyen gerektirir. Techlab antijen tanı kiti ve geleneksel PCR arasında % 100 bir uyum olduğunu belirtmiştir *35+. histolika ve E. yeterli duyarlılık ve özgüllük sağlar. Bu çalışmada. ELISA ve immünokromatografi gibi bir kaç metodun kombinasyonu faydalı olabilir. 19. aynı zamanda bu teknik daha kolay ve hızlı uygulanabilirdir. E. . buna rağmen.Mohammadi. Bu durumda üçlü IC testinin duyarlılığı ELISA testinin duyarlılığından düşük çıkmıştır. Solaymani. histolika tanısında. Çünkü mikroskopi sadece Entomeba tanısında kullanılmakta. Fakat bu durum. E. Dışkı immünotestler. testin tümünün 15-20 dakikada uygulanabilir oluşundan dolayı. üçlü IC testi ve PCR arasındaki uyum düşüktür ve E. E. birden fazla parazit içeren örneklerin analizlerinde. Bundan dolayı.duodenalis için. 30. IC testi kullanımının etkinliğini ve verimini gözler önüne sermek amacıyla yürütülmelidir. Kriptosporidyum. hızlı sonuçlar verir. NPV ve PPV değerleri çok düşük çıkmıştır. Tek bir şeritte çeşitli testlerin birlikte uygulanması. analizlerin PCR veya ELISA ile değiştirilemeyeceğini göstermektedir. Bu yöntemde E. 34+. daha fala manipülasyon gerektirir ve IC testinden daha zahmetli bir yöntemdir. Dışkı örneklerinden DNA ekstraksiyonu komplekstir. ELISA'ya kıyasla 100 kat daha duyarlı olduğu saptanmıştır *32+. moshkovskii ayrıştırılması mümkün değildir ve duyarlılıklar yüksek çıkmamaktadır *33. Hastalara uygun tedavi yönteminin uygulanmasını garantilemek için. histolika tanısında. E. özgüllük değeri. 31] özgüllük değerine sahip diğer bazı immünokromatografik testler zaten bulunmaktadır. 20. bir çok laboratuar testinde daha güvenli bir mod sağlayabilir. hem IC hem de ELISA testinde . Gelecekte yapılacak olan çalışmalar. E. Fakat sadece Giardiya tanısı daha çok Giardiya ve Krisptosproidyumdadır. % 58-100 arasında duyarlılık ve %99-100 [17. dispar ve E. histolika tanısı için mikroskopi referans yöntem olarak alındığında. histolika duyarlı ve özgül tanısı gerekmektedir. E. 25. PCR'nin uygulanmasının mümkün olmadığı durumlarda. İshal durumunda bu testler. özgüllük. duyarlılık.